#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		5	5	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
RPAP2	79871	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	92789534	92789534	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:92789534A>T	ENST00000610020.1	+	8	1166	c.1057A>T	c.(1057-1059)Agt>Tgt	p.S353C	RPAP2_ENST00000484158.1_3'UTR	NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	353					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		GTCAGTGTCTAGTTCAGTGCA	0.373																																					p.S353C		.											.	RPAP2-91	0			c.A1057T						.						96.0	101.0	99.0					1																	92789534		2203	4300	6503	SO:0001583	missense	79871	exon8			GTGTCTAGTTCAG	AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.1057A>T	1.37:g.92789534A>T	ENSP00000476948:p.Ser353Cys	123	0		95	73	NM_024813	0	0	0	1	1	C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	ENST00000610020.1	37	CCDS740.1	.	.	.	.	.	.	.	.	.	.	A	6.585	0.476209	0.12521	.	.	ENSG00000122484	ENST00000370343;ENST00000394482	.	.	.	5.05	-1.27	0.09347	.	0.748686	0.13603	N	0.375738	T	0.16471	0.0396	L	0.47716	1.5	0.22762	N	0.998767	P	0.39131	0.661	B	0.39419	0.299	T	0.05716	-1.0868	8	0.56958	D	0.05	-1.1198	6.4109	0.21690	0.4053:0.1529:0.4418:0.0	.	353	Q8IXW5	RPAP2_HUMAN	C	353	.	ENSP00000359368:S353C	S	+	1	0	RPAP2	92562122	0.002000	0.14202	0.067000	0.19924	0.094000	0.18550	0.301000	0.19174	-0.402000	0.07633	-0.274000	0.10170	AGT	.		0.373	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028368.2	NM_024813	
AGL	178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	100376292	100376292	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:100376292A>C	ENST00000294724.4	+	28	4203	c.3725A>C	c.(3724-3726)gAt>gCt	p.D1242A	AGL_ENST00000361915.3_Missense_Mutation_p.D1242A|AGL_ENST00000361522.4_Missense_Mutation_p.D1225A|AGL_ENST00000370161.2_Missense_Mutation_p.D1226A|AGL_ENST00000370163.3_Missense_Mutation_p.D1242A|AGL_ENST00000361302.3_Missense_Mutation_p.D1226A|AGL_ENST00000370165.3_Missense_Mutation_p.D1242A	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1242					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		GCAGGAGTTGATGAAGAAACA	0.279																																					p.D1242A		.											.	AGL-92	0			c.A3725C						.						77.0	75.0	76.0					1																	100376292		2203	4300	6503	SO:0001583	missense	178	exon28			GAGTTGATGAAGA	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.3725A>C	1.37:g.100376292A>C	ENSP00000294724:p.Asp1242Ala	159	0		108	73	NM_000644	0	0	1	3	2	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	.	.	.	.	.	.	.	.	.	.	A	17.52	3.411104	0.62399	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78	5.46	4.33	0.51752	Six-hairpin glycosidase-like (1);	0.183879	0.56097	D	0.000022	T	0.74366	0.3707	M	0.86740	2.835	0.52099	D	0.999947	B;B;B	0.23591	0.088;0.088;0.053	B;B;B	0.39503	0.301;0.301;0.278	T	0.76572	-0.2910	10	0.72032	D	0.01	.	11.5652	0.50800	0.9296:0.0:0.0704:0.0	.	1225;1226;1242	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	A	1242;1242;1242;1242;1226;1226;1225	ENSP00000355106:D1242A;ENSP00000359184:D1242A;ENSP00000359182:D1242A;ENSP00000294724:D1242A;ENSP00000354971:D1226A;ENSP00000359180:D1226A;ENSP00000354635:D1225A	ENSP00000294724:D1242A	D	+	2	0	AGL	100148880	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	7.075000	0.76798	1.006000	0.39211	0.533000	0.62120	GAT	.		0.279	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
VAV3	10451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	108291635	108291635	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:108291635G>C	ENST00000370056.4	-	15	1731	c.1457C>G	c.(1456-1458)aCa>aGa	p.T486R	VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.T486R|VAV3_ENST00000371846.4_Missense_Mutation_p.T421R	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	486	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TAAATCTTTTGTTTTGCAATA	0.284																																					p.T486R		.											.	VAV3-1339	0			c.C1457G						.						60.0	62.0	61.0					1																	108291635		2203	4299	6502	SO:0001583	missense	10451	exon15			TCTTTTGTTTTGC	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1457C>G	1.37:g.108291635G>C	ENSP00000359073:p.Thr486Arg	38	0		28	4	NM_006113	0	0	0	0	0	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	37	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.556480|4.556480	0.86231|0.86231	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000529809;ENST00000490388|ENST00000370056;ENST00000527011;ENST00000371846	.|D;D;D	.|0.90324	.|-2.65;-2.65;-2.65	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95169|0.95169	0.8434|0.8434	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|0.996;1.0;0.998;0.998	D|D	0.95146|0.95146	0.8268|0.8268	5|10	.|0.87932	.|D	.|0	.|.	19.7215|19.7215	0.96144|0.96144	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|486;486;421;486	.|B7ZLR1;E9PQ97;B4DHL6;Q9UKW4	.|.;.;.;VAV3_HUMAN	E|R	38;481|486;486;421	.|ENSP00000359073:T486R;ENSP00000432540:T486R;ENSP00000360912:T421R	.|ENSP00000359073:T486R	Q|T	-|-	1|2	0|0	VAV3|VAV3	108093158|108093158	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.450000|9.450000	0.97607|0.97607	2.667000|2.667000	0.90743|0.90743	0.585000|0.585000	0.79938|0.79938	CAA|ACA	.		0.284	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
RBM15	64783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	110884071	110884071	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:110884071G>C	ENST00000369784.3	+	1	2944	c.2044G>C	c.(2044-2046)Gat>Cat	p.D682H	RBM15_ENST00000602849.1_Missense_Mutation_p.D682H|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Missense_Mutation_p.D682H	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	682	Arg-rich.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CAGTAGCCGGGATCGTTACAA	0.542			T	MKL1	acute megakaryocytic leukemia																																p.D682H		.		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	.	RBM15-661	0			c.G2044C						.						69.0	64.0	66.0					1																	110884071		2203	4300	6503	SO:0001583	missense	64783	exon1			AGCCGGGATCGTT	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.2044G>C	1.37:g.110884071G>C	ENSP00000358799:p.Asp682His	119	0		117	86	NM_022768	0	0	0	1	1	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	37	CCDS822.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231056	0.39399	.	.	ENSG00000162775	ENST00000369784	T	0.18810	2.19	5.02	5.02	0.67125	.	0.000000	0.45867	D	0.000329	T	0.13927	0.0337	L	0.46157	1.445	0.40992	D	0.984869	P;P	0.47677	0.899;0.838	P;B	0.44990	0.466;0.276	T	0.01118	-1.1446	10	0.49607	T	0.09	-11.711	11.9247	0.52812	0.0795:0.0:0.9205:0.0	.	682;682	Q96T37-3;Q96T37	.;RBM15_HUMAN	H	682	ENSP00000358799:D682H	ENSP00000358799:D682H	D	+	1	0	RBM15	110685594	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.093000	0.71422	2.608000	0.88229	0.655000	0.94253	GAT	.		0.542	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
DDX20	11218	hgsc.bcm.edu	37	1	112298829	112298829	+	Silent	SNP	T	T	C	rs197393	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:112298829T>C	ENST00000369702.4	+	1	903	c.283T>C	c.(283-285)Ttg>Ctg	p.L95L	FAM212B_ENST00000444059.2_5'Flank|DDX20_ENST00000536167.1_Silent_p.L95L|FAM212B_ENST00000412270.1_5'Flank	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	95	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGCCATCCCGTTGGGGCGCTG	0.771													C|||	2365	0.472244	0.7254	0.5014	5008	,	,		8724	0.3403		0.4105	False		,,,				2504	0.3088				p.L95L		.											.	DDX20-227	0			c.T283C						.	C		1324,1278		354,616,331	2.0	2.0	2.0		283	2.9	1.0	1	dbSNP_79	2	1538,3832		298,942,1445	no	coding-synonymous	DDX20	NM_007204.4		652,1558,1776	CC,CT,TT		28.6406,49.1161,35.9007		95/825	112298829	2862,5110	1301	2685	3986	SO:0001819	synonymous_variant	11218	exon1			ATCCCGTTGGGGC	AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.283T>C	1.37:g.112298829T>C		0	0		5	4	NM_007204	0	0	0	0	0	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Silent	SNP	ENST00000369702.4	37	CCDS842.1																																																																																			T|0.526;C|0.474		0.771	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033063.2	NM_007204	
RSBN1	54665	hgsc.bcm.edu	37	1	114354654	114354654	+	Silent	SNP	T	T	C	rs3195954	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:114354654T>C	ENST00000261441.5	-	1	444	c.381A>G	c.(379-381)ccA>ccG	p.P127P	RP5-1073O3.2_ENST00000429398.1_RNA|RP5-1073O3.2_ENST00000418238.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	127	Pro-rich.					nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGCATTCGTTGGCGGCAGCG	0.746													T|||	610	0.121805	0.0045	0.1311	5008	,	,		11529	0.2282		0.1869	False		,,,				2504	0.0971				p.P127P		.											.	RSBN1-91	0			c.A381G						.	T		149,4053		2,145,1954	13.0	24.0	21.0		381	-4.9	0.5	1	dbSNP_105	21	1412,6854		115,1182,2836	no	coding-synonymous	RSBN1	NM_018364.3		117,1327,4790	CC,CT,TT		17.082,3.5459,12.5201		127/803	114354654	1561,10907	2101	4133	6234	SO:0001819	synonymous_variant	54665	exon1			ATTCGTTGGCGGC	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.381A>G	1.37:g.114354654T>C		2	0		18	16	NM_018364	0	0	0	1	1	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Silent	SNP	ENST00000261441.5	37	CCDS862.1																																																																																			T|0.861;C|0.139		0.746	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033022.2	NM_018364	
HRNR	388697	broad.mit.edu	37	1	152187065	152187065	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:152187065C>G	ENST00000368801.2	-	3	7115	c.7040G>C	c.(7039-7041)aGc>aCc	p.S2347T	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2347					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCCATGAGCTAGACTCGTG	0.567																																					p.S2347T		.											.	HRNR-93	0			c.G7040C						.						460.0	722.0	633.0					1																	152187065		2184	4298	6482	SO:0001583	missense	388697	exon3			CATGAGCTAGACT	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7040G>C	1.37:g.152187065C>G	ENSP00000357791:p.Ser2347Thr	1687	1		1959	35	NM_001009931	0	0	0	0	0	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	37	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	4.660	0.122642	0.08931	.	.	ENSG00000197915	ENST00000368801	T	0.03801	3.8	3.04	-0.555	0.11807	.	.	.	.	.	T	0.00724	0.0024	N	0.24115	0.695	0.09310	N	1	B	0.15930	0.015	B	0.08055	0.003	T	0.48080	-0.9066	9	0.12430	T	0.62	.	2.4038	0.04407	0.1827:0.3457:0.3583:0.1133	.	2347	Q86YZ3	HORN_HUMAN	T	2347	ENSP00000357791:S2347T	ENSP00000357791:S2347T	S	-	2	0	HRNR	150453689	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.092000	0.15066	-0.212000	0.10109	0.644000	0.83932	AGC	.		0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
LCE1F	353137	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	1	152749023	152749023	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:152749023G>C	ENST00000334371.2	+	1	176	c.176G>C	c.(175-177)tGc>tCc	p.C59S		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	59					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTGGGGGCTGCTGCAGCTCT	0.677																																					p.C59S		.											.	LCE1F-68	0			c.G176C						.						32.0	36.0	35.0					1																	152749023		2202	4300	6502	SO:0001583	missense	353137	exon1			GGGGCTGCTGCAG		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.176G>C	1.37:g.152749023G>C	ENSP00000334187:p.Cys59Ser	52	0		49	21	NM_178354	0	0	0	0	0		Missense_Mutation	SNP	ENST00000334371.2	37	CCDS1023.1	.	.	.	.	.	.	.	.	.	.	G	8.703	0.910299	0.17833	.	.	ENSG00000240386	ENST00000334371	T	0.05786	3.39	3.89	2.94	0.34122	.	.	.	.	.	T	0.05640	0.0148	M	0.86864	2.845	0.26225	N	0.97909	P	0.44816	0.844	B	0.41088	0.347	T	0.14172	-1.0482	9	0.87932	D	0	.	8.7311	0.34501	0.0:0.0:0.7738:0.2262	.	59	Q5T754	LCE1F_HUMAN	S	59	ENSP00000334187:C59S	ENSP00000334187:C59S	C	+	2	0	LCE1F	151015647	1.000000	0.71417	0.999000	0.59377	0.783000	0.44284	3.936000	0.56568	0.923000	0.37045	0.508000	0.49915	TGC	.		0.677	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
LCE1E	353135	bcgsc.ca	37	1	152760075	152760075	+	Silent	SNP	A	A	G	rs201660535	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:152760075A>G	ENST00000368770.3	+	2	353	c.300A>G	c.(298-300)tcA>tcG	p.S100S	LCE1E_ENST00000368771.1_Silent_p.S100S	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	100	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAGCCCTCAGGGGGCTCCA	0.642													G|||	1333	0.266174	0.3654	0.2406	5008	,	,		14498	0.3313		0.1064	False		,,,				2504	0.2474				p.S100S		.											.	LCE1E-90	0			c.A300G						.	G		355,3853		89,177,1838	36.0	52.0	47.0		300	-4.6	0.5	1	dbSNP_132	47	177,8331		25,127,4102	no	coding-synonymous	LCE1E	NM_178353.1		114,304,5940	GG,GA,AA		2.0804,8.4363,4.1837		100/119	152760075	532,12184	2104	4254	6358	SO:0001819	synonymous_variant	353135	exon2			GCCCTCAGGGGGC	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.300A>G	1.37:g.152760075A>G		156	13		52	29	NM_178353	0	0	0	0	0	D3DV30	Silent	SNP	ENST00000368770.3	37	CCDS1024.1																																																																																			A|0.995;G|0.005		0.642	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
OBSCN	84033	broad.mit.edu	37	1	228473929	228473929	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:228473929A>G	ENST00000422127.1	+	34	9199	c.9155A>G	c.(9154-9156)gAg>gGg	p.E3052G	OBSCN_ENST00000366707.4_Missense_Mutation_p.E171G|OBSCN_ENST00000570156.2_Missense_Mutation_p.E3481G|OBSCN_ENST00000366709.4_Missense_Mutation_p.E171G|OBSCN_ENST00000284548.11_Missense_Mutation_p.E3052G|OBSCN_ENST00000359599.6_Missense_Mutation_p.E1899G	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3052	Ig-like 30.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGCTCAATGAGATCGATGCC	0.657																																					p.E3481G		.											.	OBSCN-403	0			c.A10442G						.						38.0	47.0	44.0					1																	228473929		2105	4226	6331	SO:0001583	missense	84033	exon39			TCAATGAGATCGA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9155A>G	1.37:g.228473929A>G	ENSP00000409493:p.Glu3052Gly	222	1		226	4	NM_001271223	0	0	1	1	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.411179	0.83340	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32	5.67	5.67	0.87782	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.385839	0.25771	N	0.028414	T	0.71592	0.3358	L	0.59967	1.855	0.43678	D	0.996112	B;P	0.38729	0.317;0.644	B;P	0.48571	0.279;0.582	T	0.68051	-0.5511	10	0.25751	T	0.34	.	15.0902	0.72188	1.0:0.0:0.0:0.0	.	3052;3052	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	3052;3052;171;171;1899	ENSP00000284548:E3052G;ENSP00000409493:E3052G;ENSP00000355668:E171G;ENSP00000355670:E171G;ENSP00000352613:E1899G	ENSP00000284548:E3052G	E	+	2	0	OBSCN	226540552	1.000000	0.71417	0.997000	0.53966	0.275000	0.26752	8.793000	0.91862	2.155000	0.67459	0.459000	0.35465	GAG	.		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	61819102	61819102	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr10:61819102C>T	ENST00000280772.2	-	41	12873	c.12682G>A	c.(12682-12684)Gac>Aac	p.D4228N	ANK3_ENST00000503366.1_Missense_Mutation_p.D1719N|ANK3_ENST00000355288.2_Missense_Mutation_p.D852N|RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000373827.2_Missense_Mutation_p.D1712N	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4228					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CCATACCTGTCATCCAGTCGA	0.393																																					p.D4228N		.											.	ANK3-107	0			c.G12682A						.						170.0	153.0	159.0					10																	61819102		2203	4300	6503	SO:0001583	missense	288	exon41			ACCTGTCATCCAG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12682G>A	10.37:g.61819102C>T	ENSP00000280772:p.Asp4228Asn	88	0		71	34	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.942890	0.53079	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000355288;ENST00000503366;ENST00000395299;ENST00000373817	T;T;T;T;T	0.71934	-0.26;-0.61;0.45;0.16;-0.61	5.56	4.65	0.58169	.	0.000000	0.37857	U	0.001912	T	0.68165	0.2971	N	0.17082	0.46	0.80722	D	1	B;B;B;D;B;B;B	0.55605	0.012;0.001;0.001;0.972;0.001;0.001;0.073	B;B;B;P;B;B;B	0.57911	0.005;0.001;0.001;0.829;0.002;0.001;0.027	T	0.67662	-0.5613	10	0.34782	T	0.22	.	14.8163	0.70036	0.0:0.9294:0.0:0.0706	.	1719;852;1712;4228;953;852;251	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	N	4228;1712;310;852;1719;1698;953	ENSP00000280772:D4228N;ENSP00000362933:D1712N;ENSP00000362926:D310N;ENSP00000347436:D852N;ENSP00000425236:D1719N	ENSP00000280772:D4228N	D	-	1	0	ANK3	61489108	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.120000	0.50430	2.623000	0.88846	0.455000	0.32223	GAC	.		0.393	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
DDX50	79009	broad.mit.edu	37	10	70666540	70666540	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr10:70666540A>G	ENST00000373585.3	+	2	268	c.161A>G	c.(160-162)gAt>gGt	p.D54G		NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	54						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						GGTGTTACAGATGACCTGGAT	0.383																																					p.D54G		.											.	DDX50-91	0			c.A161G						.						81.0	80.0	80.0					10																	70666540		2203	4300	6503	SO:0001583	missense	79009	exon2			TTACAGATGACCT	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.161A>G	10.37:g.70666540A>G	ENSP00000362687:p.Asp54Gly	338	1		355	7	NM_024045	0	0	11	11	0	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	37	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	A	14.12	2.441518	0.43326	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.20200	2.09	5.03	5.03	0.67393	.	0.798753	0.11754	N	0.532787	T	0.13457	0.0326	N	0.19112	0.55	0.34356	D	0.690364	P;P	0.38767	0.646;0.646	B;B	0.31101	0.091;0.124	T	0.18745	-1.0327	10	0.56958	D	0.05	-10.543	11.4287	0.50027	1.0:0.0:0.0:0.0	.	54;54	Q9BQ39;B4DED6	DDX50_HUMAN;.	G	54	ENSP00000362687:D54G	ENSP00000362687:D54G	D	+	2	0	DDX50	70336546	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	3.003000	0.49505	2.011000	0.59026	0.533000	0.62120	GAT	.		0.383	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
ADAMTS14	140766	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	72489935	72489935	+	Silent	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr10:72489935C>G	ENST00000373207.1	+	6	1032	c.1032C>G	c.(1030-1032)cgC>cgG	p.R344R	ADAMTS14_ENST00000373208.1_Silent_p.R344R	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	344	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						CCCAGCAGCGCCAGGACCCCA	0.647																																					p.R344R		.											.	ADAMTS14-232	0			c.C1032G						.						78.0	69.0	72.0					10																	72489935		2203	4300	6503	SO:0001819	synonymous_variant	140766	exon6			GCAGCGCCAGGAC	AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.1032C>G	10.37:g.72489935C>G		103	0		141	75	NM_080722	0	0	0	0	0	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Silent	SNP	ENST00000373207.1	37	CCDS7306.1																																																																																			.		0.647	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048522.1	NM_080722	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		0	0		13	13	NM_001077494	0	0	0	1	1	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
SMC3	9126	broad.mit.edu	37	10	112356159	112356159	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr10:112356159A>G	ENST00000361804.4	+	19	2093	c.1967A>G	c.(1966-1968)gAc>gGc	p.D656G		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	656	Flexible hinge.				DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TTTATAGGTGACCAAGTCAGC	0.343																																					p.D656G		.											.	SMC3-92	0			c.A1967G						.						93.0	94.0	94.0					10																	112356159		2203	4300	6503	SO:0001583	missense	9126	exon19			TAGGTGACCAAGT	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.1967A>G	10.37:g.112356159A>G	ENSP00000354720:p.Asp656Gly	39	0		32	5	NM_005445	0	0	0	0	0	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	A	16.94	3.259869	0.59321	.	.	ENSG00000108055	ENST00000361804	D	0.88431	-2.38	5.33	5.33	0.75918	SMCs flexible hinge (1);RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.95847	0.8648	M	0.93283	3.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96956	0.9698	10	0.87932	D	0	.	15.3105	0.74028	1.0:0.0:0.0:0.0	.	656	Q9UQE7	SMC3_HUMAN	G	656	ENSP00000354720:D656G	ENSP00000354720:D656G	D	+	2	0	SMC3	112346149	1.000000	0.71417	1.000000	0.80357	0.198000	0.23893	8.864000	0.92294	2.014000	0.59158	0.260000	0.18958	GAC	.		0.343	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
CFAP46	54777	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	134623954	134623954	+	Silent	SNP	C	C	T	rs368155362		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr10:134623954C>T	ENST00000368586.5	-	57	7723	c.7623G>A	c.(7621-7623)gcG>gcA	p.A2541A	TTC40_ENST00000263170.5_Silent_p.A702A	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CTGAAGGAGACGCACTGTTTC	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		17372	0.0		0.0	False		,,,				2504	0.001				p.A2541A		.											.	.	0			c.G7623A						.	C		1,4405	2.1+/-5.4	0,1,2202	93.0	79.0	84.0		2559	1.1	0.0	10		84	0,8600		0,0,4300	no	coding-synonymous	C10orf92	NM_001200049.1		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		853/1028	134623954	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	54777	exon57			AGGAGACGCACTG																												ENST00000368586.5:c.7623G>A	10.37:g.134623954C>T		272	2		318	171	NM_001200049	0	0	0	0	0		Silent	SNP	ENST00000368586.5	37	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	C	7.233	0.599784	0.13939	2.27E-4	0.0	ENSG00000171811	ENST00000435957	.	.	.	2.98	1.09	0.20402	.	.	.	.	.	T	0.24812	0.0602	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24119	-1.0169	5	0.27082	T	0.32	.	5.2034	0.15277	0.0:0.6042:0.0:0.3958	.	.	.	.	H	170	.	ENSP00000396731:R170H	R	-	2	0	C10orf93	134473944	0.010000	0.17322	0.001000	0.08648	0.006000	0.05464	0.024000	0.13555	0.318000	0.23185	0.591000	0.81541	CGT	.		0.617	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
KNDC1	85442	hgsc.bcm.edu	37	10	135012429	135012429	+	Missense_Mutation	SNP	T	T	A	rs386749477|rs3008390	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr10:135012429T>A	ENST00000304613.3	+	14	2438	c.2417T>A	c.(2416-2418)gTt>gAt	p.V806D	KNDC1_ENST00000368571.2_Missense_Mutation_p.V741D|KNDC1_ENST00000368572.2_Missense_Mutation_p.V806D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCACCTGGAGTTGCTTCCGGG	0.746													T|||	2004	0.40016	0.1604	0.3919	5008	,	,		10760	0.5476		0.4195	False		,,,				2504	0.5583				p.V806D		.											.	KNDC1-229	0			c.T2417A						.		ASP/VAL	526,2634		71,384,1125	4.0	5.0	4.0		2417	-1.3	0.0	10	dbSNP_101	4	2723,4467		626,1471,1498	yes	missense	KNDC1	NM_152643.6	152	697,1855,2623	AA,AT,TT		37.872,16.6456,31.3913	benign	806/1750	135012429	3249,7101	1580	3595	5175	SO:0001583	missense	85442	exon14			CTGGAGTTGCTTC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2417T>A	10.37:g.135012429T>A	ENSP00000304437:p.Val806Asp	0	0		5	4	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	884	0.40476190476190477	86	0.17479674796747968	139	0.3839779005524862	333	0.5821678321678322	326	0.43007915567282323	T	4.682	0.126733	0.08931	0.166456	0.37872	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.18174	2.82;2.82;2.23	3.43	-1.31	0.09230	.	1.661170	0.03733	N	0.253684	T	0.00012	0.0000	L	0.36672	1.1	0.80722	P	0.0	P;P;B	0.45827	0.867;0.531;0.244	B;B;B	0.41271	0.352;0.107;0.05	T	0.45614	-0.9249	9	0.12103	T	0.63	.	3.9153	0.09220	0.0:0.3422:0.3942:0.2636	rs3008390;rs61587518	806;741;806	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	D	806;806;741	ENSP00000304437:V806D;ENSP00000357561:V806D;ENSP00000357560:V741D	ENSP00000304437:V806D	V	+	2	0	KNDC1	134862419	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.817000	0.27281	-0.241000	0.09681	0.255000	0.18592	GTT	T|0.406;A|0.594		0.746	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
SYT8	90019	hgsc.bcm.edu	37	11	1858572	1858572	+	Missense_Mutation	SNP	C	C	T	rs2292474	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr11:1858572C>T	ENST00000381968.3	+	9	1245	c.1117C>T	c.(1117-1119)Cgg>Tgg	p.R373W	SYT8_ENST00000341958.3_Missense_Mutation_p.R359W|TNNI2_ENST00000381906.1_5'Flank|TNNI2_ENST00000381905.3_5'Flank|SYT8_ENST00000535046.1_3'UTR|TNNI2_ENST00000381911.1_5'Flank|TNNI2_ENST00000252898.7_5'Flank	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	373					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CATTGCCCAGCGGCACCCCCT	0.731													T|||	1928	0.384984	0.1679	0.415	5008	,	,		13483	0.378		0.498	False		,,,				2504	0.5481				p.R373W		.											.	SYT8-91	0			c.C1117T						.	T	TRP/ARG	906,3442		119,668,1387	12.0	14.0	14.0		1117	2.7	1.0	11	dbSNP_100	14	4072,4398		1026,2020,1189	no	missense	SYT8	NM_138567.3	101	1145,2688,2576	TT,TC,CC		48.0756,20.8372,38.836	benign	373/402	1858572	4978,7840	2174	4235	6409	SO:0001583	missense	90019	exon9			GCCCAGCGGCACC	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.1117C>T	11.37:g.1858572C>T	ENSP00000371394:p.Arg373Trp	2	0		18	14	NM_138567	0	0	0	0	0	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	37	CCDS7726.2	855|855	0.3914835164835165|0.3914835164835165	84|84	0.17073170731707318|0.17073170731707318	163|163	0.45027624309392267|0.45027624309392267	226|226	0.3951048951048951|0.3951048951048951	382|382	0.503957783641161|0.503957783641161	t|t	1.107|1.107	-0.659353|-0.659353	0.03454|0.03454	0.208372|0.208372	0.480756|0.480756	ENSG00000149043|ENSG00000149043	ENST00000381978|ENST00000381968;ENST00000341958	.|T;T	.|0.03951	.|3.77;3.75	3.85|3.85	2.68|2.68	0.31781|0.31781	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.00005|0.00005	-3.275|-3.275	0.09310|0.09310	P|P	1.0|1.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.41928|0.41928	-0.9481|-0.9481	4|8	.|0.02654	.|T	.|1	.|.	8.5203|8.5203	0.33270|0.33270	0.0:0.1655:0.0:0.8345|0.0:0.1655:0.0:0.8345	rs2292474|rs2292474	.|373;359	.|Q8NBV8;A6NCR4	.|SYT8_HUMAN;.	V|W	371|373;359	.|ENSP00000371394:R373W;ENSP00000343691:R359W	.|ENSP00000343691:R359W	A|R	+|+	2|1	0|2	SYT8|SYT8	1815148|1815148	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.293000|0.293000	0.27360|0.27360	3.304000|3.304000	0.51866|0.51866	0.174000|0.174000	0.19809|0.19809	-0.665000|-0.665000	0.03846|0.03846	GCG|CGG	C|0.602;T|0.398		0.731	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
SERPING1	710	ucsc.edu;bcgsc.ca	37	11	57373627	57373627	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr11:57373627T>G	ENST00000278407.4	+	5	1057	c.830T>G	c.(829-831)cTg>cGg	p.L277R	SERPING1_ENST00000378323.4_Missense_Mutation_p.L282R|SERPING1_ENST00000340687.6_Missense_Mutation_p.L277R|SERPING1_ENST00000403558.1_Missense_Mutation_p.L311R|SERPING1_ENST00000378324.2_Missense_Mutation_p.L225R	NM_000062.2	NP_000053.2	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G (C1 inhibitor), member 1	277					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|pancreas(2)|prostate(1)|urinary_tract(1)	27						ATCAGCCGGCTGCTAGACAGT	0.547																																					p.L277R		.											.	SERPING1-650	0			c.T830G						.						208.0	193.0	198.0					11																	57373627		2201	4296	6497	SO:0001583	missense	710	exon4			GCCGGCTGCTAGA	X54486	CCDS7962.1	11q12.1	2014-09-17	2008-07-31		ENSG00000149131	ENSG00000149131		"""Serine (or cysteine) peptidase inhibitors"""	1228	protein-coding gene	gene with protein product	"""plasma protease C1 inhibitor"", ""angioedema, hereditary"""	606860	"""serine (or cysteine) proteinase inhibitor, clade G (C1 inhibitor), member 1, (angioedema, hereditary)"""	C1NH		2026152, 24172014	Standard	NM_000062		Approved	C1IN, C1-INH, HAE1, HAE2	uc001nkp.1	P05155	OTTHUMG00000150304	ENST00000278407.4:c.830T>G	11.37:g.57373627T>G	ENSP00000278407:p.Leu277Arg	220	3		192	141	NM_001032295	0	0	78	80	2	A6NMU0|A8KAI9|B2R6L5|B4E1F0|B4E1H2|Q16304|Q547W3|Q59EI5|Q7Z455|Q96FE0|Q9UC49|Q9UCF9	Missense_Mutation	SNP	ENST00000278407.4	37	CCDS7962.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907229	0.52333	.	.	ENSG00000149131	ENST00000278407;ENST00000340687;ENST00000378323;ENST00000378324;ENST00000403558	D;D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32;-2.32	4.99	4.99	0.66335	Serpin domain (3);	0.084740	0.48767	D	0.000166	D	0.94288	0.8165	M	0.91920	3.255	0.49915	D	0.99983	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95139	0.8262	10	0.87932	D	0	.	12.1984	0.54311	0.0:0.0:0.0:1.0	.	282;311;277;277	B4E1F0;E9PGN7;E9KL26;P05155	.;.;.;IC1_HUMAN	R	277;277;282;225;311	ENSP00000278407:L277R;ENSP00000341861:L277R;ENSP00000367574:L282R;ENSP00000367575:L225R;ENSP00000384420:L311R	ENSP00000278407:L277R	L	+	2	0	SERPING1	57130203	1.000000	0.71417	0.938000	0.37757	0.280000	0.26924	5.162000	0.64942	1.891000	0.54761	0.459000	0.35465	CTG	.		0.547	SERPING1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317465.1	NM_000062	
BEST1	7439	broad.mit.edu	37	11	61730553	61730553	+	Intron	SNP	T	T	C	rs17185413	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr11:61730553T>C	ENST00000378043.4	+	10	2382				FTH1_ENST00000529191.1_Intron|FTH1_ENST00000529631.1_Intron|BEST1_ENST00000378042.3_Intron|BEST1_ENST00000534553.1_3'UTR|BEST1_ENST00000301774.9_Missense_Mutation_p.S271P|BEST1_ENST00000449131.2_Missense_Mutation_p.S583P	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1						chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						AGGGAAGTGTTCGGGACCTTT	0.537													T|||	523	0.104433	0.0151	0.1268	5008	,	,		21309	0.002		0.2247	False		,,,				2504	0.1912				p.S583P		.											.	BEST1-90	0			c.T1747C						.	T	PRO/SER,	73,1311		1,71,620	52.0	45.0	47.0		1747,	-2.9	0.0	11	dbSNP_123	47	798,2384		102,594,895	yes	missense,intron	BEST1	NM_001139443.1,NM_004183.3	74,	103,665,1515	CC,CT,TT		25.0786,5.2746,19.0758	,	583/605,	61730553	871,3695	692	1591	2283	SO:0001627	intron_variant	7439	exon9			AAGTGTTCGGGAC	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.1739+188T>C	11.37:g.61730553T>C		183	0		145	5	NM_001139443	0	0	0	0	0	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	Missense_Mutation	SNP	ENST00000378043.4	37	CCDS31580.1	230	0.10531135531135531	9	0.018292682926829267	60	0.16574585635359115	0	0.0	161	0.21240105540897097	T	17.59	3.427298	0.62733	0.052746	0.250786	ENSG00000167995	ENST00000301774;ENST00000449131	T;D	0.97209	-0.36;-4.29	4.35	-2.91	0.05631	.	.	.	.	.	T	0.00109	0.0003	N	0.08118	0	0.58432	P	5.000000000032756E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.50448	-0.8827	7	.	.	.	.	2.0384	0.03545	0.1365:0.3758:0.2746:0.2131	rs17185413	583	O76090-3	.	P	271;583	ENSP00000301774:S271P;ENSP00000399709:S583P	.	S	+	1	0	BEST1	61487129	0.000000	0.05858	0.000000	0.03702	0.259000	0.26198	-0.347000	0.07750	-0.344000	0.08338	0.459000	0.35465	TCG	T|0.906;C|0.094		0.537	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	NM_004183	
BSCL2	26580	broad.mit.edu;bcgsc.ca	37	11	62472840	62472840	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr11:62472840A>G	ENST00000403550.1	-	2	568	c.145T>C	c.(145-147)Tat>Cat	p.Y49H	GNG3_ENST00000294117.5_5'Flank|BSCL2_ENST00000421906.1_Missense_Mutation_p.Y49H|BSCL2_ENST00000433053.1_Missense_Mutation_p.Y113H|BSCL2_ENST00000405837.1_Missense_Mutation_p.Y113H|HNRNPUL2-BSCL2_ENST00000403734.2_3'UTR|BSCL2_ENST00000360796.5_Missense_Mutation_p.Y113H|BSCL2_ENST00000537604.1_Intron|BSCL2_ENST00000407022.3_Missense_Mutation_p.Y49H|BSCL2_ENST00000278893.7_Missense_Mutation_p.Y49H			Q96G97	BSCL2_HUMAN	Berardinelli-Seip congenital lipodystrophy 2 (seipin)	49					cell death (GO:0008219)|fat cell differentiation (GO:0045444)|lipid catabolic process (GO:0016042)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of lipid catabolic process (GO:0050995)	integral component of endoplasmic reticulum membrane (GO:0030176)				endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	12						AAGGAGCCATAGAGGAAGACA	0.552																																					p.Y113H		.											.	BSCL2-514	0			c.T337C						.						53.0	48.0	50.0					11																	62472840		2202	4299	6501	SO:0001583	missense	26580	exon2			AGCCATAGAGGAA		CCDS8031.1, CCDS44627.1, CCDS55769.1	11q13	2014-09-17	2009-07-30		ENSG00000168000	ENSG00000168000			15832	protein-coding gene	gene with protein product		606158	"""spastic paraplegia 17 (Silver syndrome)"""	GNG3LG, SPG17		11479539, 14981520	Standard	NM_001122955		Approved		uc001nur.4	Q96G97	OTTHUMG00000150624	ENST00000403550.1:c.145T>C	11.37:g.62472840A>G	ENSP00000385561:p.Tyr49His	320	1		238	14	NM_001122955	0	0	60	61	1	G3XAE4|Q567S1|Q96SV1|Q9BSQ0	Missense_Mutation	SNP	ENST00000403550.1	37	CCDS8031.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.619815	0.87460	.	.	ENSG00000168000	ENST00000405837;ENST00000433053;ENST00000278893;ENST00000360796;ENST00000403550;ENST00000407022;ENST00000421906;ENST00000448568;ENST00000524862;ENST00000533982;ENST00000532818	D;D;D;D;D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	5.57	5.57	0.84162	.	0.000000	0.64402	U	0.000004	D	0.95928	0.8674	M	0.89601	3.045	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.96550	0.9407	10	0.72032	D	0.01	-18.6787	13.6882	0.62529	1.0:0.0:0.0:0.0	.	49;49;113;49	Q96G97-3;Q53EN3;G3XAE4;Q96G97	.;.;.;BSCL2_HUMAN	H	113;113;49;113;49;49;49;49;113;49;113	ENSP00000385332:Y113H;ENSP00000414002:Y113H;ENSP00000278893:Y49H;ENSP00000354032:Y113H;ENSP00000385561:Y49H;ENSP00000384080:Y49H;ENSP00000413209:Y49H;ENSP00000413340:Y49H;ENSP00000433888:Y113H;ENSP00000434149:Y49H	ENSP00000278893:Y49H	Y	-	1	0	BSCL2	62229416	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.900000	0.87376	2.135000	0.66039	0.379000	0.24179	TAT	.		0.552	BSCL2-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000319185.1	NM_032667	
PITPNM1	9600	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	67262351	67262351	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr11:67262351T>C	ENST00000534749.1	-	17	2896	c.2708A>G	c.(2707-2709)aAg>aGg	p.K903R	PITPNM1_ENST00000356404.3_Missense_Mutation_p.K903R|PITPNM1_ENST00000436757.2_Missense_Mutation_p.K902R|PITPNM1_ENST00000526450.1_5'UTR			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	903					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						TCGCTGCCACTTCTCCCTGGG	0.692																																					p.K903R	GBM(28;144 709 4607 5525)	.											.	PITPNM1-227	0			c.A2708G						.						108.0	99.0	102.0					11																	67262351		2200	4295	6495	SO:0001583	missense	9600	exon18			TGCCACTTCTCCC	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2708A>G	11.37:g.67262351T>C	ENSP00000437286:p.Lys903Arg	98	0		93	6	NM_004910	0	0	3	3	0	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Missense_Mutation	SNP	ENST00000534749.1	37	CCDS31620.1	.	.	.	.	.	.	.	.	.	.	T	15.86	2.958238	0.53400	.	.	ENSG00000110697	ENST00000534749;ENST00000436757;ENST00000356404	T;T;T	0.52295	0.67;0.67;0.67	4.28	1.89	0.25635	.	0.230468	0.29653	N	0.011556	T	0.39572	0.1083	L	0.58810	1.83	0.42771	D	0.993834	B;B	0.10296	0.003;0.002	B;B	0.09377	0.004;0.002	T	0.26467	-1.0102	10	0.42905	T	0.14	-23.9423	7.6533	0.28360	0.0:0.1862:0.0:0.8138	.	902;903	O00562-2;O00562	.;PITM1_HUMAN	R	903;902;903	ENSP00000437286:K903R;ENSP00000398787:K902R;ENSP00000348772:K903R	ENSP00000348772:K903R	K	-	2	0	PITPNM1	67018927	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.836000	0.62789	0.611000	0.30052	0.260000	0.18958	AAG	.		0.692	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395520.1	NM_004910	
FGF4	2249	hgsc.bcm.edu	37	11	69589556	69589556	+	Silent	SNP	G	G	A	rs11600280	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr11:69589556G>A	ENST00000168712.1	-	1	615	c.297C>T	c.(295-297)ctC>ctT	p.L99L	AP001888.1_ENST00000602104.1_5'Flank|FGF4_ENST00000538040.1_5'UTR	NM_002007.2	NP_001998.1	P08620	FGF4_HUMAN	fibroblast growth factor 4	99					apoptotic process involved in morphogenesis (GO:0060561)|cartilage condensation (GO:0001502)|cell-cell signaling (GO:0007267)|chondroblast differentiation (GO:0060591)|cranial suture morphogenesis (GO:0060363)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)	cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			lung(3)	3	Melanoma(5;1.89e-05)		LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)		Pentosan Polysulfate(DB00686)	GGCCGTCGGGGAGCGCCTGGA	0.776													G|||	145	0.0289537	0.0008	0.0548	5008	,	,		8358	0.0		0.0865	False		,,,				2504	0.0194				p.L99L		.											.	FGF4-1270	0			c.C297T						.	G		45,3935		0,45,1945	4.0	4.0	4.0		297	-0.8	1.0	11	dbSNP_120	4	419,7473		7,405,3534	no	coding-synonymous	FGF4	NM_002007.2		7,450,5479	AA,AG,GG		5.3092,1.1307,3.9084		99/207	69589556	464,11408	1990	3946	5936	SO:0001819	synonymous_variant	2249	exon1			GTCGGGGAGCGCC	M17446	CCDS8194.1	11q13.3	2014-01-30	2008-08-01		ENSG00000075388	ENSG00000075388		"""Endogenous ligands"""	3682	protein-coding gene	gene with protein product	"""human stomach cancer, transforming factor from FGF-related oncogene"", ""kaposi sarcoma oncogene"", ""transforming protein KS3"""	164980	"""heparin secretory transforming protein 1"""	HSTF1		1611909	Standard	NM_002007		Approved	K-FGF, HBGF-4, HST, HST-1, KFGF	uc001opg.1	P08620	OTTHUMG00000167887	ENST00000168712.1:c.297C>T	11.37:g.69589556G>A		0	0		9	9	NM_002007	0	0	0	0	0	B7U994	Silent	SNP	ENST00000168712.1	37	CCDS8194.1																																																																																			G|0.967;A|0.033		0.776	FGF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396834.2	NM_002007	
H2AFX	3014	broad.mit.edu	37	11	118965789	118965789	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr11:118965789C>T	ENST00000530167.1	-	1	388	c.316G>A	c.(316-318)Gga>Aga	p.G106R		NM_002105.2	NP_002096.1	P16104	H2AX_HUMAN	H2A histone family, member X	106					cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|nucleosome assembly (GO:0006334)|positive regulation of DNA repair (GO:0045739)|response to ionizing radiation (GO:0010212)|spermatogenesis (GO:0007283)	condensed nuclear chromosome (GO:0000794)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)			lung(3)	3	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)		AGGACGCCTCCCTGGGCGATC	0.682								Chromatin Structure			OREG0021395	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G106R		.											.	H2AFX-651	0			c.G316A						.						85.0	86.0	85.0					11																	118965789		2200	4294	6494	SO:0001583	missense	3014	exon1			CGCCTCCCTGGGC	X14850	CCDS8410.1	11q23.3	2011-01-27						"""Histones / Replication-independent"""	4739	protein-coding gene	gene with protein product		601772		H2AX		8076949	Standard	NM_002105		Approved		uc001pvg.3	P16104		ENST00000530167.1:c.316G>A	11.37:g.118965789C>T	ENSP00000434024:p.Gly106Arg	107	0	1492	213	6	NM_002105	0	0	29	29	0	Q4ZGJ7|Q6IAS5	Missense_Mutation	SNP	ENST00000530167.1	37	CCDS8410.1	.	.	.	.	.	.	.	.	.	.	C	34	5.385604	0.95967	.	.	ENSG00000188486	ENST00000530167;ENST00000375167	D;D	0.95103	-3.61;-3.61	5.92	5.92	0.95590	Histone-fold (2);Histone H2A (2);	0.000000	0.64402	D	0.000009	D	0.97794	0.9276	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98128	1.0429	10	0.87932	D	0	.	19.2987	0.94134	0.0:1.0:0.0:0.0	.	106	P16104	H2AX_HUMAN	R	106	ENSP00000434024:G106R;ENSP00000364310:G106R	ENSP00000364310:G106R	G	-	1	0	H2AFX	118470999	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	7.597000	0.82733	2.809000	0.96659	0.655000	0.94253	GGA	.		0.682	H2AFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388330.2	NM_002105	
PARP11	57097	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	3921573	3921573	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:3921573T>C	ENST00000228820.4	-	8	877	c.733A>G	c.(733-735)Agt>Ggt	p.S245G	PARP11_ENST00000476985.1_Intron|PARP11_ENST00000427057.2_Missense_Mutation_p.S164G|PARP11_ENST00000397096.2_Intron|PARP11_ENST00000447133.3_Missense_Mutation_p.S164G	NM_020367.4	NP_065100.2	Q9NR21	PAR11_HUMAN	poly (ADP-ribose) polymerase family, member 11	238	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.						NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	17			all cancers(3;1.58e-07)|OV - Ovarian serous cystadenocarcinoma(31;0.00287)|GBM - Glioblastoma multiforme(3;0.0141)|COAD - Colon adenocarcinoma(12;0.0264)			CAGAAACGACTGGAATAAGCA	0.363																																					p.S245G		.											.	PARP11-523	0			c.A733G						.						78.0	75.0	76.0					12																	3921573		2203	4300	6503	SO:0001583	missense	57097	exon8			AACGACTGGAATA	AF263540	CCDS8523.2, CCDS66281.1	12p13.3	2014-01-28	2004-08-25	2004-08-26	ENSG00000111224	ENSG00000111224		"""Poly (ADP-ribose) polymerases"""	1186	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 6"""	C12orf6		15273990	Standard	NM_001286522		Approved		uc001qml.2	Q9NR21	OTTHUMG00000156442	ENST00000228820.4:c.733A>G	12.37:g.3921573T>C	ENSP00000228820:p.Ser245Gly	64	0		82	40	NM_020367	0	0	9	16	7	B4DRQ0|Q68DS1|Q8N5Y9	Missense_Mutation	SNP	ENST00000228820.4	37	CCDS8523.2	.	.	.	.	.	.	.	.	.	.	T	17.45	3.393570	0.62066	.	.	ENSG00000111224	ENST00000427057;ENST00000228820;ENST00000447133	T;T;T	0.14516	2.5;2.5;2.5	5.95	5.95	0.96441	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.29588	0.0738	L	0.45581	1.43	0.58432	D	0.999997	P;D;D	0.69078	0.917;0.996;0.997	P;D;D	0.77004	0.503;0.98;0.989	T	0.01053	-1.1467	10	0.30078	T	0.28	.	14.3843	0.66934	0.0:0.0:0.0:1.0	.	164;245;238	Q9NR21-2;Q9NR21-4;Q9NR21	.;.;PAR11_HUMAN	G	164;245;164	ENSP00000397058:S164G;ENSP00000228820:S245G;ENSP00000405385:S164G	ENSP00000228820:S245G	S	-	1	0	PARP11	3791834	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.474000	0.81024	2.281000	0.76405	0.528000	0.53228	AGT	.		0.363	PARP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344213.1		
ATN1	1822	ucsc.edu	37	12	7045906	7045906	+	Silent	SNP	G	G	A	rs377147612		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:7045906G>A	ENST00000356654.4	+	5	1713	c.1476G>A	c.(1474-1476)caG>caA	p.Q492Q	ATN1_ENST00000396684.2_Silent_p.Q492Q	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	492	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.647																																					p.Q492Q		.											.	ATN1-139	0			c.G1476A						.						43.0	53.0	49.0					12																	7045906		2188	4263	6451	SO:0001819	synonymous_variant	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1476G>A	12.37:g.7045906G>A		107	0		153	14	NM_001007026	0	0	372	373	1	Q99495|Q99621|Q9UEK7	Silent	SNP	ENST00000356654.4	37	CCDS31734.1																																																																																			.		0.647	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
ATN1	1822	hgsc.bcm.edu	37	12	7045924	7045924	+	Missense_Mutation	SNP	G	G	T	rs199988271		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:7045924G>T	ENST00000356654.4	+	5	1731	c.1494G>T	c.(1492-1494)caG>caT	p.Q498H	ATN1_ENST00000396684.2_Missense_Mutation_p.Q498H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	498	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.637																																					p.Q498H		.											.	ATN1-139	0			c.G1494T						.						43.0	53.0	49.0					12																	7045924		2201	4297	6498	SO:0001583	missense	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1494G>T	12.37:g.7045924G>T	ENSP00000349076:p.Gln498His	102	0		141	8	NM_001007026	0	0	232	232	0	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.273578	0.00257	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.56776	0.44;0.44;0.44	1.44	-2.88	0.05682	.	.	.	.	.	T	0.24392	0.0591	N	0.22421	0.69	0.09310	N	1	P	0.40970	0.734	B	0.30401	0.115	T	0.19353	-1.0308	9	0.17832	T	0.49	.	3.3676	0.07208	0.2981:0.2446:0.4573:0.0	.	498	P54259	ATN1_HUMAN	H	498;498;498;83	ENSP00000349076:Q498H;ENSP00000379915:Q498H;ENSP00000441744:Q498H	ENSP00000229279:Q83H	Q	+	3	2	ATN1	6916185	0.175000	0.23083	0.269000	0.24586	0.334000	0.28698	-0.489000	0.06490	-0.760000	0.04677	0.109000	0.15622	CAG	G|0.999;A|0.001		0.637	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
CLEC1A	51267	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	10223960	10223960	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:10223960G>T	ENST00000315330.4	-	6	877	c.815C>A	c.(814-816)cCc>cAc	p.P272H	CLEC1A_ENST00000420265.2_Missense_Mutation_p.P180H|CLEC1A_ENST00000457018.2_Missense_Mutation_p.P239H	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	272					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						TGTTTCAGGGGGGACATGGAG	0.507																																					p.P272H		.											.	CLEC1A-91	0			c.C815A						.						157.0	141.0	146.0					12																	10223960		2203	4300	6503	SO:0001583	missense	51267	exon6			TCAGGGGGGACAT	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.815C>A	12.37:g.10223960G>T	ENSP00000326407:p.Pro272His	94	0		157	69	NM_016511	0	0	3	3	0	Q8IUW7|Q9NZH3	Missense_Mutation	SNP	ENST00000315330.4	37	CCDS8612.1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.732243	0.30684	.	.	ENSG00000150048	ENST00000315330;ENST00000457018;ENST00000420265	T;T;T	0.01505	4.91;4.91;4.82	4.8	-6.63	0.01807	.	4.133730	0.00766	N	0.001162	T	0.01156	0.0038	N	0.08118	0	0.09310	N	1	P;P;P	0.36438	0.553;0.553;0.553	B;B;B	0.34824	0.19;0.19;0.125	T	0.40757	-0.9546	10	0.52906	T	0.07	.	6.2335	0.20750	0.2935:0.3572:0.3494:0.0	.	180;239;272	E7ESV9;E9PFB4;Q8NC01	.;.;CLC1A_HUMAN	H	272;239;180	ENSP00000326407:P272H;ENSP00000415048:P239H;ENSP00000417010:P180H	ENSP00000326407:P272H	P	-	2	0	CLEC1A	10115227	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-2.271000	0.01166	-1.277000	0.02411	-0.440000	0.05779	CCC	.		0.507	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511	
KIAA1467	57613	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	13232844	13232844	+	Silent	SNP	G	G	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:13232844G>A	ENST00000197268.8	+	12	1884	c.1764G>A	c.(1762-1764)gaG>gaA	p.E588E		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	588						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		CACTAATGGAGGGCCAGATGG	0.542																																					p.E588E		.											.	KIAA1467-92	0			c.G1764A						.						71.0	68.0	69.0					12																	13232844		2203	4300	6503	SO:0001819	synonymous_variant	57613	exon12			AATGGAGGGCCAG	AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.1764G>A	12.37:g.13232844G>A		177	0		251	122	NM_020853	0	0	2	6	4	Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Silent	SNP	ENST00000197268.8	37	CCDS31750.1																																																																																			.		0.542	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401007.1	NM_020853	
HDAC7	51564	ucsc.edu;bcgsc.ca	37	12	48181875	48181875	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:48181875G>A	ENST00000427332.2	-	20	2347	c.2191C>T	c.(2191-2193)Cgc>Tgc	p.R731C	HDAC7_ENST00000488927.1_5'Flank|HDAC7_ENST00000080059.7_Missense_Mutation_p.R770C|HDAC7_ENST00000354334.3_Missense_Mutation_p.R733C|HDAC7_ENST00000552960.1_Missense_Mutation_p.R753C|HDAC7_ENST00000380610.4_Missense_Mutation_p.R787C			Q8WUI4	HDAC7_HUMAN	histone deacetylase 7	731	Histone deacetylase.				cell-cell junction assembly (GO:0007043)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25				GBM - Glioblastoma multiforme(48;0.137)		TCGTCATGGCGATGCAGGGAG	0.592																																					p.R770C		.											.	HDAC7-289	0			c.C2308T						.						226.0	168.0	188.0					12																	48181875		2203	4300	6503	SO:0001583	missense	51564	exon20			CATGGCGATGCAG	AF239243	CCDS8756.2, CCDS41776.1	12q13.1	2008-02-25	2008-02-25	2008-02-25	ENSG00000061273	ENSG00000061273			14067	protein-coding gene	gene with protein product		606542	"""histone deacetylase 7A"""	HDAC7A		10922406, 10640276	Standard	NM_015401		Approved	DKFZP586J0917	uc010slo.2	Q8WUI4	OTTHUMG00000152968	ENST00000427332.2:c.2191C>T	12.37:g.48181875G>A	ENSP00000404394:p.Arg731Cys	357	3		525	198	NM_015401	0	0	25	53	28	B3KY08|B4DWI0|B4E0Q5|Q6P1W9|Q6W9G7|Q7Z4K2|Q7Z5I1|Q96K01|Q9BR73|Q9H7L0|Q9NW41|Q9NWA9|Q9NYK9|Q9UFU7	Missense_Mutation	SNP	ENST00000427332.2	37		.	.	.	.	.	.	.	.	.	.	G	31	5.097640	0.94197	.	.	ENSG00000061273	ENST00000080059;ENST00000354334;ENST00000552960;ENST00000380610;ENST00000427332	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	D	0.88303	0.6400	M	0.93763	3.455	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;P;D	0.97110	0.917;0.873;1.0	D	0.91328	0.5087	10	0.87932	D	0	.	17.3928	0.87437	0.0:0.0:1.0:0.0	.	770;753;733	Q8WUI4-5;Q8WUI4-6;Q8WUI4-7	.;.;.	C	770;733;753;787;731	ENSP00000080059:R770C;ENSP00000351326:R733C;ENSP00000448532:R753C;ENSP00000369984:R787C;ENSP00000404394:R731C	ENSP00000080059:R770C	R	-	1	0	HDAC7	46468142	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.807000	0.99171	2.522000	0.85027	0.555000	0.69702	CGC	.		0.592	HDAC7-013	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000328804.2		
KRT6B	3854	bcgsc.ca	37	12	52841672	52841672	+	Silent	SNP	C	C	T	rs142297644	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:52841672C>T	ENST00000252252.3	-	7	1361	c.1314G>A	c.(1312-1314)aaG>aaA	p.K438K		NM_005555.3	NP_005546.2	P04259	K2C6B_HUMAN	keratin 6B	438	Coil 2.|Rod.				ectoderm development (GO:0007398)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(19)|ovary(4)|prostate(2)	40				BRCA - Breast invasive adenocarcinoma(357;0.083)		CCAGGTCCTGCTTGGCCTTCT	0.617													C|||	47	0.00938498	0.0129	0.0144	5008	,	,		20875	0.003		0.0099	False		,,,				2504	0.0072				p.K438K		.											.	KRT6B-92	0			c.G1314A						.						101.0	94.0	96.0					12																	52841672		2203	4298	6501	SO:0001819	synonymous_variant	3854	exon7			GTCCTGCTTGGCC	BC034535	CCDS8828.1	12q13.13	2013-01-16	2004-08-11		ENSG00000185479	ENSG00000185479		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6444	protein-coding gene	gene with protein product		148042	"""keratin-like 1 (a type II keratin sequence)"""	KRTL1		1713141, 16831889	Standard	NM_005555		Approved		uc001sak.3	P04259	OTTHUMG00000169593	ENST00000252252.3:c.1314G>A	12.37:g.52841672C>T		199	5		369	38	NM_005555	0	0	0	0	0	P48669	Silent	SNP	ENST00000252252.3	37	CCDS8828.1																																																																																			C|0.998;T|0.002		0.617	KRT6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404969.1	NM_005555	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	0	0		14	14	NM_152435	0	0	0	2	2	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		0	0		28	28	NM_152435	0	0	0	2	2	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
TRPV4	59341	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	110226237	110226237	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:110226237A>G	ENST00000418703.2	-	12	2270	c.2176T>C	c.(2176-2178)Tcc>Ccc	p.S726P	TRPV4_ENST00000541794.1_Missense_Mutation_p.S679P|TRPV4_ENST00000536838.1_Missense_Mutation_p.S692P|TRPV4_ENST00000392719.2_Missense_Mutation_p.S679P|TRPV4_ENST00000261740.2_Missense_Mutation_p.S726P|TRPV4_ENST00000346520.2_Missense_Mutation_p.S666P|TRPV4_ENST00000544971.1_Missense_Mutation_p.S619P|TRPV4_ENST00000537083.1_Missense_Mutation_p.S666P	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	726					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						CTCTCCTTGGAGACCTGGCCC	0.612																																					p.S726P		.											.	TRPV4-94	0			c.T2176C						.						73.0	57.0	63.0					12																	110226237		2203	4300	6503	SO:0001583	missense	59341	exon13			CCTTGGAGACCTG	AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.2176T>C	12.37:g.110226237A>G	ENSP00000406191:p.Ser726Pro	150	0		201	44	NM_021625	0	0	1	1	0	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	ENST00000418703.2	37	CCDS9134.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.535871	0.85812	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.85629	-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01;-2.01	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.91885	0.7431	M	0.79123	2.44	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;0.999	D;D;D;D;D	0.85130	0.997;0.997;0.997;0.991;0.983	D	0.92627	0.6113	10	0.62326	D	0.03	-49.9353	14.1491	0.65370	1.0:0.0:0.0:0.0	.	666;726;619;679;692	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	P	726;726;679;666;619;666;679;692	ENSP00000406191:S726P;ENSP00000261740:S726P;ENSP00000376480:S679P;ENSP00000319003:S666P;ENSP00000443611:S619P;ENSP00000442738:S666P;ENSP00000442167:S679P;ENSP00000444336:S692P	ENSP00000261740:S726P	S	-	1	0	TRPV4	108710620	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.844000	0.69430	2.024000	0.59613	0.533000	0.62120	TCC	.		0.612	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403270.1	NM_021625	
RAD9B	144715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	110960124	110960124	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:110960124G>C	ENST00000409778.3	+	8	850	c.826G>C	c.(826-828)Gca>Cca	p.A276P	RAD9B_ENST00000409300.1_Missense_Mutation_p.A345P|RAD9B_ENST00000409425.1_Missense_Mutation_p.A273P|RAD9B_ENST00000392672.4_Missense_Mutation_p.A345P|RAD9B_ENST00000409246.1_Missense_Mutation_p.A273P			Q6WBX8	RAD9B_HUMAN	RAD9 homolog B (S. pombe)	342					DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)	checkpoint clamp complex (GO:0030896)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	7						TGGCAGCCCTGCAATGAAAAG	0.458																																					p.A345P		.											.	RAD9B-228	0			c.G1033C						.						65.0	55.0	59.0					12																	110960124		2203	4300	6503	SO:0001583	missense	144715	exon10			AGCCCTGCAATGA		CCDS9148.2, CCDS66469.1, CCDS73526.1, CCDS73527.1	12q24.13	2008-12-15	2008-12-15		ENSG00000151164	ENSG00000151164			21700	protein-coding gene	gene with protein product		608368					Standard	NM_152442		Approved	FLJ40346	uc001trf.4	Q6WBX8	OTTHUMG00000152952	ENST00000409778.3:c.826G>C	12.37:g.110960124G>C	ENSP00000386697:p.Ala276Pro	278	0		384	43	NM_152442	0	0	0	1	1	Q5U5K0|Q6NVJ1|Q6ZVT7|Q8N7T9|Q96LI8	Missense_Mutation	SNP	ENST00000409778.3	37		.	.	.	.	.	.	.	.	.	.	G	9.083	0.999916	0.19121	.	.	ENSG00000151164	ENST00000409246;ENST00000392672;ENST00000409300;ENST00000409425;ENST00000409778	T;T;T;T;T	0.24723	1.84;2.16;2.17;1.84;2.09	4.33	-4.98	0.03019	.	5.457520	0.00166	N	0.000010	T	0.10380	0.0254	N	0.04959	-0.14	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.13442	-1.0509	10	0.22109	T	0.4	10.49	3.0703	0.06229	0.1984:0.1286:0.5305:0.1425	.	276;345;342	B4DYM6;B4DX60;Q6WBX8	.;.;RAD9B_HUMAN	P	273;345;345;273;276	ENSP00000387329:A273P;ENSP00000376440:A345P;ENSP00000386434:A345P;ENSP00000386629:A273P;ENSP00000386697:A276P	ENSP00000376440:A345P	A	+	1	0	RAD9B	109444507	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.313000	0.02718	-0.832000	0.04251	-0.291000	0.09656	GCA	.		0.458	RAD9B-009	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404634.1	NM_152442	
PPTC7	160760	broad.mit.edu	37	12	111020740	111020742	+	In_Frame_Del	DEL	CGC	CGC	-	rs151075597	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr12:111020740_111020742delCGC	ENST00000354300.3	-	1	383_385	c.95_97delGCG	c.(94-99)ggcgac>gac	p.G32del		NM_139283.1	NP_644812.1	Q8NI37	PPTC7_HUMAN	PTC7 protein phosphatase homolog (S. cerevisiae)	32	Gly-rich.					mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|large_intestine(2)|lung(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	9						AGTCCGTAGTcgccgccgccgcc	0.739														302	0.0603035	0.0719	0.1254	5008	,	,		10517	0.001		0.0924	False		,,,				2504	0.0266				p.32_33del		.											.	PPTC7-90	0			c.95_97del						.			149,1205		60,29,588						4.1	1.0		dbSNP_126	4	388,2704		139,110,1297	no	coding	PPTC7	NM_139283.1		199,139,1885	A1A1,A1R,RR		12.5485,11.0044,12.0783				537,3909				SO:0001651	inframe_deletion	160760	exon1			CGTAGTCGCCGCC	AF385435	CCDS9149.1	12q24.11	2009-11-05				ENSG00000196850			30695	protein-coding gene	gene with protein product	"""T cell activation protein phosphatase 2C"""	609668				15177553	Standard	NM_139283		Approved	TA-PP2C	uc001trh.1	Q8NI37	OTTHUMG00000169529	ENST00000354300.3:c.95_97delGCG	12.37:g.111020749_111020751delCGC	ENSP00000346255:p.Gly32del	4	0		58	17	NM_139283	0	0	0	0	0	B3KWC5|Q68DZ7|Q6UY82	In_Frame_Del	DEL	ENST00000354300.3	37	CCDS9149.1																																																																																			.		0.739	PPTC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404635.1	NM_139283	
TPTE2	93492	bcgsc.ca	37	13	20056679	20056679	+	Missense_Mutation	SNP	T	T	G	rs200244531		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr13:20056679T>G	ENST00000400230.2	-	4	172	c.128A>C	c.(127-129)gAa>gCa	p.E43A	TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382977.4_Missense_Mutation_p.E43A|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000382978.1_Missense_Mutation_p.E43A|TPTE2_ENST00000400103.2_Missense_Mutation_p.E43A|TPTE2_ENST00000382975.4_Missense_Mutation_p.E43A|TPTE2_ENST00000457266.2_Missense_Mutation_p.E43A			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	43					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.E43A(1)		NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		GGAAAGTCGTTCTAACATACT	0.313																																					p.E43A		.											.	TPTE2-92	1	Substitution - Missense(1)	kidney(1)	c.A128C						.						52.0	51.0	51.0					13																	20056679		2201	4299	6500	SO:0001583	missense	93492	exon5			AGTCGTTCTAACA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.128A>C	13.37:g.20056679T>G	ENSP00000383089:p.Glu43Ala	363	2		304	9	NM_199254	0	0	0	0	0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	2.387	-0.340821	0.05243	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94931	-3.56;-3.53;-3.47;-3.47;-3.56;-3.53	2.06	0.858	0.19030	.	0.878504	0.09602	U	0.780065	D	0.86159	0.5866	N	0.21448	0.665	0.09310	N	1	B;B	0.28850	0.225;0.0	B;B	0.19946	0.027;0.0	T	0.74598	-0.3612	9	.	.	.	-0.5937	3.8365	0.08896	0.0:0.192:0.0:0.808	.	43;43	A8MX64;Q6XPS3	.;TPTE2_HUMAN	A	43	ENSP00000372438:E43A;ENSP00000382974:E43A;ENSP00000383089:E43A;ENSP00000372437:E43A;ENSP00000372435:E43A;ENSP00000442218:E43A	.	E	-	2	0	TPTE2	18954679	0.001000	0.12720	0.001000	0.08648	0.004000	0.04260	0.422000	0.21296	0.241000	0.21283	0.383000	0.25322	GAA	.		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
TPTE2	93492	bcgsc.ca	37	13	20056686	20056686	+	Splice_Site	SNP	T	T	C	rs201542496		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr13:20056686T>C	ENST00000400230.2	-	4	165	c.121A>G	c.(121-123)Atg>Gtg	p.M41V	TPTE2_ENST00000390680.2_Intron|TPTE2_ENST00000382977.4_Splice_Site_p.M41V|TPTE2_ENST00000255310.6_Intron|TPTE2_ENST00000382978.1_Splice_Site_p.M41V|TPTE2_ENST00000400103.2_Splice_Site_p.M41V|TPTE2_ENST00000382975.4_Splice_Site_p.M41V|TPTE2_ENST00000457266.2_Splice_Site_p.M41V			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	41					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CGTTCTAACATACTTTAGCCA	0.313																																					p.M41V		.											.	TPTE2-92	0			c.A121G						.						47.0	46.0	47.0					13																	20056686		2202	4298	6500	SO:0001630	splice_region_variant	93492	exon5			CTAACATACTTTA	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.120-1A>G	13.37:g.20056686T>C		350	3		286	9	NM_199254	0	0	0	0	0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	ENST00000400230.2	37	CCDS45014.1	.	.	.	.	.	.	.	.	.	.	T	0	-2.805163	0.00075	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000382977;ENST00000382975;ENST00000457266;ENST00000343548	D;D;D;D;D;D	0.94376	-3.41;-3.33;-3.28;-3.28;-3.41;-3.33	2.06	0.838	0.18902	.	0.589765	0.15086	U	0.281346	D	0.83399	0.5246	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.68424	-0.5412	9	.	.	.	0.2742	3.9369	0.09310	0.0:0.1886:0.0:0.8114	.	41;41	A8MX64;Q6XPS3	.;TPTE2_HUMAN	V	41	ENSP00000372438:M41V;ENSP00000382974:M41V;ENSP00000383089:M41V;ENSP00000372437:M41V;ENSP00000372435:M41V;ENSP00000442218:M41V	.	M	-	1	0	TPTE2	18954686	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.105000	0.10907	0.235000	0.21160	0.383000	0.25322	ATG	.		0.313	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	Missense_Mutation
RNF17	56163	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	25341412	25341412	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr13:25341412C>T	ENST00000255324.5	+	2	185	c.133C>T	c.(133-135)Cac>Tac	p.H45Y	RNF17_ENST00000255325.6_Missense_Mutation_p.H45Y|RNF17_ENST00000255326.4_3'UTR|RNF17_ENST00000381921.1_Missense_Mutation_p.H45Y	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	45					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)	p.H45N(2)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ATCAATAGGTCACCATTGTGA	0.388																																					p.H45Y		.											.	RNF17-228	2	Substitution - Missense(2)	lung(2)	c.C133T						.						171.0	152.0	158.0					13																	25341412		2203	4300	6503	SO:0001583	missense	56163	exon2			ATAGGTCACCATT	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.133C>T	13.37:g.25341412C>T	ENSP00000255324:p.His45Tyr	101	0		81	64	NM_001184993	0	0	0	0	0	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	37	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	C	7.749	0.702864	0.15172	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000255325;ENST00000255326	D;D;D	0.85629	-2.01;-2.01;-2.01	4.57	3.72	0.42706	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.393020	0.21751	N	0.069679	T	0.80193	0.4578	L	0.29908	0.895	0.23138	N	0.998232	P;P;P	0.52316	0.475;0.475;0.952	B;B;P	0.47075	0.188;0.188;0.536	T	0.72571	-0.4253	10	0.66056	D	0.02	.	10.7051	0.45950	0.0:0.8079:0.1921:0.0	.	45;45;45	B7Z7S1;Q9BXT8;Q9BXT8-2	.;RNF17_HUMAN;.	Y	45	ENSP00000255324:H45Y;ENSP00000371346:H45Y;ENSP00000255325:H45Y	ENSP00000255324:H45Y	H	+	1	0	RNF17	24239412	0.997000	0.39634	0.877000	0.34402	0.030000	0.12068	2.195000	0.42677	1.085000	0.41206	0.585000	0.79938	CAC	.		0.388	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
MTUS2	23281	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	29599148	29599148	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr13:29599148C>A	ENST00000431530.3	+	1	401	c.343C>A	c.(343-345)Cag>Aag	p.Q115K		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	105						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						TTCAACCATTCAGAGGGAACT	0.493																																					p.Q115K		.											.	MTUS2-218	0			c.C343A						.						64.0	62.0	63.0					13																	29599148		1928	4133	6061	SO:0001583	missense	23281	exon1			ACCATTCAGAGGG	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.343C>A	13.37:g.29599148C>A	ENSP00000392057:p.Gln115Lys	81	0		64	19	NM_001033602	0	0	0	0	0	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	ENST00000431530.3	37	CCDS45022.1	.	.	.	.	.	.	.	.	.	.	c	10.45	1.353299	0.24512	.	.	ENSG00000132938	ENST00000431530	T	0.10763	2.84	5.37	2.71	0.32032	.	1.659970	0.03282	N	0.186269	T	0.07908	0.0198	N	0.22421	0.69	0.09310	N	1	B	0.22346	0.068	B	0.21546	0.035	T	0.36114	-0.9761	9	.	.	.	.	1.7831	0.03036	0.1479:0.4852:0.1284:0.2386	.	105	Q5JR59	MTUS2_HUMAN	K	115	ENSP00000392057:Q115K	.	Q	+	1	0	MTUS2	28497148	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	0.659000	0.24994	0.252000	0.21531	0.563000	0.77884	CAG	.		0.493	MTUS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044336.3	XM_166270	
STARD13	90627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	33716447	33716447	+	Splice_Site	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr13:33716447C>G	ENST00000336934.5	-	4	503	c.387G>C	c.(385-387)aaG>aaC	p.K129N	STARD13_ENST00000399365.3_Splice_Site_p.K11N|STARD13_ENST00000255486.4_Splice_Site_p.K121N|STARD13_ENST00000487412.1_5'UTR	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13	129					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		GGGCACCTACCTTTTTCCTTT	0.388																																					p.K129N		.											.	STARD13-94	0			c.G387C						.						149.0	128.0	135.0					13																	33716447		2203	4300	6503	SO:0001630	splice_region_variant	90627	exon4			ACCTACCTTTTTC	AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.387+1G>C	13.37:g.33716447C>G		61	0		56	40	NM_178006	0	0	0	0	0	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	Missense_Mutation	SNP	ENST00000336934.5	37	CCDS9348.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.233106	0.79688	.	.	ENSG00000133121	ENST00000399365;ENST00000255486;ENST00000336934;ENST00000399364	T;T;T	0.47528	3.25;0.84;0.84	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.57755	0.2075	L	0.57536	1.79	0.80722	D	1	B;P;P;P	0.48640	0.292;0.907;0.913;0.735	B;P;P;B	0.51355	0.234;0.667;0.467;0.444	T	0.54879	-0.8227	9	.	.	.	.	18.8313	0.92141	0.0:1.0:0.0:0.0	.	121;94;129;121	Q9Y3M8-5;Q9Y3M8-4;Q9Y3M8;Q9Y3M8-2	.;.;STA13_HUMAN;.	N	11;121;129;121	ENSP00000382300:K11N;ENSP00000255486:K121N;ENSP00000338785:K129N	.	K	-	3	2	STARD13	32614447	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.136000	0.58004	2.622000	0.88805	0.644000	0.83932	AAG	.		0.388	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276118.2	NM_001243466	Missense_Mutation
LIG4	3981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	108862298	108862298	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr13:108862298G>C	ENST00000356922.4	-	2	1591	c.1319C>G	c.(1318-1320)cCa>cGa	p.P440R	LIG4_ENST00000405925.1_Missense_Mutation_p.P440R|LIG4_ENST00000442234.1_Missense_Mutation_p.P440R	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	440					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TCTTTTGTCTGGCTTGTAGAT	0.353								Non-homologous end-joining																													p.P440R		.											.	LIG4-659	0			c.C1319G						.						181.0	185.0	184.0					13																	108862298		2203	4299	6502	SO:0001583	missense	3981	exon3			TTGTCTGGCTTGT	X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.1319C>G	13.37:g.108862298G>C	ENSP00000349393:p.Pro440Arg	52	0		60	42	NM_206937	0	0	0	10	10	Q8IY66|Q8TEU5	Missense_Mutation	SNP	ENST00000356922.4	37	CCDS9508.1	.	.	.	.	.	.	.	.	.	.	G	18.24	3.580725	0.65992	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	D;D;D	0.82255	-1.59;-1.59;-1.59	5.19	5.19	0.71726	DNA ligase, ATP-dependent, central (2);DNA ligase, ATP-dependent, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94169	0.8129	H	0.96269	3.795	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95546	0.8616	10	0.62326	D	0.03	.	18.0695	0.89402	0.0:0.0:1.0:0.0	.	440	P49917	DNLI4_HUMAN	R	440	ENSP00000385955:P440R;ENSP00000402030:P440R;ENSP00000349393:P440R	ENSP00000349393:P440R	P	-	2	0	LIG4	107660299	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.697000	0.98697	2.572000	0.86782	0.643000	0.83706	CCA	.		0.353	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045738.4	NM_002312	
SAMD4A	23034	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	55203812	55203812	+	Silent	SNP	A	A	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr14:55203812A>T	ENST00000554335.1	+	4	1449	c.786A>T	c.(784-786)ccA>ccT	p.P262P	SAMD4A_ENST00000251091.5_Intron|SAMD4A_ENST00000392067.3_Silent_p.P262P|SAMD4A_ENST00000357634.3_Silent_p.P261P			Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4A	262					negative regulation of translation (GO:0017148)|positive regulation of translation (GO:0045727)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|translation repressor activity (GO:0030371)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)	29						TGAATGTGCCAAACCAGCCTC	0.502																																					p.P262P		.											.	SAMD4A-90	0			c.A786T						.						193.0	193.0	193.0					14																	55203812		2203	4300	6503	SO:0001819	synonymous_variant	23034	exon3			TGTGCCAAACCAG	AB028976	CCDS32084.1, CCDS55917.1, CCDS55918.1, CCDS32084.2, CCDS55917.2	14q22.2	2013-01-10	2006-01-27	2006-01-27	ENSG00000020577	ENSG00000020577		"""Sterile alpha motif (SAM) domain containing"""	23023	protein-coding gene	gene with protein product	"""smaug homolog (Drosophila)"""	610747	"""sterile alpha motif domain containing 4"""	SAMD4		16221671	Standard	NM_001161577		Approved	KIAA1053, DKFZP434H0350, Smaug, SMG, SMGA, hSmaug1	uc001xbb.4	Q9UPU9	OTTHUMG00000170999	ENST00000554335.1:c.786A>T	14.37:g.55203812A>T		73	1		67	49	NM_015589	0	0	0	0	0	A8MPZ5|Q0VA96|Q6PEW4	Silent	SNP	ENST00000554335.1	37	CCDS32084.2																																																																																			.		0.502	SAMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000411186.1	NM_015589	
ZFYVE26	23503	broad.mit.edu	37	14	68229079	68229079	+	Silent	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr14:68229079G>T	ENST00000347230.4	-	34	6348	c.6210C>A	c.(6208-6210)ggC>ggA	p.G2070G	ZFYVE26_ENST00000555452.1_Silent_p.G2070G|ZFYVE26_ENST00000557306.1_5'Flank	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	2070					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GGCAGGCCATGCCCCAAGCAT	0.547																																					p.G2070G		.											.	ZFYVE26-162	0			c.C6210A						.						72.0	60.0	64.0					14																	68229079		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon34			GGCCATGCCCCAA	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.6210C>A	14.37:g.68229079G>T		141	0		106	4	NM_015346	0	0	5	5	0	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	37	CCDS9788.1																																																																																			.		0.547	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
KCNK10	54207	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	88652422	88652422	+	Silent	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr14:88652422G>T	ENST00000340700.5	-	7	1525	c.1074C>A	c.(1072-1074)ctC>ctA	p.L358L	KCNK10_ENST00000319231.5_Silent_p.L363L|KCNK10_ENST00000312350.5_Silent_p.L363L	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	358					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						TCTCCACGCTGAGCCTTCGCC	0.647																																					p.L363L		.											.	KCNK10-95	0			c.C1089A						.						33.0	24.0	27.0					14																	88652422		2192	4291	6483	SO:0001819	synonymous_variant	54207	exon7			CACGCTGAGCCTT	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1074C>A	14.37:g.88652422G>T		133	1		155	110	NM_138318	0	0	0	0	0	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Silent	SNP	ENST00000340700.5	37	CCDS9880.1																																																																																			.		0.647	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
SERPINA9	327657	bcgsc.ca	37	14	94933709	94933709	+	Silent	SNP	C	C	T	rs6575433	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr14:94933709C>T	ENST00000380365.3	-	3	717	c.639G>A	c.(637-639)gaG>gaA	p.E213E	SERPINA9_ENST00000337425.5_Silent_p.E231E|SERPINA9_ENST00000448305.2_Silent_p.E133E|RP11-349I1.2_ENST00000536735.1_RNA|SERPINA9_ENST00000298845.7_Silent_p.E131E|SERPINA9_ENST00000546329.1_Silent_p.E195E|SERPINA9_ENST00000539349.1_5'Flank|SERPINA9_ENST00000424550.2_Silent_p.E82E			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9	213					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		GAAAGGGCTTCTCCCACTTGG	0.458													C|||	1736	0.346645	0.2126	0.3588	5008	,	,		21008	0.1825		0.5427	False		,,,				2504	0.4867				p.E231E		.											.	SERPINA9-226	0			c.G693A						.	C	,	994,2806		120,754,1026	64.0	60.0	61.0		393,693	0.5	0.9	14	dbSNP_116	61	4326,3936		1123,2080,928	no	coding-synonymous,coding-synonymous	SERPINA9	NM_001042518.1,NM_175739.3	,	1243,2834,1954	TT,TC,CC		47.6398,26.1579,44.1055	,	131/336,231/436	94933709	5320,6742	1900	4131	6031	SO:0001819	synonymous_variant	327657	exon3			GGGCTTCTCCCAC	AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710	ENST00000380365.3:c.639G>A	14.37:g.94933709C>T		63	0		70	5	NM_175739	0	0	0	0	0	B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Silent	SNP	ENST00000380365.3	37																																																																																				C|0.636;T|0.364		0.458	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395803.2	NM_175739	
CEP152	22995	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	49048340	49048340	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr15:49048340G>C	ENST00000380950.2	-	20	3292	c.3105C>G	c.(3103-3105)atC>atG	p.I1035M	CEP152_ENST00000325747.5_Missense_Mutation_p.I942M|CEP152_ENST00000399334.3_Missense_Mutation_p.I1035M	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1035					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTTCCAGTTGGATCCGCTTGG	0.423																																					p.I1035M		.											.	CEP152-70	0			c.C3105G						.						149.0	137.0	140.0					15																	49048340		1916	4129	6045	SO:0001583	missense	22995	exon20			CAGTTGGATCCGC	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3105C>G	15.37:g.49048340G>C	ENSP00000370337:p.Ile1035Met	84	0		73	8	NM_014985	0	0	0	0	0	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	ENST00000380950.2	37	CCDS58361.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.388153	0.42308	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.52754	0.65;0.66;0.66	5.49	0.15	0.14883	.	0.827292	0.11156	N	0.593592	T	0.36054	0.0953	L	0.35414	1.06	0.09310	N	1	P;B;P	0.49090	0.834;0.053;0.919	B;B;P	0.48627	0.406;0.013;0.584	T	0.15093	-1.0449	10	0.32370	T	0.25	-0.0823	1.5522	0.02578	0.2007:0.3442:0.2509:0.2042	.	942;1035;1035	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	M	1035;942;1035	ENSP00000370337:I1035M;ENSP00000321000:I942M;ENSP00000382271:I1035M	ENSP00000321000:I942M	I	-	3	3	CEP152	46835632	0.705000	0.27846	0.739000	0.30968	0.941000	0.58515	0.056000	0.14256	-0.141000	0.11374	0.591000	0.81541	ATC	.		0.423	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
VPS13C	54832	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	62170946	62170946	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr15:62170946C>A	ENST00000261517.5	-	74	10076		c.e74-1		VPS13C_ENST00000558919.1_Splice_Site|VPS13C_ENST00000395896.4_Splice_Site|VPS13C_ENST00000395898.3_Splice_Site|VPS13C_ENST00000249837.3_Splice_Site	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TCAAATGCAACTAAAAGAAAA	0.328																																					.		.											.	VPS13C-92	0			c.10003-1G>T						.						40.0	36.0	37.0					15																	62170946		2202	4299	6501	SO:0001630	splice_region_variant	54832	exon75			ATGCAACTAAAAG	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.10003-1G>T	15.37:g.62170946C>A		42	0		20	7	NM_020821	0	0	0	1	1		Splice_Site	SNP	ENST00000261517.5	37	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334606	0.81801	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6408	0.95757	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPS13C	59958238	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.487000	0.81328	2.643000	0.89663	0.650000	0.86243	.	.		0.328	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	Intron
RPS2	6187	hgsc.bcm.edu	37	16	2014528	2014528	+	Silent	SNP	G	G	A	rs17135712	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:2014528G>A	ENST00000343262.4	-	2	155	c.99C>T	c.(97-99)atC>atT	p.I33I	RNF151_ENST00000569210.2_5'Flank|RPS2_ENST00000526522.1_Silent_p.I33I|SNORA10_ENST00000384084.1_RNA|RNF151_ENST00000569714.1_5'Flank|SNHG9_ENST00000459373.1_lincRNA|SNORA64_ENST00000384674.1_RNA|RPS2_ENST00000530225.1_Silent_p.I33I|RNF151_ENST00000321392.3_5'Flank|RPS2_ENST00000529806.1_Silent_p.I33I	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	33	Arg/Gly-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CCCGGCCCCGGATGCCACTGC	0.751													G|||	533	0.10643	0.0045	0.1873	5008	,	,		12219	0.0149		0.1143	False		,,,				2504	0.273				p.I33I		.											.	RPS2-90	0			c.C99T						.	G		74,3152		0,74,1539	5.0	8.0	7.0		99	-2.2	0.3	16	dbSNP_123	7	745,6175		36,673,2751	no	coding-synonymous	RPS2	NM_002952.3		36,747,4290	AA,AG,GG		10.7659,2.2939,8.0721		33/294	2014528	819,9327	1613	3460	5073	SO:0001819	synonymous_variant	6187	exon2			GCCCCGGATGCCA	AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.99C>T	16.37:g.2014528G>A		0	0		5	4	NM_002952	0	0	49	152	103	B2R5G0|D3DU82|Q3MIB1	Silent	SNP	ENST00000343262.4	37	CCDS10452.1																																																																																			G|0.933;A|0.067		0.751	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250613.2	NM_002952	
PRSS27	83886	broad.mit.edu	37	16	2762757	2762757	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:2762757A>C	ENST00000302641.3	-	6	791	c.737T>G	c.(736-738)gTg>gGg	p.V246G	AC092117.1_ENST00000410123.1_RNA	NM_031948.3	NP_114154.1	Q9BQR3	PRS27_HUMAN	protease, serine 27	246	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8						CCAGCTGATCACCCCCGCCTG	0.667																																					p.V246G		.											.	PRSS27-91	0			c.T737G						.						27.0	24.0	25.0					16																	2762757		2178	4284	6462	SO:0001583	missense	83886	exon6			CTGATCACCCCCG	AB056161	CCDS10476.1	16p13.3	2010-05-07			ENSG00000172382	ENSG00000172382		"""Serine peptidases / Serine peptidases"""	15475	protein-coding gene	gene with protein product		608018					Standard	NM_031948		Approved	MPN, pancreasin, CAPH2, marapsin	uc002crf.3	Q9BQR3	OTTHUMG00000128929	ENST00000302641.3:c.737T>G	16.37:g.2762757A>C	ENSP00000306390:p.Val246Gly	52	9		136	28	NM_031948	0	0	2	2	0		Missense_Mutation	SNP	ENST00000302641.3	37	CCDS10476.1	.	.	.	.	.	.	.	.	.	.	.	16.11	3.030268	0.54790	.	.	ENSG00000172382	ENST00000302641;ENST00000543965	D	0.85861	-2.04	5.21	5.21	0.72293	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.48286	D	0.000182	D	0.94670	0.8281	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.987;0.992	D	0.96007	0.8998	10	0.87932	D	0	.	13.0312	0.58842	1.0:0.0:0.0:0.0	.	246;210	Q9BQR3;B3KP25	PRS27_HUMAN;.	G	246;210	ENSP00000306390:V246G	ENSP00000306390:V246G	V	-	2	0	PRSS27	2702758	0.956000	0.32656	0.212000	0.23672	0.512000	0.34134	8.849000	0.92178	1.969000	0.57287	0.459000	0.35465	GTG	.		0.667	PRSS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250908.1	NM_031948	
MEFV	4210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3293669	3293669	+	Silent	SNP	G	G	C	rs104895213		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:3293669G>C	ENST00000219596.1	-	10	1857	c.1818C>G	c.(1816-1818)acC>acG	p.T606T	MEFV_ENST00000541159.1_3'UTR|MEFV_ENST00000339854.4_Silent_p.T426T|MEFV_ENST00000536379.1_Silent_p.T395T	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	606	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TGGGGTAAGCGGTTTCTGCAT	0.483																																					p.T606T		.											.	MEFV-228	0			c.C1818G						.						158.0	172.0	167.0					16																	3293669		2197	4300	6497	SO:0001819	synonymous_variant	4210	exon10			GTAAGCGGTTTCT	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1818C>G	16.37:g.3293669G>C		89	0		117	51	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			.		0.483	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		1	0		15	9	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
SHISA9	729993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	12996322	12996322	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:12996322C>G	ENST00000424107.3	+	1	846	c.401C>G	c.(400-402)cCc>cGc	p.P134R	SHISA9_ENST00000558318.1_Missense_Mutation_p.P175R|SHISA9_ENST00000558583.1_Missense_Mutation_p.P175R|SHISA9_ENST00000423335.2_Missense_Mutation_p.P134R			B4DS77	SHSA9_HUMAN	shisa family member 9	134					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						ACCGGCAAGCCCCCCGCCCGC	0.612																																					p.P134R		.											.	.	0			c.C401G						.						45.0	49.0	48.0					16																	12996322		692	1591	2283	SO:0001583	missense	729993	exon1			GCAAGCCCCCCGC		CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.401C>G	16.37:g.12996322C>G	ENSP00000407958:p.Pro134Arg	113	0		167	34	NM_001145204	0	0	0	0	0	C9J314|C9JCE9	Missense_Mutation	SNP	ENST00000424107.3	37	CCDS45417.2	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428133	0.62844	.	.	ENSG00000237515	ENST00000424107;ENST00000423335	.	.	.	3.05	3.05	0.35203	.	.	.	.	.	T	0.75525	0.3861	M	0.73217	2.22	0.42261	D	0.992014	D;D	0.89917	0.992;1.0	D;D	0.79108	0.94;0.992	T	0.78957	-0.1999	8	0.87932	D	0	.	11.8814	0.52578	0.0:1.0:0.0:0.0	.	134;134	B4DS77;B4DS77-3	SHSA9_HUMAN;.	R	175	.	ENSP00000395245:P175R	P	+	2	0	SHISA9	12903823	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.055000	0.76656	1.682000	0.51000	0.462000	0.41574	CCC	.		0.612	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334564.5	NM_001145204	
HIRIP3	8479	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30002486	30002486	+	IGR	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:30002486C>G	ENST00000279392.3	-	0	3385				TAOK2_ENST00000279394.3_Missense_Mutation_p.S916C	NM_003609.4	NP_003600.2	Q9BW71	HIRP3_HUMAN	HIRA interacting protein 3						chromatin assembly or disassembly (GO:0006333)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(9)	17						CTGGGCTTCTCCAGCATGGCT	0.677																																					p.S916C		.											.	TAOK2-521	0			c.C2747G						.						60.0	64.0	63.0					16																	30002486		2197	4300	6497	SO:0001628	intergenic_variant	9344	exon19			GCTTCTCCAGCAT	AJ223351	CCDS10664.1, CCDS58449.1	16p12.1	2008-02-05	2001-11-29		ENSG00000149929	ENSG00000149929			4917	protein-coding gene	gene with protein product		603365	"""HIRA-interacting protein 3"""			9710638	Standard	NM_003609		Approved		uc002dve.3	Q9BW71	OTTHUMG00000132118		16.37:g.30002486C>G		47	0		129	47	NM_004783	0	0	23	59	36	H3BSR3|O75707|O75708	Missense_Mutation	SNP	ENST00000279392.3	37	CCDS10664.1	.	.	.	.	.	.	.	.	.	.	c	17.56	3.419776	0.62622	.	.	ENSG00000149930	ENST00000279394	T	0.63255	-0.03	5.0	5.0	0.66597	.	.	.	.	.	T	0.78426	0.4281	M	0.82056	2.57	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80094	-0.1526	8	.	.	.	.	12.2303	0.54484	0.0:0.7064:0.2936:0.0	.	916	Q9UL54-2	.	C	916	ENSP00000279394:S916C	.	S	+	2	0	TAOK2	29909987	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.830000	0.69324	2.324000	0.78689	0.645000	0.84053	TCC	.		0.677	HIRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255160.2	NM_003609	
RPGRIP1L	23322	hgsc.bcm.edu;broad.mit.edu	37	16	53692791	53692791	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:53692791C>T	ENST00000379925.3	-	11	1294		c.e11-1		RPGRIP1L_ENST00000262135.4_Splice_Site|RPGRIP1L_ENST00000564374.1_Splice_Site|RPGRIP1L_ENST00000563746.1_Splice_Site	NM_015272.2	NP_056087.2	Q68CZ1	FTM_HUMAN	RPGRIP1-like						camera-type eye development (GO:0043010)|cerebellum development (GO:0021549)|cilium assembly (GO:0042384)|corpus callosum development (GO:0022038)|determination of left/right symmetry (GO:0007368)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|establishment or maintenance of cell polarity (GO:0007163)|head development (GO:0060322)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lateral ventricle development (GO:0021670)|liver development (GO:0001889)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neural tube patterning (GO:0021532)|nose development (GO:0043584)|olfactory bulb development (GO:0021772)|pericardium development (GO:0060039)|regulation of smoothened signaling pathway (GO:0008589)	axoneme (GO:0005930)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	thromboxane A2 receptor binding (GO:0031870)			endometrium(6)|kidney(3)|large_intestine(9)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(2)	46		all_cancers(37;0.0973)				TCATTTTGATCTTAAAAATAA	0.308																																					.		.											.	RPGRIP1L-91	0			c.1244-1G>A						.						85.0	78.0	80.0					16																	53692791		2195	4297	6492	SO:0001630	splice_region_variant	23322	exon12			TTTGATCTTAAAA		CCDS32447.1, CCDS45486.1	16q12.2	2014-09-17				ENSG00000103494			29168	protein-coding gene	gene with protein product	"""fantom homolog"", ""Meckel syndrome, type 5"", ""protein phosphatase 1, regulatory subunit 134"""	610937				10231032	Standard	NM_015272		Approved	KIAA1005, CORS3, JBTS7, MKS5, NPHP8, FTM, PPP1R134	uc002ehp.3	Q68CZ1		ENST00000379925.3:c.1244-1G>A	16.37:g.53692791C>T		24	0		56	5	NM_001127897	0	0	0	0	0	A0PJ88|Q9Y2K8	Splice_Site	SNP	ENST00000379925.3	37	CCDS32447.1	.	.	.	.	.	.	.	.	.	.	C	18.50	3.637236	0.67130	.	.	ENSG00000103494	ENST00000379925;ENST00000262135	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7289	0.96175	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RPGRIP1L	52250292	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.716000	0.54904	2.770000	0.95276	0.655000	0.94253	.	.		0.308	RPGRIP1L-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000422187.1	NM_015272	Intron
NLRC5	84166	bcgsc.ca	37	16	57093436	57093436	+	Missense_Mutation	SNP	G	G	T	rs117950337	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:57093436G>T	ENST00000262510.6	+	30	4203	c.3978G>T	c.(3976-3978)aaG>aaT	p.K1326N	NLRC5_ENST00000436936.1_Missense_Mutation_p.K1326N|NLRC5_ENST00000308149.7_Missense_Mutation_p.K1297N|NLRC5_ENST00000539144.1_Missense_Mutation_p.K1297N|RP11-322D14.2_ENST00000562970.1_RNA	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1326					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.K1326N(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				AGGCTGGGAAGACACTCAGGT	0.637													G|||	73	0.0145767	0.0	0.0187	5008	,	,		20138	0.0		0.0229	False		,,,				2504	0.0378				p.K1326N		.											.	NLRC5-159	1	Substitution - Missense(1)	lung(1)	c.G3978T						.		ASN/LYS	25,4371	29.9+/-59.1	0,25,2173	45.0	44.0	44.0		3978	2.8	0.0	16	dbSNP_132	44	207,8393	85.8+/-148.2	1,205,4094	yes	missense	NLRC5	NM_032206.3	94	1,230,6267	TT,TG,GG		2.407,0.5687,1.7852	probably-damaging	1326/1867	57093436	232,12764	2198	4300	6498	SO:0001583	missense	84166	exon29			TGGGAAGACACTC	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3978G>T	16.37:g.57093436G>T	ENSP00000262510:p.Lys1326Asn	128	0		176	6	NM_032206	0	0	0	0	0	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	ENST00000262510.6	37	CCDS10773.1	29|29	0.013278388278388278|0.013278388278388278	0|0	0.0|0.0	7|7	0.019337016574585635|0.019337016574585635	0|0	0.0|0.0	22|22	0.029023746701846966|0.029023746701846966	g|g	6.264|6.264	0.416766|0.416766	0.11870|0.11870	0.005687|0.005687	0.02407|0.02407	ENSG00000140853|ENSG00000140853	ENST00000538805;ENST00000399221|ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030	.|T;T;T;T;T;T	.|0.55760	.|0.52;5.33;0.52;5.33;0.52;0.5	4.8|4.8	2.82|2.82	0.32997|0.32997	.|.	.|.	.|.	.|.	.|.	T|T	0.28896|0.28896	0.0717|0.0717	M|M	0.72894|0.72894	2.215|2.215	0.09310|0.09310	N|N	1|1	.|P;P;P;P;B	.|0.44090	.|0.734;0.826;0.799;0.634;0.378	.|B;P;P;B;B	.|0.45232	.|0.282;0.474;0.474;0.165;0.221	T|T	0.25257|0.25257	-1.0137|-1.0137	5|9	.|0.48119	.|T	.|0.1	.|.	6.4694|6.4694	0.21999|0.21999	0.2217:0.0:0.7783:0.0|0.2217:0.0:0.7783:0.0	.|.	.|1010;1297;1297;1326;1326	.|Q9H6Y0;Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3	.|.;.;.;.;NLRC5_HUMAN	Y|N	1078;78|1326;1297;1326;769;1297;802;537	.|ENSP00000262510:K1326N;ENSP00000308886:K1297N;ENSP00000389739:K1326N;ENSP00000441727:K1297N;ENSP00000441597:K802N;ENSP00000440153:K537N	.|ENSP00000262510:K1326N	D|K	+|+	1|3	0|2	NLRC5|NLRC5	55650937|55650937	0.292000|0.292000	0.24362|0.24362	0.005000|0.005000	0.12908|0.12908	0.483000|0.483000	0.33249|0.33249	0.734000|0.734000	0.26101|0.26101	0.613000|0.613000	0.30089|0.30089	0.544000|0.544000	0.68410|0.68410	GAC|AAG	G|0.982;T|0.018		0.637	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
ATP2C2	9914	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	84402268	84402268	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:84402268C>T	ENST00000262429.4	+	1	136	c.47C>T	c.(46-48)tCg>tTg	p.S16L	ATP2C2_ENST00000416219.2_Missense_Mutation_p.S16L	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	16					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CTCGGCTTCTCGGGCGGGGGC	0.711																																					p.S16L		.											.	ATP2C2-91	0			c.C47T						.						7.0	12.0	10.0					16																	84402268		1805	4017	5822	SO:0001583	missense	9914	exon1			GCTTCTCGGGCGG	AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.47C>T	16.37:g.84402268C>T	ENSP00000262429:p.Ser16Leu	81	1		218	36	NM_014861	0	0	0	0	0	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	ENST00000262429.4	37	CCDS42207.1	.	.	.	.	.	.	.	.	.	.	C	8.302	0.820238	0.16678	.	.	ENSG00000064270	ENST00000416219;ENST00000262429	D;D	0.92647	-3.08;-3.04	4.38	-5.22	0.02806	.	903.776000	0.00166	N	0.000000	T	0.79381	0.4436	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.73927	-0.3828	10	0.10377	T	0.69	.	5.7402	0.18089	0.0:0.2028:0.4051:0.3921	.	16;16	E7ES94;O75185	.;AT2C2_HUMAN	L	16	ENSP00000397925:S16L;ENSP00000262429:S16L	ENSP00000262429:S16L	S	+	2	0	ATP2C2	82959769	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.552000	0.06020	-0.857000	0.04115	0.514000	0.50259	TCG	.		0.711	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433404.1	NM_014861	
COX4I1	1327	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	85838589	85838589	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:85838589T>G	ENST00000562336.1	+	3	313	c.120T>G	c.(118-120)gaT>gaG	p.D40E	COX4I1_ENST00000568794.1_Missense_Mutation_p.D40E|COX4I1_ENST00000570123.1_3'UTR|COX4I1_ENST00000253452.2_Missense_Mutation_p.D40E|COX4I1_ENST00000564903.1_Missense_Mutation_p.D40E|COX4I1_ENST00000561569.1_Missense_Mutation_p.D40E			P13073	COX41_HUMAN	cytochrome c oxidase subunit IV isoform 1	40					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cytochrome-c oxidase activity (GO:0004129)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)	9		Renal(780;0.228)				CTTATATGGATCGGCGTGACC	0.498																																					p.D40E		.											.	COX4I1-226	0			c.T120G						.						62.0	64.0	63.0					16																	85838589		2198	4300	6498	SO:0001583	missense	1327	exon3			TATGGATCGGCGT	AF005889	CCDS10955.1	16q24.1	2012-10-02	2001-11-30	2001-12-07	ENSG00000131143	ENSG00000131143	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2265	protein-coding gene	gene with protein product		123864	"""cytochrome c oxidase subunit IV"""	COX4		2444497, 2157630	Standard	NM_001861		Approved	COX4-1	uc002fje.3	P13073	OTTHUMG00000137649	ENST00000562336.1:c.120T>G	16.37:g.85838589T>G	ENSP00000457513:p.Asp40Glu	184	1		232	98	NM_001861	1	0	587	1204	616	B2R4J2|D3DUM7|Q6P666	Missense_Mutation	SNP	ENST00000562336.1	37	CCDS10955.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.445563	0.43429	.	.	ENSG00000131143	ENST00000253452	T	0.64991	-0.13	4.77	-5.51	0.02568	.	0.000000	0.85682	D	0.000000	T	0.78162	0.4240	M	0.90759	3.145	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.80966	-0.1146	10	0.44086	T	0.13	-38.8807	15.2231	0.73330	0.0:0.2916:0.0:0.7084	.	40;40	Q86WV2;P13073	.;COX41_HUMAN	E	40	ENSP00000253452:D40E	ENSP00000253452:D40E	D	+	3	2	COX4I1	84396090	0.991000	0.36638	0.486000	0.27416	0.030000	0.12068	0.215000	0.17562	-0.894000	0.03925	-0.263000	0.10527	GAT	.		0.498	COX4I1-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430873.1	NM_001861	
ZNF469	84627	broad.mit.edu	37	16	88501034	88501034	+	Missense_Mutation	SNP	G	G	C	rs12598474	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:88501034G>C	ENST00000437464.1	+	2	7072	c.7072G>C	c.(7072-7074)Ggg>Cgg	p.G2358R	ZNF469_ENST00000565624.1_Missense_Mutation_p.G2386R	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2358			G -> R (in dbSNP:rs12598474). {ECO:0000269|PubMed:11347906}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G2358R(1)		breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCTGAGACCGGGCGCTCTGG	0.662													g|||	1478	0.295128	0.2231	0.2997	5008	,	,		15260	0.377		0.3807	False		,,,				2504	0.2168				p.G2358R		.											.	.	1	Substitution - Missense(1)	kidney(1)	c.G7072C						.						27.0	36.0	33.0					16																	88501034		692	1590	2282	SO:0001583	missense	84627	exon2			GAGACCGGGCGCT	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7072G>C	16.37:g.88501034G>C	ENSP00000402343:p.Gly2358Arg	80	0		143	6	NM_001127464	0	0	4	4	0		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	682	0.31227106227106227	104	0.21138211382113822	99	0.27348066298342544	195	0.3409090909090909	284	0.37467018469656993	g	7.137	0.581006	0.13686	.	.	ENSG00000225614	ENST00000437464	T	0.05513	3.43	3.66	-2.17	0.07059	.	.	.	.	.	T	0.00012	0.0000	N	0.12182	0.205	0.80722	P	0.0	B	0.32781	0.384	B	0.25884	0.064	T	0.47873	-0.9083	8	0.30078	T	0.28	.	4.2493	0.10686	0.4349:0.1731:0.392:0.0	rs12598474	2358	Q96JG9	ZN469_HUMAN	R	2358	ENSP00000402343:G2358R	ENSP00000402343:G2358R	G	+	1	0	ZNF469	87028535	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.132000	0.03235	-0.239000	0.09710	-0.320000	0.08662	GGG	G|0.686;C|0.314		0.662	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
CBFA2T3	863	ucsc.edu;bcgsc.ca	37	16	88968048	88968048	+	Silent	SNP	T	T	C	rs76033980	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr16:88968048T>C	ENST00000268679.4	-	2	564	c.168A>G	c.(166-168)aaA>aaG	p.K56K	CBFA2T3_ENST00000360302.2_5'UTR|CBFA2T3_ENST00000436887.2_Silent_p.K56K|CBFA2T3_ENST00000327483.5_5'UTR|CBFA2T3_ENST00000448839.1_Intron	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	56	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.|Pro-rich.|Required for nucleolar targeting (in isoform 1).				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		AGGCCTTAGCTTTCCTGTCCA	0.672			T	RUNX1	AML								C|||	252	0.0503195	0.0991	0.0461	5008	,	,		14614	0.0218		0.0239	False		,,,				2504	0.044				p.K56K		.		Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	.	CBFA2T3-722	0			c.A168G						.	C	,	416,3978	765.9+/-413.4	23,370,1804	33.0	37.0	36.0		168,	3.0	0.4	16	dbSNP_131	36	231,8369	798.7+/-407.4	3,225,4072	no	coding-synonymous,utr-5	CBFA2T3	NM_005187.5,NM_175931.2	,	26,595,5876	CC,CT,TT		2.686,9.4675,4.9792	,	56/654,	88968048	647,12347	2197	4300	6497	SO:0001819	synonymous_variant	863	exon2			CTTAGCTTTCCTG	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.168A>G	16.37:g.88968048T>C		14	0		31	7	NM_005187	0	0	0	0	0	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Silent	SNP	ENST00000268679.4	37	CCDS10972.1																																																																																			T|0.958;C|0.042		0.672	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269545.2	NM_005187	
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L|AC108004.3_ENST00000599026.1_RNA			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		0	0		17	17	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
GUCY2D	3000	hgsc.bcm.edu	37	17	7906529	7906529	+	Missense_Mutation	SNP	C	C	T	rs201414567	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr17:7906529C>T	ENST00000254854.4	+	2	314	c.164C>T	c.(163-165)aCg>aTg	p.T55M		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	55			T -> M (in LCA1; dbSNP:rs201414567). {ECO:0000269|PubMed:21602930}.		intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				gccgTGTTCACGGTGGGGGTC	0.781													C|||	12	0.00239617	0.0	0.0	5008	,	,		7305	0.0119		0.0	False		,,,				2504	0.0				p.T55M		.											.	GUCY2D-319	0			c.C164T						.						2.0	2.0	2.0					17																	7906529		1588	3372	4960	SO:0001583	missense	3000	exon2			TGTTCACGGTGGG	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.164C>T	17.37:g.7906529C>T	ENSP00000254854:p.Thr55Met	2	0		12	10	NM_000180	0	0	0	0	0	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	37	CCDS11127.1	4	0.0018315018315018315	0	0.0	0	0.0	4	0.006993006993006993	0	0.0	C	11.96	1.793958	0.31777	.	.	ENSG00000132518	ENST00000254854	T	0.75367	-0.93	5.41	3.34	0.38264	.	0.333624	0.21549	N	0.072773	T	0.67297	0.2878	L	0.50333	1.59	0.09310	N	0.999997	D	0.55800	0.973	P	0.48704	0.587	T	0.63994	-0.6511	10	0.62326	D	0.03	.	12.8059	0.57614	0.6499:0.35:0.0:0.0	.	55	Q02846	GUC2D_HUMAN	M	55	ENSP00000254854:T55M	ENSP00000254854:T55M	T	+	2	0	GUCY2D	7847254	0.211000	0.23529	0.548000	0.28192	0.060000	0.15804	0.805000	0.27112	0.545000	0.28902	0.650000	0.86243	ACG	C|0.998;T|0.002		0.781	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y		.											.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	302	12		258	18	NM_145301	0	0	9	46	37	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
SUPT6H	6830	broad.mit.edu	37	17	27028024	27028024	+	Silent	SNP	G	G	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr17:27028024G>A	ENST00000314616.6	+	36	5155	c.4872G>A	c.(4870-4872)acG>acA	p.T1624T	SUPT6H_ENST00000347486.4_Silent_p.T1624T	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1624					chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ACTCCTACACGACCCCAAGCC	0.627																																					p.T1624T		.											.	SUPT6H-93	0			c.G4872A						.						207.0	197.0	200.0					17																	27028024		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon36			CTACACGACCCCA	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4872G>A	17.37:g.27028024G>A		126	0		93	4	NM_003170	0	0	49	49	0	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	CCDS32596.1																																																																																			.		0.627	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
IGFBP4	3487	hgsc.bcm.edu	37	17	38600092	38600092	+	Silent	SNP	G	G	A	rs598892	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr17:38600092G>A	ENST00000269593.4	+	1	380	c.105G>A	c.(103-105)ctG>ctA	p.L35L	IGFBP4_ENST00000542955.1_Intron	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	35	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			AGGAGAAGCTGGCGCGCTGCC	0.771													G|||	1792	0.357827	0.0386	0.5	5008	,	,		9796	0.4752		0.3946	False		,,,				2504	0.5297				p.L35L	GBM(160;940 3581 26177)	.											.	IGFBP4-522	0			c.G105A						.	G		266,3270		24,218,1526	3.0	3.0	3.0		105	4.0	1.0	17	dbSNP_83	3	2267,4893		352,1563,1665	no	coding-synonymous	IGFBP4	NM_001552.2		376,1781,3191	AA,AG,GG		31.662,7.5226,23.6818		35/259	38600092	2533,8163	1768	3580	5348	SO:0001819	synonymous_variant	3487	exon1			GAAGCTGGCGCGC	M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.105G>A	17.37:g.38600092G>A		0	0		8	8	NM_001552	0	0	0	4	4	A0N9W2|B4E351|Q5U012|Q9UCL6	Silent	SNP	ENST00000269593.4	37	CCDS11367.1																																																																																			G|0.645;A|0.355		0.771	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257134.1	NM_001552	
SLC35B1	10237	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	47780364	47780364	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr17:47780364A>T	ENST00000240333.6	-	8	893	c.772T>A	c.(772-774)Ttt>Att	p.F258I	SLC35B1_ENST00000415270.2_Missense_Mutation_p.F295I			P78383	S35B1_HUMAN	solute carrier family 35, member B1	258					transport (GO:0006810)|UDP-galactose transmembrane transport (GO:0072334)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	UDP-galactose transmembrane transporter activity (GO:0005459)			endometrium(1)|large_intestine(2)|lung(3)|urinary_tract(1)	7						ACCGTCATAAAGATGAAGCTC	0.463																																					p.F258I		.											.	SLC35B1-90	0			c.T772A						.						120.0	121.0	121.0					17																	47780364		2203	4300	6503	SO:0001583	missense	10237	exon8			TCATAAAGATGAA	D16978	CCDS11552.1, CCDS11552.2	17q21.32	2013-05-22			ENSG00000121073	ENSG00000121073		"""Solute carriers"""	20798	protein-coding gene	gene with protein product		610790				9010752	Standard	NM_005827		Approved	UGTREL1	uc002iph.1	P78383	OTTHUMG00000161638	ENST00000240333.6:c.772T>A	17.37:g.47780364A>T	ENSP00000240333:p.Phe258Ile	195	0		136	108	NM_005827	0	0	0	1	1	B4DEC4|J3KQV4|Q96EW7	Missense_Mutation	SNP	ENST00000240333.6	37	CCDS11552.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.991557	0.93106	.	.	ENSG00000121073	ENST00000240333;ENST00000415270;ENST00000504260;ENST00000502406;ENST00000503334	T;T;T	0.36699	1.24;1.24;1.24	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.66317	0.2777	M	0.91920	3.255	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.66602	0.945;0.945	T	0.75416	-0.3325	10	0.87932	D	0	-8.0E-4	14.8245	0.70101	1.0:0.0:0.0:0.0	.	191;258	D3DTX1;P78383	.;S35B1_HUMAN	I	258;295;134;134;191	ENSP00000240333:F258I;ENSP00000409548:F295I;ENSP00000423323:F191I	ENSP00000240333:F258I	F	-	1	0	SLC35B1	45135363	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.874000	0.92363	2.153000	0.67306	0.533000	0.62120	TTT	.		0.463	SLC35B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365564.2	NM_005827	
FASN	2194	bcgsc.ca	37	17	80039481	80039481	+	Silent	SNP	G	G	A	rs1140616	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr17:80039481G>A	ENST00000306749.2	-	37	6620	c.6402C>T	c.(6400-6402)atC>atT	p.I2134I	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2134	Acyl carrier. {ECO:0000255|PROSITE- ProRule:PRU00258}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GCTCACCCAGGATGTGTGCCA	0.642													.|||	1522	0.303914	0.1823	0.2867	5008	,	,		14395	0.2996		0.4791	False		,,,				2504	0.3047				p.I2134I	Colon(59;314 1043 11189 28578 32273)	.											.	FASN-90	0			c.C6402T						.	G		990,3412	353.1+/-312.0	108,774,1319	42.0	41.0	41.0		6402	1.7	1.0	17	dbSNP_86	41	4501,4097	569.4+/-389.2	1196,2109,994	no	coding-synonymous	FASN	NM_004104.4		1304,2883,2313	AA,AG,GG		47.6506,22.4898,42.2385		2134/2512	80039481	5491,7509	2201	4299	6500	SO:0001819	synonymous_variant	2194	exon37			ACCCAGGATGTGT	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6402C>T	17.37:g.80039481G>A		98	1		107	5	NM_004104	0	0	0	0	0	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	37	CCDS11801.1																																																																																			G|0.632;A|0.368		0.642	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
DSC2	1824	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	28654754	28654754	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr18:28654754C>A	ENST00000280904.6	-	12	2226	c.1783G>T	c.(1783-1785)Gtt>Ttt	p.V595F	snoU13_ENST00000459603.1_RNA|DSC2_ENST00000251081.6_Missense_Mutation_p.V595F	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	595	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TCAACCGCAACAATCTCCGCA	0.448																																					p.V595F		.											.	DSC2-517	0			c.G1783T						.						161.0	133.0	143.0					18																	28654754		2203	4300	6503	SO:0001583	missense	1824	exon12			CCGCAACAATCTC	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.1783G>T	18.37:g.28654754C>A	ENSP00000280904:p.Val595Phe	228	0		181	128	NM_024422	0	0	0	0	0		Missense_Mutation	SNP	ENST00000280904.6	37	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	C	0.927	-0.713856	0.03206	.	.	ENSG00000134755	ENST00000251081;ENST00000280904;ENST00000438199;ENST00000399347	T;T	0.61392	0.11;0.11	5.27	3.34	0.38264	Cadherin (2);Cadherin-like (1);	0.694506	0.11089	N	0.600965	T	0.53110	0.1776	M	0.67953	2.075	0.35442	D	0.794925	B;B	0.31435	0.071;0.323	B;B	0.30495	0.066;0.116	T	0.63274	-0.6674	10	0.72032	D	0.01	.	5.9325	0.19146	0.3436:0.5684:0.0:0.088	.	595;595	Q02487;Q02487-2	DSC2_HUMAN;.	F	595;595;361;608	ENSP00000251081:V595F;ENSP00000280904:V595F	ENSP00000251081:V595F	V	-	1	0	DSC2	26908752	0.010000	0.17322	0.923000	0.36655	0.019000	0.09904	0.494000	0.22467	1.332000	0.45431	0.655000	0.94253	GTT	.		0.448	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
GRIN3B	116444	hgsc.bcm.edu	37	19	1003374	1003374	+	Silent	SNP	G	G	A	rs34585248	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:1003374G>A	ENST00000234389.3	+	2	691	c.672G>A	c.(670-672)gcG>gcA	p.A224A	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	224					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGATGGCGGCGCCAGTGGGGG	0.746													g|||	158	0.0315495	0.0015	0.0173	5008	,	,		11320	0.0754		0.0338	False		,,,				2504	0.0348				p.A224A		.											.	GRIN3B-90	0			c.G672A						.	G		37,3905		0,37,1934	4.0	6.0	5.0		672	-8.1	0.0	19	dbSNP_126	5	211,7611		3,205,3703	no	coding-synonymous	GRIN3B	NM_138690.1		3,242,5637	AA,AG,GG		2.6975,0.9386,2.1081		224/1044	1003374	248,11516	1971	3911	5882	SO:0001819	synonymous_variant	116444	exon2			GGCGGCGCCAGTG		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.672G>A	19.37:g.1003374G>A		0	0		39	26	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Silent	SNP	ENST00000234389.3	37	CCDS32861.1																																																																																			G|0.966;A|0.034		0.746	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
BTBD2	55643	broad.mit.edu	37	19	1993163	1993163	+	Silent	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:1993163C>T	ENST00000255608.4	-	3	556	c.540G>A	c.(538-540)tcG>tcA	p.S180S	AC005306.3_ENST00000588480.1_RNA|BTBD2_ENST00000590646.1_5'UTR|AC005306.3_ENST00000587498.1_RNA	NM_017797.3	NP_060267.2	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	180	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cytoplasmic mRNA processing body (GO:0000932)				endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	12		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACCTCGTCCGAGTAGAGAA	0.642																																					p.S180S		.											.	BTBD2-92	0			c.G540A						.						69.0	51.0	57.0					19																	1993163		2203	4300	6503	SO:0001819	synonymous_variant	55643	exon3			CTCGTCCGAGTAG	AF355797	CCDS12078.1	19p13.3	2013-10-02			ENSG00000133243	ENSG00000133243		"""BTB/POZ domain containing"""	15504	protein-coding gene	gene with protein product		608531				11179693	Standard	XM_005259593		Approved		uc002lup.1	Q9BX70	OTTHUMG00000180017	ENST00000255608.4:c.540G>A	19.37:g.1993163C>T		27	0		59	7	NM_017797	0	0	0	0	0	O60418|O75248|Q4VBZ1|Q6IAC5|Q7Z5W0|Q96SX8|Q9NPS1|Q9NX81	Silent	SNP	ENST00000255608.4	37	CCDS12078.1																																																																																			.		0.642	BTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449300.2		
AMH	268	hgsc.bcm.edu	37	19	2251829	2251829	+	Missense_Mutation	SNP	C	C	T	rs200031151	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:2251829C>T	ENST00000221496.4	+	5	1578	c.1556C>T	c.(1555-1557)gCc>gTc	p.A519V	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	519					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGGGGCCGCCCTGGCGCGC	0.692									Persistant Mullerian Duct Syndrome (type I and II)				c|||	5	0.000998403	0.0	0.0014	5008	,	,		10319	0.0		0.004	False		,,,				2504	0.0				p.A519V		.											.	AMH-130	0			c.C1556T						.		VAL/ALA	1,4367		0,1,2183	12.0	12.0	12.0		1556	1.7	0.0	19		12	13,8545		0,13,4266	yes	missense	AMH	NM_000479.3	64	0,14,6449	TT,TC,CC		0.1519,0.0229,0.1083	benign	519/561	2251829	14,12912	2184	4279	6463	SO:0001583	missense	268	exon5	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	GGGCCGCCCTGGC	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.1556C>T	19.37:g.2251829C>T	ENSP00000221496:p.Ala519Val	1	0		48	24	NM_000479	0	0	0	0	0	O75246|Q6GTN3	Missense_Mutation	SNP	ENST00000221496.4	37	CCDS12085.1	.	.	.	.	.	.	.	.	.	.	c	7.318	0.616454	0.14129	2.29E-4	0.001519	ENSG00000104899	ENST00000221496	D	0.84146	-1.81	3.88	1.72	0.24424	Transforming growth factor-beta, C-terminal (3);	0.528716	0.18165	U	0.149659	T	0.72479	0.3465	N	0.12637	0.245	0.09310	N	1	B	0.29646	0.253	B	0.36186	0.219	T	0.63686	-0.6581	10	0.42905	T	0.14	-2.3717	8.1279	0.31010	0.0:0.7986:0.0:0.2014	.	519	P03971	MIS_HUMAN	V	519	ENSP00000221496:A519V	ENSP00000221496:A519V	A	+	2	0	AMH	2202829	0.002000	0.14202	0.005000	0.12908	0.410000	0.31052	1.004000	0.29822	0.639000	0.30564	0.299000	0.19835	GCC	.		0.692	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451276.3	NM_000479	
LINGO3	645191	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	2290685	2290685	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:2290685A>G	ENST00000585527.1	-	1	1338	c.1091T>C	c.(1090-1092)gTg>gCg	p.V364A	LINGO3_ENST00000404279.1_Missense_Mutation_p.V364A			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	364	LRRCT.					integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						GCGACGCTGCACGATCCACAG	0.697																																					p.V364A		.											.	.	0			c.T1091C						.						22.0	24.0	23.0					19																	2290685		2059	4180	6239	SO:0001583	missense	645191	exon2			CGCTGCACGATCC	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.1091T>C	19.37:g.2290685A>G	ENSP00000467753:p.Val364Ala	32	0		89	28	NM_001101391	0	0	2	2	0		Missense_Mutation	SNP	ENST00000585527.1	37	CCDS45905.1	.	.	.	.	.	.	.	.	.	.	a	16.99	3.274735	0.59649	.	.	ENSG00000220008	ENST00000404279	T	0.56611	0.45	4.3	4.3	0.51218	Cysteine-rich flanking region, C-terminal (1);	.	.	.	.	T	0.39172	0.1068	N	0.25380	0.74	0.38529	D	0.948936	B	0.32051	0.354	B	0.35039	0.194	T	0.27640	-1.0068	9	0.16420	T	0.52	.	12.5973	0.56476	1.0:0.0:0.0:0.0	.	364	P0C6S8	LIGO3_HUMAN	A	364	ENSP00000384979:V364A	ENSP00000384979:V364A	V	-	2	0	LINGO3	2241685	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.010000	0.70753	1.576000	0.49790	0.379000	0.24179	GTG	.		0.697	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451291.2	NM_001101391	
PLIN5	440503	hgsc.bcm.edu	37	19	4524016	4524016	+	Missense_Mutation	SNP	G	G	A	rs1062223	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:4524016G>A	ENST00000381848.3	-	8	996	c.916C>T	c.(916-918)Cgg>Tgg	p.R306W		NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	306	Interaction with PNPLA2 and ABHD5. {ECO:0000250}.		R -> W (in dbSNP:rs1062223). {ECO:0000269|PubMed:17234449}.		lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						GGCAGGCCCCGCACGCTGGAC	0.711													G|||	464	0.0926518	0.0091	0.2104	5008	,	,		13130	0.0288		0.1958	False		,,,				2504	0.0818				p.R306W		.											.	PLIN5-22	0			c.C916T						.	G	TRP/ARG	154,3340		10,134,1603	3.0	4.0	4.0		916	4.6	1.0	19	dbSNP_86	4	1294,5560		114,1066,2247	yes	missense	PLIN5	NM_001013706.2	101	124,1200,3850	AA,AG,GG		18.8795,4.4076,13.993	probably-damaging	306/464	4524016	1448,8900	1747	3427	5174	SO:0001583	missense	440503	exon8			GGCCCCGCACGCT	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.916C>T	19.37:g.4524016G>A	ENSP00000371272:p.Arg306Trp	0	0		8	4	NM_001013706	0	0	0	0	0	A2RRC1|Q6ZS68	Missense_Mutation	SNP	ENST00000381848.3	37	CCDS42473.1	234	0.10714285714285714	10	0.02032520325203252	65	0.17955801104972377	18	0.03146853146853147	141	0.18601583113456466	.	17.14	3.314611	0.60524	0.044076	0.188795	ENSG00000214456	ENST00000381848	T	0.19938	2.11	4.59	4.59	0.56863	.	0.906390	0.09191	U	0.835949	T	0.00073	0.0002	L	0.47716	1.5	0.09310	P	1.0	D	0.89917	1.0	D	0.71184	0.972	T	0.05666	-1.0871	9	0.87932	D	0	-24.5419	14.8561	0.70338	0.0:0.0:1.0:0.0	rs1062223;rs3170378	306	Q00G26	PLIN5_HUMAN	W	306	ENSP00000371272:R306W	ENSP00000371272:R306W	R	-	1	2	PLIN5	4475016	0.995000	0.38212	0.996000	0.52242	0.090000	0.18270	5.443000	0.66581	2.080000	0.62538	0.511000	0.50034	CGG	G|0.892;A|0.108		0.711	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458647.1	NM_001013706	
ZNRF4	148066	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	5455609	5455609	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:5455609G>A	ENST00000222033.4	+	1	184	c.107G>A	c.(106-108)cGt>cAt	p.R36H		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	36						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CTGCCCTCGCGTCCTGGCCAC	0.662																																					p.R36H		.											.	ZNRF4-135	0			c.G107A						.						38.0	44.0	42.0					19																	5455609		2066	4192	6258	SO:0001583	missense	148066	exon1			CCTCGCGTCCTGG	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.107G>A	19.37:g.5455609G>A	ENSP00000222033:p.Arg36His	84	0		108	11	NM_181710	0	0	0	0	0	A8K886|O75866	Missense_Mutation	SNP	ENST00000222033.4	37	CCDS42475.1	.	.	.	.	.	.	.	.	.	.	g	1.879	-0.458450	0.04508	.	.	ENSG00000105428	ENST00000222033	T	0.04603	3.59	2.25	-4.49	0.03504	.	.	.	.	.	T	0.01800	0.0057	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38993	-0.9635	9	0.28530	T	0.3	.	3.4425	0.07469	0.1682:0.2313:0.4709:0.1296	.	36	Q8WWF5	ZNRF4_HUMAN	H	36	ENSP00000222033:R36H	ENSP00000222033:R36H	R	+	2	0	ZNRF4	5406609	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-1.345000	0.02637	-3.243000	0.00206	-2.180000	0.00316	CGT	.		0.662	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	NM_181710	
RDH8	50700	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	19	10127866	10127866	+	Missense_Mutation	SNP	T	T	G	rs2233793	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:10127866T>G	ENST00000171214.1	+	2	486	c.237T>G	c.(235-237)tgT>tgG	p.C79W	RDH8_ENST00000591589.1_Missense_Mutation_p.C99W	NM_015725.2	NP_056540.2	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	79					estrogen biosynthetic process (GO:0006703)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|steroid biosynthetic process (GO:0006694)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			endometrium(3)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|prostate(1)	21			Epithelial(33;4.24e-05)		Vitamin A(DB00162)	GTCTCAGCTGTATCCAGGGAG	0.592																																					p.C99W		.											.	RDH8-94	0			c.T297G						.						78.0	69.0	72.0					19																	10127866		2203	4300	6503	SO:0001583	missense	50700	exon2			CAGCTGTATCCAG	AF229845	CCDS12223.1, CCDS12223.2	19p13.2	2011-09-14				ENSG00000080511	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	14423	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 28C, member 2"""	608575				10753906, 19027726	Standard	NM_015725		Approved	PRRDH, SDR28C2	uc002mmr.4	Q9NYR8		ENST00000171214.1:c.237T>G	19.37:g.10127866T>G	ENSP00000171214:p.Cys79Trp	94	0		146	25	NM_015725	0	0	0	0	0	Q9H838	Missense_Mutation	SNP	ENST00000171214.1	37		.	.	.	.	.	.	.	.	.	.	T	13.98	2.400322	0.42613	.	.	ENSG00000080511	ENST00000171214	D	0.87334	-2.24	4.77	-0.279	0.12890	NAD(P)-binding domain (1);	0.664409	0.15841	N	0.242012	T	0.66934	0.2840	N	0.02842	-0.48	0.30636	N	0.757016	P	0.40931	0.733	B	0.40199	0.322	T	0.66956	-0.5792	10	0.42905	T	0.14	.	5.2421	0.15477	0.0:0.5754:0.1515:0.2731	.	79	Q9NYR8	RDH8_HUMAN	W	79	ENSP00000171214:C79W	ENSP00000171214:C79W	C	+	3	2	RDH8	9988866	0.205000	0.23458	0.996000	0.52242	0.866000	0.49608	1.066000	0.30604	0.432000	0.26286	-0.177000	0.13119	TGT	T|0.968;C|0.032		0.592	RDH8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
PSMD8	5714	hgsc.bcm.edu	37	19	38865440	38865440	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:38865440G>T	ENST00000215071.4	+	1	265	c.199G>T	c.(199-201)Gcg>Tcg	p.A67S	PSMD8_ENST00000602911.1_Missense_Mutation_p.A4S|PSMD8_ENST00000592035.1_5'Flank	NM_002812.4	NP_002803.2	P48556	PSMD8_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 8	67					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(1)	6	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GATGGCGGCCGCGGCGGTGAA	0.701																																					p.A67S		.											.	PSMD8-68	0			c.G199T						.						5.0	5.0	5.0					19																	38865440		2115	4138	6253	SO:0001583	missense	5714	exon1			GCGGCCGCGGCGG	D38047	CCDS12515.2	19q13.2	2009-05-07			ENSG00000099341	ENSG00000099341		"""Proteasome (prosome, macropain) subunits"""	9566	protein-coding gene	gene with protein product						7621825	Standard	NM_002812		Approved	S14, Nin1p, p31, HIP6, HYPF, Rpn12	uc002oii.4	P48556	OTTHUMG00000150691	ENST00000215071.4:c.199G>T	19.37:g.38865440G>T	ENSP00000215071:p.Ala67Ser	7	0		64	4	NM_002812	0	0	57	57	0	B4DX18|Q6P1L7	Missense_Mutation	SNP	ENST00000215071.4	37	CCDS12515.2	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910390	0.52439	.	.	ENSG00000099341	ENST00000215071	.	.	.	4.61	-1.4	0.08968	.	.	.	.	.	T	0.41604	0.1166	L	0.36672	1.1	0.53688	D	0.999979	B	0.21821	0.061	B	0.26416	0.069	T	0.11817	-1.0572	8	0.21540	T	0.41	-25.3606	8.1642	0.31217	0.437:0.0:0.563:0.0	.	67	P48556	PSMD8_HUMAN	S	67	.	ENSP00000215071:A67S	A	+	1	0	PSMD8	43557280	0.145000	0.22656	0.216000	0.23742	0.671000	0.39405	0.676000	0.25247	-0.207000	0.10187	-0.355000	0.07637	GCG	.		0.701	PSMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319627.1	NM_002812	
GGN	199720	hgsc.bcm.edu	37	19	38876758	38876758	+	Missense_Mutation	SNP	C	C	T	rs74911931	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:38876758C>T	ENST00000334928.6	-	3	1276	c.1144G>A	c.(1144-1146)Gca>Aca	p.A382T	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	382	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCAGAGAGTGCGGCCGCACGC	0.726													C|||	81	0.0161741	0.0318	0.0029	5008	,	,		11625	0.0337		0.001	False		,,,				2504	0.002				p.A382T		.											.	GGN-90	0			c.G1144A						.	C	THR/ALA	124,4198		1,122,2038	15.0	18.0	17.0		1144	1.1	0.4	19	dbSNP_131	17	14,8434		0,14,4210	yes	missense	GGN	NM_152657.3	58	1,136,6248	TT,TC,CC		0.1657,2.869,1.0807	benign	382/653	38876758	138,12632	2161	4224	6385	SO:0001583	missense	199720	exon3			AGAGTGCGGCCGC	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1144G>A	19.37:g.38876758C>T	ENSP00000334940:p.Ala382Thr	2	0		33	21	NM_152657	0	0	0	2	2	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	37	CCDS12516.1	40	0.018315018315018316	20	0.04065040650406504	1	0.0027624309392265192	19	0.033216783216783216	0	0.0	C	3.754	-0.051014	0.07407	0.02869	0.001657	ENSG00000179168	ENST00000334928	.	.	.	3.33	1.14	0.20703	.	0.711812	0.11524	N	0.555392	T	0.03178	0.0093	N	0.08118	0	0.09310	N	0.999998	B;B	0.15719	0.001;0.014	B;B	0.08055	0.002;0.003	T	0.27706	-1.0066	9	0.10902	T	0.67	-1.5501	5.0791	0.14647	0.0:0.6991:0.0:0.3009	.	299;382	Q86UU5-2;Q86UU5	.;GGN_HUMAN	T	382	.	ENSP00000334940:A382T	A	-	1	0	GGN	43568598	0.087000	0.21565	0.378000	0.26068	0.149000	0.21700	0.191000	0.17076	0.119000	0.18210	-0.369000	0.07265	GCA	C|0.982;T|0.018		0.726	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
CIC	23152	broad.mit.edu;bcgsc.ca	37	19	42795085	42795085	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:42795085C>G	ENST00000575354.2	+	10	2205	c.2165C>G	c.(2164-2166)cCg>cGg	p.P722R	CIC_ENST00000160740.3_Missense_Mutation_p.P722R|CIC_ENST00000572681.2_Missense_Mutation_p.P1631R	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	722	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				GGGGGCTCCCCGCTGGGTGTC	0.642			"""Mis, F, S"""		oligodendroglioma																																p.P722R		.		Rec	yes		19	19q13.2	23152	capicua homolog		O	.	CIC-591	0			c.C2165G						.						26.0	27.0	26.0					19																	42795085		2201	4290	6491	SO:0001583	missense	23152	exon10			GCTCCCCGCTGGG	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.2165C>G	19.37:g.42795085C>G	ENSP00000458663:p.Pro722Arg	115	0		170	8	NM_015125	0	0	9	10	1	Q7LGI1|Q9UEG5|Q9Y6T1	Missense_Mutation	SNP	ENST00000575354.2	37	CCDS12601.1	.	.	.	.	.	.	.	.	.	.	C	10.91	1.484964	0.26598	.	.	ENSG00000079432	ENST00000160740	.	.	.	5.3	1.74	0.24563	.	.	.	.	.	T	0.19046	0.0457	N	0.14661	0.345	0.26401	N	0.976423	B	0.24675	0.109	B	0.15870	0.014	T	0.18116	-1.0347	8	0.87932	D	0	-13.3579	4.743	0.13024	0.155:0.6093:0.1504:0.0853	.	722	Q96RK0	CIC_HUMAN	R	722	.	ENSP00000160740:P722R	P	+	2	0	CIC	47486925	0.729000	0.28090	0.554000	0.28268	0.977000	0.68977	1.981000	0.40628	0.595000	0.29777	0.561000	0.74099	CCG	.		0.642	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000594275.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		0	0		14	14	NM_000960	0	0	0	2	2		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
TPRX1	284355	broad.mit.edu	37	19	48305639	48305650	+	In_Frame_Del	DEL	GGGCCTGGGATC	GGGCCTGGGATC	-	rs112397458|rs112842028		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:48305639_48305650delGGGCCTGGGATC	ENST00000322175.3	-	2	773_784	c.618_629delGATCCCAGGCCC	c.(616-630)ccgatcccaggccca>cca	p.206_210PIPGP>P	TPRX1_ENST00000535759.1_In_Frame_Del_p.303_307PIPGP>P|TPRX1_ENST00000543508.1_In_Frame_Del_p.196_200PIPGP>P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	206	Gly-rich.			P -> L (in Ref. 1; BAC05130). {ECO:0000305}.		nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gcctgagattgggcctgggatcgggcctggga	0.675																																					p.206_210del	Esophageal Squamous(123;175 2281 3051 32395)	.											.	TPRX1-90	0			c.618_629del						.			195,3079		53,89,1495						-0.7	0.0			11	984,5118		202,580,2269	no	coding	TPRX1	NM_198479.2		255,669,3764	A1A1,A1R,RR		16.1259,5.956,12.5747				1179,8197				SO:0001651	inframe_deletion	284355	exon2			GAGATTGGGCCTG		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.618_629delGATCCCAGGCCC	19.37:g.48305639_48305650delGGGCCTGGGATC	ENSP00000323455:p.Pro206_Gly209del	39	0		56	17	NM_198479	0	0	0	0	0	A5D8Y3|B2RPL5	In_Frame_Del	DEL	ENST00000322175.3	37	CCDS33066.1																																																																																			.		0.675	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
RASIP1	54922	hgsc.bcm.edu	37	19	49232226	49232226	+	Missense_Mutation	SNP	G	G	A	rs2287922	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:49232226G>A	ENST00000222145.4	-	5	2005	c.1801C>T	c.(1801-1803)Cgc>Tgc	p.R601C	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	601	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.		R -> C (in dbSNP:rs2287922). {ECO:0000269|PubMed:15031288}.		angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CGGGCCAGGCGGCCCAGCAGT	0.731													G|||	1076	0.214856	0.1157	0.2997	5008	,	,		8786	0.0198		0.4791	False		,,,				2504	0.2178				p.R601C		.											.	RASIP1-228	0			c.C1801T						.	G	CYS/ARG	456,2624		82,292,1166	2.0	3.0	3.0		1801	4.2	1.0	19	dbSNP_100	3	2661,3381		645,1371,1005	yes	missense	RASIP1	NM_017805.2	180	727,1663,2171	AA,AG,GG		44.0417,14.8052,34.1701	probably-damaging	601/964	49232226	3117,6005	1540	3021	4561	SO:0001583	missense	54922	exon5			CCAGGCGGCCCAG	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1801C>T	19.37:g.49232226G>A	ENSP00000222145:p.Arg601Cys	0	0		5	4	NM_017805	0	0	3	8	5	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	571	0.26144688644688646	65	0.13211382113821138	127	0.35082872928176795	21	0.03671328671328671	358	0.47229551451187335	G	17.28	3.350878	0.61183	0.148052	0.440417	ENSG00000105538	ENST00000222145	T	0.27557	1.66	4.17	4.17	0.49024	Dilute (1);	0.331247	0.23983	N	0.042644	T	0.00012	0.0000	L	0.39898	1.24	0.22701	P	0.99883638	D	0.76494	0.999	P	0.54590	0.756	T	0.48328	-0.9045	9	0.66056	D	0.02	-0.9078	9.7493	0.40466	0.0:0.0:0.7933:0.2067	rs2287922	601	Q5U651	RAIN_HUMAN	C	601	ENSP00000222145:R601C	ENSP00000222145:R601C	R	-	1	0	RASIP1	53924038	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	3.181000	0.50903	2.023000	0.59567	0.462000	0.41574	CGC	G|0.738;A|0.262		0.731	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
KIR3DL2	3812	broad.mit.edu;bcgsc.ca	37	19	55378056	55378056	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:55378056G>T	ENST00000326321.3	+	9	1271	c.1238G>T	c.(1237-1239)cGc>cTc	p.R413L	KIR3DL2_ENST00000270442.5_Missense_Mutation_p.R396L|RNU6-222P_ENST00000362438.1_RNA|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.R413L	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	413					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.R413L(2)		breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		AAAATCAGTCGCCCTTCTCAG	0.517																																					p.R413L		.											.	KIR3DL2-92	2	Substitution - Missense(2)	lung(2)	c.G1238T						.						266.0	259.0	261.0					19																	55378056		2203	4300	6503	SO:0001583	missense	3812	exon9			TCAGTCGCCCTTC	L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.1238G>T	19.37:g.55378056G>T	ENSP00000325525:p.Arg413Leu	181	1		279	8	NM_006737	0	0	0	0	0	Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	ENST00000326321.3	37	CCDS12906.1	.	.	.	.	.	.	.	.	.	.	G	7.746	0.702295	0.15172	.	.	ENSG00000167633;ENSG00000240403;ENSG00000240403	ENST00000402254;ENST00000326321;ENST00000270442	T;T;T	0.00482	7.2;7.17;7.1	1.59	-0.883	0.10600	.	.	.	.	.	T	0.01029	0.0034	M	0.79805	2.47	0.09310	N	1	B;D;D	0.71674	0.095;0.997;0.998	B;D;D	0.79784	0.081;0.985;0.993	T	0.49254	-0.8959	9	0.87932	D	0	.	2.5759	0.04806	0.0:0.4307:0.3345:0.2348	.	396;413;413	Q95366;P43630;F6QF33	.;KI3L2_HUMAN;.	L	413;413;396	ENSP00000384528:R413L;ENSP00000325525:R413L;ENSP00000270442:R396L	ENSP00000384528:R413L	R	+	2	0	KIR3DL1;KIR3DL2	60069868	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.536000	0.06135	0.027000	0.15297	-0.751000	0.03497	CGC	.		0.517	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000141241.1		
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	0	0		10	10	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF814	730051	ucsc.edu	37	19	58384712	58384712	+	Silent	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:58384712A>G	ENST00000435989.2	-	3	2280	c.2046T>C	c.(2044-2046)caT>caC	p.H682H	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	682					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTTCTCCAGTATGGCCATGCT	0.408																																					p.H682H		.											.	.	0			c.T2046C						.						68.0	57.0	60.0					19																	58384712		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			TCCAGTATGGCCA		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2046T>C	19.37:g.58384712A>G		156	0		224	1	NM_001144989	0	0	6	8	2	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.408	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
TPO	7173	hgsc.bcm.edu	37	2	1481231	1481231	+	Missense_Mutation	SNP	G	G	C	rs2175977	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:1481231G>C	ENST00000345913.4	+	8	1284	c.1193G>C	c.(1192-1194)aGc>aCc	p.S398T	TPO_ENST00000349624.3_Intron|TPO_ENST00000346956.3_Missense_Mutation_p.S398T|TPO_ENST00000329066.4_Missense_Mutation_p.S398T|TPO_ENST00000382201.3_Missense_Mutation_p.S398T|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.S398T	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	398			S -> T (in dbSNP:rs2175977). {ECO:0000269|PubMed:7550241}.		cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GGCCGCGCCAGCGAGGTCCCC	0.761													G|||	3557	0.710264	0.8185	0.6571	5008	,	,		9157	0.7758		0.6034	False		,,,				2504	0.6442				p.S398T		.											.	TPO-332	0			c.G1193C						.	G	THR/SER,THR/SER,THR/SER,THR/SER,THR/SER,	2498,394		1072,354,20	2.0	2.0	2.0		1193,1193,1193,1193,1193,	4.1	1.0	2	dbSNP_96	2	4199,1477		1511,1177,150	no	missense,missense,missense,missense,missense,intron	TPO	NM_000547.5,NM_001206744.1,NM_001206745.1,NM_175719.3,NM_175721.3,NM_175722.3	58,58,58,58,58,	2583,1531,170	CC,CG,GG		26.0218,13.6238,21.8371	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,	398/934,398/934,398/877,398/877,398/890,	1481231	6697,1871	1446	2838	4284	SO:0001583	missense	7173	exon8			GCGCCAGCGAGGT		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.1193G>C	2.37:g.1481231G>C	ENSP00000318820:p.Ser398Thr	0	0		12	12	NM_175719	0	0	0	0	0	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	37	CCDS1643.1	1512|1512	0.6923076923076923|0.6923076923076923	388|388	0.7886178861788617|0.7886178861788617	227|227	0.6270718232044199|0.6270718232044199	438|438	0.7657342657342657|0.7657342657342657	459|459	0.6055408970976254|0.6055408970976254	G|G	18.72|18.72	3.683431|3.683431	0.68157|0.68157	0.863762|0.863762	0.739782|0.739782	ENSG00000115705|ENSG00000115705	ENST00000536482|ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	.|T;T;T;T;T;T	.|0.73897	.|-0.79;-0.79;-0.79;-0.79;-0.79;-0.79	4.99|4.99	4.08|4.08	0.47627|0.47627	.|.	.|0.142496	.|0.64402	.|N	.|0.000004	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.62723|0.62723	1.935|1.935	0.09310|0.09310	P|P	1.0|1.0	.|D;D;D	.|0.76494	.|0.998;0.998;0.999	.|D;D;D	.|0.69654	.|0.956;0.94;0.965	T|T	0.30060|0.30060	-0.9991|-0.9991	5|9	0.48119|0.56958	T|D	0.1|0.05	-48.0867|-48.0867	8.6411|8.6411	0.33978|0.33978	0.08:0.1541:0.7659:0.0|0.08:0.1541:0.7659:0.0	rs2175977|rs2175977	.|398;398;398	.|P07202-4;P07202-2;P07202	.|.;.;PERT_HUMAN	H|T	81|398;398;398;398;398;327	.|ENSP00000337263:S398T;ENSP00000318820:S398T;ENSP00000263886:S398T;ENSP00000329869:S398T;ENSP00000371636:S398T;ENSP00000405788:S327T	ENSP00000439133:Q81H|ENSP00000329869:S398T	Q|S	+|+	3|2	2|0	TPO|TPO	1460238|1460238	0.956000|0.956000	0.32656|0.32656	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.297000|1.297000	0.33400|0.33400	1.031000|1.031000	0.39867|0.39867	0.460000|0.460000	0.39030|0.39030	CAG|AGC	G|0.301;C|0.699		0.761	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000458098.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		1	0		4	4	NM_001256478	0	0	0	1	1	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
DHX57	90957	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	39050210	39050210	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:39050210C>A	ENST00000295373.6	-	17	3342	c.3216G>T	c.(3214-3216)atG>atT	p.M1072I		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1072							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				ACCCAAACAACATTAGTTTGC	0.438																																					p.M1072I	Melanoma(191;1090 2095 4375 23729 47341)	.											.	DHX57-228	0			c.G3216T						.						123.0	105.0	111.0					2																	39050210		2203	4300	6503	SO:0001583	missense	90957	exon17			AAACAACATTAGT	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3216G>T	2.37:g.39050210C>A	ENSP00000295373:p.Met1072Ile	222	1		136	40	NM_198963	0	0	2	10	8	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	ENST00000295373.6	37	CCDS1800.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.918|6.918	0.539043|0.539043	0.13250|0.13250	.|.	.|.	ENSG00000163214|ENSG00000163214	ENST00000295373|ENST00000452978	T|.	0.25749|.	1.78|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Helicase-associated domain (2);|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|T	0.33556|0.33556	0.0867|0.0867	N|N	0.03948|0.03948	-0.315|-0.315	0.80722|0.80722	D|D	1|1	B;B|.	0.20368|.	0.044;0.001|.	B;B|.	0.24006|.	0.05;0.004|.	T|T	0.28744|0.28744	-1.0034|-1.0034	10|5	0.22109|.	T|.	0.4|.	.|.	13.6824|13.6824	0.62493|0.62493	0.0:0.9266:0.0:0.0734|0.0:0.9266:0.0:0.0734	.|.	1072;464|.	Q6P158;Q59G60|.	DHX57_HUMAN;.|.	I|F	1072|396	ENSP00000295373:M1072I|.	ENSP00000295373:M1072I|.	M|V	-|-	3|1	0|0	DHX57|DHX57	38903714|38903714	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.430000|0.430000	0.31655|0.31655	5.982000|5.982000	0.70532|0.70532	2.592000|2.592000	0.87571|0.87571	0.650000|0.650000	0.86243|0.86243	ATG|GTT	.		0.438	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	39	4		122	44	NM_001145054	0	0	3	3	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
C2orf81	388963	broad.mit.edu	37	2	74642300	74642300	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:74642300T>G	ENST00000517883.1	-	1	1410	c.719A>C	c.(718-720)tAc>tCc	p.Y240S	C2orf81_ENST00000290390.5_Missense_Mutation_p.Y308S			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	301										endometrium(3)|kidney(1)	4						CACAGAGGGGTAGGACACCAA	0.701																																					p.Y308S		.											.	.	0			c.A923C						.						14.0	17.0	16.0					2																	74642300		692	1591	2283	SO:0001583	missense	388963	exon4			GAGGGGTAGGACA	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.719A>C	2.37:g.74642300T>G	ENSP00000431103:p.Tyr240Ser	91	8		154	45	NM_001145054	0	0	2	2	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	7.689	0.690570	0.15039	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	4.2	-6.96	0.01622	.	3.498430	0.00812	N	0.001503	T	0.07188	0.0182	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21348	-1.0248	9	0.07644	T	0.81	15.6135	1.7949	0.03059	0.2041:0.1456:0.1479:0.5023	.	308	G3XAA6	.	S	240;308	.	ENSP00000290390:Y308S	Y	-	2	0	C2orf81	74495808	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.430000	0.06973	-1.385000	0.02101	-0.712000	0.03635	TAC	.		0.701	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
ANKRD39	51239	hgsc.bcm.edu	37	2	97523720	97523720	+	Missense_Mutation	SNP	G	G	A	rs200576046	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:97523720G>A	ENST00000393537.4	-	1	112	c.5C>T	c.(4-6)gCg>gTg	p.A2V		NM_016466.5	NP_057550.3	Q53RE8	ANR39_HUMAN	ankyrin repeat domain 39	2										NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)	6						CCGAGGCGTCGCCATCCCGGC	0.751													G|||	4	0.000798722	0.0	0.0014	5008	,	,		12037	0.0		0.002	False		,,,				2504	0.001				p.A2V		.											.	ANKRD39-44	0			c.C5T						.	G	VAL/ALA	2,4228		0,2,2113	7.0	7.0	7.0		5	4.8	1.0	2		7	21,8209		0,21,4094	no	missense	ANKRD39	NM_016466.5	64	0,23,6207	AA,AG,GG		0.2552,0.0473,0.1846	possibly-damaging	2/184	97523720	23,12437	2115	4115	6230	SO:0001583	missense	51239	exon1			GGCGTCGCCATCC	BC031303	CCDS2028.1	2q11.2	2013-01-10			ENSG00000213337	ENSG00000213337		"""Ankyrin repeat domain containing"""	28640	protein-coding gene	gene with protein product						11042152	Standard	NM_016466		Approved	MGC41816	uc002sxd.4	Q53RE8	OTTHUMG00000130530	ENST00000393537.4:c.5C>T	2.37:g.97523720G>A	ENSP00000377170:p.Ala2Val	1	0		16	5	NM_016466	0	0	7	7	0	Q59FU2|Q8N5X5|Q9P0S5	Missense_Mutation	SNP	ENST00000393537.4	37	CCDS2028.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997610	0.74818	4.73E-4	0.002552	ENSG00000213337	ENST00000393537	T	0.67171	-0.25	4.81	4.81	0.61882	.	0.101047	0.38272	U	0.001751	T	0.60573	0.2279	L	0.51422	1.61	0.29494	N	0.855429	D	0.61080	0.989	B	0.41466	0.358	T	0.67166	-0.5739	10	0.87932	D	0	-17.5479	13.2546	0.60070	0.0:0.0:1.0:0.0	.	2	Q53RE8	ANR39_HUMAN	V	2	ENSP00000377170:A2V	ENSP00000377170:A2V	A	-	2	0	ANKRD39	96887447	0.063000	0.20901	1.000000	0.80357	0.113000	0.19764	1.798000	0.38814	2.507000	0.84556	0.655000	0.94253	GCG	.		0.751	ANKRD39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252951.2	NM_016466	
RBM45	129831	broad.mit.edu	37	2	178988920	178988920	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:178988920delA	ENST00000286070.5	+	8	1227	c.1135delA	c.(1135-1137)aaafs	p.K381fs		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	383					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.A382fs*7(2)|p.?(1)		endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			TCCATCATGCAAAAAAAAAGC	0.353																																					p.K379fs		.											.	RBM45-22	3	Deletion - Frameshift(2)|Unknown(1)	large_intestine(2)|skin(1)	c.1135delA						.			3,107,4156		0,0,3,40,27,2063	69.0	75.0	73.0			4.7	1.0	2		75	6,163,8085		0,0,6,55,53,4013	no	codingComplex	RBM45	NM_152945.2		0,0,9,95,80,6076	A1A1,A1A2,A1R,A2A2,A2R,RR		2.0475,2.5785,2.2284			178988920	9,270,12241	2203	4300	6503	SO:0001589	frameshift_variant	129831	exon8			TCATGCAAAAAAA	AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.1135delA	2.37:g.178988920delA	ENSP00000286070:p.Lys381fs	97	0		93	5	NM_152945	0	0	0	0	0	Q6NYL0|Q8NFC9	Frame_Shift_Del	DEL	ENST00000286070.5	37	CCDS33335.1																																																																																			.		0.353	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334375.2	NM_152945	
OSBPL6	114880	broad.mit.edu;bcgsc.ca	37	2	179251845	179251845	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:179251845C>T	ENST00000190611.4	+	20	2511	c.2135C>T	c.(2134-2136)aCa>aTa	p.T712I	OSBPL6_ENST00000409045.3_Missense_Mutation_p.T681I|OSBPL6_ENST00000315022.2_Missense_Mutation_p.T716I|OSBPL6_ENST00000409631.1_Missense_Mutation_p.T676I|OSBPL6_ENST00000392505.2_Missense_Mutation_p.T737I|OSBPL6_ENST00000359685.3_Missense_Mutation_p.T676I	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	712					lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			CCTGTTGGAACACTGAATGTC	0.408																																					p.T737I		.											.	OSBPL6-69	0			c.C2210T						.						118.0	105.0	110.0					2																	179251845		2203	4300	6503	SO:0001583	missense	114880	exon21			TTGGAACACTGAA	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.2135C>T	2.37:g.179251845C>T	ENSP00000190611:p.Thr712Ile	136	0		109	5	NM_001201480	0	0	6	6	0	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Missense_Mutation	SNP	ENST00000190611.4	37	CCDS2277.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255298	0.80135	.	.	ENSG00000079156	ENST00000392505;ENST00000359685;ENST00000409045;ENST00000190611;ENST00000409631;ENST00000315022	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47	5.67	5.67	0.87782	.	0.042662	0.85682	D	0.000000	T	0.53690	0.1812	M	0.61703	1.905	0.80722	D	1	P;B;B;D;P	0.67145	0.812;0.087;0.057;0.996;0.822	P;B;B;D;P	0.63703	0.578;0.045;0.054;0.917;0.471	T	0.49234	-0.8961	10	0.54805	T	0.06	-18.5257	20.1421	0.98061	0.0:1.0:0.0:0.0	.	681;716;676;737;712	Q9BZF3-4;Q9BZF3-3;Q9BZF3-2;Q9BZF3-5;Q9BZF3	.;.;.;.;OSBL6_HUMAN	I	737;676;681;712;676;716	ENSP00000376293:T737I;ENSP00000352713:T676I;ENSP00000387248:T681I;ENSP00000190611:T712I;ENSP00000386885:T676I;ENSP00000318723:T716I	ENSP00000190611:T712I	T	+	2	0	OSBPL6	178960091	1.000000	0.71417	0.998000	0.56505	0.833000	0.47200	6.044000	0.71012	2.836000	0.97738	0.655000	0.94253	ACA	.		0.408	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
ZC3H15	55854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	187373328	187373328	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:187373328G>T	ENST00000337859.6	+	10	1376	c.1149G>T	c.(1147-1149)ttG>ttT	p.L383F		NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	383					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			GAAGTGACTTGGAAGAGGACA	0.408																																					p.L383F		.											.	ZC3H15-91	0			c.G1149T						.						147.0	150.0	149.0					2																	187373328		1877	4115	5992	SO:0001583	missense	55854	exon10			TGACTTGGAAGAG		CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.1149G>T	2.37:g.187373328G>T	ENSP00000338788:p.Leu383Phe	175	1		113	79	NM_018471	0	0	2	109	107	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	ENST00000337859.6	37	CCDS42791.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.295841	0.60086	.	.	ENSG00000065548	ENST00000337859;ENST00000536434	T	0.32988	1.43	5.92	4.13	0.48395	.	0.174073	0.37906	N	0.001887	T	0.29190	0.0726	L	0.51422	1.61	0.80722	D	1	D	0.56521	0.976	P	0.44597	0.454	T	0.02933	-1.1092	10	0.46703	T	0.11	-7.8612	9.0716	0.36495	0.2413:0.0:0.7587:0.0	.	383	Q8WU90	ZC3HF_HUMAN	F	383	ENSP00000338788:L383F	ENSP00000338788:L383F	L	+	3	2	ZC3H15	187081573	.	.	0.988000	0.46212	0.835000	0.47333	.	.	0.836000	0.34901	0.650000	0.86243	TTG	.		0.408	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334547.2	NM_018471	
SMARCAL1	50485	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	217285234	217285234	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:217285234C>T	ENST00000357276.4	+	5	1405	c.1075C>T	c.(1075-1077)Cag>Tag	p.Q359*	SMARCAL1_ENST00000358207.5_Nonsense_Mutation_p.Q359*	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	359	HARP 2. {ECO:0000255|PROSITE- ProRule:PRU00800}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GCTTTTTAAACAGATGGATTC	0.443									Schimke Immuno-Osseous Dysplasia																												p.Q359X		.											.	SMARCAL1-293	0			c.C1075T						.						121.0	117.0	118.0					2																	217285234		2203	4300	6503	SO:0001587	stop_gained	50485	exon5	Familial Cancer Database	SIOD	TTTAAACAGATGG	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.1075C>T	2.37:g.217285234C>T	ENSP00000349823:p.Gln359*	167	2		148	115	NM_014140	0	0	1	3	2	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Nonsense_Mutation	SNP	ENST00000357276.4	37	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822296	0.90873	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000427645;ENST00000392128;ENST00000412913	.	.	.	4.7	4.7	0.59300	.	0.199915	0.43416	D	0.000576	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-17.8114	16.3851	0.83502	0.0:1.0:0.0:0.0	.	.	.	.	X	359;359;258;223;79	.	ENSP00000349823:Q359X	Q	+	1	0	SMARCAL1	216993479	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	1.500000	0.35682	2.450000	0.82876	0.561000	0.74099	CAG	.		0.443	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2		
FAM134A	79137	hgsc.bcm.edu	37	2	220043233	220043233	+	Silent	SNP	C	C	T	rs375896695	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:220043233C>T	ENST00000430297.2	+	1	295	c.159C>T	c.(157-159)gcC>gcT	p.A53A	CNPPD1_ENST00000360507.5_5'Flank|CNPPD1_ENST00000409789.1_5'Flank	NM_024293.4	NP_077269.3	Q8NC44	F134A_HUMAN	family with sequence similarity 134, member A	53						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	19		Renal(207;0.0915)		Epithelial(149;8.92e-07)|all cancers(144;0.000151)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GACGCCTGGCCACGACGCTGT	0.731													C|||	12	0.00239617	0.0008	0.0043	5008	,	,		6688	0.0		0.006	False		,,,				2504	0.002				p.A53A		.											.	FAM134A-91	0			c.C159T						.	C		4,2988		0,4,1492	4.0	3.0	3.0		159	0.9	0.9	2		3	34,5790		0,34,2878	no	coding-synonymous	FAM134A	NM_024293.4		0,38,4370	TT,TC,CC		0.5838,0.1337,0.431		53/544	220043233	38,8778	1496	2912	4408	SO:0001819	synonymous_variant	79137	exon1			CCTGGCCACGACG	AK074983	CCDS2434.1	2q36.1	2008-02-05	2007-05-01	2007-05-01	ENSG00000144567	ENSG00000144567			28450	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 17"""	C2orf17			Standard	NM_024293		Approved	MGC3035	uc002vjw.4	Q8NC44	OTTHUMG00000154577	ENST00000430297.2:c.159C>T	2.37:g.220043233C>T		1	0		16	15	NM_024293	0	0	0	3	3	Q6P1P5|Q9H0K7	Silent	SNP	ENST00000430297.2	37	CCDS2434.1																																																																																			.		0.731	FAM134A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336147.2	NM_024293	
SNED1	25992	hgsc.bcm.edu	37	2	242011084	242011084	+	Missense_Mutation	SNP	T	T	C	rs17440466	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr2:242011084T>C	ENST00000310397.8	+	25	3683	c.3683T>C	c.(3682-3684)cTg>cCg	p.L1228P	SNED1_ENST00000342631.6_Missense_Mutation_p.L1228P|MTERFD2_ENST00000464344.2_5'Flank|SNED1_ENST00000405547.3_Missense_Mutation_p.L1228P|SNED1_ENST00000401884.1_Missense_Mutation_p.L1228P	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	1228			L -> P (in dbSNP:rs17440466).		cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CTGCCGGAGCTGCGCCTGCTC	0.726													T|||	550	0.109824	0.0227	0.0821	5008	,	,		7723	0.1885		0.171	False		,,,				2504	0.1033				p.L1228P		.											.	SNED1-72	0			c.T3683C						.	T	PRO/LEU	148,3636		7,134,1751	5.0	6.0	6.0		3683	4.4	1.0	2	dbSNP_123	6	1058,6892		57,944,2974	no	missense	SNED1	NM_001080437.1	98	64,1078,4725	CC,CT,TT		13.3082,3.9112,10.2778	probably-damaging	1228/1414	242011084	1206,10528	1892	3975	5867	SO:0001583	missense	25992	exon25			CGGAGCTGCGCCT	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.3683T>C	2.37:g.242011084T>C	ENSP00000308893:p.Leu1228Pro	1	0		11	11	NM_001080437	0	0	0	7	7	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	255	0.11675824175824176	17	0.034552845528455285	27	0.07458563535911603	105	0.18356643356643357	106	0.13984168865435356	T	13.43	2.236189	0.39498	0.039112	0.133082	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	D;D;D;D	0.83992	-1.72;-1.79;-1.76;-1.72	4.36	4.36	0.52297	.	0.000000	0.34025	N	0.004340	T	0.01156	0.0038	M	0.67953	2.075	0.09310	P	0.99999566469	D;D;D;D	0.76494	0.992;0.996;0.999;0.96	P;D;D;P	0.83275	0.857;0.918;0.996;0.613	T	0.33904	-0.9850	9	0.37606	T	0.19	.	11.3537	0.49602	0.0:0.0:0.0:1.0	rs17440466;rs17440466	1228;1228;1228;1228	Q8TER0-3;Q8TER0-5;B5MEF5;Q8TER0	.;.;.;SNED1_HUMAN	P	1228	ENSP00000384871:L1228P;ENSP00000386007:L1228P;ENSP00000308893:L1228P;ENSP00000342992:L1228P	ENSP00000308893:L1228P	L	+	2	0	SNED1	241659757	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	1.160000	0.31761	1.727000	0.51537	0.383000	0.25322	CTG	T|0.877;C|0.123		0.726	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V|FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	638	12		716	28	.	0	0	80	80	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
RBM12	10137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	34242149	34242149	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:34242149G>C	ENST00000374114.3	-	3	1359	c.1096C>G	c.(1096-1098)Ctg>Gtg	p.L366V	CPNE1_ENST00000397443.1_Intron|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000397445.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.L366V|CPNE1_ENST00000352393.4_Intron|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.L366V|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000317677.5_5'Flank|CPNE1_ENST00000397442.1_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	366	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			TGAATCATCAGCATTCTGTTT	0.423											OREG0004044	type=REGULATORY REGION|Gene=CPNE1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.L366V		.											.	RBM12-93	0			c.C1096G						.						175.0	167.0	170.0					20																	34242149		2203	4300	6503	SO:0001583	missense	10137	exon2			TCATCAGCATTCT	AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.1096C>G	20.37:g.34242149G>C	ENSP00000363228:p.Leu366Val	50	0	846	72	11	NM_001198840	0	0	10	15	5	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	ENST00000374114.3	37	CCDS13261.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638181	0.29157	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.06294	3.32;3.32;3.32	4.77	4.77	0.60923	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.080477	0.51477	D	0.000100	T	0.09905	0.0243	L	0.34521	1.04	0.80722	D	1	B	0.23891	0.093	B	0.38880	0.284	T	0.37502	-0.9703	10	0.24483	T	0.36	-3.3643	18.0823	0.89444	0.0:0.0:1.0:0.0	.	366	Q9NTZ6	RBM12_HUMAN	V	366;366;366;165	ENSP00000363228:L366V;ENSP00000352668:L366V;ENSP00000363217:L366V	ENSP00000339879:L165V	L	-	1	2	RBM12	33705563	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.477000	0.73591	2.494000	0.84150	0.549000	0.68633	CTG	.		0.423	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078894.1	NM_006047	
TTI1	9675	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	36641454	36641454	+	Silent	SNP	G	G	T	rs149287636		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:36641454G>T	ENST00000373448.2	-	3	1003	c.765C>A	c.(763-765)atC>atA	p.I255I	TTI1_ENST00000449821.1_Silent_p.I255I|TTI1_ENST00000373447.3_Silent_p.I255I|TTI1_ENST00000487362.1_Intron	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	255					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						GGACCTTTGAGATTCTTTTGA	0.428																																					p.I255I		.											.	TTI1-94	0			c.C765A						.						180.0	180.0	180.0					20																	36641454		2203	4300	6503	SO:0001819	synonymous_variant	9675	exon3			CTTTGAGATTCTT	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.765C>A	20.37:g.36641454G>T		64	1		81	17	NM_014657	0	0	1	2	1	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Silent	SNP	ENST00000373448.2	37	CCDS13300.1																																																																																			G|1.000;A|0.000		0.428	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
ZHX3	23051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	39831045	39831045	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:39831045C>G	ENST00000309060.3	-	4	2927	c.2512G>C	c.(2512-2514)Ggg>Cgg	p.G838R	ZHX3_ENST00000432768.2_Missense_Mutation_p.G838R|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000544979.2_Missense_Mutation_p.G838R|ZHX3_ENST00000559234.1_Missense_Mutation_p.G838R|ZHX3_ENST00000540170.1_Missense_Mutation_p.G838R|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.G838R			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	838					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				ACCAGTAGCCCTGGTGGGAAG	0.537																																					p.G838R		.											.	ZHX3-93	0			c.G2512C						.						144.0	138.0	140.0					20																	39831045		2203	4300	6503	SO:0001583	missense	23051	exon3			GTAGCCCTGGTGG	AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.2512G>C	20.37:g.39831045C>G	ENSP00000312222:p.Gly838Arg	133	0		208	94	NM_015035	0	0	9	24	15	E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	ENST00000309060.3	37	CCDS13315.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.31|14.31	2.498122|2.498122	0.44455|0.44455	.|.	.|.	ENSG00000174306|ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262|ENST00000421422	T;T;T|.	0.12879|.	2.81;2.81;2.64|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.132904|.	0.49916|.	D|.	0.000126|.	T|T	0.71837|0.71837	0.3387|0.3387	M|M	0.66939|0.66939	2.045|2.045	0.51012|0.51012	D|D	0.999903|0.999903	D;D;D|.	0.67145|.	0.996;0.992;0.994|.	D;P;D|.	0.66602|.	0.945;0.798;0.921|.	T|T	0.69672|0.69672	-0.5082|-0.5082	10|5	0.72032|.	D|.	0.01|.	-25.6718|-25.6718	13.7909|13.7909	0.63140|0.63140	0.0:0.9305:0.0:0.0695|0.0:0.9305:0.0:0.0695	.|.	838;838;838|.	A8K8Q0;Q9H4I2;F5H820|.	.;ZHX3_HUMAN;.|.	R|T	838;838;838;838;616|546	ENSP00000362360:G838R;ENSP00000442290:G838R;ENSP00000443783:G838R|.	ENSP00000312222:G838R|.	G|R	-|-	1|2	0|0	ZHX3|ZHX3	39264459|39264459	0.726000|0.726000	0.28059|0.28059	0.995000|0.995000	0.50966|0.50966	0.326000|0.326000	0.28443|0.28443	3.575000|3.575000	0.53870|0.53870	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GGG|AGG	.		0.537	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079262.3	NM_015035	
WISP2	8839	hgsc.bcm.edu	37	20	43348735	43348735	+	Silent	SNP	C	C	A	rs2296530	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:43348735C>A	ENST00000372868.2	+	3	601	c.258C>A	c.(256-258)ggC>ggA	p.G86G	WISP2_ENST00000190983.4_Silent_p.G86G|WISP2_ENST00000372865.4_Silent_p.G86G|RP11-445H22.4_ENST00000427303.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA|RP11-445H22.4_ENST00000445420.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2	86	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				GACCCGGTGGCCGGGGGGCCC	0.706													C|||	1984	0.396166	0.4803	0.4452	5008	,	,		15685	0.3909		0.339	False		,,,				2504	0.3119				p.G86G		.											.	WISP2-130	0			c.C258A						.	C		1905,2317		492,921,698	5.0	5.0	5.0		258	5.5	0.1	20	dbSNP_100	5	2588,5598		519,1550,2024	no	coding-synonymous	WISP2	NM_003881.2		1011,2471,2722	AA,AC,CC		31.615,45.1208,36.2105		86/251	43348735	4493,7915	2111	4093	6204	SO:0001819	synonymous_variant	8839	exon2			CGGTGGCCGGGGG	AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.258C>A	20.37:g.43348735C>A		0	0		12	7	NM_003881	0	0	16	25	9	B2R9N4|E1P612|Q6PEG3	Silent	SNP	ENST00000372868.2	37	CCDS13336.1																																																																																			C|0.615;A|0.385		0.706	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127824.1	NM_003881	
SEMG1	6406	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43836226	43836226	+	Silent	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:43836226A>G	ENST00000372781.3	+	2	345	c.288A>G	c.(286-288)tcA>tcG	p.S96S	SEMG1_ENST00000244069.6_Silent_p.S96S	NM_003007.3	NP_002998.1	P04279	SEMG1_HUMAN	semenogelin I	96	Repeat-rich region. {ECO:0000250}.				insemination (GO:0007320)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|prostate(1)|skin(6)|stomach(2)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.0122)				CGACAAAATCACAACGACATC	0.378																																					p.S96S		.											.	SEMG1-92	0			c.A288G						.						148.0	128.0	135.0					20																	43836226		2203	4300	6503	SO:0001819	synonymous_variant	6406	exon2			AAAATCACAACGA		CCDS13345.1	20q12-q13.2	2009-08-06			ENSG00000124233	ENSG00000124233			10742	protein-coding gene	gene with protein product	"""semen coagulating protein"", ""cancer/testis antigen 103"""	182140		SEMG		2912989, 15563730	Standard	NM_003007		Approved	CT103		P04279	OTTHUMG00000032565	ENST00000372781.3:c.288A>G	20.37:g.43836226A>G		184	0		246	116	NM_003007	0	0	0	0	0	Q53ZV0|Q53ZV1|Q53ZV2|Q6X4I9|Q6Y809|Q6Y822|Q6Y823|Q86U64|Q96QM3	Silent	SNP	ENST00000372781.3	37	CCDS13345.1																																																																																			.		0.378	SEMG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079416.3	NM_003007	
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000243938.4_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000481847.1_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		0	0		7	7	NM_052951	0	0	0	7	7	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
SULF2	55959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	46290611	46290611	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:46290611C>G	ENST00000359930.4	-	18	3251	c.2400G>C	c.(2398-2400)agG>agC	p.R800S	SULF2_ENST00000484875.1_Missense_Mutation_p.R800S|SULF2_ENST00000361612.4_Missense_Mutation_p.R800S|SULF2_ENST00000467815.1_Missense_Mutation_p.R800S	NM_018837.3	NP_061325.1	Q8IWU5	SULF2_HUMAN	sulfatase 2	800					bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|endometrium(4)|kidney(1)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	54						TGAGGACATCCCTGTCCAGTG	0.527																																					p.R800S		.											.	SULF2-293	0			c.G2400C						.						186.0	140.0	156.0					20																	46290611		2203	4300	6503	SO:0001583	missense	55959	exon18			GACATCCCTGTCC	AY101176	CCDS13408.1, CCDS13409.1, CCDS13409.2	20q13.12-q13.13	2008-05-14			ENSG00000196562	ENSG00000196562			20392	protein-coding gene	gene with protein product		610013				12368295	Standard	NM_018837		Approved	KIAA1247, HSULF-2, SULF-2	uc002xto.3	Q8IWU5	OTTHUMG00000032675	ENST00000359930.4:c.2400G>C	20.37:g.46290611C>G	ENSP00000353007:p.Arg800Ser	126	0		242	93	NM_001161841	1	1	334	710	374	E1P5U6|Q5JYE1|Q6UX86|Q96SG2|Q9H1H0|Q9UJR3|Q9ULH3	Missense_Mutation	SNP	ENST00000359930.4	37	CCDS13408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.63|15.63	2.890992|2.890992	0.52014|0.52014	.|.	.|.	ENSG00000196562|ENSG00000196562	ENST00000495544|ENST00000359930;ENST00000484875;ENST00000361612;ENST00000371978;ENST00000467815	.|D;D;D;D	.|0.96232	.|-3.95;-3.95;-3.95;-3.95	5.55|5.55	1.01|1.01	0.19927|0.19927	.|Alkaline-phosphatase-like, core domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95392|0.95392	0.8504|0.8504	L|L	0.41906|0.41906	1.305|1.305	0.45035|0.45035	D|D	0.998057|0.998057	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.91635	.|0.999;0.994	D|D	0.91353|0.91353	0.5106|0.5106	5|10	.|0.16896	.|T	.|0.51	-27.6784|-27.6784	7.5384|7.5384	0.27723|0.27723	0.0:0.4914:0.0:0.5086|0.0:0.4914:0.0:0.5086	.|.	.|800;800	.|Q8IWU5-2;Q8IWU5	.|.;SULF2_HUMAN	A|S	155|800;800;800;219;800	.|ENSP00000353007:R800S;ENSP00000418290:R800S;ENSP00000354662:R800S;ENSP00000418442:R800S	.|ENSP00000353007:R800S	G|R	-|-	2|3	0|2	SULF2|SULF2	45724018|45724018	0.074000|0.074000	0.21230|0.21230	0.982000|0.982000	0.44146|0.44146	0.500000|0.500000	0.33767|0.33767	-0.599000|-0.599000	0.05700|0.05700	0.318000|0.318000	0.23185|0.23185	0.462000|0.462000	0.41574|0.41574	GGG|AGG	.		0.527	SULF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079606.1	NM_018837	
APCDD1L	164284	hgsc.bcm.edu	37	20	57042377	57042377	+	Silent	SNP	G	G	A	rs6128351	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr20:57042377G>A	ENST00000371149.3	-	3	756	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	APCDD1L_ENST00000439429.1_Silent_p.L187L	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	176						integral component of membrane (GO:0016021)				large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			GCGCTCCGCAGCTCGTACAGC	0.781													G|||	181	0.0361422	0.0008	0.049	5008	,	,		8501	0.1329		0.0	False		,,,				2504	0.0123				p.L176L		.											.	APCDD1L-227	0			c.C526T						.						2.0	2.0	2.0					20																	57042377		1433	3021	4454	SO:0001819	synonymous_variant	164284	exon3			TCCGCAGCTCGTA	AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.526C>T	20.37:g.57042377G>A		0	0		7	7	NM_153360	0	0	0	0	0		Silent	SNP	ENST00000371149.3	37	CCDS13467.1																																																																																			G|0.973;A|0.027		0.781	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360	
TPTE	7179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	10914373	10914373	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr21:10914373C>T	ENST00000361285.4	-	21	1675	c.1346G>A	c.(1345-1347)gGa>gAa	p.G449E	TPTE_ENST00000342420.5_Missense_Mutation_p.G411E|TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.G431E	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	449	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CGAACATTTTCCTAATGAAAT	0.318																																					p.G449E		.											.	TPTE-344	0			c.G1346A						.						73.0	65.0	68.0					21																	10914373		2203	4298	6501	SO:0001583	missense	7179	exon21			CATTTTCCTAATG	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1346G>A	21.37:g.10914373C>T	ENSP00000355208:p.Gly449Glu	286	0		258	19	NM_199261	0	0	0	0	0	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	37	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	2.638	-0.284834	0.05605	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.84660	-1.88;-1.88;-1.88	2.15	-2.7	0.06004	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.681037	0.15081	U	0.281656	T	0.67534	0.2903	N	0.24115	0.695	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.002	B;B;B	0.16289	0.015;0.015;0.012	T	0.51148	-0.8742	10	0.27082	T	0.32	-1.8607	3.026	0.06091	0.0:0.3276:0.24:0.4324	.	411;431;449	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	E	431;449;411	ENSP00000298232:G431E;ENSP00000355208:G449E;ENSP00000344441:G411E	ENSP00000298232:G431E	G	-	2	0	TPTE	9936244	0.001000	0.12720	0.000000	0.03702	0.097000	0.18754	-0.145000	0.10265	-0.575000	0.05982	0.184000	0.17185	GGA	.		0.318	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
UMODL1	89766	ucsc.edu;bcgsc.ca	37	21	43547814	43547814	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr21:43547814T>C	ENST00000408910.2	+	20	3563	c.3563T>C	c.(3562-3564)aTt>aCt	p.I1188T	UMODL1_ENST00000400427.1_Missense_Mutation_p.I1244T|UMODL1_ENST00000400423.2_3'UTR|UMODL1_ENST00000400424.2_Missense_Mutation_p.I1116T|UMODL1_ENST00000408989.2_Missense_Mutation_p.I1316T	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	1188	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						ACCAACGTGATTGAGAACGGC	0.517																																					p.I1316T	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	.											.	UMODL1-93	0			c.T3947C						.						95.0	94.0	94.0					21																	43547814		2023	4201	6224	SO:0001583	missense	89766	exon19			ACGTGATTGAGAA		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.3563T>C	21.37:g.43547814T>C	ENSP00000386147:p.Ile1188Thr	163	3		148	124	NM_173568	0	0	0	0	0	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.563337	0.27915	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910;ENST00000434156	D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57	3.67	3.67	0.42095	Zona pellucida sperm-binding protein (3);	0.163924	0.28268	N	0.015971	D	0.86698	0.5995	L	0.49513	1.565	0.24885	N	0.992208	D;D	0.76494	0.998;0.999	D;D	0.70016	0.961;0.967	T	0.77948	-0.2396	9	.	.	.	-29.9057	11.9248	0.52812	0.0:0.0:0.0:1.0	.	1316;1188	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	T	1244;1116;1316;1188;73	ENSP00000383279:I1244T;ENSP00000383276:I1116T;ENSP00000386126:I1316T;ENSP00000386147:I1188T	.	I	+	2	0	UMODL1	42420883	0.997000	0.39634	0.659000	0.29680	0.054000	0.15201	4.465000	0.60141	1.905000	0.55150	0.459000	0.35465	ATT	.		0.517	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
KRTAP12-2	353323	bcgsc.ca	37	21	46086377	46086377	+	Missense_Mutation	SNP	A	A	G	rs2838622	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr21:46086377A>G	ENST00000360770.3	-	1	467	c.427T>C	c.(427-429)Tct>Cct	p.S143P	TSPEAR_ENST00000323084.4_Intron	NM_181684.2	NP_859012.1	P59991	KR122_HUMAN	keratin associated protein 12-2	143			S -> P (in dbSNP:rs2838622).			keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(1)|lung(3)	5						CAGCAGGAAGAGATACTGTAG	0.602													G|||	2918	0.582668	0.6967	0.5403	5008	,	,		19253	0.5655		0.492	False		,,,				2504	0.5695				p.S143P		.											.	.	0			c.T427C						.	G	,PRO/SER	2893,1387		1004,885,251	54.0	59.0	57.0		,427	1.8	0.0	21	dbSNP_100	57	3867,4609		924,2019,1295	yes	intron,missense	TSPEAR,KRTAP12-2	NM_144991.2,NM_181684.2	,74	1928,2904,1546	GG,GA,AA		45.6229,32.4065,47.0053	,benign	,143/147	46086377	6760,5996	2140	4238	6378	SO:0001583	missense	353323	exon1			AGGAAGAGATACT	AJ566389	CCDS42965.1	21q22.3	2006-03-13			ENSG00000221864	ENSG00000221864		"""Keratin associated proteins"""	20530	protein-coding gene	gene with protein product							Standard	NM_181684		Approved	KRTAP12.2, KAP12.2	uc002zfu.3	P59991	OTTHUMG00000057636	ENST00000360770.3:c.427T>C	21.37:g.46086377A>G	ENSP00000354001:p.Ser143Pro	363	5		345	11	NM_181684	0	0	0	0	0	A6NIS1|A6NMS9|Q0VAS4	Missense_Mutation	SNP	ENST00000360770.3	37	CCDS42965.1	1234	0.565018315018315	353	0.717479674796748	203	0.5607734806629834	303	0.5297202797202797	375	0.4947229551451187	g	0.003	-2.494097	0.00159	0.675935	0.456229	ENSG00000221864	ENST00000360770;ENST00000539483	T	0.02067	4.47	3.62	1.78	0.24846	.	.	.	.	.	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.15780	-1.0425	8	0.02654	T	1	.	5.8109	0.18465	0.3543:0.0:0.6457:0.0	rs2838622;rs61048872;rs2838622	143	P59991	KR122_HUMAN	P	143;93	ENSP00000354001:S143P	ENSP00000354001:S143P	S	-	1	0	KRTAP12-2	44910805	0.003000	0.15002	0.002000	0.10522	0.008000	0.06430	-0.301000	0.08232	-0.049000	0.13379	-0.355000	0.07637	TCT	A|0.429;G|0.571		0.602	KRTAP12-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128039.1	NM_181684	
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		0	0		10	10	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		0	0		12	12	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
ZNF280B	140883	bcgsc.ca	37	22	22842518	22842518	+	Silent	SNP	G	G	A	rs73156173	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr22:22842518G>A	ENST00000406426.1	-	4	1948	c.1206C>T	c.(1204-1206)ccC>ccT	p.P402P	ZNF280B_ENST00000360412.2_Silent_p.P402P			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GGCACACATAGGGCATTTCGC	0.423																																					p.P402P		.											.	ZNF280B-70	0			c.C1206T						.						125.0	118.0	120.0					22																	22842518		2203	4300	6503	SO:0001819	synonymous_variant	140883	exon4			CACATAGGGCATT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1206C>T	22.37:g.22842518G>A		266	7		264	13	NM_080764	0	0	0	0	0		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																			G|0.985;A|0.015		0.423	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
CX3CR1	1524	bcgsc.ca	37	3	39307256	39307256	+	Missense_Mutation	SNP	C	C	T	rs3732379	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr3:39307256C>T	ENST00000541347.1	-	2	984	c.745G>A	c.(745-747)Gtt>Att	p.V249I	CX3CR1_ENST00000542107.1_Missense_Mutation_p.V249I|CX3CR1_ENST00000358309.3_Missense_Mutation_p.V281I|CX3CR1_ENST00000399220.2_Missense_Mutation_p.V249I	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	249			V -> I (common polymorphism in Caucasian population; associated with a markedly reduced risk of acute coronary artery disease; associated with higher risk of developing ARMD12; chemotaxis of monocytes of individuals with homozygous Ile-249 and Met-280 genotypes is impaired in the presence of bound CX3CR1 protein; dbSNP:rs3732379). {ECO:0000269|PubMed:10731151, ECO:0000269|PubMed:11264153, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15208270, ECO:0000269|Ref.6}.		cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		AAAATCATAACGTTGTAGGGT	0.483													C|||	723	0.144369	0.0893	0.2378	5008	,	,		22318	0.0278		0.2853	False		,,,				2504	0.1278				p.V281I		.											.	CX3CR1-658	0			c.G841A	GRCh37	CM000504	CX3CR1	M	rs3732379	.	C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	515,3329		36,443,1443	112.0	115.0	114.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	745,745,841,745	-2.3	0.0	3	dbSNP_107	114	2281,5975		311,1659,2158	yes	missense,missense,missense,missense	CX3CR1	NM_001171171.1,NM_001171172.1,NM_001171174.1,NM_001337.3	29,29,29,29	347,2102,3601	TT,TC,CC		27.6284,13.3975,23.1074	benign,benign,benign,benign	249/356,249/356,281/388,249/356	39307256	2796,9304	1922	4128	6050	SO:0001583	missense	1524	exon2			TCATAACGTTGTA	BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.745G>A	3.37:g.39307256C>T	ENSP00000439140:p.Val249Ile	198	0		169	6	NM_001171174	0	0	1	1	0	A0N0N6|B2R5Z4|J3KP17	Missense_Mutation	SNP	ENST00000541347.1	37	CCDS43069.1	380	0.17399267399267399	55	0.11178861788617886	93	0.2569060773480663	20	0.03496503496503497	212	0.2796833773087071	C	0.008	-1.863526	0.00552	0.133975	0.276284	ENSG00000168329	ENST00000399220;ENST00000538756;ENST00000358309;ENST00000541347;ENST00000542107	T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4	5.77	-2.32	0.06745	GPCR, rhodopsin-like superfamily (1);	0.526611	0.21488	N	0.073733	T	0.00012	0.0000	N	0.10733	0.035	0.80722	P	0.0	B	0.19073	0.033	B	0.17433	0.018	T	0.11299	-1.0593	9	0.02654	T	1	.	12.3125	0.54935	0.0:0.3682:0.0:0.6318	rs3732379;rs17792918;rs52808794;rs59717546;rs3732379	249	P49238	CX3C1_HUMAN	I	249;257;281;249;249	ENSP00000382166:V249I;ENSP00000351059:V281I;ENSP00000439140:V249I;ENSP00000444928:V249I	ENSP00000351059:V281I	V	-	1	0	CX3CR1	39282260	0.000000	0.05858	0.000000	0.03702	0.225000	0.24961	-1.393000	0.02521	-0.555000	0.06142	-0.794000	0.03295	GTT	C|0.832;T|0.168		0.483	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343613.1	NM_001337	
FAM198A	729085	broad.mit.edu	37	3	43095101	43095101	+	Missense_Mutation	SNP	A	A	G	rs536119	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr3:43095101A>G	ENST00000430121.2	+	3	1474	c.1379A>G	c.(1378-1380)cAg>cGg	p.Q460R	KRBOX1_ENST00000443313.1_3'UTR	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	460			Q -> R (in dbSNP:rs536119). {ECO:0000269|PubMed:14702039}.			extracellular region (GO:0005576)				endometrium(1)	1						GAGAAATGCCAGAACCCAGCC	0.597													G|||	2710	0.541134	0.4644	0.6686	5008	,	,		16542	0.6696		0.5954	False		,,,				2504	0.3661				p.Q460R		.											.	FAM198A-68	0			c.A1379G						.	G	ARG/GLN	625,759		142,341,209	32.0	43.0	40.0		1379	0.7	1.0	3	dbSNP_83	40	1929,1253		582,765,244	yes	missense	FAM198A	NM_001129908.2	43	724,1106,453	GG,GA,AA		39.3777,45.159,44.0648	benign	460/576	43095101	2554,2012	692	1591	2283	SO:0001583	missense	729085	exon3			AATGCCAGAACCC	AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.1379A>G	3.37:g.43095101A>G	ENSP00000407301:p.Gln460Arg	162	1		134	4	NM_001129908	0	0	0	0	0	B3KR48	Missense_Mutation	SNP	ENST00000430121.2	37	CCDS46808.1	1315	0.6021062271062271	252	0.5121951219512195	253	0.6988950276243094	373	0.6520979020979021	437	0.5765171503957783	G	3.612	-0.079297	0.07141	0.45159	0.606223	ENSG00000144649	ENST00000488863;ENST00000430121	T;T	0.27104	1.69;1.69	5.62	0.681	0.17986	.	0.564021	0.18201	N	0.148503	T	0.00012	0.0000	N	0.00054	-2.38	0.58432	P	9.99999999995449E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36237	-0.9756	9	0.02654	T	1	-20.7108	6.9169	0.24365	0.322:0.1098:0.5682:0.0	rs536119;rs17469537;rs58673217;rs536119	31;460	F5H4W4;Q9UFP1	.;F198A_HUMAN	R	31;460	ENSP00000439905:Q31R;ENSP00000407301:Q460R	ENSP00000273146:Q460R	Q	+	2	0	FAM198A	43070105	0.469000	0.25846	0.965000	0.40720	0.817000	0.46193	0.166000	0.16583	-0.417000	0.07461	-0.974000	0.02594	CAG	T|0.179;G|0.318		0.597	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344240.3	NM_001129908	
VPRBP	9730	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	51457650	51457650	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr3:51457650G>C	ENST00000335891.5	-	7	1436	c.1427C>G	c.(1426-1428)tCt>tGt	p.S476C				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	925	Protein kinase-like.				B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		AGTAGGGGCAGAAGGCGCAGA	0.607																																					p.S872C		.											.	VPRBP-92	0			c.C2615G						.						54.0	58.0	57.0					3																	51457650		2067	4208	6275	SO:0001583	missense	9730	exon14			GGGGCAGAAGGCG	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.1427C>G	3.37:g.51457650G>C	ENSP00000338857:p.Ser476Cys	74	0		83	57	NM_014703	0	0	0	8	8	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	37		.	.	.	.	.	.	.	.	.	.	G	16.36	3.101950	0.56183	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.46063	0.88;0.88	5.92	5.92	0.95590	.	0.483859	0.24854	N	0.035067	T	0.49270	0.1547	L	0.50333	1.59	0.39689	D	0.971017	B	0.31581	0.329	B	0.39562	0.303	T	0.49224	-0.8962	10	0.62326	D	0.03	-0.4046	20.3214	0.98679	0.0:0.0:1.0:0.0	.	925	Q9Y4B6	VPRBP_HUMAN	C	496;476	ENSP00000393183:S496C;ENSP00000338857:S476C	ENSP00000338857:S476C	S	-	2	0	VPRBP	51432690	1.000000	0.71417	0.981000	0.43875	0.645000	0.38454	7.373000	0.79623	2.804000	0.96469	0.655000	0.94253	TCT	.		0.607	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		6	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
AMOTL2	51421	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	134089857	134089857	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr3:134089857C>A	ENST00000422605.2	-	2	585	c.419G>T	c.(418-420)aGt>aTt	p.S140I	AMOTL2_ENST00000511759.1_Intron|AMOTL2_ENST00000514516.1_Missense_Mutation_p.S198I|AMOTL2_ENST00000513145.1_Missense_Mutation_p.S140I|AMOTL2_ENST00000249883.5_Missense_Mutation_p.S140I			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	140					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)				endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						CTGCCTCCGACTGCCTCCCGG	0.692																																					p.S140I		.											.	AMOTL2-135	0			c.G419T						.						19.0	21.0	20.0					3																	134089857		2195	4286	6481	SO:0001583	missense	51421	exon2			CTCCGACTGCCTC	AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.419G>T	3.37:g.134089857C>A	ENSP00000409999:p.Ser140Ile	19	0		75	18	NM_016201	0	0	2	2	0	A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Missense_Mutation	SNP	ENST00000422605.2	37		.	.	.	.	.	.	.	.	.	.	C	10.54	1.377846	0.24944	.	.	ENSG00000114019	ENST00000249883;ENST00000422605;ENST00000514516;ENST00000513145;ENST00000510560;ENST00000504234;ENST00000505596	T;T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3;2.3	4.53	1.25	0.21368	.	0.911595	0.09608	N	0.779295	T	0.11580	0.0282	N	0.22421	0.69	0.09310	N	1	B;B;B	0.31351	0.115;0.32;0.214	B;B;B	0.34138	0.176;0.176;0.136	T	0.36065	-0.9763	10	0.42905	T	0.14	0.1858	5.19	0.15205	0.1295:0.5383:0.2523:0.0799	.	140;140;198	Q9Y2J4-3;Q9Y2J4-2;E9PHW3	.;.;.	I	140;140;198;140;140;140;140	ENSP00000249883:S140I;ENSP00000409999:S140I;ENSP00000424765:S198I;ENSP00000425475:S140I;ENSP00000427184:S140I;ENSP00000424910:S140I	ENSP00000249883:S140I	S	-	2	0	AMOTL2	135572547	0.000000	0.05858	0.002000	0.10522	0.569000	0.35902	-0.528000	0.06193	-0.022000	0.13986	0.462000	0.41574	AGT	.		0.692	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000358149.1	NM_016201	
NAALADL2	254827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	174814615	174814615	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr3:174814615C>T	ENST00000454872.1	+	2	207	c.79C>T	c.(79-81)Caa>Taa	p.Q27*	NAALADL2_ENST00000473253.1_3'UTR|NAALADL2-AS3_ENST00000453180.1_RNA	NM_207015.2	NP_996898.2	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 2	27						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(20)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	49	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		CCATGCAGATCAAAGAGCTCC	0.378																																					p.Q27X		.											.	NAALADL2-47	0			c.C79T						.						40.0	36.0	37.0					3																	174814615		1871	4110	5981	SO:0001587	stop_gained	254827	exon2			GCAGATCAAAGAG		CCDS46960.1	3q26.3	2011-08-16			ENSG00000177694	ENSG00000177694			23219	protein-coding gene	gene with protein product	"""glutamate carboxypeptidase II-type non-peptidase homologue"""	608806				15168106	Standard	NM_207015		Approved		uc003fir.3	Q58DX5	OTTHUMG00000157120	ENST00000454872.1:c.79C>T	3.37:g.174814615C>T	ENSP00000404705:p.Gln27*	131	0		131	102	NM_207015	0	0	0	0	0	Q658X9|Q6H9J8|Q6H9J9|Q6PG38	Nonsense_Mutation	SNP	ENST00000454872.1	37	CCDS46960.1	.	.	.	.	.	.	.	.	.	.	C	35	5.431105	0.96150	.	.	ENSG00000177694	ENST00000434257;ENST00000454872	.	.	.	5.72	4.84	0.62591	.	0.259532	0.27495	N	0.019112	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-2.9467	14.1142	0.65142	0.2735:0.7265:0.0:0.0	.	.	.	.	X	10;27	.	ENSP00000409858:Q10X	Q	+	1	0	NAALADL2	176297309	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	1.859000	0.39418	1.531000	0.49152	0.650000	0.86243	CAA	.		0.378	NAALADL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347390.2	NM_207015	
SH3BP2	6452	bcgsc.ca	37	4	2826400	2826400	+	Silent	SNP	T	T	C	rs3213501	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr4:2826400T>C	ENST00000356331.5	+	4	561	c.300T>C	c.(298-300)caT>caC	p.H100H	SH3BP2_ENST00000511747.1_Silent_p.H100H|SH3BP2_ENST00000435136.2_Silent_p.H100H|SH3BP2_ENST00000503393.2_Silent_p.H157H|SH3BP2_ENST00000452765.2_Silent_p.H100H|SH3BP2_ENST00000515183.1_3'UTR|SH3BP2_ENST00000442312.2_Silent_p.H128H	NM_003023.4	NP_003014.3	P78314	3BP2_HUMAN	SH3-domain binding protein 2	100	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		AGATCATCCATATCAGCAAGA	0.627									Cherubism				c|||	3944	0.78754	0.9871	0.8271	5008	,	,		20468	0.5546		0.7197	False		,,,				2504	0.7996				p.H157H		.											.	SH3BP2-514	0			c.T471C						.	C	,,,	4153,253	145.4+/-180.2	1962,229,12	101.0	94.0	96.0		300,384,471,300	3.8	1.0	4	dbSNP_106	96	6215,2385	396.3+/-345.4	2270,1675,355	yes	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SH3BP2	NM_001122681.1,NM_001145855.1,NM_001145856.1,NM_003023.4	,,,	4232,1904,367	CC,CT,TT		27.7326,5.7422,20.2829	,,,	100/562,128/590,157/619,100/562	2826400	10368,2638	2203	4300	6503	SO:0001819	synonymous_variant	6452	exon4	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	CATCCATATCAGC	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000356331.5:c.300T>C	4.37:g.2826400T>C		80	0		116	6	NM_001145856	0	0	4	4	0	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Silent	SNP	ENST00000356331.5	37	CCDS33944.1																																																																																			T|0.225;C|0.775		0.627	SH3BP2-007	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000362406.2	NM_003023	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	0	0		21	21	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
PCDH7	5099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	30725207	30725207	+	Silent	SNP	C	C	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr4:30725207C>A	ENST00000361762.2	+	1	3171	c.2163C>A	c.(2161-2163)ccC>ccA	p.P721P	PCDH7_ENST00000543491.1_Silent_p.P721P	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	721	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GAGATCCTCCCAGATCTGCCA	0.468																																					p.P721P		.											.	PCDH7-229	0			c.C2163A						.						101.0	96.0	98.0					4																	30725207		2203	4300	6503	SO:0001819	synonymous_variant	5099	exon1			TCCTCCCAGATCT	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2163C>A	4.37:g.30725207C>A		147	0		189	79	NM_032457	0	0	0	0	0	O60246|O60247|Q4W5C4	Silent	SNP	ENST00000361762.2	37	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	C	2.552	-0.303954	0.05495	.	.	ENSG00000169851	ENST00000511884	.	.	.	5.25	2.32	0.28847	.	.	.	.	.	T	0.54598	0.1868	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47598	-0.9105	4	.	.	.	.	6.7579	0.23524	0.2159:0.6171:0.0:0.167	.	.	.	.	K	411	.	.	Q	+	1	0	PCDH7	30334305	0.062000	0.20869	0.881000	0.34555	0.986000	0.74619	-0.416000	0.07097	0.762000	0.33152	0.655000	0.94253	CAG	.		0.468	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
NMU	10874	hgsc.bcm.edu	37	4	56502307	56502307	+	Missense_Mutation	SNP	G	G	T	rs3828555	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr4:56502307G>T	ENST00000264218.3	-	1	158	c.53C>A	c.(52-54)gCg>gAg	p.A18E	NMU_ENST00000515325.1_Intron|NMU_ENST00000507338.1_Missense_Mutation_p.A18E|NMU_ENST00000511469.1_Missense_Mutation_p.A18E|NMU_ENST00000505262.1_Missense_Mutation_p.A18E	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	18					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		cGGGGACGCCGCGGCCACCTG	0.761													G|||	730	0.145767	0.0764	0.2003	5008	,	,		10197	0.3343		0.0199	False		,,,				2504	0.136				p.A18E		.											.	NMU-650	0			c.C53A						.	G	GLU/ALA	168,3058		3,162,1448	5.0	7.0	6.0		53	0.1	0.0	4	dbSNP_107	6	138,5846		0,138,2854	no	missense	NMU	NM_006681.2	107	3,300,4302	TT,TG,GG		2.3061,5.2077,3.3225	probably-damaging	18/175	56502307	306,8904	1613	2992	4605	SO:0001583	missense	10874	exon1			GACGCCGCGGCCA	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.53C>A	4.37:g.56502307G>T	ENSP00000264218:p.Ala18Glu	0	0		12	5	NM_006681	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	315	0.14423076923076922	55	0.11178861788617886	55	0.15193370165745856	187	0.3269230769230769	18	0.023746701846965697	G	17.40	3.379938	0.61845	0.052077	0.023061	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.35973	1.28;1.42;1.4;1.39	2.89	0.0796	0.14417	.	1.355690	0.05554	U	0.568010	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	P	0.38827	0.649	B	0.37015	0.239	T	0.31110	-0.9955	9	0.62326	D	0.03	-4.4644	5.3309	0.15932	0.4241:0.0:0.5759:0.0	rs3828555	18	P48645	NMU_HUMAN	E	18	ENSP00000422399:A18E;ENSP00000264218:A18E;ENSP00000424246:A18E;ENSP00000422870:A18E	ENSP00000264218:A18E	A	-	2	0	NMU	56197064	0.000000	0.05858	0.003000	0.11579	0.256000	0.26092	0.190000	0.17057	-0.022000	0.13986	0.195000	0.17529	GCG	G|0.853;T|0.147		0.761	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
RASGEF1B	153020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	82366716	82366716	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr4:82366716T>G	ENST00000264400.2	-	8	1043	c.892A>C	c.(892-894)Aac>Cac	p.N298H	RASGEF1B_ENST00000509081.1_Missense_Mutation_p.N297H|RASGEF1B_ENST00000335927.7_Missense_Mutation_p.N256H	NM_152545.1	NP_689758.1	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	298	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			endometrium(2)|kidney(5)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	26						TTGCCAATGTTAAAACACTCC	0.393																																					p.N298H		.											.	RASGEF1B-227	0			c.A892C						.						141.0	146.0	145.0					4																	82366716		2203	4300	6503	SO:0001583	missense	153020	exon8			CAATGTTAAAACA	AK056257	CCDS34022.1, CCDS75151.1, CCDS75152.1	4q21.21	2013-09-24				ENSG00000138670			24881	protein-coding gene	gene with protein product		614532				12488504	Standard	XM_005262776		Approved	GPIG4, FLJ31695	uc003hmi.1	Q0VAM2		ENST00000264400.2:c.892A>C	4.37:g.82366716T>G	ENSP00000264400:p.Asn298His	117	0		139	58	NM_152545	0	0	0	0	0	Q0VAM1|Q4W5L7|Q4W5M3|Q96MY8	Missense_Mutation	SNP	ENST00000264400.2	37	CCDS34022.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.579053	0.86645	.	.	ENSG00000138670	ENST00000509081;ENST00000264400;ENST00000335927;ENST00000504863	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.3	5.3	0.74995	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.54319	0.1851	M	0.72479	2.2	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.72982	0.965;0.972;0.979	T	0.56463	-0.7975	10	0.54805	T	0.06	.	15.0681	0.72011	0.0:0.0:0.0:1.0	.	256;297;298	Q0VAM2-2;Q0VAM2-3;Q0VAM2	.;.;RGF1B_HUMAN	H	297;298;256;143	ENSP00000425393:N297H;ENSP00000264400:N298H;ENSP00000338437:N256H;ENSP00000426929:N143H	ENSP00000264400:N298H	N	-	1	0	RASGEF1B	82585740	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.513000	0.81739	2.216000	0.71823	0.533000	0.62120	AAC	.		0.393	RASGEF1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362830.1	NM_152545	
COQ2	27235	hgsc.bcm.edu	37	4	84205872	84205872	+	Missense_Mutation	SNP	C	C	A	rs6818847	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr4:84205872C>A	ENST00000311469.4	-	1	195	c.196G>T	c.(196-198)Gtg>Ttg	p.V66L	COQ2_ENST00000439031.2_Missense_Mutation_p.V29L|COQ2_ENST00000311461.7_Missense_Mutation_p.V16L	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	16					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				GCCAGTGCCACAGCCCGCAGG	0.766													C|||	3254	0.64976	0.3775	0.647	5008	,	,		9689	0.8879		0.7227	False		,,,				2504	0.6994				p.V66L		.											.	COQ2-92	0			c.G196T						.	C	LEU/VAL	1570,1290		474,622,334	2.0	3.0	3.0		196	-2.7	0.0	4	dbSNP_116	3	4779,1627		1892,995,316	no	missense	COQ2	NM_015697.7	32	2366,1617,650	AA,AC,CC		25.3981,45.1049,31.4807	benign	66/422	84205872	6349,2917	1430	3203	4633	SO:0001583	missense	27235	exon1			GTGCCACAGCCCG		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.196G>T	4.37:g.84205872C>A	ENSP00000310873:p.Val66Leu	0	0		8	7	NM_015697	0	0	0	0	0	O95331|Q1JQ78|Q684R2	Missense_Mutation	SNP	ENST00000311469.4	37	CCDS47090.2	1475	0.6753663003663004	219	0.4451219512195122	244	0.6740331491712708	490	0.8566433566433567	522	0.6886543535620053	C	5.506	0.278257	0.10403	0.548951	0.746019	ENSG00000173085	ENST00000311469;ENST00000439031;ENST00000311461	T;T;T	0.77098	-1.07;-1.03;-1.0	3.59	-2.74	0.05932	.	2.205390	0.02429	N	0.083323	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	8	0.07813	T	0.8	-2.056	4.7989	0.13287	0.0:0.2608:0.3311:0.4081	rs6818847;rs17850399;rs17858544	16	E2QRG7	.	L	66;29;16	ENSP00000310873:V66L;ENSP00000409275:V29L;ENSP00000311835:V16L	ENSP00000311835:V16L	V	-	1	0	COQ2	84424896	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.921000	0.01569	-0.746000	0.04766	0.467000	0.42956	GTG	C|0.324;A|0.676		0.766	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
DSPP	1834	bcgsc.ca	37	4	88537126	88537126	+	Silent	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr4:88537126C>T	ENST00000282478.7	+	4	3345	c.3312C>T	c.(3310-3312)gaC>gaT	p.D1104D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1104D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1104	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagcgacagcagcgata	0.542																																					p.D1104D		.											.	DSPP-90	0			c.C3312T						.						13.0	18.0	17.0					4																	88537126		1133	2209	3342	SO:0001819	synonymous_variant	1834	exon5			CAGCGACAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3312C>T	4.37:g.88537126C>T		164	3		346	28	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.542	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5140632	5140632	+	Silent	SNP	T	T	C	rs270208	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:5140632T>C	ENST00000274181.7	+	1	190	c.52T>C	c.(52-54)Ttg>Ctg	p.L18L	ADAMTS16_ENST00000511368.1_Silent_p.L18L|CTD-2297D10.2_ENST00000512155.1_RNA|CTD-2297D10.1_ENST00000514848.1_RNA	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	18					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTGGATGCTGTTGGCGCAGGT	0.766													C|||	3127	0.624401	0.6747	0.6571	5008	,	,		8861	0.8065		0.501	False		,,,				2504	0.4724				p.L18L		.											.	ADAMTS16-275	0			c.T52C						.	C		2046,874		775,496,189	2.0	5.0	4.0		52	1.2	1.0	5	dbSNP_79	4	3653,3047		1121,1411,818	no	coding-synonymous	ADAMTS16	NM_139056.2		1896,1907,1007	CC,CT,TT		45.4776,29.9315,40.7588		18/1225	5140632	5699,3921	1460	3350	4810	SO:0001819	synonymous_variant	170690	exon1			ATGCTGTTGGCGC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.52T>C	5.37:g.5140632T>C		0	0		6	4	NM_139056	0	0	0	0	0	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																			T|0.352;C|0.648		0.766	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
MAST4	375449	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	66429340	66429340	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:66429340A>G	ENST00000403625.2	+	17	2388		c.e17-1		MAST4_ENST00000403666.1_Splice_Site|MAST4_ENST00000261569.7_Splice_Site|MAST4_ENST00000405643.1_Splice_Site|MAST4_ENST00000404260.3_Splice_Site	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4							cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCTGCCTCATAGCTTGTTGGT	0.398																																					.		.											.	MAST4-647	0			c.2094-2A>G						.						161.0	159.0	159.0					5																	66429340		1911	4125	6036	SO:0001630	splice_region_variant	375449	exon17			CCTCATAGCTTGT	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.2094-1A>G	5.37:g.66429340A>G		159	0		251	41	NM_001164664	0	0	0	0	0	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Splice_Site	SNP	ENST00000403625.2	37	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.623899	0.87460	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5827	0.76459	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAST4	66465096	1.000000	0.71417	0.987000	0.45799	0.955000	0.61496	9.287000	0.95975	2.141000	0.66446	0.460000	0.39030	.	.		0.398	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		Intron
PDE8B	8622	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	76717663	76717663	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:76717663T>G	ENST00000264917.5	+	20	2313	c.2268T>G	c.(2266-2268)tgT>tgG	p.C756W	PDE8B_ENST00000340978.3_Missense_Mutation_p.C709W|PDE8B_ENST00000333194.4_Missense_Mutation_p.C701W|PDE8B_ENST00000346042.3_Missense_Mutation_p.C659W|PDE8B_ENST00000342343.4_Missense_Mutation_p.C736W|PDE8B_ENST00000505283.1_Missense_Mutation_p.C221W	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	756	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	GCAGCGACTGTGAATGCAACC	0.512																																					p.C756W		.											.	PDE8B-90	0			c.T2268G						.						105.0	93.0	97.0					5																	76717663		2203	4300	6503	SO:0001583	missense	8622	exon20			CGACTGTGAATGC	AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.2268T>G	5.37:g.76717663T>G	ENSP00000264917:p.Cys756Trp	173	1		278	36	NM_003719	0	0	16	17	1	Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Missense_Mutation	SNP	ENST00000264917.5	37	CCDS4037.1	.	.	.	.	.	.	.	.	.	.	T	15.30	2.791326	0.50102	.	.	ENSG00000113231	ENST00000340978;ENST00000346042;ENST00000264917;ENST00000342343;ENST00000333194;ENST00000505283	T;T;T;T;T;T	0.71222	-0.43;-0.43;-0.55;-0.55;-0.4;-0.46	5.18	1.47	0.22746	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.742908	0.13927	N	0.353163	T	0.66376	0.2783	N	0.17631	0.505	0.80722	D	1	P;P;P;P;P	0.47841	0.796;0.88;0.88;0.88;0.901	B;P;P;P;P	0.56343	0.267;0.694;0.753;0.694;0.796	T	0.59337	-0.7473	10	0.38643	T	0.18	.	9.6624	0.39962	0.0:0.3777:0.0:0.6223	.	659;709;701;736;756	O95263-2;O95263-6;O95263-3;O95263-4;O95263	.;.;.;.;PDE8B_HUMAN	W	709;659;756;736;701;221	ENSP00000345446:C709W;ENSP00000330428:C659W;ENSP00000264917:C756W;ENSP00000345646:C736W;ENSP00000331336:C701W;ENSP00000423461:C221W	ENSP00000264917:C756W	C	+	3	2	PDE8B	76753419	0.999000	0.42202	0.999000	0.59377	0.994000	0.84299	0.539000	0.23175	0.106000	0.17784	0.533000	0.62120	TGT	.		0.512	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000220015.3	NM_003719	
ADAMTS19	171019	broad.mit.edu;bcgsc.ca	37	5	129037114	129037114	+	Silent	SNP	A	A	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:129037114A>T	ENST00000274487.4	+	20	3115	c.2970A>T	c.(2968-2970)cgA>cgT	p.R990R	CTC-575N7.1_ENST00000503616.1_RNA|ADAMTS19_ENST00000509467.1_3'UTR	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	990	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CTTGTTCACGAACTTGTGGAA	0.458																																					p.R990R		.											.	ADAMTS19-295	0			c.A2970T						.						117.0	110.0	112.0					5																	129037114		2203	4300	6503	SO:0001819	synonymous_variant	171019	exon20			TTCACGAACTTGT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2970A>T	5.37:g.129037114A>T		250	0		348	9	NM_133638	0	0	0	0	0		Silent	SNP	ENST00000274487.4	37	CCDS4146.1																																																																																			.		0.458	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	0	0		11	11	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PCDHB2	56133	broad.mit.edu	37	5	140476411	140476411	+	Silent	SNP	A	A	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:140476411A>C	ENST00000194155.4	+	1	2185	c.2037A>C	c.(2035-2037)gcA>gcC	p.A679A		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	679					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.A679A(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGAGGCGGCACCGGCCCAGG	0.687																																					p.A679A		.											.	PCDHB2-96	1	Substitution - coding silent(1)	lung(1)	c.A2037C						.						65.0	67.0	66.0					5																	140476411		2178	4247	6425	SO:0001819	synonymous_variant	56133	exon1			GGCGGCACCGGCC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2037A>C	5.37:g.140476411A>C		45	1		233	11	NM_018936	0	0	17	17	0	Q4KMU1	Silent	SNP	ENST00000194155.4	37	CCDS4244.1																																																																																			.		0.687	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PCDHGA7	56108	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140764326	140764326	+	Silent	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:140764326G>T	ENST00000518325.1	+	1	1860	c.1860G>T	c.(1858-1860)ggG>ggT	p.G620G	PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	620	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGCGGTTGGGCTGTACACGG	0.642																																					p.G620G		.											.	.	0			c.G1860T						.						46.0	54.0	51.0					5																	140764326		2203	4300	6503	SO:0001819	synonymous_variant	56108	exon1			GGTTGGGCTGTAC	AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.1860G>T	5.37:g.140764326G>T		222	1		407	67	NM_032087	0	0	2	10	8	B2RN87|Q9Y5D0	Silent	SNP	ENST00000518325.1	37	CCDS54927.1																																																																																			.		0.642	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374744.1	NM_018920	
FLT4	2324	broad.mit.edu;bcgsc.ca	37	5	180048668	180048668	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:180048668G>T	ENST00000261937.6	-	13	1972	c.1894C>A	c.(1894-1896)Cgc>Agc	p.R632S	FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000502649.1_Missense_Mutation_p.R632S|FLT4_ENST00000393347.3_Missense_Mutation_p.R632S	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	632	Ig-like C2-type 6.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTGGCGTGGCGCGCCCCAGGT	0.677																																					p.R632S	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4-1490	0			c.C1894A						.						26.0	25.0	26.0					5																	180048668		2200	4294	6494	SO:0001583	missense	2324	exon13			CGTGGCGCGCCCC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1894C>A	5.37:g.180048668G>T	ENSP00000261937:p.Arg632Ser	50	1		303	130	NM_182925	0	0	5	5	0	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	G	12.05	1.823083	0.32237	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.40756	1.02;1.02;1.02	4.57	2.59	0.31030	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	.	.	.	.	T	0.33440	0.0863	L	0.44542	1.39	0.09310	N	1	P;B;B;B	0.40083	0.702;0.079;0.025;0.044	B;B;B;B	0.41374	0.355;0.125;0.125;0.176	T	0.10870	-1.0611	9	0.06494	T	0.89	.	12.1317	0.53946	0.0:0.0:0.5612:0.4388	.	632;442;632;632	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	S	632;632;632;442	ENSP00000261937:R632S;ENSP00000377016:R632S;ENSP00000426057:R632S	ENSP00000261937:R632S	R	-	1	0	FLT4	179981274	0.116000	0.22171	0.740000	0.30986	0.626000	0.37791	0.548000	0.23314	1.030000	0.39839	0.511000	0.50034	CGC	.		0.677	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
SLC44A4	80736	bcgsc.ca	37	6	31842598	31842598	+	Missense_Mutation	SNP	T	T	A	rs12661281	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr6:31842598T>A	ENST00000229729.6	-	6	388	c.368A>T	c.(367-369)gAc>gTc	p.D123V	SLC44A4_ENST00000375562.4_Intron|SLC44A4_ENST00000465707.1_5'UTR|SLC44A4_ENST00000544672.1_Missense_Mutation_p.D47V	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	123			D -> V (in dbSNP:rs12661281).		acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	AGTCCATGGGTCCTCCGGGCA	0.542													T|||	473	0.0944489	0.0068	0.183	5008	,	,		20016	0.1022		0.1491	False		,,,				2504	0.0859				p.D123V		.											.	SLC44A4-156	0			c.A368T						.	T	,VAL/ASP,VAL/ASP	127,4279	93.4+/-132.2	1,125,2077	71.0	75.0	73.0		,140,368	-9.7	0.0	6	dbSNP_120	73	1322,7278	261.2+/-283.7	90,1142,3068	yes	intron,missense,missense	SLC44A4	NM_001178044.1,NM_001178045.1,NM_025257.2	,152,152	91,1267,5145	AA,AT,TT		15.3721,2.8824,11.141	,benign,benign	,47/635,123/711	31842598	1449,11557	2203	4300	6503	SO:0001583	missense	80736	exon6			CATGGGTCCTCCG	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.368A>T	6.37:g.31842598T>A	ENSP00000229729:p.Asp123Val	132	1		85	5	NM_025257	0	0	4	4	0	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	37	CCDS4724.2	248|248	0.11355311355311355|0.11355311355311355	6|6	0.012195121951219513|0.012195121951219513	67|67	0.1850828729281768|0.1850828729281768	69|69	0.12062937062937062|0.12062937062937062	106|106	0.13984168865435356|0.13984168865435356	T|T	11.13|11.13	1.549042|1.549042	0.27652|0.27652	0.028824|0.028824	0.153721|0.153721	ENSG00000204385|ENSG00000204385	ENST00000229729;ENST00000544672|ENST00000414427	T;T|.	0.18657|.	2.2;2.2|.	4.9|4.9	-9.67|-9.67	0.00531|0.00531	.|.	3.055490|.	0.00649|.	N|.	0.000555|.	T|T	0.06872|0.06872	0.0175|0.0175	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.13710|0.13710	-1.0499|-1.0499	9|4	0.49607|.	T|.	0.09|.	-27.1204|-27.1204	10.1697|10.1697	0.42902|0.42902	0.075:0.0:0.3333:0.5917|0.075:0.0:0.3333:0.5917	rs12661281;rs52792968;rs12661281|rs12661281;rs52792968;rs12661281	123|.	Q53GD3|.	CTL4_HUMAN|.	V|S	123;47|119	ENSP00000229729:D123V;ENSP00000444109:D47V|.	ENSP00000229729:D123V|.	D|T	-|-	2|1	0|0	SLC44A4|SLC44A4	31950577|31950577	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.103000|0.103000	0.19146|0.19146	-3.226000|-3.226000	0.00550|0.00550	-2.288000|-2.288000	0.00668|0.00668	-0.144000|-0.144000	0.13903|0.13903	GAC|ACC	T|0.871;A|0.129		0.542	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3		
B3GAT2	135152	hgsc.bcm.edu	37	6	71665731	71665731	+	Silent	SNP	C	C	T	rs149577161	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr6:71665731C>T	ENST00000230053.6	-	1	1010	c.402G>A	c.(400-402)ggG>ggA	p.G134G		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	134					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						TGCTGGGCAGCCCGGCCCGCG	0.756													C|||	17	0.00339457	0.0008	0.0072	5008	,	,		10988	0.0		0.0099	False		,,,				2504	0.001				p.G134G		.											.	B3GAT2-93	0			c.G402A						.	C		15,4123		0,15,2054	5.0	6.0	6.0		402	2.4	1.0	6	dbSNP_134	6	94,7904		0,94,3905	no	coding-synonymous	B3GAT2	NM_080742.2		0,109,5959	TT,TC,CC		1.1753,0.3625,0.8982		134/324	71665731	109,12027	2069	3999	6068	SO:0001819	synonymous_variant	135152	exon1			GGGCAGCCCGGCC	AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.402G>A	6.37:g.71665731C>T		0	0		19	16	NM_080742	0	0	0	0	0	Q5JS09|Q8TF38|Q96NK4	Silent	SNP	ENST00000230053.6	37	CCDS4974.1																																																																																			C|0.993;T|0.007		0.756	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742	
RARS2	57038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	88229355	88229355	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr6:88229355C>G	ENST00000369536.5	-	14	1228	c.1183G>C	c.(1183-1185)Gat>Cat	p.D395H	RARS2_ENST00000497828.1_5'Flank	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	395					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		TTTAAAACATCTTCCAGGAAA	0.388																																					p.D395H		.											.	RARS2-92	0			c.G1183C						.						124.0	115.0	118.0					6																	88229355		2203	4300	6503	SO:0001583	missense	57038	exon14			AAACATCTTCCAG	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.1183G>C	6.37:g.88229355C>G	ENSP00000358549:p.Asp395His	205	0		147	104	NM_020320	0	0	0	43	43	B2RDT7|Q96FU5|Q9H8K8	Missense_Mutation	SNP	ENST00000369536.5	37	CCDS5011.1	.	.	.	.	.	.	.	.	.	.	C	31	5.086235	0.94100	.	.	ENSG00000146282	ENST00000369536	T	0.70631	-0.5	5.97	5.97	0.96955	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	D	0.86806	0.6021	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88034	0.2777	10	0.87932	D	0	.	20.4324	0.99085	0.0:1.0:0.0:0.0	.	395;220	Q5T160;E1P510	SYRM_HUMAN;.	H	395	ENSP00000358549:D395H	ENSP00000358549:D395H	D	-	1	0	RARS2	88286074	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.158000	0.77470	2.833000	0.97629	0.585000	0.79938	GAT	.		0.388	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041448.1	NM_020320	
NUS1	116150	broad.mit.edu;bcgsc.ca	37	6	118015275	118015275	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr6:118015275G>C	ENST00000368494.3	+	3	792	c.623G>C	c.(622-624)tGc>tCc	p.C208S		NM_138459.3	NP_612468.1	Q96E22	NGBR_HUMAN	nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae)	208					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|intracellular cholesterol transport (GO:0032367)|protein glycosylation (GO:0006486)|sterol homeostasis (GO:0055092)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|prostate(2)	8		all_cancers(87;0.0395)|all_epithelial(87;0.0301)		GBM - Glioblastoma multiforme(226;0.02)|OV - Ovarian serous cystadenocarcinoma(136;0.115)|all cancers(137;0.146)		CAGGACTTTTGCCAGTTAGTA	0.363																																					p.C208S		.											.	NUS1-108	0			c.G623C						.						105.0	109.0	107.0					6																	118015275		2203	4300	6503	SO:0001583	missense	116150	exon3			ACTTTTGCCAGTT	BC013026	CCDS5118.1	6q22.1	2012-12-13	2006-11-24	2006-11-24	ENSG00000153989	ENSG00000153989			21042	protein-coding gene	gene with protein product	"""Nogo-B receptor"", ""transport and golgi organization 14 homolog (Drosophila)"""	610463	"""chromosome 6 open reading frame 68"""	C6orf68			Standard	NM_138459		Approved	MGC7199, NgBR, TANGO14	uc003pxw.3	Q96E22	OTTHUMG00000015458	ENST00000368494.3:c.623G>C	6.37:g.118015275G>C	ENSP00000357480:p.Cys208Ser	213	0		227	17	NM_138459	0	0	42	42	0	B2RWQ4|O00251	Missense_Mutation	SNP	ENST00000368494.3	37	CCDS5118.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.041445	0.75732	.	.	ENSG00000153989	ENST00000368494	T	0.16897	2.31	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.27866	0.0686	L	0.42686	1.345	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.01652	-1.1303	10	0.52906	T	0.07	-14.1694	18.8944	0.92417	0.0:0.0:1.0:0.0	.	208	Q96E22	NGBR_HUMAN	S	208	ENSP00000357480:C208S	ENSP00000357480:C208S	C	+	2	0	NUS1	118121968	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.523000	0.73787	2.537000	0.85549	0.650000	0.86243	TGC	.		0.363	NUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041989.1	NM_138459	
SMOC2	64094	hgsc.bcm.edu	37	6	168842113	168842113	+	Silent	SNP	T	T	G	rs73270928	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr6:168842113T>G	ENST00000356284.2	+	1	283	c.63T>G	c.(61-63)gcT>gcG	p.A21A	SMOC2_ENST00000354536.5_Silent_p.A21A	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2	21					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		CGGTGCCCGCTCAGAAGTTCT	0.751													G|||	1980	0.395367	0.5787	0.2839	5008	,	,		9314	0.4593		0.167	False		,,,				2504	0.3957				p.A21A		.											.	SMOC2-91	0			c.T63G						.	G	,	924,2074		89,746,664	2.0	3.0	3.0		63,63	-0.4	1.0	6	dbSNP_131	3	645,5799		34,577,2611	no	coding-synonymous,coding-synonymous	SMOC2	NM_001166412.1,NM_022138.2	,	123,1323,3275	GG,GT,TT		10.0093,30.8205,16.6172	,	21/447,21/458	168842113	1569,7873	1499	3222	4721	SO:0001819	synonymous_variant	64094	exon1			GCCCGCTCAGAAG	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.63T>G	6.37:g.168842113T>G		2	0		55	11	NM_022138	0	0	0	0	0	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Silent	SNP	ENST00000356284.2	37	CCDS55076.1																																																																																			T|0.654;G|0.346		0.751	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	0	0		10	5	NM_032172	0	0	0	3	3	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
SCIN	85477	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	12664641	12664641	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr7:12664641G>C	ENST00000297029.5	+	6	867	c.766G>C	c.(766-768)Gat>Cat	p.D256H	SCIN_ENST00000445618.2_Missense_Mutation_p.D9H|SCIN_ENST00000473722.1_3'UTR|SCIN_ENST00000519209.1_Missense_Mutation_p.D9H	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	256	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		TTAGGTTTCAGATGCAAGTGG	0.413																																					p.D256H		.											.	SCIN-24	0			c.G766C						.						42.0	44.0	43.0					7																	12664641		1886	4126	6012	SO:0001583	missense	85477	exon6			GTTTCAGATGCAA	AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.766G>C	7.37:g.12664641G>C	ENSP00000297029:p.Asp256His	78	0		106	7	NM_001112706	0	0	0	0	0	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	ENST00000297029.5	37	CCDS47545.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.683318	0.68157	.	.	ENSG00000006747	ENST00000297029;ENST00000523729;ENST00000519209;ENST00000445618	T;T;T;T	0.30182	1.54;2.18;1.54;1.54	5.53	5.53	0.82687	.	0.101660	0.64402	D	0.000004	T	0.65026	0.2652	M	0.90082	3.085	0.58432	D	0.999999	D	0.76494	0.999	D	0.71414	0.973	T	0.71846	-0.4469	10	0.87932	D	0	-29.6195	19.8304	0.96632	0.0:0.0:1.0:0.0	.	256	Q9Y6U3	ADSV_HUMAN	H	256;97;9;9	ENSP00000297029:D256H;ENSP00000429598:D97H;ENSP00000430997:D9H;ENSP00000390189:D9H	ENSP00000297029:D256H	D	+	1	0	SCIN	12631166	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	6.375000	0.73137	2.775000	0.95449	0.585000	0.79938	GAT	.		0.413	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326041.1	NM_033128	
AMPH	273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	38500996	38500996	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr7:38500996G>A	ENST00000356264.2	-	11	1119	c.904C>T	c.(904-906)Cct>Tct	p.P302S	AMPH_ENST00000325590.5_Missense_Mutation_p.P302S|AMPH_ENST00000428293.2_Missense_Mutation_p.P302S	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	302					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GGTGGGACAGGAGGCCCTTTC	0.448																																					p.P302S		.											.	AMPH-95	0			c.C904T						.						155.0	155.0	155.0					7																	38500996		2203	4300	6503	SO:0001583	missense	273	exon11			GGACAGGAGGCCC		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.904C>T	7.37:g.38500996G>A	ENSP00000348602:p.Pro302Ser	150	0		260	54	NM_139316	0	0	0	0	0	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	37	CCDS5456.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.607372|4.607372	0.87157|0.87157	.|.	.|.	ENSG00000078053|ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242;ENST00000544070|ENST00000441628	T;T;T|.	0.42131|.	0.98;0.98;0.98|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76828|0.76828	0.4042|0.4042	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.999|.	T|T	0.74429|0.74429	-0.3668|-0.3668	10|5	0.42905|.	T|.	0.14|.	-15.263|-15.263	19.9922|19.9922	0.97370|0.97370	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	302;302;58|.	P49418-2;P49418;Q8NFL4|.	.;AMPH_HUMAN;.|.	S|F	302;302;302;72;305|52	ENSP00000317441:P302S;ENSP00000348602:P302S;ENSP00000390734:P302S|.	ENSP00000317441:P302S|.	P|S	-|-	1|2	0|0	AMPH|AMPH	38467521|38467521	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	5.948000|5.948000	0.70249|0.70249	2.740000|2.740000	0.93945|0.93945	0.557000|0.557000	0.71058|0.71058	CCT|TCC	.		0.448	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
CDK13	8621	hgsc.bcm.edu	37	7	39990355	39990355	+	Silent	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr7:39990355C>T	ENST00000181839.4	+	1	720	c.115C>T	c.(115-117)Ctg>Ttg	p.L39L	CDK13_ENST00000340829.5_Silent_p.L39L|RP11-467D6.1_ENST00000569710.1_RNA	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	39					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						GCAgccgccgctgctgttgcc	0.751																																					p.L39L		.											.	CDK13-548	0			c.C115T						.						6.0	5.0	5.0					7																	39990355		1070	2264	3334	SO:0001819	synonymous_variant	8621	exon1			CCGCCGCTGCTGT	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.115C>T	7.37:g.39990355C>T		2	0		20	9	NM_003718	0	0	2	3	1	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	ENST00000181839.4	37	CCDS5461.1																																																																																			.		0.751	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718	
COL1A2	1278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	94055328	94055328	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr7:94055328G>C	ENST00000297268.6	+	45	3433	c.2962G>C	c.(2962-2964)Ggt>Cgt	p.G988R		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	988					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TGGTCCTGTTGGTCCTGCTGG	0.478										HNSCC(75;0.22)																											p.G988R		.											.	COL1A2-521	0			c.G2962C						.						168.0	157.0	161.0					7																	94055328		2203	4300	6503	SO:0001583	missense	1278	exon45			CCTGTTGGTCCTG	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.2962G>C	7.37:g.94055328G>C	ENSP00000297268:p.Gly988Arg	95	0		124	46	NM_000089	0	0	63	63	0	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	37	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514600	0.64522	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.98807	-5.15	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.99533	0.9833	H	0.98594	4.275	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97940	1.0325	10	0.87932	D	0	.	17.53	0.87811	0.0:0.0:1.0:0.0	.	988	P08123	CO1A2_HUMAN	R	988;989	ENSP00000297268:G988R	ENSP00000297268:G988R	G	+	1	0	COL1A2	93893264	1.000000	0.71417	0.996000	0.52242	0.681000	0.39784	8.890000	0.92477	2.894000	0.99253	0.655000	0.94253	GGT	.		0.478	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
LMTK2	22853	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	97821142	97821142	+	Silent	SNP	G	G	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr7:97821142G>A	ENST00000297293.5	+	11	1658	c.1365G>A	c.(1363-1365)ctG>ctA	p.L455L		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	455					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					GGGACCGGCTGGGTCGTGAAA	0.562																																					p.L455L		.											.	LMTK2-1381	0			c.G1365A						.						74.0	65.0	68.0					7																	97821142		2203	4300	6503	SO:0001819	synonymous_variant	22853	exon11			CCGGCTGGGTCGT	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.1365G>A	7.37:g.97821142G>A		124	1		204	33	NM_014916	0	0	1	3	2	A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	37	CCDS5654.1																																																																																			.		0.562	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
CADPS2	93664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	122130227	122130227	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr7:122130227C>G	ENST00000449022.2	-	11	1779	c.1760G>C	c.(1759-1761)aGg>aCg	p.R587T	CADPS2_ENST00000476131.1_5'Flank|CADPS2_ENST00000334010.7_Missense_Mutation_p.R587T|CADPS2_ENST00000313070.7_Missense_Mutation_p.R587T|CADPS2_ENST00000412584.2_Missense_Mutation_p.R587T	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	587	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						ACCTGTGGCCCTATACATGGC	0.403																																					p.R587T		.											.	CADPS2-94	0			c.G1760C						.						147.0	142.0	144.0					7																	122130227		1881	4117	5998	SO:0001583	missense	93664	exon11			GTGGCCCTATACA		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.1760G>C	7.37:g.122130227C>G	ENSP00000398481:p.Arg587Thr	103	0		160	75	NM_001167940	0	0	12	23	11	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	37	CCDS55158.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.14|18.14	3.558442|3.558442	0.65538|0.65538	.|.	.|.	ENSG00000081803|ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022|ENST00000397721	T;T;T;T|.	0.75821|.	-0.97;-0.97;-0.97;-0.97|.	5.15|5.15	5.15|5.15	0.70609|0.70609	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.117334|.	0.56097|.	D|.	0.000032|.	T|.	0.77857|.	0.4193|.	M|M	0.78637|0.78637	2.42|2.42	0.80722|0.80722	D|D	1|1	D;B;D|.	0.76494|.	0.999;0.026;0.971|.	D;B;D|.	0.91635|.	0.999;0.014;0.987|.	T|.	0.78575|.	-0.2151|.	10|.	0.87932|.	D|.	0|.	-12.5156|-12.5156	18.6307|18.6307	0.91359|0.91359	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	587;587;587|.	Q86UW7-2;Q86UW7;Q86UW7-3|.	.;CAPS2_HUMAN;.|.	T|Y	587;587;587;554;587;587|235	ENSP00000325581:R587T;ENSP00000333940:R587T;ENSP00000400401:R587T;ENSP00000398481:R587T|.	ENSP00000325581:R587T|.	R|X	-|-	2|3	0|2	CADPS2|CADPS2	121917463|121917463	1.000000|1.000000	0.71417|0.71417	0.915000|0.915000	0.36163|0.36163	0.967000|0.967000	0.64934|0.64934	7.718000|7.718000	0.84743|0.84743	2.389000|2.389000	0.81357|0.81357	0.491000|0.491000	0.48974|0.48974	AGG|TAG	.		0.403	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
PAXIP1	22976	bcgsc.ca;mdanderson.org	37	7	154760666	154760666	+	Silent	SNP	C	C	A	rs61752011	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr7:154760666C>A	ENST00000404141.1	-	7	1399	c.1245G>T	c.(1243-1245)ccG>ccT	p.P415P	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Silent_p.P415P			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	415	Gln-rich.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GGTGTAAAACCGGGtgctgct	0.562																																					p.P415P		.											.	PAXIP1-228	0			c.G1245T						.						22.0	22.0	22.0					7																	154760666		1953	3819	5772	SO:0001819	synonymous_variant	22976	exon7			TAAAACCGGGTGC	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1245G>T	7.37:g.154760666C>A		43	1		69	30	NM_007349	0	0	0	1	1	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Silent	SNP	ENST00000404141.1	37	CCDS47753.1																																																																																			C|0.784;T|0.216		0.562	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		2	0	1096	15	14	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
SULF1	23213	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca|broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	70533313	70533314	+	Missense_Mutation	DNP	AC	AC	TT			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A|	A|	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr8:70533313_70533314AC>TT	ENST00000260128.4	+	14	2138_2139	c.1421_1422AC>TT	c.(1420-1422)cAC>cTT	p.H474L	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000458141.2_Missense_Mutation_p.H474L|SULF1_ENST00000402687.4_Missense_Mutation_p.H474L|SULF1_ENST00000419716.3_Missense_Mutation_p.H474L	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	474					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CTTCGAATTCACAAGTGTAAAG	0.49																																					p.H474L|p.H474H		.											.	SULF1-518	0			c.A1421T|c.C1422T						.																																			SO:0001583	missense	23213	exon14			GAATTCACAAGTG|AATTCACAAGTGT	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	Exception_encountered	8.37:g.70533313_70533314delinsTT	ENSP00000260128:p.His474Leu	86|88	0|1		133|135	21|22	NM_001128205	0	0	0	0	0	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation|Silent	SNP	ENST00000260128.4	37	CCDS6204.1																																																																																			.		0.490	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378885.2	NM_015170	
EXT1	2131	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	118816990	118816990	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr8:118816990T>C	ENST00000378204.2	-	10	2832	c.2026A>G	c.(2026-2028)Aag>Gag	p.K676E		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	676					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TTATACTGCTTCTTCTGGGTC	0.478			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses																												p.K676E		.	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	EXT1-660	0			c.A2026G						.						215.0	204.0	208.0					8																	118816990		2203	4300	6503	SO:0001583	missense	2131	exon10	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	ACTGCTTCTTCTG	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.2026A>G	8.37:g.118816990T>C	ENSP00000367446:p.Lys676Glu	195	2		358	76	NM_000127	0	0	98	124	26	B2R7V2|Q9BVI9	Missense_Mutation	SNP	ENST00000378204.2	37	CCDS6324.1	.	.	.	.	.	.	.	.	.	.	t	32	5.168700	0.94768	.	.	ENSG00000182197	ENST00000378204	D	0.86497	-2.13	5.68	5.68	0.88126	EXTL2, alpha-1,4-N-acetylhexosaminyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.93674	0.7979	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.92635	0.6119	10	0.23302	T	0.38	-12.4169	15.9321	0.79672	0.0:0.0:0.0:1.0	.	676	Q16394	EXT1_HUMAN	E	676	ENSP00000367446:K676E	ENSP00000367446:K676E	K	-	1	0	EXT1	118886171	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.036000	0.88901	2.160000	0.67779	0.477000	0.44152	AAG	.		0.478	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		0	0		15	14	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
SHARPIN	81858	hgsc.bcm.edu	37	8	145158503	145158503	+	Silent	SNP	G	G	T	rs11136254	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr8:145158503G>T	ENST00000398712.2	-	1	590	c.154C>A	c.(154-156)Cgg>Agg	p.R52R	MAF1_ENST00000532522.1_5'Flank|MAF1_ENST00000534585.1_5'Flank|SHARPIN_ENST00000533948.1_Intron|MAF1_ENST00000322428.5_5'Flank	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	52	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCAGGCCGCTCAGGGTCC	0.771													G|||	4431	0.884784	0.6884	0.9366	5008	,	,		10154	0.999		0.9115	False		,,,				2504	0.9683				p.R52R		.											.	SHARPIN-523	0			c.C154A						.	G		1990,374		815,360,7	2.0	2.0	2.0		154	2.7	0.6	8	dbSNP_120	2	5503,323		2593,317,3	no	coding-synonymous	SHARPIN	NM_030974.3		3408,677,10	TT,TG,GG		5.5441,15.8206,8.5104		52/388	145158503	7493,697	1182	2913	4095	SO:0001819	synonymous_variant	81858	exon1			CAGGCCGCTCAGG	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.154C>A	8.37:g.145158503G>T		0	0		4	4	NM_030974	0	0	0	43	43	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Silent	SNP	ENST00000398712.2	37	CCDS43777.1																																																																																			G|0.108;T|0.892		0.771	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974	
MFSD3	113655	hgsc.bcm.edu	37	8	145738764	145738764	+	IGR	DEL	A	A	-			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr8:145738764delA	ENST00000301327.4	+	0	1548				RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000428558.2_Frame_Shift_Del_p.V769fs	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GGCCACCACCACCCGGCAACT	0.687																																					p.V767fs		.											.	RECQL4-1083	0			c.2300delT						.						15.0	20.0	19.0					8																	145738764		2073	4204	6277	SO:0001628	intergenic_variant	9401	exon15			ACCACCACCCGGC		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		8.37:g.145738764delA		42	0		255	0	NM_004260	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000301327.4	37	CCDS6431.1																																																																																			.		0.687	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		12	12	NM_213605	0	0	0	1	1		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
C9orf66	157983	hgsc.bcm.edu	37	9	214679	214679	+	Missense_Mutation	SNP	G	G	A	rs117856897	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:214679G>A	ENST00000382387.2	-	1	1214	c.718C>T	c.(718-720)Ccc>Tcc	p.P240S	DOCK8_ENST00000432829.2_5'Flank|DOCK8_ENST00000453981.1_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	240	Arg-rich.									central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GCGGCCCCGGGCAGAGCGCGC	0.781													G|||	53	0.0105831	0.0	0.0	5008	,	,		10249	0.0496		0.001	False		,,,				2504	0.002				p.P240S		.											.	C9orf66-514	0			c.C718T						.						5.0	6.0	6.0					9																	214679		2051	3945	5996	SO:0001583	missense	157983	exon1			CCCCGGGCAGAGC	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.718C>T	9.37:g.214679G>A	ENSP00000371824:p.Pro240Ser	1	0		12	6	NM_152569	0	0	0	0	0	Q96NB0	Missense_Mutation	SNP	ENST00000382387.2	37	CCDS6439.1	23	0.010531135531135532	0	0.0	0	0.0	23	0.04020979020979021	0	0.0	.	10.34	1.322106	0.23994	.	.	ENSG00000183784	ENST00000382387	T	0.20200	2.09	3.91	0.383	0.16239	.	.	.	.	.	T	0.05502	0.0145	N	0.08118	0	0.09310	N	1	D	0.67145	0.996	D	0.67725	0.953	T	0.24764	-1.0151	9	0.87932	D	0	.	10.834	0.46677	0.0:0.5905:0.4095:0.0	.	240	Q5T8R8	CI066_HUMAN	S	240	ENSP00000371824:P240S	ENSP00000371824:P240S	P	-	1	0	C9orf66	204679	0.000000	0.05858	0.092000	0.20876	0.739000	0.42172	-0.253000	0.08794	0.321000	0.23259	0.484000	0.47621	CCC	G|0.986;A|0.014		0.781	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
ERMP1	79956	hgsc.bcm.edu	37	9	5832928	5832928	+	Missense_Mutation	SNP	G	G	C	rs13283149	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:5832928G>C	ENST00000339450.5	-	1	189	c.100C>G	c.(100-102)Cga>Gga	p.R34G	ERMP1_ENST00000214893.5_5'Flank|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	34						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		TCCTGCGCTCGGGCCTCCCTC	0.761													G|||	55	0.0109824	0.0	0.0086	5008	,	,		10754	0.0		0.0159	False		,,,				2504	0.0337				p.R34G		.											.	ERMP1-69	0			c.C100G						.	G	GLY/ARG	10,3136		0,10,1563	4.0	5.0	4.0		100	-1.2	0.1	9	dbSNP_121	4	98,7004		0,98,3453	no	missense	ERMP1	NM_024896.2	125	0,108,5016	CC,CG,GG		1.3799,0.3179,1.0539	benign	34/905	5832928	108,10140	1573	3551	5124	SO:0001583	missense	79956	exon1			GCGCTCGGGCCTC	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.100C>G	9.37:g.5832928G>C	ENSP00000340427:p.Arg34Gly	1	0		13	5	NM_024896	0	0	1	2	1	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Missense_Mutation	SNP	ENST00000339450.5	37	CCDS34983.1	27	0.012362637362637362	7	0.014227642276422764	7	0.019337016574585635	0	0.0	13	0.017150395778364115	G	2.887	-0.230467	0.05983	0.003179	0.013799	ENSG00000099219	ENST00000339450	T	0.42513	0.97	3.94	-1.25	0.09405	.	2.895070	0.01605	N	0.022244	T	0.11281	0.0275	N	0.08118	0	0.20196	N	0.999921	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.002	T	0.08764	-1.0706	10	0.23302	T	0.38	3.6025	4.9111	0.13821	0.361:0.1662:0.4729:0.0	rs13283149	34;34	E7ER77;Q7Z2K6	.;ERMP1_HUMAN	G	34	ENSP00000340427:R34G	ENSP00000340427:R34G	R	-	1	2	ERMP1	5822928	0.011000	0.17503	0.145000	0.22337	0.021000	0.10359	0.179000	0.16840	-0.098000	0.12285	0.313000	0.20887	CGA	G|0.987;C|0.013		0.761	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
PRSS3	5646	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	33797865	33797865	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:33797865T>A	ENST00000361005.5	+	3	410	c.410T>A	c.(409-411)gTc>gAc	p.V137D	RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_Missense_Mutation_p.V80D|PRSS3_ENST00000342836.4_Missense_Mutation_p.V94D|PRSS3_ENST00000429677.3_Missense_Mutation_p.V73D	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	137	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			AACATCAAAGTCCTGGAGGGG	0.552																																					p.V137D		.											.	PRSS3-90	0			c.T410A						.						169.0	145.0	153.0					9																	33797865		2203	4300	6503	SO:0001583	missense	5646	exon3			TCAAAGTCCTGGA		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.410T>A	9.37:g.33797865T>A	ENSP00000354280:p.Val137Asp	294	0		481	199	NM_007343	0	0	0	0	0	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	T	16.30	3.083047	0.55861	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41	3.62	2.4	0.29515	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.053950	0.64402	D	0.000001	T	0.80243	0.4587	N	0.10707	0.03	0.80722	D	1	P;P;P	0.45212	0.618;0.853;0.618	B;P;B	0.48227	0.241;0.571;0.241	T	0.78071	-0.2347	10	0.72032	D	0.01	.	7.3632	0.26758	0.196:0.0:0.0:0.804	.	80;137;94	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	D	137;92;94;73;80	ENSP00000354280:V137D;ENSP00000401249:V92D;ENSP00000340889:V94D;ENSP00000401828:V73D;ENSP00000368715:V80D	ENSP00000340889:V94D	V	+	2	0	PRSS3	33787865	0.031000	0.19500	0.008000	0.14137	0.056000	0.15407	1.699000	0.37804	0.359000	0.24239	0.260000	0.18958	GTC	.		0.552	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052121.1	NM_002771	
COL27A1	85301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	117053185	117053185	+	Silent	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:117053185C>T	ENST00000356083.3	+	48	4855	c.4464C>T	c.(4462-4464)ccC>ccT	p.P1488P		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1488	Collagen-like 14.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CACAGGGACCCCCAGGATTCA	0.592											OREG0019416	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1488P		.											.	COL27A1-94	0			c.C4464T						.						41.0	40.0	40.0					9																	117053185		2055	4066	6121	SO:0001819	synonymous_variant	85301	exon48			GGGACCCCCAGGA	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4464C>T	9.37:g.117053185C>T		231	1	1478	292	128	NM_032888	0	0	0	0	0	Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1																																																																																			.		0.592	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
TLR4	7099	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	120475205	120475205	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:120475205G>A	ENST00000355622.6	+	3	900	c.799G>A	c.(799-801)Gga>Aga	p.G267R	TLR4_ENST00000394487.4_Missense_Mutation_p.G227R|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	267					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TAGAAATGAAGGAAACTTGGA	0.353																																					p.G267R		.											.	TLR4-577	0			c.G799A						.						82.0	90.0	87.0					9																	120475205		2203	4299	6502	SO:0001583	missense	7099	exon3			AATGAAGGAAACT	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.799G>A	9.37:g.120475205G>A	ENSP00000363089:p.Gly267Arg	74	0		68	18	NM_138554	0	0	0	1	1	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	37	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.818954	0.00595	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.37752	1.48;1.18	5.78	3.4	0.38934	.	0.777104	0.12320	N	0.479383	T	0.06962	0.0177	N	0.00210	-1.845	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33471	-0.9867	10	0.10377	T	0.69	.	1.6556	0.02781	0.508:0.1314:0.2338:0.1269	.	267	O00206	TLR4_HUMAN	R	227;267	ENSP00000377997:G227R;ENSP00000363089:G267R	ENSP00000363089:G267R	G	+	1	0	TLR4	119515026	0.000000	0.05858	0.854000	0.33618	0.137000	0.21094	-0.109000	0.10840	1.008000	0.39264	-0.294000	0.09567	GGA	.		0.353	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554	
RPL12	6136	bcgsc.ca	37	9	130211601	130211601	+	Missense_Mutation	SNP	G	G	T	rs149234502		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:130211601G>T	ENST00000361436.5	-	4	338	c.251C>A	c.(250-252)gCc>gAc	p.A84D	RPL12_ENST00000497322.1_5'UTR|SNORA65_ENST00000364432.1_RNA|LRSAM1_ENST00000373322.1_5'Flank|LRSAM1_ENST00000323301.4_5'Flank|LRSAM1_ENST00000300417.6_5'Flank|LRSAM1_ENST00000373324.4_5'Flank|RPL12_ENST00000536368.1_Missense_Mutation_p.A51D	NM_000976.3	NP_000967.1	P30050	RL12_HUMAN	ribosomal protein L12	84					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|prostate(1)	4						TTCCTTGAGGGCTTTGATGAT	0.448																																					p.A84D		.											.	RPL12-90	0			c.C251A						.						88.0	76.0	80.0					9																	130211601		2203	4298	6501	SO:0001583	missense	6136	exon4			TTGAGGGCTTTGA		CCDS6872.1	9q34	2011-04-06			ENSG00000197958	ENSG00000197958		"""L ribosomal proteins"""	10302	protein-coding gene	gene with protein product		180475				8441690	Standard	NM_000976		Approved	L12	uc004bqy.2	P30050	OTTHUMG00000020704	ENST00000361436.5:c.251C>A	9.37:g.130211601G>T	ENSP00000354739:p.Ala84Asp	56	0		67	4	NM_000976	2	0	2309	2312	1	Q5VVV2|Q6PB27	Missense_Mutation	SNP	ENST00000361436.5	37	CCDS6872.1	.	.	.	.	.	.	.	.	.	.	G	34	5.298339	0.95574	.	.	ENSG00000197958	ENST00000361436;ENST00000536368	T;T	0.40756	1.02;1.02	4.98	4.98	0.66077	Ribosomal protein L11, N-terminal (1);Ribosomal protein L11, C-terminal (3);	0.000000	0.85682	U	0.000000	T	0.76758	0.4032	H	0.99705	4.715	0.80722	D	1	P;P	0.49090	0.919;0.667	P;P	0.54924	0.764;0.745	D	0.87585	0.2487	10	0.87932	D	0	-20.295	16.1444	0.81555	0.0:0.0:1.0:0.0	.	51;84	P30050-2;P30050	.;RL12_HUMAN	D	84;51	ENSP00000354739:A84D;ENSP00000441179:A51D	ENSP00000354739:A84D	A	-	2	0	RPL12	129251422	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.597000	0.90847	2.473000	0.83533	0.561000	0.74099	GCC	G|1.000;C|0.000		0.448	RPL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054189.1		
PRRC2B	84726	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	134351358	134351358	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:134351358C>T	ENST00000357304.4	+	15	3897	c.3842C>T	c.(3841-3843)tCc>tTc	p.S1281F	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000405995.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1281							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GACAAGAGATCCTTCTTCCAA	0.582											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1281F		.											.	PRRC2B-24	0			c.C3842T						.						49.0	56.0	54.0					9																	134351358		1985	4152	6137	SO:0001583	missense	84726	exon15			AGAGATCCTTCTT	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.3842C>T	9.37:g.134351358C>T	ENSP00000349856:p.Ser1281Phe	52	0	1610	66	11	NM_013318	0	0	8	8	0	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	ENST00000357304.4	37	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.197967	0.58126	.	.	ENSG00000130723	ENST00000357304;ENST00000418650	T	0.02015	4.5	5.66	5.66	0.87406	.	.	.	.	.	T	0.04952	0.0133	L	0.47716	1.5	0.80722	D	1	P;P;P	0.49559	0.925;0.755;0.641	P;B;B	0.48141	0.568;0.444;0.259	T	0.32241	-0.9914	9	0.62326	D	0.03	.	14.2417	0.65961	0.1585:0.8415:0.0:0.0	.	577;14;1281	Q5H9R5;Q5JSZ8;Q5JSZ5	.;.;PRC2B_HUMAN	F	1281;577	ENSP00000349856:S1281F	ENSP00000349856:S1281F	S	+	2	0	PRRC2B	133341179	0.996000	0.38824	0.993000	0.49108	0.971000	0.66376	1.294000	0.33365	2.675000	0.91044	0.655000	0.94253	TCC	.		0.582	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
CEL	1056	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	135947102	135947102	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:135947102C>T	ENST00000372080.4	+	11	2238	c.2222C>T	c.(2221-2223)cCc>cTc	p.P741L	CEL_ENST00000351304.7_Missense_Mutation_p.P672L	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	738	17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CCTGTGCCCCCCACAGATGAC	0.667																																					p.P741L		.											.	CEL-91	0			c.C2222T						.						18.0	21.0	20.0					9																	135947102		1846	4086	5932	SO:0001583	missense	1056	exon11			TGCCCCCCACAGA	M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.2222C>T	9.37:g.135947102C>T	ENSP00000361151:p.Pro741Leu	93	0		107	42	NM_001807	0	0	0	0	0	Q16398|Q5T7U7|Q9UCH1|Q9UP41	Missense_Mutation	SNP	ENST00000372080.4	37	CCDS43896.1	.	.	.	.	.	.	.	.	.	.	c	16.21	3.058421	0.55325	.	.	ENSG00000170835	ENST00000372080;ENST00000351304;ENST00000303626	T;T	0.73575	-0.56;-0.76	2.58	2.58	0.30949	.	.	.	.	.	T	0.63165	0.2488	L	0.29908	0.895	0.28791	N	0.899318	B	0.17038	0.02	B	0.12156	0.007	T	0.62186	-0.6907	9	0.87932	D	0	.	11.3773	0.49735	0.0:1.0:0.0:0.0	.	738	P19835	CEL_HUMAN	L	741;672;707	ENSP00000361151:P741L;ENSP00000342217:P672L	ENSP00000304021:P707L	P	+	2	0	CEL	134936923	0.036000	0.19791	0.004000	0.12327	0.173000	0.22820	2.750000	0.47500	1.786000	0.52430	0.454000	0.30748	CCC	.		0.667	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054823.1		
ABO	28	bcgsc.ca	37	9	136131415	136131415	+	RNA	SNP	C	C	T	rs8176743	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:136131415C>T	ENST00000453660.2	-	0	713				RP11-430N14.4_ENST00000606717.1_RNA			P16442	BGAT_HUMAN	ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)						protein glycosylation (GO:0006486)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	fucosylgalactoside 3-alpha-galactosyltransferase activity (GO:0004381)|glycoprotein-fucosylgalactoside alpha-N-acetylgalactosaminyltransferase activity (GO:0004380)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|prostate(1)|stomach(2)	11				OV - Ovarian serous cystadenocarcinoma(145;5.82e-06)|Epithelial(140;3.45e-05)		CCGTAGAAGCCGGGGTGCAGG	0.657													C|||	766	0.152955	0.1694	0.0476	5008	,	,		15910	0.1944		0.0845	False		,,,				2504	0.2331				.		.											.	ABO-90	0			.						.	C	SER/GLY	647,3471		52,543,1464	21.0	26.0	24.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	702	2.5	0.0	9	dbSNP_117	24	603,7749		27,549,3600	no	missense	ABO	NM_020469.2	56	79,1092,5064	TT,TC,CC		7.2198,15.7115,10.0241	possibly-damaging	235/355	136131415	1250,11220	2059	4176	6235			28	.			AGAAGCCGGGGTG	AF134415		9q34.2	2014-07-19			ENSG00000175164	ENSG00000175164	2.4.1.40, 2.4.1.37	"""Blood group antigens"", ""Glycosyltransferase family 6 domain containing"""	79	protein-coding gene	gene with protein product		110300				184030	Standard	NM_020469		Approved	A3GALNT, A3GALT1	uc004cda.1	P16442	OTTHUMG00000020872		9.37:g.136131415C>T		68	0		91	5	.	0	0	7	7	0	B0JDB9|O14758|Q14490|Q53I57|Q6ISD4|Q6KFZ2|Q70V27|Q99484|Q99485|Q9NY01|Q9UQ68|Q9UQ69	RNA	SNP	ENST00000453660.2	37																																																																																				C|0.861;T|0.139		0.657	ABO-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000054907.4	NM_020469	
RXRA	6256	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	137325961	137325961	+	Silent	SNP	C	C	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:137325961C>G	ENST00000481739.1	+	9	1201	c.1149C>G	c.(1147-1149)ctC>ctG	p.L383L	RXRA_ENST00000356384.4_3'UTR|RXRA_ENST00000540193.1_Silent_p.L286L	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha	383	Ligand-binding.				camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	CCAAGGGGCTCTCGAACCCGG	0.642																																					p.L383L		.											.	RXRA-188	0			c.C1149G						.						50.0	53.0	52.0					9																	137325961		2203	4300	6503	SO:0001819	synonymous_variant	6256	exon9			GGGGCTCTCGAAC	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887	ENST00000481739.1:c.1149C>G	9.37:g.137325961C>G		71	0		74	24	NM_002957	0	0	0	1	1	B3KY83|Q2NL52|Q2V504	Silent	SNP	ENST00000481739.1	37	CCDS35172.1																																																																																			.		0.642	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054949.1	NM_002957	
GPSM1	26086	hgsc.bcm.edu	37	9	139252666	139252666	+	Silent	SNP	G	G	A	rs200980257	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:139252666G>A	ENST00000440944.1	+	14	2242	c.2022G>A	c.(2020-2022)gcG>gcA	p.A674A	GPSM1_ENST00000392944.1_Silent_p.A165A|GPSM1_ENST00000429455.1_Silent_p.A165A	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	674					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		AGCCTGGTGCGAGCTAAGGCC	0.736													G|||	7	0.00139776	0.0	0.0	5008	,	,		12973	0.0069		0.0	False		,,,				2504	0.0				p.A674A		.											.	GPSM1-90	0			c.G2022A						.						5.0	6.0	6.0					9																	139252666		2016	3973	5989	SO:0001819	synonymous_variant	26086	exon14			TGGTGCGAGCTAA	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.2022G>A	9.37:g.139252666G>A		0	0		9	4	NM_001145638	0	0	3	6	3	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Silent	SNP	ENST00000440944.1	37	CCDS48055.1																																																																																			G|0.998;A|0.002		0.736	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
TRAF2	7186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139818401	139818401	+	Silent	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr9:139818401G>C	ENST00000247668.2	+	10	1288	c.1236G>C	c.(1234-1236)gtG>gtC	p.V412V	TRAF2_ENST00000359662.3_Silent_p.V464V|TRAF2_ENST00000536468.1_Silent_p.V412V	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2	412	MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		TCTTCTTTGTGGTGATGAAGG	0.622																																					p.V412V		.											.	TRAF2-660	0			c.G1236C						.						103.0	84.0	90.0					9																	139818401		2203	4300	6503	SO:0001819	synonymous_variant	7186	exon10			CTTTGTGGTGATG	U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.1236G>C	9.37:g.139818401G>C		138	0		187	79	NM_021138	0	0	11	16	5	A8K107|B4DPJ7|Q7Z337|Q96NT2	Silent	SNP	ENST00000247668.2	37	CCDS7013.1																																																																																			.		0.622	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055166.1	NM_021138	
DDX53	168400	broad.mit.edu	37	X	23020626	23020629	+	IGR	DEL	GAGT	GAGT	-			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:23020626_23020629delGAGT	ENST00000327968.5	+	0	2118				RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53							nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						AAAAATGAGAGAGTGAGAGACTAT	0.309																																					.		.											.	.	0			.						.																																			SO:0001628	intergenic_variant	0	.			ATGAGAGAGTGAG	AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248		X.37:g.23020626_23020629delGAGT		289	0		435	8	.	0	0	0	0	0	Q0D2N2|Q6NVV4	RNA	DEL	ENST00000327968.5	37	CCDS35214.1																																																																																			.		0.309	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
ACOT9	23597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	23754092	23754092	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:23754092C>T	ENST00000336430.7	-	2	193	c.62G>A	c.(61-63)gGa>gAa	p.G21E	ACOT9_ENST00000379303.5_Missense_Mutation_p.G21E|ACOT9_ENST00000492081.1_Intron|ACOT9_ENST00000379295.1_5'UTR	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	21					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)			breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						TTGAGTCAGTCCTCTTCCAGG	0.478																																					p.G21E		.											.	ACOT9-133	0			c.G62A						.						251.0	209.0	223.0					X																	23754092		2203	4300	6503	SO:0001583	missense	23597	exon2			GTCAGTCCTCTTC	AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.62G>A	X.37:g.23754092C>T	ENSP00000336580:p.Gly21Glu	151	0		210	93	NM_001037171	0	0	24	24	0	B3KNC9|B7ZM94	Missense_Mutation	SNP	ENST00000336430.7	37	CCDS35216.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631569	0.46944	.	.	ENSG00000123130	ENST00000379303;ENST00000336430	T;T	0.30714	1.52;1.54	4.69	2.72	0.32119	.	0.430348	0.23360	N	0.049038	T	0.29716	0.0742	L	0.51422	1.61	0.80722	D	1	P;D	0.53462	0.651;0.96	B;P	0.51229	0.153;0.663	T	0.28490	-1.0042	10	0.02654	T	1	-17.7669	9.5945	0.39565	0.0:0.5898:0.4102:0.0	.	21;21	Q9Y305;Q9Y305-4	ACOT9_HUMAN;.	E	21	ENSP00000368605:G21E;ENSP00000336580:G21E	ENSP00000336580:G21E	G	-	2	0	ACOT9	23664013	0.999000	0.42202	1.000000	0.80357	0.415000	0.31203	1.112000	0.31172	1.049000	0.40321	0.538000	0.68166	GGA	.		0.478	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056065.1	NM_012332	
CXorf38	159013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	40496395	40496395	+	Missense_Mutation	SNP	C	C	T	rs376500009		TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:40496395C>T	ENST00000327877.5	-	4	511	c.485G>A	c.(484-486)cGt>cAt	p.R162H	CXorf38_ENST00000440784.2_Missense_Mutation_p.R77H|CXorf38_ENST00000378421.1_Missense_Mutation_p.R43H|CXorf38_ENST00000378426.1_Missense_Mutation_p.R43H	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	162										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						GATCTCATTACGACATTTAAT	0.338																																					p.R162H		.											.	CXorf38-131	0			c.G485A						.	C	HIS/ARG	0,3833		0,0,1631,571	41.0	37.0	38.0		485	4.8	1.0	X		38	1,6722		0,1,2425,1871	no	missense	CXorf38	NM_144970.2	29	0,1,4056,2442	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging	162/320	40496395	1,10555	2202	4297	6499	SO:0001583	missense	159013	exon4			TCATTACGACATT	AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.485G>A	X.37:g.40496395C>T	ENSP00000330488:p.Arg162His	96	0		89	33	NM_144970	0	0	21	21	0	B3KW28|D3DWB5|Q5JPF5|Q8N941	Missense_Mutation	SNP	ENST00000327877.5	37	CCDS14253.1	.	.	.	.	.	.	.	.	.	.	C	19.37	3.814126	0.70912	0.0	1.49E-4	ENSG00000185753	ENST00000378426;ENST00000327877;ENST00000378421;ENST00000440784	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	4.84	4.84	0.62591	.	0.233120	0.31884	N	0.006917	T	0.80276	0.4593	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.82812	-0.0272	10	0.87932	D	0	-0.359	15.779	0.78246	0.0:1.0:0.0:0.0	.	77;162	E7EN46;Q8TB03	.;CX038_HUMAN	H	43;162;43;77	ENSP00000367683:R43H;ENSP00000330488:R162H;ENSP00000367677:R43H;ENSP00000400019:R77H	ENSP00000330488:R162H	R	-	2	0	CXorf38	40381339	1.000000	0.71417	0.998000	0.56505	0.685000	0.39939	4.934000	0.63491	2.238000	0.73509	0.422000	0.28245	CGT	.		0.338	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060685.3	NM_144970	
USP51	158880	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	55515272	55515272	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:55515272G>A	ENST00000500968.3	-	2	183	c.101C>T	c.(100-102)gCg>gTg	p.A34V	USP51_ENST00000586165.1_5'Flank	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	34					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						CATTTTCCCCGCCTTCTCAAC	0.642																																					p.A34V		.											.	USP51-659	0			c.C101T						.						15.0	16.0	16.0					X																	55515272		2191	4287	6478	SO:0001583	missense	158880	exon2			TTCCCCGCCTTCT	BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.101C>T	X.37:g.55515272G>A	ENSP00000423333:p.Ala34Val	53	0		79	9	NM_201286	0	0	5	5	0	Q8IWJ8	Missense_Mutation	SNP	ENST00000500968.3	37	CCDS14370.1	.	.	.	.	.	.	.	.	.	.	.	12.51	1.960658	0.34565	.	.	ENSG00000247746	ENST00000500968	T	0.14391	2.51	2.37	1.41	0.22369	.	.	.	.	.	T	0.05960	0.0155	N	0.24115	0.695	0.20074	N	0.999938	P	0.48764	0.915	B	0.27796	0.083	T	0.33266	-0.9875	9	0.87932	D	0	.	5.411	0.16349	0.0:0.0:0.6677:0.3323	.	34	Q70EK9	UBP51_HUMAN	V	34	ENSP00000423333:A34V	ENSP00000423333:A34V	A	-	2	0	USP51	55531997	0.285000	0.24296	0.696000	0.30242	0.586000	0.36452	0.866000	0.27954	0.382000	0.24878	0.431000	0.28591	GCG	.		0.642	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056871.2	NM_201286	
TAF1	6872	broad.mit.edu;bcgsc.ca	37	X	70674672	70674672	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:70674672C>A	ENST00000373790.4	+	34	4951	c.4900C>A	c.(4900-4902)Ctg>Atg	p.L1634M	TAF1_ENST00000449580.1_Missense_Mutation_p.L1634M|TAF1_ENST00000461764.1_3'UTR|TAF1_ENST00000423759.1_Missense_Mutation_p.L1655M|TAF1_ENST00000276072.3_Missense_Mutation_p.L1655M	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1634	Asp/Glu-rich (acidic tail).|Protein kinase 2.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ATTAGAAAGCCTGGACCCAAT	0.423																																					p.L1655M		.											.	TAF1-900	0			c.C4963A						.						61.0	57.0	58.0					X																	70674672		2203	4300	6503	SO:0001583	missense	6872	exon34			GAAAGCCTGGACC		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.4900C>A	X.37:g.70674672C>A	ENSP00000362895:p.Leu1634Met	203	1		217	11	NM_004606	0	0	28	28	0	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	ENST00000373790.4	37	CCDS35325.1	.	.	.	.	.	.	.	.	.	.	C	14.96	2.692194	0.48202	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000395779;ENST00000276072	T;T;T;T	0.10192	2.9;3.02;2.97;2.91	5.04	0.814	0.18756	.	0.068459	0.56097	D	0.000021	T	0.19327	0.0464	L	0.42245	1.32	0.41718	D	0.989496	D;P;P;P	0.76494	0.999;0.911;0.917;0.95	D;P;P;P	0.79108	0.992;0.702;0.603;0.776	T	0.00918	-1.1515	10	0.33141	T	0.24	.	9.0061	0.36113	0.0:0.5942:0.0:0.4058	.	288;1634;1634;1655	A5CVC9;P21675-4;P21675;P21675-2	.;.;TAF1_HUMAN;.	M	1634;1634;1655;340;1655	ENSP00000362895:L1634M;ENSP00000389000:L1634M;ENSP00000406549:L1655M;ENSP00000276072:L1655M	ENSP00000276072:L1655M	L	+	1	2	TAF1	70591397	0.958000	0.32768	0.996000	0.52242	0.997000	0.91878	0.656000	0.24948	0.080000	0.16959	0.513000	0.50165	CTG	.		0.423	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
ATRX	546	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	76875873	76875873	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:76875873G>T	ENST00000373344.5	-	20	5476	c.5262C>A	c.(5260-5262)aaC>aaA	p.N1754K	ATRX_ENST00000395603.3_Missense_Mutation_p.N1716K|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1754	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ACTCAATTAGGTTATTTTGAA	0.313			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.N1754K		.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX-248	1	Unknown(1)	bone(1)	c.C5262A	GRCh37	CM081519	ATRX	M		.						82.0	70.0	74.0					X																	76875873		2201	4294	6495	SO:0001583	missense	546	exon20			AATTAGGTTATTT	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5262C>A	X.37:g.76875873G>T	ENSP00000362441:p.Asn1754Lys	287	0		384	136	NM_000489	0	0	0	0	0	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.77|17.77	3.470875|3.470875	0.63625|0.63625	.|.	.|.	ENSG00000085224|ENSG00000085224	ENST00000373344;ENST00000395603|ENST00000400866	D;D|.	0.94000|.	-3.33;-3.33|.	4.57|4.57	4.57|4.57	0.56435|0.56435	DEAD-like helicase (2);SNF2-related (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67767|0.67767	0.2928|0.2928	M|M	0.80746|0.80746	2.51|2.51	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.998;1.0|.	D;D|.	0.91635|.	0.994;0.999|.	T|T	0.69632|0.69632	-0.5093|-0.5093	10|5	0.66056|.	D|.	0.02|.	-8.9951|-8.9951	7.6576|7.6576	0.28383|0.28383	0.2096:0.0:0.7904:0.0|0.2096:0.0:0.7904:0.0	.|.	1716;1754|.	P46100-4;P46100|.	.;ATRX_HUMAN|.	K|N	1754;1716|43	ENSP00000362441:N1754K;ENSP00000378967:N1716K|.	ENSP00000362441:N1754K|.	N|T	-|-	3|2	2|0	ATRX|ATRX	76762529|76762529	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.113000|2.113000	0.41902|0.41902	1.833000|1.833000	0.53350|0.53350	0.600000|0.600000	0.82982|0.82982	AAC|ACC	.		0.313	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
PCDH11X	27328	broad.mit.edu	37	X	91090885	91090885	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:91090885C>A	ENST00000373094.1	+	1	1227	c.382C>A	c.(382-384)Ctg>Atg	p.L128M	PCDH11X_ENST00000361724.1_Missense_Mutation_p.L128M|PCDH11X_ENST00000361655.2_Missense_Mutation_p.L128M|PCDH11X_ENST00000298274.8_Missense_Mutation_p.L128M|PCDH11X_ENST00000395337.2_Missense_Mutation_p.L128M|PCDH11X_ENST00000504220.2_Missense_Mutation_p.L128M|PCDH11X_ENST00000406881.1_Missense_Mutation_p.L128M|PCDH11X_ENST00000373097.1_Missense_Mutation_p.L128M|PCDH11X_ENST00000373088.1_Missense_Mutation_p.L128M	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	128	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						GATACGTTTTCTGATAGAAGA	0.373																																					p.L128M	NSCLC(38;925 1092 2571 38200 45895)	.											.	PCDH11X-193	0			c.C382A						.						44.0	41.0	42.0					X																	91090885		2202	4276	6478	SO:0001583	missense	27328	exon1			CGTTTTCTGATAG	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.382C>A	X.37:g.91090885C>A	ENSP00000362186:p.Leu128Met	240	1		342	57	NM_001168363	0	0	0	0	0	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	37	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307430	0.40795	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.53857	0.6;0.66;0.67;0.6;0.67;0.65;0.65;0.68;0.67	4.44	-0.212	0.13169	Cadherin (2);	0.172870	0.38164	N	0.001793	T	0.55257	0.1909	L	0.45137	1.4	0.37349	D	0.910717	D;D;D;D;D;D;D;D	0.71674	0.997;0.99;0.998;0.998;0.998;0.996;0.997;0.996	D;D;D;D;D;D;D;D	0.72982	0.975;0.947;0.979;0.979;0.979;0.954;0.975;0.962	T	0.55970	-0.8056	10	0.49607	T	0.09	.	4.871	0.13633	0.4795:0.3448:0.0:0.1757	.	128;128;128;128;128;128;128;128	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	M	128	ENSP00000378746:L128M;ENSP00000362186:L128M;ENSP00000362189:L128M;ENSP00000355040:L128M;ENSP00000362180:L128M;ENSP00000423762:L128M;ENSP00000355105:L128M;ENSP00000384758:L128M;ENSP00000298274:L128M	ENSP00000298274:L128M	L	+	1	2	PCDH11X	90977541	0.998000	0.40836	0.999000	0.59377	0.988000	0.76386	0.604000	0.24164	0.000000	0.14550	-0.376000	0.06991	CTG	.		0.373	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
ZMAT1	84460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101139569	101139569	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:101139569A>G	ENST00000372782.3	-	7	877	c.830T>C	c.(829-831)tTc>tCc	p.F277S	ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000540921.1_Missense_Mutation_p.F277S|ZMAT1_ENST00000458570.1_Missense_Mutation_p.F106S	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	277						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						GTATGTCCGGAAAGTCTCAAA	0.403																																					p.F277S		.											.	ZMAT1-131	0			c.T830C						.						187.0	175.0	179.0					X																	101139569		2203	4300	6503	SO:0001583	missense	84460	exon7			GTCCGGAAAGTCT	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.830T>C	X.37:g.101139569A>G	ENSP00000361868:p.Phe277Ser	106	0		149	24	NM_001011657	0	0	15	16	1	Q8NDS3|Q96JN6	Missense_Mutation	SNP	ENST00000372782.3	37	CCDS35348.1	.	.	.	.	.	.	.	.	.	.	A	1.808	-0.475394	0.04414	.	.	ENSG00000166432	ENST00000372782;ENST00000540921;ENST00000458570	T;T;T	0.27104	2.25;2.25;1.69	4.37	0.415	0.16411	.	0.751749	0.12036	N	0.505499	T	0.14056	0.0340	L	0.35487	1.065	0.09310	N	1	B	0.18310	0.027	B	0.14023	0.01	T	0.35101	-0.9802	10	0.13470	T	0.59	0.1087	3.4305	0.07426	0.5771:0.1996:0.2233:0.0	.	277	Q5H9K5	ZMAT1_HUMAN	S	277;277;106	ENSP00000361868:F277S;ENSP00000437529:F277S;ENSP00000413044:F106S	ENSP00000361868:F277S	F	-	2	0	ZMAT1	101026225	0.880000	0.30214	0.001000	0.08648	0.106000	0.19336	0.597000	0.24059	-0.030000	0.13804	0.437000	0.28790	TTC	.		0.403	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1		
ALG13	79868	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	110973752	110973752	+	Splice_Site	SNP	G	G	C			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:110973752G>C	ENST00000394780.3	+	21	2413		c.e21-1		ALG13_ENST00000251943.4_Splice_Site|ALG13_ENST00000470971.1_Splice_Site	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						ATATTCTCTAGAGCCAGACTA	0.338																																					.		.											.	ALG13-130	0			c.2090-1G>C						.						68.0	52.0	57.0					X																	110973752		1567	3578	5145	SO:0001630	splice_region_variant	79868	exon21			TCTCTAGAGCCAG	AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.2402-1G>C	X.37:g.110973752G>C		137	0		164	37	NM_001257230	0	0	0	0	0	B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Splice_Site	SNP	ENST00000394780.3	37	CCDS55477.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190850	0.58017	.	.	ENSG00000101901	ENST00000251943;ENST00000394780;ENST00000436609	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4259	0.90608	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ALG13	110860408	1.000000	0.71417	0.671000	0.29857	0.812000	0.45895	6.719000	0.74718	2.291000	0.77112	0.600000	0.82982	.	.		0.338	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272895.1	NM_018466	Intron
MAP7D3	79649	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	135303014	135303014	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chrX:135303014C>T	ENST00000316077.9	-	16	2616	c.2396G>A	c.(2395-2397)cGt>cAt	p.R799H	MAP7D3_ENST00000370661.1_Missense_Mutation_p.R764H|MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370663.5_Missense_Mutation_p.R781H	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	799					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TGGCTCTTTACGGACCTGGCT	0.388																																					p.R799H		.											.	MAP7D3-110	0			c.G2396A						.						253.0	227.0	235.0					X																	135303014		1835	4082	5917	SO:0001583	missense	79649	exon16			TCTTTACGGACCT	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.2396G>A	X.37:g.135303014C>T	ENSP00000318086:p.Arg799His	98	0		158	53	NM_024597	0	0	7	7	0	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	ENST00000316077.9	37	CCDS44004.1	.	.	.	.	.	.	.	.	.	.	C	0.790	-0.759024	0.03019	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.17370	2.28;3.7;3.7;2.29	3.84	-7.68	0.01268	.	.	.	.	.	T	0.04048	0.0113	N	0.01874	-0.695	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.35176	-0.9799	9	0.19147	T	0.46	2.1948	3.4315	0.07430	0.1116:0.388:0.1122:0.3881	.	781;758;799;764	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	H	764;799;781;758	ENSP00000359695:R764H;ENSP00000318086:R799H;ENSP00000359697:R781H;ENSP00000359694:R758H	ENSP00000318086:R799H	R	-	2	0	MAP7D3	135130680	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.232000	0.01205	-2.400000	0.00579	-2.119000	0.00349	CGT	.		0.388	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058487.2		
CELSR2	1952	hgsc.bcm.edu	37	1	109792735	109792736	+	In_Frame_Ins	INS	-	-	CGC	rs377757908|rs59201433|rs144034706	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr1:109792735_109792736insCGC	ENST00000271332.3	+	1	95_96	c.34_35insCGC	c.(34-36)acg>aCGCcg	p.16_17insP		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	16					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCTCCCAACgccgccgccg	0.752														2846	0.568291	0.4198	0.6311	5008	,	,		10222	0.5298		0.7276	False		,,,				2504	0.6002				p.T12delinsTP	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.34_35insCGC						.			1363,1439		473,417,511						3.0	0.1		dbSNP_130	6	4135,1897		1679,777,560	no	coding	CELSR2	NM_001408.2		2152,1194,1071	A1A1,A1R,RR		31.4489,48.6438,37.7632				5498,3336				SO:0001652	inframe_insertion	1952	exon1			CTCCCAACGCCGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.47_49dupCGC	1.37:g.109792742_109792744dupCGC	ENSP00000271332:p.Pro16_Pro16dup	2	0		13	10	NM_001408	0	0	0	0	0	Q5T2Y7|Q92566	In_Frame_Ins	INS	ENST00000271332.3	37	CCDS796.1																																																																																			-|0.389;CGC|0.611		0.752	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
SIRT6	51548	broad.mit.edu	37	19	4175089	4175090	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr19:4175089_4175090insG	ENST00000337491.2	-	7	737_738	c.673_674insC	c.(673-675)ctgfs	p.L225fs	SIRT6_ENST00000594279.1_Frame_Shift_Ins_p.C140fs|SIRT6_ENST00000601488.1_Frame_Shift_Ins_p.C151fs|SIRT6_ENST00000381935.3_Frame_Shift_Ins_p.L153fs|SIRT6_ENST00000305232.6_Frame_Shift_Ins_p.L198fs	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	225	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCCAGCGGCAGGTTCCCGCTG	0.688																																					p.L225fs		.											.	SIRT6-227	0			c.674_675insC						.																																			SO:0001589	frameshift_variant	51548	exon7			AGCGGCAGGTTCC	AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.674dupC	19.37:g.4175091_4175091dupG	ENSP00000337332:p.Leu225fs	75	0		272	12	NM_016539	0	0	0	0	0	B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Frame_Shift_Ins	INS	ENST00000337491.2	37	CCDS12122.1																																																																																			.		0.688	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457931.2		
SREBF2	6721	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	42262853	42262854	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr22:42262853_42262854insT	ENST00000361204.4	+	2	273_274	c.107_108insT	c.(106-111)agtaatfs	p.N37fs		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	37	Transcriptional activation (acidic).				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CAATTTGTCAGTAATCAAGTGG	0.431																																					p.S36fs		.											.	SREBF2-154	0			c.107_108insT						.																																			SO:0001589	frameshift_variant	6721	exon2			TTGTCAGTAATCA	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.108dupT	22.37:g.42262854_42262854dupT	ENSP00000354476:p.Asn37fs	92	0		84	22	NM_004599	0	0	0	0	0	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Frame_Shift_Ins	INS	ENST00000361204.4	37	CCDS14023.1																																																																																			.		0.431	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
MCC	4163	hgsc.bcm.edu;broad.mit.edu	37	5	112824033	112824034	+	In_Frame_Ins	INS	-	-	GCTGCC	rs575244177	byFrequency	TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr5:112824033_112824034insGCTGCC	ENST00000408903.3	-	1	493_494	c.78_79insGGCAGC	c.(76-81)agcagc>agcGGCAGCagc	p.25_26insSG		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)	p.S26_S27insGS(1)		endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		Tcgctgctgctgctgctgctgc	0.743																																					p.S27delinsGSS		.											.	MCC-69	1	Insertion - In frame(1)	prostate(1)	c.79_80insGGCAGC						.																																			SO:0001652	inframe_insertion	4163	exon1			TGCTGCTGCTGCT		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.78_79insGGCAGC	5.37:g.112824033_112824034insGCTGCC	ENSP00000386227:p.Ser25_Ser26insSerGly	19	0		77	43	NM_001085377	0	0	0	0	0	D3DT05|Q6ZR04	In_Frame_Ins	INS	ENST00000408903.3	37	CCDS43351.1																																																																																			.		0.743	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
ATXN1	6310	broad.mit.edu	37	6	16327864	16327865	+	In_Frame_Ins	INS	-	-	TGC			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr6:16327864_16327865insTGC	ENST00000244769.4	-	8	1613_1614	c.677_678insGCA	c.(676-678)cac>caGCAc	p.225_226insQ	ATXN1_ENST00000436367.1_In_Frame_Ins_p.225_226insQ	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	225	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				CCCTGCTGAGGtgctgctgctg	0.653																																					p.H226delinsQH		.											.	ATXN1-93	0			c.678_679insGCA						.																																			SO:0001652	inframe_insertion	6310	exon7			GCTGAGGTGCTGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.675_677dupGCA	6.37:g.16327871_16327873dupTGC	ENSP00000244769:p.Gln225_Gln225dup	53	0		40	15	NM_001128164	0	0	0	0	0	Q17S02|Q9UJG2|Q9Y4J1	In_Frame_Ins	INS	ENST00000244769.4	37	CCDS34342.1																																																																																			.		0.653	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
TMEM255B	348013	bcgsc.ca	37	13	114471933	114471934	+	Intron	DNP	GG	GG	AA			TCGA-OR-A5JF-01A-11D-A29I-10	TCGA-OR-A5JF-10A-01D-A29L-10	GG	GG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	0c0a475a-8dd3-454a-a217-84368080e029	8c78352c-8bfd-4ff0-86e3-4bab48fd510c	g.chr13:114471933_114471934GG>AA	ENST00000375353.3	+	3	216					NM_182614.2	NP_872420.1	Q8WV15	T255B_HUMAN	transmembrane protein 255B							integral component of membrane (GO:0016021)											CAGTGGTTGAGGTTCTTGAGGT	0.495																																					p.V69I		.											.	.	0			.						.																																			SO:0001627	intron_variant	348013	.			GTTGAGGTTCTTG	BC018995	CCDS45071.1	13q34	2012-11-30	2012-11-30	2012-11-30	ENSG00000184497	ENSG00000184497			28297	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member B"""	FAM70B		12477932	Standard	NM_182614		Approved	MGC20579	uc001vuh.3	Q8WV15	OTTHUMG00000017398	Exception_encountered	13.37:g.114471933_114471934delinsAA		144	0		99	31	.	0	0	0	0	0		Missense_Mutation	DNP	ENST00000375353.3	37	CCDS45071.1																																																																																			.		0.495	TMEM255B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045953.4	NM_182614	
