#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TTLL10	254173	hgsc.bcm.edu	37	1	1132966	1132966	+	Silent	SNP	C	C	A	rs2274790	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:1132966C>A	ENST00000379290.1	+	16	1934	c.1761C>A	c.(1759-1761)ccC>ccA	p.P587P	TTLL10_ENST00000379289.1_Silent_p.P587P			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	587	Pro-rich.				cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GCTGGCCGCCCCTGCCCACCC	0.766													N|||	1321	0.263778	0.0703	0.353	5008	,	,		5669	0.6071		0.1143	False		,,,				2504	0.2618				p.P587P		.											.	TTLL10-153	0			c.C1761A						.						1.0	2.0	2.0					1																	1132966		234	815	1049	SO:0001819	synonymous_variant	254173	exon16			GCCGCCCCTGCCC	AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.1761C>A	1.37:g.1132966C>A		0	0		12	12	NM_001130045	0	0	0	0	0	B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Silent	SNP	ENST00000379290.1	37	CCDS44036.1																																																																																			C|0.737;A|0.263		0.766	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002421.3	NM_153254	
AJAP1	55966	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	4772335	4772335	+	Silent	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:4772335G>A	ENST00000378191.4	+	2	786	c.405G>A	c.(403-405)tcG>tcA	p.S135S	AJAP1_ENST00000378190.3_Silent_p.S135S	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	135					cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		CTTCGTCCTCGTCCTCGTCCT	0.716																																					p.S135S		.											.	AJAP1-515	0			c.G405A						.						9.0	8.0	9.0					1																	4772335		2101	4145	6246	SO:0001819	synonymous_variant	55966	exon2			GTCCTCGTCCTCG	AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.405G>A	1.37:g.4772335G>A		12	0		21	11	NM_018836	0	0	0	2	2	Q9Y229	Silent	SNP	ENST00000378191.4	37	CCDS54.1																																																																																			.		0.716	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001542.3	NM_018836	
FHAD1	114827	bcgsc.ca	37	1	15642956	15642956	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:15642956G>T	ENST00000375998.4	+	8	1253	c.1253G>T	c.(1252-1254)tGc>tTc	p.C418F	FHAD1_ENST00000375999.3_Missense_Mutation_p.C418F|FHAD1_ENST00000417793.1_Missense_Mutation_p.C418F|FHAD1_ENST00000401090.2_Missense_Mutation_p.C124F|FHAD1_ENST00000375995.3_Intron|FHAD1_ENST00000358897.4_Missense_Mutation_p.C418F			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	418										skin(1)|stomach(1)	2						TTAAAACTCTGCAAAACCGTG	0.483																																					p.C418F		.											.	FHAD1-69	0			c.G1253T						.						147.0	139.0	142.0					1																	15642956		692	1591	2283	SO:0001583	missense	114827	exon9			AACTCTGCAAAAC	AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.1253G>T	1.37:g.15642956G>T	ENSP00000365166:p.Cys418Phe	246	0		198	8	NM_052929	0	0	1	1	0	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	ENST00000375998.4	37		.	.	.	.	.	.	.	.	.	.	G	6.386	0.439380	0.12104	.	.	ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000524761;ENST00000401090	T;T;T;T;D;D	0.84223	0.9;0.91;0.89;0.9;-1.8;-1.82	4.93	2.05	0.26809	.	0.612452	0.14449	N	0.318916	T	0.79587	0.4471	L	0.56769	1.78	0.19300	N	0.99998	P;P	0.44044	0.731;0.825	B;B	0.39068	0.151;0.289	T	0.67409	-0.5678	10	0.41790	T	0.15	-0.0784	7.17	0.25712	0.2835:0.0:0.7165:0.0	.	418;145	B1AJZ9;B1AJZ8	FHAD1_HUMAN;.	F	418;418;418;418;45;124	ENSP00000351770:C418F;ENSP00000407615:C418F;ENSP00000365167:C418F;ENSP00000365166:C418F;ENSP00000436559:C45F;ENSP00000383868:C124F	ENSP00000351770:C418F	C	+	2	0	FHAD1	15515543	0.892000	0.30473	0.014000	0.15608	0.001000	0.01503	0.569000	0.23638	0.242000	0.21303	-0.270000	0.10280	TGC	.		0.483	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000393400.2	NM_052929	
AGMAT	79814	hgsc.bcm.edu	37	1	15911349	15911349	+	Silent	SNP	G	G	A	rs3737705	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:15911349G>A	ENST00000375826.3	-	1	256	c.114C>T	c.(112-114)gaC>gaT	p.D38D	DNAJC16_ENST00000483270.1_Intron|RP4-680D5.2_ENST00000428945.1_RNA	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	38					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		TCCGGGGCGCGTCGGAAGCCT	0.791													G|||	1691	0.33766	0.2685	0.3084	5008	,	,		9254	0.5794		0.2952	False		,,,				2504	0.2464				p.D38D	NSCLC(126;1678 1780 25805 43508 49531)	.											.	AGMAT-91	0			c.C114T						.	G		446,1872		44,358,757	2.0	3.0	3.0		114	-4.1	0.0	1	dbSNP_107	3	1412,4272		187,1038,1617	no	coding-synonymous	AGMAT	NM_024758.4		231,1396,2374	AA,AG,GG		24.8417,19.2407,23.2192		38/353	15911349	1858,6144	1159	2842	4001	SO:0001819	synonymous_variant	79814	exon1			GGGCGCGTCGGAA	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.114C>T	1.37:g.15911349G>A		1	0		18	10	NM_024758	0	0	0	4	4	Q5TDH1|Q9H5J3	Silent	SNP	ENST00000375826.3	37	CCDS160.1																																																																																			G|0.647;A|0.353		0.791	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		11	11	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
SH3D21	79729	broad.mit.edu	37	1	36773405	36773405	+	Silent	SNP	T	T	G	rs35343437	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:36773405T>G	ENST00000426732.2	+	5	408	c.123T>G	c.(121-123)ccT>ccG	p.P41P	SH3D21_ENST00000505871.1_Silent_p.P46P|SH3D21_ENST00000453908.2_Silent_p.P157P|SH3D21_ENST00000312808.4_5'UTR			A4FU49	SH321_HUMAN	SH3 domain containing 21	41						extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(6)|lung(4)|pancreas(1)	12						CAGTCAGCCCTGGTCCCCAGC	0.582													T|||	2109	0.421126	0.1241	0.562	5008	,	,		19550	0.7192		0.4443	False		,,,				2504	0.3916				p.P157P		.											.	SH3D21-91	0			c.T471G						.	T	,	257,1127		20,217,455	89.0	78.0	81.0		471,138	-2.8	0.0	1	dbSNP_126	81	1567,1615		371,825,395	no	coding-synonymous,coding-synonymous	SH3D21	NM_001162530.1,NM_024676.4	,	391,1042,850	GG,GT,TT		49.2458,18.5694,39.9474	,	157/757,46/646	36773405	1824,2742	692	1591	2283	SO:0001819	synonymous_variant	79729	exon6			CAGCCCTGGTCCC	AK056459	CCDS30674.1, CCDS30674.2	1p34.3	2011-02-21	2011-02-21	2011-02-21	ENSG00000214193	ENSG00000214193			26236	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 113"""	C1orf113		12477932	Standard	NM_024676		Approved	FLJ22938	uc010oia.1	A4FU49	OTTHUMG00000007868	ENST00000426732.2:c.123T>G	1.37:g.36773405T>G		240	3		210	5	NM_001162530	0	0	0	0	0	B4DLI6|D3DPS6|J3KQM5|Q5VTK7|Q86XZ6|Q8N445|Q96DN4|Q9H5W5	Silent	SNP	ENST00000426732.2	37																																																																																				T|0.555;G|0.445		0.582	SH3D21-202	KNOWN	basic	protein_coding	protein_coding		NM_024676	
RSBN1	54665	hgsc.bcm.edu	37	1	114354654	114354654	+	Silent	SNP	T	T	C	rs3195954	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:114354654T>C	ENST00000261441.5	-	1	444	c.381A>G	c.(379-381)ccA>ccG	p.P127P	RP5-1073O3.2_ENST00000418238.1_RNA|RP5-1073O3.2_ENST00000429398.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	127	Pro-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCATTCGTTGGCGGCAGCG	0.746													T|||	610	0.121805	0.0045	0.1311	5008	,	,		11529	0.2282		0.1869	False		,,,				2504	0.0971				p.P127P		.											.	RSBN1-91	0			c.A381G						.	T		149,4053		2,145,1954	13.0	24.0	21.0		381	-4.9	0.5	1	dbSNP_105	21	1412,6854		115,1182,2836	no	coding-synonymous	RSBN1	NM_018364.3		117,1327,4790	CC,CT,TT		17.082,3.5459,12.5201		127/803	114354654	1561,10907	2101	4133	6234	SO:0001819	synonymous_variant	54665	exon1			ATTCGTTGGCGGC	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.381A>G	1.37:g.114354654T>C		5	0		21	7	NM_018364	0	0	2	4	2	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	37	CCDS862.1																																																																																			T|0.861;C|0.139		0.746	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
OR6N2	81442	bcgsc.ca	37	1	158746678	158746678	+	Missense_Mutation	SNP	T	T	C	rs41273541	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:158746678T>C	ENST00000339258.1	-	1	747	c.748A>G	c.(748-750)Atc>Gtc	p.I250V		NM_001005278.1	NP_001005278.1	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N, member 2	250			I -> V (in dbSNP:rs41273541).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(6)|lung(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(112;0.0378)					CCAAAGAAGATGAGGACCACA	0.453													C|||	879	0.175519	0.2345	0.0288	5008	,	,		22440	0.1925		0.0437	False		,,,				2504	0.318				p.I250V		.											.	OR6N2-68	0			c.A748G						.	C	VAL/ILE	824,3582	748.0+/-411.9	72,680,1451	85.0	84.0	85.0		748	1.2	1.0	1	dbSNP_127	85	401,8199	801.3+/-407.4	11,379,3910	yes	missense	OR6N2	NM_001005278.1	29	83,1059,5361	CC,CT,TT		4.6628,18.7018,9.4187	benign	250/318	158746678	1225,11781	2203	4300	6503	SO:0001583	missense	81442	exon1			AGAAGATGAGGAC	BK004200	CCDS30906.1	1q23.1	2012-08-09			ENSG00000188340	ENSG00000188340		"""GPCR / Class A : Olfactory receptors"""	15035	protein-coding gene	gene with protein product							Standard	NM_001005278		Approved		uc010pir.2	Q8NGY6	OTTHUMG00000022775	ENST00000339258.1:c.748A>G	1.37:g.158746678T>C	ENSP00000344101:p.Ile250Val	232	2		176	7	NM_001005278	0	0	0	0	0	Q6IFR2	Missense_Mutation	SNP	ENST00000339258.1	37	CCDS30906.1	251	0.11492673992673992	104	0.21138211382113822	14	0.03867403314917127	101	0.17657342657342656	32	0.04221635883905013	C	2.754	-0.259368	0.05791	0.187018	0.046628	ENSG00000188340	ENST00000339258	T	0.00107	8.72	4.84	1.22	0.21188	GPCR, rhodopsin-like superfamily (1);	0.415403	0.17630	N	0.167403	T	0.00039	0.0001	L	0.41632	1.29	0.80722	P	0.0	B	0.11235	0.004	B	0.15870	0.014	T	0.08617	-1.0713	9	0.45353	T	0.12	-6.3668	9.9249	0.41485	0.0:0.232:0.0:0.768	rs41273541	250	Q8NGY6	OR6N2_HUMAN	V	250	ENSP00000344101:I250V	ENSP00000344101:I250V	I	-	1	0	OR6N2	157013302	0.000000	0.05858	0.972000	0.41901	0.304000	0.27724	-3.517000	0.00444	-0.189000	0.10482	-2.069000	0.00389	ATC	T|0.900;C|0.100		0.453	OR6N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059068.1		
PAPPA2	60676	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	176525604	176525604	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:176525604G>A	ENST00000367662.3	+	2	1310	c.146G>A	c.(145-147)cGt>cAt	p.R49H	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R49H	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	49					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GAAGGAGAACGTTGTTGGCTG	0.567																																					p.R49H		.											.	PAPPA2-548	0			c.G146A						.						92.0	91.0	91.0					1																	176525604		1990	4173	6163	SO:0001583	missense	60676	exon2			GAGAACGTTGTTG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.146G>A	1.37:g.176525604G>A	ENSP00000356634:p.Arg49His	246	0		194	66	NM_020318	0	0	0	0	0	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	37	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	10.45	1.352770	0.24512	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.32272	4.69;1.46	4.82	-4.07	0.03975	.	1.124460	0.06933	N	0.811346	T	0.18551	0.0445	L	0.36672	1.1	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.35226	-0.9797	10	0.44086	T	0.13	-2.9966	2.0784	0.03629	0.5022:0.1392:0.2168:0.1417	.	49;49	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	H	49	ENSP00000356634:R49H;ENSP00000356633:R49H	ENSP00000356633:R49H	R	+	2	0	PAPPA2	174792227	0.000000	0.05858	0.780000	0.31762	0.884000	0.51177	-0.994000	0.03716	-0.150000	0.11195	-0.367000	0.07326	CGT	.		0.567	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	0	0		12	7	NM_022371	0	0	0	1	1	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
ABL2	27	bcgsc.ca	37	1	179077613	179077613	+	Missense_Mutation	SNP	T	T	C	rs17277288	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:179077613T>C	ENST00000502732.1	-	12	2992	c.2789A>G	c.(2788-2790)aAa>aGa	p.K930R	ABL2_ENST00000408940.3_Missense_Mutation_p.K894R|ABL2_ENST00000367623.4_Missense_Mutation_p.K909R|ABL2_ENST00000511413.1_Missense_Mutation_p.K827R|ABL2_ENST00000504405.1_Missense_Mutation_p.K791R|ABL2_ENST00000344730.3_Missense_Mutation_p.K812R|ABL2_ENST00000512653.1_Missense_Mutation_p.K915R|ABL2_ENST00000507173.1_Missense_Mutation_p.K806R	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	930	F-actin-binding. {ECO:0000250}.|Pro-rich.		K -> R (in dbSNP:rs17277288). {ECO:0000269|PubMed:17344846, ECO:0000269|Ref.5}.		actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GACTGGCACTTTGTGGTTGTG	0.562			T	ETV6	AML								T|||	25	0.00499201	0.0015	0.0086	5008	,	,		20755	0.0		0.0139	False		,,,				2504	0.0031				p.K930R		.		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	ABL2-1081	0			c.A2789G						.	T	ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS,ARG/LYS	17,4389	23.3+/-48.9	0,17,2186	92.0	86.0	88.0		2435,2726,2480,2417,2372,2744,2789	5.4	1.0	1	dbSNP_123	88	121,8479	63.5+/-125.6	1,119,4180	yes	missense,missense,missense,missense,missense,missense,missense	ABL2	NM_001136000.2,NM_001168236.1,NM_001168237.1,NM_001168238.1,NM_001168239.1,NM_005158.4,NM_007314.3	26,26,26,26,26,26,26	1,136,6366	CC,CT,TT		1.407,0.3858,1.061	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	812/1065,909/1162,827/1080,806/1059,791/1044,915/1168,930/1183	179077613	138,12868	2203	4300	6503	SO:0001583	missense	27	exon12			GGCACTTTGTGGT	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.2789A>G	1.37:g.179077613T>C	ENSP00000427562:p.Lys930Arg	116	1		102	5	NM_007314	0	0	0	0	0	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	37	CCDS30947.1	18	0.008241758241758242	0	0.0	4	0.011049723756906077	0	0.0	14	0.018469656992084433	T	17.08	3.297014	0.60086	0.003858	0.01407	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	T;T;T;T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78;1.78;1.78;1.78	5.4	5.4	0.78164	.	0.000000	0.53938	D	0.000053	T	0.28732	0.0712	L	0.55481	1.735	0.51233	D	0.999916	D;D;D;D;D;D;D;D	0.76494	0.999;0.998;0.998;0.996;0.998;0.999;0.998;0.974	D;D;D;D;D;D;D;D	0.80764	0.994;0.991;0.991;0.987;0.986;0.994;0.986;0.969	T	0.05835	-1.0861	10	0.30078	T	0.28	.	14.908	0.70735	0.0:0.0:0.0:1.0	rs17277288;rs17277288	909;806;827;791;930;915;894;812	P42684-6;P42684-7;P42684-5;P42684-4;P42684;P42684-3;D1MPS6;P42684-10	.;.;.;.;ABL2_HUMAN;.;.;.	R	930;894;812;915;791;909;806;827	ENSP00000427562:K930R;ENSP00000386152:K894R;ENSP00000339209:K812R;ENSP00000423578:K915R;ENSP00000426831:K791R;ENSP00000356595:K909R;ENSP00000423413:K806R;ENSP00000424697:K827R	ENSP00000339209:K812R	K	-	2	0	ABL2	177344236	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.766000	0.62279	2.164000	0.68074	0.533000	0.62120	AAA	T|0.989;C|0.011		0.562	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158	
TPR	7175	broad.mit.edu;bcgsc.ca	37	1	186303520	186303520	+	Missense_Mutation	SNP	T	T	C	rs35766045	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:186303520T>C	ENST00000367478.4	-	36	5415	c.5119A>G	c.(5119-5121)Aca>Gca	p.T1707A		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1707			T -> A (in dbSNP:rs35766045).		carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GTGGGATTTGTAACAGTTGCA	0.448			T	NTRK1	papillary thyroid								T|||	15	0.00299521	0.0008	0.0058	5008	,	,		17372	0.0		0.007	False		,,,				2504	0.0031				p.T1707A		.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR-228	0			c.A5119G						.	T	ALA/THR	9,3817		0,9,1904	152.0	151.0	152.0		5119	5.4	1.0	1	dbSNP_126	152	67,8171		1,65,4053	yes	missense	TPR	NM_003292.2	58	1,74,5957	CC,CT,TT		0.8133,0.2352,0.63	benign	1707/2364	186303520	76,11988	1913	4119	6032	SO:0001583	missense	7175	exon36			GATTTGTAACAGT	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5119A>G	1.37:g.186303520T>C	ENSP00000356448:p.Thr1707Ala	321	2		260	8	NM_003292	0	0	29	29	0	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	ENST00000367478.4	37	CCDS41446.1	5	0.0022893772893772895	0	0.0	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	T	12.46	1.945369	0.34377	0.002352	0.008133	ENSG00000047410	ENST00000367478	T	0.24350	1.86	5.41	5.41	0.78517	.	0.191502	0.45606	D	0.000349	T	0.14787	0.0357	L	0.47716	1.5	0.32886	D	0.511215	B	0.15930	0.015	B	0.06405	0.002	T	0.18555	-1.0333	10	0.11485	T	0.65	.	10.9175	0.47146	0.14:0.0:0.0:0.86	rs35766045	1707	P12270	TPR_HUMAN	A	1707	ENSP00000356448:T1707A	ENSP00000356448:T1707A	T	-	1	0	TPR	184570143	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.654000	0.54453	2.172000	0.68678	0.460000	0.39030	ACA	T|0.996;C|0.004		0.448	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
WDR37	22884	hgsc.bcm.edu	37	10	1094906	1094906	+	5'Flank	SNP	C	C	T	rs7091756	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr10:1094906C>T	ENST00000358220.1	+	0	0				IDI1_ENST00000381344.3_Missense_Mutation_p.C13Y|IDI1_ENST00000491735.1_5'UTR			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37											breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ccgggccgcgcAGCCAATCGC	0.721													C|||	154	0.0307508	0.0038	0.0317	5008	,	,		13577	0.0		0.0368	False		,,,				2504	0.092				p.C13Y		.											.	IDI1-90	0			c.G38A						.	C	TYR/CYS	42,3924		1,40,1942	4.0	6.0	5.0		38	-3.5	0.0	10	dbSNP_116	5	362,7338		7,348,3495	no	missense	IDI1	NM_004508.2	194	8,388,5437	TT,TC,CC		4.7013,1.059,3.4631	benign	13/285	1094906	404,11262	1983	3850	5833	SO:0001631	upstream_gene_variant	3422	exon1			GCCGCGCAGCCAA	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540		10.37:g.1094906C>T	Exception_encountered	0	0		49	33	NM_004508	0	0	1	7	6	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	CCDS7057.1	45	0.020604395604395604	5	0.01016260162601626	9	0.024861878453038673	0	0.0	31	0.040897097625329816	C	0.031	-1.335823	0.01287	0.01059	0.047013	ENSG00000067064	ENST00000381344	.	.	.	1.77	-3.54	0.04653	.	3.373570	0.01792	U	0.032349	T	0.01940	0.0061	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17715	-1.0360	8	0.02654	T	1	.	4.1354	0.10169	0.0:0.2425:0.3482:0.4093	rs7091756;rs7091756	13	Q13907-2	.	Y	13	.	ENSP00000370748:C13Y	C	-	2	0	IDI1	1084906	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.721000	0.01870	-1.854000	0.01163	-0.350000	0.07774	TGC	C|0.981;T|0.019		0.721	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
GPRIN2	9721	hgsc.bcm.edu	37	10	47000217	47000217	+	Missense_Mutation	SNP	G	G	A	rs72780221	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr10:47000217G>A	ENST00000374317.1	+	3	1610	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R446H	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	446								p.R446H(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						TCCCTGCGGCGCCCCAGCTGC	0.716																																					p.R446H		.											.	GPRIN2-90	1	Substitution - Missense(1)	prostate(1)	c.G1337A						.						8.0	9.0	9.0					10																	47000217		2121	4098	6219	SO:0001583	missense	9721	exon3			TGCGGCGCCCCAG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1337G>A	10.37:g.47000217G>A	ENSP00000363436:p.Arg446His	1	0		35	11	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	220	0.10073260073260074	86	0.17479674796747968	30	0.08287292817679558	25	0.043706293706293704	79	0.10422163588390501	G	13.52	2.261176	0.39995	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.26223	1.75;1.75	5.11	3.2	0.36748	.	0.744361	0.10758	N	0.637492	T	0.00073	0.0002	L	0.49350	1.555	0.09310	N	1	B	0.24533	0.105	B	0.17433	0.018	T	0.22243	-1.0222	10	0.34782	T	0.22	-0.7153	5.5226	0.16941	0.1777:0.1655:0.6568:0.0	.	446	O60269	GRIN2_HUMAN	H	446	ENSP00000363436:R446H;ENSP00000363433:R446H	ENSP00000363433:R446H	R	+	2	0	GPRIN2	46420223	0.000000	0.05858	0.420000	0.26596	0.986000	0.74619	0.143000	0.16115	0.639000	0.30564	0.561000	0.74099	CGC	G|0.901;A|0.099		0.716	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
MUC5B	727897	bcgsc.ca	37	11	1266696	1266696	+	Silent	SNP	A	A	C	rs532138150	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr11:1266696A>C	ENST00000529681.1	+	31	8644	c.8586A>C	c.(8584-8586)ccA>ccC	p.P2862P	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.P2865P	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2862	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CATCGGCCCCAATAACCACGG	0.692													-|||	1610	0.321486	0.236	0.3386	5008	,	,		9611	0.497		0.2575	False		,,,				2504	0.3098				p.P2862P		.											.	.	0			c.A8586C						.						54.0	65.0	61.0					11																	1266696		1727	3813	5540	SO:0001819	synonymous_variant	727897	exon31			GGCCCCAATAACC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8586A>C	11.37:g.1266696A>C		195	5		104	68	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			A|0.500;C|0.500		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	221	3		117	56	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
TMEM132A	54972	hgsc.bcm.edu	37	11	60701987	60701987	+	Silent	SNP	G	G	A	rs7715	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr11:60701987G>A	ENST00000453848.2	+	9	1745	c.1587G>A	c.(1585-1587)tcG>tcA	p.S529S	TMEM132A_ENST00000005286.4_Silent_p.S530S			Q24JP5	T132A_HUMAN	transmembrane protein 132A	529						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CAGAGGCGTCGGATGAGGCCG	0.776													A|||	2111	0.421526	0.4713	0.4467	5008	,	,		10338	0.3165		0.4225	False		,,,				2504	0.4438				p.S530S		.											.	TMEM132A-227	0			c.G1590A						.	A	,	942,1508		213,516,496	2.0	2.0	2.0		1590,1587	-7.2	0.0	11	dbSNP_52	2	2096,3524		468,1160,1182	no	coding-synonymous,coding-synonymous	TMEM132A	NM_017870.3,NM_178031.2	,	681,1676,1678	AA,AG,GG		37.2954,38.449,37.6456	,	530/1025,529/1024	60701987	3038,5032	1225	2810	4035	SO:0001819	synonymous_variant	54972	exon9			GGCGTCGGATGAG	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1587G>A	11.37:g.60701987G>A		0	0		5	4	NM_017870	0	0	0	125	125	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Silent	SNP	ENST00000453848.2	37	CCDS44618.1	914	0.4184981684981685	245	0.49796747967479676	164	0.4530386740331492	185	0.32342657342657344	320	0.42216358839050133	A	4.934	0.173621	0.09391	0.38449	0.372954	ENSG00000006118	ENST00000536409	.	.	.	3.58	-7.16	0.01516	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999658343	.	.	.	.	.	.	T	0.36792	-0.9733	3	.	.	.	.	2.6854	0.05106	0.499:0.0869:0.2045:0.2096	rs7715;rs1054244;rs3168133;rs17341674;rs17349396;rs60745855	.	.	.	R	121	.	.	G	+	1	0	TMEM132A	60458563	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-2.810000	0.00348	-1.376000	0.01182	GGA	G|0.581;A|0.419		0.776	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs|B3GNT6_ENST00000421061.1_Intron			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	0	0		18	18	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
ITPR2	3709	broad.mit.edu	37	12	26628350	26628350	+	Splice_Site	SNP	A	A	C			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr12:26628350A>C	ENST00000381340.3	-	45	6637	c.6221T>G	c.(6220-6222)gTg>gGg	p.V2074G		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2074					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CATCACATCCACCTATCCAAA	0.358																																					p.V2074G		.											.	ITPR2-542	0			c.T6221G						.						78.0	77.0	78.0					12																	26628350		1914	4136	6050	SO:0001630	splice_region_variant	3709	exon45			ACATCCACCTATC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.6220-1T>G	12.37:g.26628350A>C		47	11		90	22	NM_002223	0	0	0	0	0	O94773	Missense_Mutation	SNP	ENST00000381340.3	37	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	A	17.77	3.471765	0.63737	.	.	ENSG00000123104	ENST00000381340	D	0.94417	-3.42	4.98	3.82	0.43975	.	0.061993	0.64402	N	0.000005	D	0.97005	0.9022	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96538	0.9398	10	0.52906	T	0.07	.	12.0592	0.53552	0.8558:0.1442:0.0:0.0	.	2074	Q14571	ITPR2_HUMAN	G	2074	ENSP00000370744:V2074G	ENSP00000370744:V2074G	V	-	2	0	ITPR2	26519617	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.071000	0.93980	0.907000	0.36646	-0.313000	0.08912	GTG	.		0.358	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	Missense_Mutation
METTL7B	196410	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	56075586	56075586	+	Silent	SNP	C	C	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr12:56075586C>T	ENST00000394252.3	+	1	257	c.48C>T	c.(46-48)acC>acT	p.T16T		NM_152637.2	NP_689850.2	Q6UX53	MET7B_HUMAN	methyltransferase like 7B	16							methyltransferase activity (GO:0008168)			kidney(1)|large_intestine(1)|lung(4)	6						TGCTTCTTACCCTGCCCCTGC	0.617																																					p.T16T		.											.	METTL7B-514	0			c.C48T						.						17.0	18.0	18.0					12																	56075586		692	1591	2283	SO:0001819	synonymous_variant	196410	exon1			TCTTACCCTGCCC		CCDS8887.2	12q13.2	2012-06-12			ENSG00000170439	ENSG00000170439			28276	protein-coding gene	gene with protein product	"""associated with lipid droplets 1"""					17004324	Standard	NM_152637		Approved	MGC17301, ALDI	uc010spr.2	Q6UX53	OTTHUMG00000152665	ENST00000394252.3:c.48C>T	12.37:g.56075586C>T		78	0		99	7	NM_152637	0	0	0	0	0	A8K247|Q8WUI1	Silent	SNP	ENST00000394252.3	37	CCDS8887.2																																																																																			.		0.617	METTL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327271.1	NM_152637	
NUDT4	11163	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	93792979	93792979	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr12:93792979G>C	ENST00000415493.2	+	5	794	c.367G>C	c.(367-369)Gaa>Caa	p.E123Q	NUDT4_ENST00000337179.5_Missense_Mutation_p.E124Q|NUDT4_ENST00000549992.1_Missense_Mutation_p.E71Q|NUDT4_ENST00000547014.1_Missense_Mutation_p.E72Q|NUDT4_ENST00000548662.1_Missense_Mutation_p.E71Q	NM_019094.4	NP_061967.3	Q9NZJ9	NUDT4_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 4	123	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				calcium-mediated signaling (GO:0019722)|cyclic nucleotide metabolic process (GO:0009187)|cyclic-nucleotide-mediated signaling (GO:0019935)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|regulation of RNA export from nucleus (GO:0046831)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|metal ion binding (GO:0046872)|snoRNA binding (GO:0030515)			endometrium(2)|kidney(1)|lung(2)	5						GTTCAAAGTAGAAGATGCTAT	0.388																																					p.E124Q		.											.	NUDT4-90	0			c.G370C						.						83.0	81.0	82.0					12																	93792979		2203	4300	6503	SO:0001583	missense	11163	exon5			AAAGTAGAAGATG	AF067803	CCDS9044.1, CCDS44952.1, CCDS73504.1	12q21	2008-09-04			ENSG00000173598	ENSG00000173598		"""Nudix motif containing"""	8051	protein-coding gene	gene with protein product	"""diphosphoinositol polyphosphate phosphohydrolase type 2"""	609229				10777568, 11376937	Standard	XM_005268595		Approved	DIPP2, HDCMB47P, KIAA0487, DIPP2alpha, DIPP2beta	uc001tcm.3	Q9NZJ9	OTTHUMG00000170155	ENST00000415493.2:c.367G>C	12.37:g.93792979G>C	ENSP00000406612:p.Glu123Gln	217	0		275	69	NM_199040	0	0	63	76	13	B7Z916|Q4AEJ6|Q53EZ2|Q68DD7|Q9NPC5|Q9NS30|Q9NZK0|Q9NZK1	Missense_Mutation	SNP	ENST00000415493.2	37	CCDS44952.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604246	0.66445	.	.	ENSG00000173598	ENST00000337179;ENST00000415493;ENST00000550056;ENST00000549992;ENST00000548662;ENST00000547014;ENST00000546925	T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77	5.53	5.53	0.82687	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.085126	0.85682	D	0.000000	T	0.46308	0.1386	L	0.37561	1.115	0.80722	D	1	P;B	0.49961	0.93;0.09	P;B	0.45794	0.493;0.131	T	0.23084	-1.0198	10	0.28530	T	0.3	-22.3987	19.8241	0.96610	0.0:0.0:1.0:0.0	.	124;123	Q9NZJ9-2;Q9NZJ9	.;NUDT4_HUMAN	Q	124;123;71;71;71;72;71	ENSP00000338352:E124Q;ENSP00000406612:E123Q;ENSP00000448504:E71Q;ENSP00000449552:E71Q;ENSP00000449724:E71Q;ENSP00000448032:E72Q;ENSP00000448620:E71Q	ENSP00000338352:E124Q	E	+	1	0	NUDT4	92317110	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.328000	0.96403	2.758000	0.94735	0.655000	0.94253	GAA	.		0.388	NUDT4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407702.1	NM_019094	
BTBD11	121551	hgsc.bcm.edu	37	12	107713511	107713511	+	Missense_Mutation	SNP	G	G	C	rs961498	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr12:107713511G>C	ENST00000280758.5	+	1	1322	c.794G>C	c.(793-795)gGg>gCg	p.G265A	BTBD11_ENST00000420571.2_Missense_Mutation_p.G265A|BTBD11_ENST00000490090.2_Missense_Mutation_p.G265A	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	265						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGTGGCCCTGGGTCAGGCTCG	0.751													G|||	1975	0.394369	0.2194	0.4539	5008	,	,		9398	0.4127		0.492	False		,,,				2504	0.4693				p.G265A		.											.	BTBD11-93	0			c.G794C						.	G	ALA/GLY	786,2720		135,516,1102	5.0	3.0	3.0		794	4.2	0.1	12	dbSNP_86	3	2882,3822		730,1422,1200	no	missense	BTBD11	NM_001018072.1	60	865,1938,2302	CC,CG,GG		42.9893,22.4187,35.9256	benign	265/1105	107713511	3668,6542	1753	3352	5105	SO:0001583	missense	121551	exon1			GCCCTGGGTCAGG	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.794G>C	12.37:g.107713511G>C	ENSP00000280758:p.Gly265Ala	0	0		13	7	NM_001018072	0	0	0	0	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	899	0.4116300366300366	119	0.241869918699187	158	0.43646408839779005	241	0.42132867132867136	381	0.5026385224274407	G	11.75	1.731449	0.30684	0.224187	0.429893	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090	T;T;T	0.33865	1.39;1.48;1.43	4.15	4.15	0.48705	Histone-fold (1);	0.272599	0.26478	N	0.024144	T	0.00012	0.0000	L	0.52905	1.665	0.09310	P	1.0	B;B;B	0.28971	0.229;0.088;0.143	B;B;B	0.29176	0.099;0.017;0.061	T	0.47898	-0.9081	9	0.54805	T	0.06	.	13.8733	0.63634	0.0:0.0:1.0:0.0	rs961498	265;265;265	A6QL63-2;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	A	265	ENSP00000280758:G265A;ENSP00000413889:G265A;ENSP00000447319:G265A	ENSP00000280758:G265A	G	+	2	0	BTBD11	106237641	0.973000	0.33851	0.080000	0.20451	0.808000	0.45660	2.685000	0.46959	2.308000	0.77769	0.549000	0.68633	GGG	G|0.588;C|0.412		0.751	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	2	0		37	14	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
CCDC168	643677	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	103382007	103382007	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr13:103382007G>C	ENST00000322527.2	-	1	7152	c.7153C>G	c.(7153-7155)Ccc>Gcc	p.P2385A		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2385																	AAAAAAAAGGGCCGGTTTTGT	0.403																																					p.P7014A		.											.	.	0			c.C21040G						.						88.0	100.0	96.0					13																	103382007		692	1591	2283	SO:0001583	missense	643677	exon4			AAAAGGGCCGGTT		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.7153C>G	13.37:g.103382007G>C	ENSP00000320232:p.Pro2385Ala	80	0		106	16	NM_001146197	0	0	0	0	0	Q8N800	Missense_Mutation	SNP	ENST00000322527.2	37		.	.	.	.	.	.	.	.	.	.	G	15.53	2.862015	0.51482	.	.	ENSG00000175820	ENST00000322527	T	0.18016	2.24	5.15	5.15	0.70609	.	0.000000	0.33235	N	0.005135	T	0.37265	0.0997	L	0.54323	1.7	0.36251	D	0.853931	D	0.89917	1.0	D	0.91635	0.999	T	0.40979	-0.9534	10	0.87932	D	0	-12.1178	14.4918	0.67657	0.0:0.0:1.0:0.0	.	2385	Q8NDH2	CC168_HUMAN	A	2385	ENSP00000320232:P2385A	ENSP00000320232:P2385A	P	-	1	0	CCDC168	102180008	0.993000	0.37304	0.949000	0.38748	0.293000	0.27360	4.431000	0.59915	2.546000	0.85860	0.655000	0.94253	CCC	.		0.403	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000333219.7_Intron|CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000338450.7_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000464141.1_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		0	0		11	9	NM_005537	0	0	2	6	4	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
ACIN1	22985	ucsc.edu	37	14	23548787	23548787	+	Missense_Mutation	SNP	C	C	T	rs55838227|rs34870944|rs61741619	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr14:23548787C>T	ENST00000262710.1	-	6	2258	c.1931G>A	c.(1930-1932)cGt>cAt	p.R644H	ACIN1_ENST00000457657.1_Missense_Mutation_p.R604H|ACIN1_ENST00000605057.1_Missense_Mutation_p.R586H|ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Missense_Mutation_p.R644H	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	644	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.S643_R644insHS(1)		breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		TGAACGAGAACGTGAACGTGA	0.488																																					p.R644H		.											.	ACIN1-156	1	Insertion - In frame(1)	upper_aerodigestive_tract(1)	c.G1931A						.						255.0	224.0	235.0					14																	23548787		2203	4300	6503	SO:0001583	missense	22985	exon6			CGAGAACGTGAAC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1931G>A	14.37:g.23548787C>T	ENSP00000262710:p.Arg644His	185	0		335	42	NM_001164814	0	0	0	0	0	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.061864	0.76187	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.30448	2.29;1.53;2.29	5.46	5.46	0.80206	.	0.000000	0.41001	D	0.000979	T	0.42720	0.1215	L	0.27053	0.805	0.36352	D	0.86012	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79784	0.993;0.984;0.984	T	0.50808	-0.8784	10	0.59425	D	0.04	-1.7144	14.8141	0.70017	0.0:1.0:0.0:0.0	.	644;644;604	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	H	644;604;644	ENSP00000262710:R644H;ENSP00000405677:R604H;ENSP00000451328:R644H	ENSP00000262710:R644H	R	-	2	0	ACIN1	22618627	0.999000	0.42202	1.000000	0.80357	0.906000	0.53458	1.398000	0.34554	2.556000	0.86216	0.655000	0.94253	CGT	C|0.985;T|0.015		0.488	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		0	0		20	10	NM_018139	0	0	9	14	5	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
ASB2	51676	broad.mit.edu	37	14	94405527	94405527	+	Missense_Mutation	SNP	T	T	G	rs199833352		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr14:94405527T>G	ENST00000315988.4	-	6	1888	c.1400A>C	c.(1399-1401)cAc>cCc	p.H467P	ASB2_ENST00000555019.1_Missense_Mutation_p.H515P|ASB2_ENST00000556337.1_5'Flank|RP11-131H24.4_ENST00000557646.1_5'Flank	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	467					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGCCGGCGGGTGCGGGCCGTT	0.692																																					p.H515P		.											.	ASB2-228	0			c.A1544C						.						11.0	13.0	12.0					14																	94405527		2100	4140	6240	SO:0001583	missense	51676	exon8			GGCGGGTGCGGGC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1400A>C	14.37:g.94405527T>G	ENSP00000320675:p.His467Pro	75	20		106	35	NM_001202429	0	0	1	1	0	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.443232	0.63067	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.69685	-0.42;-0.34;-0.32	5.07	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.80847	2.515	0.58432	D	0.999992	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.987;0.994;0.987	T	0.78076	-0.2345	10	0.30854	T	0.27	.	12.1543	0.54068	0.0:0.0:0.1436:0.8564	.	483;515;467	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	P	515;483;467;413;413	ENSP00000451575:H515P;ENSP00000320675:H467P;ENSP00000450940:H413P	ENSP00000320675:H467P	H	-	2	0	ASB2	93475280	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	7.714000	0.84703	0.781000	0.33589	-0.527000	0.04329	CAC	.		0.692	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
NDUFAF1	51103	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	41680715	41680715	+	Silent	SNP	A	A	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr15:41680715A>T	ENST00000260361.4	-	4	1146	c.765T>A	c.(763-765)ccT>ccA	p.P255P		NM_016013.3	NP_057097.2	Q9Y375	CIA30_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 1	255					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|mitochondrial respiratory chain complex I (GO:0005747)	unfolded protein binding (GO:0051082)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	12		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;8e-17)|GBM - Glioblastoma multiforme(113;1.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.114)		ATTTGGAAAAAGGAATCTGAA	0.338																																					p.P255P		.											.	NDUFAF1-91	0			c.T765A						.						50.0	53.0	52.0					15																	41680715		2203	4300	6503	SO:0001819	synonymous_variant	51103	exon4			GGAAAAAGGAATC	AF151823	CCDS10075.1	15q11.2-q21.3	2012-10-12	2012-05-08		ENSG00000137806	ENSG00000137806		"""Mitochondrial respiratory chain complex assembly factors"""	18828	protein-coding gene	gene with protein product		606934				11935339, 10810093	Standard	NM_016013		Approved	CIA30, CGI-65	uc001znx.3	Q9Y375	OTTHUMG00000130340	ENST00000260361.4:c.765T>A	15.37:g.41680715A>T		109	0		98	18	NM_016013	0	0	1	1	0	Q9BVZ5	Silent	SNP	ENST00000260361.4	37	CCDS10075.1																																																																																			.		0.338	NDUFAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252692.2	NM_016013	
C15orf48	84419	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	45724279	45724279	+	Silent	SNP	A	A	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr15:45724279A>G	ENST00000344300.3	+	3	322	c.132A>G	c.(130-132)cgA>cgG	p.R44R	RP11-519G16.5_ENST00000559553.1_RNA|MIR147B_ENST00000390185.1_RNA|C15orf48_ENST00000396650.2_Silent_p.R44R	NM_032413.3	NP_115789.1	Q9C002	NMES1_HUMAN	chromosome 15 open reading frame 48	44						mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.67e-16)|GBM - Glioblastoma multiforme(94;1.71e-06)		GCCTTGATCGAAAAAAAAATC	0.318																																					p.R44R		.											.	C15orf48-91	0			c.A132G						.						109.0	107.0	107.0					15																	45724279		2198	4298	6496	SO:0001819	synonymous_variant	84419	exon4			TGATCGAAAAAAA		CCDS10124.1	15q21.1	2014-05-29			ENSG00000166920	ENSG00000166920			29898	protein-coding gene	gene with protein product	"""normal mucosa of esophagus specific 1"""	608409				12209954	Standard	NM_032413		Approved	NMES1	uc001zvh.4	Q9C002	OTTHUMG00000131424	ENST00000344300.3:c.132A>G	15.37:g.45724279A>G		60	0		54	16	NM_197955	0	0	0	0	0		Silent	SNP	ENST00000344300.3	37	CCDS10124.1																																																																																			.		0.318	C15orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254217.2	NM_032413	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		5	5	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79051846	79051846	+	Missense_Mutation	SNP	T	T	C	rs199524707		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr15:79051846T>C	ENST00000388820.4	-	24	5188	c.4978A>G	c.(4978-4980)Atc>Gtc	p.I1660V		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1660	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TGGGTGCGGATGGTGGGCAGC	0.721																																					p.I1660V		.											.	ADAMTS7-226	0			c.A4978G						.						9.0	11.0	10.0					15																	79051846		2122	4204	6326	SO:0001583	missense	11173	exon24			TGCGGATGGTGGG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4978A>G	15.37:g.79051846T>C	ENSP00000373472:p.Ile1660Val	21	0		79	7	NM_014272	0	0	60	60	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	t	0.003	-2.471801	0.00167	.	.	ENSG00000136378	ENST00000388820	T	0.56941	0.43	2.92	-0.818	0.10833	PLAC (1);	0.176997	0.36002	N	0.002857	T	0.17066	0.0410	N	0.01874	-0.695	0.24807	N	0.992664	B	0.02656	0.0	B	0.01281	0.0	T	0.33292	-0.9874	10	0.02654	T	1	.	7.4446	0.27203	0.0:0.6997:0.0:0.3003	.	1660	Q9UKP4	ATS7_HUMAN	V	1660	ENSP00000373472:I1660V	ENSP00000373472:I1660V	I	-	1	0	ADAMTS7	76838901	0.463000	0.25799	0.157000	0.22605	0.002000	0.02628	0.822000	0.27352	-0.289000	0.09038	-0.830000	0.03078	ATC	.		0.721	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
NAGPA	51172	bcgsc.ca	37	16	5077284	5077284	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:5077284G>C	ENST00000312251.3	-	8	1290	c.1271C>G	c.(1270-1272)tCc>tGc	p.S424C	NAGPA_ENST00000381955.3_Intron|RP11-165E7.1_ENST00000588778.1_RNA	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	424					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	GGTACCTCTGGAGACGCTGCA	0.592																																					p.S424C		.											.	NAGPA-90	0			c.C1271G						.						55.0	57.0	56.0					16																	5077284		2197	4300	6497	SO:0001583	missense	51172	exon8			CCTCTGGAGACGC	AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.1271C>G	16.37:g.5077284G>C	ENSP00000310998:p.Ser424Cys	128	0		137	5	NM_016256	0	0	0	0	0	B2RAS1|Q96EJ8	Missense_Mutation	SNP	ENST00000312251.3	37	CCDS10527.1	.	.	.	.	.	.	.	.	.	.	G	12.15	1.852889	0.32699	.	.	ENSG00000103174	ENST00000312251	T	0.72835	-0.69	5.28	5.28	0.74379	.	0.401240	0.25366	N	0.031181	T	0.72558	0.3475	M	0.70275	2.135	0.80722	D	1	B	0.26876	0.162	B	0.30855	0.121	T	0.73300	-0.4026	10	0.66056	D	0.02	-5.3382	16.0587	0.80822	0.0:0.0:1.0:0.0	.	424	Q9UK23	NAGPA_HUMAN	C	424	ENSP00000310998:S424C	ENSP00000310998:S424C	S	-	2	0	NAGPA	5017285	1.000000	0.71417	0.038000	0.18304	0.003000	0.03518	6.155000	0.71833	2.465000	0.83290	0.655000	0.94253	TCC	.		0.592	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207003.1	NM_016256	
CIITA	4261	bcgsc.ca	37	16	10989219	10989219	+	Missense_Mutation	SNP	C	C	G	rs2229317	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:10989219C>G	ENST00000324288.8	+	2	266	c.133C>G	c.(133-135)Ctg>Gtg	p.L45V	CIITA_ENST00000537380.1_3'UTR|CIITA_ENST00000381835.5_Missense_Mutation_p.L45V	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	45			L -> V (in dbSNP:rs2229317).		aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)	p.L45V(1)		central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						TGCTGACCCCCTGTGCCTCTA	0.572			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """								c|||	727	0.145168	0.0605	0.3602	5008	,	,		20257	0.3194		0.008	False		,,,				2504	0.0685				p.L45V		.		Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	.	CIITA-226	1	Substitution - Missense(1)	stomach(1)	c.C133G						.	G	VAL/LEU	278,4116	155.9+/-189.0	5,268,1924	95.0	85.0	88.0		133	-4.3	0.0	16	dbSNP_98	88	119,8481	61.0+/-122.8	0,119,4181	yes	missense	CIITA	NM_000246.3	32	5,387,6105	GG,GC,CC		1.3837,6.3268,3.0553	probably-damaging	45/1131	10989219	397,12597	2197	4300	6497	SO:0001583	missense	4261	exon2			GACCCCCTGTGCC	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.133C>G	16.37:g.10989219C>G	ENSP00000316328:p.Leu45Val	96	0		130	6	NM_000246	0	0	0	0	0	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	ENST00000324288.8	37	CCDS10544.1	329	0.15064102564102563	27	0.054878048780487805	97	0.26795580110497236	200	0.34965034965034963	5	0.006596306068601583	c	7.523	0.657013	0.14580	0.063268	0.013837	ENSG00000179583	ENST00000324288;ENST00000381835;ENST00000388910;ENST00000537380	D;T	0.82619	-1.63;0.72	4.31	-4.35	0.03656	.	1.001520	0.08061	N	0.998189	T	0.00012	0.0000	L	0.55990	1.75	0.80722	P	0.0	D;P;D;D;D;D	0.89917	0.999;0.939;1.0;1.0;1.0;0.999	D;B;D;D;D;D	0.87578	0.998;0.412;0.996;0.996;0.998;0.996	T	0.27123	-1.0083	9	0.56958	D	0.05	.	6.4948	0.22136	0.0:0.47:0.1472:0.3828	rs2229317	45;45;45;45;45;45	F5H2J4;E9PFE0;A0N0N9;P33076;F2Z2G8;Q96KL4	.;.;.;C2TA_HUMAN;.;.	V	45	ENSP00000316328:L45V;ENSP00000371257:L45V	ENSP00000316328:L45V	L	+	1	2	CIITA	10896720	0.050000	0.20438	0.004000	0.12327	0.000000	0.00434	-0.942000	0.03921	-0.749000	0.04747	-2.229000	0.00292	CTG	C|0.937;G|0.063		0.572	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251966.2	NM_000246	
ZNF319	57567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	58031921	58031921	+	Silent	SNP	G	G	A	rs144999714		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:58031921G>A	ENST00000299237.2	-	2	871	c.249C>T	c.(247-249)caC>caT	p.H83H	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						GCGCCAGGTCGTGACCACACA	0.642																																					p.H83H		.											.	ZNF319-90	0			c.C249T						.	G		1,4395	2.1+/-5.4	0,1,2197	56.0	55.0	55.0		249	-1.0	1.0	16	dbSNP_134	55	0,8600		0,0,4300	no	coding-synonymous	ZNF319	NM_020807.1		0,1,6497	AA,AG,GG		0.0,0.0227,0.0077		83/583	58031921	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	57567	exon2			CAGGTCGTGACCA	AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.249C>T	16.37:g.58031921G>A		70	0		92	29	NM_020807	0	0	10	12	2	Q52LH8	Silent	SNP	ENST00000299237.2	37	CCDS32462.1																																																																																			G|1.000;A|0.000		0.642	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430317.1		
HYDIN	54768	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	70891677	70891677	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:70891677C>G	ENST00000393567.2	-	72	12376	c.12226G>C	c.(12226-12228)Gta>Cta	p.V4076L		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4076					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GTTTTGCCTACCAGCAGGAAA	0.473																																					p.V4076L		.											.	HYDIN-92	0			c.G12226C						.						100.0	119.0	113.0					16																	70891677		1958	4164	6122	SO:0001583	missense	54768	exon72			TGCCTACCAGCAG	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12226G>C	16.37:g.70891677C>G	ENSP00000377197:p.Val4076Leu	291	1		270	39	NM_001270974	0	0	2	2	0	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	ENST00000393567.2	37	CCDS59269.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.929826	0.73327	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01725	4.67	5.86	5.86	0.93980	.	0.000000	0.30085	U	0.010450	T	0.11879	0.0289	M	0.81802	2.56	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.00382	-1.1775	10	0.41790	T	0.15	.	18.7357	0.91753	0.0:1.0:0.0:0.0	.	4075	F8WD23	.	L	4076;4075	ENSP00000377197:V4076L	ENSP00000313052:V4075L	V	-	1	0	HYDIN	69449178	1.000000	0.71417	0.999000	0.59377	0.221000	0.24807	4.302000	0.59092	2.779000	0.95612	0.511000	0.50034	GTA	.		0.473	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000398624.3		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	0	0		29	19	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		29	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	0	0		21	18	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	0	0		22	18	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
PIEZO1	9780	broad.mit.edu	37	16	88791458	88791458	+	Missense_Mutation	SNP	G	G	A	rs11645197	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr16:88791458G>A	ENST00000301015.9	-	30	4439	c.4193C>T	c.(4192-4194)cCa>cTa	p.P1398L		NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1398					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CTGCCTCCGTGGCGGGGAGGA	0.701													G|||	878	0.175319	0.0121	0.1643	5008	,	,		17170	0.0873		0.3171	False		,,,				2504	0.3487				p.P1398L		.											.	.	0			c.C4193T						.						5.0	11.0	9.0					16																	88791458		644	1514	2158	SO:0001583	missense	9780	exon30			CTCCGTGGCGGGG	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.4193C>T	16.37:g.88791458G>A	ENSP00000301015:p.Pro1398Leu	37	0		82	4	NM_001142864	0	0	24	24	0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	356	0.163003663003663	12	0.024390243902439025	72	0.19889502762430938	46	0.08041958041958042	226	0.29815303430079154	G	13.18	2.159529	0.38119	.	.	ENSG00000103335	ENST00000301015	T	0.71934	-0.61	4.33	4.33	0.51752	.	0.581104	0.16407	N	0.215765	T	0.00012	0.0000	L	0.54323	1.7	0.53688	P	2.4000000000024002E-5	B	0.29716	0.255	B	0.26614	0.071	T	0.06391	-1.0829	9	0.36615	T	0.2	-9.1253	11.3569	0.49621	0.0:0.0:0.8181:0.1819	rs11645197;rs11645197	1398	Q92508	PIEZ1_HUMAN	L	1398	ENSP00000301015:P1398L	ENSP00000301015:P1398L	P	-	2	0	FAM38A	87318959	.	.	0.902000	0.35471	0.960000	0.62799	.	.	2.406000	0.81754	0.462000	0.41574	CCA	G|0.827;A|0.173		0.701	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
WDR81	124997	ucsc.edu;bcgsc.ca	37	17	1640812	1640812	+	Missense_Mutation	SNP	G	G	A	rs200284291		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:1640812G>A	ENST00000409644.1	+	10	5659	c.5659G>A	c.(5659-5661)Gtg>Atg	p.V1887M	WDR81_ENST00000309182.5_Missense_Mutation_p.V836M|WDR81_ENST00000446363.1_Missense_Mutation_p.V526M|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000545662.1_Missense_Mutation_p.V518M|WDR81_ENST00000437219.2_Missense_Mutation_p.V684M|WDR81_ENST00000419248.1_Missense_Mutation_p.V660M	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1887					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CACTGGCACCGTGTCCAACAA	0.617																																					p.V1887M		.											.	WDR81-91	0			c.G5659A						.	G	MET/VAL,MET/VAL,MET/VAL,MET/VAL	0,4404		0,0,2202	219.0	133.0	162.0		2050,5659,1978,2506	5.1	1.0	17		162	1,8597	1.2+/-3.3	0,1,4298	yes	missense,missense,missense,missense	WDR81	NM_001163673.1,NM_001163809.1,NM_001163811.1,NM_152348.3	21,21,21,21	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	684/739,1887/1942,660/715,836/891	1640812	1,13001	2202	4299	6501	SO:0001583	missense	124997	exon10			GGCACCGTGTCCA	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.5659G>A	17.37:g.1640812G>A	ENSP00000386609:p.Val1887Met	194	2		140	55	NM_001163809	0	0	16	35	19	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	ENST00000409644.1	37	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366257	0.82463	0.0	1.16E-4	ENSG00000167716	ENST00000437219;ENST00000309182;ENST00000446363;ENST00000419248;ENST00000409644;ENST00000354680;ENST00000545662	T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11	5.1	5.1	0.69264	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.53938	U	0.000053	T	0.40979	0.1139	L	0.57536	1.79	0.58432	D	0.999999	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.62298	0.858;0.813;0.9	T	0.08207	-1.0733	10	0.33141	T	0.24	.	18.5161	0.90936	0.0:0.0:1.0:0.0	.	518;684;836	B7Z6V3;B7Z579;Q562E7	.;.;WDR81_HUMAN	M	684;836;526;660;1887;638;518	ENSP00000391074:V684M;ENSP00000312074:V836M;ENSP00000401560:V526M;ENSP00000407845:V660M;ENSP00000386609:V1887M;ENSP00000442726:V518M	ENSP00000312074:V836M	V	+	1	0	WDR81	1587562	1.000000	0.71417	0.986000	0.45419	0.843000	0.47879	6.683000	0.74533	2.361000	0.80049	0.650000	0.86243	GTG	.		0.617	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
ZZEF1	23140	hgsc.bcm.edu	37	17	4046101	4046101	+	Missense_Mutation	SNP	A	A	G	rs1454121	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:4046101A>G	ENST00000381638.2	-	1	213	c.89T>C	c.(88-90)gTc>gCc	p.V30A	CYB5D2_ENST00000575251.1_5'Flank|CYB5D2_ENST00000573984.1_5'Flank|ZZEF1_ENST00000574474.1_5'UTR|CYB5D2_ENST00000301391.3_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	30			V -> A (in dbSNP:rs1454121). {ECO:0000269|PubMed:14702039}.				calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CGTGCCCGAGACCGCGGCCCA	0.746													A|||	4028	0.804313	0.4781	0.8617	5008	,	,		11055	1.0		0.8529	False		,,,				2504	0.953				p.V30A		.											.	ZZEF1-93	0			c.T89C						.						2.0	2.0	2.0					17																	4046101		1609	3070	4679	SO:0001583	missense	23140	exon1			CCCGAGACCGCGG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.89T>C	17.37:g.4046101A>G	ENSP00000371051:p.Val30Ala	0	0		10	10	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	1773	0.8118131868131868	254	0.516260162601626	308	0.850828729281768	572	1.0	639	0.8430079155672823	A	12.64	1.999923	0.35320	.	.	ENSG00000074755	ENST00000381638	T	0.18810	2.19	4.8	1.17	0.20885	.	0.614467	0.15724	N	0.247743	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20107	-1.0285	9	0.33940	T	0.23	-2.2642	0.9962	0.01467	0.1675:0.1675:0.1581:0.5069	rs1454121	30;30	O43149-3;O43149	.;ZZEF1_HUMAN	A	30	ENSP00000371051:V30A	ENSP00000371051:V30A	V	-	2	0	ZZEF1	3992850	0.343000	0.24818	0.021000	0.16686	0.882000	0.50991	0.278000	0.18753	0.760000	0.33108	-0.527000	0.04329	GTC	A|0.188;G|0.812		0.746	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	0	0		10	10	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
GUCY2D	3000	hgsc.bcm.edu	37	17	7906426	7906426	+	Missense_Mutation	SNP	T	T	C	rs9905402	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:7906426T>C	ENST00000254854.4	+	2	211	c.61T>C	c.(61-63)Tgg>Cgg	p.W21R		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	21			W -> R (in dbSNP:rs9905402). {ECO:0000269|PubMed:21602930}.		intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				CGGTCCCGCGTGGTGGGctcc	0.756													C|||	614	0.122604	0.2852	0.0504	5008	,	,		6556	0.0536		0.0139	False		,,,				2504	0.137				p.W21R		.											.	GUCY2D-319	0			c.T61C	GRCh37	CM057708	GUCY2D	M	rs9905402	.	C	ARG/TRP	278,2104		1,276,914	1.0	2.0	2.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	61	0.6	0.0	17	dbSNP_119	2	65,5361		0,65,2648	no	missense	GUCY2D	NM_000180.3	101	1,341,3562	CC,CT,TT		1.1979,11.6709,4.3929	benign	21/1104	7906426	343,7465	1191	2713	3904	SO:0001583	missense	3000	exon2			CCCGCGTGGTGGG	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.61T>C	17.37:g.7906426T>C	ENSP00000254854:p.Trp21Arg	0	0		6	5	NM_000180	0	0	0	0	0	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	211	0.09661172161172162	168	0.34146341463414637	17	0.04696132596685083	12	0.02097902097902098	14	0.018469656992084433	C	0.480	-0.880400	0.02530	0.116709	0.011979	ENSG00000132518	ENST00000254854	T	0.81247	-1.47	4.03	0.628	0.17681	.	0.583249	0.12965	N	0.424688	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.08911	-1.0699	9	0.06365	T	0.9	.	1.839	0.03146	0.161:0.4894:0.1568:0.1928	rs9905402	21	Q02846	GUC2D_HUMAN	R	21	ENSP00000254854:W21R	ENSP00000254854:W21R	W	+	1	0	GUCY2D	7847151	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.252000	0.08806	-0.161000	0.10983	-0.828000	0.03084	TGG	T|0.896;C|0.104		0.756	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
RNF135	84282	hgsc.bcm.edu	37	17	29298413	29298413	+	Missense_Mutation	SNP	T	T	C	rs7211440	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:29298413T>C	ENST00000328381.5	+	1	1195	c.322T>C	c.(322-324)Tcc>Ccc	p.S108P	RP11-848P1.2_ENST00000580979.1_RNA|RNF135_ENST00000443677.2_Missense_Mutation_p.S108P|RNF135_ENST00000324689.4_Missense_Mutation_p.S108P|RNF135_ENST00000535306.2_Missense_Mutation_p.S108P	NM_032322.3	NP_115698.3	Q8IUD6	RN135_HUMAN	ring finger protein 135	108			S -> P (in dbSNP:rs7211440). {ECO:0000269|PubMed:19291764}.		innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-beta production (GO:0032728)|protein ubiquitination (GO:0016567)|regulation of innate immune response (GO:0045088)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	10		all_cancers(10;8.65e-08)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Myeloproliferative disorder(56;0.0255)				GGGCTCCAGTTCCCTCTCCAg	0.771													C|||	1087	0.217053	0.77	0.0519	5008	,	,		9907	0.001		0.0119	False		,,,				2504	0.0204				p.S108P		.											.	RNF135-227	1	Unknown(1)	central_nervous_system(1)	c.T322C						.	C	PRO/SER,PRO/SER,PRO/SER	1011,1665		77,857,404	2.0	2.0	2.0		322,322,322	1.7	0.0	17	dbSNP_116	2	30,5322		0,30,2646	no	missense,missense,missense	RNF135	NM_001184992.1,NM_032322.3,NM_197939.1	74,74,74	77,887,3050	CC,CT,TT		0.5605,37.7803,12.9671	benign,benign,benign	108/287,108/433,108/211	29298413	1041,6987	1338	2676	4014	SO:0001583	missense	84282	exon1			TCCAGTTCCCTCT	AJ496729	CCDS11262.1, CCDS11263.1, CCDS54104.1	17q11.2	2013-01-09			ENSG00000181481	ENSG00000181481		"""RING-type (C3HC4) zinc fingers"""	21158	protein-coding gene	gene with protein product	"""riplet"""	611358				11468690, 19017631	Standard	NM_001184992		Approved	MGC13061	uc002hfz.3	Q8IUD6	OTTHUMG00000132867	ENST00000328381.5:c.322T>C	17.37:g.29298413T>C	ENSP00000328340:p.Ser108Pro	0	0		12	12	NM_197939	0	0	0	10	10	A0AVM5|B2R7G9|B6ZLM5|F5GX60|Q9BSE9	Missense_Mutation	SNP	ENST00000328381.5	37	CCDS11262.1	380	0.17399267399267399	348	0.7073170731707317	19	0.052486187845303865	3	0.005244755244755245	10	0.013192612137203167	C	6.940	0.543207	0.13250	0.377803	0.005605	ENSG00000181481	ENST00000328381;ENST00000324689;ENST00000535306;ENST00000443677	T;T;T	0.56776	0.44;1.54;2.94	1.68	1.68	0.24146	.	1.726760	0.04004	N	0.297022	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.0	T	0.42682	-0.9437	9	0.26408	T	0.33	.	4.2911	0.10879	0.0:0.7842:0.0:0.2158	rs7211440	108;108;108;108	F5GX60;Q8IUD6-2;B2R7G9;Q8IUD6	.;.;.;RN135_HUMAN	P	108;108;108;42	ENSP00000328340:S108P;ENSP00000323693:S108P;ENSP00000440470:S108P	ENSP00000323693:S108P	S	+	1	0	RNF135	26322539	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.154000	0.10130	0.258000	0.21686	-0.971000	0.02607	TCC	T|0.825;C|0.175		0.771	RNF135-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256342.3	NM_032322	
ARHGAP23	57636	hgsc.bcm.edu	37	17	36666551	36666551	+	Silent	SNP	T	T	C	rs62074752	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:36666551T>C	ENST00000431231.2	+	24	3887	c.3819T>C	c.(3817-3819)gaT>gaC	p.D1273D	ARHGAP23_ENST00000443378.1_Silent_p.D1179D	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1273					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGCGGGGGATGAGGCGGACG	0.746													C|||	4194	0.83746	0.792	0.8617	5008	,	,		5789	0.9365		0.7883	False		,,,				2504	0.8303				p.D1273D		.											.	ARHGAP23-205	0			c.T3819C						.						2.0	3.0	3.0					17																	36666551		517	1330	1847	SO:0001819	synonymous_variant	57636	exon24			GGGGGATGAGGCG	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3819T>C	17.37:g.36666551T>C		0	0		6	6	NM_001199417	0	0	0	6	6		Silent	SNP	ENST00000431231.2	37	CCDS56027.1																																																																																			C|0.823;G|0.000;T|0.177		0.746	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441789.1	XM_290799	
KRT26	353288	bcgsc.ca	37	17	38928019	38928019	+	Missense_Mutation	SNP	T	T	C	rs73985745	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:38928019T>C	ENST00000335552.4	-	1	395	c.347A>G	c.(346-348)aAg>aGg	p.K116R		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				GTACCAGCCCTTGATCTTCTG	0.507													T|||	33	0.00658946	0.0061	0.0231	5008	,	,		18055	0.0		0.008	False		,,,				2504	0.001				p.K116R		.											.	KRT26-90	0			c.A347G						.	T	ARG/LYS	39,4367	43.1+/-76.7	0,39,2164	121.0	118.0	119.0		347	4.6	0.2	17	dbSNP_130	119	58,8542	35.3+/-89.8	0,58,4242	yes	missense	KRT26	NM_181539.4	26	0,97,6406	CC,CT,TT		0.6744,0.8852,0.7458	benign	116/469	38928019	97,12909	2203	4300	6503	SO:0001583	missense	353288	exon1			CAGCCCTTGATCT	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.347A>G	17.37:g.38928019T>C	ENSP00000334798:p.Lys116Arg	142	1		112	5	NM_181539	0	0	0	0	0		Missense_Mutation	SNP	ENST00000335552.4	37	CCDS11374.1	18	0.008241758241758242	3	0.006097560975609756	11	0.03038674033149171	0	0.0	4	0.005277044854881266	T	6.167	0.399042	0.11696	0.008852	0.006744	ENSG00000186393	ENST00000335552	D	0.88818	-2.43	5.72	4.62	0.57501	Filament (1);	0.457146	0.20775	N	0.085901	T	0.52757	0.1754	N	0.13168	0.305	0.09310	N	0.999999	B	0.17268	0.021	B	0.21151	0.033	T	0.53933	-0.8368	10	0.02654	T	1	.	6.9617	0.24601	0.0:0.0814:0.1525:0.7661	.	116	Q7Z3Y9	K1C26_HUMAN	R	116	ENSP00000334798:K116R	ENSP00000334798:K116R	K	-	2	0	KRT26	36181545	0.001000	0.12720	0.208000	0.23602	0.919000	0.55068	0.468000	0.22051	1.064000	0.40671	0.528000	0.53228	AAG	T|0.992;C|0.008		0.507	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	NM_181539	
GRIN2C	2905	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	72846371	72846371	+	Missense_Mutation	SNP	C	C	T	rs140384270		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:72846371C>T	ENST00000293190.5	-	6	1611	c.1465G>A	c.(1465-1467)Ggc>Agc	p.G489S	GRIN2C_ENST00000578159.1_5'Flank|GRIN2C_ENST00000347612.4_Missense_Mutation_p.G489S	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	489					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TTCCATACGCCGCGCACCCGC	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18845	0.0		0.0	False		,,,				2504	0.0				p.G489S		.											.	GRIN2C-228	0			c.G1465A						.	C	SER/GLY	8,4398	14.3+/-33.2	0,8,2195	106.0	87.0	93.0		1465	4.1	1.0	17	dbSNP_134	93	0,8600		0,0,4300	yes	missense	GRIN2C	NM_000835.3	56	0,8,6495	TT,TC,CC		0.0,0.1816,0.0615	possibly-damaging	489/1234	72846371	8,12998	2203	4300	6503	SO:0001583	missense	2905	exon6			ATACGCCGCGCAC		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.1465G>A	17.37:g.72846371C>T	ENSP00000293190:p.Gly489Ser	163	0		94	5	NM_000835	0	0	8	8	0	B2RTT1	Missense_Mutation	SNP	ENST00000293190.5	37	CCDS32724.1	.	.	.	.	.	.	.	.	.	.	C	17.88	3.497942	0.64186	0.001816	0.0	ENSG00000161509	ENST00000293190;ENST00000347612	T	0.54866	0.55	4.06	4.06	0.47325	Extracellular solute-binding protein, family 3 (1);Glutamate receptor, L-glutamate/glycine-binding (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	T	0.70753	0.3260	M	0.79343	2.45	0.80722	D	1	D;D	0.61080	0.988;0.989	P;P	0.62885	0.9;0.908	T	0.76449	-0.2955	10	0.66056	D	0.02	.	16.3861	0.83504	0.0:1.0:0.0:0.0	.	523;489	Q8IW23;Q14957	.;NMDE3_HUMAN	S	489;523	ENSP00000293190:G489S	ENSP00000293190:G489S	G	-	1	0	GRIN2C	70357966	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	7.582000	0.82546	2.256000	0.74724	0.491000	0.48974	GGC	C|0.999;T|0.001		0.622	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1		
UBALD2	283991	bcgsc.ca	37	17	74261677	74261677	+	Silent	SNP	T	T	C	rs2585751	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:74261677T>C	ENST00000327490.6	+	1	395	c.91T>C	c.(91-93)Ttg>Ctg	p.L31L	UBALD2_ENST00000589240.1_5'Flank	NM_182565.3	NP_872371.1	Q8IYN6	UBAD2_HUMAN	UBA-like domain containing 2	31																	GGCGAAGCAGTTGCTGCAGGC	0.766													C|||	3578	0.714457	0.8843	0.6412	5008	,	,		3805	0.7024		0.5547	False		,,,				2504	0.7137				p.L31L		.											.	.	0			c.T91C						.	C		3526,686		1494,538,74	10.0	12.0	11.0		91	2.6	1.0	17	dbSNP_100	11	4861,3485		1480,1901,792	no	coding-synonymous	FAM100B	NM_182565.3		2974,2439,866	CC,CT,TT		41.7565,16.2868,33.2139		31/165	74261677	8387,4171	2106	4173	6279	SO:0001819	synonymous_variant	283991	exon1			AAGCAGTTGCTGC		CCDS11742.1	17q25.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000185262	ENSG00000185262			28438	protein-coding gene	gene with protein product			"""family with sequence similarity 100, member B"""	FAM100B			Standard	NM_182565		Approved	MGC29814	uc010wsy.1	Q8IYN6	OTTHUMG00000132666	ENST00000327490.6:c.91T>C	17.37:g.74261677T>C		14	0		26	20	NM_182565	0	0	8	46	38		Silent	SNP	ENST00000327490.6	37	CCDS11742.1																																																																																			T|0.356;C|0.644		0.766	UBALD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255920.1	NM_182565	
NDC80	10403	broad.mit.edu	37	18	2616568	2616568	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr18:2616568G>T	ENST00000261597.4	+	17	2106	c.1924G>T	c.(1924-1926)Gaa>Taa	p.E642*		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	642	Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						GTCTTCTGAAGAATGAAGATA	0.284																																					p.E642X		.											.	NDC80-91	0			c.G1924T						.						29.0	31.0	30.0					18																	2616568		2193	4270	6463	SO:0001587	stop_gained	10403	exon17			TCTGAAGAATGAA	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1924G>T	18.37:g.2616568G>T	ENSP00000261597:p.Glu642*	121	0		93	3	NM_006101	0	0	3	3	0	Q6PJX2	Nonsense_Mutation	SNP	ENST00000261597.4	37	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	32	5.138951	0.94560	.	.	ENSG00000080986	ENST00000261597	.	.	.	5.47	4.59	0.56863	.	0.599063	0.16977	N	0.191861	.	.	.	.	.	.	0.22511	N	0.999031	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	12.6429	0.56718	0.083:0.0:0.917:0.0	.	.	.	.	X	642	.	ENSP00000261597:E642X	E	+	1	0	NDC80	2606568	0.437000	0.25593	0.728000	0.30774	0.820000	0.46376	1.050000	0.30404	1.406000	0.46857	0.555000	0.69702	GAA	.		0.284	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	
KIAA1328	57536	bcgsc.ca	37	18	34740290	34740290	+	Missense_Mutation	SNP	A	A	C	rs140424487	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr18:34740290A>C	ENST00000280020.5	+	8	1382	c.1360A>C	c.(1360-1362)Aaa>Caa	p.K454Q	KIAA1328_ENST00000435985.2_Missense_Mutation_p.K206Q|KIAA1328_ENST00000543923.1_Missense_Mutation_p.K346Q|KIAA1328_ENST00000586135.1_Missense_Mutation_p.K206Q|KIAA1328_ENST00000591619.1_Missense_Mutation_p.K450Q	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328	454										central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		TTCGCATATGAAAGATGATGC	0.428													A|||	18	0.00359425	0.0	0.0058	5008	,	,		19194	0.0		0.0109	False		,,,				2504	0.0031				p.K454Q		.											.	KIAA1328-90	0			c.A1360C						.	A	GLN/LYS	2,3782		0,2,1890	84.0	76.0	79.0		1360	4.0	0.8	18	dbSNP_134	79	65,8187		0,65,4061	yes	missense	KIAA1328	NM_020776.1	53	0,67,5951	CC,CA,AA		0.7877,0.0529,0.5567	benign	454/578	34740290	67,11969	1892	4126	6018	SO:0001583	missense	57536	exon8			CATATGAAAGATG	AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.1360A>C	18.37:g.34740290A>C	ENSP00000280020:p.Lys454Gln	178	2		127	5	NM_020776	0	0	4	4	0	Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	ENST00000280020.5	37	CCDS45855.1	10	0.004578754578754579	0	0.0	2	0.0055248618784530384	0	0.0	8	0.010554089709762533	A	9.941	1.217466	0.22373	5.29E-4	0.007877	ENSG00000150477	ENST00000543923;ENST00000280020;ENST00000383055;ENST00000435985	T;T;T	0.46819	0.95;0.96;0.86	5.82	4.0	0.46444	.	0.494055	0.22366	N	0.061018	T	0.23572	0.0570	N	0.19112	0.55	0.22479	N	0.999069	B;B;B	0.28933	0.228;0.228;0.082	B;B;B	0.27796	0.083;0.083;0.058	T	0.15723	-1.0427	10	0.45353	T	0.12	.	9.7848	0.40670	0.1688:0.0:0.8312:0.0	.	454;206;454	A8K8C3;Q86T90-3;Q86T90	.;.;K1328_HUMAN	Q	346;454;454;206	ENSP00000441359:K346Q;ENSP00000280020:K454Q;ENSP00000390515:K206Q	ENSP00000280020:K454Q	K	+	1	0	KIAA1328	32994288	0.894000	0.30519	0.755000	0.31263	0.218000	0.24690	1.159000	0.31749	1.440000	0.47531	-0.462000	0.05337	AAA	A|0.994;C|0.006		0.428	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440455.1	NM_020776	
CBLN2	147381	hgsc.bcm.edu	37	18	70209321	70209321	+	Silent	SNP	C	C	A	rs7237888	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr18:70209321C>A	ENST00000269503.4	-	3	848	c.75G>T	c.(73-75)ccG>ccT	p.P25P	CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000585159.1_Silent_p.P25P|CBLN2_ENST00000583651.1_Intron|CBLN2_ENST00000584764.1_Intron	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	25					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				CGCAgccgcccggctcgcgca	0.786													C|||	2820	0.563099	0.1868	0.8573	5008	,	,		7947	0.381		0.9304	False		,,,				2504	0.6728				p.P25P		.											.	CBLN2-90	0			c.G75T						.	C		1660,2420		328,1004,708	5.0	7.0	6.0		75	-0.8	1.0	18	dbSNP_116	6	7475,487		3530,415,36	no	coding-synonymous	CBLN2	NM_182511.3		3858,1419,744	AA,AC,CC		6.1166,40.6863,24.1405		25/225	70209321	9135,2907	2040	3981	6021	SO:0001819	synonymous_variant	147381	exon3			GCCGCCCGGCTCG	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.75G>T	18.37:g.70209321C>A		0	0		19	18	NM_182511	0	0	0	0	0	Q53Z56	Silent	SNP	ENST00000269503.4	37	CCDS11999.1																																																																																			C|0.390;A|0.610		0.786	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
PPAP2C	8612	bcgsc.ca	37	19	282753	282753	+	Splice_Site	SNP	G	G	A	rs1138439	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:282753G>A	ENST00000269812.3	-	4	588	c.539C>T	c.(538-540)gCg>gTg	p.A180V	PPAP2C_ENST00000327790.3_Splice_Site_p.A201V|PPAP2C_ENST00000434325.2_Splice_Site_p.A124V	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	180			A -> V (in dbSNP:rs1138439).		dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGACTCACCGCCAAGAACAC	0.537													.|||	1826	0.364617	0.4682	0.4323	5008	,	,		16201	0.1181		0.4602	False		,,,				2504	0.3323				p.A201V		.											.	PPAP2C-90	0			c.C602T						.	G	VAL/ALA,VAL/ALA,VAL/ALA	2049,2357		479,1091,633	121.0	103.0	109.0		539,371,602	-0.1	0.4	19	dbSNP_86	109	3724,4876		824,2076,1400	yes	missense-near-splice,missense-near-splice,missense-near-splice	PPAP2C	NM_003712.2,NM_177526.1,NM_177543.1	64,64,64	1303,3167,2033	AA,AG,GG		43.3023,46.5048,44.3872	benign,benign,benign	180/289,124/233,201/310	282753	5773,7233	2203	4300	6503	SO:0001630	splice_region_variant	8612	exon4			CTCACCGCCAAGA	AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.540+1C>T	19.37:g.282753G>A		114	2		161	6	NM_177543	0	0	0	0	0	A6NLV0|E9PAY8	Missense_Mutation	SNP	ENST00000269812.3	37	CCDS12023.1	815	0.3731684981684982	210	0.4268292682926829	153	0.42265193370165743	88	0.15384615384615385	364	0.48021108179419525	.	6.371	0.436500	0.12104	0.465048	0.433023	ENSG00000141934	ENST00000269812;ENST00000327790;ENST00000434325	T;T;T	0.75367	-0.93;-0.93;-0.93	4.73	-0.069	0.13753	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.209140	0.39687	N	0.001299	T	0.00012	0.0000	L	0.42581	1.335	0.22479	P	0.999061563	B;B	0.21309	0.032;0.054	B;B	0.24006	0.05;0.033	T	0.43147	-0.9409	9	0.33141	T	0.24	-21.5272	8.9489	0.35776	0.3281:0.0:0.6719:0.0	rs1138439;rs1802137;rs3202329;rs10407115;rs52811693;rs57859690;rs10407115	180;201	O43688;O43688-2	LPP2_HUMAN;.	V	180;201;124	ENSP00000269812:A180V;ENSP00000329697:A201V;ENSP00000388565:A124V	ENSP00000269812:A180V	A	-	2	0	PPAP2C	233753	1.000000	0.71417	0.424000	0.26647	0.000000	0.00434	6.075000	0.71261	-0.160000	0.11002	-1.008000	0.02478	GCG	T|0.152;G|0.332;C|0.259;A|0.258		0.537	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451777.2		Missense_Mutation
ARID3A	1820	hgsc.bcm.edu	37	19	929741	929741	+	Silent	SNP	C	C	T	rs34967265	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:929741C>T	ENST00000263620.3	+	2	540	c.213C>T	c.(211-213)ggC>ggT	p.G71G	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	71						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCTGCGGGCCTGGGACACC	0.766													c|||	805	0.160743	0.354	0.1167	5008	,	,		8522	0.0873		0.0586	False		,,,				2504	0.1115				p.G71G	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.C213T						.	C		862,2694		85,692,1001	3.0	5.0	4.0		213	2.4	0.4	19	dbSNP_126	4	366,7224		12,342,3441	no	coding-synonymous	ARID3A	NM_005224.2		97,1034,4442	TT,TC,CC		4.8221,24.2407,11.0174		71/594	929741	1228,9918	1778	3795	5573	SO:0001819	synonymous_variant	1820	exon2			TGCGGGCCTGGGA	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.213C>T	19.37:g.929741C>T		0	0		19	12	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			C|0.865;T|0.135		0.766	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
KLF16	83855	hgsc.bcm.edu	37	19	1854557	1854557	+	Silent	SNP	A	A	G	rs3746045	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:1854557A>G	ENST00000250916.4	-	2	730	c.660T>C	c.(658-660)ccT>ccC	p.P220P	CTB-31O20.6_ENST00000592884.1_RNA|KLF16_ENST00000592313.1_5'UTR	NM_031918.3	NP_114124.1	Q9BXK1	KLF16_HUMAN	Kruppel-like factor 16	220	Pro/Ser-rich.				dopamine receptor signaling pathway (GO:0007212)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)	1		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCGGGCACCAGGGCGCCGGA	0.756													A|||	2119	0.423123	0.6785	0.4611	5008	,	,		10654	0.3829		0.2177	False		,,,				2504	0.3037				p.P220P		.											.	KLF16-90	0			c.T660C						.	A		2319,1817		694,931,443	10.0	16.0	14.0		660	-6.7	0.2	19	dbSNP_107	14	1682,6356		211,1260,2548	no	coding-synonymous	KLF16	NM_031918.3		905,2191,2991	GG,GA,AA		20.9256,43.9313,32.8651		220/253	1854557	4001,8173	2068	4019	6087	SO:0001819	synonymous_variant	83855	exon2			GGCACCAGGGCGC	AF327440	CCDS12075.1	19p13.3	2013-10-15			ENSG00000129911	ENSG00000129911		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16857	protein-coding gene	gene with protein product		606139				11438660	Standard	NM_031918		Approved	NSLP2, BTEB4, DRRF	uc002luc.3	Q9BXK1	OTTHUMG00000179994	ENST00000250916.4:c.660T>C	19.37:g.1854557A>G		1	0		20	19	NM_031918	0	0	0	17	17		Silent	SNP	ENST00000250916.4	37	CCDS12075.1																																																																																			A|0.591;G|0.409		0.756	KLF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449214.1		
JSRP1	126306	hgsc.bcm.edu	37	19	2253732	2253732	+	Missense_Mutation	SNP	G	G	A	rs74521370	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:2253732G>A	ENST00000300961.6	-	5	387	c.323C>T	c.(322-324)cCg>cTg	p.P108L	JSRP1_ENST00000586471.2_Missense_Mutation_p.P108L	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	108	Pro-rich.		P -> L (polymorphism affecting excitation/contraction coupling in muscle fibers; the sensitivity of CACNA1S voltage sensor is shifted to higher depolarizing voltages in cells carrying this variant; dbSNP:rs74521370). {ECO:0000269|PubMed:22927026}.		protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		cgggggcggcggcggcggctg	0.751													G|||	27	0.00539137	0.0015	0.0043	5008	,	,		11527	0.0		0.0159	False		,,,				2504	0.0061				p.P108L		.											.	JSRP1-91	0			c.C323T						.	G	LEU/PRO	11,3173		0,11,1581	3.0	5.0	4.0		323	1.2	0.9	19	dbSNP_131	4	94,6418		0,94,3162	no	missense	JSRP1	NM_144616.3	98	0,105,4743	AA,AG,GG		1.4435,0.3455,1.0829	benign	108/332	2253732	105,9591	1592	3256	4848	SO:0001583	missense	126306	exon5			GGCGGCGGCGGCG	AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.323C>T	19.37:g.2253732G>A	ENSP00000300961:p.Pro108Leu	0	0		13	11	NM_144616	0	0	0	0	0		Missense_Mutation	SNP	ENST00000300961.6	37	CCDS12086.1	14	0.00641025641025641	0	0.0	5	0.013812154696132596	0	0.0	9	0.011873350923482849	G	9.861	1.196429	0.22037	0.003455	0.014435	ENSG00000167476	ENST00000300961	T	0.16073	2.37	4.61	1.22	0.21188	.	0.304893	0.23985	N	0.042624	T	0.04227	0.0117	N	0.12746	0.255	0.09310	N	1	P	0.44195	0.828	B	0.32342	0.144	T	0.32903	-0.9889	10	0.52906	T	0.07	.	6.4814	0.22065	0.3832:0.0:0.6168:0.0	.	108	Q96MG2	JSPR1_HUMAN	L	108	ENSP00000300961:P108L	ENSP00000300961:P108L	P	-	2	0	JSRP1	2204732	0.004000	0.15560	0.888000	0.34837	0.023000	0.10783	0.186000	0.16978	0.899000	0.36444	0.561000	0.74099	CCG	G|0.994;A|0.006		0.751	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451266.2	NM_144616	
ANKRD24	170961	hgsc.bcm.edu	37	19	4217956	4217956	+	Silent	SNP	A	A	G	rs6510794	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:4217956A>G	ENST00000600132.1	+	18	3075	c.2799A>G	c.(2797-2799)gcA>gcG	p.A933A	ANKRD24_ENST00000318934.4_Silent_p.A933A|ANKRD24_ENST00000262970.5_Silent_p.A1023A	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	933										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GGGGCCGGGCAGCCAGTCTGG	0.766													G|||	2256	0.450479	0.5166	0.4164	5008	,	,		6898	0.4692		0.4751	False		,,,				2504	0.3405				p.A933A		.											.	ANKRD24-68	0			c.A2799G						.	G		1357,2019		337,683,668	3.0	6.0	5.0		2799	0.3	1.0	19	dbSNP_116	5	2607,4473		599,1409,1532	no	coding-synonymous	ANKRD24	NM_133475.1		936,2092,2200	GG,GA,AA		36.822,40.1955,37.9112		933/1147	4217956	3964,6492	1688	3540	5228	SO:0001819	synonymous_variant	170961	exon18			CCGGGCAGCCAGT	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.2799A>G	19.37:g.4217956A>G		0	0		16	16	NM_133475	0	0	0	4	4	O75268|O95781	Silent	SNP	ENST00000600132.1	37	CCDS45925.1																																																																																			A|0.541;G|0.459		0.766	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000	
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	0	0		32	17	NM_019107	0	0	28	45	17	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
RANBP3	8498	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5951537	5951537	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:5951537T>A	ENST00000340578.6	-	3	206	c.149A>T	c.(148-150)cAt>cTt	p.H50L	RANBP3_ENST00000541471.1_Intron|RANBP3_ENST00000034275.8_Intron|RANBP3_ENST00000591092.1_Intron|RANBP3_ENST00000591124.1_Intron|RANBP3_ENST00000439268.2_Missense_Mutation_p.H50L	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	50					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						ACCCGTGCCATGGTGGGGGGC	0.627																																					p.H50L		.											.	RANBP3-272	0			c.A149T						.						18.0	23.0	21.0					19																	5951537		2062	4203	6265	SO:0001583	missense	8498	exon3			GTGCCATGGTGGG	Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.149A>T	19.37:g.5951537T>A	ENSP00000341483:p.His50Leu	60	0		103	18	NM_007322	0	0	16	18	2	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	ENST00000340578.6	37	CCDS42478.1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.533634	0.27387	.	.	ENSG00000031823	ENST00000340578;ENST00000439268	T;T	0.34859	1.34;1.35	5.21	3.07	0.35406	.	0.269330	0.29493	N	0.011996	T	0.18341	0.0440	N	0.19112	0.55	0.80722	D	1	B;B	0.23650	0.062;0.089	B;B	0.24701	0.055;0.025	T	0.07121	-1.0789	10	0.10111	T	0.7	-4.1311	5.1824	0.15167	0.0:0.0959:0.1907:0.7135	.	50;50	Q9H6Z4-2;Q9H6Z4	.;RANB3_HUMAN	L	50	ENSP00000341483:H50L;ENSP00000404837:H50L	ENSP00000341483:H50L	H	-	2	0	RANBP3	5902537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.351000	0.20096	0.300000	0.22699	0.459000	0.35465	CAT	.		0.627	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452304.1	NM_007322	
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		1	0		13	13	NM_198471	0	0	0	1	1	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
KANK3	256949	hgsc.bcm.edu	37	19	8399635	8399635	+	Missense_Mutation	SNP	C	C	T	rs890853	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:8399635C>T	ENST00000593649.1	-	3	1141	c.1076G>A	c.(1075-1077)cGc>cAc	p.R359H	KANK3_ENST00000330915.3_Missense_Mutation_p.R359H			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	359			R -> H (in dbSNP:rs890853).							breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						CAGACTGGCGCGCAGCAGCTC	0.761													C|||	962	0.192093	0.093	0.3847	5008	,	,		10548	0.2113		0.2545	False		,,,				2504	0.1053				p.R359H		.											.	KANK3-90	0			c.G1076A						.						1.0	1.0	1.0					19																	8399635		1163	2476	3639	SO:0001583	missense	256949	exon3			CTGGCGCGCAGCA	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1076G>A	19.37:g.8399635C>T	ENSP00000470728:p.Arg359His	1	0		11	8	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Missense_Mutation	SNP	ENST00000593649.1	37		505	0.23122710622710624	63	0.12804878048780488	131	0.36187845303867405	117	0.20454545454545456	194	0.2559366754617414	C	13.09	2.134512	0.37630	.	.	ENSG00000186994	ENST00000330915	T	0.54071	0.59	4.52	0.959	0.19624	.	.	.	.	.	T	0.00012	0.0000	L	0.29908	0.895	0.53688	P	2.8999999999945736E-5	B	0.16396	0.017	B	0.09377	0.004	T	0.33394	-0.9870	8	0.54805	T	0.06	-23.4019	6.9118	0.24338	0.0:0.5682:0.0:0.4318	rs890853	359	Q6NY19-2	.	H	359	ENSP00000328923:R359H	ENSP00000328923:R359H	R	-	2	0	KANK3	8305635	0.014000	0.17966	0.688000	0.30117	0.060000	0.15804	0.173000	0.16724	0.468000	0.27243	0.297000	0.19635	CGC	C|0.769;T|0.231		0.761	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
NWD1	284434	broad.mit.edu;bcgsc.ca	37	19	16860082	16860082	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:16860082G>A	ENST00000552788.1	+	4	629	c.629G>A	c.(628-630)cGg>cAg	p.R210Q	NWD1_ENST00000523826.1_Missense_Mutation_p.R4Q|NWD1_ENST00000339803.6_Missense_Mutation_p.R75Q|NWD1_ENST00000379808.3_Missense_Mutation_p.R210Q|NWD1_ENST00000524140.2_Missense_Mutation_p.R210Q|NWD1_ENST00000549814.1_Missense_Mutation_p.R210Q			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	210							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATGGTGGACCGGCTCGCGGAT	0.587																																					p.R210Q		.											.	NWD1-7	0			c.G629A						.						86.0	70.0	75.0					19																	16860082		2203	4300	6503	SO:0001583	missense	284434	exon6			TGGACCGGCTCGC	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.629G>A	19.37:g.16860082G>A	ENSP00000447224:p.Arg210Gln	146	1		251	70	NM_001007525	0	0	0	0	0	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	g	16.02	3.004632	0.54254	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.56444	2.01;2.01;2.01;0.46;2.01;0.54	4.52	3.42	0.39159	.	0.436688	0.21147	N	0.079396	T	0.52549	0.1741	L	0.29908	0.895	0.23542	N	0.997455	D;D;D	0.89917	0.997;1.0;1.0	P;P;P	0.61070	0.637;0.883;0.86	T	0.35051	-0.9804	10	0.31617	T	0.26	-36.2704	9.925	0.41487	0.0:0.0:0.7983:0.2017	.	210;210;75	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	Q	75;210;210;210;4;210;75	ENSP00000428579:R210Q;ENSP00000447548:R210Q;ENSP00000369136:R210Q;ENSP00000428955:R4Q;ENSP00000447224:R210Q;ENSP00000340159:R75Q	ENSP00000340159:R75Q	R	+	2	0	NWD1	16721082	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	1.150000	0.31639	2.068000	0.61886	0.542000	0.68232	CGG	.		0.587	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
LRP3	4037	hgsc.bcm.edu	37	19	33696354	33696354	+	Silent	SNP	C	C	T	rs3745977	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:33696354C>T	ENST00000253193.7	+	5	880	c.678C>T	c.(676-678)cgC>cgT	p.R226R	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	226	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					GCTCCACGCGCTGCCTGCCTG	0.756													C|||	253	0.0505192	0.0098	0.0764	5008	,	,		12161	0.121		0.0447	False		,,,				2504	0.0204				p.R226R		.											.	LRP3-92	0			c.C678T						.	C		95,4097		1,93,2002	7.0	9.0	8.0		678	-0.2	1.0	19	dbSNP_107	8	408,7832		13,382,3725	no	coding-synonymous	LRP3	NM_002333.3		14,475,5727	TT,TC,CC		4.9515,2.2662,4.046		226/771	33696354	503,11929	2096	4120	6216	SO:0001819	synonymous_variant	4037	exon5			CACGCGCTGCCTG	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.678C>T	19.37:g.33696354C>T		0	0		64	34	NM_002333	0	0	62	141	79	B3KQD6|B4DKF2	Silent	SNP	ENST00000253193.7	37	CCDS12430.1																																																																																			C|0.945;T|0.055		0.756	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450842.4		
UBA2	10054	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	34929551	34929551	+	Splice_Site	SNP	G	G	C			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:34929551G>C	ENST00000246548.4	+	6	531	c.461G>C	c.(460-462)gGt>gCt	p.G154A	UBA2_ENST00000439527.2_Splice_Site_p.G58A	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	154					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			ACTTCATAGGGTGTGACCGAG	0.393																																					p.G154A		.											.	UBA2-227	0			c.G461C						.						201.0	177.0	185.0					19																	34929551		2203	4300	6503	SO:0001630	splice_region_variant	10054	exon6			CATAGGGTGTGAC	BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.460-1G>C	19.37:g.34929551G>C		113	0		189	47	NM_005499	0	0	0	0	0	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Missense_Mutation	SNP	ENST00000246548.4	37	CCDS12439.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606399	0.87157	.	.	ENSG00000126261	ENST00000542624;ENST00000246548;ENST00000439527	T;T	0.34859	1.34;1.34	5.39	5.39	0.77823	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-activating enzyme (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.65471	0.2694	M	0.91038	3.17	0.80722	D	1	D	0.56521	0.976	P	0.61070	0.883	T	0.69781	-0.5052	10	0.35671	T	0.21	-20.8715	17.929	0.88992	0.0:0.0:1.0:0.0	.	154	Q9UBT2	SAE2_HUMAN	A	27;154;58	ENSP00000246548:G154A;ENSP00000437484:G58A	ENSP00000246548:G154A	G	+	2	0	UBA2	39621391	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	9.261000	0.95576	2.520000	0.84964	0.555000	0.69702	GGT	.		0.393	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3	NM_005499	Missense_Mutation
HPN	3249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35551399	35551399	+	Silent	SNP	C	C	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:35551399C>T	ENST00000262626.2	+	8	1428	c.603C>T	c.(601-603)gcC>gcT	p.A201A	HPN_ENST00000392226.1_Silent_p.A201A|HPN-AS1_ENST00000392227.2_RNA|HPN_ENST00000597419.1_Intron	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	201	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	TGCTGACAGCCGCCCACTGCT	0.662																																					p.A201A		.											.	HPN-515	0			c.C603T						.						51.0	60.0	57.0					19																	35551399		2203	4300	6503	SO:0001819	synonymous_variant	3249	exon8			GACAGCCGCCCAC		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.603C>T	19.37:g.35551399C>T		72	0		136	28	NM_182983	0	0	0	0	0	B2RDS4	Silent	SNP	ENST00000262626.2	37	CCDS32993.1																																																																																			.		0.662	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151	
ZNF585B	92285	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	37677163	37677163	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:37677163T>A	ENST00000532828.2	-	5	1527	c.1276A>T	c.(1276-1278)Att>Ttt	p.I426F	ZNF585B_ENST00000527838.1_3'UTR|CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_Missense_Mutation_p.I14F|ZNF585B_ENST00000531805.1_Missense_Mutation_p.I371F	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGATGTGTAATCAAGTGTGCC	0.388																																					p.I426F	Melanoma(93;882 1454 18863 28917 48427)	.											.	ZNF585B-91	0			c.A1276T						.						108.0	106.0	107.0					19																	37677163		2203	4300	6503	SO:0001583	missense	92285	exon5			GTGTAATCAAGTG	AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1276A>T	19.37:g.37677163T>A	ENSP00000433773:p.Ile426Phe	103	0		156	42	NM_152279	0	0	4	6	2	Q8IZD3|Q96JW6	Missense_Mutation	SNP	ENST00000532828.2	37	CCDS12500.1	.	.	.	.	.	.	.	.	.	.	t	5.322	0.244664	0.10077	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.33865	1.39;1.39;2.25	2.47	-0.249	0.13011	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.937475	0.08719	N	0.903832	T	0.33206	0.0855	L	0.37507	1.11	0.09310	N	1	B;P	0.48998	0.18;0.918	B;P	0.46718	0.08;0.525	T	0.27640	-1.0068	10	0.72032	D	0.01	.	8.2406	0.31658	0.0:0.1921:0.0:0.8079	.	371;426	E9PQH3;Q52M93	.;Z585B_HUMAN	F	371;426;14	ENSP00000436774:I371F;ENSP00000433773:I426F;ENSP00000442139:I14F	ENSP00000442139:I14F	I	-	1	0	ZNF585B	42369003	0.000000	0.05858	0.003000	0.11579	0.500000	0.33767	-1.804000	0.01738	-0.558000	0.06118	-0.374000	0.07098	ATT	.		0.388	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388272.2	NM_152279	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000598904.1_Missense_Mutation_p.P288L|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000340740.3_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	0	0		35	24	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
ZNF575	284346	broad.mit.edu	37	19	44039527	44039527	+	Silent	SNP	A	A	C	rs535870980	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:44039527A>C	ENST00000314228.5	+	4	938	c.426A>C	c.(424-426)gcA>gcC	p.A142A	ZNF575_ENST00000458714.2_Silent_p.A241A|ZNF575_ENST00000601282.1_Silent_p.A142A	NM_174945.2	NP_777605.1	Q86XF7	ZN575_HUMAN	zinc finger protein 575	142					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4		Prostate(69;0.0199)				GGACCCACGCACCCACCCGCC	0.731													A|||	251	0.0501198	0.0416	0.0389	5008	,	,		6815	0.0605		0.0666	False		,,,				2504	0.0419				p.A142A		.											.	ZNF575-90	0			c.A426C						.						11.0	15.0	14.0					19																	44039527		2194	4282	6476	SO:0001819	synonymous_variant	284346	exon4			CCACGCACCCACC	BC043611	CCDS12623.1	19q13.31	2013-09-20			ENSG00000176472	ENSG00000176472		"""Zinc fingers, C2H2-type"""	27606	protein-coding gene	gene with protein product							Standard	NM_174945		Approved	FLJ32567	uc002ows.3	Q86XF7	OTTHUMG00000182698	ENST00000314228.5:c.426A>C	19.37:g.44039527A>C		20	1		137	29	NM_174945	0	0	0	0	0	B4DX54	Silent	SNP	ENST00000314228.5	37	CCDS12623.1																																																																																			.		0.731	ZNF575-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463191.1	NM_174945	
PTGIR	5739	hgsc.bcm.edu	37	19	47127378	47127378	+	Silent	SNP	C	C	A	rs76887099	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:47127378C>A	ENST00000291294.2	-	2	238	c.105G>T	c.(103-105)ctG>ctT	p.L35L	PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000596260.1_Silent_p.L35L|PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000597185.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	35					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	TCAGGATGCCCAGGGCCAGCC	0.726													C|||	41	0.0081869	0.0303	0.0014	5008	,	,		14016	0.0		0.0	False		,,,				2504	0.0				p.L35L		.											.	PTGIR-522	0			c.G105T						.	C		57,3885		0,57,1914	4.0	4.0	4.0		105	3.4	1.0	19	dbSNP_131	4	0,7798		0,0,3899	no	coding-synonymous	PTGIR	NM_000960.3		0,57,5813	AA,AC,CC		0.0,1.446,0.4855		35/387	47127378	57,11683	1971	3899	5870	SO:0001819	synonymous_variant	5739	exon2			GATGCCCAGGGCC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.105G>T	19.37:g.47127378C>A		0	0		7	4	NM_000960	0	0	3	4	1		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.998;A|0.002		0.726	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
GLTSCR2	29997	hgsc.bcm.edu	37	19	48258699	48258699	+	Missense_Mutation	SNP	C	C	T	rs11538665	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:48258699C>T	ENST00000246802.5	+	9	1186	c.1148C>T	c.(1147-1149)gCg>gTg	p.A383V	GLTSCR2_ENST00000598681.1_3'UTR|SNORD23_ENST00000408876.1_RNA|CTD-2571L23.6_ENST00000602048.1_RNA	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	383						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		CTGAGGCTGGCGGAGCTggcg	0.761													C|||	17	0.00339457	0.0	0.0043	5008	,	,		7822	0.0		0.008	False		,,,				2504	0.0061				p.A383V	Colon(58;613 1041 9473 10089 15241)	.											.	GLTSCR2-514	0			c.C1148T						.	C	VAL/ALA	8,2480		0,8,1236	1.0	2.0	2.0		1148	3.8	1.0	19	dbSNP_120	2	64,5588		0,64,2762	no	missense	GLTSCR2	NM_015710.4	64	0,72,3998	TT,TC,CC		1.1323,0.3215,0.8845	possibly-damaging	383/479	48258699	72,8068	1244	2826	4070	SO:0001583	missense	29997	exon9			GGCTGGCGGAGCT	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.1148C>T	19.37:g.48258699C>T	ENSP00000246802:p.Ala383Val	0	0		17	14	NM_015710	0	2	118	272	152	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	12	0.005494505494505495	0	0.0	2	0.0055248618784530384	4	0.006993006993006993	6	0.0079155672823219	C	18.73	3.685886	0.68157	0.003215	0.011323	ENSG00000105373	ENST00000246802	T	0.46451	0.87	3.8	3.8	0.43715	.	0.807243	0.11526	N	0.555190	T	0.33177	0.0854	M	0.62016	1.91	0.31171	N	0.703183	P;P;P	0.49090	0.919;0.919;0.919	B;B;B	0.41917	0.37;0.37;0.37	T	0.42749	-0.9433	10	0.34782	T	0.22	-10.9561	11.3494	0.49579	0.0:1.0:0.0:0.0	rs11538665	383;383;381	Q53YP0;Q9NZM5;Q96CS0	.;GSCR2_HUMAN;.	V	383	ENSP00000246802:A383V	ENSP00000246802:A383V	A	+	2	0	GLTSCR2	52950511	0.652000	0.27349	0.960000	0.40013	0.888000	0.51559	0.923000	0.28757	2.107000	0.64212	0.448000	0.29417	GCG	G|0.994;A|0.006		0.761	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
GLTSCR2	29997	hgsc.bcm.edu	37	19	48258717	48258717	+	Missense_Mutation	SNP	A	A	G	rs1804994	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:48258717A>G	ENST00000246802.5	+	9	1204	c.1166A>G	c.(1165-1167)cAg>cGg	p.Q389R	GLTSCR2_ENST00000598681.1_3'UTR|SNORD23_ENST00000408876.1_RNA|CTD-2571L23.6_ENST00000602048.1_RNA	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	389			Q -> R (in dbSNP:rs1804994). {ECO:0000269|PubMed:10708517, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005, ECO:0000269|Ref.4}.			intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		gcgcggcggcagaggcggcgg	0.761													G|||	3570	0.712859	0.857	0.6888	5008	,	,		6528	0.5546		0.6799	False		,,,				2504	0.7321				p.Q389R	Colon(58;613 1041 9473 10089 15241)	.											.	GLTSCR2-514	0			c.A1166G						.						1.0	2.0	1.0					19																	48258717		823	2228	3051	SO:0001583	missense	29997	exon9			GGCGGCAGAGGCG	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.1166A>G	19.37:g.48258717A>G	ENSP00000246802:p.Gln389Arg	0	0		13	13	NM_015710	0	0	0	95	95	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	1513	0.6927655677655677	424	0.8617886178861789	252	0.6961325966850829	316	0.5524475524475524	521	0.6873350923482849	G	0.092	-1.166361	0.01660	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.39229	1.09	3.93	2.86	0.33363	.	0.430291	0.24226	N	0.040398	T	0.00012	0.0000	N	0.00289	-1.7	0.54753	P	1.2000000000012001E-5	B	0.02656	0.0	B	0.06405	0.002	T	0.35450	-0.9788	9	0.05620	T	0.96	-11.9316	6.8245	0.23874	0.2235:0.0:0.7765:0.0	rs1804994;rs3211363;rs16949619;rs17343460;rs17856180;rs17856325;rs57240470	389	Q9NZM5	GSCR2_HUMAN	R	389;383	ENSP00000246802:Q389R	ENSP00000246802:Q389R	Q	+	2	0	GLTSCR2	52950529	0.025000	0.19082	0.815000	0.32552	0.328000	0.28507	0.153000	0.16323	0.415000	0.25817	-0.231000	0.12243	CAG	A|0.308;G|0.692		0.761	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464870.1	NM_015710	
PRR12	57479	hgsc.bcm.edu	37	19	50104948	50104948	+	Missense_Mutation	SNP	C	C	A	rs142810131	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:50104948C>A	ENST00000418929.2	+	6	4558	c.4546C>A	c.(4546-4548)Ccc>Acc	p.P1516T		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	0							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		tccaccaccacccccaccaGC	0.771													C|||	223	0.0445288	0.0272	0.0216	5008	,	,		8407	0.006		0.0368	False		,,,				2504	0.1319				p.P1516T		.											.	PRR12-70	0			c.C4546A						.	C	THR/PRO	50,3042		0,50,1496	2.0	4.0	4.0		4546	1.1	0.3	19	dbSNP_134	4	152,6668		1,150,3259	no	missense	PRR12	NM_020719.1	38	1,200,4755	AA,AC,CC		2.2287,1.6171,2.0379	benign	1516/2037	50104948	202,9710	1546	3410	4956	SO:0001583	missense	57479	exon6			CCACCACCCCCAC	AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4546C>A	19.37:g.50104948C>A	ENSP00000394510:p.Pro1516Thr	0	0		25	13	NM_020719	0	0	12	20	8	E9PB06|Q8N4J6	Missense_Mutation	SNP	ENST00000418929.2	37	CCDS46143.1	52	0.023809523809523808	11	0.022357723577235773	10	0.027624309392265192	1	0.0017482517482517483	30	0.0395778364116095	C	7.464	0.645206	0.14451	0.016171	0.022287	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	3.55	1.08	0.20341	.	.	.	.	.	T	0.07728	0.0194	.	.	.	0.25622	N	0.986386	B	0.27732	0.187	B	0.24701	0.055	T	0.07635	-1.0762	7	0.30078	T	0.28	-5.7304	12.5433	0.56184	0.0:0.5474:0.4526:0.0	.	1516	Q9ULL5-3	.	T	1516;696;696	.	ENSP00000246798:P696T	P	+	1	0	PRR12	54796760	0.004000	0.15560	0.271000	0.24616	0.060000	0.15804	1.614000	0.36911	0.642000	0.30620	0.313000	0.20887	CCC	C|0.976;A|0.024		0.771	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465915.1	NM_020719	
SCAF1	58506	hgsc.bcm.edu	37	19	50154904	50154904	+	Missense_Mutation	SNP	A	A	C	rs7251334	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:50154904A>C	ENST00000360565.3	+	7	1382	c.1258A>C	c.(1258-1260)Aca>Cca	p.T420P		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	420	Pro-rich.			T -> P (in Ref. 2; BAB15734 and 3; AAH53992). {ECO:0000305}.	mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		cgcccggccTACACCGGCCGC	0.756													C|||	4992	0.996805	0.9985	0.9986	5008	,	,		5626	1.0		0.993	False		,,,				2504	0.9939				p.T420P		.											.	SCAF1-68	0			c.A1258C						.						1.0	1.0	1.0					19																	50154904		644	1667	2311	SO:0001583	missense	58506	exon7			CGGCCTACACCGG	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.1258A>C	19.37:g.50154904A>C	ENSP00000353769:p.Thr420Pro	0	0		9	9	NM_021228	0	0	0	14	14	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	37	CCDS33074.1	2147	0.983058608058608	474	0.9634146341463414	354	0.9779005524861878	570	0.9965034965034965	749	0.9881266490765171	C	7.840	0.721709	0.15372	.	.	ENSG00000126461	ENST00000360565	T	0.33438	1.41	2.81	1.65	0.23941	.	0.836758	0.09740	N	0.761924	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23655	-1.0182	8	.	.	.	-2.8066	5.1642	0.15077	0.236:0.5339:0.2301:0.0	rs7251334;rs17857439	420	Q9H7N4	SFR19_HUMAN	P	420	ENSP00000353769:T420P	.	T	+	1	0	SCAF1	54846716	0.053000	0.20554	0.021000	0.16686	0.005000	0.04900	0.139000	0.16036	0.415000	0.25817	-0.648000	0.03929	ACA	A|0.017;C|0.983		0.756	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228	
SCAF1	58506	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	50156834	50156834	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:50156834C>G	ENST00000360565.3	+	7	3312	c.3188C>G	c.(3187-3189)tCc>tGc	p.S1063C		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1063					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		AGCGCGGGGTCCACAGCCGGT	0.701																																					p.S1063C		.											.	SCAF1-68	0			c.C3188G						.						8.0	11.0	10.0					19																	50156834		2171	4238	6409	SO:0001583	missense	58506	exon7			CGGGGTCCACAGC	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3188C>G	19.37:g.50156834C>G	ENSP00000353769:p.Ser1063Cys	20	0		93	17	NM_021228	0	0	129	164	35	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	37	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937976	0.52972	.	.	ENSG00000126461	ENST00000360565	T	0.39787	1.06	5.44	5.44	0.79542	.	0.000000	0.40064	N	0.001185	T	0.42223	0.1193	N	0.08118	0	0.31170	N	0.703369	D	0.76494	0.999	D	0.68483	0.958	T	0.43196	-0.9406	9	.	.	.	-29.7266	15.1045	0.72310	0.0:1.0:0.0:0.0	.	1063	Q9H7N4	SFR19_HUMAN	C	1063	ENSP00000353769:S1063C	.	S	+	2	0	SCAF1	54848646	0.993000	0.37304	1.000000	0.80357	0.993000	0.82548	1.162000	0.31786	2.713000	0.92767	0.655000	0.94253	TCC	.		0.701	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228	
MYH14	79784	hgsc.bcm.edu	37	19	50713713	50713713	+	Missense_Mutation	SNP	C	C	A	rs590722	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:50713713C>A	ENST00000596571.1	+	1	91	c.91C>A	c.(91-93)Ccc>Acc	p.P31T	MYH14_ENST00000440075.2_Missense_Mutation_p.P31T|MYH14_ENST00000376970.2_Missense_Mutation_p.P31T|MYH14_ENST00000598205.1_Missense_Mutation_p.P31T|MYH14_ENST00000262269.8_Missense_Mutation_p.P31T|MYH14_ENST00000425460.1_Missense_Mutation_p.P31T|MYH14_ENST00000601313.1_Missense_Mutation_p.P31T			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	31					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		CCTGTTCACGCCCCGCGGGCC	0.766													C|||	941	0.187899	0.1581	0.1527	5008	,	,		8614	0.2579		0.1372	False		,,,				2504	0.2331				p.P31T		.											.	MYH14-23	0			c.C91A						.	C	THR/PRO,THR/PRO,THR/PRO	319,2625		14,291,1167	3.0	4.0	4.0		91,91,91	2.2	0.0	19	dbSNP_83	4	784,5950		48,688,2631	no	missense,missense,missense	MYH14	NM_001077186.1,NM_001145809.1,NM_024729.3	38,38,38	62,979,3798	AA,AC,CC		11.6424,10.8356,11.397	possibly-damaging,possibly-damaging,possibly-damaging	31/2004,31/2037,31/1996	50713713	1103,8575	1472	3367	4839	SO:0001583	missense	79784	exon2			TTCACGCCCCGCG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.91C>A	19.37:g.50713713C>A	ENSP00000472819:p.Pro31Thr	1	0		7	4	NM_001077186	0	0	0	0	0	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	37	CCDS59411.1	373	0.1707875457875458	76	0.15447154471544716	47	0.1298342541436464	140	0.24475524475524477	110	0.14511873350923482	C	14.02	2.410075	0.42715	0.108356	0.116424	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	D;D;D;D	0.86097	-2.07;-2.04;-2.02;-2.06	4.46	2.2	0.27929	.	.	.	.	.	T	0.00073	0.0002	N	0.19112	0.55	0.80722	P	0.0	B;B;B	0.26876	0.162;0.038;0.063	B;B;B	0.21917	0.037;0.016;0.037	T	0.09487	-1.0672	8	0.72032	D	0.01	.	12.3488	0.55136	0.0:0.4912:0.5088:0.0	rs590722	31;31;31	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	T	31	ENSP00000406273:P31T;ENSP00000366169:P31T;ENSP00000407879:P31T;ENSP00000262269:P31T	ENSP00000262269:P31T	P	+	1	0	MYH14	55405525	0.000000	0.05858	0.026000	0.17262	0.272000	0.26649	0.139000	0.16036	0.565000	0.29255	0.555000	0.69702	CCC	T|0.171;G|0.829		0.766	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
VN1R2	317701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53761677	53761677	+	Missense_Mutation	SNP	A	A	G	rs376857944		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:53761677A>G	ENST00000341702.3	+	1	133	c.49A>G	c.(49-51)Atc>Gtc	p.I17V		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	17					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		tccaataaatatcagcgcagc	0.527																																					p.I17V		.											.	VN1R2-90	0			c.A49G						.	A	VAL/ILE	0,3466		0,0,1733	9.0	9.0	9.0		49		0.3	19		9	1,6345		0,1,3172	no	missense	VN1R2	NM_173856.2	29	0,1,4905	GG,GA,AA		0.0158,0.0,0.0102	possibly-damaging	17/396	53761677	1,9811	1733	3173	4906	SO:0001583	missense	317701	exon1			ATAAATATCAGCG	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.49A>G	19.37:g.53761677A>G	ENSP00000351244:p.Ile17Val	79	0		120	28	NM_173856	0	0	5	5	0	A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	37	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	-	1.760	-0.486927	0.04352	0.0	1.58E-4	ENSG00000196131	ENST00000341702	T	0.09723	2.95	.	.	.	.	.	.	.	.	T	0.05318	0.0141	N	0.08118	0	0.09310	N	1	B	0.17465	0.022	B	0.20767	0.031	T	0.38415	-0.9662	7	0.87932	D	0	.	.	.	.	.	17	Q8NFZ6	VN1R2_HUMAN	V	17	ENSP00000351244:I17V	ENSP00000351244:I17V	I	+	1	0	VN1R2	58453489	0.100000	0.21855	0.344000	0.25628	0.345000	0.29048	0.164000	0.16542	0.103000	0.17682	0.102000	0.15555	ATC	.		0.527	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
FIZ1	84922	hgsc.bcm.edu	37	19	56104152	56104152	+	Silent	SNP	G	G	A	rs114339119	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:56104152G>A	ENST00000221665.3	-	3	1244	c.1155C>T	c.(1153-1155)ggC>ggT	p.G385G		NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	385					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CCTCCTCCCCGCCGCCCTCAC	0.756													G|||	61	0.0121805	0.0446	0.0029	5008	,	,		6422	0.0		0.0	False		,,,				2504	0.0				p.G385G		.											.	FIZ1-90	0			c.C1155T						.	G		81,2749		1,79,1335	7.0	11.0	9.0		1155	0.6	0.2	19	dbSNP_132	9	2,6350		0,2,3174	no	coding-synonymous	FIZ1	NM_032836.2		1,81,4509	AA,AG,GG		0.0315,2.8622,0.9039		385/497	56104152	83,9099	1415	3176	4591	SO:0001819	synonymous_variant	84922	exon3			CTCCCCGCCGCCC	AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.1155C>T	19.37:g.56104152G>A		0	0		33	17	NM_032836	1	0	7	18	10	A2RU72|Q6ZMJ7	Silent	SNP	ENST00000221665.3	37	CCDS12928.1																																																																																			G|0.984;A|0.016		0.756	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453350.1	NM_032836	
ZNF787	126208	hgsc.bcm.edu	37	19	56599405	56599405	+	Missense_Mutation	SNP	C	C	G	rs4077285	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:56599405C>G	ENST00000270459.3	-	3	1254	c.1136G>C	c.(1135-1137)gGt>gCt	p.G379A		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	379				G -> A (in Ref. 1; AAB58413 and 3; AAH77728). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCTCCCCACCGCGGCACTC	0.766													g|||	3398	0.678514	0.3086	0.6254	5008	,	,		3042	0.7113		0.8996	False		,,,				2504	0.955				p.G379A		.											.	ZNF787-69	0			c.G1136C						.						3.0	3.0	3.0					19																	56599405		1007	2375	3382	SO:0001583	missense	126208	exon3			TCCCCACCGCGGC	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1136G>C	19.37:g.56599405C>G	ENSP00000270459:p.Gly379Ala	0	0		4	4	NM_001002836	0	0	0	3	3	O00455	Missense_Mutation	SNP	ENST00000270459.3	37	CCDS42634.1	1464	0.6703296703296703	162	0.32926829268292684	248	0.6850828729281768	389	0.6800699300699301	665	0.8773087071240105	g	1.843	-0.466969	0.04476	.	.	ENSG00000142409	ENST00000270459	T	0.08102	3.13	2.52	0.135	0.14775	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.58432	P	4.000000000004E-6	.	.	.	.	.	.	T	0.04191	-1.0970	6	0.66056	D	0.02	.	10.1479	0.42776	0.0:0.61:0.39:0.0	rs4077285	.	.	.	A	379	ENSP00000270459:G379A	ENSP00000270459:G379A	G	-	2	0	ZNF787	61291217	0.000000	0.05858	0.094000	0.20943	0.122000	0.20287	-0.261000	0.08694	-0.140000	0.11394	-1.512000	0.00943	GGT	C|0.668;G|0.332		0.766	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	2	2		23	20	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF444	55311	hgsc.bcm.edu	37	19	56671359	56671359	+	Missense_Mutation	SNP	C	C	G	rs145075834	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:56671359C>G	ENST00000337080.3	+	5	1140	c.773C>G	c.(772-774)aCc>aGc	p.T258S	ZNF444_ENST00000592949.1_Missense_Mutation_p.T257S	NM_001253792.1|NM_018337.3	NP_001240721.1|NP_060807.2	Q8N0Y2	ZN444_HUMAN	zinc finger protein 444	258					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(1)|lung(5)	7		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0531)		TGTGGCAAGACCTTCTACTGG	0.746													C|||	62	0.0123802	0.0461	0.0014	5008	,	,		9131	0.0		0.0	False		,,,				2504	0.0				p.T258S		.											.	ZNF444-90	0			c.C773G						.	C	SER/THR	95,3577		0,95,1741	3.0	2.0	3.0		773	3.4	1.0	19	dbSNP_134	3	0,7290		0,0,3645	yes	missense	ZNF444	NM_018337.2	58	0,95,5386	GG,GC,CC		0.0,2.5871,0.8666	probably-damaging	258/328	56671359	95,10867	1836	3645	5481	SO:0001583	missense	55311	exon5			GCAAGACCTTCTA	AB052954	CCDS12939.1, CCDS59426.1	19q13.43	2013-01-09			ENSG00000167685	ENSG00000167685		"""-"", ""Zinc fingers, C2H2-type"""	16052	protein-coding gene	gene with protein product		607874				11978792, 19760602	Standard	NM_001253792		Approved	ZSCAN17, FLJ11137, EZF2	uc002qmm.3	Q8N0Y2		ENST00000337080.3:c.773C>G	19.37:g.56671359C>G	ENSP00000338860:p.Thr258Ser	6	0		41	9	NM_018337	0	0	4	8	4	Q8TEQ9|Q8WU35|Q9NUU1	Missense_Mutation	SNP	ENST00000337080.3	37	CCDS12939.1	29	0.013278388278388278	28	0.056910569105691054	1	0.0027624309392265192	0	0.0	0	0.0	C	13.37	2.215791	0.39102	0.025871	0.0	ENSG00000167685	ENST00000337080	T	0.27402	1.67	3.43	3.43	0.39272	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.203463	0.24681	N	0.036467	T	0.01454	0.0047	N	0.01473	-0.845	0.24823	N	0.992574	B;P	0.48089	0.106;0.905	B;P	0.47118	0.047;0.538	T	0.07986	-1.0744	10	0.21540	T	0.41	.	12.7548	0.57328	0.0:1.0:0.0:0.0	.	257;258	Q8N0Y2-2;Q8N0Y2	.;ZN444_HUMAN	S	258	ENSP00000338860:T258S	ENSP00000338860:T258S	T	+	2	0	ZNF444	61363171	0.072000	0.21174	1.000000	0.80357	0.965000	0.64279	0.403000	0.20982	1.938000	0.56188	0.455000	0.32223	ACC	C|0.987;G|0.013		0.746	ZNF444-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457503.1	NM_018337	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000337415.3_Missense_Mutation_p.S398T|TPO_ENST00000382198.1_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	0	0		16	16	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
TRAPPC12	51112	hgsc.bcm.edu	37	2	3391826	3391826	+	Silent	SNP	C	C	T	rs11127423	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:3391826C>T	ENST00000324266.5	+	2	627	c.432C>T	c.(430-432)gcC>gcT	p.A144A	TRAPPC12_ENST00000382110.2_Silent_p.A144A	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	144					vesicle-mediated transport (GO:0016192)												GCAGCGAAGCCGCGCGCCCGG	0.781													C|||	1528	0.305112	0.2352	0.1628	5008	,	,		6707	0.4048		0.2435	False		,,,				2504	0.4611				p.A144A		.											.	.	0			c.C432T						.						2.0	2.0	2.0					2																	3391826		1308	2977	4285	SO:0001819	synonymous_variant	51112	exon2			CGAAGCCGCGCGC	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.432C>T	2.37:g.3391826C>T		0	0		10	10	NM_016030	0	0	0	13	13	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Silent	SNP	ENST00000324266.5	37	CCDS1652.1																																																																																			C|0.719;T|0.281		0.781	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206693.2	NM_016030	
APOB	338	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	21224859	21224859	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:21224859delT	ENST00000233242.1	-	29	13562	c.13435delA	c.(13435-13437)agcfs	p.S4479fs	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4479					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGGCCTGGCTTTTAATTATT	0.378																																					p.S4479fs		.											.	APOB-175	0			c.13435delA						.						83.0	88.0	86.0					2																	21224859		2202	4299	6501	SO:0001589	frameshift_variant	338	exon29			CCTGGCTTTTAAT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.13435delA	2.37:g.21224859delT	ENSP00000233242:p.Ser4479fs	62	0		53	19	NM_000384	0	0	0	0	0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Del	DEL	ENST00000233242.1	37	CCDS1703.1																																																																																			.		0.378	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ITSN2	50618	hgsc.bcm.edu;bcgsc.ca	37	2	24522816	24522816	+	Silent	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:24522816G>T	ENST00000355123.4	-	12	1749	c.1306C>A	c.(1306-1308)Cga>Aga	p.R436R	ITSN2_ENST00000406921.3_Silent_p.R436R|ITSN2_ENST00000361999.3_Silent_p.R436R	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	436					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTTCCTCTCGTTGTCTCTCC	0.328																																					p.R436R		.											.	ITSN2-539	0			c.C1306A						.						172.0	156.0	161.0					2																	24522816		2203	4300	6503	SO:0001819	synonymous_variant	50618	exon12			CCTCTCGTTGTCT	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1306C>A	2.37:g.24522816G>T		65	0		68	4	NM_147152	0	0	3	3	0	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	ENST00000355123.4	37	CCDS1710.2																																																																																			.		0.328	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
CLIP4	79745	bcgsc.ca	37	2	29356669	29356669	+	Silent	SNP	A	A	G	rs3100232	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:29356669A>G	ENST00000320081.5	+	5	771	c.516A>G	c.(514-516)acA>acG	p.T172T	CLIP4_ENST00000404424.1_Silent_p.T172T|CLIP4_ENST00000401617.2_Silent_p.T65T|CLIP4_ENST00000401605.1_Silent_p.T172T	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	172										endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					TTTTGAAAACATCGAAACCAA	0.333													A|||	2079	0.415136	0.6747	0.317	5008	,	,		17714	0.3204		0.4006	False		,,,				2504	0.2464				p.T172T		.											.	CLIP4-91	0			c.A516G						.	A		2675,1731	649.3+/-398.9	829,1017,357	101.0	97.0	98.0		516	-2.0	1.0	2	dbSNP_103	98	3414,5186	503.0+/-375.8	688,2038,1574	no	coding-synonymous	CLIP4	NM_024692.4		1517,3055,1931	GG,GA,AA		39.6977,39.2873,46.8169		172/706	29356669	6089,6917	2203	4300	6503	SO:0001819	synonymous_variant	79745	exon5			GAAAACATCGAAA	AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.516A>G	2.37:g.29356669A>G		85	1		66	5	NM_024692	0	0	0	0	0	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Silent	SNP	ENST00000320081.5	37	CCDS1770.1																																																																																			A|0.551;G|0.449		0.333	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215123.2	NM_024692	
FAM98A	25940	bcgsc.ca	37	2	33810648	33810648	+	Silent	SNP	T	T	C	rs371527406		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:33810648T>C	ENST00000238823.8	-	7	977	c.837A>G	c.(835-837)ttA>ttG	p.L279L	FAM98A_ENST00000403368.1_Silent_p.L279L|FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000441530.2_Silent_p.L84L			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	280							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					TGCTTGTCCTTAAAATCTTTG	0.398																																					p.L279L		.											.	FAM98A-91	0			c.A837G						.	T		2,4404	4.2+/-10.8	0,2,2201	65.0	67.0	67.0		837	2.9	1.0	2		67	0,8600		0,0,4300	no	coding-synonymous	FAM98A	NM_015475.3		0,2,6501	CC,CT,TT		0.0,0.0454,0.0154		279/519	33810648	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	25940	exon7			TGTCCTTAAAATC		CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.837A>G	2.37:g.33810648T>C		114	0		90	4	NM_015475	0	0	15	15	0	B2RNA2|Q9Y3Y6	Silent	SNP	ENST00000238823.8	37	CCDS33179.1																																																																																			.		0.398	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325457.2	NM_015475	
DYNC2LI1	51626	broad.mit.edu	37	2	44021826	44021826	+	Intron	SNP	T	T	A	rs9309107	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:44021826T>A	ENST00000260605.8	+	6	607				DYNC2LI1_ENST00000489222.2_Intron|DYNC2LI1_ENST00000443170.3_Intron|DYNC2LI1_ENST00000398823.2_3'UTR|DYNC2LI1_ENST00000605786.1_Intron|DYNC2LI1_ENST00000406852.3_Missense_Mutation_p.F184Y	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TTAGTCCCATTTATAGTTAAT	0.343													A|||	2262	0.451677	0.7262	0.4654	5008	,	,		18661	0.1895		0.326	False		,,,				2504	0.4703				p.F184Y		.											.	DYNC2LI1-91	0			c.T551A						.	A	,TYR/PHE,	2915,1491	456.1+/-351.2	990,935,278	92.0	99.0	96.0		,551,	0.9	0.0	2	dbSNP_119	96	2828,5772	675.0+/-403.2	471,1886,1943	yes	intron,missense,intron	DYNC2LI1	NM_001193464.1,NM_015522.3,NM_016008.3	,22,	1461,2821,2221	AA,AT,TT		32.8837,33.8402,44.1565	,,	,184/202,	44021826	5743,7263	2203	4300	6503	SO:0001627	intron_variant	51626	exon6			TCCCATTTATAGT		CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.507+44T>A	2.37:g.44021826T>A		131	0		117	4	NM_015522	0	0	9	9	0	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Missense_Mutation	SNP	ENST00000260605.8	37	CCDS1813.1	884	0.40476190476190477	361	0.733739837398374	172	0.47513812154696133	108	0.1888111888111888	243	0.32058047493403696	A	4.001	-0.002468	0.07819	0.661598	0.328837	ENSG00000138036	ENST00000406852	T	0.32023	1.47	4.45	0.913	0.19354	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22591	-1.0212	7	0.87932	D	0	.	5.1073	0.14790	0.6522:0.0:0.2213:0.1265	rs9309107;rs52802708;rs59663186;rs9309107	184	Q8TCX1-4	.	Y	184	ENSP00000385738:F184Y	ENSP00000385738:F184Y	F	+	2	0	DYNC2LI1	43875330	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.411000	0.21115	0.048000	0.15891	-1.185000	0.01705	TTT	A|0.389;N|0.001		0.343	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000250536.2	NM_016008	
DNAH6	1768	broad.mit.edu	37	2	84954849	84954849	+	Silent	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:84954849G>T	ENST00000237449.6	+	60	10037	c.10029G>T	c.(10027-10029)ctG>ctT	p.L3343L	DNAH6_ENST00000389394.3_Silent_p.L3343L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	3343					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AACAGCGCCTGGACGTACTAC	0.368																																					p.L3343L		.											.	DNAH6-69	0			c.G10029T						.						174.0	143.0	153.0					2																	84954849		692	1591	2283	SO:0001819	synonymous_variant	1768	exon61			GCGCCTGGACGTA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.10029G>T	2.37:g.84954849G>T		156	0		118	3	NM_001370	0	0	0	0	0	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	37	CCDS46348.1																																																																																			.		0.368	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
LONRF2	164832	hgsc.bcm.edu	37	2	100938481	100938481	+	Missense_Mutation	SNP	C	C	G	rs74177696	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:100938481C>G	ENST00000393437.3	-	1	714	c.75G>C	c.(73-75)caG>caC	p.Q25H		NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	25							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						CCTCTAAGCGCTGGGCGATCG	0.756													c|||	1977	0.394768	0.1225	0.4597	5008	,	,		5596	0.7212		0.4861	False		,,,				2504	0.2863				p.Q25H		.											.	LONRF2-154	0			c.G75C						.						3.0	3.0	3.0					2																	100938481		905	2065	2970	SO:0001583	missense	164832	exon1			TAAGCGCTGGGCG	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.75G>C	2.37:g.100938481C>G	ENSP00000377086:p.Gln25His	0	0		7	7	NM_198461	0	0	0	2	2	B9A006|Q6ZSR4	Missense_Mutation	SNP	ENST00000393437.3	37	CCDS2046.2	1003	0.4592490842490842	60	0.12195121951219512	161	0.4447513812154696	415	0.7255244755244755	367	0.4841688654353562	C	9.334	1.061304	0.19987	.	.	ENSG00000170500	ENST00000393437	D	0.83837	-1.77	2.7	1.8	0.24995	.	0.253832	0.22536	U	0.058792	T	0.00012	0.0000	N	0.22421	0.69	0.54753	P	1.2000000000012001E-5	P	0.39964	0.697	B	0.32465	0.146	T	0.46830	-0.9163	9	0.46703	T	0.11	.	7.0577	0.25109	0.197:0.6118:0.1912:0.0	.	25	Q1L5Z9	LONF2_HUMAN	H	25	ENSP00000377086:Q25H	ENSP00000377086:Q25H	Q	-	3	2	LONRF2	100304913	0.256000	0.24012	0.001000	0.08648	0.015000	0.08874	-0.229000	0.09098	0.466000	0.27193	-1.098000	0.02139	CAG	C|0.540;G|0.460		0.756	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253161.2	NM_198461	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000397712.2_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		0	0		14	14	NM_023016	0	0	0	1	1	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
INHBB	3625	hgsc.bcm.edu	37	2	121104111	121104111	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:121104111G>A	ENST00000295228.3	+	1	393	c.347G>A	c.(346-348)cGc>cAc	p.R116H		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	116					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				GGCAAGGTGCGCGAGGACGGC	0.711																																					p.R116H		.											.	INHBB-93	0			c.G347A						.						7.0	7.0	7.0					2																	121104111		2032	4022	6054	SO:0001583	missense	3625	exon1			AGGTGCGCGAGGA		CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.347G>A	2.37:g.121104111G>A	ENSP00000295228:p.Arg116His	1	0		23	13	NM_002193	0	0	11	11	0	Q53T31|Q8N1D3	Missense_Mutation	SNP	ENST00000295228.3	37	CCDS2132.1	.	.	.	.	.	.	.	.	.	.	g	18.06	3.540179	0.65085	.	.	ENSG00000163083	ENST00000295228	T	0.65549	-0.16	3.44	3.44	0.39384	Transforming growth factor-beta, N-terminal (1);	0.000000	0.50627	U	0.000104	T	0.71022	0.3291	M	0.67953	2.075	0.36822	D	0.886451	D	0.59357	0.985	P	0.56788	0.806	T	0.77138	-0.2698	10	0.41790	T	0.15	-6.7567	13.8095	0.63253	0.0:0.0:1.0:0.0	.	116	P09529	INHBB_HUMAN	H	116	ENSP00000295228:R116H	ENSP00000295228:R116H	R	+	2	0	INHBB	120820581	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	4.993000	0.63895	1.729000	0.51567	0.176000	0.17051	CGC	.		0.711	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254234.1		
NRP2	8828	hgsc.bcm.edu	37	2	206641241	206641245	+	Frame_Shift_Del	DEL	GCACT	GCACT	-	rs144037623|rs144430402|rs139894618|rs527478913|rs200483574	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	GCACT	GCACT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:206641241_206641245delGCACT	ENST00000357118.4	+	16	2728_2732	c.2697_2701delGCACT	c.(2695-2703)tcgcactgcfs	p.HC900fs	NRP2_ENST00000360409.3_Intron|NRP2_ENST00000412873.2_Intron|NRP2_ENST00000357785.5_Intron|NRP2_ENST00000272849.3_Frame_Shift_Del_p.HC905fs|NRP2_ENST00000540841.1_Intron|NRP2_ENST00000540178.1_Intron	NM_201267.1	NP_957719	Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						ACCGTGGCTCGCACTGCTGAGGGCC	0.532											OREG0015157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.904_906del		.											.	NRP2-93	0			c.2712_2716del						.																																			SO:0001589	frameshift_variant	8828	exon16			TGGCTCGCACTGC	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357118.4:c.2697_2701delGCACT	2.37:g.206641241_206641245delGCACT	ENSP00000349632:p.His900fs	18	0	2161	27	0	NM_018534	0	0	0	0	0	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Frame_Shift_Del	DEL	ENST00000357118.4	37	CCDS46498.1																																																																																			.		0.532	NRP2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336465.1		
ABCA12	26154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	215914356	215914356	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:215914356G>C	ENST00000272895.7	-	6	906	c.687C>G	c.(685-687)ttC>ttG	p.F229L		NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	229					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCACCTGGGAGAACTGTTTGT	0.388																																					p.F229L	Ovarian(66;664 1488 5121 34295)	.											.	ABCA12-99	0			c.C687G						.						77.0	75.0	76.0					2																	215914356		2203	4300	6503	SO:0001583	missense	26154	exon6			CTGGGAGAACTGT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.687C>G	2.37:g.215914356G>C	ENSP00000272895:p.Phe229Leu	127	0		78	29	NM_173076	0	0	0	0	0	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	5.670	0.308171	0.10733	.	.	ENSG00000144452	ENST00000272895	D	0.84442	-1.85	5.75	2.9	0.33743	.	0.686361	0.14356	N	0.324753	T	0.65069	0.2656	N	0.04508	-0.205	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.54344	-0.8308	10	0.22706	T	0.39	.	5.8765	0.18832	0.1626:0.3022:0.5352:0.0	.	229	Q86UK0	ABCAC_HUMAN	L	229	ENSP00000272895:F229L	ENSP00000272895:F229L	F	-	3	2	ABCA12	215622601	0.998000	0.40836	0.981000	0.43875	0.858000	0.48976	0.588000	0.23924	0.857000	0.35407	0.655000	0.94253	TTC	.		0.388	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
SP110	3431	bcgsc.ca	37	2	231042276	231042276	+	Missense_Mutation	SNP	A	A	G	rs1135791	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:231042276A>G	ENST00000358662.4	-	14	1646	c.1568T>C	c.(1567-1569)aTg>aCg	p.M523T	SP110_ENST00000392048.3_Missense_Mutation_p.M521T|SP110_ENST00000258382.5_Missense_Mutation_p.M523T|SP110_ENST00000338556.3_Missense_Mutation_p.M225T|SP110_ENST00000258381.6_Missense_Mutation_p.M523T|SP110_ENST00000540870.1_Missense_Mutation_p.M529T	NM_004509.3	NP_004500	Q9HB58	SP110_HUMAN	SP110 nuclear body protein	523	SAND. {ECO:0000255|PROSITE- ProRule:PRU00185}.		M -> T (in dbSNP:rs1135791). {ECO:0000269|PubMed:10913195, ECO:0000269|PubMed:16803959}.		regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(4)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)		TCCTAGGGTCATTCCTTCACA	0.423													G|||	1627	0.32488	0.208	0.3545	5008	,	,		20126	0.1677		0.496	False		,,,				2504	0.4479				p.M529T		.											.	SP110-155	0			c.T1586C						.	G	THR/MET,THR/MET,THR/MET,THR/MET	1124,3282	717.8+/-408.8	128,868,1207	370.0	347.0	355.0		1586,1568,1568,1568	-0.8	0.0	2	dbSNP_86	355	4306,4294	577.4+/-390.5	1110,2086,1104	yes	missense,missense,missense,missense	SP110	NM_001185015.1,NM_004509.3,NM_004510.3,NM_080424.2	81,81,81,81	1238,2954,2311	GG,GA,AA		49.9302,25.5107,41.75	benign,benign,benign,benign	529/556,523/690,523/550,523/714	231042276	5430,7576	2203	4300	6503	SO:0001583	missense	3431	exon15			AGGGTCATTCCTT	L22343	CCDS2474.1, CCDS2475.1, CCDS2476.1, CCDS54435.1	2q37.1	2014-09-17	2001-12-19	2001-12-20	ENSG00000135899	ENSG00000135899			5401	protein-coding gene	gene with protein product		604457	"""interferon-induced protein 41, 30kD"""	IFI41, IFI75		7693701, 10388521	Standard	NM_080424		Approved		uc002vqg.3	Q9HB58	OTTHUMG00000133204	ENST00000358662.4:c.1568T>C	2.37:g.231042276A>G	ENSP00000351488:p.Met523Thr	168	1		142	5	NM_001185015	0	0	10	10	0	B4DVI4|F5H1M1|Q14976|Q14977|Q53TG2|Q8WUZ6|Q9HCT8	Missense_Mutation	SNP	ENST00000358662.4	37	CCDS2474.1	738	0.33791208791208793	120	0.24390243902439024	146	0.40331491712707185	97	0.16958041958041958	375	0.4947229551451187	G	3.063	-0.192867	0.06259	0.255107	0.500698	ENSG00000135899	ENST00000258381;ENST00000358662;ENST00000392048;ENST00000258382;ENST00000540870;ENST00000338556	T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46	4.61	-0.782	0.10961	SAND domain-like (2);SAND domain (3);	0.977573	0.08310	N	0.965581	T	0.00012	0.0000	N	0.02247	-0.625	0.80722	P	0.0	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.41928	-0.9481	9	0.21014	T	0.42	.	0.2939	0.00262	0.2799:0.1726:0.15:0.3975	rs1135791;rs1804027;rs3198703;rs11556889;rs17327944;rs59171471;rs1135791	521;225;529;523;523	G5E9C0;E7ER70;F5H1M1;Q9HB58;Q9HB58-6	.;.;.;SP110_HUMAN;.	T	523;523;521;523;529;225	ENSP00000258381:M523T;ENSP00000351488:M523T;ENSP00000375902:M521T;ENSP00000258382:M523T;ENSP00000439558:M529T;ENSP00000344049:M225T	ENSP00000258381:M523T	M	-	2	0	SP110	230750520	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.527000	0.06200	-0.498000	0.06632	-1.974000	0.00461	ATG	A|0.640;G|0.360		0.423	SP110-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000332414.1	NM_080424	
RBM44	375316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	238729832	238729832	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr2:238729832G>A	ENST00000409864.1	+	6	2289	c.2035G>A	c.(2035-2037)Gaa>Aaa	p.E679K	RBM44_ENST00000316997.4_Missense_Mutation_p.E679K			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	678						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		CATACCACTGGAAGAGCTGCC	0.353																																					p.E679K		.											.	RBM44-26	0			c.G2035A						.						45.0	44.0	44.0					2																	238729832		1833	4091	5924	SO:0001583	missense	375316	exon6			CCACTGGAAGAGC	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.2035G>A	2.37:g.238729832G>A	ENSP00000386727:p.Glu679Lys	80	0		82	37	NM_001080504	0	0	0	0	0	A0AUW3	Missense_Mutation	SNP	ENST00000409864.1	37	CCDS46554.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933762	0.73442	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.26518	1.73;1.73	5.84	4.95	0.65309	.	.	.	.	.	T	0.43612	0.1255	M	0.72479	2.2	0.26182	N	0.979712	D	0.67145	0.996	P	0.60609	0.877	T	0.37911	-0.9685	9	0.72032	D	0.01	-19.9818	7.6322	0.28247	0.0821:0.0:0.753:0.1649	.	678	Q6ZP01	RBM44_HUMAN	K	679	ENSP00000321179:E679K;ENSP00000386727:E679K	ENSP00000321179:E679K	E	+	1	0	RBM44	238394571	1.000000	0.71417	0.994000	0.49952	0.978000	0.69477	3.640000	0.54350	1.436000	0.47453	0.591000	0.81541	GAA	.		0.353	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504	
ZCCHC3	85364	hgsc.bcm.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	CGG	-	rs11468351|rs5839847|rs6147263	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	CGG	CGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr20:278688_278690delCGG	ENST00000382352.3	+	1	952_954	c.461_463delCGG	c.(460-465)ccggcg>ccg	p.A159del		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	159	Poly-Ala.						poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A159delA(3)		endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.768														4335	0.865615	0.8343	0.9395	5008	,	,		8937	0.8065		0.9423	False		,,,				2504	0.8374				p.154_155del		.											.	ZCCHC3-90	3	Deletion - In frame(3)	prostate(2)|large_intestine(1)	c.461_463del						.																																			SO:0001651	inframe_deletion	85364	exon1			ATGAGCCGGCGGC	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.461_463delCGG	20.37:g.278697_278699delCGG	ENSP00000371789:p.Ala159del	1	1		15	15	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	In_Frame_Del	DEL	ENST00000382352.3	37	CCDS42844.1																																																																																			.		0.768	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
LZTS3	9762	hgsc.bcm.edu	37	20	3147706	3147706	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr20:3147706A>G	ENST00000329152.3	-	1	1501	c.104T>C	c.(103-105)cTg>cCg	p.L35P	LZTS3_ENST00000337576.5_Missense_Mutation_p.L35P|LZTS3_ENST00000360342.3_Missense_Mutation_p.L35P			O60299	LZTS3_HUMAN		35						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)											GCCCATGGCCAGGCGGGGGTC	0.711																																					p.L35P		.											.	.	0			c.T104C						.						6.0	7.0	7.0					20																	3147706		2073	4149	6222	SO:0001583	missense	0	exon1			ATGGCCAGGCGGG																												ENST00000329152.3:c.104T>C	20.37:g.3147706A>G	ENSP00000332123:p.Leu35Pro	1	0		36	10	NM_014731	0	0	4	6	2	A2A2Q7|D3DVX6|Q8IXX8	Missense_Mutation	SNP	ENST00000329152.3	37	CCDS13049.1	.	.	.	.	.	.	.	.	.	.	A	16.77	3.214612	0.58452	.	.	ENSG00000088899	ENST00000329152;ENST00000360342;ENST00000337576	T;T;T	0.32753	1.46;1.44;1.44	4.98	3.89	0.44902	.	0.388928	0.18575	N	0.137218	T	0.11922	0.0290	N	0.08118	0	0.49483	D	0.999793	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.001	T	0.20773	-1.0265	10	0.24483	T	0.36	-13.6751	1.1106	0.01704	0.3983:0.3007:0.1516:0.1495	.	35;35	O60299-2;O60299	.;PRIP1_HUMAN	P	35	ENSP00000332123:L35P;ENSP00000353496:L35P;ENSP00000338166:L35P	ENSP00000332123:L35P	L	-	2	0	RP5-1187M17.10	3095706	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	1.925000	0.40074	1.871000	0.54225	0.459000	0.35465	CTG	.		0.711	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077715.2		
FAM182B	728882	broad.mit.edu	37	20	25755510	25755510	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr20:25755510C>T	ENST00000376403.1	-	3	824	c.446G>A	c.(445-447)cGc>cAc	p.R149H	FAM182B_ENST00000376404.2_Intron|FAM182B_ENST00000478164.1_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	149										lung(1)	1						CCTTCCATCGCGGCCACCATG	0.706																																					.		.											.	.	0			.						.																																			SO:0001583	missense	728882	.			CCATCGCGGCCAC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.446G>A	20.37:g.25755510C>T	ENSP00000365585:p.Arg149His	48	0		129	6	.	0	0	2	2	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	2.423	-0.332565	0.05314	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.18425	0.0442	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.30822	-0.9965	3	0.15066	T	0.55	.	.	.	.	.	.	.	.	H	149	.	ENSP00000365585:R149H	R	-	2	0	FAM182B	25703510	0.001000	0.12720	0.047000	0.18901	0.048000	0.14542	-1.599000	0.02085	0.064000	0.16427	0.064000	0.15345	CGC	.		0.706	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
DNMT3B	1789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	31372582	31372582	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr20:31372582G>T	ENST00000328111.2	+	4	544	c.223G>T	c.(223-225)Gac>Tac	p.D75Y	DNMT3B_ENST00000348286.2_Missense_Mutation_p.D75Y|DNMT3B_ENST00000353855.2_Missense_Mutation_p.D75Y|DNMT3B_ENST00000456297.2_Intron|DNMT3B_ENST00000443239.3_Missense_Mutation_p.D75Y|DNMT3B_ENST00000201963.3_Missense_Mutation_p.D87Y|DNMT3B_ENST00000375623.4_Missense_Mutation_p.D75Y|DNMT3B_ENST00000344505.4_Missense_Mutation_p.D75Y	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	75	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGGCGATGGCGACGGGGAAGA	0.507																																					p.D87Y		.											.	DNMT3B-660	0			c.G259T						.						79.0	67.0	71.0					20																	31372582		2203	4300	6503	SO:0001583	missense	1789	exon4			GATGGCGACGGGG		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.223G>T	20.37:g.31372582G>T	ENSP00000328547:p.Asp75Tyr	123	0		128	36	NM_175850	0	0	0	0	0	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	37	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.371104	0.61624	.	.	ENSG00000088305	ENST00000328111;ENST00000537219;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000344505;ENST00000375623;ENST00000201963	D;D;D;D;D;T;D	0.97888	-4.57;-4.58;-4.55;-4.48;-4.42;-0.38;-4.59	4.32	3.38	0.38709	.	0.058805	0.64402	D	0.000002	D	0.96371	0.8816	N	0.24115	0.695	0.31155	N	0.705002	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.997;0.998	D;D;D;D;D	0.78314	0.938;0.934;0.991;0.934;0.93	D	0.93268	0.6649	10	0.25751	T	0.34	-17.7884	8.1897	0.31361	0.1069:0.0:0.8931:0.0	.	75;87;75;75;75	E7EN63;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;DNM3B_HUMAN	Y	75;161;75;75;75;75;75;87	ENSP00000328547:D75Y;ENSP00000313397:D75Y;ENSP00000337764:D75Y;ENSP00000403169:D75Y;ENSP00000345105:D75Y;ENSP00000364774:D75Y;ENSP00000201963:D87Y	ENSP00000201963:D87Y	D	+	1	0	DNMT3B	30836243	0.739000	0.28196	0.738000	0.30950	0.268000	0.26511	1.097000	0.30988	1.406000	0.46857	0.655000	0.94253	GAC	.		0.507	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
STK4	6789	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43623747	43623747	+	Missense_Mutation	SNP	G	G	A	rs202070040		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr20:43623747G>A	ENST00000372806.3	+	6	637	c.542G>A	c.(541-543)cGg>cAg	p.R181Q	STK4_ENST00000499879.2_Missense_Mutation_p.R126Q|STK4_ENST00000372801.1_Missense_Mutation_p.R181Q|STK4_ENST00000396731.4_Missense_Mutation_p.R181Q	NM_006282.2	NP_006273.1	Q13043	STK4_HUMAN	serine/threonine kinase 4	181	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|cell morphogenesis (GO:0000902)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|keratinocyte differentiation (GO:0030216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)	p.R181Q(2)		NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Myeloproliferative disorder(115;0.0122)				ATGGCCAAGCGGAATACAGTG	0.433													G|||	0	0.0	0.0	0.0	5008	,	,		16652	0.0		0.0	False		,,,				2504	0.0				p.R181Q	GBM(187;1039 2137 11798 21916 33213)	.											.	STK4-767	2	Substitution - Missense(2)	endometrium(2)	c.G542A						.						144.0	138.0	140.0					20																	43623747		2203	4300	6503	SO:0001583	missense	6789	exon6			CCAAGCGGAATAC		CCDS13341.1	20q11.2-q13.2	2014-09-17			ENSG00000101109	ENSG00000101109			11408	protein-coding gene	gene with protein product	"""mammalian sterile 20-like 1"", ""yeast Ste20-like"", ""kinase responsive to stress 2"""	604965				8816758, 9545236, 11517310	Standard	NM_006282		Approved	MST1, KRS2, YSK3	uc002xnb.3	Q13043	OTTHUMG00000033059	ENST00000372806.3:c.542G>A	20.37:g.43623747G>A	ENSP00000361892:p.Arg181Gln	149	0		169	56	NM_006282	0	0	0	3	3	B2RCR8|Q15802|Q4G156|Q5H982|Q6PD60|Q9BR32|Q9NTZ4	Missense_Mutation	SNP	ENST00000372806.3	37	CCDS13341.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	29.1	4.979888	0.92982	.	.	ENSG00000101109	ENST00000372806;ENST00000396731;ENST00000372801;ENST00000499879	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.9	5.9	0.94986	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.057390	0.64402	D	0.000003	T	0.76300	0.3968	L	0.48642	1.525	0.80722	D	1	D;D;D;D	0.89917	1.0;0.994;0.995;0.998	D;P;P;P	0.87578	0.998;0.779;0.815;0.859	T	0.76550	-0.2918	10	0.87932	D	0	.	20.2822	0.98520	0.0:0.0:1.0:0.0	.	126;181;181;181	F5H5B4;Q13043-2;A0PJ51;Q13043	.;.;.;STK4_HUMAN	Q	181;181;181;126	ENSP00000361892:R181Q;ENSP00000379957:R181Q;ENSP00000361887:R181Q;ENSP00000443514:R126Q	ENSP00000361887:R181Q	R	+	2	0	STK4	43057161	1.000000	0.71417	0.962000	0.40283	0.865000	0.49528	9.338000	0.96553	2.806000	0.96561	0.655000	0.94253	CGG	G|0.999;A|0.000		0.433	STK4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080401.4	NM_006282	
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000481847.1_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000243938.4_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		1	0		6	5	NM_052951	0	0	0	5	5	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
TMPRSS2	7113	hgsc.bcm.edu	37	21	42879909	42879909	+	5'UTR	SNP	C	C	A	rs75603675	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr21:42879909C>A	ENST00000458356.1	-	0	0				TMPRSS2_ENST00000398585.3_Missense_Mutation_p.G8V|TMPRSS2_ENST00000332149.5_Intron|TMPRSS2_ENST00000497881.1_Intron			O15393	TMPS2_HUMAN	transmembrane protease, serine 2						positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)		TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				CCCGCTTTCACCTCCGGGCGG	0.781			T	"""ERG, ETV1, ETV4, ETV5"""	prostate								C|||	1221	0.24381	0.295	0.2723	5008	,	,		8686	0.0169		0.4046	False		,,,				2504	0.2229				p.G8V		.		Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	.	TMPRSS2-5208	0			c.G23T						.						1.0	3.0	2.0					21																	42879909		366	1027	1393	SO:0001623	5_prime_UTR_variant	7113	exon1			CTTTCACCTCCGG	U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000458356.1:c.-89G>T	21.37:g.42879909C>A		0	0		5	5	NM_001135099	0	0	0	0	0	A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Missense_Mutation	SNP	ENST00000458356.1	37	CCDS33564.1	584	0.2673992673992674	163	0.3313008130081301	109	0.3011049723756906	6	0.01048951048951049	306	0.40369393139841686	C	7.435	0.639422	0.14386	.	.	ENSG00000184012	ENST00000398585	D	0.88975	-2.45	2.68	1.73	0.24493	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.32829	0.386	B	0.33620	0.167	T	0.11036	-1.0604	8	0.39692	T	0.17	.	7.8348	0.29363	0.0:0.7083:0.2917:0.0	.	8	F8WES1	.	V	8	ENSP00000381588:G8V	ENSP00000381588:G8V	G	-	2	0	TMPRSS2	41801779	0.006000	0.16342	0.001000	0.08648	0.121000	0.20230	0.965000	0.29319	0.624000	0.30286	0.313000	0.20887	GGT	C|0.732;A|0.268		0.781	TMPRSS2-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339862.1		
KRTAP10-4	386672	ucsc.edu	37	21	45993851	45993851	+	Silent	SNP	C	C	T	rs201895065		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr21:45993851C>T	ENST00000400374.3	+	1	246	c.216C>T	c.(214-216)tgC>tgT	p.C72C	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_5'Flank	NM_198687.1	NP_941960.1	P60372	KR104_HUMAN	keratin associated protein 10-4	72	36 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(1)	18						CAGTGACCTGCGAGCCCAGCC	0.721																																					p.C72C		.											.	KRTAP10-4-90	0			c.C216T						.						20.0	38.0	32.0					21																	45993851		1993	4191	6184	SO:0001819	synonymous_variant	386672	exon1			GACCTGCGAGCCC	AB076351	CCDS42957.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000215454	ENSG00000215454		"""Keratin associated proteins"""	20521	protein-coding gene	gene with protein product			"""keratin associated protein 18-4"""	KRTAP18-4			Standard	NM_198687		Approved	KRTAP18.4, KAP10.4	uc002zfk.1	P60372	OTTHUMG00000057641	ENST00000400374.3:c.216C>T	21.37:g.45993851C>T		43	5		107	37	NM_198687	0	0	0	0	0	Q08AS0	Silent	SNP	ENST00000400374.3	37	CCDS42957.1																																																																																			C|1.000;|0.000		0.721	KRTAP10-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128045.1	NM_198687	
IL17RA	23765	hgsc.bcm.edu	37	22	17590180	17590180	+	Missense_Mutation	SNP	G	G	A	rs41323645	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr22:17590180G>A	ENST00000319363.6	+	13	2204	c.2071G>A	c.(2071-2073)Gca>Aca	p.A691T		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	691					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TGACGGTGCCGCAGTCCGGCT	0.766													G|||	570	0.113818	0.2352	0.0778	5008	,	,		11920	0.0		0.1064	False		,,,				2504	0.1002				p.A691T		.											.	IL17RA-92	0			c.G2071A						.	G	THR/ALA	684,3102		61,562,1270	3.0	4.0	4.0		2071	3.6	0.0	22	dbSNP_127	4	730,6516		42,646,2935	no	missense	IL17RA	NM_014339.5	58	103,1208,4205	AA,AG,GG		10.0745,18.0666,12.8173	probably-damaging	691/867	17590180	1414,9618	1893	3623	5516	SO:0001583	missense	23765	exon13			GGTGCCGCAGTCC	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.2071G>A	22.37:g.17590180G>A	ENSP00000320936:p.Ala691Thr	0	0		11	10	NM_014339	0	0	0	5	5	O43844|Q20WK1	Missense_Mutation	SNP	ENST00000319363.6	37	CCDS13739.1	225	0.10302197802197802	106	0.21544715447154472	39	0.10773480662983426	0	0.0	80	0.10554089709762533	G	17.37	3.372199	0.61624	0.180666	0.100745	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.06687	3.27	4.6	3.56	0.40772	.	0.358898	0.24384	N	0.038991	T	0.00012	0.0000	M	0.70595	2.14	0.80722	P	0.0	D;D	0.89917	0.996;1.0	P;D	0.64506	0.715;0.926	T	0.14952	-1.0454	9	0.36615	T	0.2	-30.1852	7.7218	0.28736	0.099:0.223:0.678:0.0	rs41323645;rs58353000	639;691	D3YTB4;Q96F46	.;I17RA_HUMAN	T	639;691	ENSP00000320936:A691T	ENSP00000320936:A691T	A	+	1	0	IL17RA	15970180	0.004000	0.15560	0.046000	0.18839	0.001000	0.01503	1.290000	0.33319	2.261000	0.74972	0.561000	0.74099	GCA	G|0.897;A|0.103		0.766	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315820.1	NM_014339	
ZNF70	7621	bcgsc.ca	37	22	24086107	24086107	+	Silent	SNP	A	A	G	rs5759985	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr22:24086107A>G	ENST00000341976.3	-	2	1681	c.1221T>C	c.(1219-1221)atT>atC	p.I407I		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	407					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						TATAGTGCTCAATGAGGGCTG	0.582													g|||	2787	0.55651	0.7927	0.4006	5008	,	,		18529	0.6865		0.3579	False		,,,				2504	0.4182				p.I407I		.											.	ZNF70-92	0			c.T1221C						.	G		3262,1144	405.8+/-333.6	1225,812,166	124.0	119.0	121.0		1221	-5.1	0.4	22	dbSNP_114	121	3116,5484	658.5+/-401.6	596,1924,1780	no	coding-synonymous	ZNF70	NM_021916.2		1821,2736,1946	GG,GA,AA		36.2326,25.9646,49.0389		407/447	24086107	6378,6628	2203	4300	6503	SO:0001819	synonymous_variant	7621	exon2			GTGCTCAATGAGG	X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.1221T>C	22.37:g.24086107A>G		137	2		86	5	NM_021916	0	0	1	1	0		Silent	SNP	ENST00000341976.3	37	CCDS13812.1																																																																																			A|0.481;G|0.519		0.582	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319881.1	NM_021916	
GSTT2	2953	bcgsc.ca	37	22	24323227	24323227	+	Splice_Site	SNP	G	G	A	rs76498342	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr22:24323227G>A	ENST00000215780.5	+	2	250		c.e2+1		DDT_ENST00000404092.1_5'Flank|DDT_ENST00000350608.3_5'Flank|GSTT2_ENST00000402588.3_Splice_Site	NM_000854.3	NP_000845.1	P0CG29	GST2_HUMAN	glutathione S-transferase theta 2							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			lung(1)	1						TGACCGAAAGGTGCCCTCCTT	0.617																																					.		.											.	GSTT2-68	0			c.200+1G>A						.	G		349,4057		1,347,1855	439.0	350.0	380.0			3.1	1.0	22	dbSNP_131	380	1220,7376		7,1206,3085	no	splice-5	GSTT2	NM_000854.3		8,1553,4940	AA,AG,GG		14.1926,7.921,12.0674			24323227	1569,11433	2203	4298	6501	SO:0001630	splice_region_variant	2953	exon2			CGAAAGGTGCCCT	L38503		22q11.23	2012-06-21			ENSG00000099984	ENSG00000099984	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4642	protein-coding gene	gene with protein product		600437				7789971, 9729470	Standard	NM_000854		Approved		uc002zyw.4	P0CG29	OTTHUMG00000150786	ENST00000215780.5:c.200+1G>A	22.37:g.24323227G>A		603	3		267	10	NM_000854	0	0	0	0	0	O60665|P30712|Q6IPV7|Q9HD76	Splice_Site	SNP	ENST00000215780.5	37	CCDS13821.1	367	0.16804029304029305	37	0.07520325203252033	50	0.13812154696132597	170	0.2972027972027972	110	0.14511873350923482	.	13.58	2.279780	0.40294	0.07921	0.141926	ENSG00000099984	ENST00000215780;ENST00000402588	.	.	.	3.11	3.11	0.35812	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.9816	0.41817	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GSTT2	22653227	1.000000	0.71417	0.966000	0.40874	0.223000	0.24884	3.348000	0.52209	1.807000	0.52817	0.591000	0.81541	.	G|0.847;A|0.153		0.617	GSTT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320080.1	NM_000854	Intron
RTCB	51493	bcgsc.ca	37	22	32795641	32795641	+	Silent	SNP	C	C	T	rs5749426	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr22:32795641C>T	ENST00000216038.5	-	6	701	c.603G>A	c.(601-603)caG>caA	p.Q201Q	RTCB_ENST00000451746.2_Intron|RTCB_ENST00000476619.1_5'UTR	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase																		TGGGGTCAGCCTGCAGCATCC	0.498													T|||	2232	0.445687	0.6392	0.3487	5008	,	,		16455	0.5179		0.3032	False		,,,				2504	0.3252				p.Q201Q		.											.	C22orf28-90	0			c.G603A						.	T		2691,1715	516.5+/-369.2	800,1091,312	204.0	194.0	197.0		603	1.1	1.0	22	dbSNP_114	197	2998,5602	665.3+/-402.3	523,1952,1825	no	coding-synonymous	C22orf28	NM_014306.4		1323,3043,2137	TT,TC,CC		34.8605,38.9242,43.7414		201/506	32795641	5689,7317	2203	4300	6503	SO:0001819	synonymous_variant	51493	exon6			GTCAGCCTGCAGC	BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.603G>A	22.37:g.32795641C>T		139	0		57	4	NM_014306	0	0	39	39	0		Silent	SNP	ENST00000216038.5	37	CCDS13905.1																																																																																			C|0.552;T|0.448		0.498	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075188.3	NM_014306	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	1	0		18	14	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
CHADL	150356	broad.mit.edu	37	22	41635555	41635555	+	Silent	SNP	C	C	T	rs8135399	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr22:41635555C>T	ENST00000216241.9	-	2	130	c.78G>A	c.(76-78)agG>agA	p.R26R		NM_138481.1	NP_612490.1	Q6NUI6	CHADL_HUMAN	chondroadherin-like	26						proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(1)|skin(1)	4						CGGCGGCCTGCCTAGCCGGGG	0.667													C|||	99	0.0197684	0.0666	0.013	5008	,	,		15943	0.0		0.002	False		,,,				2504	0.0				p.R26R		.											.	CHADL-68	0			c.G78A						.	C		105,1279		5,95,592	20.0	28.0	25.0		78	4.4	0.6	22	dbSNP_116	25	8,3172		0,8,1582	no	coding-synonymous	CHADL	NM_138481.1		5,103,2174	TT,TC,CC		0.2516,7.5867,2.4759		26/763	41635555	113,4451	692	1590	2282	SO:0001819	synonymous_variant	150356	exon2			GGCCTGCCTAGCC	BC012882	CCDS46715.1	22q13.2	2008-10-31			ENSG00000100399	ENSG00000100399			25165	protein-coding gene	gene with protein product						12477932	Standard	NM_138481		Approved	SLRR4B	uc003azq.4	Q6NUI6	OTTHUMG00000150936	ENST00000216241.9:c.78G>A	22.37:g.41635555C>T		123	1		72	3	NM_138481	0	0	0	0	0	Q05CY2|Q4G0S0|Q5JY13|Q86XY1|Q96E60	Silent	SNP	ENST00000216241.9	37	CCDS46715.1	36	0.016483516483516484	28	0.056910569105691054	4	0.011049723756906077	2	0.0034965034965034965	2	0.002638522427440633	C	7.839	0.721574	0.15372	0.075867	0.002516	ENSG00000100399	ENST00000417999	.	.	.	5.43	4.38	0.52667	.	.	.	.	.	T	0.01387	0.0045	.	.	.	0.23366	N	0.99783	.	.	.	.	.	.	T	0.07046	-1.0793	4	.	.	.	.	4.7611	0.13108	0.1547:0.6139:0.1495:0.0819	rs8135399	.	.	.	D	24	.	.	G	-	2	0	CHADL	39965501	0.734000	0.28142	0.562000	0.28370	0.057000	0.15508	1.374000	0.34283	2.540000	0.85666	0.462000	0.41574	GGC	C|0.983;T|0.017		0.667	CHADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320597.1	NM_138481	
ACVR2B	93	bcgsc.ca	37	3	38519424	38519424	+	Silent	SNP	A	A	G	rs2070489	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr3:38519424A>G	ENST00000352511.4	+	3	805	c.333A>G	c.(331-333)gaA>gaG	p.E111E		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	111					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		TCTGCAACGAACGCTTCACTC	0.582													G|||	2406	0.480431	0.3109	0.4914	5008	,	,		17973	0.4425		0.6153	False		,,,				2504	0.6022				p.E111E		.											.	ACVR2B-942	0			c.A333G						.	G		1524,2882	672.8+/-402.7	262,1000,941	122.0	120.0	121.0		333	3.7	1.0	3	dbSNP_96	121	5275,3325	494.2+/-373.8	1619,2037,644	no	coding-synonymous	ACVR2B	NM_001106.3		1881,3037,1585	GG,GA,AA		38.6628,34.5892,47.7241		111/513	38519424	6799,6207	2203	4300	6503	SO:0001819	synonymous_variant	93	exon3			CAACGAACGCTTC	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.333A>G	3.37:g.38519424A>G		287	2		223	8	NM_001106	0	0	1	1	0	Q4VAV0	Silent	SNP	ENST00000352511.4	37	CCDS2679.1																																																																																			A|0.485;G|0.515		0.582	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254059.3	NM_001106	
FAM198A	729085	broad.mit.edu	37	3	43097710	43097710	+	Silent	SNP	A	A	G	rs664628	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr3:43097710A>G	ENST00000430121.2	+	5	1655	c.1560A>G	c.(1558-1560)ctA>ctG	p.L520L		NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	520						extracellular region (GO:0005576)				endometrium(1)	1						CAGGGTGTCTACAGAACATGC	0.567													A|||	1950	0.389377	0.2685	0.5058	5008	,	,		19848	0.5823		0.3887	False		,,,				2504	0.272				p.L520L		.											.	FAM198A-68	0			c.A1560G						.	A		400,984		56,288,348	43.0	42.0	42.0		1560	-3.7	0.0	3	dbSNP_83	42	1211,1971		234,743,614	no	coding-synonymous	FAM198A	NM_001129908.2		290,1031,962	GG,GA,AA		38.0578,28.9017,35.2825		520/576	43097710	1611,2955	692	1591	2283	SO:0001819	synonymous_variant	729085	exon5			GTGTCTACAGAAC	AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.1560A>G	3.37:g.43097710A>G		124	1		101	4	NM_001129908	0	0	0	0	0	B3KR48	Silent	SNP	ENST00000430121.2	37	CCDS46808.1																																																																																			A|0.589;G|0.411		0.567	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344240.3	NM_001129908	
DOCK3	1795	broad.mit.edu	37	3	51370644	51370644	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr3:51370644A>C	ENST00000266037.9	+	35	3594	c.3571A>C	c.(3571-3573)Acc>Ccc	p.T1191P		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1191					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTCCTTTGTGACCTCAGTCAC	0.527																																					p.T1191P		.											.	DOCK3-22	0			c.A3571C						.						120.0	121.0	121.0					3																	51370644		1940	4135	6075	SO:0001583	missense	1795	exon35			TTTGTGACCTCAG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3571A>C	3.37:g.51370644A>C	ENSP00000266037:p.Thr1191Pro	73	4		53	13	NM_004947	0	0	2	2	0	O15017	Missense_Mutation	SNP	ENST00000266037.9	37	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425907	0.83667	.	.	ENSG00000088538	ENST00000266037	T	0.48836	0.8	6.06	6.06	0.98353	.	0.042715	0.85682	D	0.000000	T	0.50854	0.1640	L	0.54323	1.7	0.80722	D	1	P	0.47545	0.897	P	0.45794	0.493	T	0.48980	-0.8986	10	0.39692	T	0.17	.	16.6127	0.84892	1.0:0.0:0.0:0.0	.	1191	Q8IZD9	DOCK3_HUMAN	P	1191	ENSP00000266037:T1191P	ENSP00000266037:T1191P	T	+	1	0	DOCK3	51345684	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.322000	0.78497	0.528000	0.53228	ACC	.		0.527	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
CCDC54	84692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	107096799	107096799	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr3:107096799C>T	ENST00000261058.1	+	1	612	c.365C>T	c.(364-366)aCg>aTg	p.T122M		NM_032600.2	NP_115989.1	Q8NEL0	CCD54_HUMAN	coiled-coil domain containing 54	122										NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	19						CAATGCACAACGACTAAAGAT	0.378																																					p.T122M		.											.	CCDC54-90	0			c.C365T						.						57.0	53.0	54.0					3																	107096799		2202	4300	6502	SO:0001583	missense	84692	exon1			GCACAACGACTAA	AF367469	CCDS2949.1	3q13.12	2013-10-11			ENSG00000138483	ENSG00000138483			30703	protein-coding gene	gene with protein product	"""sperm protein 17"""					15257753	Standard	NM_032600		Approved	NYD-SP17, FLJ25362, SP17	uc003dwi.1	Q8NEL0	OTTHUMG00000159169	ENST00000261058.1:c.365C>T	3.37:g.107096799C>T	ENSP00000261058:p.Thr122Met	137	0		118	52	NM_032600	0	0	0	0	0	Q96A43	Missense_Mutation	SNP	ENST00000261058.1	37	CCDS2949.1	.	.	.	.	.	.	.	.	.	.	C	5.685	0.311016	0.10733	.	.	ENSG00000138483	ENST00000261058	T	0.41065	1.01	5.39	0.646	0.17789	.	1.235070	0.05820	N	0.615646	T	0.29126	0.0724	L	0.29908	0.895	0.09310	N	1	B	0.24675	0.109	B	0.19666	0.026	T	0.23368	-1.0190	10	0.44086	T	0.13	0.0027	4.0806	0.09924	0.0:0.3214:0.4074:0.2712	.	122	Q8NEL0	CCD54_HUMAN	M	122	ENSP00000261058:T122M	ENSP00000261058:T122M	T	+	2	0	CCDC54	108579489	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.881000	0.04179	-0.112000	0.11979	0.585000	0.79938	ACG	.		0.378	CCDC54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353651.1	NM_032600	
HEG1	57493	hgsc.bcm.edu;bcgsc.ca	37	3	124696757	124696757	+	Missense_Mutation	SNP	G	G	T	rs186214189		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr3:124696757G>T	ENST00000311127.4	-	15	3834	c.3767C>A	c.(3766-3768)gCg>gAg	p.A1256E		NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	1256					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						CCCACCTCCCGCGGCTGCGAT	0.483																																					p.A1256E		.											.	HEG1-70	0			c.C3767A						.						32.0	34.0	34.0					3																	124696757		2004	4157	6161	SO:0001583	missense	57493	exon15			CCTCCCGCGGCTG	AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.3767C>A	3.37:g.124696757G>T	ENSP00000311502:p.Ala1256Glu	101	0		68	4	NM_020733	0	0	2	2	0	Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	ENST00000311127.4	37	CCDS46898.1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337459	0.60963	.	.	ENSG00000173706	ENST00000311127;ENST00000487661	D;T	0.90732	-2.72;0.74	5.16	5.16	0.70880	.	0.000000	0.38381	U	0.001713	D	0.91794	0.7404	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91828	0.5473	10	0.44086	T	0.13	.	17.8076	0.88606	0.0:0.0:1.0:0.0	.	1256	Q9ULI3	HEG1_HUMAN	E	1256;140	ENSP00000311502:A1256E;ENSP00000417648:A140E	ENSP00000311502:A1256E	A	-	2	0	HEG1	126179447	1.000000	0.71417	0.818000	0.32626	0.104000	0.19210	7.693000	0.84214	2.687000	0.91594	0.557000	0.71058	GCG	G|0.999;A|0.001		0.483	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355732.2	XM_087386	
ZBBX	79740	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	167051700	167051700	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr3:167051700G>T	ENST00000392766.2	-	10	942	c.602C>A	c.(601-603)cCc>cAc	p.P201H	ZBBX_ENST00000455345.2_Missense_Mutation_p.P201H|ZBBX_ENST00000392767.2_Missense_Mutation_p.P201H|ZBBX_ENST00000392764.1_Missense_Mutation_p.P172H|ZBBX_ENST00000307529.5_Missense_Mutation_p.P201H|ZBBX_ENST00000469220.1_Intron	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	201						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTCCTCTTTGGGTTCATCTGG	0.323																																					p.P201H		.											.	ZBBX-92	0			c.C602A						.						130.0	117.0	121.0					3																	167051700		1804	4072	5876	SO:0001583	missense	79740	exon10			TCTTTGGGTTCAT	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.602C>A	3.37:g.167051700G>T	ENSP00000376519:p.Pro201His	55	0		62	32	NM_024687	0	0	0	0	0	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	37	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	G	13.45	2.242026	0.39598	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.10960	2.98;2.98;2.98;2.98;2.82	4.83	3.95	0.45737	.	0.561190	0.13154	U	0.409660	T	0.21631	0.0521	L	0.50333	1.59	0.30303	N	0.789226	D;D	0.65815	0.995;0.992	P;P	0.58873	0.847;0.707	T	0.05257	-1.0896	10	0.72032	D	0.01	1.2647	9.1783	0.37125	0.102:0.0:0.898:0.0	.	201;201	A8MT70-2;A8MT70	.;ZBBX_HUMAN	H	201;201;201;201;172	ENSP00000376519:P201H;ENSP00000376520:P201H;ENSP00000390232:P201H;ENSP00000305065:P201H;ENSP00000376517:P172H	ENSP00000305065:P201H	P	-	2	0	ZBBX	168534394	0.360000	0.24964	0.905000	0.35620	0.252000	0.25951	0.768000	0.26590	1.134000	0.42165	0.650000	0.86243	CCC	.		0.323	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
ATP13A5	344905	broad.mit.edu	37	3	193051683	193051683	+	Silent	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr3:193051683G>T	ENST00000342358.4	-	11	1245	c.1128C>A	c.(1126-1128)gcC>gcA	p.A376A		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	376						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AGTCCCCTTTGGCTGTATTGT	0.448																																					p.A376A		.											.	ATP13A5-144	0			c.C1128A						.						89.0	88.0	88.0					3																	193051683		2203	4300	6503	SO:0001819	synonymous_variant	344905	exon11			CCCTTTGGCTGTA	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1128C>A	3.37:g.193051683G>T		110	0		82	3	NM_198505	0	0	0	0	0	Q6UWS4|Q6ZWL0	Silent	SNP	ENST00000342358.4	37	CCDS33914.1																																																																																			.		0.448	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
TNK2	10188	hgsc.bcm.edu	37	3	195595405	195595405	+	Silent	SNP	G	G	A	rs1056726	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr3:195595405G>A	ENST00000333602.6	-	12	2336	c.1719C>T	c.(1717-1719)ttC>ttT	p.F573F	TNK2_ENST00000381916.2_Silent_p.F651F|TNK2_ENST00000392400.1_Silent_p.F573F|TNK2_ENST00000428187.1_Silent_p.F605F	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	573				Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GCTCCTCACCGAAGTCGATGA	0.746													a|||	310	0.061901	0.0847	0.0259	5008	,	,		10834	0.0704		0.0467	False		,,,				2504	0.0634				p.F651F		.											.	TNK2-957	0			c.C1953T						.		,	269,3657		9,251,1703	5.0	6.0	6.0		1953,1719	-5.7	0.0	3	dbSNP_86	6	322,7600		4,314,3643	no	coding-synonymous,coding-synonymous	TNK2	NM_001010938.1,NM_005781.4	,	13,565,5346	AA,AG,GG		4.0646,6.8518,4.9882	,	651/1087,573/1039	195595405	591,11257	1963	3961	5924	SO:0001819	synonymous_variant	10188	exon13			CTCACCGAAGTCG	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1719C>T	3.37:g.195595405G>A		0	0		18	13	NM_001010938	0	0	8	15	7	Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	ENST00000333602.6	37	CCDS33928.1	134	0.06135531135531135	38	0.07723577235772358	10	0.027624309392265192	53	0.09265734265734266	33	0.04353562005277045	A	0.025	-1.382365	0.01204	0.068518	0.040646	ENSG00000061938	ENST00000424563	.	.	.	5.41	-5.74	0.02391	.	.	.	.	.	T	0.06096	0.0158	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56288	-0.8004	4	.	.	.	.	15.998	0.80265	0.6944:0.0:0.3056:0.0	rs1056726;rs3197336;rs57297005	.	.	.	L	183	.	.	S	-	2	0	TNK2	197079802	0.028000	0.19301	0.045000	0.18777	0.071000	0.16799	-0.555000	0.05999	-1.423000	0.02002	-2.075000	0.00382	TCG	G|0.936;A|0.064		0.746	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
CRMP1	1400	hgsc.bcm.edu	37	4	5894586	5894586	+	Silent	SNP	G	G	A	rs143304363	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr4:5894586G>A	ENST00000324989.7	-	1	199	c.111C>T	c.(109-111)gcC>gcT	p.A37A	CRMP1_ENST00000512574.1_5'Flank	NM_001014809.1	NP_001014809.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	0					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTCCACCGCGGCGAACATGC	0.756													G|||	277	0.0553115	0.0076	0.0461	5008	,	,		4031	0.0437		0.0805	False		,,,				2504	0.1125				p.A37A		.											.	CRMP1-92	0			c.C111T						.	G		56,3324		2,52,1636	4.0	4.0	4.0		111	0.2	1.0	4	dbSNP_134	4	409,6095		9,391,2852	no	coding-synonymous	CRMP1	NM_001014809.1		11,443,4488	AA,AG,GG		6.2884,1.6568,4.7046		37/687	5894586	465,9419	1690	3252	4942	SO:0001819	synonymous_variant	1400	exon1			CACCGCGGCGAAC	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000324989.7:c.111C>T	4.37:g.5894586G>A		0	0		20	7	NM_001014809	0	0	0	0	0	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	ENST00000324989.7	37	CCDS33950.1																																																																																			G|0.946;A|0.054		0.756	CRMP1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246814.2	NM_001313	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000514014.1_Intron|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000515809.1_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		0	0		21	21	NM_001098634	0	0	0	13	13	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
ZAR1	326340	hgsc.bcm.edu	37	4	48492546	48492546	+	Silent	SNP	C	C	A	rs73144650	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr4:48492546C>A	ENST00000327939.4	+	1	278	c.238C>A	c.(238-240)Cgg>Agg	p.R80R		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	80					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						CAGCTACCAGCGGGAGCGGCT	0.771													C|||	114	0.0227636	0.0832	0.0058	5008	,	,		8996	0.0		0.0	False		,,,				2504	0.0				p.R80R		.											.	ZAR1-90	0			c.C238A						.	C		119,2137		0,119,1009	2.0	2.0	2.0		238	1.2	0.1	4	dbSNP_131	2	4,5278		0,4,2637	no	coding-synonymous	ZAR1	NM_175619.1		0,123,3646	AA,AC,CC		0.0757,5.2748,1.6317		80/425	48492546	123,7415	1128	2641	3769	SO:0001819	synonymous_variant	326340	exon1			TACCAGCGGGAGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.238C>A	4.37:g.48492546C>A		0	0		14	10	NM_175619	0	0	0	0	0		Silent	SNP	ENST00000327939.4	37	CCDS3483.1																																																																																			C|0.977;A|0.023		0.771	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		3	0		16	7	NM_001029870	0	0	0	0	0	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
COQ2	27235	hgsc.bcm.edu	37	4	84205872	84205872	+	Missense_Mutation	SNP	C	C	A	rs6818847	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr4:84205872C>A	ENST00000311469.4	-	1	195	c.196G>T	c.(196-198)Gtg>Ttg	p.V66L	COQ2_ENST00000439031.2_Missense_Mutation_p.V29L|COQ2_ENST00000311461.7_Missense_Mutation_p.V16L	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	16					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				GCCAGTGCCACAGCCCGCAGG	0.766													C|||	3254	0.64976	0.3775	0.647	5008	,	,		9689	0.8879		0.7227	False		,,,				2504	0.6994				p.V66L		.											.	COQ2-92	0			c.G196T						.	C	LEU/VAL	1570,1290		474,622,334	2.0	3.0	3.0		196	-2.7	0.0	4	dbSNP_116	3	4779,1627		1892,995,316	no	missense	COQ2	NM_015697.7	32	2366,1617,650	AA,AC,CC		25.3981,45.1049,31.4807	benign	66/422	84205872	6349,2917	1430	3203	4633	SO:0001583	missense	27235	exon1			GTGCCACAGCCCG		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.196G>T	4.37:g.84205872C>A	ENSP00000310873:p.Val66Leu	0	0		9	5	NM_015697	0	0	0	0	0	O95331|Q1JQ78|Q684R2	Missense_Mutation	SNP	ENST00000311469.4	37	CCDS47090.2	1475	0.6753663003663004	219	0.4451219512195122	244	0.6740331491712708	490	0.8566433566433567	522	0.6886543535620053	C	5.506	0.278257	0.10403	0.548951	0.746019	ENSG00000173085	ENST00000311469;ENST00000439031;ENST00000311461	T;T;T	0.77098	-1.07;-1.03;-1.0	3.59	-2.74	0.05932	.	2.205390	0.02429	N	0.083323	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	8	0.07813	T	0.8	-2.056	4.7989	0.13287	0.0:0.2608:0.3311:0.4081	rs6818847;rs17850399;rs17858544	16	E2QRG7	.	L	66;29;16	ENSP00000310873:V66L;ENSP00000409275:V29L;ENSP00000311835:V16L	ENSP00000311835:V16L	V	-	1	0	COQ2	84424896	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.921000	0.01569	-0.746000	0.04766	0.467000	0.42956	GTG	C|0.324;A|0.676		0.766	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
DSPP	1834	bcgsc.ca	37	4	88537051	88537051	+	Silent	SNP	T	T	C	rs371970214		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr4:88537051T>C	ENST00000282478.7	+	4	3270	c.3237T>C	c.(3235-3237)agT>agC	p.S1079S	DSPP_ENST00000399271.1_Silent_p.S1079S|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1079	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcgacagcagtgatagcagtg	0.552																																					p.S1079S		.											.	DSPP-90	0			c.T3237C						.						42.0	49.0	47.0					4																	88537051		1482	2726	4208	SO:0001819	synonymous_variant	1834	exon5			CAGCAGTGATAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3237T>C	4.37:g.88537051T>C		484	12		466	24	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.552	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
USP38	84640	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	144135926	144135926	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr4:144135926A>G	ENST00000307017.4	+	9	3303	c.2797A>G	c.(2797-2799)Acg>Gcg	p.T933A	USP38_ENST00000510377.1_Missense_Mutation_p.T933A	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	933	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CCAGAAAATTACGAGCAGGTT	0.343																																					p.T933A		.											.	USP38-660	0			c.A2797G						.						70.0	73.0	72.0					4																	144135926		2203	4299	6502	SO:0001583	missense	84640	exon9			AAAATTACGAGCA	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.2797A>G	4.37:g.144135926A>G	ENSP00000303434:p.Thr933Ala	218	0		231	48	NM_032557	0	0	23	37	14	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	ENST00000307017.4	37	CCDS3758.1	.	.	.	.	.	.	.	.	.	.	A	17.41	3.383769	0.61845	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.31510	1.49;1.49	5.88	4.69	0.59074	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.51210	0.1661	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.46638	-0.9177	10	0.37606	T	0.19	-6.4395	11.9918	0.53180	0.9324:0.0:0.0676:0.0	.	933;933	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	A	933	ENSP00000427647:T933A;ENSP00000303434:T933A	ENSP00000303434:T933A	T	+	1	0	USP38	144355376	1.000000	0.71417	0.932000	0.37286	0.871000	0.50021	9.339000	0.96797	1.041000	0.40125	-0.290000	0.09829	ACG	.		0.343	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364869.1	NM_032557	
IRX4	50805	hgsc.bcm.edu	37	5	1882129	1882129	+	Silent	SNP	T	T	G	rs2232374	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:1882129T>G	ENST00000505790.1	-	3	546	c.90A>C	c.(88-90)ggA>ggC	p.G30G	IRX4_ENST00000505938.1_5'Flank|CTD-2194D22.3_ENST00000506335.1_RNA|IRX4_ENST00000231357.2_Silent_p.G30G|IRX4_ENST00000513692.1_Silent_p.G30G	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	30					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCGTGCGGCCTCCGGACTCGC	0.741													N|||	1389	0.277356	0.2821	0.3141	5008	,	,		10764	0.3313		0.2177	False		,,,				2504	0.2505				p.G30G		.											.	IRX4-226	0			c.A90C						.			440,2456		29,382,1037	2.0	2.0	2.0		90	-2.3	0.0	5	dbSNP_98	2	967,5425		81,805,2310	no	coding-synonymous	IRX4	NM_016358.2		110,1187,3347	GG,GT,TT		15.1283,15.1934,15.1486		30/520	1882129	1407,7881	1448	3196	4644	SO:0001819	synonymous_variant	50805	exon2			GCGGCCTCCGGAC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.90A>C	5.37:g.1882129T>G		4	0		13	6	NM_016358	0	0	0	0	0	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1																																																																																			T|0.735;G|0.265		0.741	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
NSUN2	54888	hgsc.bcm.edu	37	5	6633071	6633071	+	Missense_Mutation	SNP	G	G	A	rs181415619	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:6633071G>A	ENST00000264670.6	-	1	333	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W	NSUN2_ENST00000539938.1_5'UTR|SRD5A1_ENST00000274192.5_5'Flank|SRD5A1_ENST00000538824.1_5'Flank|SRD5A1_ENST00000537411.1_5'Flank|NSUN2_ENST00000506139.1_Missense_Mutation_p.R8W	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	8					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						TGGAGCCGCCGACCCCGCGAC	0.756													G|||	125	0.0249601	0.0893	0.0101	5008	,	,		10402	0.0		0.0	False		,,,				2504	0.0				p.R8W		.											.	NSUN2-91	0			c.C22T						.	G	TRP/ARG,TRP/ARG	120,1992		0,120,936	1.0	2.0	2.0		22,22	2.6	0.9	5		2	3,4631		0,3,2314	no	missense,missense	NSUN2	NM_001193455.1,NM_017755.5	101,101	0,123,3250	AA,AG,GG		0.0647,5.6818,1.8233	probably-damaging,probably-damaging	8/733,8/768	6633071	123,6623	1056	2317	3373	SO:0001583	missense	54888	exon1			GCCGCCGACCCCG	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.22C>T	5.37:g.6633071G>A	ENSP00000264670:p.Arg8Trp	1	0		11	9	NM_017755	0	0	7	11	4	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	CCDS3869.1	57	0.0260989010989011	45	0.09146341463414634	2	0.0055248618784530384	0	0.0	10	0.013192612137203167	G	17.62	3.434487	0.62955	0.056818	6.47E-4	ENSG00000037474	ENST00000264670;ENST00000506139	T;T	0.38722	1.12;1.12	4.5	2.59	0.31030	.	0.397846	0.23951	N	0.042944	T	0.03477	0.0100	L	0.51422	1.61	0.09310	P	0.99999999735625	D;D	0.89917	1.0;1.0	D;D	0.75020	0.985;0.985	T	0.42085	-0.9472	9	0.72032	D	0.01	-12.5115	9.6603	0.39952	0.0:0.0:0.6264:0.3736	.	8;8	B4DQW2;Q08J23	.;NSUN2_HUMAN	W	8	ENSP00000264670:R8W;ENSP00000420957:R8W	ENSP00000264670:R8W	R	-	1	2	NSUN2	6686071	0.066000	0.20996	0.881000	0.34555	0.921000	0.55340	0.367000	0.20382	0.860000	0.35481	0.557000	0.71058	CGG	G|0.974;A|0.026		0.756	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206902.1	NM_017755	
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	NSUN2_ENST00000539938.1_5'Flank|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G|SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G|SRD5A1_ENST00000504286.1_3'UTR|NSUN2_ENST00000506139.1_5'Flank	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		0	0		9	8	NM_001047	0	0	0	2	2	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
PRDM9	56979	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	23509687	23509687	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:23509687G>A	ENST00000296682.3	+	3	360	c.178G>A	c.(178-180)Gca>Aca	p.A60T		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	60	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						GAACTATAATGCACTGATTAC	0.433										HNSCC(3;0.000094)																											p.A60T		.											.	PRDM9-139	0			c.G178A						.						166.0	153.0	157.0					5																	23509687		1869	4113	5982	SO:0001583	missense	56979	exon3			TATAATGCACTGA	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.178G>A	5.37:g.23509687G>A	ENSP00000296682:p.Ala60Thr	145	0		249	69	NM_020227	0	0	0	0	0	B4DX22|Q27Q50	Missense_Mutation	SNP	ENST00000296682.3	37	CCDS43307.1	.	.	.	.	.	.	.	.	.	.	G	5.219	0.225894	0.09916	.	.	ENSG00000164256	ENST00000502755;ENST00000296682	T;T	0.01572	4.76;4.76	2.93	-1.78	0.07957	Krueppel-associated box-related (1);Krueppel-associated box (3);	.	.	.	.	T	0.00815	0.0027	N	0.03050	-0.425	0.09310	N	1	B	0.24920	0.114	B	0.20577	0.03	T	0.48885	-0.8995	9	0.18276	T	0.48	-4.0E-4	6.8725	0.24129	0.6425:0.0:0.3575:0.0	.	60	Q9NQV7	PRDM9_HUMAN	T	60	ENSP00000425471:A60T;ENSP00000296682:A60T	ENSP00000296682:A60T	A	+	1	0	PRDM9	23545444	0.000000	0.05858	0.000000	0.03702	0.157000	0.22087	0.102000	0.15272	-0.434000	0.07275	-0.192000	0.12808	GCA	.		0.433	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366375.1	NM_020227	
SPEF2	79925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	35667294	35667294	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:35667294G>A	ENST00000356031.3	+	9	1442	c.1288G>A	c.(1288-1290)Gca>Aca	p.A430T	SPEF2_ENST00000282469.6_Missense_Mutation_p.A430T|SPEF2_ENST00000509059.1_Missense_Mutation_p.A430T|SPEF2_ENST00000440995.2_Missense_Mutation_p.A430T	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	430					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTCAGTATGTGCAGAAATTTT	0.323																																					p.A430T		.											.	SPEF2-26	0			c.G1288A						.						92.0	88.0	89.0					5																	35667294		2203	4300	6503	SO:0001583	missense	79925	exon9			GTATGTGCAGAAA	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1288G>A	5.37:g.35667294G>A	ENSP00000348314:p.Ala430Thr	303	0		337	74	NM_024867	0	0	2	2	0	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	G	7.805	0.714412	0.15306	.	.	ENSG00000152582	ENST00000282469;ENST00000356031;ENST00000509059;ENST00000440995	T;T;T;T	0.16743	2.32;3.33;2.32;3.33	5.65	2.9	0.33743	.	0.333982	0.33075	N	0.005312	T	0.11879	0.0289	L	0.50919	1.6	0.80722	D	1	B;B;B	0.14438	0.01;0.006;0.001	B;B;B	0.11329	0.005;0.006;0.002	T	0.15549	-1.0433	10	0.19147	T	0.46	.	2.0494	0.03567	0.2237:0.1134:0.5021:0.1608	.	430;430;430	D6REZ4;Q9C093;Q9C093-3	.;SPEF2_HUMAN;.	T	430	ENSP00000282469:A430T;ENSP00000348314:A430T;ENSP00000421593:A430T;ENSP00000412125:A430T	ENSP00000282469:A430T	A	+	1	0	SPEF2	35703051	0.998000	0.40836	0.996000	0.52242	0.592000	0.36648	0.780000	0.26760	0.759000	0.33084	-0.266000	0.10368	GCA	.		0.323	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367199.1	NM_144722	
SNX18	112574	hgsc.bcm.edu	37	5	53814052	53814052	+	Silent	SNP	T	T	C	rs2548615	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:53814052T>C	ENST00000326277.3	+	1	460	c.270T>C	c.(268-270)ccT>ccC	p.P90P	SNX18_ENST00000381410.4_Silent_p.P90P|SNX18_ENST00000343017.6_Silent_p.P90P	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	90					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				AGCCCCTGCCTGTCGCGCCCC	0.791													N|||	4953	0.989018	0.9728	0.9942	5008	,	,		9287	1.0		0.9901	False		,,,				2504	0.9949				p.P90P		.											.	SNX18-226	0			c.T270C						.	C	,,	1635,19		808,19,0	1.0	2.0	2.0		270,270,270	-2.1	0.2	5	dbSNP_100	2	4035,67		1984,67,0	no	coding-synonymous,coding-synonymous,coding-synonymous	SNX18	NM_001102575.1,NM_001145427.1,NM_052870.2	,,	2792,86,0	CC,CT,TT		1.6333,1.1487,1.4941	,,	90/625,90/592,90/629	53814052	5670,86	827	2051	2878	SO:0001819	synonymous_variant	112574	exon1			CCTGCCTGTCGCG	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.270T>C	5.37:g.53814052T>C		0	0		4	4	NM_052870	0	0	0	0	0	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	ENST00000326277.3	37	CCDS3962.1																																																																																			G|0.979;C|0.003		0.791	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
ENC1	8507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	73931914	73931914	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:73931914G>A	ENST00000302351.4	-	2	1527	c.397C>T	c.(397-399)Cgg>Tgg	p.R133W	ENC1_ENST00000510316.1_Missense_Mutation_p.R60W|ENC1_ENST00000537006.1_Missense_Mutation_p.R133W	NM_003633.3	NP_003624.1	O14682	ENC1_HUMAN	ectodermal-neural cortex 1 (with BTB domain)	133					multicellular organismal development (GO:0007275)|negative regulation of translation (GO:0017148)|nervous system development (GO:0007399)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	20		all_lung(232;0.0154)|Lung NSC(167;0.0331)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;1.45e-59)		CATGCATCCCGGATGTCTTGA	0.532																																					p.R133W		.											.	ENC1-228	0			c.C397T						.						95.0	91.0	93.0					5																	73931914		2203	4300	6503	SO:0001583	missense	8507	exon2			CATCCCGGATGTC	AF059611	CCDS4021.1, CCDS58958.1	5q13	2013-01-30	2013-01-30		ENSG00000171617	ENSG00000171617		"""Kelch-like"", ""BTB/POZ domain containing"""	3345	protein-coding gene	gene with protein product	"""kelch-like family member 37"""	605173	"""ectodermal-neural cortex 1 (with BTB-like domain)"""	NRPB		9305847, 9566959	Standard	NM_003633		Approved	PIG10, ENC-1, TP53I10, KLHL37	uc003kdc.5	O14682	OTTHUMG00000102059	ENST00000302351.4:c.397C>T	5.37:g.73931914G>A	ENSP00000306356:p.Arg133Trp	121	0		112	25	NM_003633	0	0	9	17	8	B4DHJ1|E9PFU0|O75464|Q9UPG9	Missense_Mutation	SNP	ENST00000302351.4	37	CCDS4021.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288689	0.59976	.	.	ENSG00000171617	ENST00000302351;ENST00000510316;ENST00000537006	T;T;T	0.71341	-0.56;-0.56;-0.56	6.04	5.15	0.70609	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.87680	0.6238	H	0.94847	3.59	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	D	0.90689	0.4611	10	0.87932	D	0	.	13.3294	0.60477	0.0:0.0:0.5532:0.4468	.	133	O14682	ENC1_HUMAN	W	133;60;133	ENSP00000306356:R133W;ENSP00000423804:R60W;ENSP00000446289:R133W	ENSP00000306356:R133W	R	-	1	2	ENC1	73967670	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.779000	0.38624	1.505000	0.48720	0.561000	0.74099	CGG	.		0.532	ENC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219862.2	NM_003633	
PCDHB2	56133	bcgsc.ca	37	5	140476000	140476000	+	Silent	SNP	G	G	T	rs141231979	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:140476000G>T	ENST00000194155.4	+	1	1774	c.1626G>T	c.(1624-1626)gcG>gcT	p.A542A		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	542	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A542A(2)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCCCCGGCGTTGAGCAGCG	0.706																																					p.A542A		.											.	PCDHB2-96	2	Substitution - coding silent(2)	large_intestine(1)|kidney(1)	c.G1626T						.						39.0	44.0	42.0					5																	140476000		2200	4298	6498	SO:0001819	synonymous_variant	56133	exon1			CCCGGCGTTGAGC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1626G>T	5.37:g.140476000G>T		41	0		486	44	NM_018936	0	0	3	47	44	Q4KMU1	Silent	SNP	ENST00000194155.4	37	CCDS4244.1																																																																																			G|0.994;T|0.006		0.706	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
ABLIM3	22885	broad.mit.edu	37	5	148637920	148637920	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:148637920G>T	ENST00000506113.1	+	23	2487	c.2005G>T	c.(2005-2007)Gcc>Tcc	p.A669S	ABLIM3_ENST00000517451.1_Missense_Mutation_p.A155S|AC012613.2_ENST00000523176.1_RNA|ABLIM3_ENST00000309868.7_Missense_Mutation_p.A669S|RP11-331K21.1_ENST00000522685.1_RNA|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000326685.7_Missense_Mutation_p.A574S|ABLIM3_ENST00000356541.3_Intron|ABLIM3_ENST00000504238.1_Intron|ABLIM3_ENST00000508983.1_Missense_Mutation_p.A636S			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	669	HP. {ECO:0000255|PROSITE- ProRule:PRU00595}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)	p.A669S(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACCGGCTGGCCCTCTGGAA	0.502																																					p.A669S		.											.	ABLIM3-93	2	Substitution - Missense(2)	endometrium(2)	c.G2005T						.						58.0	57.0	57.0					5																	148637920		2203	4300	6503	SO:0001583	missense	22885	exon24			CGGCTGGCCCTCT	AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.2005G>T	5.37:g.148637920G>T	ENSP00000425394:p.Ala669Ser	65	1		67	5	NM_014945	0	0	0	0	0	A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	ENST00000506113.1	37	CCDS4294.1	.	.	.	.	.	.	.	.	.	.	G	34	5.329622	0.95733	.	.	ENSG00000173210	ENST00000326685;ENST00000309868;ENST00000506113;ENST00000508983;ENST00000517451;ENST00000536903	T;T;T;T;T	0.56444	0.46;0.51;0.51;0.52;0.88	5.86	5.86	0.93980	Villin headpiece (5);	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	N	0.25890	0.77	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.91635	0.997;0.987;0.999	T	0.62779	-0.6782	10	0.46703	T	0.11	.	20.1802	0.98196	0.0:0.0:1.0:0.0	.	155;574;669	O94929-4;O94929-3;O94929	.;.;ABLM3_HUMAN	S	574;669;669;636;155;154	ENSP00000315841:A574S;ENSP00000310309:A669S;ENSP00000425394:A669S;ENSP00000420855:A636S;ENSP00000430150:A155S	ENSP00000310309:A669S	A	+	1	0	ABLIM3	148618113	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.859000	0.99545	2.783000	0.95769	0.542000	0.68232	GCC	.		0.502	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945	
TAP2	6891	bcgsc.ca	37	6	32796751	32796751	+	Missense_Mutation	SNP	T	T	C	rs241447	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr6:32796751T>C	ENST00000374897.2	-	12	2124	c.1993A>G	c.(1993-1995)Aca>Gca	p.T665A	TAP2_ENST00000374899.4_Intron|TAP2_ENST00000452392.2_Intron	NM_000544.3	NP_000535.3	Q9UDX4	S14L3_HUMAN	transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)	0						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)									Vitamin E(DB00163)	CGCTGAACTGTCTGCAGCCTG	0.592													T|||	1511	0.301717	0.1573	0.3141	5008	,	,		15635	0.369		0.2763	False		,,,				2504	0.4448				.		.											.	TAP2-90	0			.	GRCh37	CM920659	TAP2	M	rs241447	.	T	ALA/THR,	397,2145		36,325,910	8.0	10.0	9.0		1993,	3.4	0.5	6	dbSNP_79	9	1026,3758		115,796,1481	yes	missense,intron	TAP2	NM_000544.3,NM_018833.2	58,	151,1121,2391	CC,CT,TT		21.4465,15.6176,19.424	benign,	665/704,	32796751	1423,5903	1271	2392	3663	SO:0001583	missense	6891	.			GAACTGTCTGCAG	M74447	CCDS4755.1	6p21.3	2014-09-17			ENSG00000204267	ENSG00000204267		"""ATP binding cassette transporters / subfamily B"""	44	protein-coding gene	gene with protein product		170261		ABCB3		1529427, 1946428, 16395595	Standard	NM_001290043		Approved	PSF2, RING11, D6S217E	uc003ocd.3	Q03519	OTTHUMG00000031068	ENST00000374897.2:c.1993A>G	6.37:g.32796751T>C	ENSP00000364032:p.Thr665Ala	96	0		72	5	.	0	0	16	16	0	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Missense_Mutation	SNP	ENST00000374897.2	37		623	0.28525641025641024	96	0.1951219512195122	107	0.2955801104972376	217	0.3793706293706294	203	0.2678100263852243	T	10.10	1.258849	0.23051	0.156176	0.214465	ENSG00000204267	ENST00000374897	D	0.81499	-1.5	5.77	3.38	0.38709	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.422797	0.20180	N	0.097551	T	0.54498	0.1862	L	0.38953	1.18	0.41253	P	0.01327900000000004	B	0.27910	0.193	B	0.21708	0.036	T	0.48603	-0.9021	9	0.72032	D	0.01	.	8.6055	0.33771	0.0:0.1585:0.0:0.8415	rs241447;rs2228394;rs17884069;rs45468099;rs52832084;rs61341816;rs241447	665	Q03519	TAP2_HUMAN	A	665	ENSP00000364032:T665A	ENSP00000364032:T665A	T	-	1	0	TAP2	32904729	1.000000	0.71417	0.463000	0.27130	0.002000	0.02628	4.371000	0.59523	0.456000	0.26937	-0.382000	0.06688	ACA	T|0.702;C|0.298		0.592	TAP2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000076088.2	NM_000544	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	0	0		26	25	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
NFKBIE	4794	hgsc.bcm.edu	37	6	44233175	44233175	+	Missense_Mutation	SNP	C	C	T	rs2233431	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr6:44233175C>T	ENST00000275015.5	-	1	325	c.326G>A	c.(325-327)tGc>tAc	p.C109Y		NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	109					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GTCCGCTTGGCAGAgcgggcg	0.781													C|||	46	0.0091853	0.0325	0.0043	5008	,	,		8998	0.0		0.0	False		,,,				2504	0.0				p.C109Y		.											.	NFKBIE-135	0			c.G326A						.	C	TYR/CYS	54,2288		0,54,1117	2.0	2.0	2.0		326	-0.0	0.0	6	dbSNP_98	2	1,5379		0,1,2689	no	missense	NFKBIE	NM_004556.2	194	0,55,3806	TT,TC,CC		0.0186,2.3057,0.7123	possibly-damaging	109/501	44233175	55,7667	1171	2690	3861	SO:0001583	missense	4794	exon1			GCTTGGCAGAGCG	U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.326G>A	6.37:g.44233175C>T	ENSP00000275015:p.Cys109Tyr	2	0		6	5	NM_004556	0	0	0	0	0	Q5T9V9	Missense_Mutation	SNP	ENST00000275015.5	37	CCDS34463.1	27	0.012362637362637362	25	0.0508130081300813	0	0.0	0	0.0	2	0.002638522427440633	C	19.29	3.799301	0.70567	0.023057	1.86E-4	ENSG00000146232	ENST00000275015	T	0.42900	0.96	4.29	-0.0104	0.13997	.	2.244940	0.02263	N	0.067704	T	0.11196	0.0273	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24799	-1.0150	10	0.87932	D	0	-32.9433	3.9046	0.09177	0.0:0.4966:0.1798:0.3235	rs2233431	109	O00221	IKBE_HUMAN	Y	109	ENSP00000275015:C109Y	ENSP00000275015:C109Y	C	-	2	0	NFKBIE	44341153	0.000000	0.05858	0.000000	0.03702	0.369000	0.29798	-0.197000	0.09518	0.058000	0.16222	0.462000	0.41574	TGC	C|0.987;T|0.013		0.781	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040733.2		
PGK2	5232	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	49753750	49753750	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr6:49753750T>G	ENST00000304801.3	-	1	1303	c.1151A>C	c.(1150-1152)aAc>aCc	p.N384T		NM_138733.4	NP_620061.2	P07205	PGK2_HUMAN	phosphoglycerate kinase 2	384					glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			autonomic_ganglia(1)|endometrium(3)|large_intestine(12)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	47	Lung NSC(77;0.0402)					ATCTTCAGTGTTCCATTTGGC	0.507																																					p.N384T		.											.	PGK2-91	0			c.A1151C						.						147.0	141.0	143.0					6																	49753750		2203	4300	6503	SO:0001583	missense	5232	exon1			TCAGTGTTCCATT	K03019	CCDS4930.1	6p12.3	2012-09-20		2002-04-19	ENSG00000170950	ENSG00000170950			8898	protein-coding gene	gene with protein product		172270				3839763, 3453121	Standard	NM_138733		Approved	PGKPS, PGK-2	uc003ozu.3	P07205	OTTHUMG00000014824	ENST00000304801.3:c.1151A>C	6.37:g.49753750T>G	ENSP00000305995:p.Asn384Thr	180	1		146	70	NM_138733	0	0	0	0	0	B2R6Y8|Q9H107	Missense_Mutation	SNP	ENST00000304801.3	37	CCDS4930.1	.	.	.	.	.	.	.	.	.	.	T	12.93	2.085711	0.36758	.	.	ENSG00000170950	ENST00000304801	D	0.92149	-2.98	4.19	1.78	0.24846	Phosphoglycerate kinase, C-terminal (1);	0.410526	0.30159	N	0.010262	D	0.88654	0.6495	M	0.84326	2.69	0.36655	D	0.877636	B	0.25521	0.128	B	0.36534	0.227	D	0.85501	0.1191	10	0.87932	D	0	-4.5155	7.5041	0.27534	0.0:0.188:0.0:0.812	.	384	P07205	PGK2_HUMAN	T	384	ENSP00000305995:N384T	ENSP00000305995:N384T	N	-	2	0	PGK2	49861709	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	3.650000	0.54424	0.392000	0.25172	-0.386000	0.06593	AAC	.		0.507	PGK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040872.1		
STX7	8417	broad.mit.edu	37	6	132793498	132793498	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr6:132793498A>G	ENST00000367941.2	-	4	285	c.172T>C	c.(172-174)Tat>Cat	p.Y58H	STX7_ENST00000448348.3_5'UTR|STX7_ENST00000367937.4_Missense_Mutation_p.Y58H	NM_003569.2	NP_003560.2	O15400	STX7_HUMAN	syntaxin 7	58					intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(1)|lung(5)	19	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		TGGTTAGTATACTGCTGCTTC	0.403																																					p.Y58H		.											.	STX7-90	0			c.T172C						.						154.0	132.0	139.0					6																	132793498		2203	4300	6503	SO:0001583	missense	8417	exon4			TAGTATACTGCTG	U77942	CCDS5153.1	6q23.1	2008-02-05			ENSG00000079950	ENSG00000079950			11442	protein-coding gene	gene with protein product		603217				9358037	Standard	NM_003569		Approved		uc003qdg.2	O15400	OTTHUMG00000015577	ENST00000367941.2:c.172T>C	6.37:g.132793498A>G	ENSP00000356918:p.Tyr58His	52	0		31	4	NM_003569	0	0	18	18	0	E1P579|Q5SZW2|Q96ES9	Missense_Mutation	SNP	ENST00000367941.2	37	CCDS5153.1	.	.	.	.	.	.	.	.	.	.	A	19.52	3.843617	0.71488	.	.	ENSG00000079950	ENST00000367941;ENST00000448348;ENST00000309255;ENST00000367937	T;T;T	0.29397	1.57;1.57;1.57	6.17	6.17	0.99709	t-SNARE (1);Syntaxin, N-terminal (2);	0.216383	0.50627	D	0.000117	T	0.19846	0.0477	L	0.53729	1.69	0.44816	D	0.997828	B	0.21381	0.055	B	0.21708	0.036	T	0.02683	-1.1124	10	0.34782	T	0.22	-10.8953	16.8222	0.85835	1.0:0.0:0.0:0.0	.	58	O15400	STX7_HUMAN	H	58	ENSP00000356918:Y58H;ENSP00000412202:Y58H;ENSP00000356914:Y58H	ENSP00000309600:Y58H	Y	-	1	0	STX7	132835191	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.354000	0.52254	2.371000	0.80710	0.533000	0.62120	TAT	.		0.403	STX7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042252.2		
CARD11	84433	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	2946306	2946306	+	Missense_Mutation	SNP	C	C	T	rs573740263		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr7:2946306C>T	ENST00000396946.4	-	25	3834	c.3431G>A	c.(3430-3432)cGc>cAc	p.R1144H		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1144					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GATGGTCTTGCGCTGCTCCTC	0.667			Mis		DLBCL								C|||	1	0.000199681	0.0008	0.0	5008	,	,		18014	0.0		0.0	False		,,,				2504	0.0				p.R1144H		.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11-870	0			c.G3431A						.						96.0	82.0	87.0					7																	2946306		2203	4300	6503	SO:0001583	missense	84433	exon25			GTCTTGCGCTGCT	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.3431G>A	7.37:g.2946306C>T	ENSP00000380150:p.Arg1144His	222	0		187	79	NM_032415	0	0	1	1	0	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	37	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496480	0.44352	.	.	ENSG00000198286	ENST00000396946	T	0.17370	2.28	3.68	2.78	0.32641	.	0.225701	0.30959	N	0.008535	T	0.15262	0.0368	L	0.53249	1.67	0.36211	D	0.851364	B	0.22851	0.076	B	0.14023	0.01	T	0.10800	-1.0614	10	0.40728	T	0.16	-22.3643	9.0282	0.36243	0.0:0.8156:0.0:0.1844	.	1144	Q9BXL7	CAR11_HUMAN	H	1144	ENSP00000380150:R1144H	ENSP00000380150:R1144H	R	-	2	0	CARD11	2912832	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.178000	0.42519	1.591000	0.50007	0.511000	0.50034	CGC	.		0.667	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
RAMP3	10268	hgsc.bcm.edu	37	7	45197433	45197433	+	Silent	SNP	G	G	A	rs67477213	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr7:45197433G>A	ENST00000242249.4	+	1	44	c.6G>A	c.(4-6)gaG>gaA	p.E2E	RAMP3_ENST00000496212.1_Silent_p.E2E|RAMP3_ENST00000481345.1_Silent_p.E2E	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	2					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CAGCCATGGAGACTGGAGCGC	0.771													G|||	1244	0.248403	0.4947	0.1657	5008	,	,		7876	0.0159		0.2276	False		,,,				2504	0.2352				p.E2E		.											.	RAMP3-90	0			c.G6A						.	G		1194,2386		196,802,792	3.0	3.0	3.0		6	2.0	0.0	7	dbSNP_130	3	1312,6004		141,1030,2487	no	coding-synonymous	RAMP3	NM_005856.2		337,1832,3279	AA,AG,GG		17.9333,33.352,22.9993		2/149	45197433	2506,8390	1790	3658	5448	SO:0001819	synonymous_variant	10268	exon1			CATGGAGACTGGA	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.6G>A	7.37:g.45197433G>A		0	0		10	10	NM_005856	0	0	0	18	18	Q7Z2Y1	Silent	SNP	ENST00000242249.4	37	CCDS5503.1																																																																																			G|0.760;A|0.240		0.771	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
ZAN	7455	bcgsc.ca	37	7	100374087	100374087	+	RNA	SNP	A	A	G	rs314300	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr7:100374087A>G	ENST00000348028.3	+	0	6382				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000542585.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGGAACTTCAATGATGAGGAA	0.483													A|||	1228	0.245208	0.1316	0.2839	5008	,	,		12725	0.0327		0.5408	False		,,,				2504	0.2863				.		.											.	ZAN-142	0			.						.	A	SER/ASN,SER/ASN	790,3222		79,632,1295	94.0	89.0	90.0		6217,6217	4.8	0.9	7	dbSNP_79	90	4373,4023		1130,2113,955	yes	missense,missense	ZAN	NM_003386.1,NM_173059.1	46,46	1209,2745,2250	GG,GA,AA		47.9157,19.6909,41.6103	probably-damaging,probably-damaging	2073/2813,2073/2722	100374087	5163,7245	2006	4198	6204			7455	.			ACTTCAATGATGA	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100374087A>G		207	3		224	7	.	0	0	0	0	0	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	ENST00000348028.3	37		617	0.2825091575091575	75	0.1524390243902439	114	0.3149171270718232	16	0.027972027972027972	412	0.5435356200527705	N	15.21	2.765624	0.49574	0.196909	0.520843	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	4.82	4.82	0.62117	von Willebrand factor, type D domain (3);	0.000000	0.48286	D	0.000194	T	0.00012	0.0000	.	.	.	0.36173	P	0.151084	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.997;0.998	T	0.51434	-0.8706	8	0.72032	D	0.01	.	11.3758	0.49726	1.0:0.0:0.0:0.0	rs314300;rs511897;rs1233159;rs17449864;rs57893639;rs314300	583;2072;2073	F5GX59;F5H0T8;Q9Y493	.;.;ZAN_HUMAN	S	2072;2072;2072;583	ENSP00000445943:N2072S;ENSP00000445091:N2072S;ENSP00000444427:N2072S;ENSP00000441117:N583S	ENSP00000445091:N2072S	N	+	2	0	ZAN	100212023	1.000000	0.71417	0.911000	0.35937	0.038000	0.13279	7.130000	0.77235	2.118000	0.64928	0.478000	0.44815	AAT	A|0.712;G|0.288		0.483	ZAN-006	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000347214.1	NM_003386	
CFTR	1080	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	117149172	117149172	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr7:117149172C>G	ENST00000003084.6	+	3	381	c.249C>G	c.(247-249)ttC>ttG	p.F83L	CFTR_ENST00000454343.1_Missense_Mutation_p.F83L	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	83	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GATTTATGTTCTATGGAATCT	0.313									Cystic Fibrosis																												p.F83L		.											.	CFTR-518	0			c.C249G						.						128.0	136.0	133.0					7																	117149172		2203	4300	6503	SO:0001583	missense	1080	exon3	Familial Cancer Database	CF	TATGTTCTATGGA	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.249C>G	7.37:g.117149172C>G	ENSP00000003084:p.Phe83Leu	34	0		57	22	NM_000492	0	0	0	0	0	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	ENST00000003084.6	37	CCDS5773.1	.	.	.	.	.	.	.	.	.	.	C	15.52	2.857174	0.51376	.	.	ENSG00000001626	ENST00000446805;ENST00000003084;ENST00000454343;ENST00000426809	D;D;D;D	0.99462	-5.94;-2.58;-2.58;-2.58	5.68	4.61	0.57282	ABC transporter, transmembrane domain, type 1 (1);	0.042931	0.85682	D	0.000000	D	0.96516	0.8863	N	0.11064	0.09	0.43902	D	0.996533	B	0.13145	0.007	B	0.22880	0.042	D	0.94460	0.7675	10	0.05351	T	0.99	-19.8907	15.5251	0.75898	0.0:0.9226:0.0:0.0774	.	83	P13569	CFTR_HUMAN	L	2;83;83;83	ENSP00000417012:F2L;ENSP00000003084:F83L;ENSP00000403677:F83L;ENSP00000389119:F83L	ENSP00000003084:F83L	F	+	3	2	CFTR	116936408	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.003000	0.29809	2.681000	0.91329	0.591000	0.81541	TTC	.		0.313	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059397.3	NM_000492	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	8	2		69	20	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
MCPH1	79648	broad.mit.edu	37	8	6302794	6302794	+	Silent	SNP	C	C	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:6302794C>T	ENST00000344683.5	+	8	1627	c.1551C>T	c.(1549-1551)gaC>gaT	p.D517D	MCPH1_ENST00000522905.1_Silent_p.D469D|MCPH1_ENST00000519480.1_Silent_p.D517D	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	517					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GGAAAGAAGACGCATGCCCAG	0.493																																					p.D517D	Colon(95;1448 1467 8277 34473 35819)	.											.	MCPH1-229	0			c.C1551T						.						86.0	87.0	87.0					8																	6302794		1911	4123	6034	SO:0001819	synonymous_variant	79648	exon8			AGAAGACGCATGC	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1551C>T	8.37:g.6302794C>T		144	0		189	7	NM_001172574	0	0	8	10	2	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Silent	SNP	ENST00000344683.5	37	CCDS43689.1																																																																																			.		0.493	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374532.2	NM_024596	
GPR124	25960	hgsc.bcm.edu;bcgsc.ca	37	8	37686420	37686420	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:37686420A>G	ENST00000412232.2	+	3	366	c.353A>G	c.(352-354)aAc>aGc	p.N118S	GPR124_ENST00000315215.7_Missense_Mutation_p.N118S	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	118					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CTGAGGAACAACATCATCAGC	0.682																																					p.N118S		.											.	GPR124-157	0			c.A353G						.						72.0	69.0	70.0					8																	37686420		2203	4300	6503	SO:0001583	missense	25960	exon3			GGAACAACATCAT	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.353A>G	8.37:g.37686420A>G	ENSP00000406367:p.Asn118Ser	39	0		48	8	NM_032777	0	0	0	0	0	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	37	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	A	18.10	3.549329	0.65311	.	.	ENSG00000020181	ENST00000428068;ENST00000416514;ENST00000315215;ENST00000412232	D;D;D	0.95205	-3.64;-3.64;-3.64	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.97845	0.9292	M	0.93720	3.45	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.968	D	0.98266	1.0501	10	0.46703	T	0.11	-21.2223	14.641	0.68726	1.0:0.0:0.0:0.0	.	118;118	Q96PE1-2;Q96PE1	.;GP124_HUMAN	S	76;111;118;118	ENSP00000400860:N76S;ENSP00000323508:N118S;ENSP00000406367:N118S	ENSP00000323508:N118S	N	+	2	0	GPR124	37805578	1.000000	0.71417	0.913000	0.36048	0.198000	0.23893	7.825000	0.86693	2.200000	0.70718	0.459000	0.35465	AAC	.		0.682	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		0	0	1096	60	11	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
ODF1	4956	ucsc.edu	37	8	103573037	103573037	+	Silent	SNP	G	G	C	rs143802899|rs568456031|rs377699584|rs62523273|rs386728348|rs58232162	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:103573037G>C	ENST00000285402.3	+	2	834	c.678G>C	c.(676-678)ccG>ccC	p.P226P	ODF1_ENST00000518835.1_Silent_p.P19P	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	226	C-X-P repeat region.		Missing. {ECO:0000269|PubMed:8111388}.		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.C218_P226delCNPCSPCNP(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			cctgcaacccgtgcagcccAT	0.547																																					p.P226P		.											.	ODF1-70	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.G678C						.	C		691,3579		206,279,1650	52.0	62.0	58.0		678	-2.8	0.9	8	dbSNP_129	58	540,7902		123,294,3804	no	coding-synonymous	ODF1	NM_024410.3		329,573,5454	CC,CG,GG		6.3966,16.1827,9.6838		226/251	103573037	1231,11481	2135	4221	6356	SO:0001819	synonymous_variant	4956	exon2			CAACCCGTGCAGC	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.678G>C	8.37:g.103573037G>C		93	1		112	39	NM_024410	0	0	1	1	0	Q3SX72	Silent	SNP	ENST00000285402.3	37	CCDS6293.1																																																																																			G|0.862;C|0.138		0.547	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1		
ODF1	4956	ucsc.edu	37	8	103573042	103573042	+	Missense_Mutation	SNP	G	G	A	rs59109601|rs11992195|rs386728348	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:103573042G>A	ENST00000285402.3	+	2	839	c.683G>A	c.(682-684)aGc>aAc	p.S228N	ODF1_ENST00000518835.1_Missense_Mutation_p.S21N	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	228	C-X-P repeat region.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			aacccgtgcagcccATATGAT	0.532																																					p.S228N		.											.	ODF1-70	0			c.G683A						.	A	ASN/SER	536,3838		65,406,1716	62.0	77.0	72.0		683	-2.7	0.0	8	dbSNP_120	72	18,8582		0,18,4282	yes	missense	ODF1	NM_024410.3	46	65,424,5998	AA,AG,GG		0.2093,12.2542,4.2701	benign	228/251	103573042	554,12420	2187	4300	6487	SO:0001583	missense	4956	exon2			CGTGCAGCCCATA	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.683G>A	8.37:g.103573042G>A	ENSP00000285402:p.Ser228Asn	91	1		113	40	NM_024410	0	0	1	1	0	Q3SX72	Missense_Mutation	SNP	ENST00000285402.3	37	CCDS6293.1	118	0.05402930402930403	102	0.2073170731707317	7	0.019337016574585635	6	0.01048951048951049	3	0.00395778364116095	A	0.005	-2.132544	0.00338	0.122542	0.002093	ENSG00000155087	ENST00000285402;ENST00000518835	D;T	0.85861	-2.04;1.83	5.51	-2.68	0.06041	.	0.192721	0.37393	N	0.002106	T	0.00073	0.0002	N	0.01048	-1.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.11665	-1.0578	9	0.02654	T	1	-12.6038	13.1343	0.59402	0.4393:0.0:0.5607:0.0	rs11992195;rs11992195	228	Q14990	ODFP1_HUMAN	N	228;21	ENSP00000285402:S228N;ENSP00000430023:S21N	ENSP00000285402:S228N	S	+	2	0	ODF1	103642218	0.004000	0.15560	0.020000	0.16555	0.024000	0.10985	-0.613000	0.05610	-0.912000	0.03837	-1.966000	0.00469	AGC	G|0.993;A|0.007		0.532	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1		
DPYS	1807	hgsc.bcm.edu	37	8	105479146	105479146	+	Start_Codon_SNP	SNP	C	C	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:105479146C>T	ENST00000351513.2	-	1	135	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase	1					beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AGGGCGCCGCCATAGCGAGGG	0.756																																					p.M1I		.											.	DPYS-229	0			c.G3A						.						3.0	4.0	4.0					8																	105479146		1441	2897	4338	SO:0001582	initiator_codon_variant	1807	exon1			CGCCGCCATAGCG	D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.3G>A	8.37:g.105479146C>T	ENSP00000276651:p.Met1Ile	1	0		23	11	NM_001385	0	0	0	0	0		Missense_Mutation	SNP	ENST00000351513.2	37	CCDS6302.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.037226	0.54896	.	.	ENSG00000147647	ENST00000351513;ENST00000521573	D;D	0.85258	-1.88;-1.96	4.47	4.47	0.54385	.	0.122369	0.52532	D	0.000073	T	0.74869	0.3773	.	.	.	0.80722	D	1	D	0.55385	0.971	B	0.39465	0.3	T	0.72865	-0.4163	9	0.23891	T	0.37	-24.3584	10.3643	0.44015	0.0:0.9049:0.0:0.0951	.	1	Q14117	DPYS_HUMAN	I	1	ENSP00000276651:M1I;ENSP00000430246:M1I	ENSP00000276651:M1I	M	-	3	0	DPYS	105548322	0.997000	0.39634	0.996000	0.52242	0.437000	0.31866	3.986000	0.56937	2.316000	0.78162	0.585000	0.79938	ATG	.		0.756	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380814.1	NM_001385	Missense_Mutation
ENPP2	5168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	120594822	120594822	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:120594822C>G	ENST00000075322.6	-	18	1622	c.1564G>C	c.(1564-1566)Gct>Cct	p.A522P	ENPP2_ENST00000427067.2_Missense_Mutation_p.A518P|ENPP2_ENST00000522167.1_Missense_Mutation_p.A161P|ENPP2_ENST00000259486.6_Missense_Mutation_p.A574P|ENPP2_ENST00000522826.1_Missense_Mutation_p.A522P	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	522					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TTATTAGGAGCTGGCTTCAAT	0.418																																					p.A574P	Melanoma(20;305 879 2501 4818 31020)	.											.	ENPP2-292	0			c.G1720C						.						129.0	135.0	133.0					8																	120594822		2203	4300	6503	SO:0001583	missense	5168	exon19			TAGGAGCTGGCTT	D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.1564G>C	8.37:g.120594822C>G	ENSP00000075322:p.Ala522Pro	90	0		162	44	NM_006209	0	0	365	365	0	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	ENST00000075322.6	37	CCDS34936.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.754901	0.89843	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522167;ENST00000522826;ENST00000075322	T;T;T;T;T	0.79141	-1.01;-0.95;-1.24;-0.95;-0.97	6.08	6.08	0.98989	.	0.094099	0.64402	D	0.000001	D	0.88055	0.6334	M	0.66939	2.045	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.80764	0.994;0.976;0.979;0.994;0.989	D	0.87665	0.2537	10	0.87932	D	0	.	20.6634	0.99662	0.0:1.0:0.0:0.0	.	39;522;522;574;161	B4DJD3;E9PHP7;Q13822;Q13822-2;E5RIA2	.;.;ENPP2_HUMAN;.;.	P	574;518;161;522;522	ENSP00000259486:A574P;ENSP00000403315:A518P;ENSP00000429476:A161P;ENSP00000428291:A522P;ENSP00000075322:A522P	ENSP00000075322:A522P	A	-	1	0	ENPP2	120664003	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.667000	0.68067	2.894000	0.99253	0.655000	0.94253	GCT	.		0.418	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000381390.1		
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		2	0		35	12	NM_030895	0	0	4	8	4	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
FAM83H	286077	hgsc.bcm.edu	37	8	144810138	144810138	+	Missense_Mutation	SNP	G	G	A	rs1137806	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:144810138G>A	ENST00000388913.3	-	5	1618	c.1493C>T	c.(1492-1494)cCg>cTg	p.P498L		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	498					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCCGAGCTCCGGGAAGCGGGG	0.771													G|||	831	0.165935	0.0083	0.147	5008	,	,		6578	0.247		0.1451	False		,,,				2504	0.3303				p.P498L		.											.	FAM83H-92	0			c.C1493T						.	G	LEU/PRO	64,3096		3,58,1519	4.0	7.0	6.0		1493	4.4	0.3	8	dbSNP_86	6	767,6345		32,703,2821	no	missense	FAM83H	NM_198488.3	98	35,761,4340	AA,AG,GG		10.7846,2.0253,8.09	benign	498/1180	144810138	831,9441	1580	3556	5136	SO:0001583	missense	286077	exon5			AGCTCCGGGAAGC	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.1493C>T	8.37:g.144810138G>A	ENSP00000373565:p.Pro498Leu	1	0		20	12	NM_198488	0	0	7	16	9	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	321	0.14697802197802198	19	0.03861788617886179	46	0.1270718232044199	147	0.256993006993007	109	0.1437994722955145	N	15.31	2.796089	0.50208	0.020253	0.107846	ENSG00000180921	ENST00000388913	T	0.15256	2.44	4.45	4.45	0.53987	.	425.438000	0.00924	U	0.002638	T	0.00012	0.0000	L	0.32530	0.975	0.49299	P	2.2400000000000198E-4	D	0.76494	0.999	P	0.61275	0.886	T	0.14090	-1.0485	9	0.56958	D	0.05	.	12.8618	0.57918	0.0:0.0:0.8368:0.1632	rs1137806;rs3201609	498	Q6ZRV2	FA83H_HUMAN	L	498	ENSP00000373565:P498L	ENSP00000373565:P498L	P	-	2	0	FAM83H	144882126	1.000000	0.71417	0.283000	0.24790	0.537000	0.34900	4.979000	0.63806	2.010000	0.58986	0.455000	0.32223	CCG	G|0.853;A|0.147		0.771	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000354589.3_Silent_p.A1969A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		0	0		60	28	NM_201380	0	0	9	18	9	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144999417	144999417	+	Silent	SNP	C	C	T	rs55836855	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:144999417C>T	ENST00000322810.4	-	31	5260	c.5091G>A	c.(5089-5091)gcG>gcA	p.A1697A	PLEC_ENST00000354958.2_Silent_p.A1538A|PLEC_ENST00000436759.2_Silent_p.A1587A|PLEC_ENST00000356346.3_Silent_p.A1546A|PLEC_ENST00000527096.1_Silent_p.A1583A|PLEC_ENST00000345136.3_Silent_p.A1560A|PLEC_ENST00000398774.2_Silent_p.A1528A|PLEC_ENST00000357649.2_Silent_p.A1564A|PLEC_ENST00000354589.3_Silent_p.A1560A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1697	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTACCTGCCGCGCTCGCTCCA	0.741													C|||	1156	0.230831	0.028	0.2954	5008	,	,		8861	0.1429		0.4274	False		,,,				2504	0.3476				p.A1697A		.											.	PLEC-141	0			c.G5091A						.	C	,,,,,,,	258,3112		16,226,1443	6.0	7.0	7.0		4761,4638,4614,5091,4584,4680,4692,4680	-9.4	0.1	8	dbSNP_129	7	2520,4470		444,1632,1419	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	460,1858,2862	TT,TC,CC		36.0515,7.6558,26.8147	,,,,,,,	1587/4575,1546/4534,1538/4526,1697/4685,1528/4516,1560/4548,1564/4552,1560/4548	144999417	2778,7582	1685	3495	5180	SO:0001819	synonymous_variant	5339	exon31			CTGCCGCGCTCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5091G>A	8.37:g.144999417C>T		1	0		18	10	NM_201380	0	0	1	1	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.731;T|0.269		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	0	0		40	20	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000354589.3_Silent_p.L1184L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		0	0		53	24	NM_201380	0	0	16	25	9	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
SCRT1	83482	hgsc.bcm.edu	37	8	145557497	145557497	+	Missense_Mutation	SNP	A	A	C	rs7013127	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:145557497A>C	ENST00000332135.4	-	2	508	c.397T>G	c.(397-399)Tct>Gct	p.S133A		NM_031309.4	NP_112599.2	Q9BWW7	SCRT1_HUMAN	scratch family zinc finger 1	133			S -> A (in dbSNP:rs7013127). {ECO:0000269|Ref.2}.		negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neuron migration (GO:2001222)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|upper_aerodigestive_tract(1)	3	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;1.35e-39)|all cancers(56;1.37e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			GCGGCGGCAGAGCCGGCATTG	0.776													c|||	4719	0.942292	0.9418	0.9568	5008	,	,		3920	0.9921		0.8956	False		,,,				2504	0.9294				p.S133A		.											.	.	0			c.T397G						.						1.0	1.0	1.0					8																	145557497		634	1472	2106	SO:0001583	missense	83482	exon2			CGGCAGAGCCGGC	BC014675	CCDS6421.1	8q24.3	2013-10-09	2013-10-09		ENSG00000170616	ENSG00000261678		"""Zinc fingers, C2H2-type"""	15950	protein-coding gene	gene with protein product		605858	"""scratch (drosophila homolog) 1, zinc finger protein"", ""scratch homolog 1, zinc finger protein (Drosophila)"""			11274425	Standard	NM_031309		Approved	DKFZp547F072, ZNF898	uc003zbw.1	Q9BWW7	OTTHUMG00000165229	ENST00000332135.4:c.397T>G	8.37:g.145557497A>C	ENSP00000331692:p.Ser133Ala	0	0		7	7	NM_031309	0	0	0	0	0	A8MX66|Q96C52	Missense_Mutation	SNP	ENST00000332135.4	37	CCDS6421.1	1975	0.9043040293040293	396	0.8048780487804879	339	0.93646408839779	552	0.965034965034965	688	0.9076517150395779	c	0.007	-1.995963	0.00435	.	.	ENSG00000170616	ENST00000332135	T	0.06933	3.24	0.926	-0.0566	0.13805	.	.	.	.	.	T	0.00012	0.0000	N	0.02539	-0.55	0.58432	P	5.999999999950489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.33879	-0.9851	8	0.05525	T	0.97	5.8842	6.2142	0.20646	0.3034:0.6966:0.0:0.0	rs7013127	133	Q9BWW7	SCRT1_HUMAN	A	133	ENSP00000331692:S133A	ENSP00000331692:S133A	S	-	1	0	SCRT1	145528305	.	.	0.675000	0.29917	0.381000	0.30169	.	.	-1.712000	0.01393	-3.289000	0.00047	TCT	A|0.096;C|0.904		0.776	SCRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382800.2	NM_031309	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		39	38	NM_213605	0	0	0	7	7		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
JAK2	3717	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	5055714	5055714	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr9:5055714A>G	ENST00000381652.3	+	8	1476	c.982A>G	c.(982-984)Att>Gtt	p.I328V	JAK2_ENST00000539801.1_Missense_Mutation_p.I328V|JAK2_ENST00000544510.1_Missense_Mutation_p.I179V	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	328	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	TGATGTCAGTATTAAGCAAGC	0.299		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.I328V		.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2-75307	0			c.A982G						.						80.0	81.0	80.0					9																	5055714		2203	4296	6499	SO:0001583	missense	3717	exon8	Familial Cancer Database		GTCAGTATTAAGC		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.982A>G	9.37:g.5055714A>G	ENSP00000371067:p.Ile328Val	51	0		21	10	NM_004972	0	0	1	1	0	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	A	14.64	2.596585	0.46318	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	T;T;T	0.65916	-0.18;-0.18;-0.18	5.78	4.65	0.58169	FERM domain (1);	0.047099	0.85682	D	0.000000	T	0.55033	0.1895	L	0.55103	1.725	0.46901	D	0.999244	B	0.26902	0.163	B	0.19666	0.026	T	0.54390	-0.8301	10	0.59425	D	0.04	-13.9874	10.1755	0.42935	0.8623:0.0:0.1377:0.0	.	328	O60674	JAK2_HUMAN	V	328;328;179	ENSP00000440387:I328V;ENSP00000371067:I328V;ENSP00000443103:I179V	ENSP00000371067:I328V	I	+	1	0	JAK2	5045714	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.921000	0.75805	1.029000	0.39812	0.533000	0.62120	ATT	.		0.299	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
JAK2	3717	broad.mit.edu	37	9	5089735	5089735	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr9:5089735T>C	ENST00000381652.3	+	20	3127	c.2633T>C	c.(2632-2634)gTg>gCg	p.V878A	JAK2_ENST00000539801.1_Missense_Mutation_p.V878A|JAK2_ENST00000544510.1_Missense_Mutation_p.V729A	NM_004972.3	NP_004963.1	O60674	JAK2_HUMAN	Janus kinase 2	878	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin filament polymerization (GO:0030041)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon regeneration (GO:0031103)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone receptor signaling pathway (GO:0060396)|histone H3-Y41 phosphorylation (GO:0035409)|hormone-mediated signaling pathway (GO:0009755)|host programmed cell death induced by symbiont (GO:0034050)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-12-mediated signaling pathway (GO:0035722)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|mammary gland epithelium development (GO:0061180)|mesoderm development (GO:0007498)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA binding (GO:0043392)|negative regulation of heart contraction (GO:0045822)|negative regulation of neuron apoptotic process (GO:0043524)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell activation (GO:0050867)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA binding (GO:0043388)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of inflammatory response (GO:0050729)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to antibiotic (GO:0046677)|response to hydroperoxide (GO:0033194)|response to interleukin-12 (GO:0070671)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|tyrosine phosphorylation of STAT protein (GO:0007260)|tyrosine phosphorylation of Stat1 protein (GO:0042508)|tyrosine phosphorylation of Stat3 protein (GO:0042503)|tyrosine phosphorylation of Stat5 protein (GO:0042506)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome lumen (GO:0031904)|membrane raft (GO:0045121)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|heme binding (GO:0020037)|histone binding (GO:0042393)|histone kinase activity (H3-Y41 specific) (GO:0035401)|interleukin-12 receptor binding (GO:0005143)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)		BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)|ETV6/JAK2(11)|PCM1/JAK2(30)|PAX5/JAK2(18)	breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(32944)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(4)|skin(2)|urinary_tract(1)	32998	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	ACTGGGGAGGTGGTCGCTGTA	0.428		1	"""T, Mis, O"""	"""ETV6, PCM1, BCR"""	"""ALL, AML, MPD,  CML"""				Polycythemia Vera, Familial																												p.V878A		.		Dom	yes		9	9p24	3717	Janus kinase 2		L	.	JAK2-75307	0			c.T2633C						.						144.0	131.0	135.0					9																	5089735		2203	4300	6503	SO:0001583	missense	3717	exon20	Familial Cancer Database		GGGAGGTGGTCGC		CCDS6457.1	9p24	2014-09-17	2009-04-23		ENSG00000096968	ENSG00000096968	2.7.10.1	"""SH2 domain containing"""	6192	protein-coding gene	gene with protein product		147796				1848670	Standard	NM_004972		Approved	JTK10	uc003ziw.3	O60674	OTTHUMG00000019490	ENST00000381652.3:c.2633T>C	9.37:g.5089735T>C	ENSP00000371067:p.Val878Ala	109	0		48	4	NM_004972	0	0	3	3	0	O14636|O75297	Missense_Mutation	SNP	ENST00000381652.3	37	CCDS6457.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.067140	0.76301	.	.	ENSG00000096968	ENST00000539801;ENST00000381652;ENST00000544510	D;D;D	0.81908	-1.55;-1.55;-1.55	5.28	4.12	0.48240	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79941	0.4533	N	0.10664	0.02	0.80722	D	1	D	0.63046	0.992	D	0.64506	0.926	T	0.81870	-0.0734	10	0.62326	D	0.03	-11.3218	11.4413	0.50099	0.1353:0.0:0.0:0.8647	.	878	O60674	JAK2_HUMAN	A	878;878;729	ENSP00000440387:V878A;ENSP00000371067:V878A;ENSP00000443103:V729A	ENSP00000371067:V878A	V	+	2	0	JAK2	5079735	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.594000	0.82698	0.817000	0.34445	0.528000	0.53228	GTG	.		0.428	JAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051609.1		
ANKRD18B	441459	bcgsc.ca	37	9	33524684	33524684	+	Missense_Mutation	SNP	G	G	A	rs3843933	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr9:33524684G>A	ENST00000290943.6	+	1	293	c.197G>A	c.(196-198)aGa>aAa	p.R66K		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	66										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						GTCCGCGACAGAAAAGACAGG	0.706													.|||	3772	0.753195	0.562	0.7363	5008	,	,		12251	0.8462		0.7952	False		,,,				2504	0.8845				p.R66K		.											.	.	0			c.G197A						.																																			SO:0001583	missense	441459	exon1			GCGACAGAAAAGA			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.197G>A	9.37:g.33524684G>A	ENSP00000290943:p.Arg66Lys	90	1		60	4	NM_001244752	0	0	0	0	0		Missense_Mutation	SNP	ENST00000290943.6	37		1642	0.7518315018315018	269	0.5467479674796748	275	0.7596685082872928	497	0.8688811188811189	601	0.7928759894459103	g	0.038	-1.296759	0.01364	.	.	ENSG00000230453	ENST00000290943	T	0.27890	1.64	1.19	-0.0771	0.13720	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.21627	N	0.99962	.	.	.	.	.	.	T	0.37079	-0.9721	5	0.02654	T	1	.	3.0271	0.06095	0.6689:0.0:0.3311:0.0	rs3843933;rs16935561;rs3843933	.	.	.	K	66	ENSP00000290943:R66K	ENSP00000290943:R66K	R	+	2	0	ANKRD18B	33514684	0.001000	0.12720	0.002000	0.10522	0.011000	0.07611	-0.204000	0.09425	-0.031000	0.13781	0.298000	0.19748	AGA	G|0.284;A|0.716		0.706	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000313729.2	XM_001718334	
ODF2	4957	broad.mit.edu	37	9	131245096	131245096	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr9:131245096G>T	ENST00000434106.3	+	10	1280	c.917G>T	c.(916-918)cGc>cTc	p.R306L	ODF2_ENST00000372814.3_Splice_Site_p.R350L|ODF2_ENST00000444119.2_Splice_Site_p.R282L|ODF2_ENST00000372791.3_Splice_Site_p.R287L|ODF2_ENST00000535026.1_3'UTR|ODF2_ENST00000393533.2_Splice_Site_p.R306L|ODF2_ENST00000604420.1_Splice_Site_p.R306L|ODF2_ENST00000448249.3_Splice_Site_p.R225L|ODF2_ENST00000393527.3_Splice_Site_p.R282L|ODF2_ENST00000351030.3_Splice_Site_p.R301L|ODF2_ENST00000546203.1_Splice_Site_p.R287L|ODF2_ENST00000372807.5_Splice_Site_p.R301L	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	306					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						CTCTCCCAGCGCCTGCTGTTA	0.522																																					p.R370L		.											.	ODF2-69	0			c.G1109T						.						66.0	72.0	70.0					9																	131245096		2203	4300	6503	SO:0001630	splice_region_variant	4957	exon10			CCCAGCGCCTGCT	AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.916-1G>T	9.37:g.131245096G>T		150	1		120	4	NM_153435	0	0	0	0	0	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Missense_Mutation	SNP	ENST00000434106.3	37	CCDS56588.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948694	0.53186	.	.	ENSG00000136811	ENST00000393533;ENST00000372814;ENST00000351030;ENST00000372796;ENST00000303890;ENST00000448249;ENST00000546203;ENST00000372791	T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;1.82;0.95;0.95;0.95	5.66	2.68	0.31781	.	0.552387	0.21440	N	0.074507	T	0.26340	0.0643	L	0.34521	1.04	0.80722	D	1	P;P;P;B;P;P;B;P;P;P	0.42375	0.557;0.551;0.683;0.359;0.778;0.778;0.408;0.557;0.551;0.551	B;B;B;B;B;B;B;B;B;B	0.38842	0.095;0.121;0.229;0.089;0.184;0.283;0.184;0.095;0.121;0.184	T	0.04373	-1.0956	10	0.48119	T	0.1	-7.0512	3.5239	0.07752	0.3275:0.0:0.5038:0.1688	.	287;301;225;240;306;350;301;287;306;282	Q5BJF6-8;Q5BJF6-4;Q5BJF6-9;Q5BJF6-2;B4DX73;Q5BJF6-7;B1AND4;Q5BJF6-5;Q5BJF6;Q5BJF6-3	.;.;.;.;.;.;.;.;ODFP2_HUMAN;.	L	306;350;301;306;282;225;287;287	ENSP00000377166:R306L;ENSP00000361901:R350L;ENSP00000342581:R301L;ENSP00000361882:R306L;ENSP00000307781:R282L;ENSP00000396687:R225L;ENSP00000437579:R287L;ENSP00000361877:R287L	ENSP00000307781:R282L	R	+	2	0	ODF2	130284917	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	2.513000	0.45494	0.750000	0.32877	0.561000	0.74099	CGC	.		0.522	ODF2-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054449.3		Missense_Mutation
CCBL1	883	broad.mit.edu	37	9	131597770	131597770	+	Silent	SNP	G	G	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr9:131597770G>T	ENST00000302586.3	-	10	1194	c.1032C>A	c.(1030-1032)atC>atA	p.I344I	CCBL1_ENST00000483599.1_5'UTR|CCBL1_ENST00000320665.6_Silent_p.I294I|CCBL1_ENST00000436267.2_Silent_p.I438I	NM_001122671.1|NM_004059.4	NP_001116143.1|NP_004050.3	Q16773	KAT1_HUMAN	cysteine conjugate-beta lyase, cytoplasmic	344					cellular amino acid biosynthetic process (GO:0008652)|cellular modified amino acid metabolic process (GO:0006575)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine catabolic process (GO:0097053)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|glutamine-phenylpyruvate transaminase activity (GO:0047316)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-glutamine:pyruvate aminotransferase activity (GO:0047945)|L-phenylalanine-oxaloacetate transaminase activity (GO:0036141)|L-phenylalanine:pyruvate aminotransferase activity (GO:0047312)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)	18					L-Glutamine(DB00130)	TGAAGTCTGAGATGTCTGTGA	0.607																																					p.I344I		.											.	CCBL1-91	0			c.C1032A						.						84.0	84.0	84.0					9																	131597770		2109	4237	6346	SO:0001819	synonymous_variant	883	exon10			GTCTGAGATGTCT	Y17448	CCDS43884.1, CCDS48038.1, CCDS75915.1	9q34.11	2008-03-11	2008-03-11		ENSG00000171097	ENSG00000171097	2.6.1.64		1564	protein-coding gene	gene with protein product	"""glutamine transaminase K"", ""kyneurenine aminotransferase"""	600547	"""cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)"""			7883047	Standard	NM_001122671		Approved	KATI, GTK	uc004bwh.3	Q16773	OTTHUMG00000020767	ENST00000302586.3:c.1032C>A	9.37:g.131597770G>T		76	0		113	3	NM_001122671	0	0	0	0	0	Q5T275|Q8N191	Silent	SNP	ENST00000302586.3	37	CCDS43884.1																																																																																			.		0.607	CCBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054521.2		
LRRC26	389816	hgsc.bcm.edu	37	9	140064315	140064315	+	Missense_Mutation	SNP	C	C	A	rs7019671	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr9:140064315C>A	ENST00000371542.3	-	1	188	c.81G>T	c.(79-81)caG>caT	p.Q27H	RP11-350O14.18_ENST00000568665.1_RNA|MIR3621_ENST00000580529.1_RNA|TMEM210_ENST00000430332.1_5'Flank	NM_001013653.2	NP_001013675.1	Q2I0M4	LRC26_HUMAN	leucine rich repeat containing 26	27				Q -> H (in Ref. 1; ABC79623 and 3; AAI40912). {ECO:0000305}.	ion transport (GO:0006811)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|voltage-gated potassium channel complex (GO:0008076)	potassium channel regulator activity (GO:0015459)					all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		TGGCCGACACCTGGGCCCAGA	0.766													C|||	1433	0.286142	0.1415	0.3833	5008	,	,		11222	0.1567		0.3857	False		,,,				2504	0.4438				p.Q27H		.											.	LRRC26-22	0			c.G81T						.	C	HIS/GLN	338,2078		47,244,917	2.0	2.0	2.0		81	-5.4	0.0	9	dbSNP_116	2	1741,3449		368,1005,1222	no	missense	LRRC26	NM_001013653.2	24	415,1249,2139	AA,AC,CC		33.5453,13.9901,27.3337	probably-damaging	27/335	140064315	2079,5527	1208	2595	3803	SO:0001583	missense	389816	exon1			CGACACCTGGGCC	DQ355157	CCDS35184.1	9q34.3	2007-06-13			ENSG00000184709	ENSG00000184709			31409	protein-coding gene	gene with protein product		613505					Standard	NM_001013653		Approved	bA350O14.10, OTTHUMG00000020980	uc004clp.2	Q2I0M4	OTTHUMG00000020980	ENST00000371542.3:c.81G>T	9.37:g.140064315C>A	ENSP00000360597:p.Gln27His	0	0		6	6	NM_001013653	0	0	0	0	0	B9EIR7|C3RUL3|Q5VSG2	Missense_Mutation	SNP	ENST00000371542.3	37	CCDS35184.1	582	0.2664835164835165	61	0.12398373983739837	140	0.3867403314917127	77	0.1346153846153846	304	0.40105540897097625	C	12.58	1.979230	0.34942	0.139901	0.335453	ENSG00000184709	ENST00000371542	T	0.66280	-0.2	3.5	-5.42	0.02640	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.10296	0.003	B	0.04013	0.001	T	0.37220	-0.9715	8	0.46703	T	0.11	.	1.2009	0.01884	0.1317:0.2276:0.2613:0.3794	rs7019671	27	Q2I0M4	LRC26_HUMAN	H	27	ENSP00000360597:Q27H	ENSP00000360597:Q27H	Q	-	3	2	LRRC26	139184136	0.000000	0.05858	0.000000	0.03702	0.085000	0.17905	-0.219000	0.09228	-1.024000	0.03338	-0.379000	0.06801	CAG	C|0.733;A|0.267		0.766	LRRC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055307.1	NM_001013653	
PPP2R3B	28227	bcgsc.ca	37	X	299360	299360	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:299360G>A	ENST00000390665.3	-	12	1574	c.1556C>T	c.(1555-1557)gCg>gTg	p.A519V		NM_013239.4	NP_037371.2	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'', beta	519			A -> V (in dbSNP:rs1133520). {ECO:0000269|PubMed:15489334}.		cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|phosphoprotein phosphatase activity (GO:0004721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(5)|lung(5)|skin(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGGCTCTCCCGCAGTCTCCTC	0.692													G|||	1043	0.208267	0.1135	0.2133	5008	,	,		11088	0.2222		0.3012	False		,,,				2504	0.2229				p.A519V		.											.	PPP2R3B-136	0			c.C1556T						.	G	VAL/ALA	680,3680		59,562,1559	74.0	66.0	69.0		1556	0.9	0.0	X	dbSNP_134	69	2514,6044		372,1770,2137	no	missense	PPP2R3B	NM_013239.4	64	431,2332,3696	AA,AG,GG		29.376,15.5963,24.7252	possibly-damaging	519/576	299360	3194,9724	2180	4279	6459	SO:0001583	missense	28227	exon12			TCTCCCGCAGTCT	AF215840	CCDS14104.1	Xp22.3 and Yp11.3	2013-01-10	2010-06-18		ENSG00000167393	ENSG00000167393		"""Pseudoautosomal regions / PAR1"", ""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	13417	protein-coding gene	gene with protein product		300339	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta"""	PPP2R3L		11173861	Standard	NM_013239		Approved	PPP2R3LY, PR48	uc004cpg.3	Q9Y5P8	OTTHUMG00000021052	ENST00000390665.3:c.1556C>T	X.37:g.299360G>A	ENSP00000375080:p.Ala519Val	70	0		70	4	NM_013239	0	0	0	0	0	Q6P4G9|Q7RTT1|Q96H01	Missense_Mutation	SNP	ENST00000390665.3	37	CCDS14104.1	504	0.23076923076923078	56	0.11382113821138211	87	0.24033149171270718	129	0.22552447552447552	232	0.30606860158311344	G	13.72	2.322172	0.41096	0.155963	0.29376	ENSG00000167393	ENST00000390665	T	0.47528	0.84	1.87	0.895	0.19247	.	0.000000	0.64402	U	0.000001	T	0.00012	0.0000	L	0.56769	1.78	0.09310	N	0.999999	D	0.61697	0.99	P	0.55112	0.769	T	0.01711	-1.1290	10	0.66056	D	0.02	.	7.588	0.28004	0.1538:0.0:0.8462:0.0	.	519	Q9Y5P8	P2R3B_HUMAN	V	519	ENSP00000375080:A519V	ENSP00000375080:A519V	A	-	2	0	PPP2R3B	219360	1.000000	0.71417	0.004000	0.12327	0.040000	0.13550	2.464000	0.45067	0.487000	0.27698	0.174000	0.16983	GCG	G|0.755;A|0.245		0.692	PPP2R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055577.2	NM_013239	
FRMPD4	9758	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	12736016	12736016	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:12736016C>A	ENST00000380682.1	+	16	3577	c.3071C>A	c.(3070-3072)aCt>aAt	p.T1024N		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	1024					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						TACTCCTGCACTAGCAAAAGG	0.512																																					p.T1024N		.											.	FRMPD4-263	0			c.C3071A						.						102.0	87.0	92.0					X																	12736016		2203	4300	6503	SO:0001583	missense	9758	exon16			CCTGCACTAGCAA	AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.3071C>A	X.37:g.12736016C>A	ENSP00000370057:p.Thr1024Asn	382	1		203	123	NM_014728	0	0	0	0	0	A8K0X9|O15032	Missense_Mutation	SNP	ENST00000380682.1	37	CCDS35201.1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352235	0.41700	.	.	ENSG00000169933	ENST00000380682;ENST00000429478;ENST00000304087	T	0.06449	3.3	5.36	4.48	0.54585	.	0.065150	0.64402	D	0.000009	T	0.10937	0.0267	M	0.63428	1.95	0.32368	N	0.556203	P;P	0.46395	0.877;0.877	B;B	0.43360	0.417;0.417	T	0.05818	-1.0862	10	0.72032	D	0.01	-11.4348	12.8981	0.58111	0.1627:0.8373:0.0:0.0	.	1016;1024	B7ZLE1;Q14CM0	.;FRPD4_HUMAN	N	1024;1015;1013	ENSP00000370057:T1024N	ENSP00000304583:T1013N	T	+	2	0	FRMPD4	12645937	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.383000	0.52471	1.006000	0.39211	0.513000	0.50165	ACT	.		0.512	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055771.1	XM_045712	
SCML2	10389	broad.mit.edu;bcgsc.ca	37	X	18343062	18343062	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:18343062C>A	ENST00000251900.4	-	4	286	c.127G>T	c.(127-129)Ggg>Tgg	p.G43W		NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	43					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CTTATAGACCCAGTCTCTTTC	0.373																																					p.G43W	Esophageal Squamous(100;1252 1965 19021 35517)	.											.	SCML2-226	0			c.G127T						.						118.0	108.0	112.0					X																	18343062		2203	4300	6503	SO:0001583	missense	10389	exon4			TAGACCCAGTCTC	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.127G>T	X.37:g.18343062C>A	ENSP00000251900:p.Gly43Trp	388	1		203	6	NM_006089	0	0	0	0	0	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Missense_Mutation	SNP	ENST00000251900.4	37	CCDS14185.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.291177	0.59976	.	.	ENSG00000102098	ENST00000251900	T	0.20738	2.05	4.62	3.75	0.43078	.	0.338199	0.31221	N	0.008023	T	0.45776	0.1359	M	0.79805	2.47	0.80722	D	1	D	0.71674	0.998	D	0.68039	0.955	T	0.49670	-0.8915	10	0.72032	D	0.01	.	12.663	0.56824	0.0:0.9163:0.0:0.0837	.	43	Q9UQR0	SCML2_HUMAN	W	43	ENSP00000251900:G43W	ENSP00000251900:G43W	G	-	1	0	SCML2	18252983	0.508000	0.26154	0.993000	0.49108	0.925000	0.55904	1.945000	0.40273	0.846000	0.35142	0.513000	0.50165	GGG	.		0.373	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	
SUPT20HL2	170067	bcgsc.ca	37	X	24329897	24329902	+	IGR	DEL	AGCAGG	AGCAGG	-			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	AGCAGG	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:24329897_24329902delAGCAGG								AC096509.1 (25103 upstream) : AC004552.1 (37023 downstream)																							caggagcagcagcaggagcaggagca	0.602														54	0.0143046	0.0356	0.0072	3775	,	,		12026	0.002		0.0	False		,,,				2504	0.0				p.511_512del		.											.	.	0			c.1531_1536del						.			83,3063		11,49,12,1313,388						-0.9	0.0			10	29,5450		4,15,6,1995,1445	no	coding	FAM48B2	NM_001136233.1		15,64,18,3308,1833	A1A1,A1R,A1,RR,R		0.5293,2.6383,1.2986				112,8513				SO:0001628	intergenic_variant	170067	exon1			AGCAGCAGCAGGA																													X.37:g.24329903_24329908delAGCAGG		312	0		164	5	NM_001136233	0	0	0	0	0		In_Frame_Del	DEL		37																																																																																				.	0	0.602								
SUPT20HL1	100130302	bcgsc.ca	37	X	24381387	24381387	+	IGR	SNP	G	G	C	rs1207577	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:24381387G>C								AC004552.1 (14364 upstream) : PDK3 (101950 downstream)																							TACGTCCAACGATGCAGACTT	0.468													G|||	2036	0.539338	0.5756	0.3141	3775	,	,		16356	0.3423		0.1998	False		,,,				2504	0.5225				p.T170T		.											.	.	0			c.G510C						.	G		1856,771		543,413,357,103,152	222.0	214.0	217.0		510	-6.8	0.0	X	dbSNP_87	217	1472,4026		145,737,445,1034,1221	no	coding-synonymous	FAM48B1	NM_001136234.1		688,1150,802,1137,1373	CC,CG,C,GG,G		26.7734,29.3491,40.96		170/888	24381387	3328,4797	1568	3582	5150	SO:0001628	intergenic_variant	100130302	exon1			TCCAACGATGCAG																													X.37:g.24381387G>C		1224	9		594	20	NM_001136234	0	0	0	0	0		Silent	SNP		37																																																																																				G|0.448;C|0.552	0	0.468								
NUDT10	170685	bcgsc.ca	37	X	51076018	51076018	+	Silent	SNP	C	C	T	rs12846945	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:51076018C>T	ENST00000376006.3	+	2	421	c.201C>T	c.(199-201)taC>taT	p.Y67Y	NUDT10_ENST00000356450.2_Silent_p.Y67Y	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	232					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					GAGAGGTGTACGAAGAGGCGG	0.642													C|||	371	0.0982781	0.0953	0.0576	3775	,	,		9846	0.0119		0.1233	False		,,,				2504	0.0706				p.Y67Y	NSCLC(90;1817 2035 37909 38249)	.											.	NUDT10-90	0			c.C201T						.	C		516,3319		29,384,74,1219,497	47.0	57.0	54.0		201	0.3	1.0	X	dbSNP_121	54	1094,5634		68,651,307,1709,1565	no	coding-synonymous	NUDT10	NM_153183.2		97,1035,381,2928,2062	TT,TC,T,CC,C		16.2604,13.455,15.2419		67/165	51076018	1610,8953	2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			GGTGTACGAAGAG	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.201C>T	X.37:g.51076018C>T		204	3		196	8	NM_153183	0	0	2	2	0	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																			C|0.864;T|0.136		0.642	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
ZNF711	7552	broad.mit.edu;bcgsc.ca	37	X	84520165	84520165	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:84520165C>T	ENST00000373165.3	+	6	1126	c.820C>T	c.(820-822)Cat>Tat	p.H274Y	ZNF711_ENST00000395402.1_Missense_Mutation_p.H252Y|ZNF711_ENST00000542798.1_Missense_Mutation_p.H70Y|ZNF711_ENST00000360700.4_Missense_Mutation_p.H274Y|ZNF711_ENST00000276123.3_Missense_Mutation_p.H274Y	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	274			H -> R (in an individual affected by mental retardation; unknown pathological role). {ECO:0000269|PubMed:19377476}.		positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						CACCAGTGGACATTCAGTAGC	0.388																																					p.H274Y		.											.	ZNF711-134	0			c.C820T						.						85.0	79.0	81.0					X																	84520165		2203	4300	6503	SO:0001583	missense	7552	exon6			AGTGGACATTCAG	BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.820C>T	X.37:g.84520165C>T	ENSP00000362260:p.His274Tyr	404	1		176	9	NM_021998	0	0	24	24	0	B4DSV4|Q6NX42|Q9Y4J6	Missense_Mutation	SNP	ENST00000373165.3	37	CCDS35344.1	.	.	.	.	.	.	.	.	.	.	C	19.49	3.837441	0.71373	.	.	ENSG00000147180	ENST00000395402;ENST00000373165;ENST00000276123;ENST00000360700;ENST00000542798	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69	4.92	4.06	0.47325	Transcriptional activator, Zfx / Zfy domain (1);	0.000000	0.41823	U	0.000804	T	0.65270	0.2675	M	0.73217	2.22	0.58432	D	0.999997	D;D	0.67145	0.996;0.991	D;D	0.75484	0.986;0.982	T	0.65034	-0.6266	10	0.45353	T	0.12	-9.9758	12.4472	0.55657	0.0:0.9163:0.0:0.0837	.	274;274	Q9Y462-3;Q9Y462	.;ZN711_HUMAN	Y	252;274;274;274;70	ENSP00000378798:H252Y;ENSP00000362260:H274Y;ENSP00000276123:H274Y;ENSP00000353922:H274Y;ENSP00000442071:H70Y	ENSP00000276123:H274Y	H	+	1	0	ZNF711	84406821	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	5.564000	0.67359	0.857000	0.35407	0.506000	0.49869	CAT	.		0.388	ZNF711-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057388.2	NM_021998	
KLHL4	56062	bcgsc.ca	37	X	86877348	86877348	+	Silent	SNP	G	G	T	rs2273050	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:86877348G>T	ENST00000373119.4	+	5	1207	c.1062G>T	c.(1060-1062)ggG>ggT	p.G354G	KLHL4_ENST00000373114.4_Silent_p.G354G	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	354						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						AGTGGGTGGGGCATGATGTGC	0.433													G|||	717	0.189934	0.1513	0.0504	3775	,	,		12144	0.1448		0.1879	False		,,,				2504	0.1503				p.G354G		.											.	KLHL4-133	0			c.G1062T						.	G	,	714,3121		53,505,103,1074,468	159.0	131.0	140.0		1062,1062	-6.9	0.3	X	dbSNP_100	140	1319,5409		93,760,373,1575,1499	no	coding-synonymous,coding-synonymous	KLHL4	NM_019117.4,NM_057162.2	,	146,1265,476,2649,1967	TT,TG,T,GG,G		19.6046,18.618,19.2464	,	354/719,354/721	86877348	2033,8530	2203	4300	6503	SO:0001819	synonymous_variant	56062	exon5			GGTGGGGCATGAT	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1062G>T	X.37:g.86877348G>T		334	0		157	9	NM_019117	0	0	0	0	0	B2RTW2|Q9Y3J5	Silent	SNP	ENST00000373119.4	37	CCDS14457.1																																																																																			G|0.807;T|0.193		0.433	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
MAGEA4	4103	bcgsc.ca	37	X	151092220	151092220	+	Silent	SNP	A	A	G	rs1047248	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chrX:151092220A>G	ENST00000360243.2	+	3	351	c.84A>G	c.(82-84)gcA>gcG	p.A28A	MAGEA4_ENST00000393921.1_Silent_p.A28A|MAGEA4_ENST00000370335.1_Silent_p.A28A|MAGEA4_ENST00000370337.4_Silent_p.A28A|MAGEA4_ENST00000393920.1_Silent_p.A28A|MAGEA4_ENST00000370340.3_Silent_p.A28A|MAGEA4_ENST00000276344.2_Silent_p.A28A	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	28										breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					TGGTGGGTGCACAGGCTCCTA	0.612													G|||	2014	0.53351	0.4902	0.2738	3775	,	,		14322	0.4514		0.3698	False		,,,				2504	0.3569				p.A28A		.											.	MAGEA4-194	0			c.A84G						.	G	,,,	2388,1447		641,748,358,243,213	46.0	44.0	45.0		84,84,84,84	-3.5	0.0	X	dbSNP_86	45	3362,3366		604,1203,951,621,921	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MAGEA4	NM_001011548.1,NM_001011549.1,NM_001011550.1,NM_002362.4	,,,	1245,1951,1309,864,1134	GG,GA,G,AA,A		49.9703,37.7314,45.5647	,,,	28/318,28/318,28/318,28/318	151092220	5750,4813	2203	4300	6503	SO:0001819	synonymous_variant	4103	exon3			GGGTGCACAGGCT		CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.84A>G	X.37:g.151092220A>G		327	0		176	7	NM_001011548	0	0	0	0	0	Q14798	Silent	SNP	ENST00000360243.2	37	CCDS14702.1																																																																																			A|0.460;G|0.540		0.612	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060898.1	NM_002362	
CELSR2	1952	hgsc.bcm.edu	37	1	109792735	109792736	+	In_Frame_Ins	INS	-	-	CGC	rs377757908|rs59201433|rs144034706	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr1:109792735_109792736insCGC	ENST00000271332.3	+	1	95_96	c.34_35insCGC	c.(34-36)acg>aCGCcg	p.16_17insP		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	16					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCTCCCAACgccgccgccg	0.752														2846	0.568291	0.4198	0.6311	5008	,	,		10222	0.5298		0.7276	False		,,,				2504	0.6002				p.T12delinsTP	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.34_35insCGC						.			1363,1439		473,417,511						3.0	0.1		dbSNP_130	6	4135,1897		1679,777,560	no	coding	CELSR2	NM_001408.2		2152,1194,1071	A1A1,A1R,RR		31.4489,48.6438,37.7632				5498,3336				SO:0001652	inframe_insertion	1952	exon1			CTCCCAACGCCGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.47_49dupCGC	1.37:g.109792742_109792744dupCGC	ENSP00000271332:p.Pro16_Pro16dup	3	0		19	10	NM_001408	0	0	0	0	0	Q5T2Y7|Q92566	In_Frame_Ins	INS	ENST00000271332.3	37	CCDS796.1																																																																																			-|0.389;CGC|0.611		0.752	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
CBX4	8535	hgsc.bcm.edu	37	17	77807917	77807918	+	In_Frame_Ins	INS	-	-	GCCGCC			TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr17:77807917_77807918insGCCGCC	ENST00000269397.4	-	5	1700_1701	c.1523_1524insGGCGGC	c.(1522-1524)gca>gcGGCGGCa	p.508_508A>AAA		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	508	Interaction with BMI1.|Poly-Ala.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TGGGTgccgctgccgccgccac	0.683																																					p.A508delinsAAA		.											.	CBX4-228	0			c.1524_1525insGGCGGC						.			245,2867		49,147,1360						-4.3	0.0			21	468,6186		62,344,2921	no	coding	CBX4	NM_003655.2		111,491,4281	A1A1,A1R,RR		7.0334,7.8728,7.3008				713,9053				SO:0001652	inframe_insertion	8535	exon5			TGCCGCTGCCGCC	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1518_1523dupGGCGGC	17.37:g.77807918_77807923dupGCCGCC	ENSP00000269397:p.AlaAla510dup	32	0		56	30	NM_003655	0	0	0	0	0	B1PJR7|Q6TPI8|Q96C04	In_Frame_Ins	INS	ENST00000269397.4	37	CCDS32758.1																																																																																			.		0.683	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
HSPBP1	23640	broad.mit.edu	37	19	55790886	55790887	+	In_Frame_Ins	INS	-	-	GCCGCCGCC	rs199849782|rs10701478|rs3040014		TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr19:55790886_55790887insGCCGCCGCC	ENST00000255631.5	-	3	400_401	c.90_91insGGCGGCGGC	c.(88-93)ggctcc>ggcGGCGGCGGCtcc	p.29_30insGGG	HSPBP1_ENST00000587922.1_In_Frame_Ins_p.29_30insGGG|BRSK1_ENST00000590333.1_5'Flank|HSPBP1_ENST00000376343.3_In_Frame_Ins_p.29_30insGGG|HSPBP1_ENST00000433386.2_In_Frame_Ins_p.29_30insGGG	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	29	Gly-rich.				negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCAGCCGAGGAGCCGCCGCCGC	0.713																																					p.S31delinsGGGS		.											.	HSPBP1-90	0			c.91_92insGGCGGCGGC						.																																			SO:0001652	inframe_insertion	23640	exon3			CCGAGGAGCCGCC		CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.82_90dupGGCGGCGGC	19.37:g.55790887_55790895dupGCCGCCGCC	ENSP00000255631:p.Gly27_Gly29dup	21	0		64	0	NM_001130106	0	0	0	0	0	B3KQP0|B4DG11|O95351|Q6ZNU5	In_Frame_Ins	INS	ENST00000255631.5	37	CCDS33111.1																																																																																			.		0.713	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452670.1	NM_012267	
LAMA5	3911	broad.mit.edu	37	20	60895697	60895698	+	Frame_Shift_Ins	INS	-	-	G	rs2297587|rs200954467	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr20:60895697_60895698insG	ENST00000252999.3	-	50	6742_6743	c.6676_6677insC	c.(6676-6678)cgcfs	p.R2226fs		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2226	Domain II and I.		R -> H (in dbSNP:rs2297587).		angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CGTCTCATGGCGGGGGCCCAGG	0.708																																					p.R2226fs		.											.	LAMA5-93	0			c.6677_6678insC						.																																			SO:0001589	frameshift_variant	3911	exon50			TCATGGCGGGGGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6677dupC	20.37:g.60895702_60895702dupG	ENSP00000252999:p.Arg2226fs	23	0		65	8	NM_005560	0	0	0	0	0	Q8TDF8|Q8WZA7|Q9H1P1	Frame_Shift_Ins	INS	ENST00000252999.3	37	CCDS33502.1																																																																																			.		0.708	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
KRTAP10-6	386674	broad.mit.edu	37	21	46012219	46012220	+	In_Frame_Ins	INS	-	-	GGGGCGCAGCAGCTG	rs374776064|rs587611810|rs71199613	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr21:46012219_46012220insGGGGCGCAGCAGCTG	ENST00000400368.1	-	1	166_167	c.146_147insCAGCTGCTGCGCCCC	c.(145-147)ccg>ccCAGCTGCTGCGCCCCg	p.49_49P>PSCCAP	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	49	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGCAGGGGGCCGGGGCGCAGCA	0.688														1042	0.208067	0.1188	0.2522	5008	,	,		15055	0.1379		0.3231	False		,,,				2504	0.2515				p.P49delinsPSCCAP		.											.	KRTAP10-6-90	0			c.147_148insCAGCTGCTGCGCCCC						.																																			SO:0001652	inframe_insertion	386674	exon1			GGGGGCCGGGGCG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.146_147insCAGCTGCTGCGCCCC	21.37:g.46012219_46012220insGGGGCGCAGCAGCTG	Exception_encountered	50	0		96	12	NM_198688	0	0	0	0	0		In_Frame_Ins	INS	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.688	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
KCTD8	386617	hgsc.bcm.edu	37	4	44449953	44449954	+	In_Frame_Ins	INS	-	-	CCA	rs560688379	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr4:44449953_44449954insCCA	ENST00000360029.3	-	1	870_871	c.587_588insTGG	c.(586-588)ggc>ggTGGc	p.196_196G>GG	AC131951.1_ENST00000584757.1_RNA	NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	196	Poly-Gly.				protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						cgccgccgccgccaccaccgtg	0.748										HNSCC(17;0.042)				90	0.0179712	0.0651	0.0029	5008	,	,		8163	0.0		0.002	False		,,,				2504	0.0				p.G196delinsGG		.											.	KCTD8-92	0			c.588_589insTGG						.			70,1444		25,20,712						-0.6	0.0			1	2,3662		0,2,1830	no	coding	KCTD8	NM_198353.2		25,22,2542	A1A1,A1R,RR		0.0546,4.6235,1.3905				72,5106				SO:0001652	inframe_insertion	386617	exon1			GCCGCCGCCACCA	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.585_587dupTGG	4.37:g.44449957_44449959dupCCA	ENSP00000353129:p.Gly200dup	0	0		25	10	NM_198353	0	0	0	0	0	A2RU39	In_Frame_Ins	INS	ENST00000360029.3	37	CCDS3467.1																																																																																			.		0.748	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
ADAMTS19	171019	hgsc.bcm.edu	37	5	128797315	128797316	+	In_Frame_Ins	INS	-	-	CCCGGC	rs3980042|rs373500239|rs142924298	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr5:128797315_128797316insCCCGGC	ENST00000274487.4	+	2	739_740	c.594_595insCCCGGC	c.(595-597)ccc>CCCGGCccc	p.199_199P>PGP	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	199	Pro-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.N198_P199insPG(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		AGCGGCCAAATCCCGGCCCCGG	0.713														951	0.189896	0.1815	0.1254	5008	,	,		13147	0.3294		0.1083	False		,,,				2504	0.1871				p.N198delinsNPG		.											.	ADAMTS19-295	1	Insertion - In frame(1)	breast(1)	c.594_595insCCCGGC						.			443,3611		48,347,1632						-6.8	0.0		dbSNP_134	11	670,7398		63,544,3427	no	coding	ADAMTS19	NM_133638.3		111,891,5059	A1A1,A1R,RR		8.3044,10.9275,9.1817				1113,11009				SO:0001652	inframe_insertion	171019	exon2			GCCAAATCCCGGC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.601_606dupCCCGGC	5.37:g.128797316_128797321dupCCCGGC	Exception_encountered	5	0		42	12	NM_133638	0	0	0	0	0		In_Frame_Ins	INS	ENST00000274487.4	37	CCDS4146.1																																																																																			-|0.817;CCCGGC|0.183		0.713	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
SLC4A2	6522	hgsc.bcm.edu;broad.mit.edu	37	7	150763615	150763616	+	In_Frame_Ins	INS	-	-	GGAGGC	rs150330052|rs374531279	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr7:150763615_150763616insGGAGGC	ENST00000485713.1	+	6	1630_1631	c.590_591insGGAGGC	c.(589-594)gaggag>gaGGAGGCggag	p.202_203insAE	SLC4A2_ENST00000413384.2_In_Frame_Ins_p.202_203insAE|SLC4A2_ENST00000392826.2_In_Frame_Ins_p.193_194insAE|SLC4A2_ENST00000461735.1_In_Frame_Ins_p.188_189insAE|SLC4A2_ENST00000310317.5_In_Frame_Ins_p.120_121insAE	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	202	Pro-rich.		E -> V (in dbSNP:rs2229551). {ECO:0000269|Ref.2}.		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACCCAGGTGGAGGAGGCGGAGG	0.733																																					p.E197delinsEEA		.											.	SLC4A2-90	0			c.590_591insGGAGGC						.																																			SO:0001652	inframe_insertion	6522	exon6			AGGTGGAGGAGGC		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.603_608dupGGAGGC	7.37:g.150763616_150763621dupGGAGGC	ENSP00000419412:p.Ala201_Glu202dup	7	0		50	10	NM_001199692	0	0	0	0	0	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	In_Frame_Ins	INS	ENST00000485713.1	37	CCDS5917.1																																																																																			-|0.038;GGAGGC|0.962		0.733	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351039.1	NM_003040	
SALL3	27164	hgsc.bcm.edu	37	18	76752544	76752545	+	Missense_Mutation	DNP	GC	GC	TT	rs186555722|rs191414199	byFrequency	TCGA-OR-A5J9-01A-11D-A29I-10	TCGA-OR-A5J9-10A-01D-A29L-10	GC	GC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0e14fd74-7eaa-4401-8daa-ec9e467b4299	e0439659-3c97-4d71-a90e-4be39c757a3a	g.chr18:76752544_76752545GC>TT	ENST00000537592.2	+	2	553_554	c.553_554GC>TT	c.(553-555)GCg>TTg	p.A185L	SALL3_ENST00000575389.2_Missense_Mutation_p.A185L|SALL3_ENST00000536229.3_Missense_Mutation_p.A52L	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	185					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CTCGCAGGGCGCGCGCGCGGCA	0.723																																					p.A185L		.											.	SALL3-155	0			c.C554T						.																																			SO:0001583	missense	27164	exon2			AGGGCGCGCGCGC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	Exception_encountered	18.37:g.76752544_76752545delinsTT	ENSP00000441823:p.Ala185Leu	0	0		6	3	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	DNP	ENST00000537592.2	37	CCDS12013.1																																																																																			C|0.967;T|0.033		0.723	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
