#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MMEL1	79258	broad.mit.edu	37	1	2560819	2560821	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:2560819_2560821delCAG	ENST00000378412.3	-	2	264_266	c.103_105delCTG	c.(103-105)ctgdel	p.L35del	MMEL1_ENST00000288709.6_In_Frame_Del_p.L26del|MMEL1_ENST00000511099.1_5'Flank|MMEL1_ENST00000502556.1_In_Frame_Del_p.L35del			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	35						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		CAGCGGTCACcagcagcagcagc	0.739																																					p.35_35del		.											.	MMEL1-90	0			c.103_105del						.			2,190,3148		0,0,2,18,154,1496						-0.2	0.9			12	5,359,6192		1,0,3,61,237,2976	no	codingComplex	MMEL1	NM_033467.3		1,0,5,79,391,4472	A1A1,A1A2,A1R,A2A2,A2R,RR		5.5522,5.7485,5.6184				7,549,9340				SO:0001651	inframe_deletion	79258	exon2			GGTCACCAGCAGC	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.103_105delCTG	1.37:g.2560828_2560830delCAG	ENSP00000367668:p.Leu35del	6	0		311	10	NM_033467	0	0	0	0	0	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	In_Frame_Del	DEL	ENST00000378412.3	37	CCDS30569.2																																																																																			.		0.739	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002395.2	NM_033467	
HES3	390992	hgsc.bcm.edu	37	1	6305201	6305201	+	Missense_Mutation	SNP	A	A	C	rs188463518	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:6305201A>C	ENST00000377898.3	+	4	260	c.195A>C	c.(193-195)caA>caC	p.Q65H		NM_001024598.3	NP_001019769.1	Q5TGS1	HES3_HUMAN	hes family bHLH transcription factor 3	65	Orange.				hindbrain morphogenesis (GO:0021575)|in utero embryonic development (GO:0001701)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oculomotor nerve development (GO:0021557)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription, DNA-templated (GO:0006351)|trochlear nerve development (GO:0021558)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			lung(2)|skin(1)	3	Ovarian(185;0.0634)	all_cancers(23;2.48e-32)|all_epithelial(116;1.14e-17)|all_lung(118;2.85e-06)|all_neural(13;3.68e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;3.77e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.2e-37)|GBM - Glioblastoma multiforme(13;3.2e-29)|OV - Ovarian serous cystadenocarcinoma(86;2.52e-19)|Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00308)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.241)		GAGCCGAGCAACCGTCGGGCT	0.721													C|||	221	0.0441294	0.0741	0.0159	5008	,	,		7481	0.0308		0.007	False		,,,				2504	0.0757				p.Q65H		.											.	HES3-514	0			c.A195C						.	C	HIS/GLN	138,3116		2,134,1491	3.0	3.0	3.0		195	2.3	0.4	1		3	36,7122		0,36,3543	no	missense	HES3	NM_001024598.3	24	2,170,5034	CC,CA,AA		0.5029,4.2409,1.6711	benign	65/187	6305201	174,10238	1627	3579	5206	SO:0001583	missense	390992	exon4			CGAGCAACCGTCG		CCDS41238.1	1p36.31	2013-10-17	2013-10-17		ENSG00000173673	ENSG00000173673		"""Basic helix-loop-helix proteins"""	26226	protein-coding gene	gene with protein product		609971	"""hairy and enhancer of split 3 (Drosophila)"""				Standard	NM_001024598		Approved	bHLHb43	uc009vly.2	Q5TGS1	OTTHUMG00000001271	ENST00000377898.3:c.195A>C	1.37:g.6305201A>C	ENSP00000367130:p.Gln65His	0	0		16	16	NM_001024598	0	0	0	0	0	Q5TGS0	Missense_Mutation	SNP	ENST00000377898.3	37	CCDS41238.1	73	0.033424908424908424	40	0.08130081300813008	7	0.019337016574585635	19	0.033216783216783216	7	0.009234828496042216	C	9.558	1.117756	0.20877	0.042409	0.005029	ENSG00000173673	ENST00000377898	T	0.31510	1.49	3.2	2.28	0.28536	.	0.393226	0.19492	N	0.112980	T	0.00580	0.0019	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18178	-1.0345	10	0.66056	D	0.02	-10.1808	4.0729	0.09891	0.2297:0.645:0.0:0.1253	.	65	Q5TGS1	HES3_HUMAN	H	65	ENSP00000367130:Q65H	ENSP00000367130:Q65H	Q	+	3	2	HES3	6227788	0.055000	0.20627	0.403000	0.26384	0.425000	0.31504	0.673000	0.25203	0.398000	0.25338	-0.763000	0.03452	CAA	A|0.967;C|0.033		0.721	HES3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003716.3	NM_001024598	
NOL9	79707	hgsc.bcm.edu	37	1	6614391	6614391	+	Missense_Mutation	SNP	A	A	C	rs6693391	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:6614391A>C	ENST00000377705.5	-	1	204	c.172T>G	c.(172-174)Tcc>Gcc	p.S58A	TAS1R1_ENST00000333172.6_5'Flank|TAS1R1_ENST00000328191.4_5'Flank|TAS1R1_ENST00000351136.3_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	58			S -> A (in dbSNP:rs6693391). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACGCCGGACGCCTGGGCT	0.781													C|||	4789	0.95627	0.8722	0.9841	5008	,	,		9026	0.9692		0.995	False		,,,				2504	0.9969				p.S58A		.											.	NOL9-515	0			c.T172G						.	C	ALA/SER	2196,260		975,246,7	2.0	3.0	3.0		172	3.0	0.2	1	dbSNP_116	3	4875,25		2425,25,0	no	missense	NOL9	NM_024654.4	99	3400,271,7	CC,CA,AA		0.5102,10.5863,3.8744	benign	58/703	6614391	7071,285	1228	2450	3678	SO:0001583	missense	79707	exon1			CGCCGGACGCCTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.172T>G	1.37:g.6614391A>C	ENSP00000366934:p.Ser58Ala	0	0		7	7	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2092	0.9578754578754579	421	0.8556910569105691	355	0.9806629834254144	562	0.9825174825174825	754	0.9947229551451188	C	0.416	-0.910621	0.02434	0.894137	0.994898	ENSG00000162408	ENST00000377705	T	0.15718	2.4	4.0	3.05	0.35203	.	0.361559	0.20066	N	0.099972	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-12.1681	8.8998	0.35487	0.424:0.576:0.0:0.0	rs6693391;rs56691058	58	Q5SY16	NOL9_HUMAN	A	58	ENSP00000366934:S58A	ENSP00000366934:S58A	S	-	1	0	NOL9	6536978	0.795000	0.28851	0.220000	0.23810	0.044000	0.14063	0.592000	0.23984	0.422000	0.26005	-0.285000	0.09966	TCC	A|0.047;C|0.953		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
GPR157	80045	hgsc.bcm.edu	37	1	9188967	9188967	+	Silent	SNP	G	G	C	rs77649572	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:9188967G>C	ENST00000377411.4	-	1	262	c.120C>G	c.(118-120)ccC>ccG	p.P40P	GPR157_ENST00000414642.2_Silent_p.P40P	NM_024980.4	NP_079256.4	Q5UAW9	GP157_HUMAN	G protein-coupled receptor 157	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			lung(4)|prostate(1)	5	all_lung(157;0.185)	all_epithelial(116;5.02e-20)|all_lung(118;3.6e-06)|Lung NSC(185;7.93e-06)|Renal(390;0.000147)|Breast(348;0.000688)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.16e-07)|COAD - Colon adenocarcinoma(227;7.73e-05)|Kidney(185;0.000252)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.00178)|BRCA - Breast invasive adenocarcinoma(304;0.00186)|READ - Rectum adenocarcinoma(331;0.0642)		TGCGCAGGTCGGGCCACAGGG	0.726													g|||	385	0.076877	0.0371	0.0836	5008	,	,		8444	0.1895		0.001	False		,,,				2504	0.0879				p.P40P		.											.	GPR157-514	0			c.C120G						.	G		37,3867		0,37,1915	3.0	4.0	4.0		120	-8.0	1.0	1	dbSNP_131	4	11,7709		0,11,3849	no	coding-synonymous	GPR157	NM_024980.4		0,48,5764	CC,CG,GG		0.1425,0.9477,0.4129		40/336	9188967	48,11576	1952	3860	5812	SO:0001819	synonymous_variant	80045	exon1			CAGGTCGGGCCAC	AK022194	CCDS100.2	1p36.22	2012-08-21			ENSG00000180758	ENSG00000180758		"""GPCR / Class B : Orphans"""	23687	protein-coding gene	gene with protein product						10574461	Standard	XM_005263496		Approved	FLJ12132	uc001apq.1	Q5UAW9	OTTHUMG00000001758	ENST00000377411.4:c.120C>G	1.37:g.9188967G>C		2	0		34	31	NM_024980	0	0	0	0	0	A2A334|Q8WWB8|Q9HA73	Silent	SNP	ENST00000377411.4	37	CCDS100.2																																																																																			G|0.920;C|0.080		0.726	GPR157-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127658.2	NM_024980	
SRM	6723	hgsc.bcm.edu	37	1	11119899	11119899	+	Silent	SNP	T	T	C	rs7545802		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:11119899T>C	ENST00000376957.2	-	1	182	c.102A>G	c.(100-102)tcA>tcG	p.S34S		NM_003132.2	NP_003123.2	P19623	SPEE_HUMAN	spermidine synthase	34	PABS.				cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)|spermidine synthase activity (GO:0004766)			large_intestine(1)|lung(1)|urinary_tract(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)	CCACCTGCAGTGACAGGGCCT	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		7294	1.0		1.0	False		,,,				2504	1.0				p.S34S		.											.	SRM-90	0			c.A102G						.						8.0	10.0	10.0					1																	11119899		1613	3461	5074	SO:0001819	synonymous_variant	6723	exon1			CTGCAGTGACAGG	BC033106	CCDS125.1	1p36-p22	2010-11-08			ENSG00000116649	ENSG00000116649	2.5.1.16		11296	protein-coding gene	gene with protein product		182891		SRML1		2344393	Standard	NM_003132		Approved	SPS1	uc001arz.1	P19623	OTTHUMG00000002119	ENST00000376957.2:c.102A>G	1.37:g.11119899T>C		0	0		9	9	NM_003132	0	0	0	0	0	B1AKP9|Q15511	Silent	SNP	ENST00000376957.2	37	CCDS125.1																																																																																			T|0.001;C|0.999		0.761	SRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006056.1	NM_003132	
TNFRSF1B	7133	broad.mit.edu	37	1	12262126	12262126	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:12262126G>T	ENST00000376259.3	+	9	1092	c.1003G>T	c.(1003-1005)Gcc>Tcc	p.A335S	TNFRSF1B_ENST00000492361.1_3'UTR	NM_001066.2	NP_001057.1	P20333	TNR1B_HUMAN	tumor necrosis factor receptor superfamily, member 1B	335					aging (GO:0007568)|cellular response to growth factor stimulus (GO:0071363)|cellular response to lipopolysaccharide (GO:0071222)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of inflammatory response (GO:0050728)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|RNA destabilization (GO:0050779)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|varicosity (GO:0043196)	tumor necrosis factor-activated receptor activity (GO:0005031)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|liver(1)|lung(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)	GGAGAGCTCGGCCAGTGCGTT	0.706																																					p.A335S		.											.	TNFRSF1B-1085	0			c.G1003T						.						11.0	14.0	13.0					1																	12262126		2194	4288	6482	SO:0001583	missense	7133	exon9			AGCTCGGCCAGTG	M32315	CCDS145.1	1p36.22	2008-02-05			ENSG00000028137	ENSG00000028137		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11917	protein-coding gene	gene with protein product		191191		TNFR2		2158863, 8702885	Standard	NM_001066		Approved	TNFBR, TNFR80, TNF-R75, TNF-R-II, p75, CD120b	uc001att.3	P20333	OTTHUMG00000001829	ENST00000376259.3:c.1003G>T	1.37:g.12262126G>T	ENSP00000365435:p.Ala335Ser	37	1		187	11	NM_001066	0	0	0	0	0	B1AJZ3|Q16042|Q6YI29|Q9UIH1	Missense_Mutation	SNP	ENST00000376259.3	37	CCDS145.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.428595	0.43122	.	.	ENSG00000028137	ENST00000376259	D	0.87029	-2.2	4.76	2.74	0.32292	.	2.391520	0.01257	N	0.009056	D	0.85839	0.5790	M	0.67953	2.075	0.09310	N	0.999997	P	0.42908	0.793	B	0.38842	0.283	T	0.70718	-0.4795	10	0.32370	T	0.25	-19.0182	7.1672	0.25698	0.1003:0.1731:0.7265:0.0	.	335	P20333	TNR1B_HUMAN	S	335	ENSP00000365435:A335S	ENSP00000365435:A335S	A	+	1	0	TNFRSF1B	12184713	0.448000	0.25681	0.930000	0.37139	0.708000	0.40852	1.783000	0.38664	1.123000	0.41961	0.561000	0.74099	GCC	.		0.706	TNFRSF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005133.1	NM_001066	
IGSF21	84966	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	18691917	18691917	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:18691917C>T	ENST00000251296.1	+	6	1124	c.741C>T	c.(739-741)tcC>tcT	p.S247S		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	247						extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		AGCGCCCCTCCCGTGGCCTGA	0.637																																					p.S247S		.											.	IGSF21-156	0			c.C741T						.						89.0	98.0	95.0					1																	18691917		2203	4300	6503	SO:0001819	synonymous_variant	84966	exon6			CCCCTCCCGTGGC	AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.741C>T	1.37:g.18691917C>T		171	0		328	30	NM_032880	0	0	0	0	0	Q8NBR8	Silent	SNP	ENST00000251296.1	37	CCDS184.1	.	.	.	.	.	.	.	.	.	.	C	7.514	0.655193	0.14580	.	.	ENSG00000117154	ENST00000412684	.	.	.	5.03	1.9	0.25705	.	.	.	.	.	T	0.46964	0.1420	.	.	.	0.38034	D	0.935249	.	.	.	.	.	.	T	0.36648	-0.9739	4	.	.	.	-7.5151	4.9815	0.14168	0.1393:0.5101:0.2712:0.0794	.	.	.	.	S	200	.	.	P	+	1	0	IGSF21	18564504	0.000000	0.05858	0.327000	0.25402	0.817000	0.46193	-0.197000	0.09518	0.183000	0.20059	0.561000	0.74099	CCG	.		0.637	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006924.1	NM_032880	
USP48	84196	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22055060	22055060	+	Intron	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:22055060G>C	ENST00000308271.9	-	11	2099				USP48_ENST00000400301.1_Intron|USP48_ENST00000421625.2_Missense_Mutation_p.L485V|USP48_ENST00000529637.1_Intron	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48						ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ATATCTTACAGACCAGCTCCA	0.383																																					p.L485V		.											.	USP48-659	0			c.C1453G						.						196.0	168.0	177.0					1																	22055060		2203	4300	6503	SO:0001627	intron_variant	84196	exon11			CTTACAGACCAGC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.1450+2C>G	1.37:g.22055060G>C		100	0		152	40	NM_001032730	0	0	0	0	0	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	37	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090811	0.36855	.	.	ENSG00000090686	ENST00000421625	T	0.04275	3.66	5.84	5.84	0.93424	.	.	.	.	.	T	0.06917	0.0176	.	.	.	0.80722	D	1	P	0.40476	0.718	B	0.35353	0.201	T	0.08289	-1.0729	8	0.87932	D	0	.	17.2998	0.87180	0.0:0.0:1.0:0.0	.	485	Q86UV5-7	.	V	485	ENSP00000406256:L485V	ENSP00000406256:L485V	L	-	1	2	USP48	21927647	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.788000	0.75105	2.768000	0.95171	0.650000	0.86243	CTG	.		0.383	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
FUCA1	2517	bcgsc.ca	37	1	24180962	24180962	+	Missense_Mutation	SNP	T	T	C	rs13551	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:24180962T>C	ENST00000374479.3	-	5	864	c.857A>G	c.(856-858)cAg>cGg	p.Q286R		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	286			Q -> R (in allele FUCA1*2; dbSNP:rs13551). {ECO:0000269|PubMed:12408193, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:7815431, ECO:0000269|PubMed:8399358, ECO:0000269|PubMed:8504303}.		fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		TGGCAAGCTCTGTGGCTTGAA	0.463													t|||	1058	0.211262	0.1021	0.2464	5008	,	,		17166	0.2808		0.332	False		,,,				2504	0.138				p.Q286R		.											.	FUCA1-153	0			c.A857G						.		ARG/GLN	643,3763	276.9+/-273.4	46,551,1606	140.0	133.0	135.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	857	3.6	0.0	1	dbSNP_52	135	2845,5755	447.0+/-361.4	457,1931,1912	yes	missense	FUCA1	NM_000147.4	43	503,2482,3518	CC,CT,TT		33.0814,14.5937,26.8184	benign	286/467	24180962	3488,9518	2203	4300	6503	SO:0001583	missense	2517	exon5			AAGCTCTGTGGCT	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.857A>G	1.37:g.24180962T>C	ENSP00000363603:p.Gln286Arg	144	1		205	8	NM_000147	0	0	0	0	0	B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Missense_Mutation	SNP	ENST00000374479.3	37	CCDS244.2	549	0.25137362637362637	63	0.12804878048780488	97	0.26795580110497236	141	0.2465034965034965	248	0.32717678100263853	t	7.821	0.717720	0.15372	0.145937	0.330814	ENSG00000179163	ENST00000374479;ENST00000374475	T	0.56444	0.46	4.74	3.6	0.41247	Glycoside hydrolase, family 29, conserved site (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	1.038340	0.07550	N	0.915237	T	0.00012	0.0000	L	0.35487	1.065	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.22871	-1.0204	9	0.87932	D	0	-18.2834	3.1357	0.06438	0.0:0.2037:0.2751:0.5212	rs13551;rs1126515;rs2228423;rs3181585;rs11549094;rs52796281;rs13551	286	P04066	FUCO_HUMAN	R	286;75	ENSP00000363603:Q286R	ENSP00000363599:Q75R	Q	-	2	0	FUCA1	24053549	0.000000	0.05858	0.002000	0.10522	0.148000	0.21650	0.652000	0.24888	0.839000	0.34971	0.515000	0.50301	CAG	T|0.737;C|0.263		0.463	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147	
FAM46B	115572	hgsc.bcm.edu	37	1	27339103	27339103	+	Missense_Mutation	SNP	G	G	T	rs4970471	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:27339103G>T	ENST00000289166.5	-	1	224	c.59C>A	c.(58-60)aCg>aAg	p.T20K		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	20										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		ggccgcagccgtccccacctg	0.776													G|||	1682	0.335863	0.0416	0.3833	5008	,	,		10818	0.7232		0.17	False		,,,				2504	0.4714				p.T20K		.											.	FAM46B-90	0			c.C59A						.						2.0	3.0	3.0					1																	27339103		1323	2827	4150	SO:0001583	missense	115572	exon1			GCAGCCGTCCCCA	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.59C>A	1.37:g.27339103G>T	ENSP00000289166:p.Thr20Lys	0	0		6	6	NM_052943	0	0	0	0	0		Missense_Mutation	SNP	ENST00000289166.5	37	CCDS294.2	721	0.3301282051282051	37	0.07520325203252033	121	0.3342541436464088	437	0.763986013986014	126	0.1662269129287599	G	11.37	1.619792	0.28801	.	.	ENSG00000158246	ENST00000289166	T	0.21191	2.02	5.38	3.52	0.40303	.	1.667900	0.02757	N	0.118208	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.04013	0.001	T	0.47100	-0.9143	9	0.59425	D	0.04	2.3053	4.1771	0.10356	0.2481:0.0:0.5902:0.1618	rs4970471	20	Q96A09	FA46B_HUMAN	K	20	ENSP00000289166:T20K	ENSP00000289166:T20K	T	-	2	0	FAM46B	27211690	0.009000	0.17119	0.813000	0.32504	0.001000	0.01503	0.817000	0.27281	0.843000	0.35070	-0.137000	0.14449	ACG	G|0.670;T|0.330		0.776	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943	
UTP11L	51118	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	38482069	38482069	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:38482069G>T	ENST00000373014.4	+	2	163	c.102G>T	c.(100-102)aaG>aaT	p.K34N	UTP11L_ENST00000537711.1_Missense_Mutation_p.K34N	NM_016037.3	NP_057121.2	Q9Y3A2	UTP11_HUMAN	UTP11-like, U3 small nucleolar ribonucleoprotein (yeast)	34					nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleolus (GO:0005730)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGGAGAAAAAGAAAGATTACA	0.448																																					p.K34N		.											.	UTP11L-90	0			c.G102T						.						136.0	133.0	134.0					1																	38482069		2203	4300	6503	SO:0001583	missense	51118	exon2			GAAAAAGAAAGAT	AF151852	CCDS429.1	1p34.3	2014-03-06	2014-03-06		ENSG00000183520	ENSG00000183520			24329	protein-coding gene	gene with protein product		609440				11860508, 10810093	Standard	NM_016037		Approved	CGI-94	uc001ccn.4	Q9Y3A2	OTTHUMG00000004435	ENST00000373014.4:c.102G>T	1.37:g.38482069G>T	ENSP00000362105:p.Lys34Asn	41	0		67	16	NM_016037	0	0	0	0	0	A8K785|B4DJC6|D3DPT7|Q5VT93|Q9BS98|Q9NS31	Missense_Mutation	SNP	ENST00000373014.4	37	CCDS429.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134751	0.77662	.	.	ENSG00000183520	ENST00000373014;ENST00000537711	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.85013	0.5600	M	0.94021	3.485	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	D	0.87883	0.2679	9	0.66056	D	0.02	5.3328	12.7637	0.57380	0.0754:0.0:0.9246:0.0	.	34	Q9Y3A2	UTP11_HUMAN	N	34	.	ENSP00000362105:K34N	K	+	3	2	UTP11L	38254656	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.664000	0.68045	2.691000	0.91804	0.561000	0.74099	AAG	.		0.448	UTP11L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012962.1	NM_016037	
HIVEP3	59269	hgsc.bcm.edu	37	1	41976389	41976389	+	Silent	SNP	C	C	T	rs535491571		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:41976389C>T	ENST00000372583.1	-	9	7839	c.6954G>A	c.(6952-6954)ccG>ccA	p.P2318P	HIVEP3_ENST00000429157.2_Silent_p.P2317P|HIVEP3_ENST00000372584.1_Silent_p.P2317P|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000247584.5_Silent_p.P2318P	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2318					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GTCCCTGGGGCGGCCGGGGCA	0.751													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12254	0.0		0.0	False		,,,				2504	0.0				p.P2318P		.											.	HIVEP3-157	0			c.G6954A						.						4.0	6.0	6.0					1																	41976389		1994	3948	5942	SO:0001819	synonymous_variant	59269	exon9			CTGGGGCGGCCGG	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.6954G>A	1.37:g.41976389C>T		0	0		9	9	NM_024503	0	0	0	0	0	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	37	CCDS463.1																																																																																			.		0.751	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
PTBP2	58155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	97272469	97272469	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:97272469G>A	ENST00000426398.2	+	11	1169	c.1126G>A	c.(1126-1128)Gac>Aac	p.D376N	PTBP2_ENST00000609116.1_Missense_Mutation_p.D376N|PTBP2_ENST00000482253.1_3'UTR|PTBP2_ENST00000370198.1_Missense_Mutation_p.D381N|PTBP2_ENST00000541987.1_3'UTR|PTBP2_ENST00000394184.3_Missense_Mutation_p.D392N|PTBP2_ENST00000370197.1_Missense_Mutation_p.D381N	NM_021190.2	NP_067013.1	Q9UKA9	PTBP2_HUMAN	polypyrimidine tract binding protein 2	376	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splice site selection (GO:0006376)|negative regulation of RNA splicing (GO:0033119)|regulation of neural precursor cell proliferation (GO:2000177)	spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|skin(1)	26		all_epithelial(167;2.95e-05)|all_lung(203;0.000396)|Lung NSC(277;0.00171)		all cancers(265;0.0582)|Epithelial(280;0.0716)|Colorectal(170;0.0879)|KIRC - Kidney renal clear cell carcinoma(1967;0.202)		CAATAAGAAAGACAGCGCTCT	0.348																																					p.D376N		.											.	PTBP2-90	0			c.G1126A						.						139.0	136.0	137.0					1																	97272469		2203	4300	6503	SO:0001583	missense	58155	exon11			AAGAAAGACAGCG	AB051232	CCDS754.1, CCDS72828.1, CCDS72829.1, CCDS72830.1	1p21.3	2013-07-16			ENSG00000117569	ENSG00000117569		"""RNA binding motif (RRM) containing"""	17662	protein-coding gene	gene with protein product		608449				11003644	Standard	XM_005271084		Approved	brPTB, nPTB, PTB, PTBLP	uc001drq.3	Q9UKA9	OTTHUMG00000010685	ENST00000426398.2:c.1126G>A	1.37:g.97272469G>A	ENSP00000412788:p.Asp376Asn	96	0		99	19	NM_021190	0	0	0	0	0	Q8N0Z1|Q8N160|Q8NFB0|Q8NFB1|Q969N9|Q96Q76	Missense_Mutation	SNP	ENST00000426398.2	37	CCDS754.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936313	0.73442	.	.	ENSG00000117569	ENST00000236228;ENST00000543738;ENST00000370198;ENST00000370197;ENST00000426398;ENST00000394184	T;T;T;T;T	0.48836	0.83;0.81;0.81;0.82;0.8	5.53	5.53	0.82687	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.043268	0.85682	D	0.000000	T	0.57844	0.2081	M	0.83692	2.655	0.80722	D	1	P;D;D;B;P;B	0.55605	0.576;0.972;0.965;0.11;0.511;0.182	P;P;P;B;P;B	0.51945	0.641;0.685;0.558;0.155;0.452;0.138	T	0.61710	-0.7007	10	0.45353	T	0.12	-3.7772	19.4552	0.94884	0.0:0.0:1.0:0.0	.	384;392;381;376;376;381	B4DSU5;B4DSS8;Q9UKA9-4;Q9UKA9;Q9UKA9-2;Q9UKA9-3	.;.;.;PTBP2_HUMAN;.;.	N	376;48;381;381;376;392	ENSP00000236228:D376N;ENSP00000359217:D381N;ENSP00000359216:D381N;ENSP00000412788:D376N;ENSP00000377738:D392N	ENSP00000236228:D376N	D	+	1	0	PTBP2	97045057	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.476000	0.97823	2.591000	0.87537	0.563000	0.77884	GAC	.		0.348	PTBP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029453.1		
TRIM33	51592	hgsc.bcm.edu	37	1	115053471	115053471	+	Missense_Mutation	SNP	T	T	G	rs374161587	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:115053471T>G	ENST00000358465.2	-	1	310	c.227A>C	c.(226-228)cAg>cCg	p.Q76P	TRIM33_ENST00000369543.2_Missense_Mutation_p.Q76P	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	76	Necessary for E3 ubiquitin-protein ligase activity and repression of SMAD4 signaling and transcriptional repression.				gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGAAGCAGCCTGGGCCGAGCC	0.771			T	RET	papillary thyroid								T|||	4	0.000798722	0.0	0.0	5008	,	,		8411	0.003		0.0	False		,,,				2504	0.001				p.Q76P		.		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	TRIM33-1351	0			c.A227C						.						1.0	2.0	2.0					1																	115053471		1146	2779	3925	SO:0001583	missense	51592	exon1			GCAGCCTGGGCCG	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.227A>C	1.37:g.115053471T>G	ENSP00000351250:p.Gln76Pro	0	0		15	7	NM_033020	0	0	0	0	0	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	ENST00000358465.2	37	CCDS872.1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.495685	0.26774	.	.	ENSG00000197323	ENST00000358465;ENST00000369543	T;T	0.72835	-0.69;-0.59	3.6	1.55	0.23275	.	1.051000	0.07560	N	0.916845	T	0.18087	0.0434	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42515	-0.9447	10	0.02654	T	1	0.0852	6.1281	0.20189	0.0:0.1751:0.4315:0.3934	.	76;76	Q9UPN9-2;Q9UPN9	.;TRI33_HUMAN	P	76	ENSP00000351250:Q76P;ENSP00000358556:Q76P	ENSP00000351250:Q76P	Q	-	2	0	TRIM33	114854994	0.951000	0.32395	0.995000	0.50966	0.727000	0.41649	1.111000	0.31159	0.085000	0.17107	-0.666000	0.03841	CAG	.		0.771	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
NOTCH2	4853	hgsc.bcm.edu	37	1	120611964	120611964	+	Missense_Mutation	SNP	G	G	C	rs11810554	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:120611964G>C	ENST00000256646.2	-	1	276	c.57C>G	c.(55-57)tgC>tgG	p.C19W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	19					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.C19W(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGGGGCCGCGCAGCACAGCC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C19W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	1	Substitution - Missense(1)	central_nervous_system(1)	c.C57G						.						6.0	8.0	8.0					1																	120611964		1705	3721	5426	SO:0001583	missense	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGCCGCGCAGCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.57C>G	1.37:g.120611964G>C	ENSP00000256646:p.Cys19Trp	0	0		9	5	NM_024408	0	0	0	0	0	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	697|697	0.3191391941391941|0.3191391941391941	81|81	0.16463414634146342|0.16463414634146342	112|112	0.30939226519337015|0.30939226519337015	224|224	0.3916083916083916|0.3916083916083916	280|280	0.36939313984168864|0.36939313984168864	G|G	6.292|6.292	0.421956|0.421956	0.11928|0.11928	.|.	.|.	ENSG00000134250|ENSG00000134250	ENST00000538680|ENST00000256646	.|T	.|0.57436	.|0.4	3.09|3.09	2.04|2.04	0.26737|0.26737	.|.	.|.	.|.	.|.	.|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.14661|0.14661	0.345|0.345	0.26751|0.26751	N|N	0.970205|0.970205	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.14337|0.14337	-1.0476|-1.0476	6|9	0.87932|0.37606	D|T	0|0.19	.|.	6.7594|6.7594	0.23532|0.23532	0.0:0.0:0.7206:0.2794|0.0:0.0:0.7206:0.2794	rs11810554|rs11810554	.|19;19	.|Q6IQ50;Q04721	.|.;NOTC2_HUMAN	G|W	36|19	.|ENSP00000256646:C19W	ENSP00000439516:A36G|ENSP00000256646:C19W	A|C	-|-	2|3	0|2	NOTCH2|NOTCH2	120413487|120413487	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.313000|0.313000	0.28021|0.28021	0.766000|0.766000	0.26560|0.26560	1.760000|1.760000	0.52011|0.52011	0.184000|0.184000	0.17185|0.17185	GCG|TGC	G|0.680;C|0.320		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
NOTCH2	4853	hgsc.bcm.edu	37	1	120612006	120612006	+	Silent	SNP	G	G	A	rs4021006	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:120612006G>A	ENST00000256646.2	-	1	234	c.15C>T	c.(13-15)cgC>cgT	p.R5R		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	5					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCAGAGCGGGGCGCAGGGCGG	0.761			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome				g|||	1973	0.39397	0.2632	0.4049	5008	,	,		21911	0.4315		0.4423	False		,,,				2504	0.4744				p.R5R		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	0			c.C15T						.						6.0	8.0	8.0					1																	120612006		1838	3882	5720	SO:0001819	synonymous_variant	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AGCGGGGCGCAGG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.15C>T	1.37:g.120612006G>A		0	0		8	4	NM_024408	0	0	0	0	0	Q5T3X7|Q99734|Q9H240	Silent	SNP	ENST00000256646.2	37	CCDS908.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169358	0.21621	.	.	ENSG00000134250	ENST00000538680	.	.	.	2.9	1.95	0.26073	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0819	0.14661	0.1818:0.0:0.8182:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH2	120413529	0.988000	0.35896	0.959000	0.39883	0.588000	0.36517	1.074000	0.30703	0.543000	0.28864	0.184000	0.17185	.	G|0.500;A|0.500		0.761	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	0	0		10	10	NM_053055	0	0	0	0	0	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
LCE1E	353135	bcgsc.ca	37	1	152760075	152760075	+	Silent	SNP	A	A	G	rs201660535	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:152760075A>G	ENST00000368770.3	+	2	353	c.300A>G	c.(298-300)tcA>tcG	p.S100S	LCE1E_ENST00000368771.1_Silent_p.S100S	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	100	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAGCCCTCAGGGGGCTCCA	0.642													G|||	1333	0.266174	0.3654	0.2406	5008	,	,		14498	0.3313		0.1064	False		,,,				2504	0.2474				p.S100S		.											.	LCE1E-90	0			c.A300G						.	G		355,3853		89,177,1838	36.0	52.0	47.0		300	-4.6	0.5	1	dbSNP_132	47	177,8331		25,127,4102	no	coding-synonymous	LCE1E	NM_178353.1		114,304,5940	GG,GA,AA		2.0804,8.4363,4.1837		100/119	152760075	532,12184	2104	4254	6358	SO:0001819	synonymous_variant	353135	exon2			GCCCTCAGGGGGC	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.300A>G	1.37:g.152760075A>G		127	6		211	47	NM_178353	0	0	0	0	0	D3DV30	Silent	SNP	ENST00000368770.3	37	CCDS1024.1																																																																																			A|0.995;G|0.005		0.642	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
LCE1E	353135	ucsc.edu	37	1	152760096	152760096	+	Silent	SNP	A	A	T	rs115864544	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:152760096A>T	ENST00000368770.3	+	2	374	c.321A>T	c.(319-321)ggA>ggT	p.G107G	LCE1E_ENST00000368771.1_Silent_p.G107G	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	107	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGCTGTGGAGGGGGCAGCG	0.622													A|||	882	0.176118	0.239	0.1383	5008	,	,		14571	0.2639		0.0616	False		,,,				2504	0.1452				p.G107G		.											.	LCE1E-90	0			c.A321T						.	A		397,3855		43,311,1772	39.0	58.0	52.0		321	1.2	1.0	1	dbSNP_132	52	221,8299		15,191,4054	no	coding-synonymous	LCE1E	NM_178353.1		58,502,5826	TT,TA,AA		2.5939,9.3368,4.8387		107/119	152760096	618,12154	2126	4260	6386	SO:0001819	synonymous_variant	353135	exon2			CTGTGGAGGGGGC	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.321A>T	1.37:g.152760096A>T		179	11		237	46	NM_178353	0	0	0	0	0	D3DV30	Silent	SNP	ENST00000368770.3	37	CCDS1024.1																																																																																			A|0.901;T|0.099		0.622	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
DENND4B	9909	hgsc.bcm.edu;bcgsc.ca	37	1	153907278	153907278	+	Missense_Mutation	SNP	C	C	G	rs3835302|rs535500992		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:153907278C>G	ENST00000361217.4	-	18	3149	c.2731G>C	c.(2731-2733)Gag>Cag	p.E911Q	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	911	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GACACctgctcctgctgctgc	0.632																																					p.E911Q		.											.	DENND4B-69	0			c.G2731C						.						15.0	24.0	21.0					1																	153907278		2068	4056	6124	SO:0001583	missense	9909	exon18			CCTGCTCCTGCTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2731G>C	1.37:g.153907278C>G	ENSP00000354597:p.Glu911Gln	46	0		129	9	NM_014856	0	0	0	0	0	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	37	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	C	0.021	-1.431217	0.01117	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.06687	3.27;3.28	4.28	-0.0248	0.13938	.	7739.210000	0.00166	N	0.000000	T	0.01421	0.0046	N	0.08118	0	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.48091	-0.9065	10	0.10902	T	0.67	.	14.2373	0.65934	0.0:0.6605:0.3395:0.0	.	911	O75064	DEN4B_HUMAN	Q	911;922	ENSP00000354597:E911Q;ENSP00000357635:E922Q	ENSP00000354597:E911Q	E	-	1	0	DENND4B	152173902	0.004000	0.15560	0.747000	0.31113	0.197000	0.23852	-0.089000	0.11180	-0.084000	0.12595	-1.569000	0.00873	GAG	.		0.632	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
CD1E	913	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158324185	158324185	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:158324185C>A	ENST00000368167.3	+	2	316	c.77C>A	c.(76-78)tCc>tAc	p.S26Y	CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368155.3_Missense_Mutation_p.S26Y|CD1E_ENST00000368160.3_Missense_Mutation_p.S26Y|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.S26Y|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368161.3_Missense_Mutation_p.S26Y|CD1E_ENST00000464822.1_Intron|CD1E_ENST00000368165.3_Missense_Mutation_p.S26Y|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368156.1_Missense_Mutation_p.S26Y|CD1E_ENST00000444681.2_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.S24Y	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	26					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GCTCTACAATCCTATCATCTA	0.517																																					p.S26Y		.											.	CD1E-93	0			c.C77A						.						144.0	146.0	145.0					1																	158324185		2101	4238	6339	SO:0001583	missense	913	exon2			TACAATCCTATCA	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.77C>A	1.37:g.158324185C>A	ENSP00000357149:p.Ser26Tyr	89	0		94	21	NM_001185107	0	0	0	0	0	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	ENST00000368167.3	37	CCDS41417.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969603	0.34754	.	.	ENSG00000158488	ENST00000434258;ENST00000368167;ENST00000368165;ENST00000368163;ENST00000368160;ENST00000368161;ENST00000368156;ENST00000368155	T;T;T;T;T;T;T;T	0.06608	4.57;4.46;3.28;3.4;4.55;3.78;3.48;3.44	3.57	-1.85	0.07784	.	1.378010	0.05045	N	0.476956	T	0.02156	0.0067	L	0.27053	0.805	0.09310	N	1	P;B;B;B;B;B;B;P	0.45569	0.543;0.218;0.218;0.349;0.276;0.188;0.218;0.861	B;B;B;B;B;B;B;P	0.47075	0.096;0.08;0.08;0.116;0.074;0.09;0.08;0.536	T	0.33343	-0.9872	10	0.54805	T	0.06	-0.0936	4.1806	0.10374	0.0:0.4116:0.1721:0.4163	.	24;26;26;26;26;26;26;26	E7ET31;P15812-5;P15812-7;P15812-2;P15812;P15812-3;P15812-6;P15812-4	.;.;.;.;CD1E_HUMAN;.;.;.	Y	24;26;26;26;26;26;26;26	ENSP00000401957:S24Y;ENSP00000357149:S26Y;ENSP00000357147:S26Y;ENSP00000357145:S26Y;ENSP00000357142:S26Y;ENSP00000357143:S26Y;ENSP00000357138:S26Y;ENSP00000357137:S26Y	ENSP00000357137:S26Y	S	+	2	0	CD1E	156590809	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.011000	0.13264	-0.365000	0.08076	0.563000	0.77884	TCC	.		0.517	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
OR6K6	128371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158725430	158725430	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:158725430C>A	ENST00000368144.2	+	1	921	c.825C>A	c.(823-825)ttC>ttA	p.F275L		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	275						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TTGCTGTGTTCTTGCTATTTT	0.448																																					p.F275L		.											.	OR6K6-69	0			c.C825A						.						244.0	186.0	206.0					1																	158725430		2203	4300	6503	SO:0001583	missense	128371	exon1			TGTGTTCTTGCTA	BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.825C>A	1.37:g.158725430C>A	ENSP00000357126:p.Phe275Leu	278	0		403	92	NM_001005184	0	0	0	0	0	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	ENST00000368144.2	37	CCDS30904.1	.	.	.	.	.	.	.	.	.	.	C	18.24	3.581198	0.65992	.	.	ENSG00000180433	ENST00000368144	T	0.00099	8.73	5.48	1.46	0.22682	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000297	T	0.00109	0.0003	N	0.20685	0.6	0.34020	D	0.652551	D	0.65815	0.995	D	0.70016	0.967	T	0.72144	-0.4379	10	0.72032	D	0.01	-21.796	10.3537	0.43952	0.0:0.7202:0.0:0.2798	.	275	Q8NGW6	OR6K6_HUMAN	L	275	ENSP00000357126:F275L	ENSP00000357126:F275L	F	+	3	2	OR6K6	156992054	0.000000	0.05858	0.992000	0.48379	0.990000	0.78478	-3.087000	0.00610	0.426000	0.26116	-0.136000	0.14681	TTC	.		0.448	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059065.2	NM_001005184	
IFI16	3428	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159021731	159021731	+	Missense_Mutation	SNP	A	A	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:159021731A>T	ENST00000295809.7	+	10	2183	c.1928A>T	c.(1927-1929)gAg>gTg	p.E643V	IFI16_ENST00000368131.4_Missense_Mutation_p.E587V|IFI16_ENST00000448393.2_Missense_Mutation_p.E531V|IFI16_ENST00000340979.6_Missense_Mutation_p.E531V|IFI16_ENST00000430894.2_Missense_Mutation_p.E591V|IFI16_ENST00000359709.3_Missense_Mutation_p.E587V|IFI16_ENST00000368132.3_Missense_Mutation_p.E587V			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	643	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					GGGTTCCTGGAGGTATATCCT	0.418																																					p.E587V		.											.	IFI16-91	0			c.A1760T						.						95.0	94.0	95.0					1																	159021731		2203	4300	6503	SO:0001583	missense	3428	exon9			TCCTGGAGGTATA	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1928A>T	1.37:g.159021731A>T	ENSP00000295809:p.Glu643Val	126	0		147	35	NM_001206567	0	0	0	0	0	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.18|14.18	2.459195|2.459195	0.43634|0.43634	.|.	.|.	ENSG00000163565|ENSG00000163565	ENST00000359709;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894|ENST00000448393	T;T;T;T;T|.	0.39056|.	1.1;1.1;1.1;1.1;1.1|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	.|.	.|.	.|.	.|.	T|T	0.44201|0.44201	0.1282|0.1282	M|M	0.74467|0.74467	2.265|2.265	0.26473|0.26473	N|N	0.975245|0.975245	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;0.999|.	T|T	0.40997|0.40997	-0.9533|-0.9533	9|5	0.87932|.	D|.	0|.	.|.	10.7594|10.7594	0.46256|0.46256	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	591;531;587|.	E7EPR3;Q16666-3;Q16666-2|.	.;.;.|.	V|W	272;643;531;587;587;591|352	ENSP00000295809:E643V;ENSP00000342741:E531V;ENSP00000357113:E587V;ENSP00000357114:E587V;ENSP00000394935:E591V|.	ENSP00000295809:E643V|.	E|R	+|+	2|1	0|2	IFI16|IFI16	157288355|157288355	0.987000|0.987000	0.35691|0.35691	0.904000|0.904000	0.35570|0.35570	0.046000|0.046000	0.14306|0.14306	3.423000|3.423000	0.52756|0.52756	2.029000|2.029000	0.59856|0.59856	0.496000|0.496000	0.49642|0.49642	GAG|AGG	.		0.418	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531	
FCER1A	2205	bcgsc.ca	37	1	159277689	159277689	+	Missense_Mutation	SNP	C	C	A	rs41264475	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:159277689C>A	ENST00000368115.1	+	6	840	c.741C>A	c.(739-741)aaC>aaA	p.N247K	FCER1A_ENST00000368114.1_Missense_Mutation_p.N214K	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	247					activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	GACTTCTGAACCCACATCCTA	0.378													C|||	32	0.00638978	0.0008	0.0187	5008	,	,		19810	0.0		0.0179	False		,,,				2504	0.0				p.N247K		.											.	FCER1A-524	0			c.C741A						.	C	LYS/ASN	13,4393	17.9+/-39.9	0,13,2190	89.0	85.0	87.0		741	-1.5	0.0	1	dbSNP_127	87	105,8495	55.6+/-116.7	2,101,4197	yes	missense	FCER1A	NM_002001.3	94	2,114,6387	AA,AC,CC		1.2209,0.2951,0.9073	benign	247/258	159277689	118,12888	2203	4300	6503	SO:0001583	missense	2205	exon6			TCTGAACCCACAT	BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.741C>A	1.37:g.159277689C>A	ENSP00000357097:p.Asn247Lys	58	0		54	4	NM_002001	0	0	0	0	0		Missense_Mutation	SNP	ENST00000368115.1	37	CCDS1184.1	21	0.009615384615384616	0	0.0	9	0.024861878453038673	0	0.0	12	0.0158311345646438	C	11.45	1.641438	0.29157	0.002951	0.012209	ENSG00000179639	ENST00000368115;ENST00000368114	T;T	0.01918	4.92;4.56	4.71	-1.46	0.08800	.	1.456950	0.05088	U	0.484709	T	0.00412	0.0013	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.48281	-0.9049	10	0.62326	D	0.03	.	0.7756	0.01031	0.1679:0.2637:0.1652:0.4033	rs41264475	247	P12319	FCERA_HUMAN	K	247;214	ENSP00000357097:N247K;ENSP00000357096:N214K	ENSP00000357096:N214K	N	+	3	2	FCER1A	157544313	0.000000	0.05858	0.000000	0.03702	0.067000	0.16453	-0.188000	0.09642	-0.209000	0.10156	0.650000	0.86243	AAC	C|0.991;A|0.009		0.378	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090328.2	NM_002001	
COPA	1314	broad.mit.edu	37	1	160277011	160277011	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:160277011C>A	ENST00000241704.7	-	14	1473	c.1244G>T	c.(1243-1245)gGc>gTc	p.G415V	COPA_ENST00000368069.3_Missense_Mutation_p.G415V	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	415					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GGCTGTCAGGCCTGAGGATCG	0.522																																					p.G415V		.											.	COPA-92	0			c.G1244T						.						150.0	143.0	146.0					1																	160277011		2203	4300	6503	SO:0001583	missense	1314	exon14			GTCAGGCCTGAGG	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1244G>T	1.37:g.160277011C>A	ENSP00000241704:p.Gly415Val	93	1		167	9	NM_004371	0	0	0	0	0	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	37	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919933	0.73098	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.68025	-0.24;-0.3	5.55	4.64	0.57946	Coatomer, WD associated region (1);	0.000000	0.85682	D	0.000000	D	0.82462	0.5042	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.992;0.994	D	0.87291	0.2299	10	0.72032	D	0.01	-15.9614	13.4655	0.61251	0.0:0.9244:0.0:0.0756	.	415;415	P53621;P53621-2	COPA_HUMAN;.	V	415	ENSP00000357048:G415V;ENSP00000241704:G415V	ENSP00000241704:G415V	G	-	2	0	COPA	158543635	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.416000	0.80143	1.586000	0.49944	0.591000	0.81541	GGC	.		0.522	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
IGFN1	91156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	201182038	201182038	+	Missense_Mutation	SNP	G	G	T	rs537015394		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:201182038G>T	ENST00000335211.4	+	12	8147	c.8017G>T	c.(8017-8019)Ggt>Tgt	p.G2673C	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGGCTTTAAGGGTGGGGAGGG	0.607																																					p.G2673C		.											.	IGFN1-71	0			c.G8017T						.						11.0	16.0	14.0					1																	201182038		692	1589	2281	SO:0001583	missense	91156	exon12			TTTAAGGGTGGGG	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.8017G>T	1.37:g.201182038G>T	ENSP00000334714:p.Gly2673Cys	137	0		163	38	NM_001164586	0	0	0	0	0	F8WAI1|Q9NT72	Missense_Mutation	SNP	ENST00000335211.4	37	CCDS53455.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.37|14.37	2.514102|2.514102	0.44763|0.44763	.|.	.|.	ENSG00000163395|ENSG00000163395	ENST00000335211|ENST00000412892	T|.	0.59502|.	0.26|.	3.54|3.54	2.61|2.61	0.31194|0.31194	.|.	.|.	.|.	.|.	.|.	T|T	0.18215|0.18215	0.0437|0.0437	N|N	0.08118|0.08118	0|0	0.26680|0.26680	N|N	0.971557|0.971557	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.26087|0.26087	-1.0113|-1.0113	7|5	0.87932|.	D|.	0|.	.|.	8.0359|8.0359	0.30493|0.30493	0.1224:0.0:0.8776:0.0|0.1224:0.0:0.8776:0.0	.|.	.|.	.|.	.|.	C|V	2673|90	ENSP00000334714:G2673C|.	ENSP00000334714:G2673C|.	G|G	+|+	1|2	0|0	IGFN1|IGFN1	199448661|199448661	0.018000|0.018000	0.18449|0.18449	0.002000|0.002000	0.10522|0.10522	0.072000|0.072000	0.16883|0.16883	1.153000|1.153000	0.31676|0.31676	0.461000|0.461000	0.27071|0.27071	0.491000|0.491000	0.48974|0.48974	GGT|GGG	.		0.607	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_178275	
KCTD3	51133	hgsc.bcm.edu	37	1	215741053	215741053	+	Missense_Mutation	SNP	T	T	G	rs2275768	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:215741053T>G	ENST00000259154.4	+	1	319	c.25T>G	c.(25-27)Ttc>Gtc	p.F9V		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	9			F -> V (in dbSNP:rs2275768). {ECO:0000269|PubMed:15489334}.		protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		CTGCGGCAGCTTCCCCGCGGC	0.761													T|||	1459	0.291334	0.0605	0.2291	5008	,	,		8959	0.4276		0.2853	False		,,,				2504	0.5133				p.F9V		.											.	KCTD3-93	0			c.T25G						.	T	VAL/PHE	232,2814		17,198,1308	3.0	5.0	5.0		25	1.6	0.8	1	dbSNP_100	5	1189,4951		136,917,2017	no	missense	KCTD3	NM_016121.3	50	153,1115,3325	GG,GT,TT		19.3648,7.6165,15.4692	benign	9/816	215741053	1421,7765	1523	3070	4593	SO:0001583	missense	51133	exon1			GGCAGCTTCCCCG	AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.25T>G	1.37:g.215741053T>G	ENSP00000259154:p.Phe9Val	1	0		60	11	NM_016121	0	0	0	0	0	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	ENST00000259154.4	37	CCDS1515.1	595	0.2724358974358974	34	0.06910569105691057	93	0.2569060773480663	249	0.4353146853146853	219	0.28891820580474936	T	10.24	1.294537	0.23564	0.076165	0.193648	ENSG00000136636	ENST00000259154;ENST00000366945	T	0.36520	1.25	2.8	1.63	0.23807	.	0.611401	0.14267	U	0.330439	T	0.00012	0.0000	L	0.27053	0.805	0.50813	P	1.0900000000002574E-4	B;B	0.12013	0.005;0.003	B;B	0.08055	0.003;0.001	T	0.48115	-0.9063	9	0.23891	T	0.37	-7.5445	6.7109	0.23276	0.0:0.2267:0.0:0.7733	rs2275768;rs17845401;rs17858259	9;9	Q9Y597-2;Q9Y597	.;KCTD3_HUMAN	V	9	ENSP00000259154:F9V	ENSP00000259154:F9V	F	+	1	0	KCTD3	213807676	0.045000	0.20229	0.833000	0.33012	0.447000	0.32167	0.628000	0.24522	0.293000	0.22520	0.254000	0.18369	TTC	T|0.721;G|0.279		0.761	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089871.2	NM_016121	
RAB3GAP2	25782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	220369717	220369717	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:220369717C>G	ENST00000358951.2	-	10	951	c.835G>C	c.(835-837)Gat>Cat	p.D279H		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	279					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TTCATTTGATCAAAGGGGGAC	0.348																																					p.D279H		.											.	RAB3GAP2-90	0			c.G835C						.						87.0	90.0	89.0					1																	220369717		2203	4300	6503	SO:0001583	missense	25782	exon10			TTTGATCAAAGGG	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.835G>C	1.37:g.220369717C>G	ENSP00000351832:p.Asp279His	94	0		85	23	NM_012414	0	0	0	0	0	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	ENST00000358951.2	37	CCDS31028.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918218	0.92249	.	.	ENSG00000118873	ENST00000358951	T	0.38887	1.11	5.61	5.61	0.85477	.	0.090485	0.85682	D	0.000000	T	0.59169	0.2174	L	0.52126	1.63	0.80722	D	1	D	0.69078	0.997	P	0.62435	0.902	T	0.60388	-0.7273	10	0.87932	D	0	.	19.6344	0.95724	0.0:1.0:0.0:0.0	.	279	Q9H2M9	RBGPR_HUMAN	H	279	ENSP00000351832:D279H	ENSP00000351832:D279H	D	-	1	0	RAB3GAP2	218436340	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.396000	0.79891	2.643000	0.89663	0.462000	0.41574	GAT	.		0.348	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090205.2	NM_012414	
IBA57	200205	broad.mit.edu	37	1	228362441	228362441	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:228362441C>A	ENST00000366711.3	+	2	392	c.390C>A	c.(388-390)agC>agA	p.S130R	IBA57_ENST00000484749.1_3'UTR|IBA57_ENST00000546123.1_5'UTR	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	130					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)	p.S130R(2)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						AGTGTGACAGCTCGGTGCAGG	0.662																																					p.S130R		.											.	IBA57-90	2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)	c.C390A						.						24.0	24.0	24.0					1																	228362441		2199	4296	6495	SO:0001583	missense	200205	exon2			TGACAGCTCGGTG	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.390C>A	1.37:g.228362441C>A	ENSP00000355672:p.Ser130Arg	29	1		162	21	NM_001010867	0	0	0	0	0		Missense_Mutation	SNP	ENST00000366711.3	37	CCDS31046.1	.	.	.	.	.	.	.	.	.	.	C	7.793	0.711906	0.15306	.	.	ENSG00000181873	ENST00000366711	T	0.75154	-0.91	4.65	0.706	0.18133	Glycine cleavage T-protein, N-terminal (1);	0.591122	0.18565	N	0.137486	T	0.57651	0.2068	N	0.25647	0.755	0.20307	N	0.999915	B	0.12013	0.005	B	0.20384	0.029	T	0.42582	-0.9443	10	0.28530	T	0.3	-8.2527	8.9387	0.35715	0.0:0.6235:0.0:0.3765	.	130	Q5T440	CAF17_HUMAN	R	130	ENSP00000355672:S130R	ENSP00000355672:S130R	S	+	3	2	IBA57	226429064	0.000000	0.05858	0.001000	0.08648	0.127000	0.20565	-0.053000	0.11846	-0.022000	0.13986	0.655000	0.94253	AGC	.		0.662	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095980.1	NM_001010867	
PCNXL2	80003	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	233372603	233372603	+	Silent	SNP	C	C	A	rs371412704		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:233372603C>A	ENST00000258229.9	-	9	2580	c.2346G>T	c.(2344-2346)tcG>tcT	p.S782S	PCNXL2_ENST00000430153.1_Silent_p.S81S	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	782						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GTGGGGTTTCCGACTGGGTCC	0.507																																					p.S782S		.											.	PCNXL2-91	0			c.G2346T						.						129.0	129.0	129.0					1																	233372603		1907	4134	6041	SO:0001819	synonymous_variant	80003	exon9			GGTTTCCGACTGG	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.2346G>T	1.37:g.233372603C>A		100	0		132	12	NM_014801	0	0	0	0	0	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Silent	SNP	ENST00000258229.9	37	CCDS44335.1																																																																																			.		0.507	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
HEATR1	55127	bcgsc.ca	37	1	236758887	236758887	+	Missense_Mutation	SNP	T	T	C	rs2794751	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:236758887T>C	ENST00000366582.3	-	8	1157	c.1043A>G	c.(1042-1044)cAt>cGt	p.H348R	HEATR1_ENST00000483073.1_5'Flank|HEATR1_ENST00000366581.2_Missense_Mutation_p.H348R	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	348			H -> R (in dbSNP:rs2794751). {ECO:0000269|Ref.1}.		rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			AAGCATGTAATGCAGAAGAGG	0.363													C|||	2802	0.559505	0.329	0.6009	5008	,	,		17059	0.7242		0.6998	False		,,,				2504	0.5276				p.H348R		.											.	HEATR1-93	0			c.A1043G						.	C	ARG/HIS	1723,2683	650.4+/-399.0	336,1051,816	104.0	98.0	100.0		1043	3.0	1.0	1	dbSNP_100	100	6153,2447	402.8+/-347.6	2194,1765,341	yes	missense	HEATR1	NM_018072.5	29	2530,2816,1157	CC,CT,TT		28.4535,39.1058,39.4433	benign	348/2145	236758887	7876,5130	2203	4300	6503	SO:0001583	missense	55127	exon8			ATGTAATGCAGAA	BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1043A>G	1.37:g.236758887T>C	ENSP00000355541:p.His348Arg	194	1		274	11	NM_018072	0	0	0	0	0	Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	ENST00000366582.3	37	CCDS31066.1	1337	0.6121794871794872	176	0.35772357723577236	219	0.6049723756906077	416	0.7272727272727273	526	0.6939313984168866	C	0.606	-0.827217	0.02734	0.391058	0.715465	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.65178	1.13;-0.14	4.98	2.97	0.34412	Armadillo-type fold (1);	0.478236	0.24623	N	0.036947	T	0.00012	0.0000	N	0.02011	-0.69	0.09310	P	0.99999852289	B	0.02656	0.0	B	0.04013	0.001	T	0.39418	-0.9615	9	0.21540	T	0.41	.	5.5938	0.17315	0.0:0.5452:0.1434:0.3114	rs2794751;rs59174203;rs2794751	348	Q9H583	HEAT1_HUMAN	R	348	ENSP00000355541:H348R;ENSP00000355540:H348R	ENSP00000355540:H348R	H	-	2	0	HEATR1	234825510	0.049000	0.20398	0.990000	0.47175	0.717000	0.41224	0.196000	0.17176	0.717000	0.32145	-0.186000	0.12905	CAT	T|0.400;C|0.600		0.363	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096635.1	XM_375853	
ACTN2	88	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	236902810	236902810	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:236902810C>T	ENST00000366578.4	+	10	1251	c.1085C>T	c.(1084-1086)cCc>cTc	p.P362L	ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.P362L|ACTN2_ENST00000546208.1_Intron	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	362					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GCCTTCATGCCCTCCGAGGGC	0.597																																					p.P362L		.											.	ACTN2-95	0			c.C1085T						.						101.0	79.0	87.0					1																	236902810		2203	4300	6503	SO:0001583	missense	88	exon10			TCATGCCCTCCGA	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1085C>T	1.37:g.236902810C>T	ENSP00000355537:p.Pro362Leu	107	0		231	63	NM_001103	0	0	0	0	0	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	37	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	C	35	5.414326	0.96092	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000545611	T;T	0.74632	-0.86;-0.86	5.51	5.51	0.81932	.	0.046623	0.85682	D	0.000000	D	0.90604	0.7054	H	0.94734	3.575	0.80722	D	1	D;D;D	0.89917	0.999;0.976;1.0	D;D;D	0.91635	0.996;0.918;0.999	D	0.92857	0.6302	10	0.87932	D	0	.	19.4071	0.94651	0.0:1.0:0.0:0.0	.	362;132;362	B2RCS5;Q59FD9;P35609	.;.;ACTN2_HUMAN	L	362;362;131	ENSP00000443495:P362L;ENSP00000355537:P362L	ENSP00000355537:P362L	P	+	2	0	ACTN2	234969433	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.780000	0.85658	2.585000	0.87301	0.555000	0.69702	CCC	.		0.597	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
OR2G6	391211	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248685138	248685138	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:248685138G>T	ENST00000343414.4	+	1	223	c.191G>T	c.(190-192)aGc>aTc	p.S64I		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTCTTCCTCAGCAACCTCTCG	0.478																																					p.S64I		.											.	OR2G6-71	0			c.G191T						.						130.0	110.0	116.0					1																	248685138		2203	4300	6503	SO:0001583	missense	391211	exon1			TCCTCAGCAACCT		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.191G>T	1.37:g.248685138G>T	ENSP00000341291:p.Ser64Ile	183	1		210	49	NM_001013355	0	0	0	0	0	B2RP33	Missense_Mutation	SNP	ENST00000343414.4	37	CCDS31119.1	.	.	.	.	.	.	.	.	.	.	-	10.44	1.350540	0.24512	.	.	ENSG00000188558	ENST00000343414	T	0.00408	7.54	3.68	0.25	0.15535	GPCR, rhodopsin-like superfamily (1);	0.297112	0.23779	U	0.044657	T	0.00936	0.0031	H	0.94345	3.525	0.09310	N	1	D	0.54964	0.969	P	0.48030	0.564	T	0.30765	-0.9967	10	0.87932	D	0	.	14.2041	0.65724	0.0:0.5886:0.4114:0.0	.	64	Q5TZ20	OR2G6_HUMAN	I	64	ENSP00000341291:S64I	ENSP00000341291:S64I	S	+	2	0	OR2G6	246751761	0.000000	0.05858	0.032000	0.17829	0.832000	0.47134	-0.001000	0.12947	0.200000	0.20447	0.400000	0.26472	AGC	.		0.478	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
AKR1CL1	340811	bcgsc.ca	37	10	5202076	5202076	+	IGR	SNP	G	G	A	rs148010840	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:5202076G>A	ENST00000334314.3	-	0	492				AKR1CL1_ENST00000465430.1_Intron			Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						TGGGCTAAGGGCTCACCTGGT	0.488													G|||	33	0.00658946	0.0	0.0072	5008	,	,		15919	0.0		0.0249	False		,,,				2504	0.0031				.	Ovarian(129;1623 1737 25446 28757 47467)	.											.	AKR1CL1-90	0			.						.																																			SO:0001628	intergenic_variant	340811	.			CTAAGGGCTCACC			10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213		10.37:g.5202076G>A		280	2		207	10	.	0	0	0	0	0	A6NF66|Q6ZN81	RNA	SNP	ENST00000334314.3	37																																																																																				G|0.985;A|0.015		0.488	AKR1CL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NR_027916	
DHTKD1	55526	bcgsc.ca	37	10	12143105	12143105	+	Missense_Mutation	SNP	C	C	G	rs2062988	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:12143105C>G	ENST00000263035.4	+	10	1883	c.1821C>G	c.(1819-1821)atC>atG	p.I607M		NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	607			I -> M (in dbSNP:rs2062988). {ECO:0000269|PubMed:10997877, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.		cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			GGCATGCAATCGTGGTTTGCC	0.443													G|||	3626	0.724042	0.5545	0.6873	5008	,	,		21552	0.7054		0.8191	False		,,,				2504	0.9008				p.I607M		.											.	DHTKD1-515	0			c.C1821G						.	G	MET/ILE	2649,1757	524.9+/-371.5	811,1027,365	195.0	170.0	178.0		1821	5.5	1.0	10	dbSNP_94	178	7002,1598	297.9+/-303.7	2857,1288,155	yes	missense	DHTKD1	NM_018706.5	10	3668,2315,520	GG,GC,CC		18.5814,39.8774,25.7958	benign	607/920	12143105	9651,3355	2203	4300	6503	SO:0001583	missense	55526	exon10			TGCAATCGTGGTT	BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.1821C>G	10.37:g.12143105C>G	ENSP00000263035:p.Ile607Met	137	1		154	7	NM_018706	0	0	0	0	0	Q68CU5|Q9BUM8|Q9HCE2	Missense_Mutation	SNP	ENST00000263035.4	37	CCDS7087.1	1575|1575	0.7211538461538461|0.7211538461538461	290|290	0.5894308943089431|0.5894308943089431	263|263	0.7265193370165746|0.7265193370165746	404|404	0.7062937062937062|0.7062937062937062	618|618	0.8153034300791556|0.8153034300791556	G|G	8.483|8.483	0.860296|0.860296	0.17178|0.17178	0.601226|0.601226	0.814186|0.814186	ENSG00000181192|ENSG00000181192	ENST00000263035|ENST00000448829	D|.	0.91464|.	-2.85|.	5.48|5.48	5.48|5.48	0.80851|0.80851	Transketolase-like, pyrimidine-binding domain (2);|.	0.104529|.	0.85682|.	N|.	0.000000|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00642|0.00642	-1.3|-1.3	0.33644|0.33644	P|P	0.39239100000000005|0.39239100000000005	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.15378|0.15378	-1.0439|-1.0439	9|4	0.34782|.	T|.	0.22|.	-7.6657|-7.6657	14.8575|14.8575	0.70351|0.70351	0.0:0.1434:0.8566:0.0|0.0:0.1434:0.8566:0.0	rs2062988;rs3740018;rs12772425;rs17151290;rs17856063;rs52821578;rs59256179;rs2062988|rs2062988;rs3740018;rs12772425;rs17151290;rs17856063;rs52821578;rs59256179;rs2062988	607|.	Q96HY7|.	DHTK1_HUMAN|.	M|G	607|159	ENSP00000263035:I607M|.	ENSP00000263035:I607M|.	I|R	+|+	3|1	3|0	DHTKD1|DHTKD1	12183111|12183111	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.974000|0.974000	0.67602|0.67602	7.152000|7.152000	0.77419|0.77419	1.336000|1.336000	0.45506|0.45506	-0.120000|-0.120000	0.15030|0.15030	ATC|CGT	C|0.263;G|0.737		0.443	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046777.1	NM_018706	
SVIL	6840	bcgsc.ca	37	10	29777558	29777558	+	Silent	SNP	G	G	A	rs61737742	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:29777558G>A	ENST00000355867.4	-	23	5072	c.4320C>T	c.(4318-4320)taC>taT	p.Y1440Y	SVIL_ENST00000538146.1_Silent_p.Y232Y|SVIL_ENST00000375398.2_Silent_p.Y1440Y|SVIL_ENST00000535393.1_Silent_p.Y354Y|SVIL_ENST00000375400.3_Silent_p.Y1014Y|PTCHD3P1_ENST00000413405.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1440	Interaction with NEB.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TCAGCCTCTTGTAGGGCACGG	0.547													G|||	254	0.0507188	0.0378	0.0533	5008	,	,		19469	0.001		0.1362	False		,,,				2504	0.0297				p.Y1440Y		.											.	SVIL-96	0			c.C4320T						.	G	,	223,4183	132.5+/-169.0	0,223,1980	88.0	69.0	76.0		3042,4320	2.9	1.0	10	dbSNP_129	76	1125,7475	230.7+/-264.9	79,967,3254	no	coding-synonymous,coding-synonymous	SVIL	NM_003174.3,NM_021738.2	,	79,1190,5234	AA,AG,GG		13.0814,5.0613,10.3644	,	1014/1789,1440/2215	29777558	1348,11658	2203	4300	6503	SO:0001819	synonymous_variant	6840	exon23			CCTCTTGTAGGGC	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.4320C>T	10.37:g.29777558G>A		51	0		82	7	NM_021738	0	0	0	0	0	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																			G|0.911;A|0.089		0.547	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
GPRIN2	9721	hgsc.bcm.edu	37	10	47000193	47000193	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:47000193G>A	ENST00000374317.1	+	3	1586	c.1313G>A	c.(1312-1314)cGg>cAg	p.R438Q	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R438Q	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	438										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GGGCCACTGCGGGCTGTCATG	0.721																																					p.R438Q		.											.	GPRIN2-90	0			c.G1313A						.						15.0	15.0	15.0					10																	47000193		2173	4260	6433	SO:0001583	missense	9721	exon3			CACTGCGGGCTGT	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1313G>A	10.37:g.47000193G>A	ENSP00000363436:p.Arg438Gln	3	0		20	5	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375886	0.82682	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.32988	1.43;1.43	5.11	5.11	0.69529	.	0.000000	0.38326	N	0.001722	T	0.52741	0.1753	L	0.60455	1.87	0.28014	N	0.934772	D	0.89917	1.0	D	0.87578	0.998	T	0.49513	-0.8932	10	0.87932	D	0	-12.4502	16.3968	0.83610	0.0:0.0:1.0:0.0	.	438	O60269	GRIN2_HUMAN	Q	438	ENSP00000363436:R438Q;ENSP00000363433:R438Q	ENSP00000363433:R438Q	R	+	2	0	GPRIN2	46420199	0.992000	0.36948	0.453000	0.27007	0.751000	0.42716	2.992000	0.49417	2.549000	0.85964	0.561000	0.74099	CGG	.		0.721	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
ZNF503	84858	hgsc.bcm.edu	37	10	77158945	77158945	+	Nonsense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:77158945G>T	ENST00000372524.4	-	2	1989	c.1503C>A	c.(1501-1503)taC>taA	p.Y501*	RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503-AS2_ENST00000466942.2_RNA|ZNF503_ENST00000535216.1_Nonsense_Mutation_p.Y501*	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	501					G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					AGCCGTAGGGGTAGAGGGGGT	0.692																																					p.Y501X		.											.	ZNF503-91	0			c.C1503A						.						18.0	21.0	20.0					10																	77158945		2202	4299	6501	SO:0001587	stop_gained	84858	exon2			GTAGGGGTAGAGG	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.1503C>A	10.37:g.77158945G>T	ENSP00000361602:p.Tyr501*	19	0		67	28	NM_032772	0	0	0	0	0	Q8NAC5|Q96E25|Q96IJ0	Nonsense_Mutation	SNP	ENST00000372524.4	37	CCDS7350.1	.	.	.	.	.	.	.	.	.	.	G	37	6.063130	0.97246	.	.	ENSG00000165655	ENST00000372524;ENST00000535216;ENST00000372516	.	.	.	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-16.9757	10.2934	0.43610	0.0907:0.0:0.9093:0.0	.	.	.	.	X	501;501;464	.	ENSP00000361594:Y464X	Y	-	3	2	ZNF503	76828951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.787000	0.47798	2.139000	0.66308	0.643000	0.83706	TAC	.		0.692	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
CYP2C19	1557	ucsc.edu	37	10	96541616	96541616	+	Silent	SNP	G	G	A	rs4244285	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:96541616G>A	ENST00000371321.3	+	5	763	c.681G>A	c.(679-681)ccG>ccA	p.P227P	CYP2C19_ENST00000464755.1_3'UTR	NM_000769.1	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 19	227			P -> L (in allele CYP2C19*10; dbSNP:rs6413438). {ECO:0000269|PubMed:12464799}.		arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	43		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Acenocoumarol(DB01418)|Acetylsalicylic acid(DB00945)|Adinazolam(DB00546)|Almotriptan(DB00918)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atomoxetine(DB00289)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Benzatropine(DB00245)|Bicalutamide(DB01128)|Bifonazole(DB04794)|Bortezomib(DB00188)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carisoprodol(DB00395)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clevidipine(DB04920)|Clobazam(DB00349)|Clomipramine(DB01242)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diltiazem(DB00343)|Dimethyl sulfoxide(DB01093)|Diphenhydramine(DB01075)|Dopamine(DB00988)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enfuvirtide(DB00109)|Enzalutamide(DB08899)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estradiol(DB00783)|Ethanol(DB00898)|Ethotoin(DB00754)|Etoricoxib(DB01628)|Etravirine(DB06414)|Famotidine(DB00927)|Felbamate(DB00949)|Fluconazole(DB00196)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Gliclazide(DB01120)|Glucosamine(DB01296)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Hexobarbital(DB01355)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Indomethacin(DB00328)|Isoniazid(DB00951)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Lopinavir(DB01601)|Loratadine(DB00455)|Lorcaserin(DB04871)|Losartan(DB00678)|Lovastatin(DB00227)|LULICONAZOLE(DB08933)|Lumiracoxib(DB01283)|MACITENTAN(DB08932)|Melatonin(DB01065)|Memantine(DB01043)|Meprobamate(DB00371)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methsuximide(DB05246)|Methylphenobarbital(DB00849)|Metoprolol(DB00264)|Miconazole(DB01110)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nicotine(DB00184)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Norethindrone(DB00717)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ospemifene(DB04938)|Oxcarbazepine(DB00776)|Oxiconazole(DB00239)|Pantoprazole(DB00213)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Pentobarbital(DB00312)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phensuximide(DB00832)|Phenytoin(DB00252)|Pimozide(DB01100)|Pioglitazone(DB01132)|Pipotiazine(DB01621)|Podofilox(DB01179)|Prasugrel(DB06209)|Praziquantel(DB01058)|Prednisone(DB00635)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propofol(DB00818)|Propranolol(DB00571)|Quazepam(DB01589)|Quetiapine(DB01224)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Telmisartan(DB00966)|Temazepam(DB00231)|Teniposide(DB00444)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Timolol(DB00373)|Tioconazole(DB01007)|Tipranavir(DB00932)|Tofacitinib(DB08895)|Tolbutamide(DB01124)|Tolterodine(DB01036)|Topiramate(DB00273)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zolpidem(DB00425)|Zonisamide(DB00909)	ATTATTTCCCGGGAACCCATA	0.294													G|||	1109	0.221446	0.1702	0.1052	5008	,	,		13926	0.3125		0.1451	False		,,,				2504	0.3579				p.P227P		.											.	CYP2C19-95	0			c.G681A	GRCh37	CS941458	CYP2C19	S	rs4244285	.	G		728,3676	271.9+/-270.5	63,602,1537	50.0	55.0	53.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	681	-8.3	0.0	10	dbSNP_111	53	1276,7322	246.1+/-274.7	98,1080,3121	no	coding-synonymous	CYP2C19	NM_000769.1		161,1682,4658	AA,AG,GG		14.8407,16.5304,15.413		227/491	96541616	2004,10998	2202	4299	6501	SO:0001819	synonymous_variant	1557	exon5			TTTCCCGGGAACC	M61854	CCDS7436.1	10q24	2007-12-14	2003-01-14		ENSG00000165841	ENSG00000165841		"""Cytochrome P450s"""	2621	protein-coding gene	gene with protein product		124020	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 19"""	CYP2C		2009263, 8530044	Standard	NM_000769		Approved	P450IIC19, CPCJ	uc010qnz.2	P33261	OTTHUMG00000018799	ENST00000371321.3:c.681G>A	10.37:g.96541616G>A		91	3		38	4	NM_000769	0	0	0	0	0	P33259|Q8WZB1|Q8WZB2|Q9UCD4	Silent	SNP	ENST00000371321.3	37	CCDS7436.1																																																																																			A|0.170;G|0.830		0.294	CYP2C19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049490.1	NM_000769	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		0	0		15	15	NM_001077494	0	0	0	0	0	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
TRUB1	142940	bcgsc.ca	37	10	116719543	116719543	+	Missense_Mutation	SNP	G	G	A	rs7099565	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:116719543G>A	ENST00000298746.3	+	4	561	c.500G>A	c.(499-501)aGg>aAg	p.R167K	TRUB1_ENST00000485065.1_3'UTR	NM_139169.4	NP_631908.1	Q8WWH5	TRUB1_HUMAN	TruB pseudouridine (psi) synthase family member 1	167			R -> K (in dbSNP:rs7099565). {ECO:0000269|PubMed:14702039}.		pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(2)|kidney(2)|large_intestine(1)|lung(5)|urinary_tract(2)	12		Colorectal(252;0.09)|Breast(234;0.174)|Lung NSC(174;0.245)		Epithelial(162;0.00879)|all cancers(201;0.0243)		TCTACGGGGAGGGTAACAGAA	0.413													A|||	2117	0.422724	0.7844	0.2968	5008	,	,		18735	0.0367		0.4503	False		,,,				2504	0.3926				p.R167K		.											.	TRUB1-90	0			c.G500A						.	A	LYS/ARG	3254,1152	407.1+/-334.1	1216,822,165	87.0	85.0	86.0		500	4.6	1.0	10	dbSNP_116	86	3964,4636	601.9+/-394.4	902,2160,1238	yes	missense	TRUB1	NM_139169.4	26	2118,2982,1403	AA,AG,GG		46.093,26.1462,44.5025	benign	167/350	116719543	7218,5788	2203	4300	6503	SO:0001583	missense	142940	exon4			CGGGGAGGGTAAC	AF448144	CCDS7591.1	10q25.3	2013-09-02	2013-09-02		ENSG00000165832	ENSG00000165832			16060	protein-coding gene	gene with protein product		610726	"""TruB pseudouridine (psi) synthase homolog 1 (E. coli)"""			12736709	Standard	NM_139169		Approved	PUS4	uc001lcd.3	Q8WWH5	OTTHUMG00000019094	ENST00000298746.3:c.500G>A	10.37:g.116719543G>A	ENSP00000298746:p.Arg167Lys	129	0		140	6	NM_139169	0	0	0	0	0	B2R716|Q53ES2	Missense_Mutation	SNP	ENST00000298746.3	37	CCDS7591.1	846	0.3873626373626374	365	0.741869918699187	114	0.3149171270718232	22	0.038461538461538464	345	0.4551451187335092	A	5.009	0.187410	0.09547	0.738538	0.46093	ENSG00000165832	ENST00000298746	T	0.48522	0.81	5.69	4.56	0.56223	Pseudouridine synthase, catalytic domain (1);	0.240920	0.47455	N	0.000229	T	0.00012	0.0000	N	0.01761	-0.735	0.80722	P	0.0	B	0.02656	0.0	B	0.06405	0.002	T	0.45205	-0.9277	9	0.02654	T	1	-6.3728	8.283	0.31910	0.842:0.0:0.158:0.0	rs7099565;rs11543158;rs17325262;rs59183827;rs7099565	167	Q8WWH5	TRUB1_HUMAN	K	167	ENSP00000298746:R167K	ENSP00000298746:R167K	R	+	2	0	TRUB1	116709533	1.000000	0.71417	0.993000	0.49108	0.666000	0.39218	1.997000	0.40786	0.440000	0.26502	-0.254000	0.11334	AGG	G|0.500;A|0.500		0.413	TRUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050504.1	NM_139169	
GFRA1	2674	bcgsc.ca	37	10	117884950	117884950	+	Silent	SNP	G	G	A	rs2245020	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:117884950G>A	ENST00000355422.6	-	6	1102	c.552C>T	c.(550-552)aaC>aaT	p.N184N	GFRA1_ENST00000369236.1_Silent_p.N179N|GFRA1_ENST00000544592.1_Silent_p.N63N|GFRA1_ENST00000439649.3_Silent_p.N179N	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	184					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)	p.N179N(1)		endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		TGCAGACATCGTTGGACACGC	0.602													G|||	2429	0.485024	0.2466	0.6455	5008	,	,		17451	0.5546		0.5467	False		,,,				2504	0.5583				p.N184N	Ovarian(128;329 1725 45498 46808 50759)	.											.	GFRA1-93	1	Substitution - coding silent(1)	stomach(1)	c.C552T						.	G	,,	1396,3010	458.8+/-352.1	226,944,1033	77.0	63.0	68.0		537,552,537	-2.0	0.8	10	dbSNP_100	68	4895,3705	620.0+/-397.0	1392,2111,797	no	coding-synonymous,coding-synonymous,coding-synonymous	GFRA1	NM_001145453.1,NM_005264.4,NM_145793.3	,,	1618,3055,1830	AA,AG,GG		43.0814,31.6841,48.37	,,	179/461,184/466,179/461	117884950	6291,6715	2203	4300	6503	SO:0001819	synonymous_variant	2674	exon6			GACATCGTTGGAC	AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.552C>T	10.37:g.117884950G>A		194	1		318	10	NM_005264	0	0	0	0	0	A8KA21|O15507|O43912	Silent	SNP	ENST00000355422.6	37	CCDS44481.1																																																																																			G|0.520;A|0.480		0.602	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050512.2	NM_145793	
PHRF1	57661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	608465	608465	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:608465G>C	ENST00000264555.5	+	14	3137	c.3009G>C	c.(3007-3009)aaG>aaC	p.K1003N	PHRF1_ENST00000533464.1_Missense_Mutation_p.K999N|PHRF1_ENST00000416188.2_Missense_Mutation_p.K1002N|PHRF1_ENST00000413872.2_Missense_Mutation_p.K1001N	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	1003	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GCAGCAGGAAGAAGGCCAAGA	0.677																																					p.K1002N		.											.	PHRF1-22	0			c.G3006C						.						26.0	32.0	30.0					11																	608465		2130	4246	6376	SO:0001583	missense	57661	exon14			CAGGAAGAAGGCC	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.3009G>C	11.37:g.608465G>C	ENSP00000264555:p.Lys1003Asn	66	0		190	62	NM_020901	0	0	0	0	0	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	37		.	.	.	.	.	.	.	.	.	.	G	13.77	2.335217	0.41398	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.19532	2.14;2.14;2.14;2.14	4.32	3.37	0.38596	.	0.343233	0.21099	N	0.080182	T	0.13030	0.0316	L	0.27053	0.805	0.09310	N	1	P;P;P;P	0.46512	0.807;0.879;0.879;0.807	B;B;B;B	0.41571	0.197;0.36;0.36;0.197	T	0.10613	-1.0622	10	0.41790	T	0.15	-28.686	5.6535	0.17631	0.1603:0.0:0.6785:0.1612	.	999;1001;1002;1003	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	N	1003;1001;1002;999	ENSP00000264555:K1003N;ENSP00000388589:K1001N;ENSP00000410626:K1002N;ENSP00000431870:K999N	ENSP00000264555:K1003N	K	+	3	2	PHRF1	598465	0.999000	0.42202	0.030000	0.17652	0.985000	0.73830	2.957000	0.49137	2.243000	0.73865	0.561000	0.74099	AAG	.		0.677	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
MUC5B	727897	broad.mit.edu	37	11	1267194	1267194	+	Silent	SNP	G	G	C	rs368938736	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:1267194G>C	ENST00000529681.1	+	31	9142	c.9084G>C	c.(9082-9084)acG>acC	p.T3028T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.T3031T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3028	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.|T -> Q (in Ref. 4; CAA96577). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGACCAGCACGGCCACCACAC	0.617													g|||	2	0.000399361	0.0	0.0014	5008	,	,		17228	0.0		0.001	False		,,,				2504	0.0				p.T3028T		.											.	.	0			c.G9084C						.	G		0,4274		0,0,2137	127.0	158.0	148.0		9084	-4.4	0.0	11		148	4,8456		0,4,4226	no	coding-synonymous	MUC5B	NM_002458.2		0,4,6363	CC,CG,GG		0.0473,0.0,0.0314		3028/5763	1267194	4,12730	2137	4230	6367	SO:0001819	synonymous_variant	727897	exon31			CAGCACGGCCACC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9084G>C	11.37:g.1267194G>C		215	1		347	6	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			.		0.617	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KRTAP5-5	439915	broad.mit.edu	37	11	1651157	1651157	+	Frame_Shift_Del	DEL	A	A	-			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:1651157delA	ENST00000399676.2	+	1	125	c.87delA	c.(85-87)ggafs	p.G30fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	30						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggctgtggct	0.711																																					p.G29fs		.											.	KRTAP5-5-23	0			c.87delA						.						25.0	36.0	33.0					11																	1651157		2116	4203	6319	SO:0001589	frameshift_variant	439915	exon1			CTGTGGAGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.87delA	11.37:g.1651157delA	ENSP00000382584:p.Gly30fs	11	0		137	10	NM_001001480	0	0	0	0	0	A8MWN2	Frame_Shift_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.711	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
KRTAP5-5	439915	broad.mit.edu	37	11	1651159	1651169	+	Frame_Shift_Del	DEL	GCTGTGGCTCT	GCTGTGGCTCT	-	rs71454095|rs71454094	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:1651159_1651169delGCTGTGGCTCT	ENST00000399676.2	+	1	127_137	c.89_99delGCTGTGGCTCT	c.(88-99)ggctgtggctctfs	p.GCGS30fs		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	30						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ggctgtggaggctgtggctctggctgtgggg	0.711																																					p.30_33del		.											.	KRTAP5-5-23	0			c.89_99del						.			98,3952		6,86,1933						0.1	0.0			32	211,7787		8,195,3796	no	frameshift	KRTAP5-5	NM_001001480.2		14,281,5729	A1A1,A1R,RR		2.6382,2.4198,2.5647				309,11739				SO:0001589	frameshift_variant	439915	exon1			GTGGAGGCTGTGG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.89_99delGCTGTGGCTCT	11.37:g.1651159_1651169delGCTGTGGCTCT	ENSP00000382584:p.Gly30fs	10	0		134	9	NM_001001480	0	0	0	0	0	A8MWN2	Frame_Shift_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.711	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	TNNI2_ENST00000252898.7_5'Flank|TNNI2_ENST00000381906.1_5'Flank|TNNI2_ENST00000381905.3_5'Flank|SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381911.1_5'Flank|SYT8_ENST00000535046.1_3'UTR	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	1	0		33	28	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
OR52R1	119695	bcgsc.ca	37	11	4825225	4825225	+	Missense_Mutation	SNP	A	A	G	rs7941731	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:4825225A>G	ENST00000356069.2	-	1	385	c.386T>C	c.(385-387)aTc>aCc	p.I129T	MMP26_ENST00000477339.1_Intron|OR52R1_ENST00000380382.1_Missense_Mutation_p.I208T|MMP26_ENST00000380390.1_Intron	NM_001005177.3	NP_001005177.3	Q8NGF1	O52R1_HUMAN	olfactory receptor, family 52, subfamily R, member 1	129			I -> T (in dbSNP:rs7941731). {ECO:0000269|PubMed:14983052, ECO:0000269|Ref.1}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|prostate(1)|skin(3)	29		Medulloblastoma(188;0.0025)|Breast(177;0.0184)|all_neural(188;0.0227)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGGGAAGCAGATAGCCACGTA	0.572													A|||	1549	0.309305	0.5582	0.2795	5008	,	,		21992	0.0129		0.3897	False		,,,				2504	0.2168				p.I129T		.											.	OR52R1-69	0			c.T386C						.	A	THR/ILE	2266,2136	598.9+/-389.2	594,1078,529	127.0	112.0	117.0		386	5.4	1.0	11	dbSNP_116	117	3011,5585	465.5+/-366.5	551,1909,1838	yes	missense	OR52R1	NM_001005177.3	89	1145,2987,2367	GG,GA,AA		35.0279,48.5234,40.5986	probably-damaging	129/316	4825225	5277,7721	2201	4298	6499	SO:0001583	missense	119695	exon1			AAGCAGATAGCCA	BK004282	CCDS31360.1, CCDS31360.2	11p15.4	2012-08-09			ENSG00000176937	ENSG00000176937		"""GPCR / Class A : Olfactory receptors"""	15235	protein-coding gene	gene with protein product							Standard	NM_001005177		Approved		uc021qcs.1	Q8NGF1	OTTHUMG00000066510	ENST00000356069.2:c.386T>C	11.37:g.4825225A>G	ENSP00000348368:p.Ile129Thr	116	0		136	8	NM_001005177	0	0	0	0	0	Q6IFI0	Missense_Mutation	SNP	ENST00000356069.2	37	CCDS31360.2	682	0.31227106227106227	270	0.5487804878048781	117	0.32320441988950277	10	0.017482517482517484	285	0.3759894459102902	A	17.17	3.320491	0.60634	0.514766	0.350279	ENSG00000176937	ENST00000356069;ENST00000380382	T;T	0.59224	0.28;0.28	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000122	T	0.00012	0.0000	H	0.96970	3.915	0.20821	P	0.999840389	D	0.58620	0.983	P	0.51193	0.662	T	0.48175	-0.9058	9	0.72032	D	0.01	.	14.4289	0.67236	1.0:0.0:0.0:0.0	rs7941731;rs52795806;rs7941731	129	Q8NGF1	O52R1_HUMAN	T	129;208	ENSP00000348368:I129T;ENSP00000369742:I208T	ENSP00000348368:I129T	I	-	2	0	OR52R1	4781801	1.000000	0.71417	1.000000	0.80357	0.428000	0.31595	8.942000	0.92970	2.280000	0.76307	0.528000	0.53228	ATC	A|0.629;G|0.371		0.572	OR52R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142183.1	NM_001005177	
NLRP14	338323	bcgsc.ca	37	11	7079038	7079038	+	Missense_Mutation	SNP	G	G	A	rs10839708	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:7079038G>A	ENST00000299481.4	+	7	2768	c.2422G>A	c.(2422-2424)Gag>Aag	p.E808K		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	808			E -> K (in dbSNP:rs10839708). {ECO:0000269|PubMed:16931801}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GCTTTTGTGTGAGGCCTTAAG	0.383													G|||	2834	0.565895	0.3502	0.6124	5008	,	,		21400	0.7063		0.6024	False		,,,				2504	0.6421				p.E808K		.											.	NLRP14-295	0			c.G2422A						.	G	LYS/GLU	1588,2814	492.5+/-362.4	294,1000,907	239.0	213.0	222.0		2422	4.0	1.0	11	dbSNP_120	222	5055,3537	630.7+/-398.4	1502,2051,743	yes	missense	NLRP14	NM_176822.3	56	1796,3051,1650	AA,AG,GG		41.1662,36.0745,48.8764	benign	808/1094	7079038	6643,6351	2201	4296	6497	SO:0001583	missense	338323	exon7			TTGTGTGAGGCCT	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2422G>A	11.37:g.7079038G>A	ENSP00000299481:p.Glu808Lys	190	2		153	12	NM_176822	0	0	0	0	0	Q7RTR6	Missense_Mutation	SNP	ENST00000299481.4	37	CCDS7776.1	1230	0.5631868131868132	173	0.3516260162601626	214	0.5911602209944752	386	0.6748251748251748	457	0.6029023746701847	G	22.4	4.278511	0.80692	0.360745	0.588338	ENSG00000158077	ENST00000299481	T	0.41400	1.0	4.89	3.98	0.46160	.	0.000000	0.44483	D	0.000452	T	0.00012	0.0000	L	0.49699	1.58	0.30466	P	0.773848	P	0.52692	0.955	P	0.53224	0.721	T	0.38520	-0.9657	9	0.28530	T	0.3	.	9.4719	0.38847	0.0996:0.0:0.9004:0.0	rs10839708;rs17280430;rs52825881;rs59059579;rs10839708	808	Q86W24	NAL14_HUMAN	K	808	ENSP00000299481:E808K	ENSP00000299481:E808K	E	+	1	0	NLRP14	7035614	1.000000	0.71417	0.977000	0.42913	0.959000	0.62525	3.157000	0.50716	1.205000	0.43262	0.585000	0.79938	GAG	G|0.472;A|0.528		0.383	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384551.1	NM_176822	
WT1	7490	hgsc.bcm.edu	37	11	32456694	32456694	+	Silent	SNP	C	C	A	rs2234582	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:32456694C>A	ENST00000332351.3	-	1	482	c.198G>T	c.(196-198)ccG>ccT	p.P66P	WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1_ENST00000448076.3_Silent_p.P66P|WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000459866.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	0	Pro-rich.				adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CCATTTGCTGCGGCTCAGACC	0.761			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome				C|||	1511	0.301717	0.6604	0.1556	5008	,	,		5831	0.0675		0.1839	False		,,,				2504	0.2832				p.P66P		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.G198T						.	C	,,	1567,1733		420,727,503	2.0	3.0	3.0		198,198,198	1.2	0.0	11	dbSNP_98	3	1360,5576		235,890,2343	no	coding-synonymous,coding-synonymous,coding-synonymous	WT1	NM_000378.4,NM_024424.3,NM_024426.4	,,	655,1617,2846	AA,AC,CC		19.6078,47.4848,28.5952	,,	66/498,66/515,66/518	32456694	2927,7309	1650	3468	5118	SO:0001819	synonymous_variant	7490	exon1	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	TTGCTGCGGCTCA		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.198G>T	11.37:g.32456694C>A		0	0		7	7	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Silent	SNP	ENST00000332351.3	37	CCDS7878.2																																																																																			C|0.748;A|0.252		0.761	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000095436.2	NM_000378	
OR5AR1	219493	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	56431814	56431814	+	Missense_Mutation	SNP	A	A	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:56431814A>G	ENST00000302969.2	+	1	677	c.653A>G	c.(652-654)tAt>tGt	p.Y218C		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	218						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						TTCATCTCCTATACCTTTATC	0.488																																					p.Y218C		.											.	OR5AR1-68	0			c.A653G						.						167.0	142.0	151.0					11																	56431814		2201	4296	6497	SO:0001583	missense	219493	exon1			TCTCCTATACCTT	AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.653A>G	11.37:g.56431814A>G	ENSP00000302639:p.Tyr218Cys	121	1		142	49	NM_001004730	0	0	0	0	0	Q6IF61	Missense_Mutation	SNP	ENST00000302969.2	37	CCDS31535.1	.	.	.	.	.	.	.	.	.	.	A	14.59	2.582166	0.46006	.	.	ENSG00000172459	ENST00000302969	T	0.00520	6.85	4.91	4.91	0.64330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000591	T	0.02767	0.0083	H	0.95950	3.745	0.35195	D	0.773754	D	0.63046	0.992	P	0.62382	0.901	T	0.05289	-1.0894	10	0.87932	D	0	.	13.8765	0.63655	1.0:0.0:0.0:0.0	.	218	Q8NGP9	O5AR1_HUMAN	C	218	ENSP00000302639:Y218C	ENSP00000302639:Y218C	Y	+	2	0	OR5AR1	56188390	1.000000	0.71417	0.997000	0.53966	0.713000	0.41058	5.244000	0.65400	2.064000	0.61679	0.467000	0.42956	TAT	.		0.488	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334434.1	NM_001004730	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	TM7SF2_ENST00000540748.1_5'UTR|AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		1	0		6	6	NM_003273	0	0	0	0	0	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
KRTAP5-8	57830	broad.mit.edu	37	11	71249275	71249275	+	Silent	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:71249275G>A	ENST00000398534.3	+	1	205	c.174G>A	c.(172-174)ggG>ggA	p.G58G		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	58	9 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						GCTCCAAGGGGGGCCGTGGCT	0.657																																					p.G58G		.											.	KRTAP5-8-44	0			c.G174A						.						90.0	123.0	112.0					11																	71249275		2195	4292	6487	SO:0001819	synonymous_variant	57830	exon1			CAAGGGGGGCCGT	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.174G>A	11.37:g.71249275G>A		95	0		145	15	NM_021046	0	0	0	0	0	Q6L8G7|Q6UTX6	Silent	SNP	ENST00000398534.3	37	CCDS41683.1																																																																																			.		0.657	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
KMT2A	4297	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	118374844	118374844	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr11:118374844G>C	ENST00000389506.5	+	27	8228	c.8228G>C	c.(8227-8229)aGa>aCa	p.R2743T	KMT2A_ENST00000534358.1_Missense_Mutation_p.R2746T|KMT2A_ENST00000354520.4_Missense_Mutation_p.R2705T			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2743					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ATTCCAAAAAGAAATGGTAAA	0.403																																					p.R2746T		.											.	MLL-1255	0			c.G8237C						.						67.0	69.0	68.0					11																	118374844		2200	4296	6496	SO:0001583	missense	4297	exon27			CAAAAAGAAATGG	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.8228G>C	11.37:g.118374844G>C	ENSP00000374157:p.Arg2743Thr	82	0		56	23	NM_001197104	0	0	0	0	0	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	37	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681178	0.47886	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.85861	-2.04;-2.04;-2.0	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.80053	0.4553	L	0.29908	0.895	0.80722	D	1	P;P	0.48407	0.91;0.91	B;B	0.38106	0.265;0.265	T	0.82600	-0.0377	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	2746;2743	E9PQG7;Q03164	.;MLL1_HUMAN	T	2746;2743;2705;1653	ENSP00000436786:R2746T;ENSP00000374157:R2743T;ENSP00000346516:R2705T	ENSP00000346516:R2705T	R	+	2	0	MLL	117880054	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.467000	0.80930	2.941000	0.99782	0.655000	0.94253	AGA	.		0.403	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
ATN1	1822	ucsc.edu	37	12	7045906	7045906	+	Silent	SNP	G	G	A	rs377147612		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr12:7045906G>A	ENST00000356654.4	+	5	1713	c.1476G>A	c.(1474-1476)caG>caA	p.Q492Q	ATN1_ENST00000396684.2_Silent_p.Q492Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	492	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.647																																					p.Q492Q		.											.	ATN1-139	0			c.G1476A						.						43.0	53.0	49.0					12																	7045906		2188	4263	6451	SO:0001819	synonymous_variant	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1476G>A	12.37:g.7045906G>A		82	1		310	38	NM_001007026	0	0	0	0	0	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			.		0.647	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
ATN1	1822	hgsc.bcm.edu	37	12	7045924	7045924	+	Missense_Mutation	SNP	G	G	T	rs199988271		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr12:7045924G>T	ENST00000356654.4	+	5	1731	c.1494G>T	c.(1492-1494)caG>caT	p.Q498H	ATN1_ENST00000396684.2_Missense_Mutation_p.Q498H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	498	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.637																																					p.Q498H		.											.	ATN1-139	0			c.G1494T						.						43.0	53.0	49.0					12																	7045924		2201	4297	6498	SO:0001583	missense	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1494G>T	12.37:g.7045924G>T	ENSP00000349076:p.Gln498His	88	0		307	25	NM_001007026	0	0	0	0	0	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.273578	0.00257	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.56776	0.44;0.44;0.44	1.44	-2.88	0.05682	.	.	.	.	.	T	0.24392	0.0591	N	0.22421	0.69	0.09310	N	1	P	0.40970	0.734	B	0.30401	0.115	T	0.19353	-1.0308	9	0.17832	T	0.49	.	3.3676	0.07208	0.2981:0.2446:0.4573:0.0	.	498	P54259	ATN1_HUMAN	H	498;498;498;83	ENSP00000349076:Q498H;ENSP00000379915:Q498H;ENSP00000441744:Q498H	ENSP00000229279:Q83H	Q	+	3	2	ATN1	6916185	0.175000	0.23083	0.269000	0.24586	0.334000	0.28698	-0.489000	0.06490	-0.760000	0.04677	0.109000	0.15622	CAG	G|0.999;A|0.001		0.637	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
PPM1H	57460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	63131354	63131354	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr12:63131354G>C	ENST00000228705.6	-	5	1182	c.882C>G	c.(880-882)atC>atG	p.I294M		NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	294	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		CTCCATTTCTGATGATTATGG	0.458																																					p.I294M		.											.	PPM1H-637	0			c.C882G						.						49.0	48.0	48.0					12																	63131354		1901	4120	6021	SO:0001583	missense	57460	exon5			ATTTCTGATGATT	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.882C>G	12.37:g.63131354G>C	ENSP00000228705:p.Ile294Met	103	0		159	32	NM_020700	0	0	0	0	0	B1Q2A9|B2RXG4|Q6PI86	Missense_Mutation	SNP	ENST00000228705.6	37	CCDS44934.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318497	0.60524	.	.	ENSG00000111110	ENST00000228705	T	0.17691	2.26	5.75	3.51	0.40186	Protein phosphatase 2C-like (5);	0.150576	0.64402	D	0.000013	T	0.33440	0.0863	M	0.69358	2.11	0.41923	D	0.990524	D	0.57257	0.979	P	0.60345	0.873	T	0.08371	-1.0725	9	.	.	.	1.5853	12.1294	0.53934	0.1753:0.0:0.8247:0.0	.	294	Q9ULR3	PPM1H_HUMAN	M	294	ENSP00000228705:I294M	.	I	-	3	3	PPM1H	61417621	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.811000	0.55620	1.357000	0.45904	0.455000	0.32223	ATC	.		0.458	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	
ACSS3	79611	hgsc.bcm.edu	37	12	81472014	81472014	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr12:81472014G>A	ENST00000548058.1	+	1	1025	c.115G>A	c.(115-117)Gtc>Atc	p.V39I	ACSS3_ENST00000261206.3_Missense_Mutation_p.V39I			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	39						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						GGCTTTAGTGGTCCCGGGCCC	0.726																																					p.V39I		.											.	ACSS3-71	0			c.G115A						.						6.0	7.0	7.0					12																	81472014		2039	4058	6097	SO:0001583	missense	79611	exon1			TTAGTGGTCCCGG		CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.115G>A	12.37:g.81472014G>A	ENSP00000449535:p.Val39Ile	0	0		39	25	NM_024560	0	0	0	0	0	Q8NC66	Missense_Mutation	SNP	ENST00000548058.1	37	CCDS9022.1	.	.	.	.	.	.	.	.	.	.	G	9.905	1.207902	0.22205	.	.	ENSG00000111058	ENST00000548058;ENST00000261206	T;T	0.26373	1.74;1.74	4.35	4.35	0.52113	.	0.450569	0.20230	N	0.096504	T	0.13457	0.0326	N	0.08118	0	0.80722	D	1	B	0.11235	0.004	B	0.19666	0.026	T	0.07908	-1.0748	10	0.37606	T	0.19	-10.9919	9.6228	0.39732	0.0:0.0:0.7917:0.2083	.	39	Q9H6R3	ACSS3_HUMAN	I	39	ENSP00000449535:V39I;ENSP00000261206:V39I	ENSP00000261206:V39I	V	+	1	0	ACSS3	79996145	1.000000	0.71417	0.993000	0.49108	0.026000	0.11368	2.873000	0.48475	2.258000	0.74832	0.563000	0.77884	GTC	.		0.726	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407794.1	NM_024560	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000549752.1_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	0	0		8	8	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
TMEM119	338773	hgsc.bcm.edu	37	12	108986112	108986112	+	Silent	SNP	G	G	C	rs10861953	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr12:108986112G>C	ENST00000392806.3	-	2	216	c.48C>G	c.(46-48)ctC>ctG	p.L16L		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	16					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						CAGACCCCAGGAGCAGCAACA	0.662													G|||	986	0.196885	0.1384	0.1297	5008	,	,		16113	0.256		0.1759	False		,,,				2504	0.2843				p.L16L		.											.	TMEM119-69	0			c.C48G						.	G		571,3727		46,479,1624	10.0	11.0	11.0		48	0.4	0.1	12	dbSNP_120	11	1365,6937		115,1135,2901	no	coding-synonymous	TMEM119	NM_181724.2		161,1614,4525	CC,CG,GG		16.4418,13.2852,15.3651		16/284	108986112	1936,10664	2149	4151	6300	SO:0001819	synonymous_variant	338773	exon2			CCCCAGGAGCAGC	AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.48C>G	12.37:g.108986112G>C		2	0		8	5	NM_181724	0	0	0	0	0	Q6UXE5|Q8N2F5	Silent	SNP	ENST00000392806.3	37	CCDS9119.1																																																																																			G|0.822;C|0.178		0.662	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403900.1	NM_181724	
IQCD	115811	broad.mit.edu	37	12	113633505	113633505	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr12:113633505C>A	ENST00000416617.2	-	5	1415	c.1225G>T	c.(1225-1227)Gcc>Tcc	p.A409S	IQCD_ENST00000299732.2_Missense_Mutation_p.A307S			Q96DY2	IQCD_HUMAN	IQ motif containing D	409	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.									endometrium(2)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						TTCCATAGGGCCTGGATGAGC	0.582																																					p.A307S		.											.	IQCD-91	0			c.G919T						.						161.0	142.0	149.0					12																	113633505		2203	4300	6503	SO:0001583	missense	115811	exon3			ATAGGGCCTGGAT	BC013151	CCDS9167.1	12q24.21	2014-07-18				ENSG00000166578			25168	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 10"""					23427265, 24804578	Standard	NM_138451		Approved	DRC10, CFAP84	uc001tuu.3	Q96DY2		ENST00000416617.2:c.1225G>T	12.37:g.113633505C>A	ENSP00000400669:p.Ala409Ser	111	0		167	6	NM_138451	0	0	0	0	0	Q6ZSU0	Missense_Mutation	SNP	ENST00000416617.2	37		.	.	.	.	.	.	.	.	.	.	C	12.93	2.084743	0.36758	.	.	ENSG00000166578	ENST00000299732;ENST00000416617	T;T	0.27557	1.66;1.66	4.28	4.28	0.50868	.	.	.	.	.	T	0.43411	0.1246	.	.	.	0.80722	D	1	D	0.56287	0.975	D	0.66716	0.946	T	0.16070	-1.0415	8	0.09084	T	0.74	-5.2174	15.6415	0.77006	0.0:1.0:0.0:0.0	.	307	Q96DY2-2	.	S	307;409	ENSP00000299732:A307S;ENSP00000400669:A409S	ENSP00000299732:A307S	A	-	1	0	IQCD	112117888	1.000000	0.71417	0.997000	0.53966	0.062000	0.15995	3.592000	0.53993	2.216000	0.71823	0.561000	0.74099	GCC	.		0.582	IQCD-004	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000405327.1	NM_138451	
LINC00283	100874057	bcgsc.ca	37	13	103392709	103392709	+	RNA	SNP	A	A	T	rs79592880	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr13:103392709A>T	ENST00000430111.1	+	0	0									long intergenic non-protein coding RNA 283																		TGCTTAGCTGATCTGCAGAAA	0.408													A|||	442	0.0882588	0.0817	0.0706	5008	,	,		20545	0.0139		0.1252	False		,,,				2504	0.1483				p.D3446E		.											.	.	0			c.T10338A						.	A	GLU/ASP	114,1270		6,102,584	78.0	60.0	66.0		10338	-2.2	0.0	13	dbSNP_132	66	380,2800		22,336,1232	yes	missense	CCDC168	NM_001146197.1	45	28,438,1816	TT,TA,AA		11.9497,8.237,10.8238		3446/7082	103392709	494,4070	692	1590	2282			643677	exon4			TAGCTGATCTGCA			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103392709A>T		119	0		61	5	NM_001146197	0	0	0	0	0		Missense_Mutation	SNP	ENST00000430111.1	37																																																																																				A|0.921;T|0.079		0.408	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000338450.7_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000333219.7_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		0	0		5	5	NM_005537	0	0	0	0	0	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		8	0		64	3	NM_080687	0	0	0	0	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
ACIN1	22985	bcgsc.ca	37	14	23549319	23549319	+	Missense_Mutation	SNP	A	A	G	rs1885097	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:23549319A>G	ENST00000262710.1	-	6	1726	c.1399T>C	c.(1399-1401)Tct>Cct	p.S467P	ACIN1_ENST00000605057.1_Missense_Mutation_p.S409P|ACIN1_ENST00000555053.1_Missense_Mutation_p.S467P|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000457657.1_Missense_Mutation_p.S427P	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	467			S -> P (in dbSNP:rs1885097).		apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		GTATGCTGAGATACTAATAGC	0.502													A|||	2145	0.428315	0.4796	0.3573	5008	,	,		19842	0.3948		0.3777	False		,,,				2504	0.4959				p.S467P		.											.	ACIN1-156	0			c.T1399C						.	A	PRO/SER,PRO/SER,PRO/SER	2251,2155	594.5+/-388.2	573,1105,525	82.0	83.0	83.0		1399,1279,1399	-0.3	0.1	14	dbSNP_92	83	3540,5060	515.2+/-378.5	720,2100,1480	yes	missense,missense,missense	ACIN1	NM_001164814.1,NM_001164815.1,NM_014977.3	74,74,74	1293,3205,2005	GG,GA,AA		41.1628,48.9106,44.5256	probably-damaging,probably-damaging,probably-damaging	467/1329,427/1302,467/1342	23549319	5791,7215	2203	4300	6503	SO:0001583	missense	22985	exon6			GCTGAGATACTAA	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1399T>C	14.37:g.23549319A>G	ENSP00000262710:p.Ser467Pro	126	1		168	7	NM_001164814	0	0	0	0	0	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	855	0.3914835164835165	224	0.45528455284552843	132	0.36464088397790057	225	0.39335664335664333	274	0.36147757255936674	A	4.892	0.165752	0.09339	0.510894	0.411628	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.23552	1.9;1.9;1.9	4.98	-0.281	0.12882	.	0.414184	0.17971	N	0.155860	T	0.00012	0.0000	L	0.27053	0.805	0.58432	P	4.000000000004E-6	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.09377	0.004;0.002;0.003	T	0.45381	-0.9265	9	0.66056	D	0.02	-0.0141	7.1604	0.25661	0.3736:0.4839:0.0:0.1426	rs1885097;rs3751502;rs52814928;rs58085304;rs1885097	467;467;427	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	P	467;427;467	ENSP00000262710:S467P;ENSP00000405677:S427P;ENSP00000451328:S467P	ENSP00000262710:S467P	S	-	1	0	ACIN1	22619159	0.012000	0.17670	0.091000	0.20842	0.901000	0.52897	-0.216000	0.09266	-0.196000	0.10366	0.528000	0.53228	TCT	A|0.565;G|0.435		0.502	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
IL25	64806	broad.mit.edu	37	14	23845057	23845058	+	Frame_Shift_Del	DEL	TG	TG	-	rs569851542		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:23845057_23845058delTG	ENST00000329715.2	+	2	760_761	c.502_503delTG	c.(502-504)tgtfs	p.C168fs	IL25_ENST00000397242.2_Frame_Shift_Del_p.C152fs|CMTM5_ENST00000339180.4_5'Flank|CMTM5_ENST00000359320.3_5'Flank|CMTM5_ENST00000397227.3_5'Flank|CMTM5_ENST00000382809.2_5'Flank|CMTM5_ENST00000555731.1_5'Flank|CMTM5_ENST00000342473.4_5'Flank	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	168					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		TTCCTTAGCTTGTGTGTGTGTG	0.604																																					p.168_168del		.											.	IL25-91	0			c.502_503del						.																																			SO:0001589	frameshift_variant	64806	exon2			TTAGCTTGTGTGT	AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.502_503delTG	14.37:g.23845067_23845068delTG	ENSP00000328111:p.Cys168fs	222	0		449	8	NM_022789	0	0	0	0	0	Q2M3F0|Q8IZV3|Q8WXB0	Frame_Shift_Del	DEL	ENST00000329715.2	37	CCDS9597.1																																																																																			.		0.604	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071789.2		
C14orf159	80017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	91647656	91647656	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:91647656C>A	ENST00000523771.1	+	8	1445	c.842C>A	c.(841-843)cCt>cAt	p.P281H	C14orf159_ENST00000428926.2_Missense_Mutation_p.P281H|C14orf159_ENST00000523816.1_Missense_Mutation_p.P281H|C14orf159_ENST00000412671.2_Missense_Mutation_p.P286H|C14orf159_ENST00000518868.1_Missense_Mutation_p.P286H|C14orf159_ENST00000256324.10_Missense_Mutation_p.P286H|C14orf159_ENST00000525393.2_Missense_Mutation_p.P157H|C14orf159_ENST00000520328.1_Missense_Mutation_p.P269H|C14orf159_ENST00000522322.1_Missense_Mutation_p.P281H|C14orf159_ENST00000521077.2_Missense_Mutation_p.P286H			Q7Z3D6	CN159_HUMAN	chromosome 14 open reading frame 159	281						mitochondrion (GO:0005739)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0191)|all_epithelial(191;0.241)		Epithelial(152;0.141)|OV - Ovarian serous cystadenocarcinoma(161;0.207)		TCCCAAGATCCTCTGCACTAC	0.498																																					p.P286H		.											.	C14orf159-92	0			c.C857A						.						91.0	83.0	86.0					14																	91647656		2203	4300	6503	SO:0001583	missense	80017	exon8			AAGATCCTCTGCA	AK097294	CCDS32141.1, CCDS41979.1, CCDS45150.1, CCDS66693.1, CCDS73677.1	14q32.11	2012-09-26			ENSG00000133943	ENSG00000133943			20498	protein-coding gene	gene with protein product							Standard	NM_001102367		Approved	FLJ39975	uc001xze.2	Q7Z3D6	OTTHUMG00000164980	ENST00000523771.1:c.842C>A	14.37:g.91647656C>A	ENSP00000429655:p.Pro281His	57	0		78	22	NM_001102368	0	0	0	0	0	B3KUI7|Q86SW3|Q86SX8|Q86SX9|Q86T08|Q86TV5|Q96GW5|Q9H7G0|Q9H8Y9|Q9H9W6	Missense_Mutation	SNP	ENST00000523771.1	37	CCDS32141.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372617	0.82573	.	.	ENSG00000133943	ENST00000520328;ENST00000256324;ENST00000521077;ENST00000518868;ENST00000523816;ENST00000517518;ENST00000525393;ENST00000428926;ENST00000522322;ENST00000523771;ENST00000412671	T;T;T;T;T;T;T;T;T;T;T	0.56941	0.8;1.31;0.82;1.31;1.3;0.43;1.14;1.3;1.3;1.3;1.31	5.19	5.19	0.71726	.	0.061940	0.64402	D	0.000003	T	0.73845	0.3639	M	0.75264	2.295	0.58432	D	0.999992	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.85130	0.992;0.997;0.992;0.995;0.996;0.995	T	0.77321	-0.2631	10	0.87932	D	0	.	18.7132	0.91666	0.0:1.0:0.0:0.0	.	281;157;286;269;286;286	Q7Z3D6;Q8NB88;B3KVU6;Q7Z3D6-5;Q7Z3D6-2;Q7Z3D6-3	CN159_HUMAN;.;.;.;.;.	H	269;286;286;286;281;286;157;281;281;281;286	ENSP00000429453:P269H;ENSP00000256324:P286H;ENSP00000430137:P286H;ENSP00000428263:P286H;ENSP00000428974:P281H;ENSP00000428652:P286H;ENSP00000435459:P157H;ENSP00000404343:P281H;ENSP00000427953:P281H;ENSP00000429655:P281H;ENSP00000404196:P286H	ENSP00000256324:P286H	P	+	2	0	C14orf159	90717409	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	4.936000	0.63506	2.435000	0.82474	0.462000	0.41574	CCT	.		0.498	C14orf159-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381273.1	NM_024952	
ATG2B	55102	bcgsc.ca	37	14	96795839	96795839	+	Silent	SNP	A	A	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:96795839A>G	ENST00000359933.4	-	12	2756	c.1863T>C	c.(1861-1863)gtT>gtC	p.V621V		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	621					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AGTGAGGAGGAACAGAATGAA	0.313																																					p.V621V		.											.	ATG2B-93	0			c.T1863C						.						99.0	94.0	96.0					14																	96795839		1809	4072	5881	SO:0001819	synonymous_variant	55102	exon12			AGGAGGAACAGAA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.1863T>C	14.37:g.96795839A>G		68	1		59	4	NM_018036	0	0	0	0	0	Q6ZRE7|Q96DQ3|Q9NW80	Silent	SNP	ENST00000359933.4	37	CCDS9944.2																																																																																			.		0.313	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	0	0		17	15	NM_001127258	0	0	0	0	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
EXOC3L4	91828	hgsc.bcm.edu	37	14	103568729	103568729	+	Silent	SNP	A	A	G	rs10142200	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:103568729A>G	ENST00000380069.3	+	2	745	c.669A>G	c.(667-669)gaA>gaG	p.E223E		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	223					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						CGGAGGAGGAAGCCCACCCTT	0.756													G|||	2646	0.528355	0.5666	0.5303	5008	,	,		12079	0.6042		0.3917	False		,,,				2504	0.5378				p.E223E		.											.	EXOC3L4-23	0			c.A669G						.	G		2098,2000		603,892,554	5.0	5.0	5.0		669	2.5	0.8	14	dbSNP_119	5	2949,5055		663,1623,1716	no	coding-synonymous	EXOC3L4	NM_001077594.1		1266,2515,2270	GG,GA,AA		36.8441,48.8043,41.7039		223/723	103568729	5047,7055	2049	4002	6051	SO:0001819	synonymous_variant	91828	exon2			GGAGGAAGCCCAC	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.669A>G	14.37:g.103568729A>G		0	0		6	5	NM_001077594	0	0	0	0	0	Q14CR2	Silent	SNP	ENST00000380069.3	37	CCDS32163.1																																																																																			A|0.486;G|0.514		0.756	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		0	0		9	9	NM_001823	0	0	0	0	0	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
AHNAK2	113146	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	105414374	105414374	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:105414374C>G	ENST00000333244.5	-	7	7533	c.7414G>C	c.(7414-7416)Gcg>Ccg	p.A2472P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2472						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCTTGTCCGCCACAGACAGG	0.622																																					p.A2472P		.											.	AHNAK2-47	0			c.G7414C						.						129.0	151.0	144.0					14																	105414374		2062	4203	6265	SO:0001583	missense	113146	exon7			TGTCCGCCACAGA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7414G>C	14.37:g.105414374C>G	ENSP00000353114:p.Ala2472Pro	129	0		172	60	NM_138420	0	0	0	0	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	4.951	0.176728	0.09443	.	.	ENSG00000185567	ENST00000333244	T	0.00700	5.82	3.51	3.51	0.40186	.	.	.	.	.	T	0.01489	0.0048	N	0.17631	0.505	0.09310	N	1	D	0.76494	0.999	D	0.80764	0.994	T	0.60073	-0.7334	9	0.29301	T	0.29	.	6.9483	0.24530	0.0:0.8673:0.0:0.1327	.	2472	Q8IVF2	AHNK2_HUMAN	P	2472	ENSP00000353114:A2472P	ENSP00000353114:A2472P	A	-	1	0	AHNAK2	104485419	0.000000	0.05858	0.006000	0.13384	0.005000	0.04900	0.113000	0.15499	1.521000	0.48983	0.485000	0.47835	GCG	.		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
TMEM121	80757	hgsc.bcm.edu	37	14	105996119	105996119	+	Silent	SNP	C	C	T	rs79647036	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr14:105996119C>T	ENST00000392519.2	+	2	1112	c.948C>T	c.(946-948)ccC>ccT	p.P316P	TMEM121_ENST00000431372.1_Silent_p.P316P	NM_025268.2	NP_079544.1	Q9BTD3	TM121_HUMAN	transmembrane protein 121	316	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(2)|lung(1)	3		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.0959)|all cancers(159;0.235)		CGCGTGACCCCCTGGACACGT	0.781													c|||	471	0.0940495	0.0008	0.0	5008	,	,		11345	0.4216		0.0	False		,,,				2504	0.046				p.P316P		.											.	TMEM121-90	0			c.C948T						.																																			SO:0001819	synonymous_variant	80757	exon2			TGACCCCCTGGAC		CCDS10006.1	14q32.33	2006-02-16			ENSG00000184986	ENSG00000184986			20511	protein-coding gene	gene with protein product						12204283	Standard	NM_025268		Approved	MGC4659, hole	uc001yrp.1	Q9BTD3	OTTHUMG00000029912	ENST00000392519.2:c.948C>T	14.37:g.105996119C>T		0	0		4	4	NM_025268	0	0	0	0	0		Silent	SNP	ENST00000392519.2	37	CCDS10006.1																																																																																			C|0.912;T|0.088		0.781	TMEM121-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074621.2	NM_025268	
HERC2	8924	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	28510816	28510816	+	Silent	SNP	G	G	A	rs139612007	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr15:28510816G>A	ENST00000261609.7	-	14	1926	c.1818C>T	c.(1816-1818)atC>atT	p.I606I		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		ACGCCACATCGATGACCTTCA	0.577													G|||	4	0.000798722	0.0	0.0029	5008	,	,		20571	0.0		0.001	False		,,,				2504	0.001				p.I606I		.											.	HERC2-234	0			c.C1818T						.						203.0	135.0	158.0					15																	28510816		2203	4300	6503	SO:0001819	synonymous_variant	8924	exon14			CACATCGATGACC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1818C>T	15.37:g.28510816G>A		182	1		255	106	NM_004667	0	0	0	0	0		Silent	SNP	ENST00000261609.7	37	CCDS10021.1																																																																																			G|0.999;A|0.001		0.577	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
TYRO3	7301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41853473	41853473	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr15:41853473C>T	ENST00000263798.3	+	2	497	c.273C>T	c.(271-273)atC>atT	p.I91I	TYRO3_ENST00000559066.1_Silent_p.I46I	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	91	Ig-like C2-type 1.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AGTTGTACATCCCAGTCAGCG	0.617																																					p.I91I		.											.	TYRO3-1388	0			c.C273T						.						73.0	67.0	69.0					15																	41853473		2203	4300	6503	SO:0001819	synonymous_variant	7301	exon2			GTACATCCCAGTC	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.273C>T	15.37:g.41853473C>T		88	0		153	65	NM_006293	0	0	0	0	0	O14953|Q86VR3	Silent	SNP	ENST00000263798.3	37	CCDS10080.1																																																																																			.		0.617	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		11	11	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
ST20	400410	bcgsc.ca	37	15	80191343	80191343	+	Missense_Mutation	SNP	G	G	A	rs7257	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr15:80191343G>A	ENST00000478497.1	-	3	849	c.170C>T	c.(169-171)cCa>cTa	p.P57L	ST20_ENST00000485386.1_Missense_Mutation_p.P57L|ST20-MTHFS_ENST00000479961.1_Intron|ST20_ENST00000562759.1_Missense_Mutation_p.P57L|MTHFS_ENST00000559722.1_5'Flank|ST20-MTHFS_ENST00000494999.1_Intron|MTHFS_ENST00000258874.3_5'Flank	NM_001100879.1	NP_001094349.1	Q9HBF5	ST20_HUMAN	suppressor of tumorigenicity 20	57			P -> L (in dbSNP:rs7257). {ECO:0000269|PubMed:11857354}.		extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)	mitochondrial outer membrane (GO:0005741)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						TTCACAATATGGAGTGTCCTT	0.383													G|||	2099	0.419129	0.3306	0.4035	5008	,	,		16029	0.3085		0.5179	False		,,,				2504	0.5624				p.P57L		.											.	ST20-68	0			c.C170T						.	G	,LEU/PRO,LEU/PRO,LEU/PRO	1524,2882	479.2+/-358.4	264,996,943	116.0	115.0	115.0		,170,170,170	-0.6	0.0	15	dbSNP_52	115	4789,3811	611.0+/-395.8	1363,2063,874	yes	intron,missense,missense,missense	ST20,ST20-MTHFS	NM_001199760.1,NM_001199757.1,NM_001100880.2,NM_001100879.1	,98,98,98	1627,3059,1817	AA,AG,GG		44.314,34.5892,48.5391	,benign,benign,benign	,57/80,57/80,57/80	80191343	6313,6693	2203	4300	6503	SO:0001583	missense	400410	exon3			CAATATGGAGTGT	AF249277	CCDS42067.1	15q25.1	2007-07-16				ENSG00000180953			33520	protein-coding gene	gene with protein product							Standard	NM_001100879		Approved	HCCS-1		Q9HBF5		ENST00000478497.1:c.170C>T	15.37:g.80191343G>A	ENSP00000453502:p.Pro57Leu	256	1		207	7	NM_001199757	0	0	0	0	0		Missense_Mutation	SNP	ENST00000478497.1	37	CCDS42067.1	880	0.40293040293040294	152	0.3089430894308943	162	0.44751381215469616	161	0.28146853146853146	405	0.5343007915567283	G	11.35	1.611857	0.28712	0.345892	0.55686	ENSG00000180953	ENST00000322484;ENST00000417278	.	.	.	1.53	-0.622	0.11560	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.13594	0.008	B	0.06405	0.002	T	0.44937	-0.9295	6	0.02654	T	1	.	2.7749	0.05345	0.2087:0.3048:0.4864:0.0	rs7257;rs707187;rs3169168;rs3784763;rs7257	57	Q9HBF5	ST20_HUMAN	L	57	.	ENSP00000319125:P57L	P	-	2	0	ST20	77978398	0.000000	0.05858	0.000000	0.03702	0.730000	0.41778	-0.851000	0.04313	-0.178000	0.10672	0.205000	0.17691	CCA	G|0.590;A|0.410		0.383	ST20-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416728.2		
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	NME3_ENST00000563498.1_5'Flank|MRPS34_ENST00000397375.2_5'Flank|NME3_ENST00000219302.3_5'Flank|EME2_ENST00000307394.7_Silent_p.V72V|MRPS34_ENST00000177742.3_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		0	0		16	9	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	0	0		17	16	NM_178167	0	0	0	0	0	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
TSC2	7249	broad.mit.edu;bcgsc.ca	37	16	2136869	2136869	+	Missense_Mutation	SNP	C	C	G	rs137854272		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:2136869C>G	ENST00000219476.3	+	38	5616	c.4986C>G	c.(4984-4986)atC>atG	p.I1662M	TSC2_ENST00000401874.2_Missense_Mutation_p.I1595M|TSC2_ENST00000350773.4_Missense_Mutation_p.I1639M|TSC2_ENST00000568454.1_Missense_Mutation_p.I1606M|TSC2_ENST00000439673.2_Missense_Mutation_p.I1559M|TSC2_ENST00000353929.4_Missense_Mutation_p.I1619M|TSC2_ENST00000382538.6_Missense_Mutation_p.I1547M	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1662	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				TTGGCACCATCAAGGTGAGTG	0.617			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.I1662M		.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2-1908	0			c.C4986G						.						50.0	37.0	42.0					16																	2136869		2188	4287	6475	SO:0001583	missense	7249	exon38	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CACCATCAAGGTG	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4986C>G	16.37:g.2136869C>G	ENSP00000219476:p.Ile1662Met	69	0		254	12	NM_000548	0	0	0	0	0	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.288343	0.40494	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	D;D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92;-3.92	5.23	2.19	0.27852	Rap/ran-GAP (2);	0.060509	0.64402	D	0.000006	D	0.96500	0.8858	M	0.76328	2.33	0.44123	D	0.996904	D;D;D;D;D;D;D	0.76494	0.998;0.997;0.999;0.979;0.997;0.997;0.999	D;D;D;D;D;D;D	0.80764	0.993;0.993;0.994;0.936;0.988;0.988;0.991	D	0.94570	0.7770	10	0.87932	D	0	-29.1193	6.1382	0.20245	0.1377:0.6418:0.0:0.2205	.	1547;1559;1639;437;1618;1595;1662	B4DIL8;P49815-6;P49815-4;B3KSR9;P49815-3;P49815-5;P49815	.;.;.;.;.;.;TSC2_HUMAN	M	1662;1596;1619;1559;1547;1639	ENSP00000219476:I1662M;ENSP00000248099:I1619M;ENSP00000399232:I1559M;ENSP00000371978:I1547M;ENSP00000344383:I1639M	ENSP00000219476:I1662M	I	+	3	3	TSC2	2076870	0.998000	0.40836	0.995000	0.50966	0.344000	0.29017	0.631000	0.24568	0.210000	0.20664	0.549000	0.68633	ATC	.		0.617	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000536379.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		0	0		21	17	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
RRN3	54700	broad.mit.edu	37	16	15188060	15188060	+	Missense_Mutation	SNP	G	G	A	rs201504364		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:15188060G>A	ENST00000198767.6	-	1	114	c.31C>T	c.(31-33)Ccg>Tcg	p.P11S	RRN3_ENST00000429751.2_Missense_Mutation_p.P11S|RP11-72I8.1_ENST00000569858.1_RNA|RRN3_ENST00000563559.1_Missense_Mutation_p.P11S|RRN3_ENST00000327307.7_5'Flank|RRN3_ENST00000564131.1_Missense_Mutation_p.P11S|PDXDC1_ENST00000535621.2_Intron	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	11					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.P11S(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						GCATCTCCCGGCAAACGCGTG	0.637																																					p.P11S		.											.	RRN3-91	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C31T						.						15.0	14.0	14.0					16																	15188060		2193	4294	6487	SO:0001583	missense	54700	exon1			CTCCCGGCAAACG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.31C>T	16.37:g.15188060G>A	ENSP00000198767:p.Pro11Ser	108	0		399	13	NM_018427	0	0	0	0	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323150	0.24080	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.46819	1.02;0.86	3.13	0.948	0.19561	.	.	.	.	.	T	0.19485	0.0468	N	0.08118	0	0.09310	N	0.999994	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.26538	-1.0100	9	0.06494	T	0.89	.	3.8332	0.08883	0.1556:0.2546:0.5898:0.0	.	11;11;11	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	S	11	ENSP00000198767:P11S;ENSP00000402027:P11S	ENSP00000198767:P11S	P	-	1	0	RRN3	15095561	0.001000	0.12720	0.003000	0.11579	0.038000	0.13279	0.733000	0.26087	0.121000	0.18284	0.305000	0.20034	CCG	G|0.997;A|0.003		0.637	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
RRN3	54700	broad.mit.edu	37	16	15188066	15188066	+	Missense_Mutation	SNP	G	G	A	rs200006712		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:15188066G>A	ENST00000198767.6	-	1	108	c.25C>T	c.(25-27)Cgt>Tgt	p.R9C	RRN3_ENST00000429751.2_Missense_Mutation_p.R9C|RP11-72I8.1_ENST00000569858.1_RNA|RRN3_ENST00000563559.1_Missense_Mutation_p.R9C|RRN3_ENST00000327307.7_5'Flank|RRN3_ENST00000564131.1_Missense_Mutation_p.R9C|PDXDC1_ENST00000535621.2_Intron	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	9					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.R9C(3)		NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CCCGGCAAACGCGTGTGAAGC	0.642																																					p.R9C		.											.	RRN3-91	3	Substitution - Missense(3)	lung(1)|prostate(1)|central_nervous_system(1)	c.C25T						.						15.0	13.0	14.0					16																	15188066		2194	4290	6484	SO:0001583	missense	54700	exon1			GCAAACGCGTGTG	AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.25C>T	16.37:g.15188066G>A	ENSP00000198767:p.Arg9Cys	104	0		392	14	NM_018427	0	0	0	0	0	A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	ENST00000198767.6	37	CCDS10559.1	.	.	.	.	.	.	.	.	.	.	.	18.86	3.712820	0.68730	.	.	ENSG00000085721	ENST00000198767;ENST00000429751	T;T	0.59906	0.68;0.23	3.13	3.13	0.36017	.	.	.	.	.	T	0.59032	0.2164	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77557	0.988;0.99;0.982	T	0.62627	-0.6814	9	0.87932	D	0	.	9.8894	0.41281	0.0:0.0:1.0:0.0	.	9;9;9	F5H148;Q3MHU9;Q9NYV6	.;.;RRN3_HUMAN	C	9	ENSP00000198767:R9C;ENSP00000402027:R9C	ENSP00000198767:R9C	R	-	1	0	RRN3	15095567	1.000000	0.71417	0.965000	0.40720	0.035000	0.12851	2.717000	0.47227	1.752000	0.51891	0.305000	0.20034	CGT	G|0.997;A|0.003		0.642	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252087.2	NM_018427	
TMC5	79838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	19451450	19451450	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:19451450G>T	ENST00000396229.2	+	3	839	c.90G>T	c.(88-90)ttG>ttT	p.L30F	TMC5_ENST00000381414.4_Missense_Mutation_p.L30F|TMC5_ENST00000542583.2_Missense_Mutation_p.L30F|TMC5_ENST00000541464.1_Missense_Mutation_p.L30F	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	30					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						AGGGGTATTTGAAAACTCAAG	0.498																																					p.L30F		.											.	TMC5-91	0			c.G90T						.						98.0	95.0	96.0					16																	19451450		1876	4110	5986	SO:0001583	missense	79838	exon3			GTATTTGAAAACT	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.90G>T	16.37:g.19451450G>T	ENSP00000379531:p.Leu30Phe	73	0		134	37	NM_001105249	0	0	0	0	0	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548565	0.45383	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583	T;T;T;T	0.75260	-0.59;-0.7;-0.92;-0.92	5.0	-0.642	0.11486	.	2586.520000	0.00166	N	0.000000	T	0.79353	0.4431	L	0.57536	1.79	0.09310	N	1	P;P;P	0.43231	0.801;0.771;0.616	P;B;B	0.51833	0.681;0.424;0.342	T	0.63589	-0.6603	10	0.49607	T	0.09	-0.0121	8.0602	0.30629	0.4711:0.0:0.5289:0.0	.	30;30;30	F5GYU8;Q6UXY8;Q6UXY8-2	.;TMC5_HUMAN;.	F	30	ENSP00000441227:L30F;ENSP00000370822:L30F;ENSP00000379531:L30F;ENSP00000446274:L30F	ENSP00000370822:L30F	L	+	3	2	TMC5	19358951	0.009000	0.17119	0.036000	0.18154	0.036000	0.12997	0.810000	0.27183	0.013000	0.14918	-0.302000	0.09304	TTG	.		0.498	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
TMC5	79838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	19488768	19488768	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:19488768C>G	ENST00000396229.2	+	13	2846	c.2097C>G	c.(2095-2097)atC>atG	p.I699M	TMC5_ENST00000381414.4_Missense_Mutation_p.I699M|TMC5_ENST00000542583.2_Missense_Mutation_p.I699M|TMC5_ENST00000219821.5_Missense_Mutation_p.I453M|TMC5_ENST00000561503.1_Missense_Mutation_p.I340M|TMC5_ENST00000541464.1_Missense_Mutation_p.I647M|TMC5_ENST00000564959.1_Missense_Mutation_p.I382M|CTA-363E6.6_ENST00000561762.1_RNA	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	699					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TTAGAAACATCTTTTTGAAAA	0.393																																					p.I699M		.											.	TMC5-91	0			c.C2097G						.						211.0	198.0	202.0					16																	19488768		2197	4300	6497	SO:0001583	missense	79838	exon13			AAACATCTTTTTG	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2097C>G	16.37:g.19488768C>G	ENSP00000379531:p.Ile699Met	152	0		211	50	NM_001105249	0	0	0	0	0	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	37	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.787343	0.31593	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.68025	-0.3;0.63;0.63;0.63;0.63	4.33	3.08	0.35506	.	0.065779	0.64402	D	0.000008	T	0.71195	0.3311	M	0.72118	2.19	0.32253	N	0.571114	D;B;D;P;D;D	0.60160	0.987;0.188;0.973;0.954;0.978;0.987	P;B;P;P;P;P	0.59889	0.865;0.076;0.822;0.668;0.736;0.865	T	0.73388	-0.3998	10	0.39692	T	0.17	-14.7775	4.0747	0.09899	0.1985:0.5766:0.0:0.2249	.	647;382;453;453;699;699	F5GYU8;E7EU57;Q6UXY8-3;B3KUQ8;Q6UXY8;Q6UXY8-2	.;.;.;.;TMC5_HUMAN;.	M	647;699;699;699;453;382	ENSP00000441227:I647M;ENSP00000370822:I699M;ENSP00000379531:I699M;ENSP00000446274:I699M;ENSP00000219821:I453M	ENSP00000219821:I453M	I	+	3	3	TMC5	19396269	0.630000	0.27155	0.998000	0.56505	0.206000	0.24218	-0.011000	0.12721	2.112000	0.64535	0.655000	0.94253	ATC	.		0.393	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
GGA2	23062	hgsc.bcm.edu	37	16	23521643	23521643	+	Splice_Site	SNP	G	G	C	rs17844840|rs1071685	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:23521643G>C	ENST00000309859.4	-	1	172	c.90C>G	c.(88-90)ctC>ctG	p.L30L	GGA2_ENST00000567468.1_Splice_Site_p.L30L	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	30					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		GCTACTCACTGAGCCACAGCT	0.781													G|||	3460	0.690895	0.5756	0.7291	5008	,	,		7234	0.6964		0.8131	False		,,,				2504	0.6881				p.L30L		.											.	GGA2-91	0			c.C90G						.						1.0	1.0	1.0					16																	23521643		725	1470	2195	SO:0001630	splice_region_variant	23062	exon1			CTCACTGAGCCAC	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.91+1C>G	16.37:g.23521643G>C		0	0		6	5	NM_015044	0	0	0	0	0	D3DWF0|O14564|Q9NYN2|Q9UPS2	Silent	SNP	ENST00000309859.4	37	CCDS10611.1																																																																																			G|0.500;C|0.500		0.781	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		Silent
CDH5	1003	broad.mit.edu	37	16	66420931	66420931	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:66420931G>A	ENST00000341529.3	+	3	578	c.430G>A	c.(430-432)Gtg>Atg	p.V144M	CDH5_ENST00000563425.2_Missense_Mutation_p.V144M	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	144	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	AGTTCATGACGTGAACGACAA	0.542																																					p.V144M		.											.	CDH5-525	0			c.G430A						.						133.0	103.0	113.0					16																	66420931		2202	4300	6502	SO:0001583	missense	1003	exon3			CATGACGTGAACG	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.430G>A	16.37:g.66420931G>A	ENSP00000344115:p.Val144Met	234	1		292	6	NM_001795	0	0	0	0	0	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	ENST00000341529.3	37	CCDS10804.1	.	.	.	.	.	.	.	.	.	.	G	19.44	3.828591	0.71258	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.71341	-0.56	5.49	-1.76	0.08006	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.74496	0.3724	M	0.81341	2.54	0.80722	D	1	P	0.46277	0.875	P	0.49421	0.61	T	0.74034	-0.3794	9	0.42905	T	0.14	.	11.5571	0.50755	0.6271:0.0:0.3729:0.0	.	144	P33151	CADH5_HUMAN	M	144	ENSP00000344115:V144M	ENSP00000344115:V144M	V	+	1	0	CDH5	64978432	0.942000	0.31987	0.000000	0.03702	0.946000	0.59487	1.801000	0.38843	-0.472000	0.06881	0.655000	0.94253	GTG	.		0.542	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	2	0		23	18	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	2	0		23	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	0	0		19	15	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	0	0		21	15	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
RPL13	6137	hgsc.bcm.edu	37	16	89627671	89627671	+	Silent	SNP	C	C	T	rs174035	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:89627671C>T	ENST00000393099.3	+	2	390	c.141C>T	c.(139-141)gcC>gcT	p.A47A	RPL13_ENST00000452368.3_Silent_p.A47A|SNORD68_ENST00000363214.1_RNA|RPL13_ENST00000311528.5_Silent_p.A47A|RPL13_ENST00000567815.1_Silent_p.A47A	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GCCGCATCGCCCCGCGCCCCG	0.741													C|||	720	0.14377	0.1256	0.1282	5008	,	,		12083	0.13		0.1839	False		,,,				2504	0.1524				p.A47A		.											.	RPL13-90	0			c.C141T						.	C	,	382,2954		24,334,1310	3.0	4.0	3.0		141,141	0.9	1.0	16	dbSNP_79	3	1125,5851		71,983,2434	no	coding-synonymous,coding-synonymous	RPL13	NM_000977.3,NM_033251.2	,	95,1317,3744	TT,TC,CC		16.1267,11.4508,14.614	,	47/212,47/212	89627671	1507,8805	1668	3488	5156	SO:0001819	synonymous_variant	6137	exon3			CATCGCCCCGCGC	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.141C>T	16.37:g.89627671C>T		0	0		7	4	NM_001243131	0	0	0	0	0	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Silent	SNP	ENST00000393099.3	37	CCDS10979.1																																																																																			C|0.846;T|0.154		0.741	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
PRPF8	10594	hgsc.bcm.edu	37	17	1553003	1553003	+	IGR	SNP	G	G	T	rs9896488	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:1553003G>T	ENST00000572621.1	-	0	7445				RILP_ENST00000301336.6_Silent_p.A32A|PRPF8_ENST00000575116.1_5'Flank			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CCAGGGCCCCGGCTAGATGGT	0.751													G|||	392	0.0782748	0.2073	0.0231	5008	,	,		10869	0.0873		0.003	False		,,,				2504	0.0112				p.A32A		.											.	RILP-91	0			c.C96A						.			510,3290		20,470,1410	5.0	7.0	6.0		96	-2.2	1.0	17	dbSNP_119	6	32,7890		0,32,3929	no	coding-synonymous	RILP	NM_031430.2		20,502,5339	TT,TG,GG		0.4039,13.4211,4.6238		32/402	1553003	542,11180	1900	3961	5861	SO:0001628	intergenic_variant	83547	exon1			GGCCCCGGCTAGA	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553		17.37:g.1553003G>T		0	0		31	27	NM_031430	0	0	0	0	0	O14547|O75965	Silent	SNP	ENST00000572621.1	37	CCDS11010.1																																																																																			G|0.921;T|0.079		0.751	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
PLD2	5338	bcgsc.ca	37	17	4718776	4718776	+	Silent	SNP	G	G	A	rs1132448	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:4718776G>A	ENST00000263088.6	+	13	1310	c.1179G>A	c.(1177-1179)gaG>gaA	p.E393E	PLD2_ENST00000572940.1_Silent_p.E393E	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	393					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	ACCAGGAGGAGGGTGTCCGTG	0.542											OREG0024105	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	3131	0.6252	0.388	0.7435	5008	,	,		21414	0.6349		0.7028	False		,,,				2504	0.772				p.E393E		.											.	PLD2-291	0			c.G1179A						.	G		1962,2444	553.3+/-378.7	429,1104,670	311.0	277.0	289.0		1179	2.5	1.0	17	dbSNP_86	289	6193,2407	699.9+/-405.1	2251,1691,358	no	coding-synonymous	PLD2	NM_002663.4		2680,2795,1028	AA,AG,GG		27.9884,44.5302,37.2982		393/934	4718776	8155,4851	2203	4300	6503	SO:0001819	synonymous_variant	5338	exon13			GGAGGAGGGTGTC	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.1179G>A	17.37:g.4718776G>A		209	2	621	382	13	NM_001243108	0	0	0	0	0	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Silent	SNP	ENST00000263088.6	37	CCDS11057.1																																																																																			G|0.370;A|0.630		0.542	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663	
SLC35G6	643664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7385476	7385476	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:7385476C>T	ENST00000412468.2	+	2	288	c.173C>T	c.(172-174)tCt>tTt	p.S58F	POLR2A_ENST00000322644.6_5'Flank|POLR2A_ENST00000572844.1_5'Flank|ZBTB4_ENST00000380599.4_5'Flank|ZBTB4_ENST00000311403.4_Intron	NM_001102614.1	NP_001096084.1	P0C7Q6	S35G6_HUMAN	solute carrier family 35, member G6	58	EamA 1.					integral component of membrane (GO:0016021)											GGCCCCCTTTCTCATATGGCT	0.632																																					p.S58F		.											.	.	0			c.C173T						.						93.0	97.0	96.0					17																	7385476		2203	4300	6503	SO:0001583	missense	643664	exon2			CCCTTTCTCATAT		CCDS45603.1	17p13.1	2013-05-22	2011-08-03	2011-08-03		ENSG00000259224		"""Solute carriers"""	31351	protein-coding gene	gene with protein product			"""transmembrane protein 21B"", ""acyl-malonyl condensing enzyme 1-like 3"""	TMEM21B, AMAC1L3			Standard	NM_001102614		Approved		uc010cmj.1	P0C7Q6		ENST00000412468.2:c.173C>T	17.37:g.7385476C>T	ENSP00000396523:p.Ser58Phe	93	0		220	43	NM_001102614	0	0	0	0	0		Missense_Mutation	SNP	ENST00000412468.2	37	CCDS45603.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.716566	0.48622	.	.	ENSG00000181222	ENST00000412468	T	0.30714	1.52	4.21	4.21	0.49690	.	.	.	.	.	T	0.37348	0.1000	N	0.19112	0.55	0.46356	D	0.999006	D	0.58970	0.984	P	0.60541	0.876	T	0.36792	-0.9733	9	0.62326	D	0.03	-9.0173	15.6935	0.77473	0.0:1.0:0.0:0.0	.	58	P0C7Q6	S35G6_HUMAN	F	58	ENSP00000396523:S58F	ENSP00000396523:S58F	S	+	2	0	SLC35G6	7326200	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	4.233000	0.58651	2.069000	0.61940	0.462000	0.41574	TCT	.		0.632	SLC35G6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001102614	
MYO15A	51168	hgsc.bcm.edu	37	17	18024266	18024266	+	Missense_Mutation	SNP	T	T	G	rs2955367	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:18024266T>G	ENST00000205890.5	+	2	2490	c.2152T>G	c.(2152-2154)Tgg>Ggg	p.W718G		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	718				W -> G (in Ref. 2; AAF05903/AF051976). {ECO:0000305}.	inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCAGGCCAGCTGGTGGGCCTT	0.796													t|||	2484	0.496006	0.2995	0.451	5008	,	,		3987	0.6567		0.3668	False		,,,				2504	0.7607				p.W718G		.											.	MYO15A-97	0			c.T2152G						.						1.0	1.0	1.0					17																	18024266		862	2132	2994	SO:0001583	missense	51168	exon2			GCCAGCTGGTGGG	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.2152T>G	17.37:g.18024266T>G	ENSP00000205890:p.Trp718Gly	0	0		8	8	NM_016239	0	0	0	0	0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	961	0.440018315018315	165	0.3353658536585366	150	0.4143646408839779	374	0.6538461538461539	272	0.35883905013192613	t	8.609	0.888709	0.17540	.	.	ENSG00000091536	ENST00000205890	D	0.88509	-2.39	4.17	3.0	0.34707	.	.	.	.	.	T	0.00012	0.0000	L	0.27053	0.805	0.09310	P	0.99999999915476	P	0.43477	0.808	B	0.33295	0.161	T	0.49808	-0.8900	8	0.36615	T	0.2	.	3.0044	0.06024	0.2142:0.1168:0.0:0.6689	rs2955367	718	Q9UKN7	MYO15_HUMAN	G	718	ENSP00000205890:W718G	ENSP00000205890:W718G	W	+	1	0	MYO15A	17964991	0.538000	0.26394	0.967000	0.41034	0.089000	0.18198	0.549000	0.23329	1.516000	0.48900	0.247000	0.18012	TGG	T|0.570;G|0.430		0.796	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
MAPK7	5598	broad.mit.edu	37	17	19285118	19285118	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:19285118C>A	ENST00000308406.5	+	5	1888	c.1502C>A	c.(1501-1503)gCt>gAt	p.A501D	MAPK7_ENST00000299612.7_Missense_Mutation_p.A362D|MAPK7_ENST00000395604.3_Missense_Mutation_p.A501D|MAPK7_ENST00000395602.4_Missense_Mutation_p.A501D|MFAP4_ENST00000574313.2_5'Flank|MAPK7_ENST00000571657.1_Intron	NM_139033.2	NP_620602.2	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7	501	May not be required for kinase activity; required to stimulate MEF2C activity. {ECO:0000250}.|Pro-rich.				cAMP-mediated signaling (GO:0019933)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to transforming growth factor beta stimulus (GO:0071560)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cAMP catabolic process (GO:0030821)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of response to cytokine stimulus (GO:0060761)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|regulation of angiogenesis (GO:0045765)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|mitogen-activated protein kinase binding (GO:0051019)	p.A501D(1)		autonomic_ganglia(1)|central_nervous_system(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(9)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	30	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)					CCCCTGGAGGCTCCTGAGCCT	0.672																																					p.A501D		.											.	MAPK7-1402	1	Substitution - Missense(1)	endometrium(1)	c.C1502A						.						10.0	17.0	15.0					17																	19285118		2162	4232	6394	SO:0001583	missense	5598	exon5			TGGAGGCTCCTGA	U25278	CCDS11206.1, CCDS11207.1	17p11.2	2011-06-09			ENSG00000166484	ENSG00000166484	2.7.11.24	"""Mitogen-activated protein kinase cascade / Kinases"""	6880	protein-coding gene	gene with protein product	"""BMK1 kinase"", ""extracellular-signal-regulated kinase 5"""	602521		PRKM7		10072598, 7759517	Standard	NM_139032		Approved	BMK1, ERK5	uc002gvp.3	Q13164	OTTHUMG00000059587	ENST00000308406.5:c.1502C>A	17.37:g.19285118C>A	ENSP00000311005:p.Ala501Asp	11	0		103	15	NM_002749	0	0	0	0	0	Q16634|Q59F50|Q6QLU7|Q7L4P4|Q969G1|Q96G51	Missense_Mutation	SNP	ENST00000308406.5	37	CCDS11206.1	.	.	.	.	.	.	.	.	.	.	C	16.89	3.248312	0.59103	.	.	ENSG00000166484	ENST00000308406;ENST00000299612;ENST00000395604;ENST00000395602	T;T;T;T	0.74209	-0.57;-0.82;-0.57;-0.57	4.36	3.39	0.38822	.	0.278335	0.34291	N	0.004097	T	0.62792	0.2457	N	0.22421	0.69	0.33339	D	0.569546	P	0.50943	0.94	P	0.47299	0.543	T	0.71846	-0.4469	10	0.87932	D	0	-7.5638	6.6062	0.22726	0.0:0.7883:0.0:0.2117	.	501	Q13164	MK07_HUMAN	D	501;362;501;501	ENSP00000311005:A501D;ENSP00000299612:A362D;ENSP00000378968:A501D;ENSP00000378966:A501D	ENSP00000299612:A362D	A	+	2	0	MAPK7	19225711	0.988000	0.35896	0.980000	0.43619	0.970000	0.65996	1.704000	0.37857	1.055000	0.40461	0.561000	0.74099	GCT	.		0.672	MAPK7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132506.1	NM_139033	
GAS2L2	246176	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	34073260	34073260	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:34073260G>C	ENST00000254466.6	-	6	1283	c.1256C>G	c.(1255-1257)tCt>tGt	p.S419C	GAS2L2_ENST00000587565.1_Missense_Mutation_p.S403C	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	419					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		ATGAACCCAAGATGTGGGAAT	0.567																																					p.S419C		.											.	GAS2L2-227	0			c.C1256G						.						123.0	135.0	131.0					17																	34073260		2203	4300	6503	SO:0001583	missense	246176	exon6			ACCCAAGATGTGG	AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1256C>G	17.37:g.34073260G>C	ENSP00000254466:p.Ser419Cys	88	0		120	57	NM_139285	0	0	0	0	0	Q8NHY4	Missense_Mutation	SNP	ENST00000254466.6	37	CCDS11298.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068486	0.36470	.	.	ENSG00000132139	ENST00000254466	T	0.19938	2.11	5.03	1.81	0.25067	.	1.425250	0.04576	N	0.394150	T	0.24547	0.0595	L	0.54323	1.7	0.09310	N	1	D	0.54047	0.964	P	0.46975	0.533	T	0.28490	-1.0042	10	0.72032	D	0.01	-0.6957	1.8434	0.03154	0.1803:0.1578:0.4987:0.1631	.	419	Q8NHY3	GA2L2_HUMAN	C	419	ENSP00000254466:S419C	ENSP00000254466:S419C	S	-	2	0	GAS2L2	31097373	0.000000	0.05858	0.183000	0.23137	0.162000	0.22319	0.085000	0.14912	1.322000	0.45245	0.655000	0.94253	TCT	.		0.567	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256497.1	NM_139285	
ASB16	92591	hgsc.bcm.edu	37	17	42254417	42254417	+	Missense_Mutation	SNP	A	A	G	rs7212854	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:42254417A>G	ENST00000293414.1	+	3	965	c.881A>G	c.(880-882)aAc>aGc	p.N294S	ASB16-AS1_ENST00000592897.1_RNA|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000591166.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	294				N -> S (in Ref. 1; BAB70800/BAG37167, 3; AAH75088 and 4; AAL57353). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCTTGTGCCAACGGCTGCGGG	0.751													A|||	2275	0.454273	0.5756	0.379	5008	,	,		8774	0.6925		0.2714	False		,,,				2504	0.2863				p.N294S		.											.	ASB16-227	0			c.A881G						.	A	SER/ASN,	429,1345		24,381,482	1.0	2.0	1.0		881,204	3.8	1.0	17	dbSNP_116	1	576,3936		27,522,1707	no	missense,coding-synonymous	ASB16,C17orf65	NM_080863.4,NM_178542.3	46,	51,903,2189	GG,GA,AA		12.766,24.1826,15.9879	probably-damaging,	294/454,68/194	42254417	1005,5281	887	2256	3143	SO:0001583	missense	92591	exon3			GTGCCAACGGCTG	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.881A>G	17.37:g.42254417A>G	ENSP00000293414:p.Asn294Ser	0	0		5	4	NM_080863	0	0	0	0	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	1014	0.4642857142857143	292	0.5934959349593496	125	0.3453038674033149	385	0.6730769230769231	212	0.2796833773087071	A	18.19	3.568823	0.65765	0.241826	0.12766	ENSG00000161664	ENST00000293414	D	0.82984	-1.67	4.86	3.78	0.43462	Ankyrin repeat-containing domain (4);	0.044733	0.85682	D	0.000000	T	0.00012	0.0000	L	0.28458	0.855	0.23010	P	0.99843442	B	0.25441	0.126	B	0.27170	0.077	T	0.48514	-0.9029	9	0.39692	T	0.17	-14.5205	9.4601	0.38778	0.9148:0.0:0.0852:0.0	rs7212854	294	Q96NS5	ASB16_HUMAN	S	294	ENSP00000293414:N294S	ENSP00000293414:N294S	N	+	2	0	ASB16	39609943	0.987000	0.35691	0.978000	0.43139	0.956000	0.61745	3.125000	0.50469	0.883000	0.36040	0.454000	0.30748	AAC	A|0.590;G|0.410		0.751	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
SDK2	54549	broad.mit.edu	37	17	71503636	71503636	+	Silent	SNP	T	T	C	rs9895895	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:71503636T>C	ENST00000392650.3	-	2	165	c.165A>G	c.(163-165)ccA>ccG	p.P55P	SDK2_ENST00000388726.3_Silent_p.P55P	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	55	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TGAACTCCAGTGGCCAGCTGC	0.582													t|||	2849	0.56889	0.5113	0.4827	5008	,	,		21470	0.5		0.6899	False		,,,				2504	0.6544				p.P55P		.											.	SDK2-24	0			c.A165G						.	T		752,632		207,338,147	95.0	94.0	94.0		165	-2.4	1.0	17	dbSNP_119	94	2117,1065		705,707,179	yes	coding-synonymous	SDK2	NM_001144952.1		912,1045,326	CC,CT,TT		33.4695,45.6647,37.166		55/2173	71503636	2869,1697	692	1591	2283	SO:0001819	synonymous_variant	54549	exon2			CTCCAGTGGCCAG	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.165A>G	17.37:g.71503636T>C		123	1		105	4	NM_001144952	0	0	0	0	0	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	ENST00000392650.3	37	CCDS45769.1																																																																																			T|0.439;C|0.561		0.582	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SLC38A10	124565	bcgsc.ca	37	17	79219452	79219452	+	Silent	SNP	G	G	C	rs59820101	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:79219452G>C	ENST00000374759.3	-	16	3647	c.3264C>G	c.(3262-3264)gcC>gcG	p.A1088A		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	1088					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GGGCATCCAGGGCGCCACGGA	0.672													G|||	276	0.0551118	0.1876	0.0187	5008	,	,		16185	0.0		0.0099	False		,,,				2504	0.0051				p.A1088A		.											.	SLC38A10-70	0			c.C3264G						.	G		517,3543		32,453,1545	26.0	30.0	28.0		3264	2.5	1.0	17	dbSNP_129	28	133,8185		3,127,4029	no	coding-synonymous	SLC38A10	NM_001037984.1		35,580,5574	CC,CG,GG		1.5989,12.734,5.2513		1088/1120	79219452	650,11728	2030	4159	6189	SO:0001819	synonymous_variant	124565	exon16			ATCCAGGGCGCCA	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.3264C>G	17.37:g.79219452G>C		57	0		313	12	NM_001037984	0	0	0	0	0	Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	ENST00000374759.3	37	CCDS42397.1																																																																																			G|0.963;C|0.037		0.672	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570	
MYOM1	8736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	3079307	3079307	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr18:3079307C>T	ENST00000356443.4	-	34	4851	c.4518G>A	c.(4516-4518)aaG>aaA	p.K1506K	MYOM1_ENST00000400569.3_Silent_p.K1506K|MYOM1_ENST00000261606.7_Silent_p.K1410K	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1506					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TGACCCCGGTCTTAACTCTGT	0.478																																					p.K1506K		.											.	MYOM1-94	0			c.G4518A						.						82.0	79.0	80.0					18																	3079307		1912	4118	6030	SO:0001819	synonymous_variant	8736	exon34			CCCGGTCTTAACT	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4518G>A	18.37:g.3079307C>T		125	0		131	26	NM_003803	0	0	0	0	0	Q14BD6|Q6H969|Q6ZUU0	Silent	SNP	ENST00000356443.4	37	CCDS45824.1																																																																																			.		0.478	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
GATA6	2627	hgsc.bcm.edu;broad.mit.edu	37	18	19780774	19780774	+	Silent	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr18:19780774G>C	ENST00000269216.3	+	7	2053	c.1776G>C	c.(1774-1776)ctG>ctC	p.L592L	RP11-627G18.1_ENST00000583442.1_RNA|GATA6_ENST00000581694.1_Silent_p.L592L	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	592					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			GGTGCGCCCTGGCCCTGGCCT	0.667																																					p.L592L	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	.											.	GATA6-514	0			c.G1776C						.						34.0	26.0	29.0					18																	19780774		2202	4299	6501	SO:0001819	synonymous_variant	2627	exon7			CGCCCTGGCCCTG	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.1776G>C	18.37:g.19780774G>C		18	0		93	15	NM_005257	0	0	0	0	0	B0YJ17|P78327	Silent	SNP	ENST00000269216.3	37	CCDS11872.1																																																																																			.		0.667	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257	
PIAS2	9063	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	44435530	44435530	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr18:44435530C>A	ENST00000585916.1	-	4	632	c.633G>T	c.(631-633)ttG>ttT	p.L211F	PIAS2_ENST00000324794.7_Missense_Mutation_p.L211F|PIAS2_ENST00000545673.1_5'UTR	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	211	PINIT. {ECO:0000255|PROSITE- ProRule:PRU00799}.				androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						AAACTCACCTCAACTGAACTT	0.333																																					p.L211F		.											.	PIAS2-662	0			c.G633T						.						81.0	83.0	82.0					18																	44435530		2203	4300	6503	SO:0001583	missense	9063	exon4			TCACCTCAACTGA	AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.633G>T	18.37:g.44435530C>A	ENSP00000465676:p.Leu211Phe	106	0		120	12	NM_173206	0	0	0	0	0	O75927|Q96BT5|Q96KE3	Missense_Mutation	SNP	ENST00000585916.1	37	CCDS32824.1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.612371	0.46631	.	.	ENSG00000078043	ENST00000398654;ENST00000262161;ENST00000398651;ENST00000324794	T	0.58940	0.3	5.45	3.41	0.39046	PINIT domain (1);	0.000000	0.85682	D	0.000000	T	0.68118	0.2966	M	0.79011	2.435	0.80722	D	1	P;P;P;D	0.55172	0.72;0.789;0.858;0.97	P;P;P;P	0.62560	0.525;0.744;0.884;0.904	T	0.69491	-0.5131	10	0.87932	D	0	-1.3822	4.1229	0.10114	0.0:0.5132:0.0:0.4868	.	215;211;211;211	O75928-3;Q2TA77;O75928-2;O75928	.;.;.;PIAS2_HUMAN	F	211;211;207;211	ENSP00000317163:L211F	ENSP00000262161:L211F	L	-	3	2	PIAS2	42689528	0.954000	0.32549	1.000000	0.80357	0.997000	0.91878	0.052000	0.14163	1.302000	0.44855	0.591000	0.81541	TTG	.		0.333	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445656.2	NM_004671	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		0	0		16	16	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
MIDN	90007	hgsc.bcm.edu	37	19	1250397	1250397	+	Silent	SNP	C	C	T	rs3746107	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:1250397C>T	ENST00000591446.2	+	1	511	c.102C>T	c.(100-102)gcC>gcT	p.A34A	MIDN_ENST00000300952.2_Silent_p.A34A			Q504T8	MIDN_HUMAN	midnolin	34	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytosol (GO:0005829)|nucleolus (GO:0005730)				NS(1)|endometrium(3)|kidney(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGCCTCGCCATCCACAGCA	0.786													c|||	925	0.184704	0.5325	0.0389	5008	,	,		3815	0.1002		0.0159	False		,,,				2504	0.0787				p.A34A		.											.	MIDN-90	0			c.C102T						.			1831,2463		402,1027,718	9.0	9.0	9.0		102	0.3	1.0	19	dbSNP_107	9	104,8314		2,100,4107	no	coding-synonymous	MIDN	NM_177401.4		404,1127,4825	TT,TC,CC		1.2354,42.6409,15.2218		34/469	1250397	1935,10777	2147	4209	6356	SO:0001819	synonymous_variant	90007	exon2			CCTCGCCATCCAC	AC004221	CCDS32864.1	19p13.3	2013-09-20			ENSG00000167470	ENSG00000167470			16298	protein-coding gene	gene with protein product		606700				10974535	Standard	XM_005259671		Approved		uc002lrp.3	Q504T8	OTTHUMG00000180144	ENST00000591446.2:c.102C>T	19.37:g.1250397C>T		0	0		55	25	NM_177401	0	0	0	0	0	Q96BW8	Silent	SNP	ENST00000591446.2	37	CCDS32864.1																																																																																			C|0.846;T|0.154		0.786	MIDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449965.2		
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	TCF3_ENST00000453954.2_Silent_p.G352G|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000344749.5_Silent_p.G436G|TCF3_ENST00000395423.3_Silent_p.G385G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		0	0		16	7	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000453954.2_Silent_p.S350S|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000395423.3_Silent_p.S383S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		0	0		19	9	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619348	1619348	+	Silent	SNP	G	G	A	rs386805766|rs1052696	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:1619348G>A	ENST00000262965.5	-	15	1637	c.1293C>T	c.(1291-1293)ggC>ggT	p.G431G	TCF3_ENST00000453954.2_Silent_p.G347G|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000588136.1_Silent_p.G431G|TCF3_ENST00000344749.5_Silent_p.G431G|TCF3_ENST00000395423.3_Silent_p.G380G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGACATGGGGCCGGTGAAAC	0.736			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	536	0.107029	0.0371	0.0432	5008	,	,		13774	0.254		0.0706	False		,,,				2504	0.1329				p.G431G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1293T						.	G	,	155,4211		3,149,2031	13.0	15.0	14.0		1293,1293	-0.6	0.1	19	dbSNP_86	14	512,7976		18,476,3750	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	21,625,5781	AA,AG,GG		6.032,3.5502,5.189	,	431/652,431/655	1619348	667,12187	2183	4244	6427	SO:0001819	synonymous_variant	6929	exon15			CATGGGGCCGGTG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1293C>T	19.37:g.1619348G>A		0	0		19	10	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.903;A|0.097		0.736	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619350	1619350	+	Missense_Mutation	SNP	C	C	T	rs386805766|rs1052692	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:1619350C>T	ENST00000262965.5	-	15	1635	c.1291G>A	c.(1291-1293)Ggc>Agc	p.G431S	TCF3_ENST00000453954.2_Missense_Mutation_p.G347S|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000588136.1_Missense_Mutation_p.G431S|TCF3_ENST00000344749.5_Missense_Mutation_p.G431S|TCF3_ENST00000395423.3_Missense_Mutation_p.G380S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACATGGGGCCGGTGAAACCT	0.741			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	564	0.11262	0.056	0.0476	5008	,	,		13830	0.254		0.0716	False		,,,				2504	0.1319				p.G431S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.G1291A						.	C	SER/GLY,SER/GLY	215,4155		5,205,1975	13.0	15.0	14.0		1291,1291	-0.7	0.0	19	dbSNP_86	14	530,7974		19,492,3741	yes	missense,missense	TCF3	NM_001136139.2,NM_003200.3	56,56	24,697,5716	TT,TC,CC		6.2324,4.9199,5.7869	benign,benign	431/652,431/655	1619350	745,12129	2185	4252	6437	SO:0001583	missense	6929	exon15			TGGGGCCGGTGAA	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1291G>A	19.37:g.1619350C>T	ENSP00000262965:p.Gly431Ser	0	0		20	11	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000262965.5	37	CCDS12074.1	219	0.10027472527472528	18	0.036585365853658534	14	0.03867403314917127	142	0.24825174825174826	45	0.059366754617414245	C	11.78	1.740783	0.30865	0.049199	0.062324	ENSG00000071564	ENST00000262965;ENST00000344749;ENST00000453954;ENST00000395423	T;T;T	0.57907	0.37;0.37;0.37	4.29	-0.72	0.11195	.	0.354219	0.29342	N	0.012425	T	0.00012	0.0000	L	0.48260	1.515	0.80722	P	0.0	B;P;B;B	0.38827	0.304;0.649;0.048;0.085	B;B;B;B	0.26416	0.056;0.069;0.014;0.011	T	0.18999	-1.0319	9	0.23891	T	0.37	-16.7082	4.654	0.12608	0.1526:0.572:0.0:0.2754	rs1052692;rs3170423	431;431;380;368	P15923-2;P15923;Q2TB39;Q6PJU3	.;TFE2_HUMAN;.;.	S	431;431;431;380	ENSP00000262965:G431S;ENSP00000344375:G431S;ENSP00000378813:G380S	ENSP00000262965:G431S	G	-	1	0	TCF3	1570350	0.000000	0.05858	0.031000	0.17742	0.007000	0.05969	-1.118000	0.03280	0.264000	0.21851	-0.258000	0.10820	GGC	C|0.901;T|0.099		0.741	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
KLF16	83855	hgsc.bcm.edu	37	19	1854557	1854557	+	Silent	SNP	A	A	G	rs3746045	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:1854557A>G	ENST00000250916.4	-	2	730	c.660T>C	c.(658-660)ccT>ccC	p.P220P	KLF16_ENST00000592313.1_5'UTR|CTB-31O20.6_ENST00000592884.1_RNA	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	220	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGGGCACCAGGGCGCCGGA	0.756													A|||	2119	0.423123	0.6785	0.4611	5008	,	,		10654	0.3829		0.2177	False		,,,				2504	0.3037				p.P220P		.											.	KLF16-90	0			c.T660C						.	A		2319,1817		694,931,443	10.0	16.0	14.0		660	-6.7	0.2	19	dbSNP_107	14	1682,6356		211,1260,2548	no	coding-synonymous	KLF16	NM_031918.3		905,2191,2991	GG,GA,AA		20.9256,43.9313,32.8651		220/253	1854557	4001,8173	2068	4019	6087	SO:0001819	synonymous_variant	83855	exon2			GGCACCAGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.660T>C	19.37:g.1854557A>G		0	0		14	6	NM_031918	0	0	0	0	0		Silent	SNP	ENST00000250916.4	37	CCDS12075.1																																																																																			A|0.591;G|0.409		0.756	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	1	0		24	17	NM_019107	0	0	0	0	0	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
FEM1A	55527	hgsc.bcm.edu	37	19	4792049	4792049	+	Silent	SNP	G	G	A	rs12608548	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:4792049G>A	ENST00000269856.3	+	1	322	c.183G>A	c.(181-183)gtG>gtA	p.V61V	AC005523.2_ENST00000596170.1_RNA|AC005523.2_ENST00000601192.1_RNA|AC005523.3_ENST00000598782.1_lincRNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	61					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		AGTACCTGGTGGACCGGTGCG	0.746													G|||	119	0.023762	0.0008	0.0187	5008	,	,		14968	0.0704		0.001	False		,,,				2504	0.0337				p.V61V		.											.	FEM1A-90	0			c.G183A						.	G		4,3652		0,4,1824	3.0	4.0	4.0		183	3.6	1.0	19	dbSNP_120	4	16,7360		0,16,3672	no	coding-synonymous	FEM1A	NM_018708.2		0,20,5496	AA,AG,GG		0.2169,0.1094,0.1813		61/670	4792049	20,11012	1828	3688	5516	SO:0001819	synonymous_variant	55527	exon1			CCTGGTGGACCGG	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.183G>A	19.37:g.4792049G>A		0	0		7	4	NM_018708	0	0	0	0	0	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Silent	SNP	ENST00000269856.3	37	CCDS12135.1																																																																																			G|0.983;A|0.017		0.746	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1		
NRTN	4902	hgsc.bcm.edu	37	19	5828125	5828125	+	Missense_Mutation	SNP	G	G	T	rs376877016	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:5828125G>T	ENST00000303212.2	+	2	899	c.535G>T	c.(535-537)Gcg>Tcg	p.A179S		NM_004558.3	NP_004549.1	Q99748	NRTN_HUMAN	neurturin	179					axon guidance (GO:0007411)|MAPK cascade (GO:0000165)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neuron projection development (GO:0031175)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|extracellular region (GO:0005576)	receptor binding (GO:0005102)			large_intestine(1)	1						CTTCCTGGACGCGCACAGCCG	0.771													G|||	8	0.00159744	0.0	0.0	5008	,	,		7755	0.0079		0.0	False		,,,				2504	0.0				p.A179S		.											.	NRTN-90	0			c.G535T						.						2.0	1.0	2.0					19																	5828125		1102	2007	3109	SO:0001583	missense	4902	exon2			CTGGACGCGCACA	U78110	CCDS12151.1	19p13.3	2014-01-30				ENSG00000171119		"""Endogenous ligands"""	8007	protein-coding gene	gene with protein product	"""prepro-neurturin"""	602018				8945474	Standard	NM_004558		Approved	NTN	uc002mde.3	Q99748		ENST00000303212.2:c.535G>T	19.37:g.5828125G>T	ENSP00000302648:p.Ala179Ser	0	0		36	20	NM_004558	0	0	0	0	0	B2RPE8	Missense_Mutation	SNP	ENST00000303212.2	37	CCDS12151.1	.	.	.	.	.	.	.	.	.	.	G	9.851	1.193581	0.22037	.	.	ENSG00000171119	ENST00000303212	D	0.83673	-1.75	4.03	-4.6	0.03390	Transforming growth factor-beta, C-terminal (3);	0.893154	0.09797	N	0.754611	T	0.58090	0.2098	N	0.12182	0.205	0.22989	N	0.998467	B	0.10296	0.003	B	0.12837	0.008	T	0.52238	-0.8602	10	0.06625	T	0.88	-0.1225	5.0767	0.14634	0.1612:0.0:0.5284:0.3104	.	179	Q99748	NRTN_HUMAN	S	179	ENSP00000302648:A179S	ENSP00000302648:A179S	A	+	1	0	NRTN	5779125	0.001000	0.12720	0.800000	0.32199	0.958000	0.62258	0.058000	0.14301	-0.349000	0.08274	0.491000	0.48974	GCG	.		0.771	NRTN-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451882.2	NM_004558	
MUC16	94025	broad.mit.edu;bcgsc.ca	37	19	9056461	9056461	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:9056461G>A	ENST00000397910.4	-	3	31188	c.30985C>T	c.(30985-30987)Cct>Tct	p.P10329S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10331	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AATGGCACAGGAGTGGATGAA	0.517																																					p.P10329S		.											.	MUC16-566	0			c.C30985T						.						109.0	110.0	109.0					19																	9056461		2066	4205	6271	SO:0001583	missense	94025	exon3			GCACAGGAGTGGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30985C>T	19.37:g.9056461G>A	ENSP00000381008:p.Pro10329Ser	139	0		248	8	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	5.742	0.321393	0.10845	.	.	ENSG00000181143	ENST00000397910	T	0.03124	4.04	3.42	2.39	0.29439	.	.	.	.	.	T	0.01976	0.0062	N	0.04508	-0.205	.	.	.	B	0.16396	0.017	B	0.10450	0.005	T	0.29027	-1.0025	8	0.87932	D	0	.	5.0143	0.14328	0.8544:0.0:0.1456:0.0	.	10329	B5ME49	.	S	10329	ENSP00000381008:P10329S	ENSP00000381008:P10329S	P	-	1	0	MUC16	8917461	0.005000	0.15991	0.007000	0.13788	0.012000	0.07955	0.513000	0.22770	0.679000	0.31345	-0.382000	0.06688	CCT	.		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9090327	9090327	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:9090327G>T	ENST00000397910.4	-	1	1691	c.1488C>A	c.(1486-1488)agC>agA	p.S496R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	496	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGCAGCTGTGCTGGAACTCT	0.537																																					p.S496R		.											.	MUC16-566	0			c.C1488A						.						104.0	102.0	103.0					19																	9090327		2074	4215	6289	SO:0001583	missense	94025	exon1			AGCTGTGCTGGAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1488C>A	19.37:g.9090327G>T	ENSP00000381008:p.Ser496Arg	116	0		162	40	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	1.711	-0.499110	0.04291	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	1.36	-1.14	0.09741	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	.	.	.	D	0.58268	0.982	P	0.50136	0.632	T	0.47315	-0.9127	8	0.87932	D	0	.	6.0047	0.19539	0.2248:0.0:0.7752:0.0	.	496	B5ME49	.	R	496	ENSP00000381008:S496R	ENSP00000381008:S496R	S	-	3	2	MUC16	8951327	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	-0.225000	0.09151	-0.255000	0.09486	-0.752000	0.03492	AGC	.		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CACNA1A	773	hgsc.bcm.edu	37	19	13409696	13409696	+	Missense_Mutation	SNP	C	C	G	rs16022	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:13409696C>G	ENST00000360228.5	-	19	2750	c.2751G>C	c.(2749-2751)gaG>gaC	p.E917D	CACNA1A_ENST00000573710.2_Missense_Mutation_p.E918D	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	918					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.E918D(3)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CGGCCTCGCCCTCCCAGAACC	0.776													C|||	530	0.105831	0.0605	0.1254	5008	,	,		10618	0.1171		0.1471	False		,,,				2504	0.0992				p.E918D		.											.	CACNA1A-67	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.G2754C						.	C	ASP/GLU,ASP/GLU,ASP/GLU,ASP/GLU,ASP/GLU	206,3316		5,196,1560	8.0	9.0	8.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2763,2754,2751,2754,2763	1.5	0.9	19	dbSNP_54	8	883,6727		33,817,2955	no	missense,missense,missense,missense,missense	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	45,45,45,45,45	38,1013,4515	GG,GC,CC		11.6032,5.8489,9.7826	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	921/2267,918/2262,917/2507,918/2264,921/2513	13409696	1089,10043	1761	3805	5566	SO:0001583	missense	773	exon19			CTCGCCCTCCCAG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2751G>C	19.37:g.13409696C>G	ENSP00000353362:p.Glu917Asp	0	0		15	7	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	247	0.1130952380952381	27	0.054878048780487805	43	0.11878453038674033	69	0.12062937062937062	108	0.1424802110817942	C	2.711	-0.268795	0.05716	0.058489	0.116032	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.96265	-3.96	3.79	1.49	0.22878	.	4.032560	0.00550	N	0.000240	T	0.06508	0.0167	N	0.03608	-0.345	0.58432	P	9.99999999995449E-6	B;B;B	0.24963	0.0;0.001;0.115	B;B;B	0.24848	0.001;0.003;0.056	T	0.70303	-0.4909	9	0.30854	T	0.27	.	5.84	0.18629	0.0:0.484:0.3995:0.1165	rs16022;rs3752173	918;921;917	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	D	917;921;918;918	ENSP00000353362:E917D	ENSP00000317661:E918D	E	-	3	2	CACNA1A	13270696	0.372000	0.25064	0.886000	0.34754	0.118000	0.20060	0.109000	0.15417	0.091000	0.17302	0.462000	0.41574	GAG	C|0.363;G|0.637		0.776	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	0	0		21	13	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
IGFL1	374918	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46733364	46733364	+	Splice_Site	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:46733364G>C	ENST00000437936.1	+	2	48		c.e2-1		AC006262.10_ENST00000597337.1_RNA	NM_198541.1	NP_940943.1	Q6UW32	IGFL1_HUMAN	IGF-like family member 1							extracellular space (GO:0005615)				lung(5)	5		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.00242)|all cancers(93;0.0132)|GBM - Glioblastoma multiforme(486;0.0294)|Epithelial(262;0.201)		CTTTCCCACAGCTGTCTTTGC	0.562																																					.		.											.	.	0			c.26-1G>C						.						114.0	112.0	113.0					19																	46733364		1965	4155	6120	SO:0001630	splice_region_variant	374918	exon2			CCCACAGCTGTCT	AY359013	CCDS46123.1	19q13.32	2010-06-15			ENSG00000188293	ENSG00000188293			24093	protein-coding gene	gene with protein product		610544				12975309	Standard	NM_198541		Approved	UNQ644	uc002pee.3	Q6UW32		ENST00000437936.1:c.26-1G>C	19.37:g.46733364G>C		71	0		110	39	NM_198541	0	0	0	0	0		Splice_Site	SNP	ENST00000437936.1	37	CCDS46123.1	.	.	.	.	.	.	.	.	.	.	G	5.393	0.257761	0.10239	.	.	ENSG00000188293	ENST00000437936	.	.	.	2.52	2.52	0.30459	.	.	.	.	.	.	.	.	.	.	.	0.43069	D	0.994709	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6256	0.33888	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IGFL1	51425204	0.045000	0.20229	0.249000	0.24280	0.011000	0.07611	2.422000	0.44696	1.717000	0.51406	0.462000	0.41574	.	.		0.562	IGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461724.1	NM_198541	Intron
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000597185.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		0	0		12	5	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
PPFIA3	8541	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49637077	49637077	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:49637077G>A	ENST00000334186.4	+	10	1535	c.1186G>A	c.(1186-1188)Gag>Aag	p.E396K	PPFIA3_ENST00000602351.1_Missense_Mutation_p.E396K	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	396					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		TGGGAATTTTGAGGAGCGGCT	0.617																																					p.E396K		.											.	PPFIA3-226	0			c.G1186A						.						36.0	36.0	36.0					19																	49637077		2203	4300	6503	SO:0001583	missense	8541	exon10			AATTTTGAGGAGC	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.1186G>A	19.37:g.49637077G>A	ENSP00000335614:p.Glu396Lys	159	0		475	134	NM_003660	0	0	0	0	0	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	ENST00000334186.4	37	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	G	35	5.466844	0.96257	.	.	ENSG00000177380	ENST00000334186;ENST00000421230	T	0.37058	1.22	4.01	4.01	0.46588	.	0.000000	0.45867	U	0.000325	T	0.61751	0.2372	M	0.82517	2.595	0.80722	D	1	D;D;D	0.76494	0.999;0.992;0.995	D;D;D	0.68192	0.94;0.956;0.936	T	0.70375	-0.4889	10	0.87932	D	0	-18.3021	15.2798	0.73773	0.0:0.0:1.0:0.0	.	320;396;396	B4DEU8;O75145-2;O75145	.;.;LIPA3_HUMAN	K	396;320	ENSP00000335614:E396K	ENSP00000335614:E396K	E	+	1	0	PPFIA3	54328889	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.591000	0.67536	1.948000	0.56530	0.655000	0.94253	GAG	.		0.617	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
SIGLEC12	89858	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52003536	52003536	+	Nonsense_Mutation	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:52003536G>C	ENST00000291707.3	-	2	501	c.446C>G	c.(445-447)tCa>tGa	p.S149*	SIGLEC12_ENST00000598614.1_Nonsense_Mutation_p.S31*	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	149	Ig-like V-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CCTGTATCTTGACAGTAGGTC	0.592																																					p.S149X		.											.	SIGLEC12-96	0			c.C446G						.						73.0	66.0	68.0					19																	52003536		2203	4300	6503	SO:0001587	stop_gained	89858	exon2			TATCTTGACAGTA	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.446C>G	19.37:g.52003536G>C	ENSP00000291707:p.Ser149*	188	0		253	58	NM_053003	0	0	0	0	0	Q8IYH7	Nonsense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	.	.	.	.	.	.	.	.	.	.	.	14.09	2.431835	0.43122	.	.	ENSG00000254521	ENST00000291707	.	.	.	0.716	-1.43	0.08884	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	2.5329	0.04707	0.0:0.3142:0.3712:0.3145	.	.	.	.	X	149	.	ENSP00000291707:S149X	S	-	2	0	SIGLEC12	56695348	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-2.272000	0.01165	-0.958000	0.03622	0.392000	0.25879	TCA	.		0.592	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
LILRB4	11006	bcgsc.ca	37	19	55175009	55175009	+	Missense_Mutation	SNP	G	G	T	rs11540761	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:55175009G>T	ENST00000391736.1	+	4	369	c.54G>T	c.(52-54)agG>agT	p.R18S	LILRB4_ENST00000391733.3_Missense_Mutation_p.R18S|LILRB4_ENST00000391734.3_Missense_Mutation_p.R18S|LILRB4_ENST00000270452.2_Missense_Mutation_p.R18S|LILRB4_ENST00000430952.2_Missense_Mutation_p.R18S	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	18			R -> S (in dbSNP:rs11574570).		immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		TGGGCCCCAGGACCCACATGC	0.592													G|||	979	0.195487	0.2118	0.2032	5008	,	,		12985	0.124		0.1799	False		,,,				2504	0.2577				p.R18S		.											.	LILRB4-93	0			c.G54T						.	G	SER/ARG,SER/ARG	957,3449	359.4+/-314.8	94,769,1340	53.0	59.0	57.0		54,54	1.3	0.0	19	dbSNP_120	57	1598,7002	297.9+/-303.7	156,1286,2858	no	missense,missense	LILRB4	NM_001081438.1,NM_006847.3	110,110	250,2055,4198	TT,TG,GG		18.5814,21.7204,19.6448	possibly-damaging,possibly-damaging	18/448,18/449	55175009	2555,10451	2203	4300	6503	SO:0001583	missense	11006	exon2			CCCCAGGACCCAC	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.54G>T	19.37:g.55175009G>T	ENSP00000375616:p.Arg18Ser	191	1		225	10	NM_006847	0	0	0	0	0	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Missense_Mutation	SNP	ENST00000391736.1	37	CCDS12902.1	382	0.1749084249084249	104	0.21138211382113822	58	0.16022099447513813	77	0.1346153846153846	143	0.18865435356200527	G	9.489	1.100156	0.20552	0.217204	0.185814	ENSG00000186818	ENST00000420271;ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391734;ENST00000391733;ENST00000434286	T;T;T;T;T;T	0.00477	7.2;7.2;7.2;7.17;7.22;7.14	2.4	1.28	0.21552	.	.	.	.	.	T	0.00012	0.0000	M	0.87180	2.865	0.80722	P	0.0	B;D;B;B;D	0.89917	0.404;0.963;0.364;0.431;1.0	B;P;B;B;D	0.87578	0.254;0.885;0.341;0.358;0.998	T	0.49234	-0.8961	8	0.21014	T	0.42	.	6.8653	0.24091	0.0:0.2927:0.7073:0.0	rs11574570;rs11574570	18;18;18;18;59	C9JST2;Q8NHJ6-3;Q8NHJ6-2;Q8NHJ6;C9JHA6	.;.;.;LIRB4_HUMAN;.	S	59;18;18;18;18;18;18	ENSP00000375616:R18S;ENSP00000270452:R18S;ENSP00000408995:R18S;ENSP00000375614:R18S;ENSP00000375613:R18S;ENSP00000401962:R18S	ENSP00000270452:R18S	R	+	3	2	LILRB4	59866821	0.001000	0.12720	0.002000	0.10522	0.145000	0.21501	0.498000	0.22530	0.312000	0.23038	0.407000	0.27541	AGG	G|0.810;T|0.190		0.592	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000141127.3		
PPP1R12C	54776	hgsc.bcm.edu	37	19	55628609	55628609	+	Silent	SNP	A	A	G	rs66707428	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:55628609A>G	ENST00000263433.3	-	1	318	c.303T>C	c.(301-303)ggT>ggC	p.G101G	PPP1R12C_ENST00000376393.2_Silent_p.G101G	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGGCGCTGATACCGTCGGCGT	0.781													N|||	1009	0.201478	0.2806	0.0965	5008	,	,		7556	0.2738		0.1093	False		,,,				2504	0.1892				p.G101G		.											.	PPP1R12C-227	0			c.T303C						.						1.0	2.0	1.0					19																	55628609		1184	2666	3850	SO:0001819	synonymous_variant	54776	exon1			GCTGATACCGTCG	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.303T>C	19.37:g.55628609A>G		0	0		21	10	NM_017607	0	0	0	0	0		Silent	SNP	ENST00000263433.3	37	CCDS12916.1																																																																																			A|0.808;G|0.192		0.781	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
DNAAF3	352909	hgsc.bcm.edu	37	19	55672055	55672055	+	Missense_Mutation	SNP	A	A	G	rs890871	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:55672055A>G	ENST00000524407.2	-	9	1034	c.1001T>C	c.(1000-1002)cTg>cCg	p.L334P	TNNI3_ENST00000590463.1_5'Flank|CTD-2587H24.5_ENST00000591665.1_RNA|TNNI3_ENST00000344887.5_5'Flank|DNAAF3_ENST00000391720.4_Missense_Mutation_p.L381P|DNAAF3_ENST00000527223.2_Missense_Mutation_p.L402P|CTD-2587H24.4_ENST00000587871.1_5'Flank|DNAAF3_ENST00000455045.1_Missense_Mutation_p.L280P|DNAAF3_ENST00000587789.2_5'Flank			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	334					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											CTGCTCCTCCAGGTCCCCCCC	0.662											OREG0025678	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	g|||	587	0.117212	0.0651	0.2651	5008	,	,		12297	0.1994		0.0169	False		,,,				2504	0.1012				p.L402P		.											.	.	0			c.T1205C						.	G	PRO/LEU	152,3708		3,146,1781	74.0	78.0	77.0		1142	1.5	0.0	19	dbSNP_86	77	176,8082		2,172,3955	yes	missense	C19orf51	NM_178837.3	98	5,318,5736	GG,GA,AA		2.1313,3.9378,2.7067	benign	381/589	55672055	328,11790	1930	4129	6059	SO:0001583	missense	352909	exon9			TCCTCCAGGTCCC	AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.1001T>C	19.37:g.55672055A>G	ENSP00000432046:p.Leu334Pro	1	0	1009	44	15	NM_001256714	0	0	0	0	0	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	ENST00000524407.2	37	CCDS59422.1	239	0.10943223443223443	35	0.07113821138211382	64	0.17679558011049723	130	0.22727272727272727	10	0.013192612137203167	G	9.598	1.128001	0.20959	0.039378	0.021313	ENSG00000167646	ENST00000301249;ENST00000455045;ENST00000391720	T;T	0.16324	2.35;2.35	3.81	1.54	0.23209	.	0.950797	0.08719	N	0.903801	T	0.00012	0.0000	N	0.00760	-1.21	0.80722	P	0.0	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.45600	-0.9250	9	0.25751	T	0.34	-5.6366	3.5043	0.07684	0.2373:0.0:0.5646:0.1981	rs890871;rs56832619	402;280;355;334	E9PAX5;E3W9A1;Q8N9W5-3;Q8N9W5	.;.;.;CS051_HUMAN	P	402;280;381	ENSP00000394343:L280P;ENSP00000375600:L381P	ENSP00000301249:L402P	L	-	2	0	C19orf51	60363867	0.002000	0.14202	0.000000	0.03702	0.018000	0.09664	0.013000	0.13310	0.035000	0.15519	-0.172000	0.13284	CTG	A|0.920;G|0.080		0.662	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250388.5	NM_178837	
SSC5D	284297	hgsc.bcm.edu	37	19	56029616	56029616	+	Missense_Mutation	SNP	C	C	A	rs35104581|rs150781976	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:56029616C>A	ENST00000389623.6	+	14	3996	c.3973C>A	c.(3973-3975)Ccc>Acc	p.P1325T		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1325	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						gacccctcaccccACAACTCC	0.597																																					p.P1325T		.											.	.	0			c.C3973A						.						343.0	327.0	332.0					19																	56029616		692	1591	2283	SO:0001583	missense	284297	exon14			CCTCACCCCACAA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3973C>A	19.37:g.56029616C>A	ENSP00000374274:p.Pro1325Thr	72	0		120	1	NM_001144950	0	0	0	0	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	10.40	1.340729	0.24339	.	.	ENSG00000179954	ENST00000389623	T	0.01902	4.57	2.21	2.21	0.28008	.	.	.	.	.	T	0.02119	0.0066	L	0.27053	0.805	0.09310	N	1	B	0.23854	0.092	B	0.14023	0.01	T	0.42361	-0.9456	9	0.72032	D	0.01	.	8.4195	0.32692	0.0:1.0:0.0:0.0	.	1325	A1L4H1	SRCRL_HUMAN	T	1325	ENSP00000374274:P1325T	ENSP00000374274:P1325T	P	+	1	0	SSC5D	60721428	0.006000	0.16342	0.012000	0.15200	0.113000	0.19764	0.520000	0.22878	1.174000	0.42811	0.165000	0.16767	CCC	.		0.597	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
SSC5D	284297	broad.mit.edu	37	19	56030009	56030009	+	Missense_Mutation	SNP	C	C	T	rs925878	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:56030009C>T	ENST00000389623.6	+	14	4389	c.4366C>T	c.(4366-4368)Ccc>Tcc	p.P1456S		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1456	Pro-rich.			P -> S (in Ref. 1; ACJ02751). {ECO:0000305}.	defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						TCCCCTTGACCCCCTCACCCT	0.632													-|||	822	0.164137	0.0825	0.1902	5008	,	,		13016	0.2212		0.173	False		,,,				2504	0.1881				p.P1456S		.											.	.	0			c.C4366T						.						48.0	43.0	44.0					19																	56030009		692	1591	2283	SO:0001583	missense	284297	exon14			CTTGACCCCCTCA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.4366C>T	19.37:g.56030009C>T	ENSP00000374274:p.Pro1456Ser	33	0		47	3	NM_001144950	0	0	0	0	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	37	CCDS46196.1	408	0.18681318681318682	49	0.09959349593495935	82	0.2265193370165746	144	0.2517482517482518	133	0.17546174142480211	-	9.441	1.088029	0.20390	.	.	ENSG00000179954	ENST00000389623	T	0.01145	5.27	3.41	-0.807	0.10872	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.08055	0.003	T	0.38243	-0.9670	8	0.39692	T	0.17	.	5.8496	0.18685	0.4305:0.395:0.1745:0.0	rs925878;rs52789735;rs60801143;rs925878	1456	A1L4H1	SRCRL_HUMAN	S	1456	ENSP00000374274:P1456S	ENSP00000374274:P1456S	P	+	1	0	SSC5D	60721821	0.002000	0.14202	0.000000	0.03702	0.139000	0.21198	0.636000	0.24644	-0.296000	0.08947	0.282000	0.19409	CCC	C|0.808;T|0.192		0.632	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ZNF444	55311	hgsc.bcm.edu	37	19	56671447	56671447	+	Silent	SNP	C	C	T	rs79199638	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:56671447C>T	ENST00000337080.3	+	5	1228	c.861C>T	c.(859-861)ttC>ttT	p.F287F	ZNF444_ENST00000592949.1_Silent_p.F286F	NM_001253792.1|NM_018337.3	NP_001240721.1|NP_060807.2	Q8N0Y2	ZN444_HUMAN	zinc finger protein 444	287					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(1)|lung(5)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0531)		GCAAGGGCTTCGGGCGCCGCG	0.731													C|||	365	0.0728834	0.0121	0.0173	5008	,	,		8763	0.1865		0.0368	False		,,,				2504	0.1145				p.F287F		.											.	ZNF444-90	0			c.C861T						.	C		32,3502		0,32,1735	2.0	2.0	2.0		861	1.0	1.0	19	dbSNP_131	2	170,6736		0,170,3283	no	coding-synonymous	ZNF444	NM_018337.2		0,202,5018	TT,TC,CC		2.4616,0.9055,1.9349		287/328	56671447	202,10238	1767	3453	5220	SO:0001819	synonymous_variant	55311	exon5			GGGCTTCGGGCGC	AB052954	CCDS12939.1, CCDS59426.1	19q13.43	2013-01-09			ENSG00000167685	ENSG00000167685		"""-"", ""Zinc fingers, C2H2-type"""	16052	protein-coding gene	gene with protein product		607874				11978792, 19760602	Standard	NM_001253792		Approved	ZSCAN17, FLJ11137, EZF2	uc002qmm.3	Q8N0Y2		ENST00000337080.3:c.861C>T	19.37:g.56671447C>T		0	0		14	8	NM_018337	0	0	0	0	0	Q8TEQ9|Q8WU35|Q9NUU1	Silent	SNP	ENST00000337080.3	37	CCDS12939.1																																																																																			C|0.915;T|0.085		0.731	ZNF444-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457503.1	NM_018337	
ZNF470	388566	bcgsc.ca	37	19	57088558	57088558	+	Missense_Mutation	SNP	A	A	G	rs3752179	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:57088558A>G	ENST00000330619.8	+	6	1447	c.761A>G	c.(760-762)aAa>aGa	p.K254R	ZNF470_ENST00000601902.1_Intron|ZNF470_ENST00000391709.3_Missense_Mutation_p.K254R	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	254			K -> R (in dbSNP:rs3752179).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		ACAGGAGAGAAACCCTATGAA	0.383													A|||	370	0.0738818	0.0008	0.0677	5008	,	,		19131	0.2242		0.004	False		,,,				2504	0.0941				p.K254R		.											.	ZNF470-92	0			c.A761G						.	A	ARG/LYS	7,4397	12.9+/-30.5	0,7,2195	62.0	66.0	65.0		761	4.0	1.0	19	dbSNP_107	65	33,8567	21.0+/-64.5	1,31,4268	yes	missense	ZNF470	NM_001001668.3	26	1,38,6463	GG,GA,AA		0.3837,0.1589,0.3076	possibly-damaging	254/718	57088558	40,12964	2202	4300	6502	SO:0001583	missense	388566	exon6			GAGAGAAACCCTA	AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.761A>G	19.37:g.57088558A>G	ENSP00000333223:p.Lys254Arg	68	0		82	4	NM_001001668	0	0	0	0	0	A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	ENST00000330619.8	37	CCDS33122.1	134	0.06135531135531135	1	0.0020325203252032522	15	0.04143646408839779	114	0.1993006993006993	4	0.005277044854881266	A	16.36	3.102161	0.56183	0.001589	0.003837	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.24908	1.83;1.83	4.01	4.01	0.46588	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00039	0.0001	L	0.33624	1.015	0.47547	P	5.490000000000217E-4	B	0.34290	0.447	B	0.37888	0.26	T	0.28073	-1.0055	8	0.40728	T	0.16	.	12.0323	0.53403	1.0:0.0:0.0:0.0	rs3752179;rs52799046;rs3752179	254	Q6ECI4	ZN470_HUMAN	R	254	ENSP00000375590:K254R;ENSP00000333223:K254R	ENSP00000333223:K254R	K	+	2	0	ZNF470	61780370	0.511000	0.26179	1.000000	0.80357	0.893000	0.52053	1.286000	0.33273	1.689000	0.51079	0.377000	0.23210	AAA	A|0.968;G|0.032		0.383	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459707.2	NM_001001668	
ZNF814	730051	hgsc.bcm.edu	37	19	58385790	58385790	+	Missense_Mutation	SNP	G	G	T	rs111727691		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:58385790G>T	ENST00000435989.2	-	3	1202	c.968C>A	c.(967-969)cCt>cAt	p.P323H	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	323					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACATTCATAAGGTCTTTTCCC	0.358																																					p.P323H		.											.	.	0			c.C968A						.						15.0	12.0	13.0					19																	58385790		688	1563	2251	SO:0001583	missense	730051	exon3			TCATAAGGTCTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.968C>A	19.37:g.58385790G>T	ENSP00000410545:p.Pro323His	87	0		82	8	NM_001144989	0	0	0	0	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.139	0.784825	0.16189	.	.	ENSG00000204514	ENST00000435989	T	0.29397	1.57	2.27	1.18	0.20946	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.57080	0.2029	M	0.90019	3.08	0.20764	N	0.999853	D	0.89917	1.0	D	0.67231	0.95	T	0.46247	-0.9205	9	0.66056	D	0.02	.	9.258	0.37595	0.0:0.0:0.7811:0.2189	.	323	B7Z6K7	ZN814_HUMAN	H	323	ENSP00000410545:P323H	ENSP00000410545:P323H	P	-	2	0	ZNF814	63077602	0.000000	0.05858	0.028000	0.17463	0.016000	0.09150	-0.439000	0.06897	0.330000	0.23485	-1.407000	0.01130	CCT	G|0.500;T|0.500		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	hgsc.bcm.edu	37	19	58385793	58385793	+	Missense_Mutation	SNP	C	C	T	rs113623532		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:58385793C>T	ENST00000435989.2	-	3	1199	c.965G>A	c.(964-966)aGa>aAa	p.R322K	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	322					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTCATAAGGTCTTTTCCCAGT	0.358																																					p.R322K		.											.	.	0			c.G965A						.						15.0	12.0	13.0					19																	58385793		687	1562	2249	SO:0001583	missense	730051	exon3			TAAGGTCTTTTCC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.965G>A	19.37:g.58385793C>T	ENSP00000410545:p.Arg322Lys	84	0		80	9	NM_001144989	0	0	0	0	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395361	0.01175	.	.	ENSG00000204514	ENST00000435989	T	0.12361	2.69	2.27	9.47E-4	0.14044	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03608	0.0103	N	0.02225	-0.63	0.09310	N	0.999999	B	0.29301	0.241	B	0.28916	0.096	T	0.40534	-0.9558	9	0.02654	T	1	.	4.6969	0.12808	0.0:0.4166:0.0:0.5834	.	322	B7Z6K7	ZN814_HUMAN	K	322	ENSP00000410545:R322K	ENSP00000410545:R322K	R	-	2	0	ZNF814	63077605	0.000000	0.05858	0.024000	0.17045	0.009000	0.06853	-1.883000	0.01623	0.331000	0.23511	-1.381000	0.01174	AGA	C|0.500;T|0.500		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZSCAN18	65982	hgsc.bcm.edu	37	19	58596077	58596077	+	Missense_Mutation	SNP	G	G	C	rs201438629	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:58596077G>C	ENST00000240727.6	-	7	1907	c.1508C>G	c.(1507-1509)cCc>cGc	p.P503R	ZSCAN18_ENST00000600404.1_Missense_Mutation_p.P559R|ZSCAN18_ENST00000601144.1_Missense_Mutation_p.P503R|ZSCAN18_ENST00000421612.2_Missense_Mutation_p.P367R	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	503					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TGGGGGTGCGGGGGGAGCCTC	0.756													G|||	11	0.00219649	0.0	0.0	5008	,	,		12786	0.0109		0.0	False		,,,				2504	0.0				p.P559R		.											.	ZSCAN18-90	0			c.C1676G						.						5.0	6.0	6.0					19																	58596077		1858	3917	5775	SO:0001583	missense	65982	exon7			GGTGCGGGGGGAG	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.1508C>G	19.37:g.58596077G>C	ENSP00000240727:p.Pro503Arg	1	0		24	12	NM_001145542	0	0	0	0	0	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Missense_Mutation	SNP	ENST00000240727.6	37	CCDS12971.1	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	G	13.36	2.213121	0.39102	.	.	ENSG00000121413	ENST00000433686;ENST00000240727;ENST00000421612	T;T	0.02552	4.51;4.25	3.57	0.75	0.18387	.	0.228638	0.22598	N	0.057993	T	0.03136	0.0092	N	0.22421	0.69	0.09310	N	1	D;D;D;D	0.69078	0.995;0.989;0.997;0.995	P;P;P;P	0.62184	0.795;0.809;0.899;0.795	T	0.35500	-0.9786	10	0.56958	D	0.05	-5.705	6.7364	0.23411	0.3386:0.0:0.6614:0.0	.	559;367;502;503	B4DG23;E9PBI0;Q8TBC5-2;Q8TBC5	.;.;.;ZSC18_HUMAN	R	559;503;367	ENSP00000240727:P503R;ENSP00000392653:P367R	ENSP00000240727:P503R	P	-	2	0	ZSCAN18	63287889	0.871000	0.30034	0.010000	0.14722	0.053000	0.15095	0.994000	0.29693	0.231000	0.21079	0.561000	0.74099	CCC	G|0.998;C|0.002		0.756	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466706.1	NM_023926	
CLIP4	79745	bcgsc.ca	37	2	29356567	29356567	+	Silent	SNP	G	G	C	rs17749904	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:29356567G>C	ENST00000320081.5	+	5	669	c.414G>C	c.(412-414)ctG>ctC	p.L138L	CLIP4_ENST00000401605.1_Silent_p.L138L|CLIP4_ENST00000404424.1_Silent_p.L138L|CLIP4_ENST00000401617.2_Silent_p.L31L	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	138										endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					TTATTGACCTGGGAGCAGACA	0.353													G|||	625	0.1248	0.0681	0.1326	5008	,	,		17197	0.0149		0.2008	False		,,,				2504	0.2311				p.L138L		.											.	CLIP4-91	0			c.G414C						.	G		395,4011	196.7+/-221.0	16,363,1824	111.0	104.0	106.0		414	4.7	1.0	2	dbSNP_123	106	1947,6653	341.2+/-323.9	209,1529,2562	no	coding-synonymous	CLIP4	NM_024692.4		225,1892,4386	CC,CG,GG		22.6395,8.965,18.0071		138/706	29356567	2342,10664	2203	4300	6503	SO:0001819	synonymous_variant	79745	exon5			TGACCTGGGAGCA	AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.414G>C	2.37:g.29356567G>C		100	0		114	6	NM_024692	0	0	0	0	0	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Silent	SNP	ENST00000320081.5	37	CCDS1770.1																																																																																			G|0.838;C|0.162		0.353	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
CAPN14	440854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	31428282	31428282	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:31428282C>A	ENST00000403897.3	-	2	173	c.32G>T	c.(31-33)tGg>tTg	p.W11L	CAPN14_ENST00000444918.2_Missense_Mutation_p.W11L	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	11					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						CGCCAGCTTCCATCTGCATCG	0.577																																					p.W11L		.											.	.	0			c.G32T						.						52.0	56.0	55.0					2																	31428282		692	1591	2283	SO:0001583	missense	440854	exon2			AGCTTCCATCTGC	AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.32G>T	2.37:g.31428282C>A	ENSP00000385247:p.Trp11Leu	245	0		279	96	NM_001145122	0	0	0	0	0	B3KRU9	Missense_Mutation	SNP	ENST00000403897.3	37	CCDS46254.1	.	.	.	.	.	.	.	.	.	.	C	6.610	0.480874	0.12581	.	.	ENSG00000214711	ENST00000444918;ENST00000403897	D;D	0.96967	-4.19;-4.19	4.2	3.3	0.37823	.	0.360867	0.18885	U	0.128471	D	0.87935	0.6303	N	0.08118	0	0.09310	N	1	B	0.25105	0.118	B	0.16722	0.016	T	0.78191	-0.2300	10	0.28530	T	0.3	.	6.4148	0.21710	0.0:0.729:0.0:0.271	.	11	A8MX76	CAN14_HUMAN	L	11	ENSP00000398670:W11L;ENSP00000385247:W11L	ENSP00000381805:W11L	W	-	2	0	CAPN14	31281786	0.000000	0.05858	0.042000	0.18584	0.013000	0.08279	-0.093000	0.11111	2.075000	0.62263	0.561000	0.74099	TGG	.		0.577	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325010.1	NM_001145122	
CRIM1	51232	hgsc.bcm.edu	37	2	36583461	36583461	+	Missense_Mutation	SNP	G	G	T	rs3821169	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:36583461G>T	ENST00000280527.2	+	1	393	c.26G>T	c.(25-27)gGg>gTg	p.G9V	RP11-490M8.1_ENST00000565283.1_lincRNA	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	9					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				GGGGACAGGGGGTTGGCCGGC	0.781													g|||	330	0.0658946	0.0008	0.0245	5008	,	,		7264	0.255		0.0089	False		,,,				2504	0.047				p.G9V		.											.	CRIM1-118	0			c.G26T						.		VAL/GLY	5,3997		0,5,1996	5.0	9.0	8.0		26	0.4	1.0	2	dbSNP_107	8	51,8007		0,51,3978	no	missense	CRIM1	NM_016441.2	109	0,56,5974	TT,TG,GG		0.6329,0.1249,0.4643	probably-damaging	9/1037	36583461	56,12004	2001	4029	6030	SO:0001583	missense	51232	exon1			ACAGGGGGTTGGC	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.26G>T	2.37:g.36583461G>T	ENSP00000280527:p.Gly9Val	0	0		66	54	NM_016441	0	0	0	0	0	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	CCDS1783.1	159	0.07280219780219781	8	0.016260162601626018	3	0.008287292817679558	138	0.24125874125874125	10	0.013192612137203167	g	16.67	3.186798	0.57909	0.001249	0.006329	ENSG00000150938	ENST00000280527	T	0.05199	3.48	2.72	0.447	0.16608	.	0.259942	0.26983	U	0.021515	T	0.00012	0.0000	L	0.36672	1.1	0.22412	P	0.999128459	B	0.12630	0.006	B	0.17098	0.017	T	0.45556	-0.9253	9	0.87932	D	0	-4.1818	2.0298	0.03527	0.1274:0.1922:0.4851:0.1953	rs3821169	9	Q9NZV1	CRIM1_HUMAN	V	9	ENSP00000280527:G9V	ENSP00000280527:G9V	G	+	2	0	CRIM1	36436965	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	4.254000	0.58798	0.278000	0.22164	0.444000	0.29173	GGG	G|0.927;T|0.073		0.781	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	
HNRNPLL	92906	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	38800509	38800509	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:38800509G>T	ENST00000449105.3	-	8	1274	c.935C>A	c.(934-936)cCt>cAt	p.P312H	HNRNPLL_ENST00000378915.3_Missense_Mutation_p.P278H|HNRNPLL_ENST00000409636.1_Missense_Mutation_p.P307H|HNRNPLL_ENST00000608859.1_Missense_Mutation_p.P312H|HNRNPLL_ENST00000409328.1_Missense_Mutation_p.P278H			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	312					mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										AACAAGTTCAGGTGTATCTCG	0.373																																					p.P312H		.											.	HNRPLL-91	0			c.C935A						.						117.0	113.0	114.0					2																	38800509		2203	4300	6503	SO:0001583	missense	92906	exon8			AGTTCAGGTGTAT	BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.935C>A	2.37:g.38800509G>T	ENSP00000390625:p.Pro312His	113	0		117	36	NM_138394	0	0	0	0	0	Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	ENST00000449105.3	37		.	.	.	.	.	.	.	.	.	.	G	19.96	3.924016	0.73213	.	.	ENSG00000143889	ENST00000449105;ENST00000409636;ENST00000378915;ENST00000409328	.	.	.	5.42	4.54	0.55810	.	0.393472	0.25575	N	0.029722	T	0.53061	0.1773	L	0.52573	1.65	0.80722	D	1	P;P;P	0.44578	0.838;0.838;0.655	B;B;B	0.43990	0.438;0.438;0.23	T	0.49041	-0.8980	9	0.12103	T	0.63	-0.2746	14.417	0.67158	0.0712:0.0:0.9288:0.0	.	307;312;312	C9J9G0;D6W592;Q8WVV9	.;.;HNRLL_HUMAN	H	312;307;278;278	.	ENSP00000368195:P278H	P	-	2	0	HNRPLL	38654013	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.732000	0.62029	1.419000	0.47118	0.591000	0.81541	CCT	.		0.373	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000219887.2	NM_138394	
PLEKHH2	130271	bcgsc.ca	37	2	43903066	43903066	+	Intron	SNP	A	A	G	rs3828297	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:43903066A>G	ENST00000282406.4	+	3	233					NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2						negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TGTAGTTGTCACCATACTTTT	0.383													G|||	2717	0.542532	0.6082	0.5432	5008	,	,		22944	0.1905		0.7217	False		,,,				2504	0.6319				p.G132G		.											.	.	0			c.T396C						.	G	,	2822,1500	442.0+/-346.6	928,966,267	223.0	231.0	229.0		396,	-1.7	0.0	2	dbSNP_107	229	6191,2375	382.6+/-340.4	2225,1741,317	no	coding-synonymous,intron	PLEKHH2,LOC728819	NM_001101330.1,NM_172069.3	,	3153,2707,584	GG,GA,AA		27.7259,34.7062,30.0667	,	132/316,	43903066	9013,3875	2161	4283	6444	SO:0001627	intron_variant	0	exon1			GTTGTCACCATAC	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.124-2936A>G	2.37:g.43903066A>G		245	1		282	8	NM_001101330	0	0	0	0	0	Q5JPJ6|Q6P4Q1|Q8N3Q3	Silent	SNP	ENST00000282406.4	37	CCDS1812.1																																																																																			A|0.440;G|0.560		0.383	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
TMEM247	388946	ucsc.edu	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	119	5		305	41	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
C2orf73	129852	bcgsc.ca	37	2	54562012	54562012	+	Missense_Mutation	SNP	C	C	A	rs55714450	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:54562012C>A	ENST00000398634.2	+	2	127	c.85C>A	c.(85-87)Cac>Aac	p.H29N	C2orf73_ENST00000491538.1_Intron|C2orf73_ENST00000405749.1_Intron	NM_001100396.1	NP_001093866.1	Q8N5S3	CB073_HUMAN	chromosome 2 open reading frame 73	29			H -> N (in dbSNP:rs55714450).							breast(2)	2						AGAAATTAAACACGAAGAAAA	0.303													C|||	1021	0.203874	0.1619	0.2954	5008	,	,		18549	0.0456		0.3419	False		,,,				2504	0.2168				p.H29N		.											.	.	0			c.C85A						.	C	ASN/HIS	671,2967		80,511,1228	62.0	52.0	55.0		85	0.3	1.0	2	dbSNP_129	55	2761,5371		485,1791,1790	yes	missense	C2orf73	NM_001100396.1	68	565,2302,3018	AA,AC,CC		33.9523,18.4442,29.1589	benign	29/288	54562012	3432,8338	1819	4066	5885	SO:0001583	missense	129852	exon2			ATTAAACACGAAG	BC031669, AK097617	CCDS46285.1	2p16.2	2008-07-07			ENSG00000177994	ENSG00000177994			26861	protein-coding gene	gene with protein product						14702039	Standard	NM_001100396		Approved	FLJ40298	uc002rxt.1	Q8N5S3	OTTHUMG00000151826	ENST00000398634.2:c.85C>A	2.37:g.54562012C>A	ENSP00000381631:p.His29Asn	221	2		168	11	NM_001100396	0	0	0	0	0	A0AV79|A0AV81|Q8N7V4	Missense_Mutation	SNP	ENST00000398634.2	37	CCDS46285.1	481	0.22023809523809523	78	0.15853658536585366	107	0.2955801104972376	22	0.038461538461538464	274	0.36147757255936674	C	1.011	-0.687753	0.03328	0.184442	0.339523	ENSG00000177994	ENST00000486488;ENST00000398634	T;T	0.31247	1.5;1.5	4.5	0.334	0.15948	.	0.885835	0.09662	N	0.772356	T	0.00012	0.0000	N	0.08118	0	0.52099	P	5.299999999996974E-5	B	0.09022	0.002	B	0.10450	0.005	T	0.46400	-0.9194	9	0.35671	T	0.21	-24.6075	1.7904	0.03050	0.1957:0.3112:0.3535:0.1395	rs55714450;rs62141760	29	Q8N5S3	CB073_HUMAN	N	35;29	ENSP00000417971:H35N;ENSP00000381631:H29N	ENSP00000381631:H29N	H	+	1	0	C2orf73	54415516	0.249000	0.23941	0.972000	0.41901	0.150000	0.21749	-0.629000	0.05508	0.169000	0.19679	-0.300000	0.09419	CAC	C|0.747;A|0.253		0.303	C2orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324075.2	NM_001100396	
TLX2	3196	hgsc.bcm.edu	37	2	74743139	74743139	+	Silent	SNP	C	C	T	rs371068999	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:74743139C>T	ENST00000233638.7	+	3	1001	c.678C>T	c.(676-678)cgC>cgT	p.R226R		NM_016170.4	NP_057254.1	O43763	TLX2_HUMAN	T-cell leukemia homeobox 2	226					enteric nervous system development (GO:0048484)|mesoderm formation (GO:0001707)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|ovary(1)	2						AGCGGCACCGCGCGGGCCGGC	0.761													C|||	19	0.00379393	0.0	0.0	5008	,	,		11541	0.0188		0.0	False		,,,				2504	0.0				p.R226R	Esophageal Squamous(7;240 533 18610 24312)	.											.	TLX2-90	0			c.C678T						.						3.0	3.0	3.0					2																	74743139		1440	2967	4407	SO:0001819	synonymous_variant	3196	exon3			GCACCGCGCGGGC	AJ002607	CCDS1947.1	2p13.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000115297	ENSG00000115297		"""Homeoboxes / ANTP class : NKL subclass"""	5057	protein-coding gene	gene with protein product		604240	"""homeo box 11-like 1"", ""T-cell leukemia, homeobox 2"""	HOX11L1		10343123	Standard	NM_016170		Approved	Enx, Tlx2, NCX	uc002sma.2	O43763	OTTHUMG00000129960	ENST00000233638.7:c.678C>T	2.37:g.74743139C>T		0	0		5	5	NM_016170	0	0	0	0	0	Q9UD56|Q9UQ48	Silent	SNP	ENST00000233638.7	37	CCDS1947.1																																																																																			.		0.761	TLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252224.3		
SNRNP200	23020	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	96962720	96962720	+	Missense_Mutation	SNP	T	T	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:96962720T>C	ENST00000323853.5	-	12	1543	c.1466A>G	c.(1465-1467)tAc>tGc	p.Y489C	SNRNP200_ENST00000349783.5_Missense_Mutation_p.Y489C	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	489					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						GGCAGCACGGTAGAGCTTACT	0.502																																					p.Y489C		.											.	SNRNP200-162	0			c.A1466G						.						76.0	70.0	72.0					2																	96962720		2203	4300	6503	SO:0001583	missense	23020	exon12			GCACGGTAGAGCT	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.1466A>G	2.37:g.96962720T>C	ENSP00000317123:p.Tyr489Cys	169	1		277	87	NM_014014	0	0	0	0	0	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	37	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	T	12.45	1.941960	0.34283	.	.	ENSG00000144028	ENST00000323853;ENST00000349783;ENST00000540328	T;T	0.15017	2.46;2.46	5.63	4.48	0.54585	DEAD-like helicase (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.234826	0.43747	N	0.000524	T	0.15652	0.0377	L	0.52266	1.64	0.39489	D	0.968015	B	0.23185	0.081	B	0.26693	0.072	T	0.07328	-1.0778	10	0.42905	T	0.14	-14.1486	5.9608	0.19299	0.1456:0.0786:0.0:0.7759	.	489	O75643	U520_HUMAN	C	489;489;164	ENSP00000317123:Y489C;ENSP00000326937:Y489C	ENSP00000317123:Y489C	Y	-	2	0	SNRNP200	96326447	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.261000	0.51530	0.968000	0.38212	0.533000	0.62120	TAC	.		0.502	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
XIRP2	129446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	168104662	168104662	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:168104662C>T	ENST00000409195.1	+	9	6849	c.6760C>T	c.(6760-6762)Cta>Tta	p.L2254L	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Silent_p.L2032L|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Silent_p.L2254L	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2079					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CCAGGACTTTCTAATGAAAAC	0.358																																					p.L2254L		.											.	XIRP2-104	0			c.C6760T						.						68.0	63.0	65.0					2																	168104662		1833	4082	5915	SO:0001819	synonymous_variant	129446	exon9			GACTTTCTAATGA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6760C>T	2.37:g.168104662C>T		268	0		163	52	NM_152381	0	0	0	0	0	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	ENST00000409195.1	37	CCDS42769.1																																																																																			.		0.358	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
TMEM194B	100131211	hgsc.bcm.edu	37	2	191399378	191399378	+	Missense_Mutation	SNP	C	C	G	rs13412879	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:191399378C>G	ENST00000409150.3	-	1	70	c.4G>C	c.(4-6)Ggg>Cgg	p.G2R	TMEM194B_ENST00000492292.1_5'Flank|AC093388.3_ENST00000457407.1_RNA	NM_001142645.1	NP_001136117.1	A6NFY4	T194B_HUMAN	transmembrane protein 194B	2						integral component of membrane (GO:0016021)											TGGCGCGGCCCCATTTCGTTA	0.736													G|||	715	0.142772	0.1271	0.0994	5008	,	,		11081	0.1389		0.1998	False		,,,				2504	0.1401				p.G2R		.											.	.	0			c.G4C						.						1.0	3.0	2.0					2																	191399378		437	1202	1639	SO:0001583	missense	100131211	exon1			GCGGCCCCATTTC		CCDS46476.1	2q32.2	2008-06-10			ENSG00000189362	ENSG00000189362			33700	protein-coding gene	gene with protein product							Standard	NM_001142645		Approved		uc010zgf.2	A6NFY4	OTTHUMG00000154454	ENST00000409150.3:c.4G>C	2.37:g.191399378C>G	ENSP00000386292:p.Gly2Arg	0	0		6	4	NM_001142645	0	0	0	0	0	B4DYG6	Missense_Mutation	SNP	ENST00000409150.3	37	CCDS46476.1	355	0.16254578754578755	65	0.13211382113821138	50	0.13812154696132597	92	0.16083916083916083	148	0.19525065963060687	G	0.006	-2.115233	0.00349	.	.	ENSG00000189362	ENST00000409150	T	0.41400	1.0	3.19	0.247	0.15521	.	1.634660	0.05384	N	0.537665	T	0.00012	0.0000	N	0.08118	0	0.51767	P	7.00000000000145E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.11036	-1.0604	9	0.06099	T	0.92	.	3.8823	0.09083	0.1049:0.1644:0.5731:0.1577	rs13412879	2	A6NFY4	T194B_HUMAN	R	2	ENSP00000386292:G2R	ENSP00000340087:G2R	G	-	1	0	TMEM194B	191107623	0.000000	0.05858	0.416000	0.26546	0.005000	0.04900	-1.034000	0.03567	-0.400000	0.07656	-3.777000	0.00021	GGG	C|0.836;G|0.164		0.736	TMEM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335299.1	XM_001723498	
MARS2	92935	broad.mit.edu	37	2	198570807	198570807	+	Silent	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:198570807G>T	ENST00000282276.6	+	1	721	c.678G>T	c.(676-678)ctG>ctT	p.L226L	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	226					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)	p.L226L(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	AGCGGTGGCTGCGGGGCAACC	0.572																																					p.L226L		.											.	MARS2-92	1	Substitution - coding silent(1)	breast(1)	c.G678T						.						31.0	35.0	34.0					2																	198570807		2203	4300	6503	SO:0001819	synonymous_variant	92935	exon1			GTGGCTGCGGGGC	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.678G>T	2.37:g.198570807G>T		66	1		87	4	NM_138395	0	0	0	0	0	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Silent	SNP	ENST00000282276.6	37	CCDS33358.1																																																																																			.		0.572	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335477.1	NM_138395	
SGOL2	151246	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	201440158	201440158	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr2:201440158C>T	ENST00000357799.4	+	8	3854	c.3756C>T	c.(3754-3756)ttC>ttT	p.F1252F		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	1252					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						GTACTCCTTTCTATTTTAAAG	0.313																																					p.S1250F		.											.	SGOL2-94	0			c.C3749T						.						89.0	85.0	86.0					2																	201440158		1813	4069	5882	SO:0001819	synonymous_variant	151246	exon8			TCCTTTCTATTTT	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.3756C>T	2.37:g.201440158C>T		163	0		109	32	NM_001160033	0	0	0	0	0	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Missense_Mutation	SNP	ENST00000357799.4	37	CCDS42796.1																																																																																			.		0.313	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335834.1	NM_152524	
SLC52A3	113278	bcgsc.ca	37	20	746098	746098	+	Silent	SNP	G	G	A	rs3746808	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:746098G>A	ENST00000217254.7	-	2	562	c.321C>T	c.(319-321)gcC>gcT	p.A107A	SLC52A3_ENST00000381944.3_Silent_p.A107A|SLC52A3_ENST00000473664.1_5'UTR	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	107					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)										GGACCAAGAAGGCGATGCTGT	0.592													G|||	1284	0.25639	0.1362	0.3401	5008	,	,		19825	0.2014		0.3082	False		,,,				2504	0.363				p.A107A		.											.	.	0			c.C321T						.	G		692,3714	275.4+/-272.5	54,584,1565	62.0	48.0	53.0		321	3.7	0.7	20	dbSNP_107	53	2633,5967	403.1+/-347.7	420,1793,2087	no	coding-synonymous	C20orf54	NM_033409.3		474,2377,3652	AA,AG,GG		30.6163,15.7059,25.5651		107/470	746098	3325,9681	2203	4300	6503	SO:0001819	synonymous_variant	113278	exon2			CAAGAAGGCGATG	AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.321C>T	20.37:g.746098G>A		227	0		186	7	NM_033409	0	0	0	0	0	A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Silent	SNP	ENST00000217254.7	37	CCDS13007.1																																																																																			G|0.754;A|0.246		0.592	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077482.2	NM_033409	
SIRPB1	10326	bcgsc.ca	37	20	1552457	1552457	+	Silent	SNP	G	G	A	rs16995332	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:1552457G>A	ENST00000381605.4	-	3	724	c.660C>T	c.(658-660)gaC>gaT	p.D220D	SIRPB1_ENST00000262929.5_Intron|SIRPB1_ENST00000381603.3_Intron|RP4-576H24.4_ENST00000564763.1_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	220	Ig-like C1-type 1.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						GAGAGTGAACGTCCCCACGGG	0.587													.|||	341	0.0680911	0.0832	0.0576	5008	,	,		20250	0.002		0.1382	False		,,,				2504	0.0511				p.D220D		.											.	SIRPB1-91	0			c.C660T						.	G	,	407,3999		16,375,1812	161.0	140.0	147.0		,660	-2.7	0.0	20	dbSNP_123	147	1134,7466		74,986,3240	no	intron,coding-synonymous	SIRPB1	NM_001083910.2,NM_006065.3	,	90,1361,5052	AA,AG,GG		13.186,9.2374,11.8484	,	,220/399	1552457	1541,11465	2203	4300	6503	SO:0001819	synonymous_variant	10326	exon3			GTGAACGTCCCCA	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.660C>T	20.37:g.1552457G>A		516	3		537	13	NM_006065	0	0	0	0	0	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Silent	SNP	ENST00000381605.4	37	CCDS13019.1																																																																																			G|0.897;A|0.103		0.587	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
GPCPD1	56261	bcgsc.ca	37	20	5556512	5556512	+	Missense_Mutation	SNP	G	G	A	rs2273373	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:5556512G>A	ENST00000379019.4	-	9	1030	c.818C>T	c.(817-819)aCt>aTt	p.T273I	GPCPD1_ENST00000481038.1_5'UTR	NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	273			T -> I (in dbSNP:rs2273373).		glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						GATGGGAAGAGTAAGAATTCC	0.443													G|||	531	0.10603	0.2322	0.0648	5008	,	,		14547	0.1022		0.0318	False		,,,				2504	0.045				p.T273I		.											.	GPCPD1-90	0			c.C818T						.	G	ILE/THR	925,3481	355.4+/-313.0	93,739,1371	115.0	104.0	107.0		818	5.6	1.0	20	dbSNP_100	107	379,8221	122.9+/-181.8	16,347,3937	no	missense	GPCPD1	NM_019593.3	89	109,1086,5308	AA,AG,GG		4.407,20.9941,10.0261	possibly-damaging	273/673	5556512	1304,11702	2203	4300	6503	SO:0001583	missense	56261	exon9			GGAAGAGTAAGAA		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.818C>T	20.37:g.5556512G>A	ENSP00000368305:p.Thr273Ile	271	1		177	6	NM_019593	0	0	0	0	0	D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	37	CCDS13090.1	239	0.10943223443223443	128	0.2601626016260163	21	0.058011049723756904	64	0.11188811188811189	26	0.03430079155672823	G	22.0	4.234783	0.79800	0.209941	0.04407	ENSG00000125772	ENST00000379019	T	0.51325	0.71	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.32530	0.975	0.09310	P	0.999999629175	D	0.89917	1.0	D	0.69307	0.963	T	0.00970	-1.1496	9	0.37606	T	0.19	-17.0643	19.6443	0.95770	0.0:0.0:1.0:0.0	rs2273373	273	Q9NPB8	GPCP1_HUMAN	I	273	ENSP00000368305:T273I	ENSP00000368305:T273I	T	-	2	0	GPCPD1	5504512	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.855000	0.86950	2.634000	0.89283	0.655000	0.94253	ACT	G|0.899;A|0.101		0.443	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593	
SSTR4	6754	bcgsc.ca	37	20	23016970	23016970	+	Missense_Mutation	SNP	T	T	G	rs3746726	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:23016970T>G	ENST00000255008.3	+	1	914	c.850T>G	c.(850-852)Ttc>Gtc	p.F284V	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	284			F -> V (in dbSNP:rs3746726). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8483934, ECO:0000269|PubMed:8512564, ECO:0000269|Ref.5}.		arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					GCTGAACCTCTTCGTGACCAG	0.557													T|||	1530	0.305511	0.2179	0.281	5008	,	,		18337	0.2351		0.3698	False		,,,				2504	0.4479				p.F284V	Esophageal Squamous(15;850 1104 16640)	.											.	SSTR4-522	0			c.T850G						.	T	VAL/PHE	1031,3375	359.9+/-315.0	134,763,1306	197.0	205.0	202.0		850	3.4	0.5	20	dbSNP_107	202	3321,5279	483.4+/-371.1	672,1977,1651	yes	missense	SSTR4	NM_001052.2	50	806,2740,2957	GG,GT,TT		38.6163,23.3999,33.4615	benign	284/389	23016970	4352,8654	2203	4300	6503	SO:0001583	missense	6754	exon1			AACCTCTTCGTGA		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.850T>G	20.37:g.23016970T>G	ENSP00000255008:p.Phe284Val	127	2		94	7	NM_001052	0	0	0	0	0	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	37	CCDS42856.1	648	0.2967032967032967	113	0.22967479674796748	112	0.30939226519337015	148	0.25874125874125875	275	0.3627968337730871	T	7.979	0.750733	0.15778	0.233999	0.386163	ENSG00000132671	ENST00000255008	T	0.39406	1.08	3.36	3.36	0.38483	GPCR, rhodopsin-like superfamily (1);	0.090253	0.44483	U	0.000451	T	0.00012	0.0000	L	0.47190	1.495	0.37728	P	0.07484000000000002	B	0.11235	0.004	B	0.17098	0.017	T	0.38373	-0.9664	9	0.02654	T	1	.	6.6396	0.22901	0.0:0.1196:0.0:0.8804	rs3746726;rs60613961;rs3746726	284	P31391	SSR4_HUMAN	V	284	ENSP00000255008:F284V	ENSP00000255008:F284V	F	+	1	0	SSTR4	22964970	0.846000	0.29590	0.479000	0.27329	0.626000	0.37791	1.296000	0.33389	1.384000	0.46424	0.533000	0.62120	TTC	T|0.674;G|0.326		0.557	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
FAM182A	284800	bcgsc.ca	37	20	26061967	26061967	+	RNA	SNP	G	G	T	rs200610416	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:26061967G>T	ENST00000376398.2	+	0	987					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GCCTCAGTCGGCATCGCAGCT	0.587																																					.		.											.	.	0			.						.						20.0	17.0	18.0					20																	26061967		692	1571	2263			284800	.			CAGTCGGCATCGC	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061967G>T		162	5		202	37	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.925	0.739464	0.15642	.	.	ENSG00000125804	ENST00000376398;ENST00000246000;ENST00000415411	.	.	.	.	.	.	.	.	.	.	.	T	0.39172	0.1068	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38779	-0.9645	3	0.87932	D	0	.	.	.	.	.	.	.	.	S	107;107;48	.	ENSP00000246000:A107S	A	+	1	0	FAM182A	26009967	0.049000	0.20398	0.112000	0.21494	0.114000	0.19823	1.160000	0.31761	0.121000	0.18284	0.123000	0.15791	GCA	G|0.993;T|0.007		0.587	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
FRG1B	284802	bcgsc.ca	37	20	29628233	29628233	+	Missense_Mutation	SNP	A	A	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:29628233A>G	ENST00000278882.3	+	6	615	c.235A>G	c.(235-237)Atg>Gtg	p.M79V	FRG1B_ENST00000439954.2_Missense_Mutation_p.M84V|FRG1B_ENST00000358464.4_Missense_Mutation_p.M79V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	79										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TTAGGGGAAAATGGCTTTGTT	0.363																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			GGGAAAATGGCTT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.235A>G	20.37:g.29628233A>G	ENSP00000278882:p.Met79Val	705	9		722	22	.	0	0	0	0	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	3.138	-0.176853	0.06380	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	T	0.41065	1.01	2.08	2.08	0.27032	Actin cross-linking (1);	0.040228	0.85682	D	0.000000	T	0.23370	0.0565	.	.	.	0.41063	D	0.985397	B;B	0.17852	0.002;0.024	B;B	0.25140	0.03;0.058	T	0.04593	-1.0940	9	0.11794	T	0.64	.	8.0833	0.30758	1.0:0.0:0.0:0.0	.	84;79	F5H5R5;Q9BZ01	.;FRG1B_HUMAN	V	79;84;79	ENSP00000408863:M84V	ENSP00000278882:M79V	M	+	1	0	FRG1B	28241894	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	4.813000	0.62620	1.208000	0.43306	0.347000	0.21830	ATG	.		0.363	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
SRSF6	6431	broad.mit.edu	37	20	42086696	42086696	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:42086696G>T	ENST00000244020.3	+	1	129	c.23G>T	c.(22-24)cGc>cTc	p.R8L		NM_006275.5	NP_006266.2	Q13247	SRSF6_HUMAN	serine/arginine-rich splicing factor 6	8	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell death (GO:0060548)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of keratinocyte proliferation (GO:0010837)|regulation of wound healing (GO:0061041)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|upper_aerodigestive_tract(2)	5						TACATAGGACGCCTGAGCTAC	0.647																																					p.R8L		.											.	SRSF6-289	0			c.G23T						.						39.0	42.0	41.0					20																	42086696		2203	4300	6503	SO:0001583	missense	6431	exon1			TAGGACGCCTGAG	U30883	CCDS13318.1	20q12-q13.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000124193	ENSG00000124193		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10788	protein-coding gene	gene with protein product	"""pre-mRNA splicing factor SRP55"", ""SR splicing factor 6"""	601944	"""splicing factor, arginine/serine-rich 6"""	SFRS6		7556075, 20516191	Standard	NM_006275		Approved	SRP55, B52	uc010zwg.2	Q13247	OTTHUMG00000032502	ENST00000244020.3:c.23G>T	20.37:g.42086696G>T	ENSP00000244020:p.Arg8Leu	57	1		169	7	NM_006275	0	0	0	0	0	B7Z6J3|E1P5W6|Q13244|Q13245|Q96J06|Q9UJB8|Q9Y3N7	Missense_Mutation	SNP	ENST00000244020.3	37	CCDS13318.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779556	0.90195	.	.	ENSG00000124193	ENST00000244020	T	0.74632	-0.86	4.08	4.08	0.47627	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.85239	0.5651	M	0.78637	2.42	0.53688	D	0.999974	D;D	0.76494	0.999;0.998	D;D	0.79108	0.992;0.975	D	0.86277	0.1665	10	0.46703	T	0.11	.	15.2094	0.73206	0.0:0.0:1.0:0.0	.	8;8	Q13247;A8K588	SRSF6_HUMAN;.	L	8	ENSP00000244020:R8L	ENSP00000244020:R8L	R	+	2	0	SRSF6	41520110	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.001000	0.70685	2.078000	0.62432	0.655000	0.94253	CGC	.		0.647	SRSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079292.1	NM_006275	
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770159	48770159	+	Missense_Mutation	SNP	T	T	C	rs232733		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:48770159T>C	ENST00000341698.2	-	1	15	c.16A>G	c.(16-18)Aac>Gac	p.N6D	TMEM189_ENST00000371650.5_Missense_Mutation_p.N6D|TMEM189_ENST00000371652.4_Missense_Mutation_p.N6D|TMEM189_ENST00000557021.1_Missense_Mutation_p.N6D	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CCCGGCCAGTTCTCGGCGCCC	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		6103	1.0		1.0	False		,,,				2504	1.0				p.N6D		.											.	TMEM189-22	0			c.A16G						.						2.0	2.0	2.0					20																	48770159		1101	2248	3349	SO:0001583	missense	387521	exon1			GCCAGTTCTCGGC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.16A>G	20.37:g.48770159T>C	ENSP00000344166:p.Asn6Asp	0	0		5	5	NM_199129	0	0	0	0	0		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	2182	0.9990842490842491	492	1.0	360	0.994475138121547	572	1.0	758	1.0	C	0.054	-1.242740	0.01481	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.46819	0.86;0.86;1.11;1.11	3.81	0.707	0.18139	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40757	-0.9546	8	0.02654	T	1	.	3.4688	0.07559	0.1731:0.5239:0.0:0.303	rs232733;rs674252;rs56654084	6;6;6	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	D	6	ENSP00000344166:N6D;ENSP00000450635:N6D;ENSP00000360713:N6D;ENSP00000360715:N6D	ENSP00000360713:N6D	N	-	1	0	TMEM189-UBE2V1;TMEM189	48203566	1.000000	0.71417	0.503000	0.27626	0.073000	0.16967	0.497000	0.22514	-0.274000	0.09232	-2.268000	0.00277	AAC	C|0.999;T|0.001		0.766	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
EEF1A2	1917	hgsc.bcm.edu	37	20	62119708	62119708	+	Silent	SNP	G	G	A	rs372257864	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:62119708G>A	ENST00000298049.7	-	7	1405	c.1335C>T	c.(1333-1335)agC>agT	p.S445S	EEF1A2_ENST00000217182.3_Silent_p.S445S			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	445					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			CGGCGCCGCCGCTCTTCTTCT	0.751													g|||	38	0.00758786	0.0	0.0	5008	,	,		4388	0.0		0.002	False		,,,				2504	0.0368				p.S445S		.											.	EEF1A2-90	0			c.C1335T						.			1,3895		0,1,1947	7.0	6.0	7.0		1335	0.7	1.0	20		7	21,7681		0,21,3830	no	coding-synonymous	EEF1A2	NM_001958.2		0,22,5777	AA,AG,GG		0.2727,0.0257,0.1897		445/464	62119708	22,11576	1948	3851	5799	SO:0001819	synonymous_variant	1917	exon8			GCCGCCGCTCTTC	AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.1335C>T	20.37:g.62119708G>A		2	0		22	8	NM_001958	0	0	0	0	0	B5BUF3|E1P5J1|P54266|Q0VGC7	Silent	SNP	ENST00000298049.7	37	CCDS13522.1																																																																																			.		0.751	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080495.1	NM_001958	
SRMS	6725	bcgsc.ca	37	20	62173562	62173562	+	Silent	SNP	G	G	T	rs56130722	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:62173562G>T	ENST00000217188.1	-	5	940	c.900C>A	c.(898-900)atC>atA	p.I300I		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	300	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			GTTCCGTGACGATGTACACAG	0.672													G|||	1853	0.370008	0.0144	0.4784	5008	,	,		16702	0.9603		0.2167	False		,,,				2504	0.3231				p.I300I		.											.	SRMS-521	0			c.C900A						.	G		246,4154	141.9+/-177.2	6,234,1960	98.0	77.0	84.0		900	-0.2	1.0	20	dbSNP_129	84	1891,6709	336.0+/-321.7	213,1465,2622	no	coding-synonymous	SRMS	NM_080823.2		219,1699,4582	TT,TG,GG		21.9884,5.5909,16.4385		300/489	62173562	2137,10863	2200	4300	6500	SO:0001819	synonymous_variant	6725	exon5			CGTGACGATGTAC		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.900C>A	20.37:g.62173562G>T		118	1		239	10	NM_080823	0	0	0	0	0		Silent	SNP	ENST00000217188.1	37	CCDS13525.1																																																																																			G|0.767;T|0.233		0.672	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823	
RTEL1	51750	broad.mit.edu	37	20	62321687	62321687	+	Missense_Mutation	SNP	G	G	T	rs369014080		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr20:62321687G>T	ENST00000360203.5	+	26	2631	c.2306G>T	c.(2305-2307)cGt>cTt	p.R769L	RTEL1_ENST00000370003.1_Missense_Mutation_p.R14L|RTEL1_ENST00000508582.2_Missense_Mutation_p.R793L|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.R769L|RTEL1_ENST00000370018.3_Missense_Mutation_p.R769L|RTEL1_ENST00000318100.4_Missense_Mutation_p.R769L					regulator of telomere elongation helicase 1									p.R769H(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CCCAGTGTGCGTGGAGAAGAT	0.627																																					p.R793L		.											.	RTEL1-44	1	Substitution - Missense(1)	central_nervous_system(1)	c.G2378T						.						44.0	46.0	45.0					20																	62321687		2198	4294	6492	SO:0001583	missense	51750	exon26			GTGTGCGTGGAGA	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2306G>T	20.37:g.62321687G>T	ENSP00000353332:p.Arg769Leu	58	0		39	3	NM_032957	0	0	0	0	0		Missense_Mutation	SNP	ENST00000360203.5	37		.	.	.	.	.	.	.	.	.	.	G	8.338	0.827998	0.16749	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000425905;ENST00000370003	T;T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94;3.03	4.16	2.18	0.27775	.	1.208090	0.05740	N	0.601203	T	0.04815	0.0130	N	0.08118	0	0.09310	N	1	B;B;B;B	0.14438	0.001;0.001;0.006;0.01	B;B;B;B	0.09377	0.001;0.0;0.001;0.004	T	0.43130	-0.9410	10	0.11794	T	0.64	-1.2921	2.3071	0.04177	0.1138:0.2243:0.4834:0.1785	.	793;14;769;769	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	L	769;769;793;769;162;14	ENSP00000359035:R769L;ENSP00000322287:R769L;ENSP00000424307:R793L;ENSP00000353332:R769L;ENSP00000388063:R162L;ENSP00000359020:R14L	ENSP00000353332:R769L	R	+	2	0	AL353715.1	61792131	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.019000	0.12546	0.399000	0.25367	0.563000	0.77884	CGT	.		0.627	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
CLIC6	54102	hgsc.bcm.edu	37	21	36042579	36042579	+	Missense_Mutation	SNP	C	C	G	rs13049028	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr21:36042579C>G	ENST00000360731.3	+	1	892	c.892C>G	c.(892-894)Caa>Gaa	p.Q298E	CLIC6_ENST00000349499.2_Missense_Mutation_p.Q298E			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	298						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						TGAGCCGCAGCAATCGGGGGA	0.756													G|||	1116	0.222843	0.2648	0.1657	5008	,	,		8796	0.1825		0.2137	False		,,,				2504	0.2577				p.Q298E		.											.	CLIC6-91	0			c.C892G						.	G	GLU/GLN	454,2348		41,372,988	2.0	2.0	2.0		892	-0.8	0.0	21	dbSNP_121	2	925,5025		74,777,2124	no	missense	CLIC6	NM_053277.1	29	115,1149,3112	GG,GC,CC		15.5462,16.2027,15.7564	benign	298/687	36042579	1379,7373	1401	2975	4376	SO:0001583	missense	54102	exon1			CCGCAGCAATCGG	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.892C>G	21.37:g.36042579C>G	ENSP00000353959:p.Gln298Glu	1	0		25	21	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Missense_Mutation	SNP	ENST00000360731.3	37		434	0.1987179487179487	125	0.2540650406504065	63	0.17403314917127072	81	0.14160839160839161	165	0.21767810026385223	G	0.195	-1.050076	0.01981	0.162027	0.155462	ENSG00000159212	ENST00000360731;ENST00000349499	T;T	0.21361	2.02;2.01	3.75	-0.792	0.10925	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43861	-0.9365	8	0.02654	T	1	-10.3162	7.3436	0.26650	0.1642:0.3831:0.4527:0.0	rs13049028	298;298	Q96NY7;Q96NY7-2	CLIC6_HUMAN;.	E	298	ENSP00000353959:Q298E;ENSP00000290332:Q298E	ENSP00000290332:Q298E	Q	+	1	0	CLIC6	34964449	0.256000	0.24012	0.012000	0.15200	0.009000	0.06853	0.804000	0.27098	-0.082000	0.12640	-0.676000	0.03789	CAA	C|0.802;G|0.198		0.756	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		1	0		27	23	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
KRTAP10-7	386675	broad.mit.edu	37	21	46020656	46020670	+	In_Frame_Del	DEL	CTGCTGCGCCCCCAG	CTGCTGCGCCCCCAG	-	rs36208679|rs60739860|rs373191083		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr21:46020656_46020670delCTGCTGCGCCCCCAG	ENST00000380102.2	+	1	160_174	c.135_149delCTGCTGCGCCCCCAG	c.(133-150)ccctgctgcgcccccagc>ccc	p.CCAPS46del	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	46	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S50_P54delSCCAP(1)		breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GCGAGCCCCCCTGCTGCGCCCCCAGCTGCTGCGCC	0.698																																					.		.											.	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	.						.		,	2258,1042		849,560,241					,	-0.7	1.0		dbSNP_126	22	6001,1123		2605,791,166	no	coding,intron	TSPEAR,KRTAP10-7	NM_198689.2,NM_144991.2	,	3454,1351,407	A1A1,A1R,RR		15.7636,31.5758,20.7694	,	,		8259,2165				SO:0001651	inframe_deletion	386675	.			GCCCCCCTGCTGC	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.135_149delCTGCTGCGCCCCCAG	21.37:g.46020656_46020670delCTGCTGCGCCCCCAG	ENSP00000369445:p.Cys46_Ser50del	23	0		108	10	.	0	0	0	0	0	Q0VDJ8|Q70LJ2	Splice_Site	DEL	ENST00000380102.2	37																																																																																				.		0.698	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
GNB1L	54584	broad.mit.edu	37	22	19794180	19794180	+	Splice_Site	SNP	A	A	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr22:19794180A>C	ENST00000329517.6	-	6	753		c.e6+1		GNB1L_ENST00000403325.1_Splice_Site|GNB1L_ENST00000405009.1_Splice_Site|GNB1L_ENST00000460402.1_Splice_Site	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					GCGGGGCCTTACCTGCCACAG	0.617																																					.		.											.	GNB1L-290	0			c.516+2T>G						.						32.0	27.0	29.0					22																	19794180		2202	4300	6502	SO:0001630	splice_region_variant	54584	exon7			GGCCTTACCTGCC	AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.516+1T>G	22.37:g.19794180A>C		52	1		184	34	NM_053004	0	0	0	0	0	Q9H2S2|Q9H4M4	Splice_Site	SNP	ENST00000329517.6	37	CCDS13768.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.952684	0.92660	.	.	ENSG00000185838	ENST00000329517;ENST00000403325;ENST00000405009	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0843	0.72138	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GNB1L	18174180	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.911000	0.87458	1.962000	0.57031	0.533000	0.62120	.	.		0.617	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075202.1		Intron
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		0	0		6	6	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		0	0		10	10	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
RASL10A	10633	hgsc.bcm.edu	37	22	29711161	29711161	+	Silent	SNP	C	C	A	rs529801225	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr22:29711161C>A	ENST00000216101.6	-	1	584	c.75G>T	c.(73-75)ctG>ctT	p.L25L	RASL10A_ENST00000608559.1_Intron|RASL10A_ENST00000401450.3_Silent_p.L25L|AC002059.10_ENST00000608014.1_RNA	NM_006477.4	NP_006468.1	Q92737	RSLAA_HUMAN	RAS-like, family 10, member A	25	Small GTPase-like.			L -> V (in Ref. 3; AAH22473). {ECO:0000305}.	small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)	1						AGTCACCGAACAGGAACTGGC	0.741													C|||	2	0.000399361	0.0	0.0	5008	,	,		10093	0.002		0.0	False		,,,				2504	0.0				p.L25L		.											.	RASL10A-659	0			c.G75T						.						6.0	6.0	6.0					22																	29711161		2061	4079	6140	SO:0001819	synonymous_variant	10633	exon1			ACCGAACAGGAAC	Y07847	CCDS13854.1	22q12.2	2014-05-09			ENSG00000100276	ENSG00000100276			16954	protein-coding gene	gene with protein product		602220				8975699, 15731001	Standard	NM_006477		Approved	RRP22	uc031rxl.1	Q92737	OTTHUMG00000151106	ENST00000216101.6:c.75G>T	22.37:g.29711161C>A		0	0		17	7	NM_006477	0	0	0	0	0	Q49AU5|Q6PI03	Silent	SNP	ENST00000216101.6	37	CCDS13854.1																																																																																			.		0.741	RASL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321342.1		
SH3BP1	23616	hgsc.bcm.edu	37	22	38051355	38051355	+	Silent	SNP	G	G	A	rs762989	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr22:38051355G>A	ENST00000357436.4	+	18	2083	c.1770G>A	c.(1768-1770)ccG>ccA	p.P590P	SH3BP1_ENST00000599616.1_Intron|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	590					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CTCCAGCCCCGCCCTTGCCCC	0.741													G|||	975	0.194688	0.2867	0.3055	5008	,	,		4753	0.0833		0.1799	False		,,,				2504	0.1217				p.P590P		.											.	SH3BP1-90	0			c.G1770A						.	G		606,2448		46,514,967	3.0	4.0	4.0		1770	-1.0	0.0	22	dbSNP_86	4	739,5643		39,661,2491	no	coding-synonymous	SH3BP1	NM_018957.3		85,1175,3458	AA,AG,GG		11.5794,19.8428,14.2539		590/702	38051355	1345,8091	1527	3191	4718	SO:0001819	synonymous_variant	23616	exon18			AGCCCCGCCCTTG		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1770G>A	22.37:g.38051355G>A		0	0		17	7	NM_018957	0	0	0	0	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Silent	SNP	ENST00000357436.4	37	CCDS13952.2																																																																																			G|0.825;A|0.175		0.741	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	0	0		35	19	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
GALR3	8484	hgsc.bcm.edu	37	22	38221072	38221072	+	Silent	SNP	G	G	A	rs370236739	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr22:38221072G>A	ENST00000249041.2	+	2	727	c.702G>A	c.(700-702)ggG>ggA	p.G234G		NM_003614.1	NP_003605.1	O60755	GALR3_HUMAN	galanin receptor 3	234					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|learning or memory (GO:0007611)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|peptide hormone binding (GO:0017046)			endometrium(1)|liver(2)|lung(1)	4	Melanoma(58;0.045)					gccgcgcggggcgcgccATGC	0.791													G|||	102	0.0203674	0.0008	0.0043	5008	,	,		4492	0.0883		0.003	False		,,,				2504	0.0061				p.G234G		.											.	GALR3-90	0			c.G702A						.						2.0	2.0	2.0					22																	38221072		1088	2024	3112	SO:0001819	synonymous_variant	8484	exon2			CGCGGGGCGCGCC	AF073799	CCDS13958.1	22q113.1	2012-08-08			ENSG00000128310	ENSG00000128310		"""GPCR / Class A : Galanin receptors"""	4134	protein-coding gene	gene with protein product		603692				9722565, 9832121	Standard	NM_003614		Approved		uc003aub.1	O60755	OTTHUMG00000150658	ENST00000249041.2:c.702G>A	22.37:g.38221072G>A		0	0		7	6	NM_003614	0	0	0	0	0	Q53YJ4	Silent	SNP	ENST00000249041.2	37	CCDS13958.1																																																																																			.		0.791	GALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319452.1		
FANCD2	2177	bcgsc.ca	37	3	10108898	10108898	+	Silent	SNP	A	A	G	rs77246387		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:10108898A>G	ENST00000419585.1	+	26	2552	c.2391A>G	c.(2389-2391)gtA>gtG	p.V797V	FANCD2_ENST00000287647.3_Silent_p.V797V|FANCD2_ENST00000383807.1_Silent_p.V797V|FANCD2_ENST00000383806.1_Silent_p.V797V			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	797					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.V797V(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TGCAGATTGTAAATGCCTTCT	0.368			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.V797V		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2-229	1	Substitution - coding silent(1)	prostate(1)	c.A2391G						.						72.0	63.0	66.0					3																	10108898		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon26	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GATTGTAAATGCC	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2391A>G	3.37:g.10108898A>G		69	0		94	6	NM_001018115	0	0	0	0	0	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																			A|0.909;G|0.091		0.368	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
FANCD2	2177	bcgsc.ca	37	3	10108913	10108913	+	Missense_Mutation	SNP	G	G	T	rs80258959		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:10108913G>T	ENST00000419585.1	+	26	2567	c.2406G>T	c.(2404-2406)caG>caT	p.Q802H	FANCD2_ENST00000287647.3_Missense_Mutation_p.Q802H|FANCD2_ENST00000383807.1_Missense_Mutation_p.Q802H|FANCD2_ENST00000383806.1_Missense_Mutation_p.Q802H			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	802					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.Q802H(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCTTCTGCCAGGAAACATCAC	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.Q802H		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2-229	2	Substitution - Missense(2)	prostate(2)	c.G2406T						.						82.0	72.0	75.0					3																	10108913		2203	4300	6503	SO:0001583	missense	2177	exon26	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CTGCCAGGAAACA	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2406G>T	3.37:g.10108913G>T	ENSP00000398754:p.Gln802His	88	0		130	6	NM_001018115	0	0	0	0	0	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	37	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373535	0.61624	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.44	1.83	0.25207	.	0.551240	0.20789	N	0.085651	T	0.50240	0.1604	M	0.63428	1.95	0.30837	N	0.736052	P;P	0.50710	0.938;0.938	P;P	0.53988	0.739;0.739	T	0.53229	-0.8468	10	0.54805	T	0.06	.	3.6289	0.08124	0.3156:0.0:0.4962:0.1881	.	802;802	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	H	802	ENSP00000287647:Q802H;ENSP00000373318:Q802H;ENSP00000373317:Q802H;ENSP00000398754:Q802H	ENSP00000287647:Q802H	Q	+	3	2	FANCD2	10083913	0.804000	0.28969	0.409000	0.26459	0.904000	0.53231	1.055000	0.30467	0.519000	0.28406	0.585000	0.79938	CAG	G|0.990;T|0.010		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
CRTAP	10491	hgsc.bcm.edu	37	3	33155738	33155738	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:33155738G>A	ENST00000320954.6	+	1	268	c.169G>A	c.(169-171)Ggc>Agc	p.G57S	CRTAP_ENST00000449224.1_Missense_Mutation_p.G57S	NM_006371.4	NP_006362.1	O75718	CRTAP_HUMAN	cartilage associated protein	57					chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation to 3-hydroxy-L-proline (GO:0018400)|protein stabilization (GO:0050821)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|macromolecular complex (GO:0032991)|proteinaceous extracellular matrix (GO:0005578)	protein complex binding (GO:0032403)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9						CAAGTACAGCGGCGAGCACTG	0.687																																					p.G57S		.											.	CRTAP-90	0			c.G169A						.						9.0	8.0	9.0					3																	33155738		2114	4136	6250	SO:0001583	missense	10491	exon1			TACAGCGGCGAGC	AJ006470	CCDS2657.1	3p22	2014-09-17			ENSG00000170275	ENSG00000170275			2379	protein-coding gene	gene with protein product	"""leprecan-like 3"""	605497				9217321, 10429950	Standard	NM_006371		Approved	CASP, LEPREL3	uc003cfl.4	O75718	OTTHUMG00000130746	ENST00000320954.6:c.169G>A	3.37:g.33155738G>A	ENSP00000323696:p.Gly57Ser	5	0		68	9	NM_006371	0	0	0	0	0	B2RBL6	Missense_Mutation	SNP	ENST00000320954.6	37	CCDS2657.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.607817	0.28623	.	.	ENSG00000170275	ENST00000320954;ENST00000509775;ENST00000539684;ENST00000449224;ENST00000423366	T;T	0.36699	1.24;1.24	4.24	1.24	0.21308	.	0.485939	0.22457	N	0.059817	T	0.19005	0.0456	L	0.33485	1.01	0.28013	N	0.93482	B;B	0.27971	0.086;0.196	B;B	0.24155	0.035;0.051	T	0.19582	-1.0301	10	0.09338	T	0.73	-3.9623	5.2773	0.15657	0.3732:0.16:0.4668:0.0	.	57;57	C9JP16;O75718	.;CRTAP_HUMAN	S	57	ENSP00000323696:G57S;ENSP00000409997:G57S	ENSP00000323696:G57S	G	+	1	0	CRTAP	33130742	0.870000	0.30015	1.000000	0.80357	0.107000	0.19398	0.713000	0.25794	0.430000	0.26230	0.467000	0.42956	GGC	.		0.687	CRTAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253246.3		
FBXL2	25827	broad.mit.edu	37	3	33339167	33339167	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:33339167C>A	ENST00000484457.1	+	2	106	c.15C>A	c.(13-15)aaC>aaA	p.N5K	FBXL2_ENST00000542085.1_5'UTR|FBXL2_ENST00000283627.6_3'UTR|FBXL2_ENST00000446237.3_5'UTR|FBXL2_ENST00000538892.1_Missense_Mutation_p.N5K|FBXL2_ENST00000538181.1_5'UTR|FBXL2_ENST00000507198.1_Missense_Mutation_p.N5K	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2											endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						TTTTCTCAAACAATGATGAAG	0.284																																					p.N5K		.											.	FBXL2-289	0			c.C15A						.						51.0	52.0	52.0					3																	33339167		2201	4296	6497	SO:0001583	missense	25827	exon2			CTCAAACAATGAT	AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.15C>A	3.37:g.33339167C>A	ENSP00000417601:p.Asn5Lys	96	1		64	4	NM_012157	0	0	0	0	0		Missense_Mutation	SNP	ENST00000484457.1	37	CCDS2658.1	.	.	.	.	.	.	.	.	.	.	C	9.488	1.100020	0.20552	.	.	ENSG00000153558	ENST00000484457;ENST00000538892;ENST00000507198	T;T;T	0.11169	2.8;3.53;3.53	4.76	2.78	0.32641	.	0.047644	0.85682	D	0.000000	T	0.07279	0.0184	N	0.26042	0.785	0.80722	D	1	B	0.16396	0.017	B	0.26094	0.066	T	0.27468	-1.0073	10	0.40728	T	0.16	.	4.473	0.11722	0.0:0.5744:0.0:0.4256	.	5	Q9UKC9	FBXL2_HUMAN	K	5	ENSP00000417601:N5K;ENSP00000441228:N5K;ENSP00000426163:N5K	ENSP00000408895:N5K	N	+	3	2	FBXL2	33314171	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	0.473000	0.22132	0.562000	0.29204	0.591000	0.81541	AAC	.		0.284	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253245.2	NM_012157	
TOPAZ1	375337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	44283769	44283769	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:44283769G>C	ENST00000309765.4	+	1	392	c.224G>C	c.(223-225)gGa>gCa	p.G75A		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	75						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										TCAGGGGCTGGAAAGGCCGCA	0.637																																					p.G75A		.											.	.	0			c.G224C						.						34.0	38.0	37.0					3																	44283769		692	1591	2283	SO:0001583	missense	375337	exon1			GGGCTGGAAAGGC	AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.224G>C	3.37:g.44283769G>C	ENSP00000310303:p.Gly75Ala	174	0		353	80	NM_001145030	0	0	0	0	0		Missense_Mutation	SNP	ENST00000309765.4	37	CCDS46809.1	.	.	.	.	.	.	.	.	.	.	G	0.386	-0.926100	0.02377	.	.	ENSG00000173769	ENST00000309765	T	0.09630	2.96	3.01	1.2	0.21068	.	0.283950	0.26369	N	0.024765	T	0.04679	0.0127	N	0.19112	0.55	0.09310	N	1	B	0.33612	0.419	B	0.28553	0.091	T	0.40794	-0.9544	10	0.16896	T	0.51	-1.3379	5.0029	0.14273	0.2857:0.0:0.7143:0.0	.	75	Q8N9V7	CC077_HUMAN	A	75	ENSP00000310303:G75A	ENSP00000310303:G75A	G	+	2	0	C3orf77	44258773	0.910000	0.30920	0.003000	0.11579	0.016000	0.09150	0.666000	0.25097	0.316000	0.23135	-0.216000	0.12614	GGA	.		0.637	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343247.1	NM_001145030	
RHOA	387	broad.mit.edu	37	3	49395674	49395679	+	IGR	DEL	GCCGCC	GCCGCC	-	rs71077799|rs56041243|rs139760138|rs17838762	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:49395674_49395679delGCCGCC	ENST00000418115.1	-	0	2031				GPX1_ENST00000419783.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000419349.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000496791.1_5'UTR	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.A12_A13delAA(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CACCGACTGGgccgccgccgccgccg	0.694																																					.		.											.	GPX1-68	1	Deletion - In frame(1)	breast(1)	.						.		,	23,168,347		11,0,1,79,10,168					,	-0.2	0.0		dbSNP_123	2	116,720,1030		46,10,14,333,44,486	no	codingComplex,codingComplex	GPX1	NM_201397.1,NM_000581.2	,	57,10,15,412,54,654	A1A1,A1A2,A1R,A2A2,A2R,RR		44.8017,35.5019,42.7205	,	,		139,888,1377				SO:0001628	intergenic_variant	2876	.			GACTGGGCCGCCG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395680_49395685delGCCGCC		4	0		56	18	.	0	0	0	0	0	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	In_Frame_Del	DEL	ENST00000418115.1	37	CCDS2795.1																																																																																			.		0.694	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
ZMYND10	51364	hgsc.bcm.edu	37	3	50378176	50378176	+	IGR	SNP	T	T	G	rs4688725	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:50378176T>G	ENST00000231749.3	-	0	2896				ZMYND10-AS1_ENST00000440013.1_RNA|RASSF1_ENST00000359365.4_Missense_Mutation_p.K21Q|RASSF1_ENST00000488024.1_5'UTR|RASSF1_ENST00000395126.3_5'Flank|RASSF1_ENST00000357043.2_Missense_Mutation_p.K21Q|ZMYND10_ENST00000490675.1_5'Flank	NM_015896.2	NP_056980.2	O75800	ZMY10_HUMAN	zinc finger, MYND-type containing 10						inner dynein arm assembly (GO:0036159)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)	centriolar satellite (GO:0034451)|cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|urinary_tract(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GTGCGGCCCTTCCCAGCGCGC	0.736										TSP Lung(30;0.18)			G|||	1175	0.234625	0.2436	0.2954	5008	,	,		13606	0.62		0.0119	False		,,,				2504	0.0112				p.K21Q		.											.	RASSF1-417	0			c.A61C						.	G	,GLN/LYS,GLN/LYS	402,2740		7,388,1176	2.0	3.0	3.0		,61,61	4.5	0.0	3	dbSNP_111	3	24,6908		0,24,3442	no	utr-5,missense,missense	RASSF1	NM_001206957.1,NM_007182.4,NM_170714.1	,53,53	7,412,4618	GG,GT,TT		0.3462,12.7944,4.2287	,benign,benign	,21/341,21/345	50378176	426,9648	1571	3466	5037	SO:0001628	intergenic_variant	11186	exon1			GGCCCTTCCCAGC	U70824	CCDS2825.1	3p21.3	2014-02-03			ENSG00000004838	ENSG00000004838		"""Zinc fingers, MYND-type"""	19412	protein-coding gene	gene with protein product		607070				12629521, 23891469	Standard	NM_015896		Approved	BLU, CILD22	uc003dag.1	O75800	OTTHUMG00000156874		3.37:g.50378176T>G		0	0		7	4	NM_007182	0	0	0	0	0	A6NK41|B3KU54|O14570|O75801|Q53FE6|Q8N4R6|Q8NDN6	Missense_Mutation	SNP	ENST00000231749.3	37	CCDS2825.1	588	0.2692307692307692	154	0.3130081300813008	87	0.24033149171270718	338	0.5909090909090909	9	0.011873350923482849	G	1.302	-0.604589	0.03717	0.127944	0.003462	ENSG00000068028	ENST00000357043;ENST00000359365	T;T	0.76448	-1.02;-1.01	5.35	4.48	0.54585	.	1.004080	0.08017	N	0.991328	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.12766	T	0.61	-7.5566	7.9536	0.30029	0.0764:0.0:0.6392:0.2844	rs4688725	21;21;21	B4DVA1;Q9NS23-2;Q9NS23	.;.;RASF1_HUMAN	Q	21	ENSP00000349547:K21Q;ENSP00000352323:K21Q	ENSP00000349547:K21Q	K	-	1	0	RASSF1	50353180	0.003000	0.15002	0.029000	0.17559	0.010000	0.07245	0.412000	0.21131	0.652000	0.30806	-0.121000	0.15023	AAG	T|0.731;G|0.269		0.736	ZMYND10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346376.1	NM_015896	
CACNA1D	776	broad.mit.edu	37	3	53529193	53529195	+	Start_Codon_Del	DEL	GAT	GAT	-			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:53529193_53529195delGAT	ENST00000350061.5	+	0	511_513				CACNA1D_ENST00000288139.4_Start_Codon_Del|CACNA1D_ENST00000422281.2_Start_Codon_Del	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	aatgttcgtGgatgatgatgatg	0.581																																							.											.	CACNA1D-100	0									.																																			SO:0001582	initiator_codon_variant	776	wholegene			TTCGTGGATGATG	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278		3.37:g.53529202_53529204delGAT		231	0		743	9	NM_001128840	0	0	0	0	0	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Frame_Shift_Del	DEL	ENST00000350061.5	37	CCDS46848.1																																																																																			.		0.581	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350557.1	NM_000720	
CADPS	8618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	62631437	62631437	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:62631437C>G	ENST00000383710.4	-	6	1634	c.1285G>C	c.(1285-1287)Gag>Cag	p.E429Q	CADPS_ENST00000357948.3_Missense_Mutation_p.E429Q|CADPS_ENST00000490353.2_Missense_Mutation_p.E429Q|CADPS_ENST00000283269.9_Missense_Mutation_p.E429Q	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	429	C2.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TGTAGTTTCTCTCCTCCTTCC	0.443																																					p.E429Q		.											.	CADPS-281	0			c.G1285C						.						218.0	205.0	209.0					3																	62631437		2203	4300	6503	SO:0001583	missense	8618	exon6			GTTTCTCTCCTCC	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.1285G>C	3.37:g.62631437C>G	ENSP00000373215:p.Glu429Gln	150	0		217	53	NM_003716	0	0	0	0	0	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	ENST00000383710.4	37	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	16.66	3.185952	0.57909	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	T;T;T;T	0.70045	-0.45;-0.45;-0.45;0.76	5.44	5.44	0.79542	C2 calcium-dependent membrane targeting (1);	0.173178	0.50627	D	0.000109	T	0.70237	0.3201	M	0.69823	2.125	0.51767	D	0.999934	B;B;B	0.34290	0.036;0.447;0.006	B;B;B	0.36378	0.034;0.223;0.003	T	0.71988	-0.4426	10	0.54805	T	0.06	.	19.6287	0.95691	0.0:1.0:0.0:0.0	.	429;429;429	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	Q	429	ENSP00000373215:E429Q;ENSP00000350632:E429Q;ENSP00000283269:E429Q;ENSP00000418736:E429Q	ENSP00000283269:E429Q	E	-	1	0	CADPS	62606477	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.045000	0.49838	2.710000	0.92621	0.655000	0.94253	GAG	.		0.443	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
PTPLB	201562	hgsc.bcm.edu	37	3	123303824	123303824	+	Silent	SNP	A	A	G	rs112371142	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:123303824A>G	ENST00000383657.5	-	1	208	c.51T>C	c.(49-51)ggT>ggC	p.G17G	MYLK-AS1_ENST00000470449.1_RNA|MYLK-AS1_ENST00000463408.1_RNA|MYLK-AS1_ENST00000485162.1_RNA	NM_198402.3	NP_940684.1	Q6Y1H2	HACD2_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b	17	Poly-Gly.				fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)			kidney(2)	2				GBM - Glioblastoma multiforme(114;0.1)		cggccctgccaccgccgcccc	0.716													A|||	948	0.189297	0.211	0.2349	5008	,	,		9329	0.372		0.007	False		,,,				2504	0.1268				p.G17G		.											.	PTPLB-226	0			c.T51C						.	A		201,2695		1,199,1248	2.0	4.0	4.0		51	-0.6	0.4	3	dbSNP_132	4	22,6828		0,22,3403	no	coding-synonymous	PTPLB	NM_198402.3		1,221,4651	GG,GA,AA		0.3212,6.9406,2.2881		17/255	123303824	223,9523	1448	3425	4873	SO:0001819	synonymous_variant	201562	exon1			CCTGCCACCGCCG	AK074605	CCDS46895.1	3q21.1	2010-04-30			ENSG00000206527	ENSG00000206527			9640	protein-coding gene	gene with protein product		615939				15024066	Standard	NM_198402		Approved		uc003egj.2	Q6Y1H2	OTTHUMG00000159529	ENST00000383657.5:c.51T>C	3.37:g.123303824A>G		0	0		17	15	NM_198402	0	0	0	0	0		Silent	SNP	ENST00000383657.5	37	CCDS46895.1																																																																																			A|0.818;G|0.182		0.716	PTPLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356021.3	NM_198402	
MYLK	4638	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	123385189	123385189	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:123385189C>T	ENST00000475616.1	-	19	3707	c.3708G>A	c.(3706-3708)atG>atA	p.M1236I	MYLK_ENST00000346322.5_Missense_Mutation_p.M1167I|MYLK_ENST00000354792.5_Missense_Mutation_p.M36I|MYLK_ENST00000359169.1_Missense_Mutation_p.M1236I|MYLK_ENST00000510775.1_5'UTR|MYLK_ENST00000360772.3_Missense_Mutation_p.M1236I|MYLK_ENST00000360304.3_Missense_Mutation_p.M1236I			Q15746	MYLK_HUMAN	myosin light chain kinase	1236	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TCTGAGGGGGCATTGCTGAGG	0.557																																					p.M1236I		.											.	MYLK-365	0			c.G3708A						.						82.0	64.0	70.0					3																	123385189		2203	4300	6503	SO:0001583	missense	4638	exon22			AGGGGGCATTGCT	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3708G>A	3.37:g.123385189C>T	ENSP00000418335:p.Met1236Ile	60	0		92	26	NM_053025	0	0	0	0	0	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	37	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.413142	0.42817	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000354792;ENST00000475616;ENST00000508240	T;T;T;T;T;T;T	0.63417	-0.04;0.01;-0.04;0.0;0.21;0.01;1.28	5.66	3.69	0.42338	Immunoglobulin-like fold (1);	.	.	.	.	T	0.43853	0.1266	N	0.19112	0.55	0.32189	N	0.579401	B;B;B;B;B	0.21147	0.027;0.052;0.052;0.029;0.017	B;B;B;B;B	0.23574	0.028;0.047;0.028;0.047;0.013	T	0.47407	-0.9120	9	0.20046	T	0.44	.	8.5381	0.33375	0.2317:0.6835:0.0:0.0847	.	1236;1167;1236;1167;1236	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	I	1236;1236;1236;1167;36;1236;36	ENSP00000354004:M1236I;ENSP00000353452:M1236I;ENSP00000352088:M1236I;ENSP00000320622:M1167I;ENSP00000346846:M36I;ENSP00000418335:M1236I;ENSP00000422984:M36I	ENSP00000320622:M1167I	M	-	3	0	MYLK	124867879	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.157000	0.42320	1.407000	0.46875	-0.219000	0.12488	ATG	.		0.557	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
GP9	2815	broad.mit.edu	37	3	128780901	128780901	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:128780901G>T	ENST00000307395.4	+	3	541	c.319G>T	c.(319-321)Gcc>Tcc	p.A107S		NM_000174.3	NP_000165.1	P14770	GPIX_HUMAN	glycoprotein IX (platelet)	107	LRRCT.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|lung(4)	6					Quinine(DB00468)	CACGCCCGAGGCCCTGCTGCA	0.701																																					p.A107S		.											.	GP9-90	0			c.G319T						.						20.0	20.0	20.0					3																	128780901		2199	4296	6495	SO:0001583	missense	2815	exon3			CCCGAGGCCCTGC		CCDS3055.1	3q21.3	2014-09-17				ENSG00000169704		"""CD molecules"""	4444	protein-coding gene	gene with protein product		173515				2253772	Standard	XM_005247374		Approved	CD42a, GPIX	uc003elm.2	P14770		ENST00000307395.4:c.319G>T	3.37:g.128780901G>T	ENSP00000303942:p.Ala107Ser	23	1		131	13	NM_000174	0	0	0	0	0	Q14445|Q8N1D1|Q92525	Missense_Mutation	SNP	ENST00000307395.4	37	CCDS3055.1	.	.	.	.	.	.	.	.	.	.	G	6.262	0.416458	0.11870	.	.	ENSG00000169704	ENST00000307395	D	0.90069	-2.61	4.26	-0.227	0.13102	Cysteine-rich flanking region, C-terminal (1);	1.070780	0.07282	U	0.870998	T	0.72309	0.3444	N	0.05414	-0.055	0.09310	N	1	B	0.19445	0.036	B	0.18263	0.021	T	0.58211	-0.7676	10	0.17369	T	0.5	-0.9252	1.9494	0.03364	0.2082:0.1579:0.4733:0.1606	.	107	P14770	GPIX_HUMAN	S	107	ENSP00000303942:A107S	ENSP00000303942:A107S	A	+	1	0	GP9	130263591	0.000000	0.05858	0.002000	0.10522	0.150000	0.21749	0.045000	0.14013	0.051000	0.15978	0.462000	0.41574	GCC	.		0.701	GP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358428.1		
ATR	545	bcgsc.ca	37	3	142217537	142217537	+	Silent	SNP	A	A	G	rs2227932	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:142217537A>G	ENST00000350721.4	-	32	5581	c.5460T>C	c.(5458-5460)taT>taC	p.Y1820Y	ATR_ENST00000383101.3_Silent_p.Y1756Y	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1820	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TCAGTGAGTCATAAAAAGCTG	0.383								Other conserved DNA damage response genes					A|||	335	0.066893	0.0015	0.072	5008	,	,		18070	0.003		0.1272	False		,,,				2504	0.1554				p.Y1820Y		.											.	ATR-1139	0			c.T5460C						.	A		86,4320	72.0+/-110.0	1,84,2118	84.0	80.0	81.0		5460	5.1	1.0	3	dbSNP_98	81	913,7687	201.8+/-245.2	56,801,3443	no	coding-synonymous	ATR	NM_001184.3		57,885,5561	GG,GA,AA		10.6163,1.9519,7.6811		1820/2645	142217537	999,12007	2203	4300	6503	SO:0001819	synonymous_variant	545	exon32			TGAGTCATAAAAA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5460T>C	3.37:g.142217537A>G		163	1		128	6	NM_001184	0	0	0	0	0	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	37	CCDS3124.1																																																																																			T|0.295;G|0.053		0.383	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
MCF2L2	23101	bcgsc.ca	37	3	183027542	183027542	+	Missense_Mutation	SNP	T	T	G	rs7639705	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:183027542T>G	ENST00000328913.3	-	10	1372	c.1075A>C	c.(1075-1077)Att>Ctt	p.I359L	MCF2L2_ENST00000414362.2_Missense_Mutation_p.I359L|MCF2L2_ENST00000473233.1_Missense_Mutation_p.I359L|MCF2L2_ENST00000447025.2_Missense_Mutation_p.I359L	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	359			I -> L (in dbSNP:rs7639705). {ECO:0000269|PubMed:14702039}.				Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.I359L(1)		breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TCCTTAAGAATCTGCTCCACG	0.448													G|||	1675	0.334465	0.4244	0.2363	5008	,	,		17356	0.3562		0.2167	False		,,,				2504	0.3814				p.I359L		.											.	MCF2L2-293	1	Substitution - Missense(1)	stomach(1)	c.A1075C						.	G	LEU/ILE	1762,2644	645.6+/-398.2	377,1008,818	160.0	148.0	152.0		1075	3.8	0.0	3	dbSNP_116	152	1689,6911	738.6+/-407.1	170,1349,2781	yes	missense	MCF2L2	NM_015078.2	5	547,2357,3599	GG,GT,TT		19.6395,39.9909,26.5339	benign	359/1115	183027542	3451,9555	2203	4300	6503	SO:0001583	missense	23101	exon10			TAAGAATCTGCTC	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1075A>C	3.37:g.183027542T>G	ENSP00000328118:p.Ile359Leu	100	0		118	5	NM_015078	0	0	0	0	0	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	37	CCDS3243.1	637	0.2916666666666667	181	0.3678861788617886	96	0.26519337016574585	192	0.3356643356643357	168	0.22163588390501318	G	0.349	-0.945787	0.02304	0.399909	0.196395	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000414362	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	4.73	3.84	0.44239	.	0.066665	0.64402	N	0.000009	T	0.00012	0.0000	N	0.00456	-1.48	0.49483	P	2.0600000000003948E-4	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.44862	-0.9300	9	0.02654	T	1	.	14.0032	0.64446	0.0:0.0:0.7235:0.2765	rs7639705;rs17749805;rs52825331;rs61011857;rs7639705	359;359	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	L	359	ENSP00000328118:I359L;ENSP00000420070:I359L;ENSP00000388190:I359L;ENSP00000414131:I359L	ENSP00000328118:I359L	I	-	1	0	MCF2L2	184510236	1.000000	0.71417	0.037000	0.18230	0.074000	0.17049	3.804000	0.55568	0.706000	0.31912	-0.121000	0.15023	ATT	T|0.718;G|0.282		0.448	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
ATP13A5	344905	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	193039524	193039524	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:193039524C>A	ENST00000342358.4	-	16	1978	c.1861G>T	c.(1861-1863)Gtc>Ttc	p.V621F		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	621						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TTCATGTAGACATGGAAATGA	0.453																																					p.V621F		.											.	ATP13A5-144	0			c.G1861T						.						88.0	84.0	85.0					3																	193039524		2203	4300	6503	SO:0001583	missense	344905	exon16			TGTAGACATGGAA	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1861G>T	3.37:g.193039524C>A	ENSP00000341942:p.Val621Phe	111	0		89	35	NM_198505	0	0	0	0	0	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	37	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019972	0.35606	.	.	ENSG00000187527	ENST00000342358	T	0.71698	-0.59	5.82	4.05	0.47172	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.615971	0.16046	N	0.232167	T	0.74816	0.3766	M	0.72894	2.215	0.09310	N	0.999998	P	0.45126	0.851	P	0.50754	0.649	T	0.64516	-0.6389	10	0.45353	T	0.12	-8.7028	8.2015	0.31428	0.0:0.725:0.1298:0.1452	.	621	Q4VNC0	AT135_HUMAN	F	621	ENSP00000341942:V621F	ENSP00000341942:V621F	V	-	1	0	ATP13A5	194522218	0.221000	0.23642	0.044000	0.18714	0.083000	0.17756	2.000000	0.40816	0.822000	0.34565	-0.137000	0.14449	GTC	.		0.453	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		7	0		102	11	NM_175918	0	0	0	0	0	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1389148	1389148	+	Silent	SNP	T	T	C	rs35123539|rs79888804	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:1389148T>C	ENST00000324803.4	+	1	3809	c.849T>C	c.(847-849)caT>caC	p.H283H		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	283					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CCTGCTCACATGTGCCGATGT	0.682													c|||	53	0.0105831	0.0113	0.0086	5008	,	,		13167	0.006		0.0159	False		,,,				2504	0.0102				p.H283H		.											.	CRIPAK-90	0			c.T849C						.	C		48,4356		1,46,2155	141.0	138.0	139.0		849	-0.2	0.0	4	dbSNP_131	139	185,8415		4,177,4119	no	coding-synonymous	CRIPAK	NM_175918.3		5,223,6274	CC,CT,TT		2.1512,1.0899,1.7918		283/447	1389148	233,12771	2202	4300	6502	SO:0001819	synonymous_variant	285464	exon1			CTCACATGTGCCG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.849T>C	4.37:g.1389148T>C		5	0		165	18	NM_175918	0	0	0	0	0	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			T|0.980;C|0.020		0.682	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
BST1	683	hgsc.bcm.edu	37	4	15704874	15704874	+	Missense_Mutation	SNP	G	G	C	rs2302468	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:15704874G>C	ENST00000265016.4	+	1	302	c.107G>C	c.(106-108)gGg>gCg	p.G36A	BST1_ENST00000382346.3_Missense_Mutation_p.G36A	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	36				G -> A (in Ref. 1; BAA04885). {ECO:0000305}.	humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)			central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						cggtggcgcggggAGGGCACC	0.736													G|||	381	0.0760783	0.0212	0.0389	5008	,	,		9714	0.2103		0.008	False		,,,				2504	0.1084				p.G36A		.											.	BST1-90	0			c.G107C						.	G	ALA/GLY	23,3787		0,23,1882	3.0	4.0	4.0		107	3.4	1.0	4	dbSNP_100	4	19,7693		0,19,3837	no	missense	BST1	NM_004334.2	60	0,42,5719	CC,CG,GG		0.2464,0.6037,0.3645	possibly-damaging	36/319	15704874	42,11480	1905	3856	5761	SO:0001583	missense	683	exon1			GGCGCGGGGAGGG	D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.107G>C	4.37:g.15704874G>C	ENSP00000265016:p.Gly36Ala	0	0		6	6	NM_004334	0	0	0	0	0	B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Missense_Mutation	SNP	ENST00000265016.4	37	CCDS3416.1	141	0.06456043956043957	13	0.026422764227642278	10	0.027624309392265192	112	0.1958041958041958	6	0.0079155672823219	G	14.40	2.524166	0.44866	0.006037	0.002464	ENSG00000109743	ENST00000265016;ENST00000382346	T;T	0.17370	2.28;2.28	3.39	3.39	0.38822	.	0.510528	0.20699	N	0.087320	T	0.00039	0.0001	M	0.63843	1.955	0.36618	P	0.12441999999999998	D	0.76494	0.999	D	0.80764	0.994	T	0.04005	-1.0985	9	0.62326	D	0.03	-9.3919	10.4016	0.44233	0.0:0.0:1.0:0.0	rs2302468	36	Q10588	BST1_HUMAN	A	36	ENSP00000265016:G36A;ENSP00000371783:G36A	ENSP00000265016:G36A	G	+	2	0	BST1	15313972	0.859000	0.29813	0.955000	0.39395	0.020000	0.10135	2.992000	0.49417	1.879000	0.54435	0.462000	0.41574	GGG	G|0.084;C|0.916		0.736	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214968.2	NM_004334	
ENAM	10117	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71510524	71510524	+	Silent	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:71510524G>T	ENST00000396073.3	+	9	3662	c.3381G>T	c.(3379-3381)ggG>ggT	p.G1127G	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	1127					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			TTCAAAGAGGGACCAATGTAC	0.413																																					p.G1127G		.											.	ENAM-93	0			c.G3381T						.						84.0	77.0	79.0					4																	71510524		2203	4300	6503	SO:0001819	synonymous_variant	10117	exon9			AAGAGGGACCAAT	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.3381G>T	4.37:g.71510524G>T		389	1		556	89	NM_031889	0	0	0	0	0	Q17RI5|Q9H3D1	Silent	SNP	ENST00000396073.3	37	CCDS3544.2																																																																																			.		0.413	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
ANKRD17	26057	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74012588	74012588	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:74012588C>A	ENST00000358602.4	-	10	1878	c.1762G>T	c.(1762-1764)Gct>Tct	p.A588S	ANKRD17_ENST00000509867.2_Missense_Mutation_p.A475S|ANKRD17_ENST00000330838.6_Missense_Mutation_p.A588S|ANKRD17_ENST00000514252.1_5'UTR	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	588					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGAACGTTAGCTCCTGTAGTA	0.388																																					p.A588S		.											.	ANKRD17-234	0			c.G1762T						.						129.0	112.0	118.0					4																	74012588		2203	4300	6503	SO:0001583	missense	26057	exon10			CGTTAGCTCCTGT	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.1762G>T	4.37:g.74012588C>A	ENSP00000351416:p.Ala588Ser	107	1		206	32	NM_198889	0	0	0	0	0	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Missense_Mutation	SNP	ENST00000358602.4	37	CCDS34004.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930049	0.92389	.	.	ENSG00000132466	ENST00000358602;ENST00000426990;ENST00000330838;ENST00000509867;ENST00000411811	T;T;T	0.34072	1.38;1.38;1.38	5.11	5.11	0.69529	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000005	T	0.55481	0.1923	L	0.48218	1.51	0.43347	D	0.995404	D;P;D;P;B	0.63046	0.992;0.633;0.978;0.793;0.024	D;B;D;P;B	0.79784	0.993;0.42;0.961;0.798;0.103	T	0.55915	-0.8065	10	0.59425	D	0.04	.	18.8987	0.92433	0.0:1.0:0.0:0.0	.	109;588;588;588;475	B4DR08;O75179-2;G5E964;O75179;E7EUV3	.;.;.;ANR17_HUMAN;.	S	588;588;588;475;588	ENSP00000351416:A588S;ENSP00000332265:A588S;ENSP00000427151:A475S	ENSP00000332265:A588S	A	-	1	0	ANKRD17	74231452	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.336000	0.79245	2.536000	0.85505	0.655000	0.94253	GCT	.		0.388	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
DSPP	1834	bcgsc.ca	37	4	88537027	88537027	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:88537027C>A	ENST00000282478.7	+	4	3246	c.3213C>A	c.(3211-3213)gaC>gaA	p.D1071E	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1071E			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1071	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.542																																					p.D1071E		.											.	DSPP-90	0			c.C3213A						.						56.0	66.0	63.0					4																	88537027		1577	2848	4425	SO:0001583	missense	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3213C>A	4.37:g.88537027C>A	ENSP00000282478:p.Asp1071Glu	603	12		835	22	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	c	2.636	-0.285341	0.05605	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88124	-2.34;-2.34	1.15	-2.31	0.06765	.	.	.	.	.	T	0.69196	0.3084	L	0.38175	1.15	0.09310	N	1	P	0.46952	0.887	B	0.36766	0.232	T	0.66364	-0.5942	9	0.02654	T	1	.	2.058	0.03586	0.2533:0.3578:0.0:0.3889	.	1071	Q9NZW4	DSPP_HUMAN	E	1071	ENSP00000382213:D1071E;ENSP00000282478:D1071E	ENSP00000282478:D1071E	D	+	3	2	DSPP	88756051	0.029000	0.19370	0.018000	0.16275	0.040000	0.13550	-0.117000	0.10708	-0.986000	0.03498	0.282000	0.19409	GAC	.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
CCSER1	401145	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	91234151	91234151	+	Silent	SNP	T	T	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:91234151T>C	ENST00000509176.1	+	3	1750	c.1462T>C	c.(1462-1464)Tta>Cta	p.L488L	CCSER1_ENST00000432775.2_Silent_p.L488L|CCSER1_ENST00000333691.8_Silent_p.L488L	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	488																	AGTTAATAGTTTAAGAAAGCA	0.363																																					p.L488L		.											.	.	0			c.T1462C						.						36.0	37.0	37.0					4																	91234151		1836	4078	5914	SO:0001819	synonymous_variant	401145	exon3			AATAGTTTAAGAA		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.1462T>C	4.37:g.91234151T>C		87	0		120	9	NM_001145065	0	0	0	0	0	Q4W5M0|Q86V57	Silent	SNP	ENST00000509176.1	37	CCDS47099.1																																																																																			.		0.363	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
ADH5	128	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	99996090	99996090	+	Silent	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:99996090G>A	ENST00000296412.8	-	7	986	c.936C>T	c.(934-936)cgC>cgT	p.R312R	ADH5_ENST00000512991.1_5'Flank	NM_000671.3	NP_000662.3			alcohol dehydrogenase 5 (class III), chi polypeptide											endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)		CTTTCCATGTGCGACCTGTTA	0.498																																					p.R312R		.											.	ADH5-227	0			c.C936T						.						205.0	208.0	207.0					4																	99996090		2110	4238	6348	SO:0001819	synonymous_variant	128	exon7			CCATGTGCGACCT	M29872	CCDS47111.1	4q23	2012-07-13	2003-06-19		ENSG00000197894	ENSG00000197894	1.1.1.284	"""Alcohol dehydrogenases"""	253	protein-coding gene	gene with protein product		103710	"""formaldehyde dehydrogenase"""	FDH		1446828, 6424546	Standard	NM_000671		Approved	ADH-3, ADHX	uc003hui.3	P11766	OTTHUMG00000161230	ENST00000296412.8:c.936C>T	4.37:g.99996090G>A		435	0		664	49	NM_000671	0	0	0	0	0		Silent	SNP	ENST00000296412.8	37	CCDS47111.1																																																																																			.		0.498	ADH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364224.1	NM_000671	
INTU	27152	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	128608947	128608947	+	Silent	SNP	G	G	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:128608947G>A	ENST00000335251.6	+	8	1477	c.1374G>A	c.(1372-1374)caG>caA	p.Q458Q		NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	458					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						GTGCTCAGCAGTACGATGCTT	0.453																																					p.Q458Q		.											.	INTU-91	0			c.G1374A						.						108.0	101.0	103.0					4																	128608947		2203	4300	6503	SO:0001819	synonymous_variant	27152	exon8			TCAGCAGTACGAT	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1374G>A	4.37:g.128608947G>A		77	0		110	19	NM_015693	0	0	0	0	0	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Silent	SNP	ENST00000335251.6	37	CCDS34061.1																																																																																			.		0.453	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
GRIA2	2891	hgsc.bcm.edu	37	4	158256822	158256822	+	Splice_Site	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:158256822G>T	ENST00000264426.9	+	10	1545		c.e10-1		GRIA2_ENST00000449365.1_Splice_Site|GRIA2_ENST00000393815.2_Splice_Site|GRIA2_ENST00000507898.1_Splice_Site|GRIA2_ENST00000296526.7_Splice_Site	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2						ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTTTCATATAGGAATCTCCGT	0.363																																					.		.											.	GRIA2-515	0			c.1267-1G>T						.						59.0	57.0	57.0					4																	158256822		2203	4299	6502	SO:0001630	splice_region_variant	2891	exon10			CATATAGGAATCT		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.1267-1G>T	4.37:g.158256822G>T		120	0		89	5	NM_001083619	0	0	0	0	0	A8MT92|I6L997|Q96FP6	Splice_Site	SNP	ENST00000264426.9	37	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.278072	0.80692	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIA2	158476272	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.813000	0.99286	2.937000	0.99478	0.650000	0.86243	.	.		0.363	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		Intron
DDX60	55601	bcgsc.ca	37	4	169188780	169188780	+	Missense_Mutation	SNP	T	T	C	rs576619	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr4:169188780T>C	ENST00000393743.3	-	22	3283	c.2992A>G	c.(2992-2994)Att>Gtt	p.I998V		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	998			I -> V (in dbSNP:rs576619).		defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TCAAAATGAATGTCACCATGT	0.303													T|||	406	0.0810703	0.1467	0.085	5008	,	,		14209	0.0		0.0994	False		,,,				2504	0.0542				p.I998V		.											.	DDX60-25	0			c.A2992G						.	T	VAL/ILE	520,3886	239.6+/-250.7	31,458,1714	115.0	106.0	109.0		2992	-5.7	0.0	4	dbSNP_83	109	661,7939	166.8+/-218.7	21,619,3660	yes	missense	DDX60	NM_017631.5	29	52,1077,5374	CC,CT,TT		7.686,11.8021,9.0804	benign	998/1713	169188780	1181,11825	2203	4300	6503	SO:0001583	missense	55601	exon22			AATGAATGTCACC	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.2992A>G	4.37:g.169188780T>C	ENSP00000377344:p.Ile998Val	326	3		295	8	NM_017631	0	0	0	0	0	Q6PK35|Q9NVE3	Missense_Mutation	SNP	ENST00000393743.3	37	CCDS34097.1	180	0.08241758241758242	77	0.1565040650406504	31	0.0856353591160221	0	0.0	72	0.09498680738786279	T	5.731	0.319347	0.10845	0.118021	0.07686	ENSG00000137628	ENST00000393743;ENST00000537338	T	0.16743	2.32	5.22	-5.7	0.02421	.	0.770143	0.11971	N	0.511818	T	0.00039	0.0001	N	0.16743	0.435	0.80722	P	0.0	B	0.11235	0.004	B	0.06405	0.002	T	0.43376	-0.9395	9	0.16420	T	0.52	.	7.5868	0.27998	0.3052:0.489:0.0:0.2058	rs576619;rs52835038;rs57456959;rs576619	998	Q8IY21	DDX60_HUMAN	V	998;90	ENSP00000377344:I998V	ENSP00000377344:I998V	I	-	1	0	DDX60	169425355	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	-0.237000	0.08990	-0.772000	0.04602	0.460000	0.39030	ATT	T|0.915;C|0.085		0.303	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364622.1	NM_017631	
ZSWIM6	57688	hgsc.bcm.edu	37	5	60628774	60628774	+	Splice_Site	SNP	C	C	T	rs76811816	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:60628774C>T	ENST00000252744.5	+	1	675	c.675C>T	c.(673-675)gtC>gtT	p.V225V		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	225					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						TCCTGCAAGTCGGTGAGTCAC	0.726													c|||	351	0.0700879	0.0227	0.0432	5008	,	,		5278	0.2024		0.006	False		,,,				2504	0.0828				p.V225V		.											.	.	0			c.C675T						.																																			SO:0001630	splice_region_variant	57688	exon1			GCAAGTCGGTGAG	BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.676+1C>T	5.37:g.60628774C>T		0	0		11	6	NM_020928	0	0	0	0	0		Silent	SNP	ENST00000252744.5	37	CCDS47215.1																																																																																			C|0.932;T|0.068		0.726	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368710.1	NM_020928	Silent
ARHGEF28	64283	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	73169041	73169041	+	Missense_Mutation	SNP	C	C	G	rs535664718		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:73169041C>G	ENST00000426542.2	+	21	2804	c.2784C>G	c.(2782-2784)atC>atG	p.I928M	ARHGEF28_ENST00000287898.5_Missense_Mutation_p.I928M|ARHGEF28_ENST00000296799.4_Missense_Mutation_p.I615M|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.I928M|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.I928M|ARHGEF28_ENST00000545377.1_Missense_Mutation_p.I928M|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.I928M			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	928	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										ATTTTGTGATCGACCGAATTG	0.423													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19478	0.0		0.0	False		,,,				2504	0.0				p.I928M		.											.	.	0			c.C2784G						.						50.0	48.0	49.0					5																	73169041		1864	4106	5970	SO:0001583	missense	64283	exon22			TGTGATCGACCGA		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.2784C>G	5.37:g.73169041C>G	ENSP00000412175:p.Ile928Met	185	0		230	64	NM_001080479	0	0	0	0	0	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	37	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.921725	0.52653	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542;ENST00000296799	T;T;T;T;T;T;T	0.69926	-0.44;-0.44;-0.44;-0.44;-0.44;-0.44;-0.44	5.24	3.47	0.39725	Dbl homology (DH) domain (5);	.	.	.	.	T	0.81148	0.4762	M	0.87971	2.92	0.36916	D	0.891131	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.97110	1.0;0.996;0.994;0.989	D	0.83410	0.0027	9	0.87932	D	0	.	7.7622	0.28959	0.1318:0.7265:0.0:0.1416	.	615;928;928;928	B5MDA3;Q8N1W1;E9PC75;Q8N1W1-4	.;RGNEF_HUMAN;.;.	M	928;928;928;928;928;928;615	ENSP00000296794:I928M;ENSP00000441913:I928M;ENSP00000441436:I928M;ENSP00000287898:I928M;ENSP00000411459:I928M;ENSP00000412175:I928M;ENSP00000296799:I615M	ENSP00000287898:I928M	I	+	3	3	RP11-428C6.1	73204797	0.426000	0.25506	0.690000	0.30148	0.947000	0.59692	0.982000	0.29539	0.715000	0.32103	-0.143000	0.13931	ATC	.		0.423	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
MSH3	4437	hgsc.bcm.edu	37	5	79950781	79950781	+	Missense_Mutation	SNP	A	A	G	rs1650697	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:79950781A>G	ENST00000265081.6	+	1	315	c.235A>G	c.(235-237)Ata>Gta	p.I79V	DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	79	Interaction with EXO1.		I -> V (in dbSNP:rs1650697). {ECO:0000269|PubMed:10944853, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2722860, ECO:0000269|PubMed:8942985, ECO:0000269|Ref.3, ECO:0000269|Ref.4}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		GCCGCCGCACATAGTAGGTTC	0.761								Mismatch excision repair (MMR)					G|||	3849	0.76857	0.9349	0.755	5008	,	,		7227	0.6607		0.7555	False		,,,				2504	0.6779				p.I79V	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.A235G	GRCh37	CM003459	MSH3	M	rs1650697	.						3.0	3.0	3.0					5																	79950781		1266	2724	3990	SO:0001583	missense	4437	exon1			CCGCACATAGTAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.235A>G	5.37:g.79950781A>G	ENSP00000265081:p.Ile79Val	0	0		9	6	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	1690	0.7738095238095238	438	0.8902439024390244	285	0.787292817679558	381	0.666083916083916	586	0.7730870712401056	G	8.959	0.970033	0.18659	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.85861	-2.04	3.71	-4.46	0.03536	.	1.676640	0.04082	N	0.309797	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22556	-1.0213	8	.	.	.	1.988	3.0405	0.06137	0.0849:0.3221:0.2456:0.3473	rs1650697;rs61225035;rs1650697	79	P20585	MSH3_HUMAN	V	79;70	ENSP00000265081:I79V	.	I	+	1	0	MSH3	79986537	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.493000	0.06459	-1.742000	0.01342	-1.466000	0.01016	ATA	G|0.787;A|0.213		0.761	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
FAM81B	153643	bcgsc.ca	37	5	94749723	94749723	+	Silent	SNP	G	G	A	rs7726891	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:94749723G>A	ENST00000283357.5	+	4	412	c.366G>A	c.(364-366)gcG>gcA	p.A122A		NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	122						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		ACAACCAGGCGCGTACCATAG	0.502													G|||	1090	0.217652	0.2428	0.2406	5008	,	,		19920	0.1071		0.334	False		,,,				2504	0.1616				p.A122A		.											.	FAM81B-92	0			c.G366A						.	G		1016,2994		129,758,1118	99.0	105.0	103.0		366	1.8	1.0	5	dbSNP_116	103	2417,5941		365,1687,2127	no	coding-synonymous	FAM81B	NM_152548.2		494,2445,3245	AA,AG,GG		28.9184,25.3367,27.7571		122/453	94749723	3433,8935	2005	4179	6184	SO:0001819	synonymous_variant	153643	exon4			CCAGGCGCGTACC		CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.366G>A	5.37:g.94749723G>A		114	1		188	10	NM_152548	0	0	0	0	0		Silent	SNP	ENST00000283357.5	37	CCDS43341.1																																																																																			G|0.759;A|0.241		0.502	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370690.1	NM_152548	
PDLIM4	8572	ucsc.edu	37	5	131607080	131607080	+	Silent	SNP	A	A	G	rs270619	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:131607080A>G	ENST00000253754.3	+	5	655	c.591A>G	c.(589-591)ccA>ccG	p.P197P	P4HA2_ENST00000471826.1_Intron|PDLIM4_ENST00000484620.1_3'UTR|PDLIM4_ENST00000379018.3_Silent_p.P197P	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	197							zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGCGGGAGCCAGCCGAGCCCG	0.692													G|||	1453	0.290136	0.5242	0.1023	5008	,	,		13386	0.4673		0.1123	False		,,,				2504	0.1074				p.P197P		.											.	PDLIM4-91	0			c.A591G						.	G	,	1918,2482		441,1036,723	20.0	28.0	26.0		591,591	-10.3	0.0	5	dbSNP_79	26	906,7688		57,792,3448	no	coding-synonymous,coding-synonymous	PDLIM4	NM_001131027.1,NM_003687.3	,	498,1828,4171	GG,GA,AA		10.5422,43.5909,21.7331	,	197/247,197/331	131607080	2824,10170	2200	4297	6497	SO:0001819	synonymous_variant	8572	exon5			GGAGCCAGCCGAG	AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.591A>G	5.37:g.131607080A>G		16	0		103	49	NM_003687	0	0	0	0	0	B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Silent	SNP	ENST00000253754.3	37	CCDS4152.1																																																																																			A|0.766;G|0.233		0.692	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132644.2	NM_003687	
PROB1	389333	hgsc.bcm.edu	37	5	138730037	138730037	+	Missense_Mutation	SNP	T	T	C	rs11748963	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:138730037T>C	ENST00000434752.2	-	1	848	c.734A>G	c.(733-735)cAg>cGg	p.Q245R		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	245																	CGCGGCGGCCTGCAGGGGGCC	0.781													T|||	1773	0.354034	0.146	0.2839	5008	,	,		10752	0.6151		0.3042	False		,,,				2504	0.4673				p.Q245R		.											.	.	0			c.A734G						.						5.0	7.0	6.0					5																	138730037		671	1537	2208	SO:0001583	missense	389333	exon1			GCGGCCTGCAGGG	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.734A>G	5.37:g.138730037T>C	ENSP00000416033:p.Gln245Arg	0	0		10	10	NM_001161546	0	0	0	0	0	B4E007	Missense_Mutation	SNP	ENST00000434752.2	37	CCDS54909.1	803	0.3676739926739927	105	0.21341463414634146	108	0.2983425414364641	366	0.6398601398601399	224	0.2955145118733509	T	21.8	4.205823	0.79127	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.33628	P	0.39427599999999996	D	0.76494	0.999	D	0.83275	0.996	T	0.45483	-0.9258	7	0.52906	T	0.07	.	11.6588	0.51334	0.0:0.0:0.0:1.0	rs11748963	245	E7EW31	CE065_HUMAN	R	245	.	ENSP00000416033:Q245R	Q	-	2	0	AC135457.1	138757936	0.990000	0.36364	0.998000	0.56505	0.770000	0.43624	2.116000	0.41930	1.919000	0.55581	0.459000	0.35465	CAG	T|0.632;C|0.368		0.781	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470735.1	NM_001161546	
PCDHA8	56140	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	140223018	140223018	+	Silent	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:140223018C>A	ENST00000531613.1	+	1	2112	c.2112C>A	c.(2110-2112)atC>atA	p.I704I	PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000378123.3_Silent_p.I704I|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	704					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCATCGCCATCTGCGCGGTAT	0.657																																					p.I704I		.											.	PCDHA8-92	0			c.C2112A						.						74.0	69.0	71.0					5																	140223018		2197	4265	6462	SO:0001819	synonymous_variant	56140	exon1			CGCCATCTGCGCG	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.2112C>A	5.37:g.140223018C>A		132	0		279	29	NM_031856	0	0	0	0	0	B9EGT7|O75281	Silent	SNP	ENST00000531613.1	37	CCDS54919.1																																																																																			.		0.657	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372830.2	NM_018911	
PCDHB5	26167	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140515063	140515063	+	Missense_Mutation	SNP	T	T	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:140515063T>G	ENST00000231134.5	+	1	264	c.47T>G	c.(46-48)tTt>tGt	p.F16C		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	16					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAAGTTATGTTTCTTGCTATA	0.483																																					p.F16C		.											.	PCDHB5-95	0			c.T47G						.						100.0	89.0	93.0					5																	140515063		2203	4300	6503	SO:0001583	missense	26167	exon1			TTATGTTTCTTGC	AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.47T>G	5.37:g.140515063T>G	ENSP00000231134:p.Phe16Cys	125	0		149	63	NM_015669	0	0	0	0	0	Q549F4|Q9UFU9	Missense_Mutation	SNP	ENST00000231134.5	37	CCDS4247.1	.	.	.	.	.	.	.	.	.	.	T	8.188	0.795286	0.16327	.	.	ENSG00000113209	ENST00000231134	T	0.51817	0.69	5.37	4.2	0.49525	.	.	.	.	.	T	0.45756	0.1358	L	0.43757	1.38	0.09310	N	1	P	0.48016	0.904	P	0.48840	0.592	T	0.31251	-0.9950	9	0.46703	T	0.11	.	7.5385	0.27725	0.0:0.0766:0.1438:0.7796	.	16	Q9Y5E4	PCDB5_HUMAN	C	16	ENSP00000231134:F16C	ENSP00000231134:F16C	F	+	2	0	PCDHB5	140495247	0.038000	0.19896	0.540000	0.28089	0.383000	0.30230	0.290000	0.18975	2.166000	0.68216	0.454000	0.30748	TTT	.		0.483	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251811.1	NM_015669	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		2	0		50	18	NM_018930	0	0	0	0	0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
TCOF1	6949	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149758877	149758877	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:149758877C>G	ENST00000504761.2	+	16	2564	c.2564C>G	c.(2563-2565)gCt>gGt	p.A855G	TCOF1_ENST00000451292.1_Missense_Mutation_p.A855G|TCOF1_ENST00000439160.2_Missense_Mutation_p.A855G|TCOF1_ENST00000377797.3_Missense_Mutation_p.A855G|TCOF1_ENST00000394269.3_Missense_Mutation_p.A855G|TCOF1_ENST00000513346.1_Missense_Mutation_p.A855G|TCOF1_ENST00000323668.7_Missense_Mutation_p.A778G|TCOF1_ENST00000445265.2_Missense_Mutation_p.A778G|TCOF1_ENST00000506063.1_3'UTR			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	855					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGGCCGTGGCTACAGCAGCT	0.632																																					p.A855G		.											.	TCOF1-155	0			c.C2564G						.						67.0	77.0	73.0					5																	149758877		2203	4300	6503	SO:0001583	missense	6949	exon16			CCGTGGCTACAGC		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.2564C>G	5.37:g.149758877C>G	ENSP00000421655:p.Ala855Gly	195	1		358	87	NM_001135243	0	0	0	0	0	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	37	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339780	0.41398	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T;T	0.74209	-0.82;-0.82;-0.82;-0.82;-0.82;-0.82;-0.82;-0.82;-0.82	4.53	4.53	0.55603	Treacher Collins syndrome, treacle (1);	0.331422	0.22134	N	0.064159	D	0.83552	0.5279	M	0.77103	2.36	0.09310	N	1	D;D;D;D;D;D	0.60160	0.974;0.974;0.974;0.986;0.974;0.987	P;P;P;P;P;P	0.61800	0.655;0.655;0.655;0.894;0.655;0.655	T	0.75844	-0.3174	10	0.48119	T	0.1	-1.0329	13.5206	0.61566	0.0:1.0:0.0:0.0	.	855;778;855;855;778;855	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8;Q13428-5	.;.;.;TCOF_HUMAN;.;.	G	855;855;778;778;855;855;855;855;855	ENSP00000400939:A855G;ENSP00000367028:A855G;ENSP00000409944:A778G;ENSP00000325223:A778G;ENSP00000406888:A855G;ENSP00000377811:A855G;ENSP00000390717:A855G;ENSP00000421655:A855G;ENSP00000427484:A855G	ENSP00000325223:A778G	A	+	2	0	TCOF1	149739070	0.001000	0.12720	0.005000	0.12908	0.008000	0.06430	1.146000	0.31589	2.456000	0.83038	0.462000	0.41574	GCT	.		0.632	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
HK3	3101	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	176318107	176318107	+	Silent	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:176318107C>A	ENST00000292432.5	-	4	436	c.345G>T	c.(343-345)ggG>ggT	p.G115G		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	115	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCACCCTATGCCCCTCAATGC	0.612																																					p.G115G		.											.	HK3-294	0			c.G345T						.						60.0	60.0	60.0					5																	176318107		2203	4300	6503	SO:0001819	synonymous_variant	3101	exon4			CCTATGCCCCTCA		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.345G>T	5.37:g.176318107C>A		60	0		109	13	NM_002115	0	0	0	0	0	Q8N1E7	Silent	SNP	ENST00000292432.5	37	CCDS4407.1																																																																																			.		0.612	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
TRIM52	84851	hgsc.bcm.edu	37	5	180687431	180687431	+	Silent	SNP	T	T	C	rs200454506|rs78075294|rs3073543|rs33972170	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:180687431T>C	ENST00000327767.4	-	1	688	c.384A>G	c.(382-384)gaA>gaG	p.E128E	CTC-338M12.4_ENST00000417281.2_RNA|CTC-338M12.4_ENST00000505151.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA|TRIM52_ENST00000514805.1_5'UTR|TRIM52-AS1_ENST00000507434.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	128	Glu-rich.				positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		GATCTTCCTCTTCTTCTTCTT	0.458																																					p.E128E		.											.	TRIM52-90	0			c.A384G						.						60.0	124.0	102.0					5																	180687431		2203	4300	6503	SO:0001819	synonymous_variant	84851	exon1			TTCCTCTTCTTCT		CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.384A>G	5.37:g.180687431T>C		105	0		125	16	NM_032765	0	0	0	0	0		Silent	SNP	ENST00000327767.4	37	CCDS4467.1																																																																																			T|0.500;C|0.500		0.458	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253572.3	NM_032765	
TRIM52	84851	hgsc.bcm.edu	37	5	180687440	180687440	+	Silent	SNP	T	T	C	rs80005177	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:180687440T>C	ENST00000327767.4	-	1	679	c.375A>G	c.(373-375)gaA>gaG	p.E125E	CTC-338M12.4_ENST00000417281.2_RNA|CTC-338M12.4_ENST00000505151.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|TRIM52-AS1_ENST00000514146.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA|TRIM52_ENST00000514805.1_5'UTR|TRIM52-AS1_ENST00000507434.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	125	Glu-rich.				positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		CTTCTTCTTCTTCCTCCTCGT	0.453																																					p.E125E		.											.	TRIM52-90	0			c.A375G						.	T		1,4405	2.1+/-5.4	0,1,2202	177.0	162.0	167.0		375	-3.8	0.2	5	dbSNP_132	167	0,8600		0,0,4300	no	coding-synonymous	TRIM52	NM_032765.2		0,1,6502	CC,CT,TT		0.0,0.0227,0.0077		125/298	180687440	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	84851	exon1			TTCTTCTTCCTCC		CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.375A>G	5.37:g.180687440T>C		97	0		122	15	NM_032765	0	0	0	0	0		Silent	SNP	ENST00000327767.4	37	CCDS4467.1																																																																																			T|0.991;C|0.009		0.453	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253572.3	NM_032765	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		0	0		16	16	NM_001145115	0	0	0	0	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
HIST1H3G	8355	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26271439	26271439	+	Silent	SNP	C	C	G	rs41266825	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:26271439C>G	ENST00000305910.3	-	1	173	c.174G>C	c.(172-174)tcG>tcC	p.S58S	HIST1H2BI_ENST00000377733.2_5'Flank	NM_003534.2	NP_003525.1	P68431	H31_HUMAN	histone cluster 1, H3g	58					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12						GCAGCTCAGTCGACTTCTGAT	0.612																																					p.S58S		.											.	HIST1H3G-90	0			c.G174C						.						71.0	73.0	72.0					6																	26271439		2203	4300	6503	SO:0001819	synonymous_variant	8355	exon1			CTCAGTCGACTTC	Z80785	CCDS4602.1	6p22.1	2011-07-22	2006-10-11	2003-03-14	ENSG00000256018			"""Histones / Replication-dependent"""	4772	protein-coding gene	gene with protein product		602815	"""H3 histone family, member H"", ""histone 1, H3g"""	H3FH		9119399, 12408966	Standard	NM_003534		Approved	H3/h	uc003nhi.3	P68431	OTTHUMG00000014436	ENST00000305910.3:c.174G>C	6.37:g.26271439C>G		82	0		239	37	NM_003534	0	0	0	0	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000305910.3	37	CCDS4602.1																																																																																			C|0.991;A|0.009		0.612	HIST1H3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040099.2	NM_003534	
ZNF184	7738	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	27419101	27419101	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:27419101C>T	ENST00000211936.6	-	6	2521	c.2237G>A	c.(2236-2238)aGa>aAa	p.R746K	ZNF184_ENST00000377419.1_Missense_Mutation_p.R746K	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	746				R -> K (in Ref. 4; AAC51180). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						AGGATGCAGTCTCTGATGTTT	0.383																																					p.R746K		.											.	ZNF184-91	0			c.G2237A						.						147.0	145.0	146.0					6																	27419101		2203	4300	6503	SO:0001583	missense	7738	exon6			TGCAGTCTCTGAT	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.2237G>A	6.37:g.27419101C>T	ENSP00000211936:p.Arg746Lys	109	0		139	20	NM_007149	0	0	0	0	0	B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	ENST00000211936.6	37	CCDS4624.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816617	0.50633	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087	T;T	0.54675	0.56;0.56	4.88	4.01	0.46588	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.361470	0.24193	N	0.040691	T	0.26702	0.0653	N	0.26130	0.795	0.28688	N	0.904734	B	0.32338	0.365	B	0.41236	0.351	T	0.16453	-1.0402	10	0.31617	T	0.26	.	10.8881	0.46978	0.0:0.9078:0.0:0.0922	.	746	Q99676	ZN184_HUMAN	K	746;746;662	ENSP00000211936:R746K;ENSP00000366636:R746K	ENSP00000211936:R746K	R	-	2	0	ZNF184	27527080	0.002000	0.14202	0.997000	0.53966	0.955000	0.61496	0.162000	0.16501	1.418000	0.47098	0.591000	0.81541	AGA	.		0.383	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
C6orf136	221545	hgsc.bcm.edu	37	6	30615260	30615260	+	Intron	SNP	C	C	T	rs3132594	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:30615260C>T	ENST00000376473.5	+	1	231				AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000493705.1_Intron|C6orf136_ENST00000293604.6_Silent_p.R84R|C6orf136_ENST00000376471.4_Intron|C6orf136_ENST00000528347.2_5'Flank	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GAGGGAGGCGCTGCCGGGCCT	0.746													C|||	292	0.0583067	0.1589	0.0605	5008	,	,		10975	0.004		0.0288	False		,,,				2504	0.0072				p.R84R		.											.	C6orf136-90	0			c.C252T						.						2.0	4.0	3.0					6																	30615260		539	1316	1855	SO:0001627	intron_variant	221545	exon1			GAGGCGCTGCCGG	BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+180C>T	6.37:g.30615260C>T		1	0		64	43	NM_001161376	0	0	0	0	0	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Silent	SNP	ENST00000376473.5	37	CCDS43443.1																																																																																			C|0.944;T|0.056		0.746	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076457.4	NM_145029	
DPCR1	135656	bcgsc.ca	37	6	30917365	30917365	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:30917365C>T	ENST00000462446.1	+	2	1152	c.1124C>T	c.(1123-1125)cCa>cTa	p.P375L	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	366	Thr-rich.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						AACACCACACCATCCCCAGCA	0.483																																					p.P375L		.											.	DPCR1-90	0			c.C1124T						.						169.0	149.0	155.0					6																	30917365		692	1591	2283	SO:0001583	missense	135656	exon2			CCACACCATCCCC	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.1124C>T	6.37:g.30917365C>T	ENSP00000417182:p.Pro375Leu	187	4		242	13	NM_080870	0	0	0	0	0	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	-	0.007	-1.975468	0.00452	.	.	ENSG00000168631	ENST00000462446	T	0.44881	0.91	1.82	-3.65	0.04502	.	.	.	.	.	T	0.07143	0.0181	L	0.32530	0.975	0.09310	N	0.999999	B	0.18166	0.026	B	0.09377	0.004	T	0.16158	-1.0412	9	0.24483	T	0.36	.	1.8281	0.03125	0.3008:0.3727:0.2012:0.1253	.	375	E9PEI6	.	L	375	ENSP00000417182:P375L	ENSP00000417182:P375L	P	+	2	0	DPCR1	31025344	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-4.201000	0.00275	-2.716000	0.00391	-0.578000	0.04140	CCA	.		0.483	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
DPCR1	135656	bcgsc.ca	37	6	30917368	30917368	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:30917368C>T	ENST00000462446.1	+	2	1155	c.1127C>T	c.(1126-1128)tCc>tTc	p.S376F	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	367	Thr-rich.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						ACCACACCATCCCCAGCAGAG	0.488																																					p.S376F		.											.	DPCR1-90	0			c.C1127T						.						166.0	146.0	152.0					6																	30917368		692	1591	2283	SO:0001583	missense	135656	exon2			CACCATCCCCAGC	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.1127C>T	6.37:g.30917368C>T	ENSP00000417182:p.Ser376Phe	180	3		243	24	NM_080870	0	0	0	0	0	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	ENST00000462446.1	37	CCDS4692.2	.	.	.	.	.	.	.	.	.	.	-	5.872	0.345069	0.11126	.	.	ENSG00000168631	ENST00000462446	T	0.59906	0.23	1.82	-0.213	0.13165	.	.	.	.	.	T	0.18509	0.0444	N	0.14661	0.345	0.09310	N	0.999999	P	0.39809	0.689	B	0.41271	0.352	T	0.09707	-1.0662	9	0.51188	T	0.08	.	3.9803	0.09492	0.23:0.6171:0.0:0.1529	.	376	E9PEI6	.	F	376	ENSP00000417182:S376F	ENSP00000417182:S376F	S	+	2	0	DPCR1	31025347	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.778000	0.01778	-0.060000	0.13132	0.430000	0.28490	TCC	.		0.488	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076173.3	NM_080870	
CYP21A2	1589	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	32007391	32007391	+	Silent	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:32007391C>G	ENST00000418967.2	+	5	776	c.618C>G	c.(616-618)tcC>tcG	p.S206S	CYP21A2_ENST00000435122.2_Silent_p.S176S	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	205					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	GCCACTGGTCCATCCAAATTG	0.527																																					.	Melanoma(174;1669 1998 3915 34700 46447)	.											.	CYP21A2-68	0			.						.						27.0	27.0	27.0					6																	32007391		2197	4286	6483	SO:0001819	synonymous_variant	1589	.			CTGGTCCATCCAA	X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.618C>G	6.37:g.32007391C>G		424	0		723	142	.	0	0	0	0	0	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Silent	SNP	ENST00000418967.2	37	CCDS4735.1																																																																																			.		0.527	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268768.2	NM_000500	
NOTCH4	4855	hgsc.bcm.edu	37	6	32163664	32163664	+	Silent	SNP	C	C	T	rs8192581	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:32163664C>T	ENST00000375023.3	-	30	5700	c.5562G>A	c.(5560-5562)ggG>ggA	p.G1854G	NOTCH4_ENST00000443903.2_3'UTR|GPSM3_ENST00000375040.3_5'Flank|GPSM3_ENST00000375043.3_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1854					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GAGCCCCGCCCCCATGCGGGG	0.736													C|||	67	0.0133786	0.0008	0.0101	5008	,	,		13398	0.004		0.005	False		,,,				2504	0.0511				p.G1854G		.											.	NOTCH4-1321	0			c.G5562A						.	C		6,2802		0,6,1398	6.0	8.0	8.0		5562	-0.0	0.4	6	dbSNP_117	8	14,5070		0,14,2528	no	coding-synonymous	NOTCH4	NM_004557.3		0,20,3926	TT,TC,CC		0.2754,0.2137,0.2534		1854/2004	32163664	20,7872	1404	2542	3946	SO:0001819	synonymous_variant	4855	exon30			CCCGCCCCCATGC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.5562G>A	6.37:g.32163664C>T		0	0		14	6	NM_004557	0	0	0	0	0	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	37	CCDS34420.1																																																																																			C|0.995;T|0.005		0.736	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
CNPY3	10695	broad.mit.edu	37	6	42897358	42897360	+	In_Frame_Del	DEL	TGC	TGC	-	rs570105218	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:42897358_42897360delTGC	ENST00000372836.4	+	1	421_423	c.50_52delTGC	c.(49-54)ttgctg>ttg	p.17_18LL>L	CNPY3_ENST00000394142.3_In_Frame_Del_p.17_18LL>L	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	17					innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.L25delL(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			CTTCTTCCCTtgctgctgctgct	0.695																																					p.17_18del		.											.	CNPY3-69	1	Deletion - In frame(1)	central_nervous_system(1)	c.50_52del						.																																			SO:0001651	inframe_deletion	10695	exon1			TTCCCTTGCTGCT	U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.50_52delTGC	6.37:g.42897367_42897369delTGC	ENSP00000361926:p.Leu25del	13	0		180	9	NM_006586	0	0	0	0	0	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	In_Frame_Del	DEL	ENST00000372836.4	37	CCDS4875.1																																																																																			.		0.695	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040564.1	NM_006586	
TNFRSF21	27242	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	47200618	47200618	+	Missense_Mutation	SNP	C	C	A	rs373562029		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:47200618C>A	ENST00000296861.2	-	6	2244	c.1851G>T	c.(1849-1851)gaG>gaT	p.E617D		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	617					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			CCTGGGGAATCTCTTCAATCA	0.522																																					p.E617D		.											.	TNFRSF21-227	0			c.G1851T						.						121.0	129.0	126.0					6																	47200618		2203	4300	6503	SO:0001583	missense	27242	exon6			GGGAATCTCTTCA	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1851G>T	6.37:g.47200618C>A	ENSP00000296861:p.Glu617Asp	92	0		195	32	NM_014452	0	0	0	0	0	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	37	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124477	0.77436	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.67523	-0.27	5.95	3.88	0.44766	.	0.208574	0.50627	D	0.000119	T	0.54532	0.1864	L	0.27053	0.805	0.47621	D	0.999478	D	0.57899	0.981	P	0.54759	0.76	T	0.63422	-0.6641	10	0.87932	D	0	.	12.2152	0.54402	0.0:0.8453:0.0:0.1547	.	617	O75509	TNR21_HUMAN	D	617;306	ENSP00000296861:E617D	ENSP00000296861:E617D	E	-	3	2	TNFRSF21	47308577	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.064000	0.57506	1.534000	0.49203	0.655000	0.94253	GAG	.		0.522	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
MUT	4594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49416590	49416590	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:49416590C>G	ENST00000274813.3	-	7	1510	c.1383G>C	c.(1381-1383)gaG>gaC	p.E461D		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	461					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TAGGTATTCCCTCAGCTACAG	0.338																																					p.E461D		.											.	MUT-91	0			c.G1383C						.						145.0	144.0	144.0					6																	49416590		2203	4300	6503	SO:0001583	missense	4594	exon7			TATTCCCTCAGCT		CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.1383G>C	6.37:g.49416590C>G	ENSP00000274813:p.Glu461Asp	108	0		156	24	NM_000255	0	0	0	0	0	A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	ENST00000274813.3	37	CCDS4924.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721241	0.48728	.	.	ENSG00000146085	ENST00000274813	D	0.98120	-4.73	5.75	-3.85	0.04243	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (1);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.88862	0.6552	N	0.17312	0.475	0.54753	D	0.999989	B	0.02656	0.0	B	0.11329	0.006	T	0.69826	-0.5040	10	0.51188	T	0.08	3.8903	13.6546	0.62330	0.0:0.3985:0.0:0.6015	.	461	P22033	MUTA_HUMAN	D	461	ENSP00000274813:E461D	ENSP00000274813:E461D	E	-	3	2	MUT	49524549	0.997000	0.39634	0.904000	0.35570	0.995000	0.86356	0.489000	0.22387	-0.662000	0.05338	-0.157000	0.13467	GAG	.		0.338	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040854.1		
ICK	22858	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	6	52871155	52871155	+	Missense_Mutation	SNP	T	T	C	rs145842629	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:52871155T>C	ENST00000350082.5	-	13	2048	c.1702A>G	c.(1702-1704)Atg>Gtg	p.M568V	ICK_ENST00000356971.3_Missense_Mutation_p.M568V	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	568					intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					ACCCTCTGCATAGCAGAACCG	0.398													T|||	4	0.000798722	0.003	0.0	5008	,	,		19652	0.0		0.0	False		,,,				2504	0.0				p.M568V		.											.	ICK-421	0			c.A1702G						.	T	VAL/MET,VAL/MET	10,4396	15.5+/-35.6	0,10,2193	129.0	126.0	127.0		1702,1702	-11.5	0.0	6	dbSNP_134	127	0,8600		0,0,4300	yes	missense,missense	ICK	NM_014920.3,NM_016513.4	21,21	0,10,6493	CC,CT,TT		0.0,0.227,0.0769	benign,benign	568/633,568/633	52871155	10,12996	2203	4300	6503	SO:0001583	missense	22858	exon14			TCTGCATAGCAGA	AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.1702A>G	6.37:g.52871155T>C	ENSP00000263043:p.Met568Val	81	0		132	32	NM_016513	0	0	0	0	0	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Missense_Mutation	SNP	ENST00000350082.5	37	CCDS4949.1	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	T	10.64	1.405714	0.25378	0.00227	0.0	ENSG00000112144	ENST00000350082;ENST00000356971	T;T	0.71341	-0.56;-0.56	5.75	-11.5	0.00074	.	0.950370	0.08828	N	0.887776	T	0.36386	0.0965	L	0.36672	1.1	0.21627	N	0.999611	B	0.02656	0.0	B	0.01281	0.0	T	0.49312	-0.8953	10	0.54805	T	0.06	-1.2288	18.2217	0.89904	0.0:0.6701:0.2386:0.0912	.	568	Q9UPZ9	ICK_HUMAN	V	568	ENSP00000263043:M568V;ENSP00000349458:M568V	ENSP00000263043:M568V	M	-	1	0	ICK	52979114	0.060000	0.20803	0.037000	0.18230	0.733000	0.41908	-0.940000	0.03929	-3.462000	0.00158	-2.293000	0.00265	ATG	T|0.999;C|0.001		0.398	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040952.1	NM_016513	
COL19A1	1310	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	70890358	70890358	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:70890358G>T	ENST00000322773.4	+	44	2820	c.2718G>T	c.(2716-2718)gaG>gaT	p.E906D	COL19A1_ENST00000393344.1_Missense_Mutation_p.E528D	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	906	Collagen-like 10.|Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TATAGGGTGAGAGAGGACCTG	0.398																																					p.E906D		.											.	COL19A1-156	0			c.G2718T						.						188.0	190.0	189.0					6																	70890358		2203	4300	6503	SO:0001583	missense	1310	exon44			GGGTGAGAGAGGA		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2718G>T	6.37:g.70890358G>T	ENSP00000316030:p.Glu906Asp	143	0		218	33	NM_001858	0	0	0	0	0	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	ENST00000322773.4	37	CCDS4970.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021623	0.35701	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.94232	-3.38;-3.38	5.73	-4.87	0.03123	.	0.128657	0.48767	N	0.000166	T	0.75882	0.3910	L	0.48362	1.52	0.35182	D	0.772595	B	0.12630	0.006	B	0.17098	0.017	T	0.55547	-0.8124	10	0.13108	T	0.6	.	6.8301	0.23905	0.5205:0.2159:0.2636:0.0	.	906	Q14993	COJA1_HUMAN	D	906;528	ENSP00000316030:E906D;ENSP00000377013:E528D	ENSP00000316030:E906D	E	+	3	2	COL19A1	70947079	0.974000	0.33945	0.902000	0.35471	0.992000	0.81027	0.116000	0.15561	-0.949000	0.03663	0.484000	0.47621	GAG	.		0.398	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041127.1		
ASCC3	10973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	101246658	101246658	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:101246658C>G	ENST00000369162.2	-	8	1670	c.1326G>C	c.(1324-1326)agG>agC	p.R442S	ASCC3_ENST00000522650.1_Missense_Mutation_p.R442S	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	442					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TGTAGGGAATCCTTACTTCTT	0.333																																					p.R442S		.											.	ASCC3-96	0			c.G1326C						.						150.0	142.0	145.0					6																	101246658		2203	4300	6503	SO:0001583	missense	10973	exon8			GGGAATCCTTACT	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.1326G>C	6.37:g.101246658C>G	ENSP00000358159:p.Arg442Ser	89	0		102	19	NM_006828	0	0	0	0	0	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	37	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	7.142	0.581947	0.13749	.	.	ENSG00000112249	ENST00000369162;ENST00000522650	T;T	0.35421	1.31;1.31	5.36	2.17	0.27698	.	0.170537	0.51477	D	0.000084	T	0.03695	0.0105	N	0.01015	-1.05	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.24693	-1.0153	10	0.20046	T	0.44	.	7.5642	0.27868	0.0:0.5456:0.0:0.4544	.	442;442	E7EW23;Q8N3C0	.;HELC1_HUMAN	S	442	ENSP00000358159:R442S;ENSP00000430769:R442S	ENSP00000358159:R442S	R	-	3	2	ASCC3	101353379	0.989000	0.36119	0.993000	0.49108	0.967000	0.64934	0.211000	0.17474	0.630000	0.30394	0.591000	0.81541	AGG	.		0.333	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
ZC3H12D	340152	hgsc.bcm.edu	37	6	149772190	149772190	+	Missense_Mutation	SNP	G	G	A	rs112722576	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:149772190G>A	ENST00000409806.3	-	6	1531	c.1213C>T	c.(1213-1215)Cct>Tct	p.P405S	ZC3H12D_ENST00000416573.2_Missense_Mutation_p.A307V|ZC3H12D_ENST00000542614.1_Missense_Mutation_p.A307V|ZC3H12D_ENST00000498662.1_5'Flank|ZC3H12D_ENST00000389942.5_Missense_Mutation_p.P405S			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	405	Pro-rich. {ECO:0000255}.			P -> S (in Ref. 4; AAI57833). {ECO:0000305}.	negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.P405S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		CCGGGCGGAGGCGGGAGGTCG	0.776													G|||	1682	0.335863	0.1619	0.389	5008	,	,		8771	0.7649		0.1412	False		,,,				2504	0.2914				p.P405S		.											.	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1213T						.	G	SER/PRO	516,2856		37,442,1207	3.0	5.0	4.0		1213	-1.9	0.0	6	dbSNP_132	4	945,6567		66,813,2877	no	missense	ZC3H12D	NM_207360.2	74	103,1255,4084	AA,AG,GG		12.5799,15.3025,13.4234	benign	405/528	149772190	1461,9423	1686	3756	5442	SO:0001583	missense	340152	exon6			GCGGAGGCGGGAG			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.1213C>T	6.37:g.149772190G>A	ENSP00000386616:p.Pro405Ser	0	0		49	48	NM_207360	0	0	0	0	0	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	ENST00000409806.3	37		724|724	0.3315018315018315|0.3315018315018315	94|94	0.1910569105691057|0.1910569105691057	123|123	0.3397790055248619|0.3397790055248619	399|399	0.6975524475524476|0.6975524475524476	108|108	0.1424802110817942|0.1424802110817942	G|G	14.21|14.21	2.466986|2.466986	0.43839|0.43839	0.153025|0.153025	0.125799|0.125799	ENSG00000178199|ENSG00000178199	ENST00000416573;ENST00000542614|ENST00000389942;ENST00000409806	T;T|T;T	0.31247|0.25749	1.53;1.5|1.78;1.78	2.45|2.45	-1.9|-1.9	0.07665|0.07665	.|.	.|.	.|.	.|.	.|.	T|T	0.02193|0.02193	0.0068|0.0068	N|N	0.11427|0.11427	0.14|0.14	0.80722|0.80722	P|P	0.0|0.0	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.04013	0.0|0.001	T|T	0.42085|0.42085	-0.9472|-0.9472	8|8	0.27785|0.06365	T|T	0.31|0.9	1.0E-4|1.0E-4	3.5413|3.5413	0.07812|0.07812	0.5478:0.2181:0.2341:0.0|0.5478:0.2181:0.2341:0.0	.|.	307|405	B7WNU7|A2A288	.|ZC12D_HUMAN	V|S	307|405	ENSP00000408686:A307V;ENSP00000440813:A307V|ENSP00000374592:P405S;ENSP00000386616:P405S	ENSP00000408686:A307V|ENSP00000374592:P405S	A|P	-|-	2|1	0|0	ZC3H12D|ZC3H12D	149813883|149813883	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.563000|0.563000	0.35712|0.35712	0.541000|0.541000	0.23207|0.23207	-0.300000|-0.300000	0.08895|0.08895	0.313000|0.313000	0.20887|0.20887	GCC|CCT	G|0.668;A|0.332		0.776	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
LRP11	84918	hgsc.bcm.edu	37	6	150184882	150184882	+	Missense_Mutation	SNP	G	G	C	rs9322225	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr6:150184882G>C	ENST00000239367.2	-	1	280	c.275C>G	c.(274-276)cCg>cGg	p.P92R	RP11-244K5.8_ENST00000606915.1_RNA|LRP11_ENST00000546019.1_Intron|LRP11_ENST00000367368.2_Missense_Mutation_p.P92R|RP11-244K5.8_ENST00000596229.1_RNA	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	92			P -> R (in dbSNP:rs9322225). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCCGCTGCCCGGGCCCGGGCA	0.756													g|||	2394	0.478035	0.3071	0.5101	5008	,	,		7691	0.8224		0.4165	False		,,,				2504	0.3947				p.P92R		.											.	LRP11-90	0			c.C275G						.	G	ARG/PRO	799,1991		151,497,747	2.0	2.0	2.0		275	3.0	0.3	6	dbSNP_119	2	2072,3740		444,1184,1278	yes	missense	LRP11	NM_032832.5	103	595,1681,2025	CC,CG,GG		35.6504,28.638,33.376	possibly-damaging	92/501	150184882	2871,5731	1395	2906	4301	SO:0001583	missense	84918	exon1			CTGCCCGGGCCCG	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.275C>G	6.37:g.150184882G>C	ENSP00000239367:p.Pro92Arg	0	0		13	13	NM_032832	0	0	0	0	0	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	1110	0.5082417582417582	147	0.29878048780487804	188	0.5193370165745856	465	0.8129370629370629	310	0.40897097625329815	G	12.02	1.812850	0.32053	0.28638	0.356504	ENSG00000120256	ENST00000239367;ENST00000367368	T;T	0.20463	2.07;2.07	3.91	2.96	0.34315	Seven cysteines, N-terminal (2);	1.059560	0.07539	N	0.913589	T	0.07279	0.0184	L	0.36672	1.1	0.51767	P	7.00000000000145E-5	B;B	0.25743	0.133;0.012	B;B	0.23150	0.044;0.025	T	0.19484	-1.0304	9	0.19590	T	0.45	-4.154	11.8365	0.52327	0.0:0.1787:0.8213:0.0	rs9322225;rs17846346;rs17859381	92;92	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	R	92	ENSP00000239367:P92R;ENSP00000356338:P92R	ENSP00000239367:P92R	P	-	2	0	LRP11	150226575	0.132000	0.22450	0.342000	0.25602	0.428000	0.31595	0.489000	0.22387	1.900000	0.55004	0.484000	0.47621	CCG	G|0.492;C|0.508		0.756	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	NM_032832	
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		0	0		6	6	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TNRC18	84629	hgsc.bcm.edu	37	7	5427517	5427517	+	Silent	SNP	G	G	A	rs34693947	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:5427517G>A	ENST00000430969.1	-	5	2286	c.1938C>T	c.(1936-1938)ggC>ggT	p.G646G	TNRC18_ENST00000399537.4_Silent_p.G646G	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	646							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCCGGCCGCCGCCCGCTGCAG	0.716													G|||	998	0.199281	0.0552	0.0908	5008	,	,		13710	0.6597		0.0437	False		,,,				2504	0.1564				p.G646G		.											.	TNRC18-46	0			c.C1938T						.	G		141,3189		2,137,1526	4.0	6.0	5.0		1938	-5.6	0.0	7	dbSNP_126	5	219,7185		3,213,3486	no	coding-synonymous	TNRC18	NM_001080495.2		5,350,5012	AA,AG,GG		2.9579,4.2342,3.3538		646/2969	5427517	360,10374	1665	3702	5367	SO:0001819	synonymous_variant	84629	exon5			GCCGCCGCCCGCT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.1938C>T	7.37:g.5427517G>A		0	0		39	27	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			G|0.797;A|0.203		0.716	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TNRC18	84629	hgsc.bcm.edu	37	7	5428642	5428642	+	Silent	SNP	G	G	A	rs144662045	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:5428642G>A	ENST00000430969.1	-	5	1161	c.813C>T	c.(811-813)acC>acT	p.T271T	TNRC18_ENST00000399537.4_Silent_p.T271T	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	271							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CCGCATTCTTGGTCTTGGACT	0.756													G|||	148	0.0295527	0.0	0.0014	5008	,	,		4446	0.1369		0.003	False		,,,				2504	0.0061				p.T271T		.											.	TNRC18-46	0			c.C813T						.	G		1,3115		0,1,1557	3.0	3.0	3.0		813	0.2	0.0	7	dbSNP_134	3	6,7046		0,6,3520	no	coding-synonymous	TNRC18	NM_001080495.2		0,7,5077	AA,AG,GG		0.0851,0.0321,0.0688		271/2969	5428642	7,10161	1558	3526	5084	SO:0001819	synonymous_variant	84629	exon5			ATTCTTGGTCTTG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.813C>T	7.37:g.5428642G>A		0	0		31	19	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			G|0.955;A|0.045		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
USP42	84132	hgsc.bcm.edu	37	7	6193464	6193464	+	Missense_Mutation	SNP	T	T	G	rs61732616	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:6193464T>G	ENST00000306177.5	+	15	2437	c.2279T>G	c.(2278-2280)cTg>cGg	p.L760R		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	760	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		GCCGAATCCCTGGAGGAGCCA	0.716													T|||	1387	0.276957	0.4236	0.1686	5008	,	,		9831	0.4355		0.0895	False		,,,				2504	0.1851				p.L760R		.											.	USP42-659	0			c.T2279G						.	T	ARG/LEU	589,2085		43,503,791	2.0	4.0	3.0		2279	-10.9	0.0	7	dbSNP_129	3	319,6253		13,293,2980	no	missense	USP42	NM_032172.2	102	56,796,3771	GG,GT,TT		4.8539,22.0269,9.8205	benign	760/1317	6193464	908,8338	1337	3286	4623	SO:0001583	missense	84132	exon15			AATCCCTGGAGGA	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2279T>G	7.37:g.6193464T>G	ENSP00000301962:p.Leu760Arg	2	0		48	28	NM_032172	0	0	0	0	0	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	594	0.27197802197802196	198	0.4024390243902439	47	0.1298342541436464	276	0.4825174825174825	73	0.09630606860158311	T	5.448	0.267700	0.10294	0.220269	0.048539	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.52983	0.64;0.64	5.46	-10.9	0.00192	.	3.729060	0.00447	N	0.000090	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.17961	-1.0352	9	0.10111	T	0.7	.	1.9113	0.03287	0.4032:0.2739:0.0844:0.2385	rs61732616	723;760;760	A4D2N7;Q9H9J4-2;Q9H9J4	.;.;UBP42_HUMAN	R	760;606	ENSP00000301962:L760R;ENSP00000408217:L606R	ENSP00000301962:L760R	L	+	2	0	USP42	6159990	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.066000	0.03454	-2.404000	0.00576	-1.216000	0.01612	CTG	T|0.731;G|0.269		0.716	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
SCIN	85477	broad.mit.edu	37	7	12610451	12610451	+	Silent	SNP	G	G	A	rs76096341	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:12610451G>A	ENST00000297029.5	+	1	140	c.39G>A	c.(37-39)gcG>gcA	p.A13A	AC005281.2_ENST00000433040.1_RNA	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	13	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TCGCCCGGGCGGGCAAGCAGG	0.652													G|||	115	0.0229633	0.0045	0.0317	5008	,	,		15575	0.0		0.0696	False		,,,				2504	0.0174				p.A13A		.											.	SCIN-24	0			c.G39A						.	G		22,1360		0,22,669	17.0	27.0	24.0		39	-7.9	0.1	7	dbSNP_132	24	149,3031		5,139,1446	no	coding-synonymous	SCIN	NM_001112706.2		5,161,2115	AA,AG,GG		4.6855,1.5919,3.7484		13/716	12610451	171,4391	691	1590	2281	SO:0001819	synonymous_variant	85477	exon1			CCGGGCGGGCAAG	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.39G>A	7.37:g.12610451G>A		58	1		160	6	NM_001112706	0	0	0	0	0	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Silent	SNP	ENST00000297029.5	37	CCDS47545.1																																																																																			G|0.970;A|0.030		0.652	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000579174.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	1	0		18	4	NM_002047	0	0	0	0	0	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
NACAD	23148	broad.mit.edu	37	7	45123697	45123697	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:45123697C>T	ENST00000490531.2	-	2	2101	c.2082G>A	c.(2080-2082)tcG>tcA	p.S694S		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	694					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TTGGGGCTGACGAGAGATCTG	0.632																																					p.S694S		.											.	.	0			c.G2082A						.						1.0	1.0	1.0					7																	45123697		51	296	347	SO:0001819	synonymous_variant	23148	exon2			GGCTGACGAGAGA	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.2082G>A	7.37:g.45123697C>T		12	1		20	3	NM_001146334	0	0	0	0	0		Silent	SNP	ENST00000490531.2	37	CCDS47582.1																																																																																			.		0.632	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
NACAD	23148	hgsc.bcm.edu	37	7	45125695	45125695	+	Silent	SNP	C	C	T	rs562528462	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:45125695C>T	ENST00000490531.2	-	2	103	c.84G>A	c.(82-84)gcG>gcA	p.A28A		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	28					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TGGCAGCGGCCGCATCGCAGG	0.672													C|||	3	0.000599042	0.0	0.0029	5008	,	,		15280	0.001		0.0	False		,,,				2504	0.0				p.A28A		.											.	.	0			c.G84A						.						2.0	5.0	4.0					7																	45125695		582	1430	2012	SO:0001819	synonymous_variant	23148	exon2			AGCGGCCGCATCG	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.84G>A	7.37:g.45125695C>T		0	0		8	6	NM_001146334	0	0	0	0	0		Silent	SNP	ENST00000490531.2	37	CCDS47582.1																																																																																			.		0.672	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353652.2	NM_001146334	
AUTS2	26053	broad.mit.edu	37	7	70255577	70255579	+	In_Frame_Del	DEL	CCA	CCA	-	rs35604576|rs375018695		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:70255577_70255579delCCA	ENST00000342771.4	+	19	3696_3698	c.3375_3377delCCA	c.(3373-3378)agccac>agc	p.H1133del	AUTS2_ENST00000406775.2_In_Frame_Del_p.H1109del	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1133	His-rich.									breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ACGACTACAGccaccaccaccac	0.68																																					p.1125_1126del		.											.	AUTS2-92	0			c.3375_3377del						.																																			SO:0001651	inframe_deletion	26053	exon19			CTACAGCCACCAC	AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3375_3377delCCA	7.37:g.70255586_70255588delCCA	ENSP00000344087:p.His1133del	14	0		129	8	NM_015570	0	0	0	0	0	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	In_Frame_Del	DEL	ENST00000342771.4	37	CCDS5539.1																																																																																			.		0.680	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251971.2		
POR	5447	hgsc.bcm.edu	37	7	75615364	75615364	+	Missense_Mutation	SNP	T	T	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:75615364T>C	ENST00000461988.1	+	14	1898	c.1793T>C	c.(1792-1794)tTc>tCc	p.F598S	POR_ENST00000419840.1_Intron|POR_ENST00000394893.1_Missense_Mutation_p.F598S|POR_ENST00000450476.1_Missense_Mutation_p.F497S|TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA|POR_ENST00000545601.1_Missense_Mutation_p.F406S|POR_ENST00000439269.1_Missense_Mutation_p.F336S	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	595					carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	AACGTGGCCTTCTCCCGGGAG	0.677																																					p.F598S		.											.	POR-23	0			c.T1793C						.						19.0	25.0	23.0					7																	75615364		2045	4150	6195	SO:0001583	missense	5447	exon14			TGGCCTTCTCCCG	AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000461988.1:c.1793T>C	7.37:g.75615364T>C	ENSP00000419970:p.Phe598Ser	65	0		350	17	NM_000941	0	0	0	0	0	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Missense_Mutation	SNP	ENST00000461988.1	37	CCDS5579.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271237	0.80469	.	.	ENSG00000127948	ENST00000461988;ENST00000394893;ENST00000545601;ENST00000450476;ENST00000439269	T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36	3.59	3.59	0.41128	Oxidoreductase FAD/NAD(P)-binding (1);	0.000000	0.85682	D	0.000000	D	0.92364	0.7577	H	0.96777	3.88	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.99;0.996	D	0.94149	0.7404	10	0.87932	D	0	-37.7291	12.3556	0.55174	0.0:0.0:0.0:1.0	.	595;497;406;604	P16435;E7EVY7;F5H468;Q59ED7	NCPR_HUMAN;.;.;.	S	598;598;406;497;336	ENSP00000419970:F598S;ENSP00000378355:F598S;ENSP00000446149:F406S;ENSP00000416572:F497S;ENSP00000412490:F336S	ENSP00000378355:F598S	F	+	2	0	POR	75453300	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.582000	0.67477	1.863000	0.54032	0.459000	0.35465	TTC	.		0.677	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252796.7	NM_000941	
SMO	6608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	128851520	128851520	+	Silent	SNP	C	C	T	rs540111843		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:128851520C>T	ENST00000249373.3	+	11	2125	c.1845C>T	c.(1843-1845)tcC>tcT	p.S615S	RP11-286H14.8_ENST00000466717.1_RNA	NM_005631.4	NP_005622.1	Q99835	SMO_HUMAN	smoothened, frizzled class receptor	615					adenohypophysis development (GO:0021984)|anterior/posterior pattern specification (GO:0009952)|atrial septum morphogenesis (GO:0060413)|axon extension involved in axon guidance (GO:0048846)|canonical Wnt signaling pathway (GO:0060070)|cardioblast differentiation (GO:0010002)|cell fate specification (GO:0001708)|cellular response to cholesterol (GO:0071397)|central nervous system neuron differentiation (GO:0021953)|cerebellar cortex morphogenesis (GO:0021696)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|detection of cell density by contact stimulus involved in contact inhibition (GO:0060248)|determination of left/right asymmetry in lateral mesoderm (GO:0003140)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|epithelial-mesenchymal cell signaling (GO:0060684)|exocrine pancreas development (GO:0031017)|facial nerve development (GO:0021561)|floor plate formation (GO:0021508)|forebrain morphogenesis (GO:0048853)|gonad development (GO:0008406)|hair follicle morphogenesis (GO:0031069)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mammary gland epithelial cell differentiation (GO:0060644)|mesenchymal to epithelial transition involved in metanephric renal vesicle formation (GO:0072285)|midgut development (GO:0007494)|multicellular organism growth (GO:0035264)|muscle cell fate commitment (GO:0042693)|myoblast migration (GO:0051451)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of gene expression (GO:0010629)|negative regulation of hair follicle development (GO:0051799)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate commitment (GO:0048663)|neuron projection regeneration (GO:0031102)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|otolith morphogenesis (GO:0032474)|pancreas morphogenesis (GO:0061113)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of hh target transcription factor activity (GO:0007228)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|protein stabilization (GO:0050821)|regulation of heart morphogenesis (GO:2000826)|regulation of stem cell maintenance (GO:2000036)|renal system development (GO:0072001)|semicircular canal morphogenesis (GO:0048752)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021910)|somite development (GO:0061053)|spermatogenesis (GO:0007283)|thalamus development (GO:0021794)|type B pancreatic cell development (GO:0003323)|vasculogenesis (GO:0001570)|ventral midline determination (GO:0007371)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	drug binding (GO:0008144)|G-protein coupled receptor activity (GO:0004930)|patched binding (GO:0005113)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			biliary_tract(1)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(14)|liver(1)|lung(11)|pancreas(2)|prostate(1)|skin(20)|upper_aerodigestive_tract(3)|urinary_tract(1)	64					Fluocinonide(DB01047)|Vismodegib(DB08828)	CTGATGTCTCCTCTGCCTGGG	0.572			Mis		skin basal cell								C|||	1	0.000199681	0.0	0.0	5008	,	,		18675	0.0		0.001	False		,,,				2504	0.0				p.S615S		.		Dom	yes		7	7q31-q32	6608	smoothened homolog (Drosophila)		E	.	SMO-2451	0			c.C1845T						.						75.0	78.0	77.0					7																	128851520		2203	4300	6503	SO:0001819	synonymous_variant	6608	exon11			TGTCTCCTCTGCC	U84401	CCDS5811.1	7q32.1	2014-01-29	2014-01-29	2003-01-17	ENSG00000128602	ENSG00000128602		"""GPCR / Class F : Frizzled receptors"""	11119	protein-coding gene	gene with protein product	"""frizzled family member 11"""	601500	"""smoothened (Drosophila) homolog"", ""smoothened homolog (Drosophila)"", ""smoothened, seven transmembrane spanning receptor"", ""smoothened, frizzled family receptor"""	SMOH		9628830	Standard	NM_005631		Approved	FZD11	uc003vor.3	Q99835	OTTHUMG00000158421	ENST00000249373.3:c.1845C>T	7.37:g.128851520C>T		98	0		149	42	NM_005631	0	0	0	0	0	A4D1K5	Silent	SNP	ENST00000249373.3	37	CCDS5811.1																																																																																			.		0.572	SMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350986.1	NM_005631	
SLC4A2	6522	bcgsc.ca	37	7	150761314	150761314	+	Missense_Mutation	SNP	G	G	A	rs2303929	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:150761314G>A	ENST00000485713.1	+	3	1117	c.77G>A	c.(76-78)gGg>gAg	p.G26E	SLC4A2_ENST00000461735.1_Missense_Mutation_p.G12E|SLC4A2_ENST00000310317.5_Intron|SLC4A2_ENST00000413384.2_Missense_Mutation_p.G26E|SLC4A2_ENST00000392826.2_Missense_Mutation_p.G17E	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	26	Pro-rich.		G -> E (in dbSNP:rs2303929). {ECO:0000269|Ref.2}.		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTGGGCCCTGGGACGCCTGGG	0.617													G|||	1191	0.237819	0.1089	0.4424	5008	,	,		12118	0.2877		0.2425	False		,,,				2504	0.2106				p.G26E		.											.	SLC4A2-90	0			c.G77A						.	G	GLU/GLY,GLU/GLY,GLU/GLY,GLU/GLY	588,3818	259.5+/-263.1	40,508,1655	59.0	54.0	56.0		77,50,35,77	-0.4	0.0	7	dbSNP_100	56	1943,6657	341.8+/-324.2	220,1503,2577	yes	missense,missense,missense,missense	SLC4A2	NM_001199692.1,NM_001199693.1,NM_001199694.1,NM_003040.3	98,98,98,98	260,2011,4232	AA,AG,GG		22.593,13.3454,19.4602	probably-damaging,probably-damaging,probably-damaging,probably-damaging	26/1242,17/1233,12/1228,26/1242	150761314	2531,10475	2203	4300	6503	SO:0001583	missense	6522	exon3			GCCCTGGGACGCC		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.77G>A	7.37:g.150761314G>A	ENSP00000419412:p.Gly26Glu	128	1		143	6	NM_003040	0	0	0	0	0	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	ENST00000485713.1	37	CCDS5917.1	597	0.2733516483516483	62	0.12601626016260162	146	0.40331491712707185	184	0.32167832167832167	205	0.2704485488126649	g	4.728	0.135334	0.09032	0.133454	0.22593	ENSG00000164889	ENST00000483786;ENST00000485713;ENST00000413384;ENST00000490898;ENST00000482950;ENST00000463414;ENST00000488420;ENST00000392826;ENST00000461735	T;T;T;T;T;T;T;T;T	0.75050	0.87;-0.9;-0.9;1.46;0.88;0.88;0.65;-0.86;-0.88	4.28	-0.421	0.12332	.	0.696201	0.13322	N	0.396634	T	0.00012	0.0000	L	0.46157	1.445	0.58432	P	2.9999999999752447E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.29181	-1.0020	9	0.05833	T	0.94	.	1.1008	0.01683	0.1913:0.3358:0.2677:0.2053	rs2303929;rs60575044;rs2303929	17;12;26	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	E	26;26;26;26;26;26;26;17;12	ENSP00000417808:G26E;ENSP00000419412:G26E;ENSP00000405600:G26E;ENSP00000418114:G26E;ENSP00000419379:G26E;ENSP00000418584:G26E;ENSP00000417221:G26E;ENSP00000376571:G17E;ENSP00000419164:G12E	ENSP00000376571:G17E	G	+	2	0	SLC4A2	150392247	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	0.002000	0.13061	-0.328000	0.08539	-0.394000	0.06481	GGG	G|0.779;A|0.221		0.617	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
PRKAG2	51422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	151478345	151478345	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:151478345C>T	ENST00000287878.4	-	3	863	c.359G>A	c.(358-360)cGc>cAc	p.R120H	PRKAG2_ENST00000392801.2_Missense_Mutation_p.R76H|PRKAG2_ENST00000461529.1_5'UTR	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	120					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	GAAGCTCATGCGTCGAGGGGA	0.632																																					p.R120H		.											.	PRKAG2-658	0			c.G359A						.						77.0	78.0	78.0					7																	151478345		2203	4300	6503	SO:0001583	missense	51422	exon3			CTCATGCGTCGAG	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.359G>A	7.37:g.151478345C>T	ENSP00000287878:p.Arg120His	40	0		36	21	NM_016203	0	0	0	0	0	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Missense_Mutation	SNP	ENST00000287878.4	37	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611635	0.87258	.	.	ENSG00000106617	ENST00000287878;ENST00000392801	D;D	0.94138	-2.99;-3.36	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	D	0.94588	0.8256	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.94752	0.7928	10	0.48119	T	0.1	.	17.5175	0.87778	0.0:1.0:0.0:0.0	.	120;120	Q8NCK6;Q9UGJ0	.;AAKG2_HUMAN	H	120;76	ENSP00000287878:R120H;ENSP00000376549:R76H	ENSP00000287878:R120H	R	-	2	0	PRKAG2	151109278	1.000000	0.71417	1.000000	0.80357	0.670000	0.39368	6.981000	0.76166	2.363000	0.80096	0.563000	0.77884	CGC	.		0.632	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
FAM167A	83648	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	11282142	11282142	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr8:11282142C>T	ENST00000528897.1	-	3	1004	c.385G>A	c.(385-387)Gag>Aag	p.E129K	C8orf12_ENST00000284481.3_Intron|FAM167A_ENST00000531564.1_5'UTR|C8orf12_ENST00000529305.1_Intron|FAM167A_ENST00000534308.1_Missense_Mutation_p.E129K|FAM167A_ENST00000284486.4_Missense_Mutation_p.E129K			Q96KS9	F167A_HUMAN	family with sequence similarity 167, member A	129										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|prostate(1)	9						AGCCGCATCTCCGTCTGGAAG	0.602																																					p.E129K		.											.	FAM167A-90	0			c.G385A						.						34.0	31.0	32.0					8																	11282142		2203	4300	6503	SO:0001583	missense	83648	exon3			GCATCTCCGTCTG		CCDS5981.1	8p23-p22	2010-08-27	2008-06-11	2008-06-11	ENSG00000154319	ENSG00000154319			15549	protein-coding gene	gene with protein product		610085	"""chromosome 8 open reading frame 13"""	C8orf13			Standard	NM_053279		Approved		uc003wtw.2	Q96KS9	OTTHUMG00000129361	ENST00000528897.1:c.385G>A	8.37:g.11282142C>T	ENSP00000436655:p.Glu129Lys	90	0		103	43	NM_053279	0	0	0	0	0	A8K3T9|Q3SXY1|Q3SXY3|Q8N3M3|Q9NSR0	Missense_Mutation	SNP	ENST00000528897.1	37	CCDS5981.1	.	.	.	.	.	.	.	.	.	.	C	33	5.195640	0.94960	.	.	ENSG00000154319	ENST00000284486;ENST00000534308;ENST00000528897	T;T;T	0.07114	3.22;3.22;3.22	4.91	4.91	0.64330	.	0.063730	0.64402	D	0.000007	T	0.25044	0.0608	M	0.72118	2.19	0.51767	D	0.999934	D	0.67145	0.996	P	0.58331	0.837	T	0.00742	-1.1585	10	0.72032	D	0.01	-22.1537	17.3188	0.87231	0.0:1.0:0.0:0.0	.	129	Q96KS9	F167A_HUMAN	K	129	ENSP00000284486:E129K;ENSP00000432232:E129K;ENSP00000436655:E129K	ENSP00000284486:E129K	E	-	1	0	FAM167A	11319552	1.000000	0.71417	0.957000	0.39632	0.820000	0.46376	7.178000	0.77657	2.558000	0.86282	0.555000	0.69702	GAG	.		0.602	FAM167A-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000383901.1		
LOXL2	4017	bcgsc.ca	37	8	23186007	23186007	+	Silent	SNP	T	T	C	rs1051146	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr8:23186007T>C	ENST00000389131.3	-	6	1407	c.1038A>G	c.(1036-1038)gaA>gaG	p.E346E	LOXL2_ENST00000518472.1_5'Flank	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	346	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CGGTCCCCCATTCTCCATTTT	0.622													T|||	2840	0.567093	0.4531	0.5274	5008	,	,		16350	0.506		0.7505	False		,,,				2504	0.6237				p.E346E		.											.	LOXL2-272	0			c.A1038G						.	T		2192,2214	587.7+/-386.8	537,1118,548	107.0	88.0	94.0		1038	-1.4	1.0	8	dbSNP_86	94	6353,2247	708.8+/-405.7	2334,1685,281	no	coding-synonymous	LOXL2	NM_002318.2		2871,2803,829	CC,CT,TT		26.1279,49.7503,34.2996		346/775	23186007	8545,4461	2203	4300	6503	SO:0001819	synonymous_variant	4017	exon6			CCCCCATTCTCCA	U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.1038A>G	8.37:g.23186007T>C		130	0		181	6	NM_002318	0	0	0	0	0	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Silent	SNP	ENST00000389131.3	37	CCDS34864.1	1275	0.5837912087912088	226	0.45934959349593496	214	0.5911602209944752	270	0.47202797202797203	565	0.7453825857519789	T	11.30	1.597442	0.28445	0.497503	0.738721	ENSG00000134013	ENST00000520349	.	.	.	5.38	-1.42	0.08913	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999998	.	.	.	.	.	.	T	0.35176	-0.9799	3	.	.	.	.	11.2762	0.49168	0.0:0.439:0.0:0.561	rs1051146;rs3087997;rs3191532;rs3736017;rs17348515;rs17844851;rs17857565;rs60154722;rs1051146	.	.	.	S	63	.	.	N	-	2	0	LOXL2	23241952	0.733000	0.28132	0.997000	0.53966	0.979000	0.70002	-0.127000	0.10547	-0.190000	0.10465	0.379000	0.24179	AAT	T|0.374;C|0.626		0.622	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		
GPR124	25960	hgsc.bcm.edu	37	8	37699516	37699516	+	Silent	SNP	C	C	T	rs7010546	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr8:37699516C>T	ENST00000412232.2	+	19	3673	c.3660C>T	c.(3658-3660)ggC>ggT	p.G1220G	GPR124_ENST00000315215.7_Silent_p.G1003G	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1220					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GCGAGAGCGGCAGTCTGCACA	0.746													C|||	2324	0.464058	0.3048	0.5144	5008	,	,		7503	0.6716		0.4165	False		,,,				2504	0.4785				p.G1220G		.											.	GPR124-157	0			c.C3660T						.	C		594,1854		106,382,736	2.0	3.0	2.0		3660	3.1	1.0	8	dbSNP_116	2	1524,3502		291,942,1280	no	coding-synonymous	GPR124	NM_032777.9		397,1324,2016	TT,TC,CC		30.3223,24.2647,28.3382		1220/1339	37699516	2118,5356	1224	2513	3737	SO:0001819	synonymous_variant	25960	exon19			GAGCGGCAGTCTG	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3660C>T	8.37:g.37699516C>T		0	0		15	13	NM_032777	0	0	0	0	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	ENST00000412232.2	37	CCDS6097.2	1050	0.4807692307692308	166	0.33739837398373984	169	0.46685082872928174	397	0.6940559440559441	318	0.41952506596306066	C	4.050	0.006880	0.07866	0.242647	0.303223	ENSG00000020181	ENST00000416514	.	.	.	3.95	3.07	0.35406	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.9999999999997394	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-18.0593	4.3087	0.10960	0.1378:0.5532:0.2174:0.0916	rs7010546;rs59434562;rs7010546	.	.	.	X	1213	.	ENSP00000405145:Q1213X	Q	+	1	0	GPR124	37818674	0.843000	0.29541	1.000000	0.80357	0.388000	0.30384	-0.114000	0.10757	0.874000	0.35823	0.313000	0.20887	CAG	C|0.479;G|0.000;T|0.520		0.746	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
ADRB3	155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	37823625	37823625	+	Silent	SNP	C	C	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr8:37823625C>A	ENST00000345060.3	-	1	858	c.363G>T	c.(361-363)gtG>gtT	p.V121V	ADRB3_ENST00000520341.1_5'Flank	NM_000025.2	NP_000016.1	P13945	ADRB3_HUMAN	adrenoceptor beta 3	121					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|aging (GO:0007568)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|diet induced thermogenesis (GO:0002024)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|generation of precursor metabolites and energy (GO:0006091)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of MAPK cascade (GO:0043410)|response to antibiotic (GO:0046677)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta-adrenergic receptor activity (GO:0004939)|beta3-adrenergic receptor activity (GO:0015052)|epinephrine binding (GO:0051379)|norepinephrine binding (GO:0051380)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)	9	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)		Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Bethanidine(DB00217)|Bopindolol(DB08807)|Bupranolol(DB08808)|Clenbuterol(DB01407)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Isoprenaline(DB01064)|Mephentermine(DB01365)|Mirabegron(DB08893)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Propranolol(DB00571)|Trimipramine(DB00726)	TGCTGGCGGTCACACACAGCA	0.701																																					p.V121V		.											.	ADRB3-522	0			c.G363T						.						34.0	31.0	32.0					8																	37823625		2197	4299	6496	SO:0001819	synonymous_variant	155	exon1			GGCGGTCACACAC	AY487247	CCDS6099.1	8p12	2012-08-08	2012-05-09			ENSG00000188778		"""GPCR / Class A : Adrenoceptors : beta"""	288	protein-coding gene	gene with protein product		109691	"""adrenergic, beta-3-, receptor"""			7898940, 15123695	Standard	NM_000025		Approved		uc003xkr.2	P13945		ENST00000345060.3:c.363G>T	8.37:g.37823625C>A		40	0		346	136	NM_000025	0	0	0	0	0	Q4JFT4	Silent	SNP	ENST00000345060.3	37	CCDS6099.1																																																																																			.		0.701	ADRB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376826.1	NM_000025	
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		1	0	1096	20	7	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
CNGB3	54714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	87683246	87683246	+	Missense_Mutation	SNP	C	C	T	rs373216514		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr8:87683246C>T	ENST00000320005.5	-	4	466	c.419G>A	c.(418-420)cGt>cAt	p.R140H		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	140					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						TGTTCTTTGACGCATTCTTTT	0.473																																					p.R140H		.											.	CNGB3-93	0			c.G419A						.						246.0	249.0	248.0					8																	87683246		2203	4300	6503	SO:0001583	missense	54714	exon4			CTTTGACGCATTC	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.419G>A	8.37:g.87683246C>T	ENSP00000316605:p.Arg140His	80	0		52	14	NM_019098	0	0	0	0	0	C9JA51|Q9NRE9	Missense_Mutation	SNP	ENST00000320005.5	37	CCDS6244.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.838560	0.51057	.	.	ENSG00000170289	ENST00000320005	T	0.61742	0.08	5.68	1.85	0.25348	.	0.262756	0.32328	N	0.006245	T	0.50633	0.1627	M	0.62723	1.935	0.28492	N	0.914415	B;B	0.31153	0.31;0.206	B;B	0.28465	0.09;0.041	T	0.51411	-0.8709	10	0.66056	D	0.02	.	9.942	0.41587	0.0:0.6634:0.0:0.3366	.	140;140	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	H	140	ENSP00000316605:R140H	ENSP00000316605:R140H	R	-	2	0	CNGB3	87752362	0.051000	0.20477	0.964000	0.40570	0.997000	0.91878	0.150000	0.16263	0.343000	0.23821	0.591000	0.81541	CGT	.		0.473	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375107.1	NM_019098	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		8	8	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	RP11-429J17.8_ENST00000532625.1_RNA|RP11-429J17.8_ENST00000534089.1_RNA|SCRIB_ENST00000377533.3_Silent_p.P1369P|RP11-429J17.8_ENST00000527139.1_RNA|SCRIB_ENST00000546337.1_5'Flank|SCRIB_ENST00000356994.2_Silent_p.P1450P	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		0	0		5	5	NM_015356	0	0	0	0	0	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
DMRT1	1761	hgsc.bcm.edu	37	9	841971	841971	+	Missense_Mutation	SNP	T	T	A	rs3739583	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:841971T>A	ENST00000382276.3	+	1	282	c.133T>A	c.(133-135)Tcg>Acg	p.S45T	DMRT1_ENST00000569227.1_5'Flank	NM_021951.2	NP_068770.2	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor 1	45			S -> T (in dbSNP:rs3739583). {ECO:0000269|PubMed:10332030, ECO:0000269|PubMed:10857744, ECO:0000269|PubMed:16617334}.		cell morphogenesis (GO:0000902)|germ cell migration (GO:0008354)|intracellular signal transduction (GO:0035556)|male germ cell proliferation (GO:0002176)|male sex determination (GO:0030238)|male sex differentiation (GO:0046661)|negative regulation of meiosis (GO:0045835)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oocyte development (GO:0048599)|positive regulation of male gonad development (GO:2000020)|positive regulation of meiosis I (GO:0060903)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of nodal signaling pathway (GO:1900107)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(10)|ovary(1)	13		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		GGCCAGCGGCTCGAGCGCCGG	0.756													T|||	1125	0.224641	0.0923	0.2017	5008	,	,		10887	0.4722		0.1223	False		,,,				2504	0.2699				p.S45T		.											.	DMRT1-515	0			c.T133A						.	T	THR/SER	381,3479		16,349,1565	4.0	5.0	5.0		133	-1.9	0.0	9	dbSNP_107	5	945,6747		48,849,2949	no	missense	DMRT1	NM_021951.2	58	64,1198,4514	AA,AT,TT		12.2855,9.8705,11.4785	benign	45/374	841971	1326,10226	1930	3846	5776	SO:0001583	missense	1761	exon1			AGCGGCTCGAGCG	AF130728	CCDS6442.1	9p24.3	2014-01-21			ENSG00000137090	ENSG00000137090			2934	protein-coding gene	gene with protein product	"""DM domain expressed in testis 1"""	602424				9490411, 10332030	Standard	XM_006716732		Approved	DMT1, CT154	uc003zgv.3	Q9Y5R6	OTTHUMG00000019435	ENST00000382276.3:c.133T>A	9.37:g.841971T>A	ENSP00000371711:p.Ser45Thr	1	0		11	6	NM_021951	0	0	0	0	0	B2R913|Q6T1H8|Q6T1H9|Q8IW77	Missense_Mutation	SNP	ENST00000382276.3	37	CCDS6442.1	482	0.2206959706959707	65	0.13211382113821138	69	0.19060773480662985	259	0.4527972027972028	89	0.11741424802110818	t	3.227	-0.158317	0.06544	0.098705	0.122855	ENSG00000137090	ENST00000451501;ENST00000382276	T	0.18338	2.22	3.29	-1.87	0.07737	.	4.016930	0.01046	N	0.004398	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	B	0.16166	0.016	B	0.12156	0.007	T	0.46816	-0.9164	9	0.11485	T	0.65	.	2.6176	0.04907	0.219:0.1045:0.4923:0.1842	rs3739583;rs3739583	45	Q9Y5R6	DMRT1_HUMAN	T	45	ENSP00000371711:S45T	ENSP00000371711:S45T	S	+	1	0	DMRT1	831971	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.700000	0.05081	-0.232000	0.09811	0.454000	0.30748	TCG	T|0.317;A|0.683		0.756	DMRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051489.2	NM_021951	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		0	0		24	12	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
C9orf41	138199	hgsc.bcm.edu;broad.mit.edu	37	9	77631307	77631307	+	Missense_Mutation	SNP	T	T	C			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:77631307T>C	ENST00000376834.3	-	3	619	c.467A>G	c.(466-468)gAt>gGt	p.D156G	RP11-197P3.5_ENST00000455336.2_RNA|C9orf41_ENST00000376837.3_Missense_Mutation_p.D156G	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	156										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						TTTTAACTTATCCATGTCAAA	0.368																																					p.D156G		.											.	C9orf41-92	0			c.A467G						.						186.0	188.0	187.0					9																	77631307		2203	4300	6503	SO:0001583	missense	138199	exon3			AACTTATCCATGT	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.467A>G	9.37:g.77631307T>C	ENSP00000366030:p.Asp156Gly	89	0		113	8	NM_152420	0	0	0	0	0	Q7Z383|Q8N7C5	Missense_Mutation	SNP	ENST00000376834.3	37	CCDS6649.1	.	.	.	.	.	.	.	.	.	.	T	19.53	3.845766	0.71603	.	.	ENSG00000156017	ENST00000376834;ENST00000376837;ENST00000451153	T;T	0.05258	3.47;3.47	5.75	4.61	0.57282	N2227-like (1);	0.000000	0.85682	D	0.000000	T	0.13200	0.0320	M	0.70842	2.15	0.80722	D	1	P	0.40398	0.716	P	0.45610	0.487	T	0.01472	-1.1346	10	0.38643	T	0.18	-22.4054	11.7518	0.51853	0.0:0.0686:0.0:0.9314	.	156	Q8N4J0	CI041_HUMAN	G	156;156;95	ENSP00000366030:D156G;ENSP00000396353:D95G	ENSP00000366030:D156G	D	-	2	0	C9orf41	76821127	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.673000	0.83973	1.012000	0.39366	0.533000	0.62120	GAT	.		0.368	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052703.1	NM_152420	
PRUNE2	158471	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	79438595	79438595	+	Missense_Mutation	SNP	C	C	G			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:79438595C>G	ENST00000376718.3	-	6	832	c.709G>C	c.(709-711)Gat>Cat	p.D237H	PRUNE2_ENST00000376713.3_Missense_Mutation_p.D237H|PRUNE2_ENST00000428286.1_5'UTR	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	237					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						ATTTCTCCATCTGACAGCTCC	0.358																																					p.D237H		.											.	PRUNE2-157	0			c.G709C						.						155.0	129.0	138.0					9																	79438595		2203	4300	6503	SO:0001583	missense	158471	exon6			CTCCATCTGACAG	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.709G>C	9.37:g.79438595C>G	ENSP00000365908:p.Asp237His	139	0		196	48	NM_015225	0	0	0	0	0	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	37	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435660	0.62955	.	.	ENSG00000106772	ENST00000376718;ENST00000422033;ENST00000376713	T	0.47869	0.83	5.58	5.58	0.84498	DHHA2 (1);	0.279825	0.30667	N	0.009138	T	0.66694	0.2815	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.64257	-0.6450	10	0.41790	T	0.15	.	17.3561	0.87336	0.0:1.0:0.0:0.0	.	237;237	Q8WUY3;D6RTK6	PRUN2_HUMAN;.	H	237;236;237	ENSP00000365908:D237H	ENSP00000365903:D237H	D	-	1	0	PRUNE2	78628415	1.000000	0.71417	0.998000	0.56505	0.685000	0.39939	5.004000	0.63966	2.641000	0.89580	0.563000	0.77884	GAT	.		0.358	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PAPPA	5069	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	118974097	118974097	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:118974097G>T	ENST00000328252.3	+	4	2173	c.1804G>T	c.(1804-1806)Gat>Tat	p.D602Y	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	602					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CCTCTGCAATGATACCAACCC	0.532																																					p.D602Y		.											.	PAPPA-77	0			c.G1804T						.						208.0	200.0	203.0					9																	118974097		2203	4300	6503	SO:0001583	missense	5069	exon4			TGCAATGATACCA		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1804G>T	9.37:g.118974097G>T	ENSP00000330658:p.Asp602Tyr	174	1		170	22	NM_002581	0	0	0	0	0	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	37	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.824614	0.90955	.	.	ENSG00000182752	ENST00000328252	T	0.03242	4.0	5.63	5.63	0.86233	Peptidase M43, pregnancy-associated plasma-A (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.34135	0.0887	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.54655	-0.8261	10	0.87932	D	0	-31.2315	20.047	0.97613	0.0:0.0:1.0:0.0	.	602	Q13219	PAPP1_HUMAN	Y	602	ENSP00000330658:D602Y	ENSP00000330658:D602Y	D	+	1	0	PAPPA	118013918	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.772000	0.98984	2.821000	0.97095	0.555000	0.69702	GAT	.		0.532	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	0	0		12	12	NM_004957	0	0	0	0	0	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
STKLD1	169436	bcgsc.ca	37	9	136268084	136268084	+	Missense_Mutation	SNP	A	A	G	rs3124747	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:136268084A>G	ENST00000371957.3	+	14	1524	c.1417A>G	c.(1417-1419)Aaa>Gaa	p.K473E	C9orf96_ENST00000371955.1_Intron	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		473			K -> E (in dbSNP:rs3124747). {ECO:0000269|PubMed:15489334}.				ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CAGCTCCCTCAAAAGCAGGGA	0.667													G|||	2354	0.470048	0.3533	0.5648	5008	,	,		17050	0.2837		0.6889	False		,,,				2504	0.5276				p.K473E		.											.	C9orf96-334	0			c.A1417G						.	G	GLU/LYS	1810,2574		388,1034,770	33.0	29.0	30.0		1417	-4.6	0.0	9	dbSNP_103	30	5614,2966		1877,1860,553	yes	missense	C9orf96	NM_153710.3	56	2265,2894,1323	GG,GA,AA		34.5688,41.2865,42.7337	benign	473/681	136268084	7424,5540	2192	4290	6482	SO:0001583	missense	169436	exon14			TCCCTCAAAAGCA																												ENST00000371957.3:c.1417A>G	9.37:g.136268084A>G	ENSP00000361025:p.Lys473Glu	148	1		280	11	NM_153710	0	0	0	0	0	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	ENST00000371957.3	37	CCDS35169.1	1069	0.48946886446886445	178	0.3617886178861789	197	0.5441988950276243	157	0.2744755244755245	537	0.7084432717678101	G	0.426	-0.905737	0.02453	0.412865	0.654312	ENSG00000198870	ENST00000371957	T	0.46063	0.88	4.18	-4.6	0.03390	Armadillo-like helical (1);Armadillo-type fold (1);	1.456700	0.04337	N	0.353447	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37407	-0.9707	9	0.02654	T	1	-0.0051	6.4652	0.21977	0.4299:0.291:0.2791:0.0	rs3124747;rs9411511;rs17150551;rs3124747	473	Q8NE28	SGK71_HUMAN	E	473	ENSP00000361025:K473E	ENSP00000361025:K473E	K	+	1	0	C9orf96	135257905	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.236000	0.02925	-0.960000	0.03613	-1.608000	0.00805	AAA	A|0.479;G|0.521		0.667	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054855.1		
EHMT1	79813	hgsc.bcm.edu	37	9	140728974	140728974	+	Silent	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:140728974C>T	ENST00000460843.1	+	26	3741	c.3714C>T	c.(3712-3714)ctC>ctT	p.L1238L		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1238	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GCGAGCAGCTCGGGTACGCAC	0.682																																					p.L1238L		.											.	EHMT1-154	0			c.C3714T						.						33.0	32.0	32.0					9																	140728974		2201	4297	6498	SO:0001819	synonymous_variant	79813	exon26			GCAGCTCGGGTAC	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3714C>T	9.37:g.140728974C>T		3	0		61	22	NM_024757	0	0	0	0	0	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	ENST00000460843.1	37	CCDS7050.2																																																																																			.		0.682	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757	
PNPLA4	8228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	7890140	7890140	+	Splice_Site	SNP	C	C	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chrX:7890140C>T	ENST00000381042.4	-	3	351		c.e3-1		PNPLA4_ENST00000444736.1_Splice_Site|PNPLA4_ENST00000537427.1_Splice_Site	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4						lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				GGTTACATTCCTAAAAAAAGA	0.403																																					.		.											.	PNPLA4-130	0			c.181-1G>A						.						43.0	40.0	41.0					X																	7890140		2203	4298	6501	SO:0001630	splice_region_variant	8228	exon4			ACATTCCTAAAAA	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.181-1G>A	X.37:g.7890140C>T		154	0		118	17	NM_004650	0	0	0	0	0	A8K1H3|B4E362|Q8WW83	Splice_Site	SNP	ENST00000381042.4	37	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	C	9.924	1.212918	0.22289	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000442940	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2926	0.73879	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PNPLA4	7850140	1.000000	0.71417	0.690000	0.30148	0.199000	0.23934	5.738000	0.68613	1.896000	0.54893	0.600000	0.82982	.	.		0.403	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055687.1	NM_004650	Intron
SYTL4	94121	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	99955985	99955985	+	Missense_Mutation	SNP	T	T	A			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chrX:99955985T>A	ENST00000372989.1	-	7	778	c.447A>T	c.(445-447)agA>agT	p.R149S	SYTL4_ENST00000455616.1_Missense_Mutation_p.R149S|SYTL4_ENST00000372981.1_Missense_Mutation_p.R149S|SYTL4_ENST00000276141.6_Missense_Mutation_p.R149S|SYTL4_ENST00000263033.5_Missense_Mutation_p.R149S|SYTL4_ENST00000454200.2_Missense_Mutation_p.R149S	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	149					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCACTGTCTCTCTTTTACTCA	0.473																																					p.R149S		.											.	SYTL4-132	0			c.A447T						.						132.0	116.0	121.0					X																	99955985		2203	4300	6503	SO:0001583	missense	94121	exon6			TGTCTCTCTTTTA		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.447A>T	X.37:g.99955985T>A	ENSP00000362080:p.Arg149Ser	133	0		70	44	NM_001129896	0	0	0	0	0	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Missense_Mutation	SNP	ENST00000372989.1	37	CCDS14472.1	.	.	.	.	.	.	.	.	.	.	t	13.79	2.342285	0.41498	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033;ENST00000372981	T;T;T;T;T;T	0.65732	2.01;2.01;2.02;2.01;2.01;-0.17	5.64	4.48	0.54585	.	0.048975	0.85682	D	0.000000	T	0.72526	0.3471	M	0.70595	2.14	0.26635	N	0.972407	D;D	0.89917	1.0;0.986	D;P	0.80764	0.994;0.835	T	0.65245	-0.6215	9	.	.	.	-22.2919	4.8276	0.13423	0.0:0.2342:0.0:0.7658	.	149;149	Q96C24-2;Q96C24	.;SYTL4_HUMAN	S	149	ENSP00000362080:R149S;ENSP00000390252:R149S;ENSP00000403556:R149S;ENSP00000276141:R149S;ENSP00000263033:R149S;ENSP00000362072:R149S	.	R	-	3	2	SYTL4	99842641	0.999000	0.42202	0.998000	0.56505	0.004000	0.04260	0.288000	0.18939	1.892000	0.54788	0.478000	0.44815	AGA	.		0.473	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057488.1	NM_080737	
MAGEA11	4110	bcgsc.ca	37	X	148798223	148798223	+	Silent	SNP	T	T	C	rs2233050	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chrX:148798223T>C	ENST00000355220.5	+	5	1179	c.1077T>C	c.(1075-1077)ctT>ctC	p.L359L	MAGEA11_ENST00000333104.4_Silent_p.L330L	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	359	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGAGGCTCCTTACCCAAAATT	0.567													-|||	1917	0.507815	0.6543	0.4914	3775	,	,		15281	0.1776		0.3946	False		,,,				2504	0.138				p.L359L		.											.	MAGEA11-132	0			c.T1077C						.	C	,	3095,740		1059,506,471,67,100	129.0	134.0	132.0		990,1077	-0.1	0.0	X	dbSNP_98	132	3249,3479		585,1168,911,675,961	no	coding-synonymous,coding-synonymous	MAGEA11	NM_001011544.1,NM_005366.4	,	1644,1674,1382,742,1061	CC,CT,C,TT,T		48.2907,19.296,39.9413	,	330/401,359/430	148798223	6344,4219	2203	4300	6503	SO:0001819	synonymous_variant	4110	exon5			GCTCCTTACCCAA		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.1077T>C	X.37:g.148798223T>C		190	1		139	6	NM_005366	0	0	0	0	0	Q5ETU4|Q6ZRZ5	Silent	SNP	ENST00000355220.5	37	CCDS48180.1																																																																																			T|0.400;C|0.600		0.567	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058725.4	NM_005366	
IRAK1	3654	bcgsc.ca	37	X	153284192	153284192	+	Missense_Mutation	SNP	A	A	G	rs1059702	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chrX:153284192A>G	ENST00000369980.3	-	5	754	c.587T>C	c.(586-588)tTt>tCt	p.F196S	IRAK1_ENST00000429936.2_Missense_Mutation_p.F222S|MIR718_ENST00000390190.2_RNA|IRAK1_ENST00000477274.1_5'Flank|IRAK1_ENST00000393687.2_Missense_Mutation_p.F196S|IRAK1_ENST00000393682.1_Missense_Mutation_p.F222S|IRAK1_ENST00000369974.2_Missense_Mutation_p.F196S	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	196	ProST region.		F -> S (in dbSNP:rs1059702). {ECO:0000269|PubMed:8599092}.		activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAAAACGGAAAGGGGCGGGC	0.642													G|||	2374	0.628874	0.7337	0.4337	3775	,	,		12789	0.1667		0.6491	False		,,,				2504	0.2883				p.F196S		.											.	IRAK1-1074	0			c.T587C						.	G	SER/PHE,SER/PHE,SER/PHE	3663,172		1491,139,542,2,29	40.0	39.0	39.0		587,587,587	3.7	0.0	X	dbSNP_86	39	5783,945		1800,578,1605,50,267	yes	missense,missense,missense	IRAK1	NM_001025242.1,NM_001025243.1,NM_001569.3	155,155,155	3291,717,2147,52,296	GG,GA,G,AA,A		14.0458,4.485,10.5746	benign,benign,benign	196/683,196/634,196/713	153284192	9446,1117	2203	4300	6503	SO:0001583	missense	3654	exon5			AACGGAAAGGGGC	L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.587T>C	X.37:g.153284192A>G	ENSP00000358997:p.Phe196Ser	345	3		343	9	NM_001569	0	0	0	0	0	D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Missense_Mutation	SNP	ENST00000369980.3	37	CCDS14740.1	1126	0.6787221217600965	256	0.9552238805970149	116	0.48333333333333334	53	0.10474308300395258	339	0.7635135135135135	.	8.005	0.756226	0.15846	0.95515	0.859542	ENSG00000184216	ENST00000369980;ENST00000369974;ENST00000393682;ENST00000393687;ENST00000429936	T;D;D;T;T	0.92858	1.44;-3.12;-3.12;1.44;1.44	4.57	3.68	0.42216	Protein kinase-like domain (1);	0.475758	0.17848	N	0.159961	T	0.00012	0.0000	N	0.00116	-2.08	0.80722	P	0.0	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.44034	-0.9354	9	0.20046	T	0.44	-1.92	6.4293	0.21788	0.1022:0.3457:0.5521:0.0	rs1059702;rs17856471;rs58363670;rs1059702	196;196;196	P51617-4;P51617;P51617-2	.;IRAK1_HUMAN;.	S	196;196;222;196;222	ENSP00000358997:F196S;ENSP00000358991:F196S;ENSP00000377287:F222S;ENSP00000377291:F196S;ENSP00000392662:F222S	ENSP00000358990:F222S	F	-	2	0	IRAK1	152937386	0.053000	0.20554	0.002000	0.10522	0.090000	0.18270	0.487000	0.22356	0.235000	0.21160	-0.252000	0.11476	TTT	0|0.003;T|0.067		0.642	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061143.3		
CELSR2	1952	hgsc.bcm.edu	37	1	109792735	109792736	+	In_Frame_Ins	INS	-	-	CGC	rs377757908|rs59201433|rs144034706	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr1:109792735_109792736insCGC	ENST00000271332.3	+	1	95_96	c.34_35insCGC	c.(34-36)acg>aCGCcg	p.16_17insP		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	16					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCTCCCAACgccgccgccg	0.752														2846	0.568291	0.4198	0.6311	5008	,	,		10222	0.5298		0.7276	False		,,,				2504	0.6002				p.T12delinsTP	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.34_35insCGC						.			1363,1439		473,417,511						3.0	0.1		dbSNP_130	6	4135,1897		1679,777,560	no	coding	CELSR2	NM_001408.2		2152,1194,1071	A1A1,A1R,RR		31.4489,48.6438,37.7632				5498,3336				SO:0001652	inframe_insertion	1952	exon1			CTCCCAACGCCGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.47_49dupCGC	1.37:g.109792742_109792744dupCGC	ENSP00000271332:p.Pro16_Pro16dup	0	0		39	16	NM_001408	0	0	0	0	0	Q5T2Y7|Q92566	In_Frame_Ins	INS	ENST00000271332.3	37	CCDS796.1																																																																																			-|0.389;CGC|0.611		0.752	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
ZNF503	84858	hgsc.bcm.edu	37	10	77158939	77158940	+	Frame_Shift_Ins	INS	-	-	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr10:77158939_77158940insT	ENST00000372524.4	-	2	1994_1995	c.1508_1509insA	c.(1507-1509)tacfs	p.Y503fs	RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503-AS2_ENST00000466942.2_RNA|ZNF503_ENST00000535216.1_Frame_Shift_Ins_p.Y503fs	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	503					G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					GCATAAAGCCGTAGGGGTAGAG	0.688																																					p.Y503_G504delinsX		.											.	ZNF503-91	0			c.1509_1510insA						.																																			SO:0001589	frameshift_variant	84858	exon2			AAAGCCGTAGGGG	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.1509dupA	10.37:g.77158940_77158940dupT	ENSP00000361602:p.Tyr503fs	22	0		83	30	NM_032772	0	0	0	0	0	Q8NAC5|Q96E25|Q96IJ0	Nonsense_Mutation	INS	ENST00000372524.4	37	CCDS7350.1																																																																																			.		0.688	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048826.1	NM_032772	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7579470	7579471	+	Frame_Shift_Ins	INS	-	-	G	rs56275308|rs587782423		TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr17:7579470_7579471insG	ENST00000269305.4	-	4	405_406	c.216_217insC	c.(214-219)cccgtgfs	p.V73fs	TP53_ENST00000413465.2_Frame_Shift_Ins_p.V73fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.V73fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.V73fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.V73fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Ins_p.V73fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	73	Interaction with HRMT1L2.|Interaction with WWOX.		V -> E (in a sporadic cancer; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V73fs*76(11)|p.0?(8)|p.V73L(3)|p.G59fs*23(3)|p.R72fs*51(2)|p.V73M(2)|p.V73fs*9(1)|p.R65fs*38(1)|p.E68fs*76(1)|p.V73fs*50(1)|p.D48fs*55(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.D57_A76del20(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAGGGGCCACGGGGGGAGCAG	0.604		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V73fs	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	37	Insertion - Frameshift(11)|Deletion - Frameshift(9)|Whole gene deletion(8)|Substitution - Missense(5)|Complex - frameshift(3)|Deletion - In frame(1)	upper_aerodigestive_tract(6)|lung(6)|breast(4)|bone(4)|central_nervous_system(3)|biliary_tract(3)|urinary_tract(3)|large_intestine(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|ovary(1)|prostate(1)|liver(1)	c.217_218insC	GRCh37	CI920954	TP53	I		.																																			SO:0001589	frameshift_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGGCCACGGGGGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.217dupC	17.37:g.7579476_7579476dupG	ENSP00000269305:p.Val73fs	53	0		64	47	NM_001126112	0	0	0	0	0	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.604	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
SSUH2	51066	broad.mit.edu	37	3	8675505	8675506	+	Frame_Shift_Ins	INS	-	-	G	rs201775949	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr3:8675505_8675506insG	ENST00000317371.4	-	11	1344_1345	c.119_120insC	c.(118-120)ccgfs	p.P40fs	SSUH2_ENST00000544814.1_Intron|SSUH2_ENST00000341795.3_Frame_Shift_Ins_p.P40fs|SSUH2_ENST00000415132.1_Frame_Shift_Ins_p.P40fs			Q9Y2M2	SSUH2_HUMAN	ssu-2 homolog (C. elegans)	40						cytoplasm (GO:0005737)											AACAGAGAGGCGGGGGCTTCTG	0.639																																					p.P40fs		.											.	.	0			c.120_121insC						.																																			SO:0001589	frameshift_variant	51066	exon4			GAGAGGCGGGGGC	AB024705	CCDS2568.1, CCDS58815.1	3p25.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000125046	ENSG00000125046			24809	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 32"""	C3orf32		20205943	Standard	NM_001256748		Approved	fls485, ssu-2	uc011atg.3	Q9Y2M2	OTTHUMG00000122075	ENST00000317371.4:c.120dupC	3.37:g.8675510_8675510dupG	ENSP00000324551:p.Pro40fs	102	0		210	7	NM_015931	0	0	0	0	0	A6NFA9|B3KS84|B7Z6E3|F5H2S5|Q7Z7K4	Frame_Shift_Ins	INS	ENST00000317371.4	37	CCDS2568.1																																																																																			.		0.639	SSUH2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337900.1	NM_015931	
FNIP1	96459	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	131007363	131007364	+	Frame_Shift_Ins	INS	-	-	T			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr5:131007363_131007364insT	ENST00000510461.1	-	14	2868_2869	c.2773_2774insA	c.(2773-2775)attfs	p.I925fs	FNIP1_ENST00000307954.8_Frame_Shift_Ins_p.I880fs|FNIP1_ENST00000307968.7_Frame_Shift_Ins_p.I897fs|CTC-432M15.3_ENST00000514667.1_Intron	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	925					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TCCTACAGCAATTTTTTTATCT	0.421																																					p.I925fs		.											.	FNIP1-92	0			c.2774_2775insA						.																																			SO:0001589	frameshift_variant	96459	exon14			ACAGCAATTTTTT	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.2774dupA	5.37:g.131007370_131007370dupT	ENSP00000421985:p.Ile925fs	102	0		85	26	NM_133372	0	0	0	0	0	D6RJH5|Q86T47|Q9BUT0	Frame_Shift_Ins	INS	ENST00000510461.1	37	CCDS34227.1																																																																																			.		0.421	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
FZD1	8321	hgsc.bcm.edu	37	7	90894459	90894460	+	In_Frame_Ins	INS	-	-	CCG	rs71292991|rs139480179	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr7:90894459_90894460insCCG	ENST00000287934.2	+	1	677_678	c.264_265insCCG	c.(265-267)ccg>CCGccg	p.89_89P>PP		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	89	Poly-Pro.				autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Q88_P89insP(2)|p.Q88_P89insA(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			cggggcAGCAACCGCCGCCGCC	0.743														1874	0.374201	0.4047	0.4625	5008	,	,		10872	0.2986		0.4294	False		,,,				2504	0.2914				p.Q88delinsQP		.											.	FZD1-658	3	Insertion - In frame(3)	breast(2)|liver(1)	c.264_265insCCG						.			1606,5,2563		359,2,886,0,3,837						0.6	1.0		dbSNP_134	11	3182,3,4959		703,0,1776,1,1,1591	no	codingComplex	FZD1	NM_003505.1		1062,2,2662,1,4,2428	A1A1,A1A2,A1R,A2A2,A2R,RR		39.1085,38.5961,38.9349				4788,8,7522				SO:0001652	inframe_insertion	8321	exon1			GCAGCAACCGCCG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.274_276dupCCG	7.37:g.90894466_90894468dupCCG	ENSP00000287934:p.Pro93dup	2	2		43	18	NM_003505	0	0	0	0	0	A4D1E8|O94815|Q549T8	In_Frame_Ins	INS	ENST00000287934.2	37	CCDS5620.1																																																																																			-|0.606;CCG|0.394		0.743	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
AGPAT2	10555	broad.mit.edu;bcgsc.ca	37	9	139581758	139581759	+	In_Frame_Ins	INS	-	-	CAG	rs371175048|rs77891680|rs201504151	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr9:139581758_139581759insCAG	ENST00000371696.2	-	1	116_117	c.51_52insCTG	c.(49-54)ctggtg>ctgCTGgtg	p.17_18insL	AGPAT2_ENST00000371694.3_In_Frame_Ins_p.17_18insL|AGPAT2_ENST00000538402.1_In_Frame_Ins_p.17_18insL	NM_006412.3	NP_006403.2	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	17					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|epidermis development (GO:0008544)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)	6	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		CTcagctgcaccagcagcagca	0.743														245	0.0489217	0.0083	0.0807	5008	,	,		7580	0.0327		0.1054	False		,,,				2504	0.0399				p.V18delinsLV		.											.	AGPAT2-90	0			c.52_53insCTG						.																																			SO:0001652	inframe_insertion	10555	exon1			GCTGCACCAGCAG	AF000237	CCDS7003.1, CCDS35181.1	9q34.3	2013-02-05	2013-02-05		ENSG00000169692	ENSG00000169692	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	325	protein-coding gene	gene with protein product	"""LPAAT-beta"", ""lysophosphatidic acid acyltransferase, beta"""	603100	"""Berardinelli-Seip congenital lipodystrophy"", ""1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)"""	BSCL		9242711, 9212163	Standard	NM_006412		Approved		uc004cii.1	O15120	OTTHUMG00000020936	ENST00000371696.2:c.49_51dupCTG	9.37:g.139581765_139581767dupCAG	ENSP00000360761:p.Leu17_Leu17dup	4	0		70	39	NM_006412	0	0	0	0	0	O00516|O15106|Q5VUD3|Q5VUD4|Q9BSV7|Q9BWR7	In_Frame_Ins	INS	ENST00000371696.2	37	CCDS7003.1																																																																																			-|0.922;CAG|0.078		0.743	AGPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055090.1	NM_006412	
GAS8	2622	ucsc.edu	37	16	90095596	90095597	+	Intron	DNP	AT	AT	GC	rs61118444|rs55742939|rs71137702	byFrequency	TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	AT	AT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr16:90095596_90095597AT>GC	ENST00000268699.4	+	2	212				C16orf3_ENST00000408886.2_Missense_Mutation_p.I52A|GAS8_ENST00000536122.1_Intron|GAS8_ENST00000540721.1_Intron	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		ggggcaggctatggggcagcct	0.663																																					p.I52A		.											.	C16orf3-90	0			c.A154G						.																																			SO:0001627	intron_variant	750	exon1			AGGCTATGGGGCA	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	Exception_encountered	16.37:g.90095596_90095597delinsGC		58	0		224	0	NM_001214	0	0	0	0	0	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	DNP	ENST00000268699.4	37	CCDS10992.1																																																																																			T|0.361;C|0.639		0.663	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
ZNF814	730051	hgsc.bcm.edu	37	19	58385798	58385799	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-PK-A5HC-01A-11D-A30A-10	TCGA-PK-A5HC-11A-11D-A30A-10	CC	CC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9251b712-6bae-401a-973e-ca78f2c837e8	1dc71f1c-5f27-469f-92f0-00b5a05fe092	g.chr19:58385798_58385799CC>TT	ENST00000435989.2	-	3	1193_1194	c.959_960GG>AA	c.(958-960)gGG>gAA	p.G320E	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	320					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G320E(1)|p.G320G(1)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AAGGTCTTTTCCCAGTGTGAAC	0.356																																					p.G320E		.											.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	central_nervous_system(2)	c.G959A						.																																			SO:0001583	missense	730051	exon3			CTTTTCCCAGTGT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.959_960delinsTT	19.37:g.58385798_58385799delinsTT	ENSP00000410545:p.Gly320Glu	77	0		74	3	NM_001144989	0	0	0	0	0	A6NF35	Missense_Mutation	DNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.356	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
