#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TTLL10	254173	bcgsc.ca	37	1	1120431	1120431	+	Missense_Mutation	SNP	G	G	A	rs1320571	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:1120431G>A	ENST00000379290.1	+	13	1516	c.1343G>A	c.(1342-1344)aGt>aAt	p.S448N	TTLL10_ENST00000379288.3_Missense_Mutation_p.S375N|TTLL10_ENST00000379289.1_Missense_Mutation_p.S448N			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	448	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.		S -> N (in dbSNP:rs1320571).		cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CGCTACATCAGTGACACGTTC	0.607													A|||	928	0.185304	0.3608	0.0562	5008	,	,		19922	0.1478		0.0517	False		,,,				2504	0.2157				p.S448N		.											.	TTLL10-153	0			c.G1343A						.	A	ASN/SER,ASN/SER	1416,2990	681.9+/-404.1	235,946,1022	97.0	75.0	83.0		1343,1124	4.5	0.7	1	dbSNP_88	83	452,8148	797.6+/-407.4	16,420,3864	yes	missense,missense	TTLL10	NM_001130045.1,NM_153254.2	46,46	251,1366,4886	AA,AG,GG		5.2558,32.138,14.3626	benign,benign	448/674,375/405	1120431	1868,11138	2203	4300	6503	SO:0001583	missense	254173	exon13			ACATCAGTGACAC	AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.1343G>A	1.37:g.1120431G>A	ENSP00000368592:p.Ser448Asn	291	0		268	11	NM_001130045	0	0	0	0	0	B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Missense_Mutation	SNP	ENST00000379290.1	37	CCDS44036.1	347	0.15888278388278387	199	0.40447154471544716	23	0.06353591160220995	89	0.1555944055944056	36	0.047493403693931395	A	8.390	0.839575	0.16891	0.32138	0.052558	ENSG00000162571	ENST00000379290;ENST00000379289;ENST00000379288	T;T;T	0.05580	3.42;3.42;3.42	4.54	4.54	0.55810	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00972	-1.085	0.41513	P	0.011647999999999992	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42032	-0.9475	9	0.07644	T	0.81	.	8.3694	0.32406	0.9052:0.0:0.0948:0.0	rs1320571;rs1320571	375;448	Q6ZVT0-3;Q6ZVT0	.;TTL10_HUMAN	N	448;448;375	ENSP00000368592:S448N;ENSP00000368591:S448N;ENSP00000368590:S375N	ENSP00000368590:S375N	S	+	2	0	TTLL10	1110294	1.000000	0.71417	0.746000	0.31095	0.003000	0.03518	6.435000	0.73412	0.789000	0.33779	-0.360000	0.07572	AGT	G|0.839;A|0.161		0.607	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002421.3	NM_153254	
DVL1	1855	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	1273448	1273448	+	Silent	SNP	C	C	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:1273448C>T	ENST00000378888.5	-	14	1907	c.1623G>A	c.(1621-1623)caG>caA	p.Q541Q	DVL1_ENST00000378891.5_Silent_p.Q516Q			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	541					axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GTCCCGGGTACTGGTAGGGGT	0.677																																					p.Q516Q		.											.	DVL1-658	0			c.G1548A						.						14.0	20.0	18.0					1																	1273448		2186	4282	6468	SO:0001819	synonymous_variant	1855	exon14			CGGGTACTGGTAG	AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.1623G>A	1.37:g.1273448C>T		21	0		31	28	NM_004421	0	0	0	52	52	Q5TA33|Q5TA35	Silent	SNP	ENST00000378888.5	37																																																																																				.		0.677	DVL1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000008490.1	NM_004421	
ATAD3A	55210	hgsc.bcm.edu	37	1	1447693	1447693	+	Silent	SNP	C	C	T	rs541906634	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:1447693C>T	ENST00000378755.5	+	1	139	c.45C>T	c.(43-45)ggC>ggT	p.G15G	ATAD3A_ENST00000378756.3_Silent_p.G15G|ATAD3A_ENST00000536055.1_5'Flank	NM_018188.3	NP_060658.3	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A	15	Required for interaction with the inner surface of the mitochondrial outer membrane.		G -> D (in dbSNP:rs2274435). {ECO:0000269|PubMed:15489334}.		cell growth (GO:0016049)|negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(4)|kidney(6)|large_intestine(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		AGGGTGAAggcgcggggccgc	0.756													c|||	35	0.00698882	0.025	0.0029	5008	,	,		5907	0.0		0.0	False		,,,				2504	0.0				p.G15G		.											.	ATAD3A-91	0			c.C45T						.						2.0	3.0	2.0					1																	1447693		1313	3059	4372	SO:0001819	synonymous_variant	55210	exon1			TGAAGGCGCGGGG	AK025865	CCDS31.1, CCDS53259.1, CCDS53260.1	1p36.33	2010-04-21		2007-02-08	ENSG00000197785	ENSG00000197785		"""ATPases / AAA-type"""	25567	protein-coding gene	gene with protein product		612316				12477932	Standard	NM_018188		Approved	FLJ10709	uc001afz.2	Q9NVI7	OTTHUMG00000000575	ENST00000378755.5:c.45C>T	1.37:g.1447693C>T		4	0		16	15	NM_001170535	0	0	0	1	1	B3KPB3|D2K8Q1|G3V1I6|Q5SV23|Q8N275|Q96A50	Silent	SNP	ENST00000378755.5	37	CCDS31.1																																																																																			.		0.756	ATAD3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000001365.1	NM_018188	
CDK11A	728642	ucsc.edu;bcgsc.ca	37	1	1638897	1638897	+	Missense_Mutation	SNP	A	A	G	rs201956539		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:1638897A>G	ENST00000378633.1	-	11	1284	c.1205T>C	c.(1204-1206)tTg>tCg	p.L402S	CDK11A_ENST00000378638.2_Missense_Mutation_p.L365S|CDK11A_ENST00000356200.3_Missense_Mutation_p.L365S|CDK11A_ENST00000358779.5_Missense_Mutation_p.L389S|CDK11A_ENST00000495016.1_5'Flank|CDK11A_ENST00000357760.2_Missense_Mutation_p.L398S|CDK11A_ENST00000404249.3_Missense_Mutation_p.L399S|CDK11A_ENST00000378635.3_3'UTR|RP1-283E3.8_ENST00000598846.1_RNA			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	402			L -> S (in dbSNP:rs1059828). {ECO:0000269|PubMed:8195233}.		apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						CTCGATGGGCAACAGGGCAGG	0.667																																					p.L399S	Pancreas(186;965 2119 30274 40311 50569)	.											.	CDK11A-14	0			c.T1196C						.						60.0	75.0	70.0					1																	1638897		2046	4165	6211	SO:0001583	missense	728642	exon11			ATGGGCAACAGGG	AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.1205T>C	1.37:g.1638897A>G	ENSP00000367900:p.Leu402Ser	67	5		71	58	NM_024011	0	0	0	40	40	O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Missense_Mutation	SNP	ENST00000378633.1	37		.	.	.	.	.	.	.	.	.	.	-	0.252	-1.006077	0.02112	.	.	ENSG00000008128	ENST00000356200;ENST00000404249;ENST00000357760;ENST00000358779;ENST00000378633;ENST00000378638;ENST00000378630	T;T;T;T;T;T	0.04454	3.62;3.62;3.62;3.62;3.62;3.62	2.94	2.94	0.34122	.	0.060786	0.64402	N	0.000002	T	0.01489	0.0048	N	0.01168	-0.975	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.45175	-0.9279	10	0.02654	T	1	.	9.1582	0.37005	0.1118:0.0:0.8882:0.0	.	399;389;399;389	B4E0M9;B4E0N4;Q9UQ88-2;Q9UQ88-4	.;.;.;.	S	365;399;398;389;402;365;365	ENSP00000348529:L365S;ENSP00000384442:L399S;ENSP00000350403:L398S;ENSP00000351629:L389S;ENSP00000367900:L402S;ENSP00000367905:L365S	ENSP00000348529:L365S	L	-	2	0	CDK11A	1628757	1.000000	0.71417	0.239000	0.24122	0.359000	0.29487	6.438000	0.73426	0.467000	0.27218	-0.495000	0.04643	TTG	A|0.998;G|0.002		0.667	CDK11A-005	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000001735.1	NM_024011	
AGMAT	79814	hgsc.bcm.edu	37	1	15911349	15911349	+	Silent	SNP	G	G	A	rs3737705	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:15911349G>A	ENST00000375826.3	-	1	256	c.114C>T	c.(112-114)gaC>gaT	p.D38D	DNAJC16_ENST00000483270.1_Intron|RP4-680D5.2_ENST00000428945.1_RNA	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	38					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		TCCGGGGCGCGTCGGAAGCCT	0.791													G|||	1691	0.33766	0.2685	0.3084	5008	,	,		9254	0.5794		0.2952	False		,,,				2504	0.2464				p.D38D	NSCLC(126;1678 1780 25805 43508 49531)	.											.	AGMAT-91	0			c.C114T						.	G		446,1872		44,358,757	2.0	3.0	3.0		114	-4.1	0.0	1	dbSNP_107	3	1412,4272		187,1038,1617	no	coding-synonymous	AGMAT	NM_024758.4		231,1396,2374	AA,AG,GG		24.8417,19.2407,23.2192		38/353	15911349	1858,6144	1159	2842	4001	SO:0001819	synonymous_variant	79814	exon1			GGGCGCGTCGGAA	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.114C>T	1.37:g.15911349G>A		1	0		7	7	NM_024758	0	0	0	0	0	Q5TDH1|Q9H5J3	Silent	SNP	ENST00000375826.3	37	CCDS160.1																																																																																			G|0.647;A|0.353		0.791	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
IL22RA1	58985	bcgsc.ca	37	1	24465113	24465113	+	Silent	SNP	C	C	T	rs10903022	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:24465113C>T	ENST00000270800.1	-	2	173	c.135G>A	c.(133-135)ccG>ccA	p.P45P		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	45	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		GGGTGCCCTCCGGCCCGCTGT	0.582													C|||	2357	0.470647	0.261	0.5231	5008	,	,		20665	0.7619		0.3628	False		,,,				2504	0.5276				p.P45P		.											.	IL22RA1-91	0			c.G135A						.	C		1200,3206	418.3+/-338.2	167,866,1170	97.0	92.0	93.0		135	-5.4	0.0	1	dbSNP_120	93	3278,5322	490.9+/-373.0	635,2008,1657	no	coding-synonymous	IL22RA1	NM_021258.3		802,2874,2827	TT,TC,CC		38.1163,27.2356,34.4303		45/575	24465113	4478,8528	2203	4300	6503	SO:0001819	synonymous_variant	58985	exon2			GCCCTCCGGCCCG	AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.135G>A	1.37:g.24465113C>T		116	1		97	5	NM_021258	0	0	0	0	0	A8K839|B2R9Y9|Q9HB22	Silent	SNP	ENST00000270800.1	37	CCDS247.1																																																																																			C|0.607;N|0.000		0.582	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008412.1		
KCNA3	3738	broad.mit.edu	37	1	111216299	111216299	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:111216299G>T	ENST00000369769.2	-	1	1356	c.1133C>A	c.(1132-1134)tCg>tAg	p.S378*		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	378					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	GGAGTGGCGCGACAGCTTGAA	0.592																																					p.S378X		.											.	KCNA3-95	0			c.C1133A						.						108.0	107.0	107.0					1																	111216299		2203	4300	6503	SO:0001587	stop_gained	3738	exon1			TGGCGCGACAGCT	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1133C>A	1.37:g.111216299G>T	ENSP00000358784:p.Ser378*	177	2		113	3	NM_002232	0	0	0	0	0	Q5VWN2	Nonsense_Mutation	SNP	ENST00000369769.2	37	CCDS828.2	.	.	.	.	.	.	.	.	.	.	G	39	7.465538	0.98302	.	.	ENSG00000177272	ENST00000369769	.	.	.	5.47	5.47	0.80525	.	0.065309	0.64402	U	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3206	0.94237	0.0:0.0:1.0:0.0	.	.	.	.	X	378	.	ENSP00000358784:S378X	S	-	2	0	KCNA3	111017822	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.864000	0.99589	2.573000	0.86826	0.655000	0.94253	TCG	.		0.592	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232	
PDE4DIP	9659	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	145075687	145075687	+	Missense_Mutation	SNP	C	C	G	rs78401481	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:145075687C>G	ENST00000530740.1	-	1	214	c.176G>C	c.(175-177)aGc>aCc	p.S59T	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.S59T|PDE4DIP_ENST00000369348.3_Missense_Mutation_p.S59T|PDE4DIP_ENST00000369345.4_Missense_Mutation_p.S59T			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	0					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCTGCCCAGCTCCCGGCTGG	0.716			T	PDGFRB	MPD																																p.S59T		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP-663	0			c.G176C						.	C	THR/SER	89,4295		0,89,2103	36.0	46.0	43.0		176	3.7	1.0	1	dbSNP_131	43	0,8572		0,0,4286	no	missense	PDE4DIP	NM_022359.5	58	0,89,6389	GG,GC,CC		0.0,2.0301,0.6869		59/311	145075687	89,12867	2192	4286	6478	SO:0001583	missense	9659	exon1			GCCCAGCTCCCGG	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000530740.1:c.176G>C	1.37:g.145075687C>G	ENSP00000435654:p.Ser59Thr	16	0		115	20	NM_022359	0	0	0	0	0	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000530740.1	37		.	.	.	.	.	.	.	.	.	.	C	9.674	1.147602	0.21288	0.020301	0.0	ENSG00000178104	ENST00000530740;ENST00000369359;ENST00000369348;ENST00000369345	T;T;T	0.14516	3.89;3.87;2.5	3.72	3.72	0.42706	.	.	.	.	.	T	0.12603	0.0306	N	0.24115	0.695	0.24548	N	0.994038	D;P	0.76494	0.999;0.956	D;P	0.80764	0.994;0.899	T	0.10245	-1.0638	9	0.87932	D	0	.	11.1867	0.48660	0.0:1.0:0.0:0.0	.	59;59	Q5TB27;E9PJ64	.;.	T	59	ENSP00000435654:S59T;ENSP00000358366:S59T;ENSP00000358354:S59T	ENSP00000358351:S59T	S	-	2	0	PDE4DIP	143787044	1.000000	0.71417	0.995000	0.50966	0.257000	0.26127	2.114000	0.41911	2.068000	0.61886	0.561000	0.74099	AGC	C|0.989;G|0.011		0.716	PDE4DIP-036	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000384663.2	NM_022359	
NES	10763	bcgsc.ca	37	1	156640503	156640503	+	Silent	SNP	C	C	T	rs3828043	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:156640503C>T	ENST00000368223.3	-	4	3609	c.3477G>A	c.(3475-3477)ggG>ggA	p.G1159G		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1159	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTCTGCTCTTCCCAGGCAGCT	0.632													C|||	1121	0.223842	0.0159	0.2867	5008	,	,		15993	0.2946		0.3022	False		,,,				2504	0.3067				p.G1159G		.											.	NES-520	0			c.G3477A						.	C		279,4127	155.2+/-188.4	9,261,1933	61.0	66.0	64.0		3477	0.5	0.0	1	dbSNP_107	64	2458,6142	399.7+/-346.5	352,1754,2194	no	coding-synonymous	NES	NM_006617.1		361,2015,4127	TT,TC,CC		28.5814,6.3323,21.0441		1159/1622	156640503	2737,10269	2203	4300	6503	SO:0001819	synonymous_variant	10763	exon4			GCTCTTCCCAGGC	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3477G>A	1.37:g.156640503C>T		91	0		68	4	NM_006617	0	0	3	3	0	O00552|Q3LIF5|Q5SYZ6	Silent	SNP	ENST00000368223.3	37	CCDS1151.1																																																																																			C|0.787;T|0.213		0.632	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082844.2	NM_006617	
RNASEL	6041	bcgsc.ca	37	1	182554557	182554557	+	Missense_Mutation	SNP	C	C	T	rs486907	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:182554557C>T	ENST00000367559.3	-	2	1638	c.1385G>A	c.(1384-1386)cGa>cAa	p.R462Q	RNASEL_ENST00000444138.1_Missense_Mutation_p.R462Q|RNASEL_ENST00000539397.1_Missense_Mutation_p.R462Q	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	462	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> Q (risk factor for prostate cancer; reduced enzymatic activity; dbSNP:rs486907). {ECO:0000269|PubMed:11799394, ECO:0000269|PubMed:11941539, ECO:0000269|PubMed:17344846}.		cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						CAGGACATTTCGGGCAAATTC	0.453													C|||	1155	0.230631	0.0666	0.2233	5008	,	,		20473	0.2421		0.3708	False		,,,				2504	0.3016				p.R462Q		.											.	RNASEL-336	0			c.G1385A	GRCh37	CM020962	RNASEL	M	rs486907	.	C	GLN/ARG	587,3819	257.7+/-262.0	42,503,1658	129.0	127.0	128.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1385	0.1	0.0	1	dbSNP_83	128	3065,5535	471.5+/-368.1	516,2033,1751	yes	missense	RNASEL	NM_021133.3	43	558,2536,3409	TT,TC,CC		35.6395,13.3227,28.0793	probably-damaging	462/742	182554557	3652,9354	2203	4300	6503	SO:0001583	missense	6041	exon2			ACATTTCGGGCAA	L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1385G>A	1.37:g.182554557C>T	ENSP00000356530:p.Arg462Gln	241	3		212	8	NM_021133	0	0	2	2	0	Q5W0L2|Q6AI46	Missense_Mutation	SNP	ENST00000367559.3	37	CCDS1347.1	533	0.24404761904761904	26	0.052845528455284556	93	0.2569060773480663	135	0.23601398601398602	279	0.36807387862796836	C	22.0	4.225120	0.79576	0.133227	0.356395	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000543858;ENST00000539397	T;T;T	0.20463	2.07;2.07;2.07	5.95	0.0561	0.14318	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.497265	0.17966	N	0.156039	T	0.00012	0.0000	M	0.76574	2.34	0.80722	P	0.0	D;D;D	0.71674	0.998;0.998;0.998	P;P;P	0.59825	0.864;0.864;0.864	T	0.36138	-0.9760	9	0.18276	T	0.48	-4.1493	0.4865	0.00557	0.1814:0.2702:0.1788:0.3696	rs486907;rs3738580;rs52825450;rs60634396;rs486907	462;462;462	Q5W0L2;Q6AI46;Q05823	.;.;RN5A_HUMAN	Q	462;462;106;462	ENSP00000356530:R462Q;ENSP00000411147:R462Q;ENSP00000440844:R462Q	ENSP00000356530:R462Q	R	-	2	0	RNASEL	180821180	0.001000	0.12720	0.001000	0.08648	0.188000	0.23474	0.217000	0.17603	0.102000	0.17638	0.650000	0.86243	CGA	C|0.737;T|0.263		0.453	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085189.1	NM_021133	
CAPN2	824	bcgsc.ca	37	1	223933079	223933079	+	Silent	SNP	C	C	T	rs17598	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:223933079C>T	ENST00000295006.5	+	4	807	c.498C>T	c.(496-498)ctC>ctT	p.L166L	CAPN2_ENST00000433674.2_Silent_p.L88L	NM_001748.4	NP_001739	P17655	CAN2_HUMAN	calpain 2, (m/II) large subunit	166	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				blastocyst development (GO:0001824)|cellular response to amino acid stimulus (GO:0071230)|myoblast fusion (GO:0007520)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of cytoskeleton organization (GO:0051493)|response to hypoxia (GO:0001666)	chromatin (GO:0000785)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|cytoskeletal protein binding (GO:0008092)			breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|stomach(3)	29				GBM - Glioblastoma multiforme(131;0.109)		GGGAGCTGCTCTTTGTGCATT	0.617													C|||	1378	0.27516	0.6437	0.268	5008	,	,		18108	0.1905		0.0984	False		,,,				2504	0.0511				p.L166L		.											.	CAPN2-523	0			c.C498T						.	C	,	2335,2071	607.3+/-390.9	602,1131,470	93.0	95.0	94.0		264,498	-2.0	1.0	1	dbSNP_63	94	808,7792	187.4+/-234.7	36,736,3528	no	coding-synonymous,coding-synonymous	CAPN2	NM_001146068.1,NM_001748.4	,	638,1867,3998	TT,TC,CC		9.3953,47.0041,24.1658	,	88/623,166/701	223933079	3143,9863	2203	4300	6503	SO:0001819	synonymous_variant	824	exon4			GCTGCTCTTTGTG	J04700	CCDS31035.1, CCDS53478.1	1q41-q42	2013-01-10			ENSG00000162909	ENSG00000162909	3.4.22.52	"""EF-hand domain containing"""	1479	protein-coding gene	gene with protein product		114230				2852952, 2539381	Standard	NM_001748		Approved	mCANP, CANPml, CANPL2	uc001hob.4	P17655	OTTHUMG00000037376	ENST00000295006.5:c.498C>T	1.37:g.223933079C>T		168	2		114	5	NM_001748	0	0	40	40	0	A6NDG7|B7ZA96|E7ES58|Q16738|Q6PJT3|Q8WU26|Q9HBB1	Silent	SNP	ENST00000295006.5	37	CCDS31035.1																																																																																			C|0.742;T|0.258		0.617	CAPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090973.1	NM_001748	
PSEN2	5664	bcgsc.ca	37	1	227077809	227077809	+	Silent	SNP	C	C	T	rs75733498	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:227077809C>T	ENST00000366783.3	+	9	1297	c.861C>T	c.(859-861)ccC>ccT	p.P287P	PSEN2_ENST00000340188.4_Intron|PSEN2_ENST00000366782.1_Silent_p.P320P|PSEN2_ENST00000391872.2_Silent_p.P320P|PSEN2_ENST00000472139.2_Silent_p.P143P|PSEN2_ENST00000422240.2_Silent_p.P287P	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	287					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				GAAATGAGCCCATATTCCCTG	0.577													C|||	146	0.0291534	0.0	0.0562	5008	,	,		17530	0.0635		0.0	False		,,,				2504	0.044				p.P287P		.											.	PSEN2-658	0			c.C861T						.	C	,	1,4405	2.1+/-5.4	0,1,2202	146.0	126.0	133.0		861,861	3.0	1.0	1	dbSNP_132	133	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous	PSEN2	NM_000447.2,NM_012486.2	,	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	,	287/449,287/448	227077809	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	5664	exon9			TGAGCCCATATTC	BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.861C>T	1.37:g.227077809C>T		115	0		90	5	NM_012486	0	0	22	22	0	A8K8D4|B1AP21|Q96P32	Silent	SNP	ENST00000366783.3	37	CCDS1556.1																																																																																			C|0.993;T|0.007		0.577	PSEN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091539.1	NM_000447	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W|OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	0	0		6	5	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
FMN2	56776	mdanderson.org	37	1	240371223	240371223	+	Silent	SNP	C	C	T	rs71297737|rs575452021	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr1:240371223C>T	ENST00000319653.9	+	5	3341	c.3111C>T	c.(3109-3111)ccC>ccT	p.P1037P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1037	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCCACTTCCCGGAGCGGGCA	0.731													C|||	1089	0.217452	0.2088	0.2046	5008	,	,		4578	0.0883		0.2674	False		,,,				2504	0.32				p.P1037P		.											.	FMN2-145	0			c.C3111T						.						3.0	5.0	4.0					1																	240371223		1456	3181	4637	SO:0001819	synonymous_variant	56776	exon5			ACTTCCCGGAGCG	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3111C>T	1.37:g.240371223C>T		13	0		15	7	NM_020066	0	0	0	0	0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																			.		0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
ANKRD30A	91074	ucsc.edu	37	10	37438605	37438605	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr10:37438605A>G	ENST00000602533.1	+	10	1501	c.1402A>G	c.(1402-1404)Aag>Gag	p.K468E	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.K468E|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.K468E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	524					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ATCTGCCTTCAAGGTATTTAG	0.303																																					p.K468E		.											.	ANKRD30A-161	0			c.A1402G						.						161.0	137.0	144.0					10																	37438605		1814	4074	5888	SO:0001583	missense	91074	exon10			GCCTTCAAGGTAT	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1402A>G	10.37:g.37438605A>G	ENSP00000473551:p.Lys468Glu	139	2		121	15	NM_052997	0	0	0	0	0	Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37		.	.	.	.	.	.	.	.	.	.	.	8.353	0.831353	0.16820	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.04119	3.7;3.7	1.28	1.28	0.21552	.	.	.	.	.	T	0.08758	0.0217	L	0.29908	0.895	0.09310	N	1	P	0.46578	0.88	P	0.62184	0.899	T	0.32025	-0.9922	9	0.46703	T	0.11	.	4.7631	0.13118	1.0:0.0:0.0:0.0	.	524	Q9BXX3	AN30A_HUMAN	E	468	ENSP00000354432:K468E;ENSP00000363792:K468E	ENSP00000354432:K468E	K	+	1	0	ANKRD30A	37478611	0.041000	0.20044	0.140000	0.22221	0.050000	0.14768	-0.156000	0.10100	0.835000	0.34877	0.336000	0.21669	AAG	.		0.303	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
FAM21C	253725	bcgsc.ca	37	10	46224381	46224381	+	Silent	SNP	C	C	T	rs17157971	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr10:46224381C>T	ENST00000336378.4	+	3	316	c.198C>T	c.(196-198)gaC>gaT	p.D66D	FAM21C_ENST00000359860.4_Intron|FAM21C_ENST00000537517.1_Silent_p.D66D|FAM21C_ENST00000540872.1_Silent_p.D66D|FAM21C_ENST00000374362.2_Silent_p.D66D|FAM21FP_ENST00000608637.1_RNA	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	66					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						AACAAGTGGACGGACTAATCC	0.383													C|||	249	0.0497204	0.0772	0.0288	5008	,	,		16599	0.0546		0.0507	False		,,,				2504	0.0215				p.D66D		.											.	FAM21C-91	0			c.C198T						.	C	,,	288,3388		8,272,1558	160.0	154.0	156.0		198,198,198	-5.6	0.9	10	dbSNP_123	156	255,7913		4,247,3833	no	coding-synonymous,coding-synonymous,coding-synonymous	FAM21C	NM_001169106.1,NM_001169107.1,NM_015262.2	,,	12,519,5391	TT,TC,CC		3.1219,7.8346,4.5846	,,	66/1280,66/1246,66/1321	46224381	543,11301	1838	4084	5922	SO:0001819	synonymous_variant	253725	exon3			AGTGGACGGACTA		CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.198C>T	10.37:g.46224381C>T		203	2		152	8	NM_015262	0	0	1	1	0	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Silent	SNP	ENST00000336378.4	37																																																																																				C|0.945;T|0.055		0.383	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
SPOCK2	9806	hgsc.bcm.edu	37	10	73848075	73848075	+	Silent	SNP	C	C	T	rs2306324	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr10:73848075C>T	ENST00000373109.2	-	1	456	c.12G>A	c.(10-12)ccG>ccA	p.P4P	SPOCK2_ENST00000536168.1_Silent_p.P4P|SPOCK2_ENST00000412663.1_Silent_p.P4P|SPOCK2_ENST00000317376.4_Silent_p.P4P	NM_001244950.1	NP_001231879.1	Q92563	TICN2_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2	4					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|regulation of cell differentiation (GO:0045595)|signal transduction (GO:0007165)|synapse assembly (GO:0007416)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|glycosaminoglycan binding (GO:0005539)			endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						GCCCGCAGCCCGGGGCGCGCA	0.697													C|||	722	0.144169	0.2201	0.1585	5008	,	,		11692	0.1438		0.0437	False		,,,				2504	0.135				p.P4P		.											.	SPOCK2-90	0			c.G12A						.	C	,	759,3439		58,643,1398	6.0	8.0	7.0		12,12	0.9	0.9	10	dbSNP_100	7	414,7646		9,396,3625	yes	coding-synonymous,coding-synonymous	SPOCK2	NM_001134434.1,NM_014767.2	,	67,1039,5023	TT,TC,CC		5.1365,18.08,9.5693	,	4/78,4/425	73848075	1173,11085	2099	4030	6129	SO:0001819	synonymous_variant	9806	exon2			GCAGCCCGGGGCG	AJ001453	CCDS7313.1, CCDS44431.1	10q22.1	2013-09-19			ENSG00000107742	ENSG00000107742			13564	protein-coding gene	gene with protein product		607988				10386950	Standard	NM_014767		Approved	KIAA0275, testican-2	uc001jso.2	Q92563	OTTHUMG00000018430	ENST00000373109.2:c.12G>A	10.37:g.73848075C>T		0	0		5	5	NM_001134434	0	0	3	3	0	C9J767|Q6UW87	Silent	SNP	ENST00000373109.2	37	CCDS7313.1																																																																																			C|0.870;T|0.130		0.697	SPOCK2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048560.2		
PGAM1	5223	broad.mit.edu	37	10	99186071	99186071	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr10:99186071G>T	ENST00000334828.5	+	1	155	c.7G>T	c.(7-9)Gcc>Tcc	p.A3S	AL355490.1_ENST00000439965.2_5'Flank	NM_002629.2	NP_002620.1	P18669	PGAM1_HUMAN	phosphoglycerate mutase 1 (brain)	3					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|regulation of glycolytic process (GO:0006110)|regulation of pentose-phosphate shunt (GO:0043456)|respiratory burst (GO:0045730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)|protein kinase binding (GO:0019901)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6		Colorectal(252;0.162)		Epithelial(162;8.36e-10)|all cancers(201;5.62e-08)		CGCCATGGCCGCCTACAAACT	0.706																																					p.A3S		.											.	PGAM1-226	0			c.G7T						.						12.0	15.0	14.0					10																	99186071		2003	4038	6041	SO:0001583	missense	5223	exon1			ATGGCCGCCTACA	BC010038	CCDS7458.1	10q25.3	2012-10-02			ENSG00000171314	ENSG00000171314	5.4.2.1		8888	protein-coding gene	gene with protein product	"""Phosphoglycerate mutase A, nonmuscle form"""	172250		PGAMA		2846553	Standard	NM_002629		Approved	PGAM-B	uc001knh.3	P18669	OTTHUMG00000018846	ENST00000334828.5:c.7G>T	10.37:g.99186071G>T	ENSP00000359991:p.Ala3Ser	99	0		218	6	NM_002629	0	1	283	285	1	Q9BWC0	Missense_Mutation	SNP	ENST00000334828.5	37	CCDS7458.1	.	.	.	.	.	.	.	.	.	.	G	8.949	0.967652	0.18659	.	.	ENSG00000171314	ENST00000334828	T	0.80566	-1.39	5.03	4.12	0.48240	.	0.000000	0.64402	U	0.000001	T	0.66446	0.2790	N	0.16201	0.385	0.40796	D	0.983292	B;B	0.26147	0.143;0.026	B;B	0.29176	0.099;0.064	T	0.62900	-0.6756	10	0.30078	T	0.28	-39.4485	12.2036	0.54340	0.084:0.0:0.916:0.0	.	3;3	Q0D2Q6;P18669	.;PGAM1_HUMAN	S	3	ENSP00000359991:A3S	ENSP00000359991:A3S	A	+	1	0	PGAM1	99176061	0.969000	0.33509	0.369000	0.25952	0.024000	0.10985	3.213000	0.51153	1.338000	0.45544	0.484000	0.47621	GCC	.		0.706	PGAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049652.1	NM_002629	
RBM20	282996	hgsc.bcm.edu	37	10	112404302	112404302	+	Silent	SNP	G	G	A	rs35141404	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr10:112404302G>A	ENST00000369519.3	+	1	148	c.90G>A	c.(88-90)cgG>cgA	p.R30R	Y_RNA_ENST00000411370.1_RNA	NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	30	Pro-rich.				heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CTGGTGCCCGGGCGTCCCCGG	0.746													G|||	1113	0.222244	0.4206	0.1354	5008	,	,		7996	0.1617		0.1392	False		,,,				2504	0.1636				p.R30R		.											.	.	0			c.G90A						.						4.0	9.0	7.0					10																	112404302		625	1495	2120	SO:0001819	synonymous_variant	282996	exon1			TGCCCGGGCGTCC	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.90G>A	10.37:g.112404302G>A		0	0		13	11	NM_001134363	0	0	0	0	0	A6NIP5|B5A868|Q5JVI1	Silent	SNP	ENST00000369519.3	37	CCDS44477.1																																																																																			G|0.808;A|0.192		0.746	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
RBM20	282996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	112540915	112540915	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr10:112540915C>T	ENST00000369519.3	+	2	606	c.548C>T	c.(547-549)tCc>tTc	p.S183F		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	183					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CCCGGACCCTCCATGAACCTT	0.592																																					p.S183F		.											.	.	0			c.C548T						.						24.0	23.0	23.0					10																	112540915		692	1591	2283	SO:0001583	missense	282996	exon2			GACCCTCCATGAA	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.548C>T	10.37:g.112540915C>T	ENSP00000358532:p.Ser183Phe	98	0		74	61	NM_001134363	0	0	0	0	0	A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	ENST00000369519.3	37	CCDS44477.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005646	0.35415	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.91740	-2.9	5.51	4.55	0.56014	.	.	.	.	.	D	0.84982	0.5593	N	0.24115	0.695	0.09310	N	1	P	0.34780	0.468	B	0.36030	0.216	T	0.75071	-0.3447	9	0.33940	T	0.23	.	7.0437	0.25035	0.0:0.7336:0.1758:0.0906	.	183	Q5T481	RBM20_HUMAN	F	183	ENSP00000358532:S183F	ENSP00000358532:S183F	S	+	2	0	RBM20	112530905	0.007000	0.16637	0.058000	0.19502	0.690000	0.40134	1.617000	0.36943	2.602000	0.87976	0.591000	0.81541	TCC	.		0.592	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	19	0		91	6	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
DUSP8	1850	hgsc.bcm.edu	37	11	1578741	1578741	+	Silent	SNP	C	C	T	rs182736278	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr11:1578741C>T	ENST00000397374.3	-	7	1012	c.885G>A	c.(883-885)gaG>gaA	p.E295E	DUSP8_ENST00000331588.4_Silent_p.E295E|DUSP8_ENST00000528778.1_5'Flank	NM_004420.2	NP_004411.2	Q13202	DUS8_HUMAN	dual specificity phosphatase 8	295	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|lung(2)|prostate(1)|urinary_tract(1)	5		all_epithelial(84;0.000134)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000621)|Lung(200;0.0687)|LUSC - Lung squamous cell carcinoma(625;0.0825)		TGCGCTCGTACTCCAGCAGCT	0.741													C|||	31	0.0061901	0.0197	0.0058	5008	,	,		11633	0.0		0.001	False		,,,				2504	0.0				p.E295E		.											.	DUSP8-226	0			c.G885A						.	C		33,3915		0,33,1941	6.0	7.0	6.0		885	3.3	1.0	11		6	0,7794		0,0,3897	no	coding-synonymous	DUSP8	NM_004420.2		0,33,5838	TT,TC,CC		0.0,0.8359,0.281		295/626	1578741	33,11709	1974	3897	5871	SO:0001819	synonymous_variant	1850	exon7			CTCGTACTCCAGC		CCDS7724.1	11p15.5	2011-06-09			ENSG00000184545	ENSG00000184545		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3074	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""H1 phosphatase, vaccinia virus homolog"""	602038	"""chromosome 11 open reading frame 81"""	C11orf81		7561881, 9192849	Standard	NM_004420		Approved	HVH-5, HB5, FLJ42958	uc001lts.2	Q13202	OTTHUMG00000133348	ENST00000397374.3:c.885G>A	11.37:g.1578741C>T		0	0		7	5	NM_004420	0	0	0	1	1	Q86SS8	Silent	SNP	ENST00000397374.3	37	CCDS7724.1																																																																																			C|0.990;T|0.010		0.741	DUSP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257178.3	NM_004420	
PTPRJ	5795	broad.mit.edu	37	11	48149412	48149412	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr11:48149412G>A	ENST00000418331.2	+	7	1526	c.1174G>A	c.(1174-1176)Gag>Aag	p.E392K	PTPRJ_ENST00000440289.2_Missense_Mutation_p.E392K	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	392	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						CAGCGATAACGAGTCGTCATC	0.512																																					p.E392K		.											.	PTPRJ-541	0			c.G1174A						.						166.0	139.0	148.0					11																	48149412		2201	4298	6499	SO:0001583	missense	5795	exon7			GATAACGAGTCGT	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.1174G>A	11.37:g.48149412G>A	ENSP00000400010:p.Glu392Lys	121	0		99	4	NM_001098503	0	0	1	1	0	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	ENST00000418331.2	37	CCDS7945.1	.	.	.	.	.	.	.	.	.	.	G	13.97	2.394644	0.42512	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289	T;T	0.56444	0.46;0.46	4.65	1.69	0.24217	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.55081	0.1898	L	0.60455	1.87	0.09310	N	1	P;D	0.58268	0.95;0.982	B;P	0.55965	0.443;0.788	T	0.40720	-0.9548	9	0.26408	T	0.33	.	4.7793	0.13194	0.1924:0.1777:0.6299:0.0	.	392;392	Q12913;Q6P4H4	PTPRJ_HUMAN;.	K	392	ENSP00000400010:E392K;ENSP00000409733:E392K	ENSP00000278456:E392K	E	+	1	0	PTPRJ	48105988	0.002000	0.14202	0.000000	0.03702	0.005000	0.04900	1.228000	0.32588	0.409000	0.25649	0.655000	0.94253	GAG	.		0.512	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390525.1		
TPCN2	219931	bcgsc.ca	37	11	68837957	68837957	+	Missense_Mutation	SNP	G	G	T	rs543282845		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr11:68837957G>T	ENST00000294309.3	+	9	990	c.889G>T	c.(889-891)Gtg>Ttg	p.V297L	TPCN2_ENST00000542467.1_Missense_Mutation_p.V297L|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	297					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AGTCTTCACTGTGATAGGTGA	0.473													g|||	1	0.000199681	0.0008	0.0	5008	,	,		17406	0.0		0.0	False		,,,				2504	0.0				p.V297L		.											.	TPCN2-90	0			c.G889T						.						190.0	170.0	177.0					11																	68837957		2200	4294	6494	SO:0001583	missense	219931	exon9			TTCACTGTGATAG	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.889G>T	11.37:g.68837957G>T	ENSP00000294309:p.Val297Leu	35	0		16	3	NM_139075	0	0	0	0	0	Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	37	CCDS8189.1	.	.	.	.	.	.	.	.	.	.	g	4.473	0.087653	0.08583	.	.	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.98437	-4.93;-4.93	4.33	0.0113	0.14086	Ion transport (1);	0.430507	0.21402	N	0.075138	D	0.91002	0.7170	N	0.05351	-0.065	0.22666	N	0.998879	B;B;B	0.13145	0.007;0.001;0.003	B;B;B	0.12156	0.007;0.005;0.004	T	0.82904	-0.0226	10	0.07482	T	0.82	-5.6371	6.3741	0.21497	0.0967:0.1775:0.6238:0.102	.	297;297;212	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	L	227;297;212;297	ENSP00000294309:V297L;ENSP00000445551:V297L	ENSP00000294309:V297L	V	+	1	0	TPCN2	68594533	0.919000	0.31177	0.899000	0.35326	0.630000	0.37929	1.386000	0.34419	-0.230000	0.09840	-0.516000	0.04426	GTG	.		0.473	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075	
CNTN5	53942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	100095508	100095508	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr11:100095508G>T	ENST00000524871.1	+	16	2259	c.1969G>T	c.(1969-1971)Gac>Tac	p.D657Y	CNTN5_ENST00000279463.3_Missense_Mutation_p.D657Y|CNTN5_ENST00000524560.1_Intron|CNTN5_ENST00000527185.1_Missense_Mutation_p.D657Y|CNTN5_ENST00000528682.1_Missense_Mutation_p.D657Y|CNTN5_ENST00000418526.2_Missense_Mutation_p.D583Y	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	657	Ig-like C2-type 6.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.D657N(2)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GACCACAGCAGACAGTGTGTC	0.433																																					p.D657Y		.											.	CNTN5-366	2	Substitution - Missense(2)	endometrium(2)	c.G1969T						.						127.0	125.0	126.0					11																	100095508		2007	4180	6187	SO:0001583	missense	53942	exon15			ACAGCAGACAGTG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1969G>T	11.37:g.100095508G>T	ENSP00000435637:p.Asp657Tyr	145	0		131	119	NM_001243270	0	0	0	0	0	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087748	0.76642	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.61	5.61	0.85477	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84835	0.5560	M	0.87682	2.9	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87002	0.2117	10	0.87932	D	0	.	18.6296	0.91355	0.0:0.0:1.0:0.0	.	657;583;657	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	Y	657;657;657;583;657	ENSP00000433575:D657Y;ENSP00000436185:D657Y;ENSP00000435637:D657Y;ENSP00000393229:D583Y;ENSP00000279463:D657Y	ENSP00000279463:D657Y	D	+	1	0	CNTN5	99600718	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.334000	0.96470	2.655000	0.90218	0.650000	0.86243	GAC	.		0.433	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		288	15		378	39	NM_032704	0	0	607	1589	982		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
TESPA1	9840	bcgsc.ca	37	12	55368245	55368245	+	Silent	SNP	G	G	A	rs4758993	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr12:55368245G>A	ENST00000449076.1	-	2	234	c.102C>T	c.(100-102)gcC>gcT	p.A34A	TESPA1_ENST00000316577.8_Silent_p.A34A|TESPA1_ENST00000524622.1_5'Flank|TESPA1_ENST00000531122.1_5'Flank|TESPA1_ENST00000532804.1_5'Flank|TESPA1_ENST00000524959.1_5'Flank	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	34					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											GCAGGGCGGCGGCAGCCTCCT	0.602													G|||	2058	0.410942	0.2451	0.2262	5008	,	,		16775	0.7044		0.2336	False		,,,				2504	0.6462				p.A34A		.											.	.	0			c.C102T						.	G	,	943,2959		121,701,1129	19.0	22.0	21.0		102,102	-9.7	0.2	12	dbSNP_111	21	1651,6645		168,1315,2665	no	coding-synonymous,coding-synonymous	KIAA0748	NM_001098815.1,NM_001136030.1	,	289,2016,3794	AA,AG,GG		19.9012,24.1671,21.2658	,	34/522,34/522	55368245	2594,9604	1951	4148	6099	SO:0001819	synonymous_variant	9840	exon2			GGCGGCGGCAGCC	AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.102C>T	12.37:g.55368245G>A		114	0		168	6	NM_001098815	0	0	0	0	0	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Silent	SNP	ENST00000449076.1	37	CCDS44913.1																																																																																			G|0.625;A|0.375		0.602	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383822.1	NM_001098815	
PPFIA2	8499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	81777846	81777846	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr12:81777846T>C	ENST00000549396.1	-	9	1100	c.940A>G	c.(940-942)Aaa>Gaa	p.K314E	PPFIA2_ENST00000550359.2_Missense_Mutation_p.K161E|PPFIA2_ENST00000407050.4_Missense_Mutation_p.K240E|PPFIA2_ENST00000443686.3_Missense_Mutation_p.K215E|PPFIA2_ENST00000548586.1_Missense_Mutation_p.K314E|RP11-315E17.1_ENST00000546936.1_RNA|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000552948.1_Missense_Mutation_p.K314E|PPFIA2_ENST00000549325.1_Missense_Mutation_p.K296E|PPFIA2_ENST00000550584.2_Missense_Mutation_p.K314E|PPFIA2_ENST00000333447.7_Missense_Mutation_p.K296E	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	314	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						TCTTCTGTTTTAATGAGATCC	0.428																																					p.K314E		.											.	PPFIA2-231	0			c.A940G						.						152.0	145.0	147.0					12																	81777846		1912	4124	6036	SO:0001583	missense	8499	exon8			CTGTTTTAATGAG	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.940A>G	12.37:g.81777846T>C	ENSP00000450337:p.Lys314Glu	170	0		282	83	NM_001220476	0	0	0	0	0	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	T	32	5.170947	0.94807	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12;1.12	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.70596	0.3242	M	0.88570	2.965	0.80722	D	1	D;P	0.67145	0.996;0.956	D;D	0.76071	0.987;0.931	T	0.76798	-0.2826	10	0.72032	D	0.01	-36.5517	16.2997	0.82804	0.0:0.0:0.0:1.0	.	214;314	B7Z4H8;O75334	.;LIPA2_HUMAN	E	314;296;240;325;296;314;215;314	ENSP00000450337:K314E;ENSP00000450298:K296E;ENSP00000385093:K240E;ENSP00000327416:K296E;ENSP00000449338:K314E;ENSP00000388373:K215E;ENSP00000447868:K314E	ENSP00000327416:K296E	K	-	1	0	PPFIA2	80301977	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.182000	0.71995	2.250000	0.74265	0.528000	0.53228	AAA	.		0.428	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
ABCB9	23457	broad.mit.edu	37	12	123414623	123414623	+	Silent	SNP	C	C	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr12:123414623C>A	ENST00000542678.1	-	12	4974	c.2136G>T	c.(2134-2136)gtG>gtT	p.V712V	ABCB9_ENST00000344275.7_Intron|ABCB9_ENST00000280560.8_Silent_p.V712V|ABCB9_ENST00000540285.1_Silent_p.V649V|ABCB9_ENST00000442028.2_Silent_p.V715V|ABCB9_ENST00000392439.3_Silent_p.V712V|ABCB9_ENST00000346530.5_Silent_p.V669V|ABCB9_ENST00000442833.2_Intron			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	712	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		CCTTGTCCAGCACCACAATGA	0.662																																					p.V712V	Ovarian(49;786 1333 9175 38236)	.											.	ABCB9-90	0			c.G2136T						.																																			SO:0001819	synonymous_variant	23457	exon12			GTCCAGCACCACA	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.2136G>T	12.37:g.123414623C>A		57	1		219	9	NM_019625	0	0	13	15	2	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Silent	SNP	ENST00000542678.1	37	CCDS9241.1																																																																																			.		0.662	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624	
ATP6V0A2	23545	broad.mit.edu	37	12	124239085	124239085	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr12:124239085G>A	ENST00000330342.3	+	18	2541		c.e18+1		ATP6V0A2_ENST00000544833.1_Splice_Site	NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2						ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		GCTCACGCACGTAAGTTCCTG	0.507																																					.		.											.	ATP6V0A2-92	0			c.2293+1G>A						.						77.0	69.0	71.0					12																	124239085		2203	4300	6503	SO:0001630	splice_region_variant	23545	exon18			ACGCACGTAAGTT	AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.2293+1G>A	12.37:g.124239085G>A		83	0		96	4	NM_012463	0	0	0	0	0	A8K026|Q6NUM0	Splice_Site	SNP	ENST00000330342.3	37	CCDS9254.1	.	.	.	.	.	.	.	.	.	.	G	19.18	3.776968	0.70107	.	.	ENSG00000185344	ENST00000330342;ENST00000534943;ENST00000544833	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4622	0.94921	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP6V0A2	122805038	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	9.797000	0.99108	2.662000	0.90505	0.557000	0.71058	.	.		0.507	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	Intron
SPERT	220082	hgsc.bcm.edu	37	13	46288017	46288017	+	Nonsense_Mutation	SNP	C	C	A	rs79707842	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr13:46288017C>A	ENST00000310521.1	+	3	937	c.857C>A	c.(856-858)tCa>tAa	p.S286*	SPERT_ENST00000378966.3_Nonsense_Mutation_p.S250*	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	286						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		CCCGCCCCCTCACCCCACGAG	0.721													c|||	310	0.061901	0.0068	0.0865	5008	,	,		14469	0.0982		0.0875	False		,,,				2504	0.0552				p.S286X		.											.	SPERT-91	0			c.C857A						.		stop/SER	36,3866		0,36,1915	5.0	8.0	7.0		857	3.2	0.0	13	dbSNP_131	7	419,7219		3,413,3403	no	stop-gained	SPERT	NM_152719.1		3,449,5318	AA,AC,CC		5.4857,0.9226,3.9428		286/449	46288017	455,11085	1951	3819	5770	SO:0001587	stop_gained	220082	exon3			CCCCCTCACCCCA	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.857C>A	13.37:g.46288017C>A	ENSP00000309189:p.Ser286*	0	0		9	9	NM_152719	0	0	0	0	0	A8K8I5|Q8NHV2	Nonsense_Mutation	SNP	ENST00000310521.1	37	CCDS9399.1	161	0.07371794871794872	6	0.012195121951219513	23	0.06353591160220995	68	0.11888111888111888	64	0.08443271767810026	C	21.5	4.165935	0.78339	0.009226	0.054857	ENSG00000174015	ENST00000310521;ENST00000378966	.	.	.	5.05	3.24	0.37175	.	0.731762	0.12237	N	0.486921	.	.	.	.	.	.	0.09310	P	0.9999999999958166	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5116	0.27577	0.1627:0.751:0.0:0.0863	.	.	.	.	X	286;250	.	ENSP00000309189:S286X	S	+	2	0	SPERT	45186018	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	0.355000	0.20163	1.350000	0.45770	0.655000	0.94253	TCA	C|0.925;A|0.075		0.721	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		23	0		67	6	NM_080687	0	0	9	9	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
RTL1	388015	broad.mit.edu	37	14	101349017	101349017	+	Silent	SNP	A	A	G	rs6575805	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr14:101349017A>G	ENST00000534062.1	-	1	2167	c.2109T>C	c.(2107-2109)ttT>ttC	p.F703F	MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR432_ENST00000606207.1_RNA|MIR431_ENST00000385266.1_RNA|MIR136_ENST00000385207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	703					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GGGAGAGCGCAAACGGCTGGT	0.512													G|||	3234	0.645767	0.8495	0.5576	5008	,	,		22279	0.4504		0.7734	False		,,,				2504	0.5031				p.F703F		.											.	RTL1-46	0			c.T2109C						.	G		1167,217		495,177,20	104.0	104.0	104.0		2109	-5.7	0.0	14	dbSNP_116	104	2429,753		915,599,77	no	coding-synonymous	RTL1	NM_001134888.2		1410,776,97	GG,GA,AA		23.6644,15.6792,21.244		703/1359	101349017	3596,970	692	1591	2283	SO:0001819	synonymous_variant	388015	exon1			GAGCGCAAACGGC		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2109T>C	14.37:g.101349017A>G		145	0		216	5	NM_001134888	0	0	0	0	0	E9PKS8	Silent	SNP	ENST00000534062.1	37	CCDS53910.1																																																																																			A|0.311;G|0.689		0.512	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395127.1	NM_001134888	
SPATA5L1	79029	hgsc.bcm.edu	37	15	45695445	45695445	+	Missense_Mutation	SNP	C	C	G	rs143453038	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr15:45695445C>G	ENST00000305560.6	+	1	917	c.818C>G	c.(817-819)tCc>tGc	p.S273C	GATM_ENST00000458245.5_5'Flank|SPATA5L1_ENST00000559860.1_Missense_Mutation_p.S273C	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	273						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		CTGCAGGGTTCCCGGCCTGGG	0.761													C|||	50	0.00998403	0.0023	0.0202	5008	,	,		12129	0.0		0.0298	False		,,,				2504	0.0031				p.S273C		.											.	SPATA5L1-94	0			c.C818G						.	C	CYS/SER	17,3375		0,17,1679	3.0	4.0	4.0		818	4.9	0.3	15	dbSNP_134	4	149,7059		1,147,3456	no	missense	SPATA5L1	NM_024063.2	112	1,164,5135	GG,GC,CC		2.0671,0.5012,1.566	possibly-damaging	273/754	45695445	166,10434	1696	3604	5300	SO:0001583	missense	79029	exon1			AGGGTTCCCGGCC	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.818C>G	15.37:g.45695445C>G	ENSP00000305494:p.Ser273Cys	2	0		29	27	NM_024063	0	0	0	1	1	C9JHR5|Q9H8W7|Q9HA41	Missense_Mutation	SNP	ENST00000305560.6	37	CCDS10123.1	40	0.018315018315018316	8	0.016260162601626018	9	0.024861878453038673	0	0.0	23	0.030343007915567283	C	20.5	3.999282	0.74818	0.005012	0.020671	ENSG00000171763	ENST00000305560	D	0.93426	-3.22	4.9	4.9	0.64082	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.367137	0.28560	N	0.014910	D	0.89111	0.6622	M	0.68728	2.09	0.20307	N	0.999919	D	0.56035	0.974	P	0.57057	0.812	D	0.85330	0.1089	10	0.87932	D	0	-22.4119	16.8259	0.85931	0.0:1.0:0.0:0.0	.	273	Q9BVQ7	SPA5L_HUMAN	C	273	ENSP00000305494:S273C	ENSP00000305494:S273C	S	+	2	0	SPATA5L1	43482737	0.758000	0.28405	0.314000	0.25224	0.281000	0.26958	7.247000	0.78257	2.536000	0.85505	0.585000	0.79938	TCC	C|0.982;G|0.018		0.761	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1	NM_024063	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79051801	79051801	+	Missense_Mutation	SNP	C	C	A	rs201472223		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr15:79051801C>A	ENST00000388820.4	-	24	5233	c.5023G>T	c.(5023-5025)Gcc>Tcc	p.A1675S		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1675					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGGGAGGGGGCGCCGTGGCTG	0.721																																					p.A1675S		.											.	ADAMTS7-226	0			c.G5023T						.						7.0	9.0	9.0					15																	79051801		2082	4133	6215	SO:0001583	missense	11173	exon24			AGGGGGCGCCGTG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.5023G>T	15.37:g.79051801C>A	ENSP00000373472:p.Ala1675Ser	1	0		50	24	NM_014272	0	0	7	7	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	c	1.406	-0.576936	0.03854	.	.	ENSG00000136378	ENST00000388820	T	0.59502	0.26	2.92	0.947	0.19555	.	2.418420	0.02155	U	0.058341	T	0.39627	0.1085	N	0.19112	0.55	0.09310	N	1	B	0.25007	0.116	B	0.23150	0.044	T	0.16600	-1.0397	10	0.09590	T	0.72	.	6.0212	0.19630	0.0:0.7622:0.0:0.2378	.	1675	Q9UKP4	ATS7_HUMAN	S	1675	ENSP00000373472:A1675S	ENSP00000373472:A1675S	A	-	1	0	ADAMTS7	76838856	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.624000	0.24462	0.111000	0.17947	-2.153000	0.00332	GCC	.		0.721	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	MRPS34_ENST00000177742.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank|EME2_ENST00000307394.7_Silent_p.V72V|NME3_ENST00000219302.3_5'Flank|NME3_ENST00000563498.1_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		0	0		8	8	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
ZFP90	146198	broad.mit.edu	37	16	68597636	68597636	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr16:68597636G>T	ENST00000570495.1	+	5	1238	c.946G>T	c.(946-948)Ggg>Tgg	p.G316W	ZFP90_ENST00000398253.2_Missense_Mutation_p.G316W|ZFP90_ENST00000563169.2_Missense_Mutation_p.G316W			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	316					negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		TAGTCTCTGTGGGAAAGCCTT	0.488																																					p.G316W		.											.	ZFP90-91	0			c.G946T						.						71.0	79.0	76.0					16																	68597636		2161	4289	6450	SO:0001583	missense	146198	exon4			CTCTGTGGGAAAG	AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.946G>T	16.37:g.68597636G>T	ENSP00000460547:p.Gly316Trp	83	0		159	5	NM_133458	0	0	10	10	0	B2RU00|B3KVE7|Q49AD1|Q96MQ6	Missense_Mutation	SNP	ENST00000570495.1	37	CCDS42183.1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709376	0.68615	.	.	ENSG00000184939	ENST00000398253	T	0.01516	4.81	6.17	6.17	0.99709	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13457	0.0326	M	0.85542	2.76	0.43172	D	0.994979	D	0.89917	1.0	D	0.97110	1.0	T	0.00007	-1.2504	9	0.72032	D	0.01	-12.0006	18.3732	0.90420	0.0:0.0:1.0:0.0	.	316	Q8TF47	ZFP90_HUMAN	W	316	ENSP00000381304:G316W	ENSP00000381304:G316W	G	+	1	0	ZFP90	67155137	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.862000	0.62976	2.941000	0.99782	0.655000	0.94253	GGG	.		0.488	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436217.3	XM_085375	
MTSS1L	92154	broad.mit.edu	37	16	70698201	70698201	+	Silent	SNP	C	C	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr16:70698201C>A	ENST00000338779.6	-	15	1897	c.1623G>T	c.(1621-1623)ggG>ggT	p.G541G	FLJ00418_ENST00000597002.1_5'UTR	NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	541					filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						CGGTGGGCAGCCCAGCAGTGG	0.711																																					p.G541G		.											.	MTSS1L-68	0			c.G1623T						.						22.0	24.0	24.0					16																	70698201		2188	4278	6466	SO:0001819	synonymous_variant	92154	exon15			GGGCAGCCCAGCA		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.1623G>T	16.37:g.70698201C>A		23	2		79	8	NM_138383	0	0	8	8	0	A6NJI7|Q9BUA8	Silent	SNP	ENST00000338779.6	37	CCDS32476.1																																																																																			.		0.711	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434927.3	NM_138383	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	1	0		15	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ADPRM	56985	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	10608472	10608472	+	Missense_Mutation	SNP	G	G	A	rs74947284		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr17:10608472G>A	ENST00000379774.4	+	2	320	c.229G>A	c.(229-231)Gat>Aat	p.D77N	ADPRM_ENST00000609540.1_Missense_Mutation_p.D77N	NM_020233.4	NP_064618.3	Q3LIE5	ADPRM_HUMAN	ADP-ribose/CDP-alcohol diphosphatase, manganese-dependent	77							ADP-ribose diphosphatase activity (GO:0047631)|CDP-glycerol diphosphatase activity (GO:0047734)|metal ion binding (GO:0046872)										AGATATCATCGATGGATATAA	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		20340	0.0		0.001	False		,,,				2504	0.0				p.D77N		.											.	.	0			c.G229A						.						147.0	138.0	141.0					17																	10608472		2203	4300	6503	SO:0001583	missense	56985	exon2			ATCATCGATGGAT	BC070155	CCDS11159.2	17p13.1	2012-07-20	2012-07-20	2012-07-20	ENSG00000170222	ENSG00000170222	3.6.1.13, 3.6.1.16, 3.6.1.53		30925	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 48"""	C17orf48		18352857	Standard	XM_005256738		Approved	MDS006	uc002gmt.3	Q3LIE5	OTTHUMG00000130366	ENST00000379774.4:c.229G>A	17.37:g.10608472G>A	ENSP00000369099:p.Asp77Asn	166	0		127	113	NM_020233	0	0	1	6	5	A8K9B4|D3DTS4|Q9BVD4|Q9NRU8	Missense_Mutation	SNP	ENST00000379774.4	37	CCDS11159.2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	23.3	4.401669	0.83120	.	.	ENSG00000170222	ENST00000379774	D	0.87809	-2.3	5.65	5.65	0.86999	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.93818	0.8023	M	0.79805	2.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92551	0.6050	10	0.42905	T	0.14	-3.4882	19.5221	0.95189	0.0:0.0:1.0:0.0	.	77	Q3LIE5	ADPRM_HUMAN	N	77	ENSP00000369099:D77N	ENSP00000369099:D77N	D	+	1	0	C17orf48	10549197	1.000000	0.71417	0.986000	0.45419	0.456000	0.32438	8.739000	0.91574	2.941000	0.99782	0.655000	0.94253	GAT	G|0.999;A|0.001		0.403	ADPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252732.2	NM_020233	
KRTAP4-6	81871	ucsc.edu	37	17	39296422	39296422	+	Silent	SNP	A	A	G			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr17:39296422A>G	ENST00000345847.4	-	1	317	c.318T>C	c.(316-318)cgT>cgC	p.R106R		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	106	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						TGCAGCTGGGACGGCAGCAAG	0.652																																					p.R106R		.											.	.	0			c.T318C						.																																			SO:0001819	synonymous_variant	81871	exon1			GCTGGGACGGCAG	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.318T>C	17.37:g.39296422A>G		65	3		195	38	NM_030976	0	0	0	0	0	Q9BYR1	Silent	SNP	ENST00000345847.4	37	CCDS54125.1																																																																																			.		0.652	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305775	39305775	+	Missense_Mutation	SNP	T	T	C	rs535144703|rs141265645|rs58117746	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr17:39305775T>C	ENST00000343246.4	-	1	279	c.245A>G	c.(244-246)cAg>cGg	p.Q82R		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	82	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcaggtggtctggcagcagca	0.657																																					p.Q82R		.											.	KRTAP4-5-90	0			c.A245G						.						14.0	21.0	18.0					17																	39305775		2102	4214	6316	SO:0001583	missense	85289	exon1			GTGGTCTGGCAGC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.245A>G	17.37:g.39305775T>C	ENSP00000340546:p.Gln82Arg	5	0		42	35	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	1.564	-0.535892	0.04082	.	.	ENSG00000198271	ENST00000343246	T	0.00581	6.42	2.44	-3.27	0.05048	.	.	.	.	.	T	0.00271	0.0008	N	0.04260	-0.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35001	-0.9806	9	0.11794	T	0.64	.	3.3098	0.07013	0.2034:0.3821:0.0:0.4145	.	87	Q9BYR2	KRA45_HUMAN	R	82	ENSP00000340546:Q82R	ENSP00000340546:Q82R	Q	-	2	0	KRTAP4-5	36559301	0.000000	0.05858	0.009000	0.14445	0.001000	0.01503	-1.539000	0.02202	-0.998000	0.03446	-1.710000	0.00715	CAG	.		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
HELZ	9931	bcgsc.ca	37	17	65190106	65190106	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr17:65190106G>T	ENST00000358691.5	-	9	700	c.534C>A	c.(532-534)agC>agA	p.S178R	HELZ_ENST00000580168.1_Missense_Mutation_p.S178R|HELZ_ENST00000580662.1_Intron	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	178						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TATATTCCTCGCTGCTTGTGA	0.373																																					p.S178R		.											.	HELZ-92	0			c.C534A						.						59.0	56.0	57.0					17																	65190106		1844	4090	5934	SO:0001583	missense	9931	exon9			TTCCTCGCTGCTT	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.534C>A	17.37:g.65190106G>T	ENSP00000351524:p.Ser178Arg	114	0		82	4	NM_014877	0	0	0	0	0	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594883	0.28445	.	.	ENSG00000198265	ENST00000358691;ENST00000417253	D;T	0.83591	-1.74;1.41	4.86	1.17	0.20885	Zinc finger, CCCH-type (2);	0.038277	0.85682	D	0.000000	T	0.75803	0.3899	L	0.57536	1.79	0.54753	D	0.999987	B;B	0.24651	0.108;0.108	B;B	0.20767	0.031;0.021	T	0.71276	-0.4641	10	0.87932	D	0	-12.4591	6.5811	0.22594	0.4944:0.0:0.5056:0.0	.	178;178	B7ZLW2;P42694	.;HELZ_HUMAN	R	178	ENSP00000351524:S178R;ENSP00000411144:S178R	ENSP00000351524:S178R	S	-	3	2	HELZ	62620568	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.397000	0.34543	0.548000	0.28955	0.585000	0.79938	AGC	.		0.373	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
PRKAR1A	5573	hgsc.bcm.edu;bcgsc.ca	37	17	66526554	66526554	+	Frame_Shift_Del	DEL	C	C	-	rs62638722		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr17:66526554delC	ENST00000589228.1	+	11	1238	c.1110delC	c.(1108-1110)atcfs	p.I370fs	PRKAR1A_ENST00000588188.2_Intron|PRKAR1A_ENST00000586397.1_Frame_Shift_Del_p.I370fs|PRKAR1A_ENST00000536854.2_Frame_Shift_Del_p.I370fs|PRKAR1A_ENST00000392711.1_Frame_Shift_Del_p.I370fs|PRKAR1A_ENST00000358598.2_Frame_Shift_Del_p.I370fs	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	370					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					AACGAAACATCCAGCAGTACA	0.502			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												p.I370fs	Ovarian(167;637 1670 33025 39608 46699 51856)	.	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	.	PRKAR1A-1141	0			c.1110delC						.						212.0	166.0	182.0					17																	66526554		2203	4300	6503	SO:0001589	frameshift_variant	5573	exon11	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;	AAACATCCAGCAG		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.1110delC	17.37:g.66526554delC	ENSP00000464977:p.Ile370fs	154	2		120	94	NM_212472	0	0	0	0	0	K7ER48|Q567S7	Frame_Shift_Del	DEL	ENST00000589228.1	37	CCDS11678.1																																																																																			.		0.502	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1		
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000536229.3_Missense_Mutation_p.L460V|SALL3_ENST00000575389.2_Missense_Mutation_p.L593V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	0	0		9	9	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
ARID3A	1820	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	932572	932572	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:932572C>G	ENST00000263620.3	+	3	850	c.523C>G	c.(523-525)Cga>Gga	p.R175G		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	175						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTGTTCCCCCGAAAGGCCCA	0.741																																					p.R175G	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.C523G						.						10.0	6.0	8.0					19																	932572		2041	4017	6058	SO:0001583	missense	1820	exon3			TTCCCCCGAAAGG	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.523C>G	19.37:g.932572C>G	ENSP00000263620:p.Arg175Gly	12	0		105	35	NM_005224	0	0	1	1	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	ENST00000263620.3	37	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506997	0.44558	.	.	ENSG00000116017	ENST00000263620	T	0.47528	0.84	3.79	3.79	0.43588	.	1023.970000	0.00166	N	0.000000	T	0.43656	0.1257	L	0.29908	0.895	0.29273	N	0.870547	B	0.06786	0.001	B	0.06405	0.002	T	0.28870	-1.0030	10	0.31617	T	0.26	-7.9419	14.3902	0.66973	0.0:1.0:0.0:0.0	.	175	Q99856	ARI3A_HUMAN	G	175	ENSP00000263620:R175G	ENSP00000263620:R175G	R	+	1	2	ARID3A	883572	0.975000	0.34042	0.971000	0.41717	0.619000	0.37552	2.593000	0.46180	1.944000	0.56390	0.443000	0.29094	CGA	.		0.741	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	HMHA1_ENST00000313093.2_5'Flank|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000586866.1_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000536472.1_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		0	0		18	11	NM_019112	0	0	2	4	2	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
C19orf25	148223	hgsc.bcm.edu	37	19	1482150	1482150	+	5'Flank	SNP	G	G	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:1482150G>A	ENST00000436106.2	-	0	0				C19orf25_ENST00000427685.2_5'Flank|C19orf25_ENST00000588427.1_5'Flank|C19orf25_ENST00000585675.1_5'Flank|C19orf25_ENST00000592872.1_5'Flank|C19orf25_ENST00000591027.1_5'Flank|C19orf25_ENST00000588871.1_5'Flank|CTB-25B13.6_ENST00000585643.1_RNA|PCSK4_ENST00000300954.5_Missense_Mutation_p.R626W			Q9UFG5	CS025_HUMAN	chromosome 19 open reading frame 25														Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTGAAGAACCGCGGGGGGCAG	0.697																																					p.R626W		.											.	PCSK4-90	0			c.C1876T						.																																			SO:0001631	upstream_gene_variant	54760	exon15			AGAACCGCGGGGG	AK075267	CCDS45898.1	19p13.3	2012-10-24			ENSG00000119559	ENSG00000119559			26711	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_152482		Approved	FLJ36666	uc010dsk.3	Q9UFG5	OTTHUMG00000180092		19.37:g.1482150G>A	Exception_encountered	0	0		20	7	NM_017573	0	0	0	4	4	B3KQN6|Q8N9R7|Q8WV94	Missense_Mutation	SNP	ENST00000436106.2	37	CCDS45898.1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.278546	0.40294	.	.	ENSG00000115257	ENST00000300954	T	0.63417	-0.04	3.7	-6.84	0.01687	Growth factor, receptor (1);	3.702840	0.02592	U	0.100082	T	0.43389	0.1245	L	0.29908	0.895	0.09310	N	1	B	0.15473	0.013	B	0.06405	0.002	T	0.26503	-1.0101	10	0.52906	T	0.07	.	2.9284	0.05792	0.0936:0.2429:0.1747:0.4888	.	626	Q6UW60	PCSK4_HUMAN	W	626	ENSP00000300954:R626W	ENSP00000300954:R626W	R	-	1	2	PCSK4	1433150	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	-1.845000	0.01677	-0.867000	0.04063	0.462000	0.41574	CGG	.		0.697	C19orf25-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449694.1	NM_152482	
ANKRD24	170961	hgsc.bcm.edu	37	19	4217956	4217956	+	Silent	SNP	A	A	G	rs6510794	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:4217956A>G	ENST00000600132.1	+	18	3075	c.2799A>G	c.(2797-2799)gcA>gcG	p.A933A	ANKRD24_ENST00000318934.4_Silent_p.A933A|ANKRD24_ENST00000262970.5_Silent_p.A1023A	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	933										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGGGCCGGGCAGCCAGTCTGG	0.766													G|||	2256	0.450479	0.5166	0.4164	5008	,	,		6898	0.4692		0.4751	False		,,,				2504	0.3405				p.A933A		.											.	ANKRD24-68	0			c.A2799G						.	G		1357,2019		337,683,668	3.0	6.0	5.0		2799	0.3	1.0	19	dbSNP_116	5	2607,4473		599,1409,1532	no	coding-synonymous	ANKRD24	NM_133475.1		936,2092,2200	GG,GA,AA		36.822,40.1955,37.9112		933/1147	4217956	3964,6492	1688	3540	5228	SO:0001819	synonymous_variant	170961	exon18			CCGGGCAGCCAGT	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2799A>G	19.37:g.4217956A>G		0	0		4	4	NM_133475	0	0	0	1	1	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																			A|0.541;G|0.459		0.766	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
PLIN5	440503	hgsc.bcm.edu	37	19	4524016	4524016	+	Missense_Mutation	SNP	G	G	A	rs1062223	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:4524016G>A	ENST00000381848.3	-	8	996	c.916C>T	c.(916-918)Cgg>Tgg	p.R306W		NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	306	Interaction with PNPLA2 and ABHD5. {ECO:0000250}.		R -> W (in dbSNP:rs1062223). {ECO:0000269|PubMed:17234449}.		lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						GGCAGGCCCCGCACGCTGGAC	0.711													G|||	464	0.0926518	0.0091	0.2104	5008	,	,		13130	0.0288		0.1958	False		,,,				2504	0.0818				p.R306W		.											.	PLIN5-22	0			c.C916T						.	G	TRP/ARG	154,3340		10,134,1603	3.0	4.0	4.0		916	4.6	1.0	19	dbSNP_86	4	1294,5560		114,1066,2247	yes	missense	PLIN5	NM_001013706.2	101	124,1200,3850	AA,AG,GG		18.8795,4.4076,13.993	probably-damaging	306/464	4524016	1448,8900	1747	3427	5174	SO:0001583	missense	440503	exon8			GGCCCCGCACGCT	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.916C>T	19.37:g.4524016G>A	ENSP00000371272:p.Arg306Trp	0	0		6	6	NM_001013706	0	0	0	0	0	A2RRC1|Q6ZS68	Missense_Mutation	SNP	ENST00000381848.3	37	CCDS42473.1	234	0.10714285714285714	10	0.02032520325203252	65	0.17955801104972377	18	0.03146853146853147	141	0.18601583113456466	.	17.14	3.314611	0.60524	0.044076	0.188795	ENSG00000214456	ENST00000381848	T	0.19938	2.11	4.59	4.59	0.56863	.	0.906390	0.09191	U	0.835949	T	0.00073	0.0002	L	0.47716	1.5	0.09310	P	1.0	D	0.89917	1.0	D	0.71184	0.972	T	0.05666	-1.0871	9	0.87932	D	0	-24.5419	14.8561	0.70338	0.0:0.0:1.0:0.0	rs1062223;rs3170378	306	Q00G26	PLIN5_HUMAN	W	306	ENSP00000371272:R306W	ENSP00000371272:R306W	R	-	1	2	PLIN5	4475016	0.995000	0.38212	0.996000	0.52242	0.090000	0.18270	5.443000	0.66581	2.080000	0.62538	0.511000	0.50034	CGG	G|0.892;A|0.108		0.711	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706	
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	1	0		11	6	NM_019107	0	0	2	4	2	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
HNRNPM	4670	hgsc.bcm.edu	37	19	8551112	8551112	+	Silent	SNP	G	G	T	rs12977861	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:8551112G>T	ENST00000325495.4	+	14	1841	c.1800G>T	c.(1798-1800)ctG>ctT	p.L600L	HNRNPM_ENST00000348943.3_Silent_p.L561L	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	600	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GCCCGGCCCTGGGCGCTGGCA	0.697													G|||	195	0.0389377	0.0038	0.0317	5008	,	,		16020	0.0337		0.0616	False		,,,				2504	0.0736				p.L600L		.											.	HNRNPM-68	0			c.G1800T						.	G	,	58,4338		1,56,2141	27.0	31.0	30.0		1800,1683	0.3	1.0	19	dbSNP_121	30	520,8074		23,474,3800	no	coding-synonymous,coding-synonymous	HNRNPM	NM_005968.4,NM_031203.3	,	24,530,5941	TT,TG,GG		6.0507,1.3194,4.4496	,	600/731,561/692	8551112	578,12412	2198	4297	6495	SO:0001819	synonymous_variant	4670	exon14			GGCCCTGGGCGCT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1800G>T	19.37:g.8551112G>T		0	0		20	10	NM_005968	0	0	37	75	38	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Silent	SNP	ENST00000325495.4	37	CCDS12203.1																																																																																			G|0.960;T|0.040		0.697	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	0	0		16	6	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		0	0		6	6	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	0	0		7	7	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
LRP3	4037	hgsc.bcm.edu	37	19	33698018	33698018	+	Missense_Mutation	SNP	C	C	T	rs11539586	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:33698018C>T	ENST00000253193.7	+	7	2052	c.1850C>T	c.(1849-1851)gCg>gTg	p.A617V	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	617					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					CGGCCGCGGGCGCCCCGAGGC	0.751													c|||	306	0.0611022	0.0598	0.0303	5008	,	,		10346	0.0446		0.0348	False		,,,				2504	0.1288				p.A617V		.											.	LRP3-92	0			c.C1850T						.	T	VAL/ALA	150,3256		0,150,1553	2.0	3.0	3.0		1850	1.1	0.1	19	dbSNP_120	3	222,6744		4,214,3265	no	missense	LRP3	NM_002333.3	64	4,364,4818	TT,TC,CC		3.1869,4.404,3.5866	benign	617/771	33698018	372,10000	1703	3483	5186	SO:0001583	missense	4037	exon7			CGCGGGCGCCCCG	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.1850C>T	19.37:g.33698018C>T	ENSP00000253193:p.Ala617Val	2	0		22	14	NM_002333	0	1	12	42	29	B3KQD6|B4DKF2	Missense_Mutation	SNP	ENST00000253193.7	37	CCDS12430.1	71	0.03250915750915751	23	0.046747967479674794	8	0.022099447513812154	15	0.026223776223776224	25	0.032981530343007916	c	1.581	-0.531531	0.04112	0.04404	0.031869	ENSG00000130881	ENST00000253193	D	0.87256	-2.23	3.32	1.14	0.20703	.	0.411391	0.20707	N	0.087178	T	0.38268	0.1034	L	0.38175	1.15	0.09310	N	1	B;D	0.63880	0.001;0.993	B;B	0.38562	0.001;0.276	T	0.55952	-0.8059	10	0.27785	T	0.31	-5.3016	8.5568	0.33487	0.0:0.7835:0.0:0.2165	rs11539586	617;535	O75074;B7ZAJ9	LRP3_HUMAN;.	V	617	ENSP00000253193:A617V	ENSP00000253193:A617V	A	+	2	0	LRP3	38389858	0.435000	0.25577	0.147000	0.22382	0.046000	0.14306	1.013000	0.29937	0.098000	0.17522	-3.141000	0.00059	GCG	T|0.000;G|0.967		0.751	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450842.4		
BLOC1S3	388552	hgsc.bcm.edu	37	19	45682698	45682698	+	Silent	SNP	C	C	A	rs182286598	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:45682698C>A	ENST00000433642.2	+	2	240	c.144C>A	c.(142-144)cgC>cgA	p.R48R	TRAPPC6A_ENST00000585934.1_5'Flank|BLOC1S3_ENST00000587722.1_Silent_p.R48R|TRAPPC6A_ENST00000592647.1_5'Flank|TRAPPC6A_ENST00000588062.1_5'Flank|TRAPPC6A_ENST00000006275.4_5'Flank|AC005779.2_ENST00000593083.1_5'Flank	NM_212550.3	NP_997715.1	Q6QNY0	BL1S3_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 3	48					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|eye development (GO:0001654)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of natural killer cell activation (GO:0032816)|post-Golgi vesicle-mediated transport (GO:0006892)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|transport vesicle (GO:0030133)				ovary(1)|skin(1)	2		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GCCCGACGCGCGGCCGCCCCA	0.756									Hermansky-Pudlak syndrome				C|||	17	0.00339457	0.0	0.0043	5008	,	,		9991	0.0		0.0089	False		,,,				2504	0.0051				p.R48R		.											.	BLOC1S3-90	0			c.C144A						.	C		17,3849		0,17,1916	4.0	5.0	5.0		144	0.4	1.0	19		5	108,7598		1,106,3746	no	coding-synonymous	BLOC1S3	NM_212550.3		1,123,5662	AA,AC,CC		1.4015,0.4397,1.0802		48/203	45682698	125,11447	1933	3853	5786	SO:0001819	synonymous_variant	388552	exon2	Familial Cancer Database	HPS, HPS1-8	GACGCGCGGCCGC	AY531266	CCDS12656.1	19q13.32	2012-08-01	2008-08-11			ENSG00000189114		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20914	protein-coding gene	gene with protein product	"""BLOC-1 subunit 3"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 3"", ""Hermansky-Pudlak syndrome 8"""	609762				15102850	Standard	NM_212550		Approved	BLOS3, HPS8	uc002pax.4	Q6QNY0		ENST00000433642.2:c.144C>A	19.37:g.45682698C>A		1	0		33	20	NM_212550	0	0	0	0	0	B2RXB8	Silent	SNP	ENST00000433642.2	37	CCDS12656.1																																																																																			C|0.995;A|0.005		0.756	BLOC1S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457559.1	NM_212550	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	0	0		14	11	NM_000400	0	0	9	22	13	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		2	0		8	7	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
PPP1R12C	54776	hgsc.bcm.edu	37	19	55628609	55628609	+	Silent	SNP	A	A	G	rs66707428	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr19:55628609A>G	ENST00000263433.3	-	1	318	c.303T>C	c.(301-303)ggT>ggC	p.G101G	PPP1R12C_ENST00000376393.2_Silent_p.G101G	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGGCGCTGATACCGTCGGCGT	0.781													N|||	1009	0.201478	0.2806	0.0965	5008	,	,		7556	0.2738		0.1093	False		,,,				2504	0.1892				p.G101G		.											.	PPP1R12C-227	0			c.T303C						.						1.0	2.0	1.0					19																	55628609		1184	2666	3850	SO:0001819	synonymous_variant	54776	exon1			GCTGATACCGTCG	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.303T>C	19.37:g.55628609A>G		0	0		8	5	NM_017607	0	0	1	3	2		Silent	SNP	ENST00000263433.3	37	CCDS12916.1																																																																																			A|0.808;G|0.192		0.781	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
TP53I3	9540	broad.mit.edu	37	2	24307079	24307079	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr2:24307079T>G	ENST00000238721.4	-	1	972	c.118A>C	c.(118-120)Aac>Cac	p.N40H	TP53I3_ENST00000335934.4_Missense_Mutation_p.N40H|TP53I3_ENST00000313482.4_Missense_Mutation_p.N40H|FAM228B_ENST00000461972.1_Intron|TP53I3_ENST00000407482.1_Missense_Mutation_p.N40H|TP53I3_ENST00000417886.1_5'UTR	NM_004881.4	NP_004872.2	Q53FA7	QORX_HUMAN	tumor protein p53 inducible protein 3	40					NADP metabolic process (GO:0006739)	extracellular vesicular exosome (GO:0070062)	NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(2)|lung(3)|urinary_tract(2)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCGCCCGGTTCAGGGCGCTG	0.662											OREG0014492	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N40H		.											.	TP53I3-226	0			c.A118C						.						34.0	35.0	35.0					2																	24307079		2203	4300	6503	SO:0001583	missense	9540	exon2			CCCGGTTCAGGGC	AF010309	CCDS1708.1, CCDS56112.1	2p23.3	2009-06-12			ENSG00000115129	ENSG00000115129			19373	protein-coding gene	gene with protein product		605171				11919562, 10840161, 19349281	Standard	NM_004881		Approved	PIG3	uc002rez.2	Q53FA7	OTTHUMG00000090817	ENST00000238721.4:c.118A>C	2.37:g.24307079T>G	ENSP00000238721:p.Asn40His	41	0	770	50	5	NM_147184	0	0	5	5	0	D6W533|O14679|O14685|Q38G78|Q6JLE7|Q9BWB8	Missense_Mutation	SNP	ENST00000238721.4	37	CCDS1708.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.548787	0.86127	.	.	ENSG00000115129	ENST00000335934;ENST00000238721;ENST00000313482;ENST00000407482;ENST00000413037	T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45	5.04	5.04	0.67666	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	H	0.97758	4.07	0.43868	D	0.996472	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.59658	-0.7413	10	0.87932	D	0	-0.0071	13.8895	0.63729	0.0:0.0:0.0:1.0	.	40;40	Q53FA7;Q53FA7-2	QORX_HUMAN;.	H	40;40;40;40;35	ENSP00000337834:N40H;ENSP00000238721:N40H;ENSP00000322298:N40H;ENSP00000384414:N40H;ENSP00000389620:N35H	ENSP00000238721:N40H	N	-	1	0	TP53I3	24160583	1.000000	0.71417	0.999000	0.59377	0.622000	0.37654	6.807000	0.75201	2.036000	0.60181	0.533000	0.62120	AAC	.		0.662	TP53I3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207618.2	NM_004881	
GPR113	165082	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	26537397	26537397	+	Silent	SNP	A	A	G			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr2:26537397A>G	ENST00000311519.1	-	7	1016	c.1017T>C	c.(1015-1017)ctT>ctC	p.L339L	GPR113_ENST00000459892.1_Intron|GPR113_ENST00000333478.6_Silent_p.L140L|GPR113_ENST00000421160.2_Silent_p.L270L|GPR113_ENST00000541401.1_Intron	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	339					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTGGTATGGAAGTCGAGCCA	0.612																																					p.L339L		.											.	GPR113-94	0			c.T1017C						.						125.0	100.0	108.0					2																	26537397		2203	4300	6503	SO:0001819	synonymous_variant	165082	exon7			GTATGGAAGTCGA	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1017T>C	2.37:g.26537397A>G		380	2		317	276	NM_001145168	0	0	0	0	0	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Silent	SNP	ENST00000311519.1	37	CCDS46239.1																																																																																			.		0.612	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316892.1	NM_153835	
TMEM247	388946	ucsc.edu;bcgsc.ca	37	2	46707808	46707808	+	Missense_Mutation	SNP	C	C	G	rs70940616|rs74318890		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr2:46707808C>G	ENST00000434431.1	+	2	382	c.382C>G	c.(382-384)Cag>Gag	p.Q128E		NM_001145051.2	NP_001138523.1	A6NEH6	TM247_HUMAN	transmembrane protein 247	128						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											GAACCAGCGGCAGCGGCAGCA	0.662																																					p.Q128E		.											.	.	0			c.C382G						.						30.0	40.0	37.0					2																	46707808		692	1591	2283	SO:0001583	missense	388946	exon2			CAGCGGCAGCGGC		CCDS56117.1	2p21	2012-04-11			ENSG00000187600	ENSG00000187600			42967	protein-coding gene	gene with protein product							Standard	NM_001145051		Approved		uc010yod.3	A6NEH6	OTTHUMG00000153137	ENST00000434431.1:c.382C>G	2.37:g.46707808C>G	ENSP00000388684:p.Gln128Glu	187	1		276	36	NM_001145051	0	0	0	0	0		Missense_Mutation	SNP	ENST00000434431.1	37	CCDS56117.1	.	.	.	.	.	.	.	.	.	.	C	17.67	3.447093	0.63178	.	.	ENSG00000187600	ENST00000434431	.	.	.	4.76	4.76	0.60689	.	0.000000	0.39475	N	0.001353	T	0.65606	0.2707	L	0.34521	1.04	.	.	.	D	0.56035	0.974	D	0.70487	0.969	T	0.71735	-0.4503	8	0.54805	T	0.06	-28.7409	14.7885	0.69821	0.0:1.0:0.0:0.0	.	128	A6NEH6	YB028_HUMAN	E	128	.	ENSP00000388684:Q128E	Q	+	1	0	AC018682.6	46561312	1.000000	0.71417	1.000000	0.80357	0.569000	0.35902	3.910000	0.56371	2.484000	0.83849	0.563000	0.77884	CAG	G|1.000;|0.000		0.662	TMEM247-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329726.1	NM_001145051	
IMMT	10989	ucsc.edu;bcgsc.ca	37	2	86400824	86400824	+	Missense_Mutation	SNP	G	G	A	rs1050301	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr2:86400824G>A	ENST00000410111.3	-	4	757	c.370C>T	c.(370-372)Cct>Tct	p.P124S	IMMT_ENST00000442664.2_Missense_Mutation_p.P124S|IMMT_ENST00000409051.2_Missense_Mutation_p.P124S|IMMT_ENST00000490238.1_5'Flank|IMMT_ENST00000449247.2_Missense_Mutation_p.P124S|IMMT_ENST00000254636.5_Missense_Mutation_p.P37S	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	124			P -> S (in dbSNP:rs6750289). {ECO:0000269|PubMed:17974005, ECO:0000269|PubMed:9168817}.		mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGTGAGGCAGGCTGTTTAGAT	0.328													G|||	1649	0.329273	0.0219	0.4236	5008	,	,		16353	0.5069		0.3628	False		,,,				2504	0.4601				p.P124S		.											.	IMMT-91	0			c.C370T						.	G	SER/PRO,SER/PRO,SER/PRO	331,3325		11,309,1508	144.0	120.0	127.0		370,370,370	3.4	1.0	2	dbSNP_86	127	2750,5406		456,1838,1784	no	missense,missense,missense	IMMT	NM_001100169.1,NM_001100170.1,NM_006839.2	74,74,74	467,2147,3292	AA,AG,GG		33.7175,9.0536,26.0836	possibly-damaging,possibly-damaging,possibly-damaging	124/758,124/748,124/759	86400824	3081,8731	1828	4078	5906	SO:0001583	missense	10989	exon4			AGGCAGGCTGTTT	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.370C>T	2.37:g.86400824G>A	ENSP00000387262:p.Pro124Ser	34	0		37	4	NM_006839	0	0	51	51	0	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	37	CCDS46355.1	725|725	0.33195970695970695|0.33195970695970695	6|6	0.012195121951219513|0.012195121951219513	151|151	0.4171270718232044|0.4171270718232044	286|286	0.5|0.5	282|282	0.3720316622691293|0.3720316622691293	G|G	18.35|18.35	3.604107|3.604107	0.66445|0.66445	0.090536|0.090536	0.337175|0.337175	ENSG00000132305|ENSG00000132305	ENST00000419070|ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715	.|T;T;T;T;T	.|0.30714	.|1.52;1.52;1.52;1.52;1.52	3.43|3.43	3.43|3.43	0.39272|0.39272	.|.	.|0.176656	.|0.51477	.|D	.|0.000090	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.71581|0.71581	2.175|2.175	0.09310|0.09310	P|P	0.9999999284871|0.9999999284871	.|P;P;P;B;B;P;B;P	.|0.52061	.|0.938;0.747;0.95;0.147;0.007;0.938;0.007;0.95	.|P;P;P;B;B;P;B;P	.|0.58266	.|0.747;0.679;0.836;0.153;0.065;0.747;0.065;0.836	T|T	0.48536|0.48536	-0.9027|-0.9027	4|9	.|0.14656	.|T	.|0.56	-9.876|-9.876	13.8948|13.8948	0.63764|0.63764	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	rs6750289;rs6750289|rs6750289;rs6750289	.|124;124;124;124;124;124;124;124	.|F5GZ32;B9A067;B4DKR1;Q05DN3;F8W9I1;Q16891-2;Q16891-3;Q16891	.|.;.;.;.;.;.;.;IMMT_HUMAN	V|S	21|37;124;124;124;124;124;124;124;124	.|ENSP00000254636:P37S;ENSP00000396899:P124S;ENSP00000387262:P124S;ENSP00000407788:P124S;ENSP00000387227:P124S	.|ENSP00000254636:P37S	A|P	-|-	2|1	0|0	IMMT|IMMT	86254335|86254335	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.063000|6.063000	0.71162|0.71162	1.836000|1.836000	0.53414|0.53414	0.561000|0.561000	0.74099|0.74099	GCC|CCT	T|0.226;G|0.216;C|0.446;N|0.001;A|0.111		0.328	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
LIMS1	3987	ucsc.edu	37	2	109293130	109293130	+	Silent	SNP	A	A	G	rs2438733	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr2:109293130A>G	ENST00000393310.1	+	7	881	c.714A>G	c.(712-714)gcA>gcG	p.A238A	LIMS1_ENST00000338045.3_Silent_p.A238A|LIMS1_ENST00000410093.1_Silent_p.A242A|LIMS1_ENST00000409441.1_Silent_p.A275A|LIMS1_ENST00000544547.1_Silent_p.A250A|LIMS1_ENST00000542845.1_Silent_p.A300A|LIMS1_ENST00000332345.6_Silent_p.A238A|AC010095.5_ENST00000411710.1_RNA	NM_001193488.1	NP_001180417.1	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1	238	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell aging (GO:0007569)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chordate embryonic development (GO:0043009)|establishment or maintenance of cell polarity (GO:0007163)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|protein heterooligomerization (GO:0051291)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	10						AAGGCCTGGCATATTGTGAAA	0.373																																					p.A300A		.											.	LIMS1-522	0			c.A900G						.						58.0	45.0	50.0					2																	109293130		2104	3948	6052	SO:0001819	synonymous_variant	3987	exon7			CCTGGCATATTGT		CCDS2078.1, CCDS54382.1, CCDS54383.1, CCDS54384.1, CCDS54385.1	2q12.3	2008-05-23			ENSG00000169756	ENSG00000169756			6616	protein-coding gene	gene with protein product		602567				7517666, 10022929	Standard	NM_001193482		Approved	PINCH, PINCH1	uc002tek.4	P48059	OTTHUMG00000130983	ENST00000393310.1:c.714A>G	2.37:g.109293130A>G		263	4		50	10	NM_001193485	0	0	0	4	4	B2RAJ4|B7Z483|B7Z7R3|B7Z907|Q53TE0|Q9BS44	Silent	SNP	ENST00000393310.1	37	CCDS2078.1																																																																																			A|0.500;G|0.500		0.373	LIMS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253596.1	NM_004987	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		0	0		7	7	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
C2orf54	79919	hgsc.bcm.edu	37	2	241827798	241827798	+	Missense_Mutation	SNP	T	T	C	rs11899555	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr2:241827798T>C	ENST00000388934.4	-	4	1320	c.1162A>G	c.(1162-1164)Atc>Gtc	p.I388V	C2orf54_ENST00000307486.8_Missense_Mutation_p.I239V|C2orf54_ENST00000402775.2_Missense_Mutation_p.I220V	NM_001085437.1	NP_001078906	Q08AI8	CB054_HUMAN	chromosome 2 open reading frame 54	388										haematopoietic_and_lymphoid_tissue(1)|lung(4)|prostate(1)	6		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)		CCGGAGCCGATGCGCGGCGGG	0.711													T|||	1192	0.238019	0.5356	0.0994	5008	,	,		10641	0.1766		0.0954	False		,,,				2504	0.1442				p.I388V		.											.	C2orf54-90	0			c.A1162G						.	T	VAL/ILE,VAL/ILE	1174,2058		185,804,627	4.0	5.0	5.0		1162,658	-5.4	0.0	2	dbSNP_120	5	504,6652		22,460,3096	yes	missense,missense	C2orf54	NM_001085437.1,NM_024861.2	29,29	207,1264,3723	CC,CT,TT		7.043,36.3243,16.1533	benign,benign	388/448,220/280	241827798	1678,8710	1616	3578	5194	SO:0001583	missense	79919	exon4			AGCCGATGCGCGG	AK026324, AK056601	CCDS42839.1, CCDS42840.1, CCDS63187.1	2q37.3	2011-02-23			ENSG00000172478	ENSG00000172478			26216	protein-coding gene	gene with protein product							Standard	NM_001282921		Approved	FLJ22671	uc002wae.4	Q08AI8	OTTHUMG00000151906	ENST00000388934.4:c.1162A>G	2.37:g.241827798T>C	ENSP00000373586:p.Ile388Val	2	0		12	11	NM_001085437	0	0	0	0	0	B3KPP9|H7BXM3|Q08AI9|Q53QU5|Q9H622	Missense_Mutation	SNP	ENST00000388934.4	37	CCDS42839.1	443	0.20283882783882784	254	0.516260162601626	34	0.09392265193370165	81	0.14160839160839161	74	0.09762532981530343	T	4.846	0.157297	0.09236	0.363243	0.07043	ENSG00000172478	ENST00000402775;ENST00000307486;ENST00000388934	T;T;T	0.42900	0.96;1.52;1.54	4.61	-5.43	0.02632	.	0.927650	0.08993	N	0.864092	T	0.00012	0.0000	N	0.17082	0.46	0.80722	P	0.0	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.48186	-0.9057	9	0.87932	D	0	0.0087	6.4354	0.21821	0.0:0.3174:0.3681:0.3145	rs11899555	388;239;220	Q08AI8;B3KU29;Q08AI8-3	CB054_HUMAN;.;.	V	220;239;388	ENSP00000385338:I220V;ENSP00000302779:I239V;ENSP00000373586:I388V	ENSP00000302779:I239V	I	-	1	0	C2orf54	241476471	0.000000	0.05858	0.013000	0.15412	0.076000	0.17211	-0.609000	0.05635	-0.841000	0.04200	0.477000	0.44152	ATC	T|0.796;C|0.204		0.711	C2orf54-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324353.1	NM_024861, NM_001085437	
C2orf54	79919	hgsc.bcm.edu	37	2	241827805	241827805	+	Silent	SNP	C	C	A	rs75895045	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr2:241827805C>A	ENST00000388934.4	-	4	1313	c.1155G>T	c.(1153-1155)ccG>ccT	p.P385P	C2orf54_ENST00000307486.8_Silent_p.P236P|C2orf54_ENST00000402775.2_Silent_p.P217P	NM_001085437.1	NP_001078906	Q08AI8	CB054_HUMAN	chromosome 2 open reading frame 54	385										haematopoietic_and_lymphoid_tissue(1)|lung(4)|prostate(1)	6		all_epithelial(40;3.99e-16)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)		CGATGCGCGGCGGGGGGCTGC	0.711													C|||	339	0.0676917	0.2443	0.0216	5008	,	,		10617	0.0		0.0	False		,,,				2504	0.001				p.P385P		.											.	C2orf54-90	0			c.G1155T						.						4.0	5.0	5.0					2																	241827805		1595	3562	5157	SO:0001819	synonymous_variant	79919	exon4			GCGCGGCGGGGGG	AK026324, AK056601	CCDS42839.1, CCDS42840.1, CCDS63187.1	2q37.3	2011-02-23			ENSG00000172478	ENSG00000172478			26216	protein-coding gene	gene with protein product							Standard	NM_001282921		Approved	FLJ22671	uc002wae.4	Q08AI8	OTTHUMG00000151906	ENST00000388934.4:c.1155G>T	2.37:g.241827805C>A		2	0		10	9	NM_001085437	0	0	0	0	0	B3KPP9|H7BXM3|Q08AI9|Q53QU5|Q9H622	Silent	SNP	ENST00000388934.4	37	CCDS42839.1																																																																																			C|0.942;A|0.058		0.711	C2orf54-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324353.1	NM_024861, NM_001085437	
FAM182B	728882	broad.mit.edu	37	20	25755549	25755549	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr20:25755549C>A	ENST00000376403.1	-	3	785	c.407G>T	c.(406-408)gGc>gTc	p.G136V	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	136										lung(1)	1						TGGTCTGCAGCCTTCCTGGGA	0.716																																					.		.											.	.	0			.						.																																			SO:0001583	missense	728882	.			CTGCAGCCTTCCT			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.407G>T	20.37:g.25755549C>A	ENSP00000365585:p.Gly136Val	18	0		86	6	.	0	0	5	5	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	1.024	-0.684035	0.03353	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	V	136	.	ENSP00000365585:G136V	G	-	2	0	FAM182B	25703549	0.129000	0.22400	0.158000	0.22627	0.158000	0.22134	-0.337000	0.07852	0.064000	0.16427	0.064000	0.15345	GGC	.		0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
FAM182A	284800	broad.mit.edu	37	20	26061817	26061817	+	RNA	SNP	T	T	C			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr20:26061817T>C	ENST00000376398.2	+	0	837					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A									p.C57R(2)		breast(1)|endometrium(2)|kidney(1)	4						TGATTTCTCCTGCTTAGAAAT	0.468																																					.		.											.	.	2	Substitution - Missense(2)	endometrium(2)	.						.																																					284800	.			TTCTCCTGCTTAG	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061817T>C		51	0		75	7	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	8.475	0.858516	0.17178	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.48624	0.1510	.	.	.	0.31219	N	0.697674	.	.	.	.	.	.	T	0.56932	-0.7897	4	0.87932	D	0	.	.	.	.	.	.	.	.	R	57	.	ENSP00000246000:C57R	C	+	1	0	FAM182A	26009817	1.000000	0.71417	0.456000	0.27044	0.471000	0.32888	0.691000	0.25467	0.379000	0.24794	0.104000	0.15600	TGC	.		0.468	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
PROCR	10544	broad.mit.edu	37	20	33762727	33762727	+	Missense_Mutation	SNP	G	G	T	rs200377875		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr20:33762727G>T	ENST00000216968.4	+	2	375	c.293G>T	c.(292-294)cGc>cTc	p.R98L	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	98					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.R98L(2)		breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	GGCCTCGTGCGCCTGGTGCAC	0.726																																					p.R98L		.											.	PROCR-226	2	Substitution - Missense(2)	prostate(1)|kidney(1)	c.G293T						.						20.0	17.0	18.0					20																	33762727		2194	4296	6490	SO:0001583	missense	10544	exon2			TCGTGCGCCTGGT	L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.293G>T	20.37:g.33762727G>T	ENSP00000216968:p.Arg98Leu	23	0		45	5	NM_006404	0	0	5	5	0	B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	ENST00000216968.4	37	CCDS13248.1	.	.	.	.	.	.	.	.	.	.	g	26.5	4.741327	0.89573	.	.	ENSG00000101000	ENST00000374477;ENST00000216968	D	0.82984	-1.67	5.22	-10.4	0.00318	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.402480	0.04770	N	0.427767	T	0.71837	0.3387	L	0.51422	1.61	0.09310	N	1	B	0.30179	0.271	B	0.28385	0.089	T	0.61227	-0.7105	10	0.56958	D	0.05	-6.7275	4.9914	0.14216	0.5133:0.0:0.1891:0.2976	.	98	Q9UNN8	EPCR_HUMAN	L	98	ENSP00000216968:R98L	ENSP00000216968:R98L	R	+	2	0	PROCR	33226388	0.000000	0.05858	0.002000	0.10522	0.952000	0.60782	-3.074000	0.00617	-2.082000	0.00868	0.556000	0.70494	CGC	.		0.726	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078843.3		
IFNAR2	3455	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	34634996	34634996	+	Intron	SNP	G	G	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr21:34634996G>A	ENST00000342136.4	+	9	1166				IFNAR2_ENST00000404220.3_Missense_Mutation_p.R324H|IFNAR2_ENST00000413881.1_Intron|IFNAR2_ENST00000382264.3_Missense_Mutation_p.R324H|AP000295.9_ENST00000433395.2_Intron|IL10RB-AS1_ENST00000411998.1_RNA|IFNAR2_ENST00000342101.3_Intron|IFNAR2_ENST00000382241.3_Intron			P48551	INAR2_HUMAN	interferon (alpha, beta and omega) receptor 2						cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|type I interferon binding (GO:0019962)|type I interferon receptor activity (GO:0004905)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	11					"""""""Interferon Alfa-2a(DB00034)|""""Interferon Alfa-2b(DB00105)|Interferon alfa-n1(DB00011)|Interferon alfa-n3(DB00018)|Interferon alfacon-1(DB00069)|Interferon beta-1a(DB00060)|Interferon beta-1b(DB00068)|Peginterferon alfa-2a(DB00008)|Peginterferon alfa-2b(DB00022)"""	gattacaagcgtgcatccctg	0.423																																					p.R324H		.											.	IFNAR2-90	0			c.G971A						.						20.0	24.0	23.0					21																	34634996		1232	2415	3647	SO:0001627	intron_variant	3455	exon9			ACAAGCGTGCATC		CCDS13621.1, CCDS13622.1, CCDS74782.1	21q22.1	2010-08-17			ENSG00000159110	ENSG00000159110		"""Interferons"""	5433	protein-coding gene	gene with protein product		602376		IFNABR		8181059	Standard	NM_207585		Approved		uc002yrd.3	P48551	OTTHUMG00000065127	ENST00000342136.4:c.841-102G>A	21.37:g.34634996G>A		38	0		27	13	NM_000874	0	0	1	2	1	A8KAJ4|D3DSE8|D3DSE9|Q15467|Q6FHD7	Missense_Mutation	SNP	ENST00000342136.4	37	CCDS13621.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.842784	0.32606	.	.	ENSG00000159110	ENST00000382264;ENST00000404220	T;T	0.38077	1.16;1.16	1.07	0.137	0.14787	.	.	.	.	.	T	0.14056	0.0340	N	0.10760	0.04	0.09310	N	1	B	0.31989	0.35	B	0.15870	0.014	T	0.15093	-1.0449	9	0.87932	D	0	.	3.382	0.07257	0.2949:0.0:0.7051:0.0	.	324	P48551-2	.	H	324	ENSP00000371699:R324H;ENSP00000384309:R324H	ENSP00000371699:R324H	R	+	2	0	IFNAR2	33556866	.	.	0.002000	0.10522	0.002000	0.02628	.	.	0.024000	0.15214	-0.251000	0.11542	CGT	.		0.423	IFNAR2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139825.1		
CLIC6	54102	hgsc.bcm.edu	37	21	36042584	36042584	+	Silent	SNP	G	G	A	rs13049239	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr21:36042584G>A	ENST00000360731.3	+	1	897	c.897G>A	c.(895-897)tcG>tcA	p.S299S	CLIC6_ENST00000349499.2_Silent_p.S299S			Q96NY7	CLIC6_HUMAN	chloride intracellular channel 6	299						chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	voltage-gated chloride channel activity (GO:0005247)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19						CGCAGCAATCGGGGGACGGCA	0.751													A|||	1101	0.219848	0.2549	0.1628	5008	,	,		9144	0.1825		0.2137	False		,,,				2504	0.2577				p.S299S		.											.	CLIC6-91	0			c.G897A						.	A		412,2410		18,376,1017	2.0	2.0	2.0		897	-0.2	0.0	21	dbSNP_121	2	842,5136		42,758,2189	no	coding-synonymous	CLIC6	NM_053277.1		60,1134,3206	AA,AG,GG		14.085,14.5996,14.25		299/687	36042584	1254,7546	1411	2989	4400	SO:0001819	synonymous_variant	54102	exon1			GCAATCGGGGGAC	AF426169	CCDS13638.1	21q22.12	2012-09-26			ENSG00000159212	ENSG00000159212		"""Ion channels / Chloride channels : Intracellular"""	2065	protein-coding gene	gene with protein product		615321		CLIC1L		10830953	Standard	NM_053277		Approved	CLIC5	uc002yuf.1	Q96NY7	OTTHUMG00000086237	ENST00000360731.3:c.897G>A	21.37:g.36042584G>A		0	0		11	5	NM_053277	0	0	0	0	0	A8K0U8|Q8IX31	Silent	SNP	ENST00000360731.3	37																																																																																				G|0.803;A|0.197		0.751	CLIC6-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000194156.1		
PI4KA	5297	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	21088807	21088807	+	Missense_Mutation	SNP	G	G	A	rs559723682		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr22:21088807G>A	ENST00000572273.1	-	33	3832	c.3602C>T	c.(3601-3603)aCg>aTg	p.T1201M	PI4KA_ENST00000414196.3_Missense_Mutation_p.T11M|PI4KA_ENST00000255882.6_Missense_Mutation_p.T1259M			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1201					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CTGCTCCACCGTCATGTGCCA	0.527													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17752	0.0		0.0	False		,,,				2504	0.0				p.T1259M	GBM(136;1332 1831 3115 23601 50806)	.											.	PI4KA-454	0			c.C3776T						.						98.0	103.0	101.0					22																	21088807		2203	4300	6503	SO:0001583	missense	5297	exon33			TCCACCGTCATGT	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3602C>T	22.37:g.21088807G>A	ENSP00000458238:p.Thr1201Met	269	0		191	10	NM_058004	0	0	10	10	0	Q7Z625|Q9UPG2	Missense_Mutation	SNP	ENST00000572273.1	37		.	.	.	.	.	.	.	.	.	.	G	28.8	4.948581	0.92593	.	.	ENSG00000241973	ENST00000255882;ENST00000414196	D	0.83591	-1.74	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.91233	0.7237	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	D	0.92003	0.5612	10	0.87932	D	0	-18.5111	18.856	0.92252	0.0:0.0:1.0:0.0	.	1201	P42356	PI4KA_HUMAN	M	1201;11	ENSP00000402981:T11M	ENSP00000255882:T1201M	T	-	2	0	PI4KA	19418807	1.000000	0.71417	0.980000	0.43619	0.979000	0.70002	7.719000	0.84751	2.694000	0.91930	0.650000	0.86243	ACG	.		0.527	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
TAB1	10454	broad.mit.edu	37	22	39826114	39826114	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr22:39826114C>A	ENST00000216160.6	+	11	1464	c.1402C>A	c.(1402-1404)Cac>Aac	p.H468N	TAB1_ENST00000331454.3_Intron	NM_006116.2	NP_006107.1	Q15750	TAB1_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 1	468					activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart morphogenesis (GO:0003007)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lung development (GO:0030324)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|protein complex (GO:0043234)	catalytic activity (GO:0003824)|enzyme activator activity (GO:0008047)|kinase activator activity (GO:0019209)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|urinary_tract(1)	14						CCGGCCCGCCCACTCGCTCCC	0.647																																					p.H468N		.											.	TAB1-522	0			c.C1402A						.						92.0	81.0	84.0					22																	39826114		2203	4300	6503	SO:0001583	missense	10454	exon11			CCCGCCCACTCGC	U49928	CCDS13992.1, CCDS13993.1	22q13.1	2010-02-05	2010-02-05	2010-02-05	ENSG00000100324	ENSG00000100324			18157	protein-coding gene	gene with protein product	"""TAK1-binding protein 1"", ""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	602615	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	MAP3K7IP1		8638164, 10187861	Standard	NM_153497		Approved		uc003axt.3	Q15750	OTTHUMG00000151102	ENST00000216160.6:c.1402C>A	22.37:g.39826114C>A	ENSP00000216160:p.His468Asn	32	0		70	3	NM_006116	0	0	8	8	0	Q2PP09|Q8IZW2	Missense_Mutation	SNP	ENST00000216160.6	37	CCDS13993.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.376110	0.61735	.	.	ENSG00000100324	ENST00000216160	T	0.42513	0.97	5.38	5.38	0.77491	.	0.385065	0.29321	N	0.012485	T	0.31040	0.0784	N	0.22421	0.69	0.80722	D	1	B;B	0.29716	0.118;0.255	B;B	0.26614	0.021;0.071	T	0.07693	-1.0759	10	0.16896	T	0.51	.	19.1358	0.93428	0.0:1.0:0.0:0.0	.	468;612	Q15750;Q59FT7	TAB1_HUMAN;.	N	468	ENSP00000216160:H468N	ENSP00000216160:H468N	H	+	1	0	TAB1	38156060	1.000000	0.71417	0.993000	0.49108	0.950000	0.60333	7.103000	0.77014	2.523000	0.85059	0.650000	0.86243	CAC	.		0.647	TAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321313.1	NM_153497	
PRR34	55267	hgsc.bcm.edu	37	22	46449891	46449891	+	Missense_Mutation	SNP	G	G	A	rs12159707	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr22:46449891G>A	ENST00000396008.2	-	1	133	c.83C>T	c.(82-84)cCc>cTc	p.P28L	RP6-109B7.2_ENST00000439423.1_lincRNA|RP6-109B7.3_ENST00000451166.1_RNA|FLJ27365_ENST00000381051.2_Intron|RP6-109B7.3_ENST00000445441.1_RNA|RP6-109B7.5_ENST00000608644.1_RNA|C22orf26_ENST00000333761.1_Missense_Mutation_p.P28L|RP6-109B7.3_ENST00000416202.1_RNA			Q9NV39	PRR34_HUMAN		28	Pro-rich.		P -> L (in dbSNP:rs12159707).										Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		TGCGGGGTTGGGGGGGGAGGT	0.746													G|||	1079	0.215455	0.2723	0.2723	5008	,	,		6433	0.0278		0.33	False		,,,				2504	0.1738				p.P28L		.											.	C22orf26-90	0			c.C83T						.	G	LEU/PRO	1414,2432		349,716,858	5.0	5.0	5.0		83	0.7	0.0	22	dbSNP_120	5	2591,5181		546,1499,1841	no	missense	C22orf26	NM_018280.2	98	895,2215,2699	AA,AG,GG		33.3376,36.7655,34.4724	probably-damaging	28/139	46449891	4005,7613	1923	3886	5809	SO:0001583	missense	55267	exon1			GGGTTGGGGGGGG																												ENST00000396008.2:c.83C>T	22.37:g.46449891G>A	ENSP00000379329:p.Pro28Leu	0	0		7	5	NM_018280	0	0	0	0	0	B0QZ24	Missense_Mutation	SNP	ENST00000396008.2	37	CCDS14071.1	542	0.24816849816849818	155	0.3150406504065041	117	0.32320441988950277	22	0.038461538461538464	248	0.32717678100263853	G	5.153	0.213778	0.09810	0.367655	0.333376	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.41400	1.0;1.0	0.666	0.666	0.17901	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.69078	0.997	D	0.68483	0.958	T	0.42189	-0.9466	7	0.87932	D	0	.	.	.	.	rs12159707;rs59880898	28	Q9NV39	CV026_HUMAN	L	28	ENSP00000379329:P28L;ENSP00000327764:P28L	ENSP00000327764:P28L	P	-	2	0	C22orf26	44828555	0.742000	0.28228	0.008000	0.14137	0.010000	0.07245	0.672000	0.25187	0.636000	0.30508	0.645000	0.84053	CCC	A|0.248;C|0.000;G|0.752		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
PLCD1	5333	broad.mit.edu	37	3	38050645	38050645	+	Silent	SNP	G	G	A	rs377656276		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr3:38050645G>A	ENST00000334661.4	-	11	1833	c.1611C>T	c.(1609-1611)aaC>aaT	p.N537N	PLCD1_ENST00000479619.1_5'Flank|PLCD1_ENST00000463876.1_Silent_p.N558N	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	537	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		GGACAAAGCCGTTTCCTGAGG	0.607																																					p.N558N		.											.	PLCD1-226	0			c.C1674T						.						57.0	53.0	55.0					3																	38050645		2203	4300	6503	SO:0001819	synonymous_variant	5333	exon11			AAAGCCGTTTCCT		CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.1611C>T	3.37:g.38050645G>A		83	0		97	3	NM_001130964	0	0	0	0	0	B3KR14|Q86VN8	Silent	SNP	ENST00000334661.4	37	CCDS2671.1																																																																																			.		0.607	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253359.2		
SETD2	29072	broad.mit.edu	37	3	47163592	47163592	+	Nonsense_Mutation	SNP	G	G	C	rs201639149		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr3:47163592G>C	ENST00000409792.3	-	3	2576	c.2534C>G	c.(2533-2535)tCa>tGa	p.S845*		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	845					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGCAAATTTTGAGTGATCTGT	0.333			"""N, F, S, Mis"""		clear cell renal carcinoma								G|||	1	0.000199681	0.0	0.0	5008	,	,		22356	0.0		0.001	False		,,,				2504	0.0				p.S845X		.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2-1273	0			c.C2534G						.						51.0	54.0	53.0					3																	47163592		2203	4300	6503	SO:0001587	stop_gained	29072	exon3			AATTTTGAGTGAT	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.2534C>G	3.37:g.47163592G>C	ENSP00000386759:p.Ser845*	56	0		65	3	NM_014159	0	0	2	2	0	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Nonsense_Mutation	SNP	ENST00000409792.3	37	CCDS2749.2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	37	6.449598	0.97577	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792;ENST00000412450	.	.	.	5.18	5.18	0.71444	.	0.144833	0.32120	N	0.006558	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.0467	0.86505	0.0:0.0:1.0:0.0	.	.	.	.	X	845;845;845;801	.	ENSP00000386759:S845X	S	-	2	0	SETD2	47138596	0.937000	0.31787	0.993000	0.49108	0.928000	0.56348	4.555000	0.60767	2.679000	0.91253	0.655000	0.94253	TCA	G|0.999;C|0.000		0.333	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
RHOA	387	broad.mit.edu	37	3	49395674	49395679	+	IGR	DEL	GCCGCC	GCCGCC	-	rs71077799|rs56041243|rs139760138|rs17838762	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr3:49395674_49395679delGCCGCC	ENST00000418115.1	-	0	2031				GPX1_ENST00000419783.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000419349.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000496791.1_5'UTR	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.A12_A13delAA(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CACCGACTGGgccgccgccgccgccg	0.694																																					.		.											.	GPX1-68	1	Deletion - In frame(1)	breast(1)	.						.		,	23,168,347		11,0,1,79,10,168					,	-0.2	0.0		dbSNP_123	2	116,720,1030		46,10,14,333,44,486	no	codingComplex,codingComplex	GPX1	NM_201397.1,NM_000581.2	,	57,10,15,412,54,654	A1A1,A1A2,A1R,A2A2,A2R,RR		44.8017,35.5019,42.7205	,	,		139,888,1377				SO:0001628	intergenic_variant	2876	.			GACTGGGCCGCCG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395680_49395685delGCCGCC		5	0		44	20	.	0	0	0	0	0	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	In_Frame_Del	DEL	ENST00000418115.1	37	CCDS2795.1																																																																																			.		0.694	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
TLR9	54106	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52255624	52255624	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr3:52255624G>T	ENST00000360658.2	-	2	3341	c.2708C>A	c.(2707-2709)gCa>gAa	p.A903E	TLR9_ENST00000597542.1_Missense_Mutation_p.A927E|TLR9_ENST00000494383.1_Silent_p.G1056G	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	903	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	CAGGCGGAGTGCCCAGCGCCC	0.622																																					p.A903E		.											.	TLR9-587	0			c.C2708A						.						79.0	87.0	84.0					3																	52255624		2203	4300	6503	SO:0001583	missense	54106	exon2			CGGAGTGCCCAGC	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.2708C>A	3.37:g.52255624G>T	ENSP00000353874:p.Ala903Glu	72	0		141	11	NM_017442	0	0	1	1	0	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	CCDS2848.1	.	.	.	.	.	.	.	.	.	.	G	5.110	0.205983	0.09704	.	.	ENSG00000239732	ENST00000360658	T	0.02323	4.34	5.08	0.968	0.19680	Toll/interleukin-1 receptor homology (TIR) domain (3);	0.465830	0.16267	N	0.222000	T	0.04318	0.0119	L	0.52573	1.65	0.09310	N	1	P;D	0.56287	0.801;0.975	B;P	0.54499	0.339;0.754	T	0.31779	-0.9931	10	0.10902	T	0.67	.	2.7282	0.05220	0.0876:0.2731:0.3428:0.2966	.	1000;903	B4E0A1;Q9NR96	.;TLR9_HUMAN	E	903	ENSP00000353874:A903E	ENSP00000353874:A903E	A	-	2	0	TLR9	52230664	0.000000	0.05858	0.032000	0.17829	0.052000	0.14988	0.064000	0.14437	0.666000	0.31087	-0.182000	0.12963	GCA	.		0.622	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000350203.1		
GPR171	29909	broad.mit.edu	37	3	150916947	150916947	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr3:150916947C>T	ENST00000309180.5	-	3	457	c.227G>A	c.(226-228)gGt>gAt	p.G76D	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron	NM_013308.3	NP_037440.3	O14626	GP171_HUMAN	G protein-coupled receptor 171	76					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(4)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	15			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AGGTGCCACACCCAAGTCAAC	0.393																																					p.G76D		.											.	GPR171-90	0			c.G227A						.						89.0	88.0	88.0					3																	150916947		2203	4300	6503	SO:0001583	missense	29909	exon3			GCCACACCCAAGT	AF002986	CCDS3155.1	3q25.1	2012-08-21			ENSG00000174946	ENSG00000174946		"""GPCR / Class A : Orphans"""	30057	protein-coding gene	gene with protein product	"""platelet activating receptor homolog"""					9370294	Standard	NM_013308		Approved	H963	uc003eyq.4	O14626	OTTHUMG00000159861	ENST00000309180.5:c.227G>A	3.37:g.150916947C>T	ENSP00000308479:p.Gly76Asp	179	0		192	4	NM_013308	0	0	0	0	0	D3DNJ4|Q8IV06	Missense_Mutation	SNP	ENST00000309180.5	37	CCDS3155.1	.	.	.	.	.	.	.	.	.	.	C	17.36	3.370889	0.61624	.	.	ENSG00000174946	ENST00000309180	T	0.72051	-0.62	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.77438	0.4130	L	0.36672	1.1	0.44067	D	0.996811	D	0.89917	1.0	D	0.83275	0.996	T	0.70839	-0.4763	10	0.14252	T	0.57	-10.7679	19.2521	0.93929	0.0:1.0:0.0:0.0	.	76	O14626	GP171_HUMAN	D	76	ENSP00000308479:G76D	ENSP00000308479:G76D	G	-	2	0	GPR171	152399637	0.999000	0.42202	0.994000	0.49952	0.767000	0.43475	4.243000	0.58721	2.542000	0.85734	0.655000	0.94253	GGT	.		0.393	GPR171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357793.1	NM_013308	
ETV5	2119	broad.mit.edu	37	3	185797720	185797720	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr3:185797720T>G	ENST00000306376.5	-	7	782	c.536A>C	c.(535-537)cAt>cCt	p.H179P	ETV5_ENST00000434744.1_Missense_Mutation_p.H179P|ETV5_ENST00000537818.1_Missense_Mutation_p.H221P|ETV5-AS1_ENST00000453370.1_RNA	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	179					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			TGGAAGCGAATGGGGGGCGGG	0.617			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.H179P		.		Dom	yes		3	3q28	2119	ets variant gene 5		E	.	ETV5-706	0			c.A536C						.						54.0	61.0	59.0					3																	185797720		2203	4300	6503	SO:0001583	missense	2119	exon7			AGCGAATGGGGGG	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.536A>C	3.37:g.185797720T>G	ENSP00000306894:p.His179Pro	46	1		44	9	NM_004454	0	0	7	7	0	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	37	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	T	11.00	1.509461	0.27036	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.10860	2.86;2.86;2.83	5.32	5.32	0.75619	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.445754	0.24894	N	0.034741	T	0.12135	0.0295	N	0.25647	0.755	0.44123	D	0.996905	B;D	0.54207	0.0;0.965	B;P	0.49451	0.001;0.611	T	0.15206	-1.0445	10	0.28530	T	0.3	.	12.7886	0.57520	0.0:0.0:0.0:1.0	.	179;221	P41161;B7Z7D7	ETV5_HUMAN;.	P	179;179;221	ENSP00000306894:H179P;ENSP00000413755:H179P;ENSP00000441737:H221P	ENSP00000306894:H179P	H	-	2	0	ETV5	187280414	0.997000	0.39634	0.611000	0.29010	0.524000	0.34500	3.006000	0.49529	2.009000	0.58944	0.460000	0.39030	CAT	.		0.617	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
LEPREL1	55214	bcgsc.ca	37	3	189713205	189713205	+	Silent	SNP	T	T	C	rs9821880	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr3:189713205T>C	ENST00000319332.5	-	2	704	c.507A>G	c.(505-507)gaA>gaG	p.E169E	LEPREL1_ENST00000427335.2_5'UTR	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	169					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TGTGAGCTGCTTCCACTGCTT	0.408													T|||	1607	0.320887	0.2035	0.3069	5008	,	,		15965	0.4881		0.3002	False		,,,				2504	0.3384				p.E169E		.											.	LEPREL1-155	0			c.A507G						.	T	,	942,3464	342.5+/-307.2	94,754,1355	105.0	91.0	96.0		,507	4.1	1.0	3	dbSNP_119	96	2669,5931	416.4+/-352.1	435,1799,2066	no	utr-5,coding-synonymous	LEPREL1	NM_001134418.1,NM_018192.3	,	529,2553,3421	CC,CT,TT		31.0349,21.3799,27.7641	,	,169/709	189713205	3611,9395	2203	4300	6503	SO:0001819	synonymous_variant	55214	exon2			AGCTGCTTCCACT		CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.507A>G	3.37:g.189713205T>C		78	0		57	4	NM_018192	0	0	21	21	0	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Silent	SNP	ENST00000319332.5	37	CCDS3294.1																																																																																			C|0.302;N|0.001		0.408	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343855.1	NM_018192	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	9	0		40	8	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
DSPP	1834	ucsc.edu	37	4	88537078	88537078	+	Silent	SNP	T	T	C	rs367717407|rs373805744	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr4:88537078T>C	ENST00000282478.7	+	4	3297	c.3264T>C	c.(3262-3264)agT>agC	p.S1088S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1088S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1088	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgatagcagtgacagcagca	0.547													t|||	1148	0.229233	0.27	0.2536	5008	,	,		14971	0.2103		0.2237	False		,,,				2504	0.182				p.S1088S		.											.	DSPP-90	0			c.T3264C						.						21.0	26.0	24.0					4																	88537078		1113	2064	3177	SO:0001819	synonymous_variant	1834	exon5			TAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3264T>C	4.37:g.88537078T>C		392	6		286	12	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	bcgsc.ca	37	4	88537249	88537249	+	Silent	SNP	T	T	C	rs371359066		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr4:88537249T>C	ENST00000282478.7	+	4	3468	c.3435T>C	c.(3433-3435)agT>agC	p.S1145S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1145S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1145	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagtgacagcagtg	0.567																																					p.S1145S		.											.	DSPP-90	0			c.T3435C						.						41.0	55.0	50.0					4																	88537249		1542	2816	4358	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3435T>C	4.37:g.88537249T>C		739	15		615	30	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.567	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FRG1	2483	bcgsc.ca	37	4	190878626	190878626	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr4:190878626G>A	ENST00000226798.4	+	6	728	c.506G>A	c.(505-507)aGt>aAt	p.S169N	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GAAGCAAAAAGTAAAACAGCA	0.363																																					p.S169N		.											.	FRG1-90	1	Substitution - Missense(1)	skin(1)	c.G506A						.						49.0	46.0	47.0					4																	190878626		2184	4282	6466	SO:0001583	missense	2483	exon6			CAAAAAGTAAAAC	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.506G>A	4.37:g.190878626G>A	ENSP00000226798:p.Ser169Asn	782	17		822	34	NM_004477	0	0	72	72	0	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	14.80	2.642895	0.47153	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.48522	1.77;0.81	4.19	2.41	0.29592	Actin cross-linking (1);	0.160510	0.64402	N	0.000002	T	0.36552	0.0971	N	0.17723	0.515	0.45777	D	0.998661	P	0.35982	0.531	P	0.45406	0.479	T	0.07578	-1.0765	10	0.30854	T	0.27	0.1847	7.6816	0.28518	0.219:0.0:0.781:0.0	.	169	Q14331	FRG1_HUMAN	N	169;41;106	ENSP00000226798:S169N;ENSP00000435943:S106N	ENSP00000226798:S169N	S	+	2	0	FRG1	191115620	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	1.784000	0.38674	0.340000	0.23745	0.454000	0.30748	AGT	G|0.500;A|0.500		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
DNAH5	1767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	13870993	13870993	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr5:13870993G>T	ENST00000265104.4	-	24	3821	c.3717C>A	c.(3715-3717)ttC>ttA	p.F1239L	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1239	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTTTCTTATTGAATTCTTCAA	0.398									Kartagener syndrome																												p.F1239L		.											.	DNAH5-182	0			c.C3717A						.						103.0	102.0	102.0					5																	13870993		2203	4300	6503	SO:0001583	missense	1767	exon24	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	CTTATTGAATTCT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3717C>A	5.37:g.13870993G>T	ENSP00000265104:p.Phe1239Leu	117	0		177	77	NM_001369	0	0	0	0	0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	9.644	1.139835	0.21205	.	.	ENSG00000039139	ENST00000265104	T	0.20332	2.08	5.84	4.97	0.65823	.	0.335523	0.34906	N	0.003599	T	0.05410	0.0143	N	0.00960	-1.095	0.24157	N	0.995675	B	0.02656	0.0	B	0.01281	0.0	T	0.41034	-0.9531	10	0.10636	T	0.68	.	5.5953	0.17323	0.2588:0.0:0.7412:0.0	.	1239	Q8TE73	DYH5_HUMAN	L	1239	ENSP00000265104:F1239L	ENSP00000265104:F1239L	F	-	3	2	DNAH5	13923993	0.221000	0.23642	1.000000	0.80357	0.990000	0.78478	0.298000	0.19120	2.760000	0.94817	0.655000	0.94253	TTC	.		0.398	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
SNX18	112574	hgsc.bcm.edu	37	5	53814052	53814052	+	Silent	SNP	T	T	C	rs2548615	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr5:53814052T>C	ENST00000326277.3	+	1	460	c.270T>C	c.(268-270)ccT>ccC	p.P90P	SNX18_ENST00000381410.4_Silent_p.P90P|SNX18_ENST00000343017.6_Silent_p.P90P	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	90					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				AGCCCCTGCCTGTCGCGCCCC	0.791													N|||	4953	0.989018	0.9728	0.9942	5008	,	,		9287	1.0		0.9901	False		,,,				2504	0.9949				p.P90P		.											.	SNX18-226	0			c.T270C						.	C	,,	1635,19		808,19,0	1.0	2.0	2.0		270,270,270	-2.1	0.2	5	dbSNP_100	2	4035,67		1984,67,0	no	coding-synonymous,coding-synonymous,coding-synonymous	SNX18	NM_001102575.1,NM_001145427.1,NM_052870.2	,,	2792,86,0	CC,CT,TT		1.6333,1.1487,1.4941	,,	90/625,90/592,90/629	53814052	5670,86	827	2051	2878	SO:0001819	synonymous_variant	112574	exon1			CCTGCCTGTCGCG	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.270T>C	5.37:g.53814052T>C		0	0		4	4	NM_052870	0	0	0	0	0	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	ENST00000326277.3	37	CCDS3962.1																																																																																			G|0.979;C|0.003		0.791	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
PPWD1	23398	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	64878975	64878975	+	Silent	SNP	T	T	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr5:64878975T>A	ENST00000261308.5	+	8	1533	c.1461T>A	c.(1459-1461)ccT>ccA	p.P487P	PPWD1_ENST00000535264.1_Silent_p.P457P|PPWD1_ENST00000538977.1_Silent_p.P331P	NM_015342.3	NP_056157.1	Q96BP3	PPWD1_HUMAN	peptidylprolyl isomerase domain and WD repeat containing 1	487					mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	19		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		Lung(70;0.00451)		CTGAAGGACCTAAACGAGTTT	0.403																																					p.P487P		.											.	PPWD1-91	0			c.T1461A						.						173.0	163.0	166.0					5																	64878975		2203	4300	6503	SO:0001819	synonymous_variant	23398	exon8			AGGACCTAAACGA	AK025679	CCDS3985.1, CCDS64161.1, CCDS64162.1	5q12.3	2013-01-09			ENSG00000113593	ENSG00000113593		"""WD repeat domain containing"""	28954	protein-coding gene	gene with protein product						7584044	Standard	NM_015342		Approved	KIAA0073	uc003jtv.5	Q96BP3	OTTHUMG00000131226	ENST00000261308.5:c.1461T>A	5.37:g.64878975T>A		140	0		178	92	NM_015342	0	0	9	16	7	B4DWR9|Q15002|Q7KZ89	Silent	SNP	ENST00000261308.5	37	CCDS3985.1																																																																																			.		0.403	PPWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253970.2	NM_015342	
CMYA5	202333	broad.mit.edu	37	5	79041149	79041151	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr5:79041149_79041151delGAA	ENST00000446378.2	+	4	10870_10872	c.10839_10841delGAA	c.(10837-10842)gtgaag>gtg	p.K3617del		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3617	B-box coiled-coil; BBC.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTGAGGAAGTGAAGAAGAAGAAG	0.448																																					p.3613_3614del		.											.	CMYA5-77	0			c.10839_10841del						.																																			SO:0001651	inframe_deletion	202333	exon4			GGAAGTGAAGAAG	AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.10839_10841delGAA	5.37:g.79041158_79041160delGAA	ENSP00000394770:p.Lys3617del	466	0		672	7	NM_153610	0	0	0	0	0	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	In_Frame_Del	DEL	ENST00000446378.2	37	CCDS47238.1																																																																																			.		0.448	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369497.1	NM_153610	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	0	0		4	4	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PCDHA12	56137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140255099	140255099	+	Silent	SNP	G	G	C			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr5:140255099G>C	ENST00000398631.2	+	1	42	c.42G>C	c.(40-42)ctG>ctC	p.L14L	PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	14					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCAGCGTCTGCTGCTCTCGC	0.597																																					p.L14L	Pancreas(113;759 1672 13322 24104 50104)	.											.	.	0			c.G42C						.						34.0	40.0	38.0					5																	140255099		2200	4300	6500	SO:0001819	synonymous_variant	56137	exon1			GCGTCTGCTGCTC	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.42G>C	5.37:g.140255099G>C		61	0		101	37	NM_018903	0	0	0	0	0	O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	37	CCDS47285.1																																																																																			.		0.597	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
PCDHB13	56123	hgsc.bcm.edu	37	5	140595625	140595625	+	Missense_Mutation	SNP	G	G	A	rs2910005	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr5:140595625G>A	ENST00000341948.4	+	1	2117	c.1930G>A	c.(1930-1932)Gtc>Atc	p.V644I		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	644	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGTGGTGCTGGTCAAGGACAA	0.711													G|||	602	0.120208	0.1036	0.0937	5008	,	,		15211	0.0933		0.1421	False		,,,				2504	0.1667				p.V644I		.											.	PCDHB13-93	0			c.G1930A						.						13.0	15.0	14.0					5																	140595625		1563	3249	4812	SO:0001583	missense	56123	exon1			GTGCTGGTCAAGG	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.1930G>A	5.37:g.140595625G>A	ENSP00000345491:p.Val644Ile	2	0		106	38	NM_018933	0	0	32	33	1	A8K9V6	Missense_Mutation	SNP	ENST00000341948.4	37	CCDS4255.1	263	0.12042124542124542	52	0.10569105691056911	43	0.11878453038674033	53	0.09265734265734266	115	0.1517150395778364	-	23.4	4.405720	0.83230	.	.	ENSG00000187372	ENST00000341948;ENST00000430318;ENST00000419217	T	0.23552	1.9	3.3	3.3	0.37823	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.00300	0.0009	M	0.63843	1.955	0.27033	P	0.9641952	D	0.71674	0.998	D	0.63283	0.913	T	0.09314	-1.0680	8	0.72032	D	0.01	.	14.5914	0.68368	0.0:0.0:1.0:0.0	rs2910005	644	Q9Y5F0	PCDBD_HUMAN	I	644;644;590	ENSP00000345491:V644I	ENSP00000345491:V644I	V	+	1	0	PCDHB13	140575809	1.000000	0.71417	0.701000	0.30321	0.791000	0.44710	9.501000	0.97979	1.576000	0.49790	0.298000	0.19748	GTC	G|0.500;A|0.500		0.711	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
HK3	3101	broad.mit.edu	37	5	176315851	176315851	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr5:176315851A>G	ENST00000292432.5	-	9	1020	c.929T>C	c.(928-930)aTc>aCc	p.I310T		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	310	Hexokinase type-2 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGGCCTCCGATCATCTTCTC	0.617																																					p.I310T		.											.	HK3-294	0			c.T929C						.						39.0	42.0	41.0					5																	176315851		2203	4300	6503	SO:0001583	missense	3101	exon9			CCTCCGATCATCT		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.929T>C	5.37:g.176315851A>G	ENSP00000292432:p.Ile310Thr	60	0		98	4	NM_002115	0	0	0	0	0	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	37	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	A	10.44	1.352162	0.24512	.	.	ENSG00000160883	ENST00000292432	D	0.98280	-4.84	5.32	5.32	0.75619	Hexokinase, C-terminal (1);	0.136551	0.34025	N	0.004330	D	0.97056	0.9038	L	0.52126	1.63	0.31673	N	0.644109	P	0.44690	0.841	P	0.45232	0.474	D	0.97927	1.0318	10	0.49607	T	0.09	.	14.9448	0.71023	1.0:0.0:0.0:0.0	.	310	P52790	HXK3_HUMAN	T	310	ENSP00000292432:I310T	ENSP00000292432:I310T	I	-	2	0	HK3	176248457	0.944000	0.32072	0.992000	0.48379	0.130000	0.20726	5.055000	0.64282	2.011000	0.59026	0.459000	0.35465	ATC	.		0.617	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		0	0		7	7	NM_001145115	0	0	0	0	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	0	0		9	9	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51920393	51920393	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr6:51920393A>T	ENST00000371117.3	-	19	2103	c.1828T>A	c.(1828-1830)Tat>Aat	p.Y610N	PKHD1_ENST00000340994.4_Missense_Mutation_p.Y610N	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	610					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ACGTGTGTATACTGATCTAGC	0.542																																					p.Y610N		.											.	PKHD1-603	0			c.T1828A						.						59.0	53.0	55.0					6																	51920393		2203	4300	6503	SO:0001583	missense	5314	exon19			GTGTATACTGATC	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1828T>A	6.37:g.51920393A>T	ENSP00000360158:p.Tyr610Asn	121	1		108	93	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	A	17.82	3.481953	0.63849	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87571	-2.27;-2.27	5.53	3.13	0.36017	.	0.398297	0.24059	N	0.041924	D	0.87884	0.6290	M	0.70275	2.135	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.80892	-0.1179	10	0.72032	D	0.01	.	8.2084	0.31469	0.843:0.0:0.157:0.0	.	610;610	P08F94-2;P08F94	.;PKHD1_HUMAN	N	610	ENSP00000360158:Y610N;ENSP00000341097:Y610N	ENSP00000341097:Y610N	Y	-	1	0	PKHD1	52028352	0.008000	0.16893	0.000000	0.03702	0.333000	0.28666	1.329000	0.33770	0.479000	0.27511	-0.256000	0.11100	TAT	.		0.542	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		0	0		9	9	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	0	0		14	14	NM_032172	0	0	0	1	1	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
GBX1	2636	hgsc.bcm.edu	37	7	150864240	150864240	+	Silent	SNP	G	G	C	rs13241978	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr7:150864240G>C	ENST00000297537.4	-	1	395	c.396C>G	c.(394-396)gcC>gcG	p.A132A	GBX1_ENST00000475831.1_5'UTR	NM_001098834.1	NP_001092304.1	Q14549	GBX1_HUMAN	gastrulation brain homeobox 1	132	Ala-rich.|Pro-rich.				adult walking behavior (GO:0007628)|neuron fate commitment (GO:0048663)|proprioception (GO:0019230)|regulation of transcription, DNA-templated (GO:0006355)|sensory neuron axon guidance (GO:0097374)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)|lung(5)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGTTTCGggcggcagtggcgg	0.751													G|||	1447	0.288938	0.3971	0.3069	5008	,	,		9229	0.3433		0.2217	False		,,,				2504	0.1431				p.A132A		.											.	GBX1-68	0			c.C396G						.	G		1127,2329		197,733,798	7.0	10.0	9.0		396	0.2	0.0	7	dbSNP_121	9	1736,6108		240,1256,2426	no	coding-synonymous	GBX1	NM_001098834.1		437,1989,3224	CC,CG,GG		22.1316,32.61,25.3363		132/364	150864240	2863,8437	1728	3922	5650	SO:0001819	synonymous_variant	2636	exon1			TCGGGCGGCAGTG	L11239	CCDS43682.1	7q36.1	2012-03-09	2005-12-22		ENSG00000164900	ENSG00000164900		"""Homeoboxes / ANTP class : HOXL subclass"""	4185	protein-coding gene	gene with protein product		603354	"""gastrulation brain homeo box 1"""			7903253	Standard	NM_001098834		Approved		uc011kvg.2	Q14549	OTTHUMG00000158751	ENST00000297537.4:c.396C>G	7.37:g.150864240G>C		1	0		18	11	NM_001098834	0	0	0	0	0		Silent	SNP	ENST00000297537.4	37	CCDS43682.1																																																																																			G|0.699;C|0.301		0.751	GBX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352029.1		
SGK223	157285	broad.mit.edu	37	8	8239069	8239069	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr8:8239069C>A	ENST00000520004.1	-	2	453	c.189G>T	c.(187-189)agG>agT	p.R63S	SGK223_ENST00000330777.4_Missense_Mutation_p.R63S			Q86YV5	SG223_HUMAN		63							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										AGTTCTCAGGCCTGGGAGGCA	0.657																																					p.R63S	GBM(34;731 755 10259 33573 33867)	.											.	.	0			c.G189T						.						48.0	49.0	49.0					8																	8239069		2004	4157	6161	SO:0001583	missense	0	exon1			CTCAGGCCTGGGA																												ENST00000520004.1:c.189G>T	8.37:g.8239069C>A	ENSP00000428054:p.Arg63Ser	58	0		89	4	NM_001080826	0	0	0	0	0	Q8N3N5	Missense_Mutation	SNP	ENST00000520004.1	37	CCDS43706.1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236881	0.39498	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.59083	0.29;0.29	4.49	2.69	0.31865	.	0.226672	0.30658	N	0.009160	T	0.41696	0.1170	L	0.38531	1.155	0.27832	N	0.941416	B	0.31968	0.349	B	0.24701	0.055	T	0.44802	-0.9304	10	0.72032	D	0.01	.	8.2345	0.31618	0.0:0.7459:0.0:0.2541	.	63	Q86YV5	SG223_HUMAN	S	63	ENSP00000330930:R63S;ENSP00000428054:R63S	ENSP00000330930:R63S	R	-	3	2	AC068353.1	8276479	1.000000	0.71417	0.887000	0.34795	0.775000	0.43874	0.980000	0.29513	1.272000	0.44329	-0.230000	0.12252	AGG	.		0.657	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374864.1		
KCNB2	9312	broad.mit.edu	37	8	73850257	73850257	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr8:73850257G>T	ENST00000523207.1	+	3	3255	c.2667G>T	c.(2665-2667)ttG>ttT	p.L889F		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	889					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AAAATCACTTGTTTGCCCCAG	0.428																																					p.L889F		.											.	KCNB2-158	0			c.G2667T						.						89.0	87.0	88.0					8																	73850257		2203	4300	6503	SO:0001583	missense	9312	exon3			TCACTTGTTTGCC	U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.2667G>T	8.37:g.73850257G>T	ENSP00000430846:p.Leu889Phe	236	0		205	5	NM_004770	0	0	0	0	0	Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	ENST00000523207.1	37	CCDS6209.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784400	0.49997	.	.	ENSG00000182674	ENST00000523207	D	0.97279	-4.32	5.34	4.47	0.54385	.	2.526390	0.02322	N	0.073063	D	0.95758	0.8620	N	0.14661	0.345	0.39037	D	0.960054	D	0.57899	0.981	P	0.52514	0.701	D	0.87994	0.2751	10	0.66056	D	0.02	.	10.8243	0.46622	0.164:0.0:0.836:0.0	.	889	Q92953	KCNB2_HUMAN	F	889	ENSP00000430846:L889F	ENSP00000430846:L889F	L	+	3	2	KCNB2	74012811	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.720000	0.47252	1.466000	0.48025	0.591000	0.81541	TTG	.		0.428	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378998.1	NM_004770	
E2F5	1875	hgsc.bcm.edu	37	8	86089787	86089787	+	Silent	SNP	C	C	G	rs12926	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr8:86089787C>G	ENST00000416274.2	+	1	166	c.132C>G	c.(130-132)gcC>gcG	p.A44A	RP11-219B4.7_ENST00000566000.1_RNA|RP11-219B4.7_ENST00000562577.1_RNA|E2F5_ENST00000418930.2_Silent_p.A44A|RP11-219B4.3_ENST00000520129.1_RNA|E2F5_ENST00000256117.5_Silent_p.A44A	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	44					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TCGGGGGCGCCGGGGGCGGCA	0.751													C|||	2815	0.562101	0.5545	0.549	5008	,	,		6370	0.4157		0.6928	False		,,,				2504	0.5982				p.A44A		.											.	E2F5-415	0			c.C132G						.	C	,	2392,1558		800,792,383	4.0	5.0	5.0		132,132	0.9	0.1	8	dbSNP_52	5	5668,2428		2076,1516,456	no	coding-synonymous,coding-synonymous	E2F5	NM_001083588.1,NM_001951.3	,	2876,2308,839	GG,GC,CC		29.9901,39.443,33.0898	,	44/346,44/347	86089787	8060,3986	1975	4048	6023	SO:0001819	synonymous_variant	1875	exon1			GGGCGCCGGGGGC	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.132C>G	8.37:g.86089787C>G		0	0		5	5	NM_001083588	0	0	0	0	0	E9PBN9|Q16601|Q92756	Silent	SNP	ENST00000416274.2	37	CCDS47885.1																																																																																			C|0.434;G|0.566		0.751	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	
ADCY8	114	hgsc.bcm.edu	37	8	132052342	132052342	+	Missense_Mutation	SNP	C	C	T	rs2228949	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr8:132052342C>T	ENST00000286355.5	-	1	2330	c.238G>A	c.(238-240)Gcg>Acg	p.A80T	ADCY8_ENST00000377928.3_Missense_Mutation_p.A80T	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	80			A -> T (in dbSNP:rs2228949).		activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			AGCTGCGGCGCGTGGTGGTTG	0.726										HNSCC(32;0.087)			C|||	90	0.0179712	0.0015	0.0187	5008	,	,		11522	0.0		0.0338	False		,,,				2504	0.0419				p.A80T		.											.	ADCY8-157	0			c.G238A						.	C	THR/ALA	20,3732		0,20,1856	3.0	3.0	3.0		238	4.6	1.0	8	dbSNP_98	3	227,7205		0,227,3489	no	missense	ADCY8	NM_001115.2	58	0,247,5345	TT,TC,CC		3.0544,0.533,2.2085	benign	80/1252	132052342	247,10937	1876	3716	5592	SO:0001583	missense	114	exon1			GCGGCGCGTGGTG	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.238G>A	8.37:g.132052342C>T	ENSP00000286355:p.Ala80Thr	0	0		14	13	NM_001115	0	0	0	0	0		Missense_Mutation	SNP	ENST00000286355.5	37	CCDS6363.1	43	0.019688644688644688	4	0.008130081300813009	8	0.022099447513812154	4	0.006993006993006993	27	0.03562005277044855	C	18.88	3.716491	0.68844	0.00533	0.030544	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.65916	-0.18;-0.18	4.55	4.55	0.56014	.	0.116934	0.38605	N	0.001630	T	0.12817	0.0311	L	0.36672	1.1	0.29715	N	0.839078	B;B	0.32731	0.076;0.382	B;B	0.15052	0.012;0.012	T	0.09596	-1.0667	10	0.13470	T	0.59	.	6.3928	0.21595	0.0:0.7154:0.187:0.0976	rs2228949	80;80	E7EVL1;P40145	.;ADCY8_HUMAN	T	80	ENSP00000286355:A80T;ENSP00000367161:A80T	ENSP00000286355:A80T	A	-	1	0	ADCY8	132121524	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.772000	0.38552	2.383000	0.81215	0.462000	0.41574	GCG	C|0.979;T|0.021		0.726	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380080.1		
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	0	0		16	14	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
DAB2IP	153090	hgsc.bcm.edu	37	9	124535156	124535156	+	Silent	SNP	C	C	T	rs377593194		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr9:124535156C>T	ENST00000408936.3	+	12	2531	c.2349C>T	c.(2347-2349)gcC>gcT	p.A783A	DAB2IP_ENST00000259371.2_Silent_p.A755A|DAB2IP_ENST00000309989.1_Silent_p.A659A			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	783	Necessary for interaction with AKT1.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						AGCTGGTGGCCGGGTGGCCGG	0.756																																					p.A755A		.											.	DAB2IP-91	0			c.C2265T						.	C	,	1,4183		0,1,2091	7.0	9.0	9.0		2265,1977	-5.6	1.0	9		9	2,8182		0,2,4090	no	coding-synonymous,coding-synonymous	DAB2IP	NM_032552.2,NM_138709.1	,	0,3,6181	TT,TC,CC		0.0244,0.0239,0.0243	,	755/1133,659/1066	124535156	3,12365	2092	4092	6184	SO:0001819	synonymous_variant	153090	exon12			GGTGGCCGGGTGG	AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.2349C>T	9.37:g.124535156C>T		0	0		12	12	NM_032552	0	0	0	0	0	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Silent	SNP	ENST00000408936.3	37																																																																																				.		0.756	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317857.1	NM_032552	
GPR144	347088	broad.mit.edu	37	9	127230891	127230891	+	Missense_Mutation	SNP	G	G	A	rs10760365	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr9:127230891G>A	ENST00000334810.1	+	14	2248	c.2248G>A	c.(2248-2250)Gtg>Atg	p.V750M				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	750					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GTGGAGGAAGGTGGTAGCTGT	0.622													G|||	2605	0.520168	0.5371	0.5274	5008	,	,		16910	0.6171		0.4195	False		,,,				2504	0.4959				p.V750M		.											.	.	0			c.G2248A						.	G	MET/VAL	661,723		154,353,185	98.0	84.0	88.0		2248	4.9	1.0	9	dbSNP_120	88	1390,1792		305,780,506	yes	missense	GPR144	NM_001161808.1	21	459,1133,691	AA,AG,GG		43.6832,47.7601,44.919	probably-damaging	750/964	127230891	2051,2515	692	1591	2283	SO:0001583	missense	347088	exon14			AGGAAGGTGGTAG	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2248G>A	9.37:g.127230891G>A	ENSP00000335156:p.Val750Met	89	1		67	4	NM_001161808	0	0	0	0	0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	1132|1132	0.5183150183150184|0.5183150183150184	242|242	0.491869918699187|0.491869918699187	185|185	0.511049723756906|0.511049723756906	381|381	0.666083916083916|0.666083916083916	324|324	0.42744063324538256|0.42744063324538256	G|G	17.72|17.72	3.459464|3.459464	0.63401|0.63401	0.477601|0.477601	0.436832|0.436832	ENSG00000180264|ENSG00000180264	ENST00000446588|ENST00000334810	.|T	.|0.49432	.|0.78	4.94|4.94	4.94|4.94	0.65067|0.65067	.|GPCR, family 2-like (1);	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.72894|0.72894	2.215|2.215	0.22610|0.22610	P|P	0.99893717|0.99893717	D|D	0.63046|0.76494	0.992|0.999	P|D	0.56865|0.87578	0.808|0.998	T|T	0.50311|0.50311	-0.8843|-0.8843	7|8	0.44086|0.72032	T|D	0.13|0.01	.|.	16.7766|16.7766	0.85552|0.85552	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	rs10760365;rs57939835;rs10760365|rs10760365;rs57939835;rs10760365	18|750	A1E4E8|Q7Z7M1	.|GP144_HUMAN	D|M	18|750	.|ENSP00000335156:V750M	ENSP00000414478:G18D|ENSP00000335156:V750M	G|V	+|+	2|1	0|0	GPR144|GPR144	126270712|126270712	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.233000|0.233000	0.25261|0.25261	8.590000|8.590000	0.90821|0.90821	2.278000|2.278000	0.76064|0.76064	0.561000|0.561000	0.74099|0.74099	GGT|GTG	G|0.465;A|0.535		0.622	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
GPR144	347088	broad.mit.edu	37	9	127231774	127231774	+	Missense_Mutation	SNP	C	C	G	rs1570580	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr9:127231774C>G	ENST00000334810.1	+	16	2506	c.2506C>G	c.(2506-2508)Cgc>Ggc	p.R836G				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	836					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						CCGCCGTGCCCGCATGTTGAG	0.642													C|||	2965	0.592053	0.5787	0.6326	5008	,	,		17817	0.7629		0.4245	False		,,,				2504	0.5777				p.R836G		.											.	.	0			c.C2506G						.	C	GLY/ARG	704,680		176,352,164	29.0	36.0	34.0		2506	1.2	1.0	9	dbSNP_88	34	1401,1781		311,779,501	yes	missense	GPR144	NM_001161808.1	125	487,1131,665	GG,GC,CC		44.0289,49.1329,46.1016	probably-damaging	836/964	127231774	2105,2461	692	1591	2283	SO:0001583	missense	347088	exon16			CGTGCCCGCATGT	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2506C>G	9.37:g.127231774C>G	ENSP00000335156:p.Arg836Gly	204	1		225	4	NM_001161808	0	0	0	0	0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	1273	0.5828754578754579	274	0.556910569105691	217	0.5994475138121547	453	0.791958041958042	329	0.4340369393139842	C	17.23	3.336372	0.60963	0.508671	0.440289	ENSG00000180264	ENST00000334810	T	0.52983	0.64	4.46	1.17	0.20885	GPCR, family 2-like (1);	.	.	.	.	T	0.00012	0.0000	L	0.39326	1.205	0.42109	P	0.008624999999999994	D	0.60575	0.988	P	0.61722	0.893	T	0.33137	-0.9880	8	0.56958	D	0.05	.	3.8566	0.08978	0.366:0.4211:0.0:0.2129	rs1570580;rs57102571;rs1570580	836	Q7Z7M1	GP144_HUMAN	G	836	ENSP00000335156:R836G	ENSP00000335156:R836G	R	+	1	0	GPR144	126271595	0.973000	0.33851	0.994000	0.49952	0.800000	0.45204	4.077000	0.57598	0.330000	0.23485	0.462000	0.41574	CGC	C|0.409;G|0.591		0.642	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
COL5A1	1289	broad.mit.edu	37	9	137727048	137727048	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr9:137727048G>T	ENST00000371817.3	+	65	5782	c.5368G>T	c.(5368-5370)Gct>Tct	p.A1790S		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1790	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGACGGCTGTGCTGTGAGTAT	0.657																																					p.A1790S		.											.	COL5A1-524	0			c.G5368T						.						61.0	53.0	56.0					9																	137727048		2203	4300	6503	SO:0001583	missense	1289	exon65			GGCTGTGCTGTGA	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.5368G>T	9.37:g.137727048G>T	ENSP00000360882:p.Ala1790Ser	61	1		87	5	NM_000093	0	0	0	0	0	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.66|13.66	2.303498|2.303498	0.40795|0.40795	.|.	.|.	ENSG00000130635|ENSG00000130635	ENST00000371817;ENST00000355306|ENST00000371820	T|D	0.72282|0.88046	-0.64|-2.33	5.03|5.03	5.03|5.03	0.67393|0.67393	Fibrillar collagen, C-terminal (4);|.	0.000000|.	0.64402|.	U|.	0.000004|.	T|T	0.81569|0.81569	0.4850|0.4850	N|N	0.04090|0.04090	-0.28|-0.28	0.58432|0.58432	D|D	0.999997|0.999997	P|.	0.44044|.	0.825|.	B|.	0.38562|.	0.276|.	D|D	0.85763|0.85763	0.1350|0.1350	10|7	0.17832|0.87932	T|D	0.49|0	.|.	18.3643|18.3643	0.90385|0.90385	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1790|.	P20908|.	CO5A1_HUMAN|.	S|F	1790;327|209	ENSP00000360882:A1790S|ENSP00000360885:C209F	ENSP00000347458:A327S|ENSP00000360885:C209F	A|C	+|+	1|2	0|0	COL5A1|COL5A1	136866869|136866869	1.000000|1.000000	0.71417|0.71417	0.736000|0.736000	0.30914|0.30914	0.218000|0.218000	0.24690|0.24690	7.644000|7.644000	0.83416|0.83416	2.340000|2.340000	0.79590|0.79590	0.561000|0.561000	0.74099|0.74099	GCT|TGC	.		0.657	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
GPR174	84636	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	78426661	78426661	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chrX:78426661C>T	ENST00000276077.1	+	1	193	c.157C>T	c.(157-159)Cga>Tga	p.R53*		NM_032553.1	NP_115942.1	Q9BXC1	GP174_HUMAN	G protein-coupled receptor 174	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(19)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	38						AGAAACAAAACGAGCTGTGAT	0.378										HNSCC(63;0.18)																											p.R53X		.											.	GPR174-130	0			c.C157T						.						102.0	80.0	87.0					X																	78426661		2202	4300	6502	SO:0001587	stop_gained	84636	exon1			ACAAAACGAGCTG	AF345567	CCDS14443.1	Xq13.3	2012-08-21			ENSG00000147138	ENSG00000147138		"""GPCR / Class A : Orphans"""	30245	protein-coding gene	gene with protein product		300903					Standard	NM_032553		Approved	FKSG79	uc004edg.1	Q9BXC1	OTTHUMG00000021898	ENST00000276077.1:c.157C>T	X.37:g.78426661C>T	ENSP00000276077:p.Arg53*	91	1		104	86	NM_032553	0	0	0	0	0	Q2M3F7	Nonsense_Mutation	SNP	ENST00000276077.1	37	CCDS14443.1	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529152	0.64860	.	.	ENSG00000147138	ENST00000276077	.	.	.	5.2	1.15	0.20763	.	0.063131	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	14.1615	0.65450	0.649:0.351:0.0:0.0	.	.	.	.	X	53	.	ENSP00000276077:R53X	R	+	1	2	GPR174	78313317	0.937000	0.31787	0.932000	0.37286	0.615000	0.37417	0.091000	0.15046	-0.212000	0.10109	0.538000	0.68166	CGA	.		0.378	GPR174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057327.1	NM_032553	
MAGEC1	9947	bcgsc.ca	37	X	140994407	140994407	+	Missense_Mutation	SNP	C	C	G	rs62611965	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chrX:140994407C>G	ENST00000285879.4	+	4	1503	c.1217C>G	c.(1216-1218)tCt>tGt	p.S406C	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	406										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TTTCCCCAGTCTCCTCTCCAG	0.478										HNSCC(15;0.026)			-|||	283	0.0749669	0.0393	0.0533	3775	,	,		13424	0.0337		0.0577	False		,,,				2504	0.1043				p.S406C		.											.	MAGEC1-133	0			c.C1217G						.	C	CYS/SER	188,3647		10,136,32,1486,539	118.0	130.0	126.0		1217		0.0	X	dbSNP_129	126	633,6088		21,429,162,1978,1703	no	missense	MAGEC1	NM_005462.4	112	31,565,194,3464,2242	GG,GC,G,CC,C		9.4182,4.9022,7.7776	probably-damaging	406/1143	140994407	821,9735	2203	4293	6496	SO:0001583	missense	9947	exon4			CCCAGTCTCCTCT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1217C>G	X.37:g.140994407C>G	ENSP00000285879:p.Ser406Cys	114	0		93	5	NM_005462	0	0	0	0	0	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	107	0.0644966847498493	19	0.03991596638655462	11	0.03197674418604651	10	0.017793594306049824	33	0.045205479452054796	c	4.098	0.016180	0.07959	0.049022	0.094182	ENSG00000155495	ENST00000285879	T	0.02606	4.23	.	.	.	.	.	.	.	.	T	0.00144	0.0004	N	0.08118	0	0.32593	P	0.52694	D	0.62365	0.991	P	0.52710	0.707	T	0.51568	-0.8689	7	0.72032	D	0.01	.	5.9409	0.19192	0.0:0.9994:0.0:6.0E-4	rs62611965	406	O60732	MAGC1_HUMAN	C	406	ENSP00000285879:S406C	ENSP00000285879:S406C	S	+	2	0	MAGEC1	140822073	0.007000	0.16637	0.041000	0.18516	0.041000	0.13682	-0.137000	0.10389	0.148000	0.19059	0.150000	0.16122	TCT	C|0.933;G|0.067		0.478	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MAGEC1	9947	bcgsc.ca	37	X	140994419	140994419	+	Missense_Mutation	SNP	T	T	C	rs138268726	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chrX:140994419T>C	ENST00000285879.4	+	4	1515	c.1229T>C	c.(1228-1230)aTt>aCt	p.I410T	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	410										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCTCTCCAGATTCCTATGACC	0.483										HNSCC(15;0.026)			-|||	284	0.0752318	0.0401	0.0533	3775	,	,		13350	0.0337		0.0577	False		,,,				2504	0.1043				p.I410T		.											.	MAGEC1-133	0			c.T1229C						.	T	THR/ILE	190,3643		12,134,32,1486,537	118.0	129.0	126.0		1229		0.0	X	dbSNP_134	126	634,6086		24,425,161,1979,1703	no	missense	MAGEC1	NM_005462.4	89	36,559,193,3465,2240	CC,CT,C,TT,T		9.4345,4.957,7.8082	possibly-damaging	410/1143	140994419	824,9729	2201	4292	6493	SO:0001583	missense	9947	exon4			TCCAGATTCCTAT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1229T>C	X.37:g.140994419T>C	ENSP00000285879:p.Ile410Thr	128	0		94	5	NM_005462	0	0	0	0	0	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	107	0.0644966847498493	19	0.03991596638655462	11	0.03197674418604651	10	0.017793594306049824	33	0.045205479452054796	t	0.313	-0.966724	0.02232	0.04957	0.094345	ENSG00000155495	ENST00000285879	T	0.03801	3.8	.	.	.	.	.	.	.	.	T	0.00109	0.0003	N	0.08118	0	0.80722	P	0.0	P	0.38110	0.618	B	0.25759	0.063	T	0.47302	-0.9128	7	0.66056	D	0.02	.	4.5609	0.12160	0.0:5.0E-4:0.0:0.9995	.	410	O60732	MAGC1_HUMAN	T	410	ENSP00000285879:I410T	ENSP00000285879:I410T	I	+	2	0	MAGEC1	140822085	0.000000	0.05858	0.021000	0.16686	0.021000	0.10359	0.010000	0.13242	0.127000	0.18452	0.126000	0.15802	ATT	T|0.932;C|0.068		0.483	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
CALHM3	119395	hgsc.bcm.edu	37	10	105233174	105233175	+	In_Frame_Ins	INS	-	-	GGGGGCTCAGGCACTGCG	rs143800079	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr10:105233174_105233175insGGGGGCTCAGGCACTGCG	ENST00000369783.4	-	3	1037_1038	c.830_831insCGCAGTGCCTGAGCCCCC	c.(829-831)cca>ccCGCAGTGCCTGAGCCCCCa	p.277_277P>PAVPEPP		NM_001129742.1	NP_001123214.1	Q86XJ0	CAHM3_HUMAN	calcium homeostasis modulator 3	283					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)	2						CCAGGCCTTCTGGGGGCTCAGG	0.673														657	0.13119	0.3495	0.0648	5008	,	,		17893	0.124		0.004	False		,,,				2504	0.0215				p.P277delinsPAVPEPP		.											.	CALHM3-67	0			c.831_832insCGCAGTGCCTGAGCCCCC						.			510,1718		115,280,719						-7.8	0.0		dbSNP_134	19	9,4303		0,9,2147	no	coding	CALHM3	NM_001129742.1		115,289,2866	A1A1,A1R,RR		0.2087,22.8905,7.9358				519,6021				SO:0001652	inframe_insertion	119395	exon3			GCCTTCTGGGGGC	BC043367	CCDS44476.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000183128	ENSG00000183128			23458	protein-coding gene	gene with protein product			"""family with sequence similarity 26, member A"""	FAM26A		18585350	Standard	NM_001129742		Approved	bA225H22.7	uc001kxg.4	Q86XJ0	OTTHUMG00000018989	ENST00000369783.4:c.813_830dupCGCAGTGCCTGAGCCCCC	10.37:g.105233174_105233175insGGGGGCTCAGGCACTGCG	ENSP00000358798:p.AlaValProGluProPro277dup	28	0		45	21	NM_001129742	0	0	0	0	0	Q5W090|Q8IXR2	In_Frame_Ins	INS	ENST00000369783.4	37	CCDS44476.1																																																																																			-|0.870;GGGGGCTCAGGCACTGCG|0.130		0.673	CALHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050157.1	NM_182494	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305773	39305774	+	Missense_Mutation	DNP	TC	TC	GG	rs137947981|rs201152898		TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	TC	TC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr17:39305773_39305774TC>GG	ENST00000343246.4	-	1	280_281	c.246_247GA>CC	c.(244-249)caGAcc>caCCcc	p.82_83QT>HP		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	82	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cagcaggtggtctggcagcagc	0.653																																					p.QT82HP		.											.	KRTAP4-5-90	1	Substitution - Missense(1)	lung(1)	c.G246C						.																																			SO:0001583	missense	85289	exon1			GGTGGTCTGGCAG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.246_247delinsGG	17.37:g.39305773_39305774delinsGG	ENSP00000340546:p.Q82_T83delinsHP	7	0		40	17	NM_033188	0	0	0	0	0		Missense_Mutation	DNP	ENST00000343246.4	37	CCDS32650.1																																																																																			.		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
VARS	7407	hgsc.bcm.edu	37	6	31762843	31762844	+	Missense_Mutation	DNP	GG	GG	CT	rs2607015|rs2753960|rs67600122	byFrequency	TCGA-OR-A5J3-01A-11D-A29I-10	TCGA-OR-A5J3-10A-01D-A29L-10	GG	GG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7691e5bf-7a03-4e6a-9873-74f2c8390a41	e93eca23-3968-4f0d-83c5-54657b7a2dea	g.chr6:31762843_31762844GG>CT	ENST00000375663.3	-	2	591_592	c.151_152CC>AG	c.(151-153)CCc>AGc	p.P51S	LSM2_ENST00000491421.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	51			P -> R (in dbSNP:rs2607015).|P -> T (in dbSNP:rs2753960).	P -> S (in Ref. 1; CAA41990 and 7; AAH12808). {ECO:0000305}.	gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	TGGGGGAAAGGGAGTCCTGCTA	0.733																																					p.P51S		.											.	VARS-93	0			c.C151A						.																																			SO:0001583	missense	7407	exon2			GAAAGGGAGTCCT	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.151_152delinsCT	6.37:g.31762843_31762844delinsCT	ENSP00000364815:p.Pro51Ser	0	0		4	0	NM_006295	0	0	0	0	0	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	DNP	ENST00000375663.3	37	CCDS34412.1																																																																																			G|0.721;T|0.279		0.733	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
