#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOL9	79707	hgsc.bcm.edu	37	1	6614391	6614391	+	Missense_Mutation	SNP	A	A	C	rs6693391	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:6614391A>C	ENST00000377705.5	-	1	204	c.172T>G	c.(172-174)Tcc>Gcc	p.S58A	TAS1R1_ENST00000328191.4_5'Flank|TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000333172.6_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	58			S -> A (in dbSNP:rs6693391). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACGCCGGACGCCTGGGCT	0.781													C|||	4789	0.95627	0.8722	0.9841	5008	,	,		9026	0.9692		0.995	False		,,,				2504	0.9969				p.S58A		.											.	NOL9-515	0			c.T172G						.	C	ALA/SER	2196,260		975,246,7	2.0	3.0	3.0		172	3.0	0.2	1	dbSNP_116	3	4875,25		2425,25,0	no	missense	NOL9	NM_024654.4	99	3400,271,7	CC,CA,AA		0.5102,10.5863,3.8744	benign	58/703	6614391	7071,285	1228	2450	3678	SO:0001583	missense	79707	exon1			CGCCGGACGCCTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.172T>G	1.37:g.6614391A>C	ENSP00000366934:p.Ser58Ala	0	0		10	10	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2092	0.9578754578754579	421	0.8556910569105691	355	0.9806629834254144	562	0.9825174825174825	754	0.9947229551451188	C	0.416	-0.910621	0.02434	0.894137	0.994898	ENSG00000162408	ENST00000377705	T	0.15718	2.4	4.0	3.05	0.35203	.	0.361559	0.20066	N	0.099972	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-12.1681	8.8998	0.35487	0.424:0.576:0.0:0.0	rs6693391;rs56691058	58	Q5SY16	NOL9_HUMAN	A	58	ENSP00000366934:S58A	ENSP00000366934:S58A	S	-	1	0	NOL9	6536978	0.795000	0.28851	0.220000	0.23810	0.044000	0.14063	0.592000	0.23984	0.422000	0.26005	-0.285000	0.09966	TCC	A|0.047;C|0.953		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
NOL9	79707	hgsc.bcm.edu	37	1	6614415	6614415	+	Missense_Mutation	SNP	A	A	G	rs6693400	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:6614415A>G	ENST00000377705.5	-	1	180	c.148T>C	c.(148-150)Tgg>Cgg	p.W50R	TAS1R1_ENST00000328191.4_5'Flank|TAS1R1_ENST00000351136.3_5'Flank|TAS1R1_ENST00000333172.6_5'Flank	NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	50			W -> R (in dbSNP:rs6693400). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		AGTAACCGCCACCGTAGGCGC	0.781													G|||	4907	0.979832	0.9281	0.9914	5008	,	,		8643	1.0		1.0	False		,,,				2504	1.0				p.W50R		.											.	NOL9-515	0			c.T148C						.	G	ARG/TRP	1625,149		742,141,4	2.0	3.0	3.0		148	4.0	0.8	1	dbSNP_116	3	3888,4		1942,4,0	no	missense	NOL9	NM_024654.4	101	2684,145,4	GG,GA,AA		0.1028,8.3991,2.7003	benign	50/703	6614415	5513,153	887	1946	2833	SO:0001583	missense	79707	exon1			ACCGCCACCGTAG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.148T>C	1.37:g.6614415A>G	ENSP00000366934:p.Trp50Arg	0	0		6	6	NM_024654	0	0	0	0	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	2140	0.9798534798534798	452	0.9186991869918699	358	0.988950276243094	572	1.0	758	1.0	G	0.460	-0.889729	0.02511	0.916009	0.998972	ENSG00000162408	ENST00000377705	T	0.14516	2.5	4.0	4.0	0.46444	.	0.198450	0.25411	N	0.030874	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	1.999999999946489E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.38972	-0.9636	9	0.02654	T	1	-21.655	7.9426	0.29967	0.1142:0.0:0.8858:0.0	rs6693400;rs57411617	50	Q5SY16	NOL9_HUMAN	R	50	ENSP00000366934:W50R	ENSP00000366934:W50R	W	-	1	0	NOL9	6537002	0.793000	0.28825	0.806000	0.32338	0.033000	0.12548	0.756000	0.26419	1.042000	0.40150	-0.282000	0.10007	TGG	A|0.020;G|0.980		0.781	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
ATP13A2	23400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17318535	17318535	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:17318535G>A	ENST00000326735.8	-	19	2128	c.2095C>T	c.(2095-2097)Ccc>Tcc	p.P699S	RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000452699.1_Missense_Mutation_p.P694S|ATP13A2_ENST00000341676.5_Missense_Mutation_p.P694S			Q9NQ11	AT132_HUMAN	ATPase type 13A2	699					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		TCCAGGCTGGGCACAGTGGGC	0.662																																					p.P699S		.											.	ATP13A2-93	0			c.C2095T						.						46.0	50.0	49.0					1																	17318535		2203	4300	6503	SO:0001583	missense	23400	exon19			GGCTGGGCACAGT	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.2095C>T	1.37:g.17318535G>A	ENSP00000327214:p.Pro699Ser	254	1		191	173	NM_022089	0	0	1	48	47	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	0.245	-1.010627	0.02095	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000503552	T;T;T;T	0.64991	0.47;0.47;0.47;-0.13	5.0	0.863	0.19062	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.853403	0.10560	N	0.660369	T	0.39708	0.1088	N	0.25789	0.76	0.09310	N	1	B;B;B	0.15141	0.012;0.004;0.0	B;B;B	0.12837	0.003;0.008;0.001	T	0.23833	-1.0177	10	0.09084	T	0.74	-16.9793	3.1437	0.06464	0.1424:0.1047:0.447:0.3059	.	694;694;699	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	S	699;694;694;169	ENSP00000327214:P699S;ENSP00000341115:P694S;ENSP00000413307:P694S;ENSP00000421126:P169S	ENSP00000327214:P699S	P	-	1	0	ATP13A2	17191122	0.001000	0.12720	0.011000	0.14972	0.004000	0.04260	0.016000	0.13377	-0.318000	0.08665	-2.614000	0.00158	CCC	.		0.662	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
FUCA1	2517	hgsc.bcm.edu	37	1	24194773	24194773	+	Missense_Mutation	SNP	G	G	A	rs2070955	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:24194773G>A	ENST00000374479.3	-	1	11	c.4C>T	c.(4-6)Cgg>Tgg	p.R2W		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	2			R -> W (in dbSNP:rs2070955).		fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		CCCGGAGCCCGCATCGCTACC	0.721													G|||	716	0.142971	0.1218	0.121	5008	,	,		13745	0.2183		0.0905	False		,,,				2504	0.1636				p.R2W		.											.	FUCA1-153	0			c.C4T						.	G	TRP/ARG	282,3082		5,272,1405	3.0	5.0	4.0		4	-1.9	0.0	1	dbSNP_96	4	583,6555		14,555,3000	yes	missense	FUCA1	NM_000147.4	101	19,827,4405	AA,AG,GG		8.1676,8.3829,8.2365	probably-damaging	2/467	24194773	865,9637	1682	3569	5251	SO:0001583	missense	2517	exon1			GAGCCCGCATCGC	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.4C>T	1.37:g.24194773G>A	ENSP00000363603:p.Arg2Trp	2	0		25	22	NM_000147	0	0	0	0	0	B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Missense_Mutation	SNP	ENST00000374479.3	37	CCDS244.2	269	0.12316849816849818	45	0.09146341463414634	34	0.09392265193370165	119	0.20804195804195805	71	0.09366754617414248	G	20.6	4.014951	0.75161	0.083829	0.081676	ENSG00000179163	ENST00000374479	T	0.53640	0.61	4.9	-1.94	0.07571	.	1.623860	0.03700	N	0.248360	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.11235	0.004	B	0.04013	0.001	T	0.19095	-1.0316	9	0.72032	D	0.01	-13.4316	0.738	0.00968	0.3085:0.1179:0.3337:0.24	rs2070955;rs2234836;rs9286656;rs9424335;rs16828787;rs17523962;rs61512178	2	P04066	FUCO_HUMAN	W	2	ENSP00000363603:R2W	ENSP00000363603:R2W	R	-	1	2	FUCA1	24067360	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-1.017000	0.03630	-0.245000	0.09625	0.561000	0.74099	CGG	G|0.874;A|0.126		0.721	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147	
CATSPER4	378807	bcgsc.ca	37	1	26527951	26527951	+	Missense_Mutation	SNP	G	G	A	rs6657616	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:26527951G>A	ENST00000456354.2	+	9	1373	c.1306G>A	c.(1306-1308)Gac>Aac	p.D436N		NM_198137.1	NP_937770.1	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4	436			D -> N (in dbSNP:rs6657616).		calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		GTCATCCAAGGACATCCGCCA	0.577													G|||	1053	0.210264	0.3744	0.1657	5008	,	,		17952	0.0218		0.2654	False		,,,				2504	0.1575				p.D436N		.											.	CATSPER4-91	0			c.G1306A						.	G	ASN/ASP	1510,2896	481.7+/-359.2	272,966,965	124.0	108.0	114.0		1306	3.1	0.0	1	dbSNP_116	114	2216,6384	375.4+/-337.8	287,1642,2371	yes	missense	CATSPER4	NM_198137.1	23	559,2608,3336	AA,AG,GG		25.7674,34.2714,28.6483	benign	436/473	26527951	3726,9280	2203	4300	6503	SO:0001583	missense	378807	exon9			TCCAAGGACATCC	BN000273	CCDS30645.1	1p35.3	2011-07-05			ENSG00000188782	ENSG00000188782		"""Voltage-gated ion channels / Cation channels, sperm associated"""	23220	protein-coding gene	gene with protein product		609121				12932298, 17227845, 16382101	Standard	NM_198137		Approved		uc010oez.2	Q7RTX7	OTTHUMG00000003383	ENST00000456354.2:c.1306G>A	1.37:g.26527951G>A	ENSP00000390423:p.Asp436Asn	414	5		314	11	NM_198137	0	0	0	0	0	A1A4W6|Q5VY71	Missense_Mutation	SNP	ENST00000456354.2	37	CCDS30645.1	467	0.21382783882783882	175	0.3556910569105691	69	0.19060773480662985	11	0.019230769230769232	212	0.2796833773087071	G	18.48	3.633953	0.67130	0.342714	0.257674	ENSG00000188782	ENST00000338855;ENST00000456354	D;D	0.97455	-4.39;-4.36	5.1	3.1	0.35709	.	0.271285	0.25695	N	0.028916	T	0.00012	0.0000	L	0.43152	1.355	0.80722	P	0.0	P	0.42409	0.779	B	0.37480	0.251	T	0.00224	-1.1902	9	0.45353	T	0.12	-17.8632	5.74	0.18087	0.1085:0.2169:0.6746:0.0	rs6657616;rs52798453;rs60006559;rs6657616	436	Q7RTX7	CTSR4_HUMAN	N	436	ENSP00000341006:D436N;ENSP00000390423:D436N	ENSP00000341006:D436N	D	+	1	0	CATSPER4	26400538	0.025000	0.19082	0.018000	0.16275	0.149000	0.21700	1.622000	0.36997	2.393000	0.81446	0.313000	0.20887	GAC	G|0.743;A|0.257		0.577	CATSPER4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019849.2	NM_198137	
EFCAB14	9813	ucsc.edu	37	1	47149061	47149061	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:47149061A>G	ENST00000371933.3	-	10	2199	c.1223T>C	c.(1222-1224)tTg>tCg	p.L408S	EFCAB14-AS1_ENST00000442839.1_RNA|EFCAB14_ENST00000544071.1_Missense_Mutation_p.L344S|EFCAB14-AS1_ENST00000418985.1_RNA|EFCAB14_ENST00000484461.1_5'Flank	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	408							calcium ion binding (GO:0005509)										AAATTTTGGCAATGCTGATGG	0.358																																					p.L408S		.											.	.	0			c.T1223C						.						113.0	114.0	114.0					1																	47149061		2203	4300	6503	SO:0001583	missense	9813	exon10			TTTGGCAATGCTG	AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.1223T>C	1.37:g.47149061A>G	ENSP00000361001:p.Leu408Ser	38	0		46	4	NM_014774	0	0	19	19	0	D3DQ23|Q5SXB8	Missense_Mutation	SNP	ENST00000371933.3	37	CCDS30706.1	.	.	.	.	.	.	.	.	.	.	A	14.21	2.466054	0.43839	.	.	ENSG00000159658	ENST00000544071;ENST00000371933	T;T	0.25749	2.28;1.78	5.24	4.13	0.48395	.	0.447963	0.23738	N	0.045049	T	0.15435	0.0372	N	0.15975	0.35	0.29005	N	0.887235	B;B;B	0.24426	0.023;0.01;0.103	B;B;B	0.30572	0.011;0.007;0.117	T	0.13045	-1.0524	10	0.23302	T	0.38	-20.4758	10.219	0.43186	0.9218:0.0:0.0782:0.0	.	200;344;408	B7Z3D1;F5H7K3;O75071	.;.;K0494_HUMAN	S	344;408	ENSP00000442465:L344S;ENSP00000361001:L408S	ENSP00000361001:L408S	L	-	2	0	KIAA0494	46921648	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	1.496000	0.35638	2.326000	0.78906	0.533000	0.62120	TTG	.		0.358	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021931.1	NM_014774	
NOTCH2	4853	hgsc.bcm.edu	37	1	120611964	120611964	+	Missense_Mutation	SNP	G	G	C	rs11810554	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:120611964G>C	ENST00000256646.2	-	1	276	c.57C>G	c.(55-57)tgC>tgG	p.C19W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	19					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.C19W(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGGGGCCGCGCAGCACAGCC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C19W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	1	Substitution - Missense(1)	central_nervous_system(1)	c.C57G						.						6.0	8.0	8.0					1																	120611964		1705	3721	5426	SO:0001583	missense	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGCCGCGCAGCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.57C>G	1.37:g.120611964G>C	ENSP00000256646:p.Cys19Trp	0	0		11	5	NM_024408	0	0	0	0	0	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	697|697	0.3191391941391941|0.3191391941391941	81|81	0.16463414634146342|0.16463414634146342	112|112	0.30939226519337015|0.30939226519337015	224|224	0.3916083916083916|0.3916083916083916	280|280	0.36939313984168864|0.36939313984168864	G|G	6.292|6.292	0.421956|0.421956	0.11928|0.11928	.|.	.|.	ENSG00000134250|ENSG00000134250	ENST00000538680|ENST00000256646	.|T	.|0.57436	.|0.4	3.09|3.09	2.04|2.04	0.26737|0.26737	.|.	.|.	.|.	.|.	.|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.14661|0.14661	0.345|0.345	0.26751|0.26751	N|N	0.970205|0.970205	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.14337|0.14337	-1.0476|-1.0476	6|9	0.87932|0.37606	D|T	0|0.19	.|.	6.7594|6.7594	0.23532|0.23532	0.0:0.0:0.7206:0.2794|0.0:0.0:0.7206:0.2794	rs11810554|rs11810554	.|19;19	.|Q6IQ50;Q04721	.|.;NOTC2_HUMAN	G|W	36|19	.|ENSP00000256646:C19W	ENSP00000439516:A36G|ENSP00000256646:C19W	A|C	-|-	2|3	0|2	NOTCH2|NOTCH2	120413487|120413487	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.313000|0.313000	0.28021|0.28021	0.766000|0.766000	0.26560|0.26560	1.760000|1.760000	0.52011|0.52011	0.184000|0.184000	0.17185|0.17185	GCG|TGC	G|0.680;C|0.320		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	0	0		13	13	NM_053055	0	0	0	4	4	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	0	0		12	12	NM_022371	0	0	0	1	1	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
USH2A	7399	ucsc.edu	37	1	215956274	215956274	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:215956274A>T	ENST00000307340.3	-	53	10777	c.10391T>A	c.(10390-10392)gTg>gAg	p.V3464E	USH2A_ENST00000366943.2_Missense_Mutation_p.V3464E	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3464	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTTGAGGTTCACATCTGGAAA	0.358										HNSCC(13;0.011)																											p.V3464E		.											.	USH2A-115	0			c.T10391A						.						45.0	43.0	44.0					1																	215956274		2203	4299	6502	SO:0001583	missense	7399	exon53			AGGTTCACATCTG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.10391T>A	1.37:g.215956274A>T	ENSP00000305941:p.Val3464Glu	41	0		38	4	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	37	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	3.983	-0.006078	0.07773	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53206	0.63;0.63	5.5	-1.25	0.09405	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.493710	0.04697	N	0.415107	T	0.34366	0.0895	L	0.54323	1.7	0.09310	N	1	B	0.28128	0.201	B	0.19148	0.024	T	0.16217	-1.0410	10	0.02654	T	1	.	5.8929	0.18923	0.4136:0.3846:0.2017:0.0	.	3464	O75445	USH2A_HUMAN	E	3464	ENSP00000305941:V3464E;ENSP00000355910:V3464E	ENSP00000305941:V3464E	V	-	2	0	USH2A	214022897	0.006000	0.16342	0.000000	0.03702	0.003000	0.03518	1.623000	0.37008	-0.489000	0.06716	0.533000	0.62120	GTG	.		0.358	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
C1orf229	388759	hgsc.bcm.edu	37	1	247275218	247275218	+	Silent	SNP	C	C	G	rs141557009	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:247275218C>G	ENST00000408893.2	-	1	501	c.309G>C	c.(307-309)gcG>gcC	p.A103A		NM_207401.1	NP_997284.1	Q6ZS94	CA229_HUMAN	chromosome 1 open reading frame 229	103																	AGCGCGAGGCCGCAGCGGGGA	0.736													C|||	180	0.0359425	0.0522	0.0245	5008	,	,		9692	0.001		0.0398	False		,,,				2504	0.0542				p.A103A		.											.	C1orf229-90	0			c.G309C						.	C		93,2869		0,93,1388	2.0	2.0	2.0		309	-0.7	0.2	1	dbSNP_134	2	197,6065		0,197,2934	no	coding-synonymous	C1orf229	NM_207401.1		0,290,4322	GG,GC,CC		3.146,3.1398,3.144		103/238	247275218	290,8934	1481	3131	4612	SO:0001819	synonymous_variant	388759	exon1			CGAGGCCGCAGCG	BC156415	CCDS1630.1	1q44	2012-05-30			ENSG00000221953	ENSG00000221953			33759	protein-coding gene	gene with protein product							Standard	NM_207401		Approved	FLJ45717	uc001icg.1	Q6ZS94	OTTHUMG00000165196	ENST00000408893.2:c.309G>C	1.37:g.247275218C>G		1	0		66	65	NM_207401	0	0	0	0	0		Silent	SNP	ENST00000408893.2	37	CCDS1630.1																																																																																			C|0.971;G|0.029		0.736	C1orf229-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382614.1	NM_207401	
FAM35BP	414241	bcgsc.ca;mdanderson.org	37	10	46934806	46934806	+	lincRNA	SNP	A	A	G			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr10:46934806A>G	ENST00000600081.1	-	0	1778																											TGGAAGACATAATGTTTACAT	0.368																																					.		.											.	.	0			.						.																																					414241	.			AGACATAATGTTT																													10.37:g.46934806A>G		78	0		49	48	.	0	0	0	2	2		RNA	SNP	ENST00000600081.1	37		.	.	.	.	.	.	.	.	.	.	A	0	-2.771597	0.00081	.	.	ENSG00000165874	ENST00000301038;ENST00000539388	.	.	.	2.34	-1.44	0.08856	.	0.614997	0.16883	N	0.195618	T	0.15132	0.0365	.	.	.	0.20638	N	0.999873	B	0.02656	0.0	B	0.04013	0.001	T	0.41875	-0.9484	7	0.02654	T	1	-0.1144	6.9364	0.24468	0.5781:0.0:0.4219:0.0	.	120	F5H2C6	.	D	189;120	.	ENSP00000301038:N189D	N	+	1	0	FAM35B	46354812	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	0.110000	0.15437	-0.387000	0.07809	-0.769000	0.03391	AAT	.		0.368	RP11-38L15.2-005	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000461086.1		
CDH23	64072	bcgsc.ca	37	10	73270906	73270906	+	Silent	SNP	T	T	C	rs3802720	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr10:73270906T>C	ENST00000224721.6	+	5	371	c.366T>C	c.(364-366)gtT>gtC	p.V122V	CDH23_ENST00000461841.3_Silent_p.V167V|CDH23_ENST00000299366.7_Silent_p.V167V|CDH23-AS1_ENST00000428918.1_RNA|CDH23_ENST00000398809.4_Silent_p.V122V|CDH23_ENST00000398842.3_Silent_p.V122V	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	122	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						ACATCCAGGTTGGGGATGTGA	0.572													C|||	3679	0.734625	0.9856	0.5	5008	,	,		19305	0.7758		0.6889	False		,,,				2504	0.5665				p.V122V		.											.	CDH23-563	0			c.T366C						.	C	,,,,	3771,271		1762,247,12	106.0	116.0	113.0		366,366,366,366,366	-11.2	0.1	10	dbSNP_107	113	5521,2833		1835,1851,491	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	CDH23	NM_001171930.1,NM_001171931.1,NM_001171932.1,NM_022124.5,NM_052836.3	,,,,	3597,2098,503	CC,CT,TT		33.9119,6.7046,25.0403	,,,,	122/1382,122/1062,122/407,122/3355,122/531	73270906	9292,3104	2021	4177	6198	SO:0001819	synonymous_variant	64072	exon6			CCAGGTTGGGGAT	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.366T>C	10.37:g.73270906T>C		189	0		91	5	NM_052836	0	0	0	0	0	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	ENST00000224721.6	37																																																																																				T|0.244;C|0.756		0.572	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
SEMA4G	57715	ucsc.edu;bcgsc.ca	37	10	102734778	102734778	+	Intron	SNP	C	C	G	rs4919510	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr10:102734778C>G	ENST00000370250.4	+	3	709				SEMA4G_ENST00000210633.3_Intron|MIR608_ENST00000384820.1_RNA|SEMA4G_ENST00000519756.1_Intron|SEMA4G_ENST00000517724.1_Intron	NM_017893.3	NP_060363.2	Q9NTN9	SEM4G_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G						cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Colorectal(252;0.234)		Epithelial(162;3.71e-09)|all cancers(201;2.1e-07)		TGGGACAGCTCCGTTTAAAAA	0.473													G|||	1822	0.363818	0.4402	0.2867	5008	,	,		17643	0.5248		0.1789	False		,,,				2504	0.3395				.		.											.	.	0			.						.	G	,	1245,1891		251,743,574	42.0	47.0	45.0		,	1.7	0.0	10	dbSNP_111	45	1460,5704		154,1152,2276	no	intron,intron	SEMA4G	NM_001203244.1,NM_017893.3	,	405,1895,2850	GG,GC,CC		20.3797,39.7003,26.2621	,	,	102734778	2705,7595	1568	3582	5150	SO:0001627	intron_variant	693193	.			ACAGCTCCGTTTA	AB046839	CCDS7501.1, CCDS55724.1	10q24.31	2013-01-11			ENSG00000095539	ENSG00000095539		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10735	protein-coding gene	gene with protein product							Standard	NM_017893		Approved	FLJ20590, KIAA1619	uc001krw.2	Q9NTN9	OTTHUMG00000018922	ENST00000370250.4:c.336+1412C>G	10.37:g.102734778C>G		31	0		38	8	.	0	0	0	0	0	A1A5C6|A6NJY8|Q58EY1|Q9HCF3	RNA	SNP	ENST00000370250.4	37																																																																																				C|0.660;G|0.340		0.473	SEMA4G-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049920.2		
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR|NFKB2_ENST00000428099.1_Silent_p.P423P	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		0	0		11	11	NM_001077494	0	0	0	0	0	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
CUEDC2	79004	broad.mit.edu;bcgsc.ca	37	10	104183193	104183193	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr10:104183193C>T	ENST00000369937.4	-	9	999	c.854G>A	c.(853-855)cGc>cAc	p.R285H	PSD_ENST00000492902.2_5'Flank|CUEDC2_ENST00000465409.1_5'UTR	NM_024040.2	NP_076945.2	Q9H467	CUED2_HUMAN	CUE domain containing 2	285						cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TCAATGGAAGCGGTACTTTCT	0.582											OREG0020479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R285H		.											.	CUEDC2-90	0			c.G854A						.						172.0	179.0	177.0					10																	104183193		2041	4211	6252	SO:0001583	missense	79004	exon9			TGGAAGCGGTACT	BC000262	CCDS41566.1	10q24.32	2008-10-23	2004-03-04	2004-03-05	ENSG00000107874	ENSG00000107874			28352	protein-coding gene	gene with protein product		614142	"""chromosome 10 open reading frame 66"""	C10orf66		12477932	Standard	NM_024040		Approved	MGC2491	uc001kvn.2	Q9H467	OTTHUMG00000018958	ENST00000369937.4:c.854G>A	10.37:g.104183193C>T	ENSP00000358953:p.Arg285His	257	0	1379	174	8	NM_024040	0	1	119	120	0	D3DR88|Q9BWG8	Missense_Mutation	SNP	ENST00000369937.4	37	CCDS41566.1	.	.	.	.	.	.	.	.	.	.	C	14.75	2.628715	0.46944	.	.	ENSG00000107874	ENST00000369937	D	0.91295	-2.82	4.85	2.7	0.31948	.	0.274626	0.30859	N	0.008735	D	0.86368	0.5916	L	0.27053	0.805	0.39458	D	0.967525	D	0.65815	0.995	P	0.54924	0.764	D	0.83606	0.0131	10	0.42905	T	0.14	-9.6686	4.0251	0.09683	0.0:0.4853:0.0:0.5147	.	285	Q9H467	CUED2_HUMAN	H	285	ENSP00000358953:R285H	ENSP00000358953:R285H	R	-	2	0	CUEDC2	104173183	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.455000	0.60075	1.050000	0.40346	0.462000	0.41574	CGC	.		0.582	CUEDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050060.1	NM_024040	
COL17A1	1308	broad.mit.edu	37	10	105816838	105816838	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr10:105816838C>A	ENST00000353479.5	-	17	1650	c.1360G>T	c.(1360-1362)Gcc>Tcc	p.A454S	COL17A1_ENST00000480127.1_5'Flank|COL17A1_ENST00000369733.3_Missense_Mutation_p.A454S	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	454	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)		p.A454S(1)		NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGGCACCAGGCTGGCGCTGGT	0.672																																					p.A454S		.											.	COL17A1-95	1	Substitution - Missense(1)	endometrium(1)	c.G1360T						.						16.0	21.0	20.0					10																	105816838		2199	4294	6493	SO:0001583	missense	1308	exon17			ACCAGGCTGGCGC	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1360G>T	10.37:g.105816838C>A	ENSP00000340937:p.Ala454Ser	28	0		135	6	NM_000494	0	0	0	0	0	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	C	8.584	0.883057	0.17467	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872	T;T	0.50548	0.74;0.74	4.72	0.566	0.17317	.	0.173529	0.26734	N	0.022765	T	0.35595	0.0937	L	0.46157	1.445	0.45464	D	0.998432	B;B	0.09022	0.002;0.001	B;B	0.14023	0.01;0.005	T	0.10154	-1.0642	10	0.62326	D	0.03	-3.3983	5.9568	0.19277	0.3728:0.4825:0.0:0.1447	.	454;454	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	S	454;454;438	ENSP00000340937:A454S;ENSP00000358748:A454S	ENSP00000340937:A454S	A	-	1	0	COL17A1	105806828	0.007000	0.16637	0.069000	0.20011	0.451000	0.32288	0.015000	0.13355	-0.175000	0.10725	0.313000	0.20887	GCC	.		0.672	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
MKI67	4288	hgsc.bcm.edu	37	10	129899793	129899793	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr10:129899793G>T	ENST00000368654.3	-	14	9809	c.9434C>A	c.(9433-9435)cCt>cAt	p.P3145H	MKI67_ENST00000368653.3_Missense_Mutation_p.P2785H	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	3145					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTTGTCTCTAGGTATGGGTTT	0.483																																					p.P3145H		.											.	MKI67-519	0			c.C9434A						.						175.0	170.0	172.0					10																	129899793		2203	4300	6503	SO:0001583	missense	4288	exon14			TCTCTAGGTATGG	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.9434C>A	10.37:g.129899793G>T	ENSP00000357643:p.Pro3145His	109	0		68	4	NM_002417	0	0	21	21	0	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	37	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	G	6.845	0.525241	0.13066	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01430	4.94;4.9	3.11	2.19	0.27852	.	1.137620	0.06488	N	0.734075	T	0.01320	0.0043	N	0.14661	0.345	0.09310	N	1	P;P	0.36495	0.556;0.553	B;B	0.35073	0.195;0.095	T	0.51482	-0.8700	10	0.62326	D	0.03	.	8.3275	0.32167	0.0:0.243:0.757:0.0	.	2785;3145	P46013-2;P46013	.;KI67_HUMAN	H	3145;2785;3144	ENSP00000357643:P3145H;ENSP00000357642:P2785H	ENSP00000357642:P2785H	P	-	2	0	MKI67	129789783	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.202000	0.17295	0.881000	0.35993	-0.257000	0.10917	CCT	.		0.483	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
PWWP2B	170394	hgsc.bcm.edu	37	10	134218296	134218296	+	Missense_Mutation	SNP	C	C	G	rs10747057	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr10:134218296C>G	ENST00000305233.5	+	2	351	c.292C>G	c.(292-294)Cgc>Ggc	p.R98G	PWWP2B_ENST00000368609.4_Missense_Mutation_p.R98G	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	98	Pro-rich.		R -> G (in dbSNP:rs10747057). {ECO:0000269|PubMed:15489334}.							central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CGAGACCACCCGCCCCGAGCC	0.756													G|||	2967	0.592452	0.7065	0.5461	5008	,	,		5878	0.6954		0.4563	False		,,,				2504	0.5051				p.R98G		.											.	PWWP2B-90	0			c.C292G						.	G	GLY/ARG,GLY/ARG	2822,1070		1079,664,203	6.0	9.0	8.0		292,292	2.8	0.0	10	dbSNP_120	8	3931,3905		1096,1739,1083	no	missense,missense	PWWP2B	NM_001098637.1,NM_138499.3	125,125	2175,2403,1286	GG,GC,CC		49.8341,27.4923,42.4198	benign,benign	98/500,98/591	134218296	6753,4975	1946	3918	5864	SO:0001583	missense	170394	exon2			ACCACCCGCCCCG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.292C>G	10.37:g.134218296C>G	ENSP00000306324:p.Arg98Gly	0	0		7	7	NM_001098637	0	0	0	5	5	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Missense_Mutation	SNP	ENST00000305233.5	37	CCDS7667.2	1241	0.5682234432234432	337	0.6849593495934959	177	0.4889502762430939	394	0.6888111888111889	333	0.4393139841688654	G	0.032	-1.327586	0.01309	0.725077	0.501659	ENSG00000171813	ENST00000305233;ENST00000368609	T;T	0.54675	0.56;1.56	2.77	2.77	0.32553	.	1.934230	0.03132	N	0.165319	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44003	-0.9356	9	0.23302	T	0.38	0.1321	1.7392	0.02948	0.1217:0.2122:0.4474:0.2187	rs10747057;rs57970936	98	Q6NUJ5	PWP2B_HUMAN	G	98	ENSP00000306324:R98G;ENSP00000357598:R98G	ENSP00000306324:R98G	R	+	1	0	PWWP2B	134068286	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-1.230000	0.02942	0.744000	0.32741	-0.224000	0.12420	CGC	C|0.431;G|0.569		0.756	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
MUC5B	727897	bcgsc.ca	37	11	1266696	1266696	+	Silent	SNP	A	A	C	rs532138150	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr11:1266696A>C	ENST00000529681.1	+	31	8644	c.8586A>C	c.(8584-8586)ccA>ccC	p.P2862P	MUC5B_ENST00000447027.1_Silent_p.P2865P|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2862	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CATCGGCCCCAATAACCACGG	0.692													-|||	1610	0.321486	0.236	0.3386	5008	,	,		9611	0.497		0.2575	False		,,,				2504	0.3098				p.P2862P		.											.	.	0			c.A8586C						.						54.0	65.0	61.0					11																	1266696		1727	3813	5540	SO:0001819	synonymous_variant	727897	exon31			GGCCCCAATAACC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8586A>C	11.37:g.1266696A>C		188	1		83	45	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			A|0.500;C|0.500		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	216	2		87	35	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
WEE1	7465	hgsc.bcm.edu	37	11	9595897	9595897	+	Silent	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr11:9595897G>T	ENST00000450114.2	+	1	670	c.417G>T	c.(415-417)tcG>tcT	p.S139S	WEE1_ENST00000299613.6_5'Flank	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	139					blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		GCTCTTTCTCGCCGGTGCGCT	0.781																																					p.S139S		.											.	WEE1-1404	0			c.G417T						.						3.0	5.0	4.0					11																	9595897		1606	3502	5108	SO:0001819	synonymous_variant	7465	exon1			TTTCTCGCCGGTG	X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.417G>T	11.37:g.9595897G>T		5	0		17	4	NM_003390	0	0	0	0	0	B3KVE1|D3DQV0	Silent	SNP	ENST00000450114.2	37	CCDS7800.1																																																																																			.		0.781	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386757.1	NM_003390	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000540748.1_5'UTR|TM7SF2_ENST00000345348.5_Silent_p.P52P	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		0	0		13	13	NM_003273	0	0	0	27	27	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
KRTAP5-7	440050	bcgsc.ca	37	11	71238685	71238685	+	Silent	SNP	G	G	A	rs568152352	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr11:71238685G>A	ENST00000398536.4	+	1	373	c.339G>A	c.(337-339)caG>caA	p.Q113Q		NM_001012503.1	NP_001012521.1	Q6L8G8	KRA57_HUMAN	keratin associated protein 5-7	113	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				breast(1)|endometrium(1)|kidney(3)|lung(6)|ovary(1)	12						cctgctgccagtccagctgct	0.617													g|||	3	0.000599042	0.0023	0.0	5008	,	,		19208	0.0		0.0	False		,,,				2504	0.0				p.Q113Q		.											.	KRTAP5-7-68	0			c.G339A						.																																			SO:0001819	synonymous_variant	440050	exon1			CTGCCAGTCCAGC	AB126076	CCDS41682.1	11q13.4	2008-02-05			ENSG00000244411	ENSG00000244411		"""Keratin associated proteins"""	23602	protein-coding gene	gene with protein product						15144888	Standard	NM_001012503		Approved	KRTAP5.7, KRTAP5-3	uc001oqq.1	Q6L8G8	OTTHUMG00000057570	ENST00000398536.4:c.339G>A	11.37:g.71238685G>A		169	4		100	7	NM_001012503	0	0	0	0	0	B2RNM3|Q701N5	Silent	SNP	ENST00000398536.4	37	CCDS41682.1																																																																																			.		0.617	KRTAP5-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127953.1		
GRIN2B	2904	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	13717131	13717131	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr12:13717131T>A	ENST00000609686.1	-	13	3250	c.3041A>T	c.(3040-3042)cAg>cTg	p.Q1014L		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1014					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGACCTGGACTGGGTGGTGAA	0.577																																					p.Q1014L		.											.	GRIN2B-231	0			c.A3041T						.						113.0	87.0	96.0					12																	13717131		2203	4300	6503	SO:0001583	missense	2904	exon13			CTGGACTGGGTGG		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3041A>T	12.37:g.13717131T>A	ENSP00000477455:p.Gln1014Leu	217	1		286	107	NM_000834	0	0	0	0	0	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.136542	0.56936	.	.	ENSG00000150086	ENST00000279593	T	0.12465	2.68	5.49	4.27	0.50696	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.16171	0.0389	L	0.48642	1.525	0.58432	D	0.999999	B	0.33857	0.429	B	0.39027	0.288	T	0.03202	-1.1061	10	0.51188	T	0.08	.	12.1842	0.54227	0.0:0.0:0.1426:0.8574	.	1014	Q13224	NMDE2_HUMAN	L	1014	ENSP00000279593:Q1014L	ENSP00000279593:Q1014L	Q	-	2	0	GRIN2B	13608398	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	6.180000	0.71981	2.094000	0.63399	0.528000	0.53228	CAG	.		0.577	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268014.2		
ABCC9	10060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21960411	21960411	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr12:21960411C>T	ENST00000261201.4	-	36	4317	c.4318G>A	c.(4318-4320)Gcg>Acg	p.A1440T	ABCC9_ENST00000345162.2_Missense_Mutation_p.A1404T|ABCC9_ENST00000261200.4_Missense_Mutation_p.A1440T	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	1440	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	GTGACAACCGCATCTAAATCA	0.398																																					p.A1440T		.											.	ABCC9-96	0			c.G4318A						.						95.0	87.0	89.0					12																	21960411		2203	4300	6503	SO:0001583	missense	10060	exon36			CAACCGCATCTAA	AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.4318G>A	12.37:g.21960411C>T	ENSP00000261201:p.Ala1440Thr	59	0		88	49	NM_005691	0	0	0	0	0	O60707	Missense_Mutation	SNP	ENST00000261201.4	37	CCDS8694.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940823	0.73557	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15	5.02	5.02	0.67125	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.055041	0.64402	D	0.000001	D	0.85177	0.5637	N	0.00462	-1.47	0.80722	D	1	P;P	0.47106	0.89;0.724	P;P	0.52957	0.714;0.474	D	0.87750	0.2591	10	0.22706	T	0.39	-15.5615	18.5246	0.90967	0.0:1.0:0.0:0.0	.	1440;1440	O60706;O60706-2	ABCC9_HUMAN;.	T	1440;1067;1440;1404	ENSP00000261200:A1440T;ENSP00000440521:A1067T;ENSP00000261201:A1440T;ENSP00000261202:A1404T	ENSP00000261200:A1440T	A	-	1	0	ABCC9	21851678	1.000000	0.71417	0.997000	0.53966	0.983000	0.72400	7.534000	0.82004	2.585000	0.87301	0.561000	0.74099	GCG	.		0.398	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402230.1	NM_005691	
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		0	0		22	22	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
KRT2	3849	ucsc.edu	37	12	53045615	53045615	+	Silent	SNP	A	A	G	rs532019270|rs75253159	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr12:53045615A>G	ENST00000309680.3	-	1	333	c.312T>C	c.(310-312)ggT>ggC	p.G104G		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	104	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		agccgctgccacctccaaagc	0.622																																					p.G104G		.											.	KRT2-92	0			c.T312C						.						48.0	30.0	36.0					12																	53045615		2193	4285	6478	SO:0001819	synonymous_variant	3849	exon1			GCTGCCACCTCCA		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.312T>C	12.37:g.53045615A>G		121	2		162	36	NM_000423	0	0	0	0	0	Q4VAQ2	Silent	SNP	ENST00000309680.3	37	CCDS8835.1																																																																																			A|0.961;G|0.039		0.622	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
MDM2	4193	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	69233423	69233423	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr12:69233423G>C	ENST00000350057.5	+	9	1195	c.1195G>C	c.(1195-1197)Gag>Cag	p.E399Q	MDM2_ENST00000478070.1_3'UTR|MDM2_ENST00000517852.1_Missense_Mutation_p.E63Q|MDM2_ENST00000428863.2_Missense_Mutation_p.E203Q|MDM2_ENST00000356290.4_Missense_Mutation_p.E254Q|MDM2_ENST00000393410.1_Missense_Mutation_p.E176Q|MDM2_ENST00000258149.5_Missense_Mutation_p.E369Q|MDM2_ENST00000393412.3_Missense_Mutation_p.E151Q|MDM2_ENST00000540827.1_Missense_Mutation_p.E229Q|MDM2_ENST00000258148.7_Missense_Mutation_p.E375Q|RP11-611O2.5_ENST00000553141.1_RNA|MDM2_ENST00000544561.1_Intron|MDM2_ENST00000348801.2_Missense_Mutation_p.E198Q|MDM2_ENST00000360430.2_Missense_Mutation_p.E229Q|MDM2_ENST00000545204.1_3'UTR|MDM2_ENST00000393413.3_Missense_Mutation_p.E151Q|MDM2_ENST00000462284.1_Missense_Mutation_p.E430Q|MDM2_ENST00000299252.4_Missense_Mutation_p.E254Q			Q00987	MDM2_HUMAN	MDM2 proto-oncogene, E3 ubiquitin protein ligase	424	Necessary for interaction with USP2.				cellular response to acid chemical (GO:0071229)|cellular response to alkaloid (GO:0071312)|cellular response to antibiotic (GO:0071236)|cellular response to estrogen stimulus (GO:0071391)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to UV-C (GO:0071494)|cellular response to vitamin B1 (GO:0071301)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment of protein localization (GO:0045184)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein processing (GO:0010955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-lysine modification (GO:0018205)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein export from nucleus (GO:0046827)|protein complex assembly (GO:0006461)|protein destabilization (GO:0031648)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of protein catabolic process (GO:0042176)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ether (GO:0045472)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to morphine (GO:0043278)|synaptic transmission (GO:0007268)|traversing start control point of mitotic cell cycle (GO:0007089)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(8)|prostate(1)|urinary_tract(1)	19	all_cancers(1;8.46e-121)|all_epithelial(5;3.21e-36)|Lung NSC(4;2.16e-33)|all_lung(4;3.03e-31)|Glioma(1;1.9e-09)|Breast(13;1.59e-06)|all_neural(1;1.03e-05)|Melanoma(1;0.0171)|Renal(347;0.0684)		all cancers(2;8.67e-65)|GBM - Glioblastoma multiforme(2;8.89e-62)|BRCA - Breast invasive adenocarcinoma(5;2.43e-08)|Lung(24;1.5e-05)|LUAD - Lung adenocarcinoma(15;8.5e-05)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			AGACAAAGAAGAGAGTGTGGA	0.403			A		"""sarcoma, glioma, colorectal, other"""																																p.E430Q		.		Dom	yes		12	12q15	4193	Mdm2 p53 binding protein homolog		"""M, O, E, L"""	.	MDM2-1270	0			c.G1288C						.						143.0	134.0	137.0					12																	69233423		1886	4117	6003	SO:0001583	missense	4193	exon11			AAAGAAGAGAGTG		CCDS8986.2, CCDS61189.1	12q13-q14	2014-06-26	2014-06-26		ENSG00000135679	ENSG00000135679			6973	protein-coding gene	gene with protein product		164785	"""mouse double minute 2, human homolog of; p53-binding protein"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse)"", ""Mdm2 p53 binding protein homolog (mouse)"""			1614537, 16905769	Standard	NM_002392		Approved	HDM2, MGC5370	uc001sui.4	Q00987	OTTHUMG00000142827	ENST00000350057.5:c.1195G>C	12.37:g.69233423G>C	ENSP00000266624:p.Glu399Gln	309	0		367	183	NM_002392	0	0	1	2	1	A6NL51|A8K2S6|Q13226|Q13297|Q13298|Q13299|Q13300|Q13301|Q53XW0|Q71TW9|Q8WYJ1|Q8WYJ2|Q9UGI3|Q9UMT8	Missense_Mutation	SNP	ENST00000350057.5	37		.	.	.	.	.	.	.	.	.	.	G	10.34	1.322572	0.23994	.	.	ENSG00000135679	ENST00000462284;ENST00000544648;ENST00000258149;ENST00000356290;ENST00000540827;ENST00000428863;ENST00000393412;ENST00000311420;ENST00000258148;ENST00000393413;ENST00000350057;ENST00000393410;ENST00000299252;ENST00000360430;ENST00000517852;ENST00000348801	T;T;T;T;T;T;T;T;T;T;T;T;T	0.46819	1.44;2.94;2.94;2.94;2.94;2.94;0.86;2.94;1.44;2.94;2.94;2.94;2.94	5.44	1.36	0.22044	.	0.524204	0.22268	N	0.062318	T	0.46502	0.1396	M	0.65498	2.005	0.21782	N	0.999547	P;P;P;P;P;P;P;P;P;P	0.50156	0.9;0.799;0.799;0.893;0.865;0.799;0.551;0.835;0.932;0.873	B;B;B;B;P;B;B;P;B;B	0.46825	0.386;0.39;0.39;0.405;0.528;0.162;0.355;0.471;0.445;0.306	T	0.35699	-0.9778	9	.	.	.	-8.7882	6.9579	0.24582	0.0673:0.2328:0.5799:0.12	.	379;203;151;176;254;424;375;229;63;430	Q00987-9;Q00987-3;Q00987-4;Q9H4C5;Q00987-5;Q00987;G3XA89;Q00987-2;Q9H4C3;Q00987-11	.;.;.;.;.;MDM2_HUMAN;.;.;.;.	Q	430;379;369;254;229;203;151;385;375;151;399;176;254;229;63;198	ENSP00000417281:E430Q;ENSP00000258149:E369Q;ENSP00000348637:E254Q;ENSP00000440932:E229Q;ENSP00000410694:E203Q;ENSP00000377064:E151Q;ENSP00000258148:E375Q;ENSP00000377065:E151Q;ENSP00000266624:E399Q;ENSP00000377062:E176Q;ENSP00000299252:E254Q;ENSP00000353611:E229Q;ENSP00000335096:E198Q	.	E	+	1	0	MDM2	67519690	1.000000	0.71417	0.215000	0.23724	0.065000	0.16274	3.919000	0.56439	0.321000	0.23259	-0.176000	0.13171	GAG	.		0.403	MDM2-033	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000402665.1	NM_006880	
STAB2	55576	hgsc.bcm.edu	37	12	104025393	104025453	+	Frame_Shift_Del	DEL	GGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTG	GGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTG	-	rs200595336|rs147053330|rs149132285	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	GGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTG	GGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr12:104025393_104025453delGGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTG	ENST00000388887.2	+	6	709_769	c.505_565delGGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTG	c.(505-567)ggggtgtgcaacagtggactagatggcgatggaacctgtgagtgctactctgcgtacactggcfs	p.GVCNSGLDGDGTCECYSAYTG169fs		NM_017564.9	NP_060034.9			stabilin 2									p.G177>?(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CTGTGTGCATGGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTGGCCCCAAGTG	0.448																																					p.169_189del		.											.	STAB2-104	1	Complex(1)	lung(1)	c.505_565del						.																																			SO:0001589	frameshift_variant	55576	exon6			GTGCATGGGGTGT	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.505_565delGGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTG	12.37:g.104025393_104025453delGGGGTGTGCAACAGTGGACTAGATGGCGATGGAACCTGTGAGTGCTACTCTGCGTACACTG	ENSP00000373539:p.Gly169fs	159	0		158	0	NM_017564	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000388887.2	37	CCDS31888.1																																																																																			.		0.448	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
BTBD11	121551	hgsc.bcm.edu	37	12	107713511	107713511	+	Missense_Mutation	SNP	G	G	C	rs961498	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr12:107713511G>C	ENST00000280758.5	+	1	1322	c.794G>C	c.(793-795)gGg>gCg	p.G265A	BTBD11_ENST00000490090.2_Missense_Mutation_p.G265A|BTBD11_ENST00000420571.2_Missense_Mutation_p.G265A	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	265						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGTGGCCCTGGGTCAGGCTCG	0.751													G|||	1975	0.394369	0.2194	0.4539	5008	,	,		9398	0.4127		0.492	False		,,,				2504	0.4693				p.G265A		.											.	BTBD11-93	0			c.G794C						.	G	ALA/GLY	786,2720		135,516,1102	5.0	3.0	3.0		794	4.2	0.1	12	dbSNP_86	3	2882,3822		730,1422,1200	no	missense	BTBD11	NM_001018072.1	60	865,1938,2302	CC,CG,GG		42.9893,22.4187,35.9256	benign	265/1105	107713511	3668,6542	1753	3352	5105	SO:0001583	missense	121551	exon1			GCCCTGGGTCAGG	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.794G>C	12.37:g.107713511G>C	ENSP00000280758:p.Gly265Ala	0	0		9	9	NM_001018072	0	0	0	0	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	899	0.4116300366300366	119	0.241869918699187	158	0.43646408839779005	241	0.42132867132867136	381	0.5026385224274407	G	11.75	1.731449	0.30684	0.224187	0.429893	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090	T;T;T	0.33865	1.39;1.48;1.43	4.15	4.15	0.48705	Histone-fold (1);	0.272599	0.26478	N	0.024144	T	0.00012	0.0000	L	0.52905	1.665	0.09310	P	1.0	B;B;B	0.28971	0.229;0.088;0.143	B;B;B	0.29176	0.099;0.017;0.061	T	0.47898	-0.9081	9	0.54805	T	0.06	.	13.8733	0.63634	0.0:0.0:1.0:0.0	rs961498	265;265;265	A6QL63-2;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	A	265	ENSP00000280758:G265A;ENSP00000413889:G265A;ENSP00000447319:G265A	ENSP00000280758:G265A	G	+	2	0	BTBD11	106237641	0.973000	0.33851	0.080000	0.20451	0.808000	0.45660	2.685000	0.46959	2.308000	0.77769	0.549000	0.68633	GGG	G|0.588;C|0.412		0.751	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
NCOR2	9612	hgsc.bcm.edu	37	12	124821523	124821523	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr12:124821523G>C	ENST00000405201.1	-	38	5891	c.5891C>G	c.(5890-5892)tCc>tGc	p.S1964C	NCOR2_ENST00000397355.1_Missense_Mutation_p.S1955C|NCOR2_ENST00000404621.1_Missense_Mutation_p.S1954C|NCOR2_ENST00000429285.2_Missense_Mutation_p.S1954C|NCOR2_ENST00000356219.3_Missense_Mutation_p.S1971C|NCOR2_ENST00000404121.2_Missense_Mutation_p.S1525C			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1975					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTCCAGCCCGGAGCGGGCTGG	0.756																																					p.S1964C		.											.	NCOR2-229	0			c.C5891G						.						6.0	9.0	8.0					12																	124821523		1723	3808	5531	SO:0001583	missense	9612	exon40			AGCCCGGAGCGGG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5891C>G	12.37:g.124821523G>C	ENSP00000384018:p.Ser1964Cys	0	0		28	18	NM_006312	0	1	6	16	9	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	g	10.67	1.415224	0.25552	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000447675;ENST00000429285	T;T;T;T;T;T	0.19394	2.16;2.42;2.16;2.42;2.15;2.42	3.46	1.57	0.23409	.	1.162440	0.06628	U	0.758620	T	0.13543	0.0328	N	0.14661	0.345	0.09310	N	1	B;B;B	0.10296	0.0;0.0;0.003	B;B;B	0.04013	0.0;0.001;0.001	T	0.33979	-0.9847	10	0.48119	T	0.1	.	7.9622	0.30079	0.0924:0.1615:0.7461:0.0	.	1955;1964;1975	C9J239;C9JFD3;Q9Y618	.;.;NCOR2_HUMAN	C	1964;1954;1971;1955;1963;1525;56;1954	ENSP00000384018:S1964C;ENSP00000384202:S1954C;ENSP00000348551:S1971C;ENSP00000380513:S1955C;ENSP00000385618:S1525C;ENSP00000400281:S1954C	ENSP00000348551:S1971C	S	-	2	0	NCOR2	123387476	0.271000	0.24162	0.006000	0.13384	0.719000	0.41307	3.388000	0.52509	0.028000	0.15324	-0.271000	0.10264	TCC	.		0.756	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
SPERT	220082	hgsc.bcm.edu	37	13	46288017	46288017	+	Nonsense_Mutation	SNP	C	C	A	rs79707842	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr13:46288017C>A	ENST00000310521.1	+	3	937	c.857C>A	c.(856-858)tCa>tAa	p.S286*	SPERT_ENST00000378966.3_Nonsense_Mutation_p.S250*	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	286						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		CCCGCCCCCTCACCCCACGAG	0.721													c|||	310	0.061901	0.0068	0.0865	5008	,	,		14469	0.0982		0.0875	False		,,,				2504	0.0552				p.S286X		.											.	SPERT-91	0			c.C857A						.		stop/SER	36,3866		0,36,1915	5.0	8.0	7.0		857	3.2	0.0	13	dbSNP_131	7	419,7219		3,413,3403	no	stop-gained	SPERT	NM_152719.1		3,449,5318	AA,AC,CC		5.4857,0.9226,3.9428		286/449	46288017	455,11085	1951	3819	5770	SO:0001587	stop_gained	220082	exon3			CCCCCTCACCCCA	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.857C>A	13.37:g.46288017C>A	ENSP00000309189:p.Ser286*	1	0		16	16	NM_152719	0	0	0	0	0	A8K8I5|Q8NHV2	Nonsense_Mutation	SNP	ENST00000310521.1	37	CCDS9399.1	161	0.07371794871794872	6	0.012195121951219513	23	0.06353591160220995	68	0.11888111888111888	64	0.08443271767810026	C	21.5	4.165935	0.78339	0.009226	0.054857	ENSG00000174015	ENST00000310521;ENST00000378966	.	.	.	5.05	3.24	0.37175	.	0.731762	0.12237	N	0.486921	.	.	.	.	.	.	0.09310	P	0.9999999999958166	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5116	0.27577	0.1627:0.751:0.0:0.0863	.	.	.	.	X	286;250	.	ENSP00000309189:S286X	S	+	2	0	SPERT	45186018	0.000000	0.05858	0.005000	0.12908	0.004000	0.04260	0.355000	0.20163	1.350000	0.45770	0.655000	0.94253	TCA	C|0.925;A|0.075		0.721	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044786.2	NM_152719	
TRIM13	10206	hgsc.bcm.edu;bcgsc.ca	37	13	50588527	50588530	+	3'UTR	DEL	ATAT	ATAT	-			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	ATAT	ATAT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr13:50588527_50588530delATAT	ENST00000378182.3	+	0	3189_3192				TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000312942.1_5'Flank|KCNRG_ENST00000360473.4_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		gtacacatacatatatatacatat	0.294																																					.		.											.	TRIM13-228	0			.						.																																			SO:0001624	3_prime_UTR_variant	10206	.			ACATACATATATA	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*1230ATAT>-	13.37:g.50588531_50588534delATAT		24	0		17	14	.	0	0	0	0	0	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	DEL	ENST00000378182.3	37	CCDS9423.1																																																																																			.		0.294	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
RBM23	55147	ucsc.edu	37	14	23371268	23371268	+	Silent	SNP	A	A	G	rs56708790	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr14:23371268A>G	ENST00000359890.3	-	12	1362	c.1167T>C	c.(1165-1167)gcT>gcC	p.A389A	RBM23_ENST00000346528.5_Silent_p.A355A|RBM23_ENST00000555209.1_Silent_p.A139A|RBM23_ENST00000399922.2_Silent_p.A373A|RBM23_ENST00000542016.2_Silent_p.A219A	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23	389	Ala-rich.				mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		cggcggcggcagcagcagcag	0.552													A|||	195	0.0389377	0.0053	0.0778	5008	,	,		16698	0.0179		0.0676	False		,,,				2504	0.0491				p.A389A		.											.	RBM23-91	0			c.T1167C						.	A	,,	54,3898		1,52,1923	34.0	35.0	35.0		1167,1065,1119	-2.4	0.4	14	dbSNP_129	35	529,7793		7,515,3639	yes	coding-synonymous,coding-synonymous,coding-synonymous	RBM23	NM_001077351.1,NM_001077352.1,NM_018107.4	,,	8,567,5562	GG,GA,AA		6.3566,1.3664,4.7499	,,	389/440,355/406,373/424	23371268	583,11691	1976	4161	6137	SO:0001819	synonymous_variant	55147	exon12			GGCGGCAGCAGCA	AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.1167T>C	14.37:g.23371268A>G		53	0		52	7	NM_001077351	0	0	16	32	16	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Silent	SNP	ENST00000359890.3	37	CCDS41921.1	252	0.11538461538461539	8	0.016260162601626018	50	0.13812154696132597	73	0.12762237762237763	121	0.15963060686015831	A	0.768	-0.766868	0.02974	0.013664	0.063566	ENSG00000100461	ENST00000553884	.	.	.	3.36	-2.38	0.06622	.	.	.	.	.	T	0.00300	0.0009	.	.	.	0.53005	D	0.999961	.	.	.	.	.	.	T	0.04294	-1.0962	4	.	.	.	.	8.3885	0.32514	0.37:0.0:0.63:0.0	rs56708790;rs61730800	.	.	.	R	164	.	.	C	-	1	0	RBM23	22441108	0.115000	0.22152	0.443000	0.26883	0.195000	0.23768	0.047000	0.14056	-0.453000	0.07076	0.402000	0.26972	TGC	A|0.887;G|0.113		0.552	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413545.3		
OTX2	5015	ucsc.edu;bcgsc.ca	37	14	57272121	57272121	+	Silent	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr14:57272121G>T	ENST00000555006.1	-	2	462	c.54C>A	c.(52-54)acC>acA	p.T18T	OTX2_ENST00000408990.3_Silent_p.T18T|OTX2_ENST00000554788.1_Silent_p.T18T|OTX2_ENST00000554559.1_Silent_p.T18T|OTX2_ENST00000339475.5_Silent_p.T18T			P32243	OTX2_HUMAN	orthodenticle homeobox 2	18					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					TACCCGAAGTGGTCAGACTCA	0.597																																					p.T18T		.											.	OTX2-205	0			c.C54A						.						129.0	106.0	114.0					14																	57272121		2203	4300	6503	SO:0001819	synonymous_variant	5015	exon2			CGAAGTGGTCAGA	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.54C>A	14.37:g.57272121G>T		114	2		84	55	NM_001270524	0	0	0	0	0	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Silent	SNP	ENST00000555006.1	37	CCDS41960.1																																																																																			.		0.597	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
ACOT4	122970	hgsc.bcm.edu	37	14	74058832	74058832	+	Missense_Mutation	SNP	C	C	T	rs3742819	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr14:74058832C>T	ENST00000326303.4	+	1	423	c.169C>T	c.(169-171)Cgc>Tgc	p.R57C		NM_152331.3	NP_689544.3	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4	57			R -> C (in dbSNP:rs3742819). {ECO:0000269|PubMed:15489334}.		acyl-CoA metabolic process (GO:0006637)|dicarboxylic acid catabolic process (GO:0043649)|dicarboxylic acid metabolic process (GO:0043648)|long-chain fatty acid metabolic process (GO:0001676)|saturated monocarboxylic acid metabolic process (GO:0032788)|short-chain fatty acid metabolic process (GO:0046459)|succinyl-CoA metabolic process (GO:0006104)|unsaturated monocarboxylic acid metabolic process (GO:0032789)|very long-chain fatty acid metabolic process (GO:0000038)	peroxisome (GO:0005777)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|succinyl-CoA hydrolase activity (GO:0004778)			endometrium(1)|large_intestine(3)|lung(4)	8				BRCA - Breast invasive adenocarcinoma(234;0.00331)		CGCCGACGCCCGCGGCGAGCT	0.761													C|||	1988	0.396965	0.1059	0.513	5008	,	,		12914	0.629		0.3926	False		,,,				2504	0.4734				p.R57C		.											.	ACOT4-90	0			c.C169T						.	C	CYS/ARG	496,3446		38,420,1513	6.0	7.0	6.0		169	-9.9	0.0	14	dbSNP_107	6	2402,5202		412,1578,1812	no	missense	ACOT4	NM_152331.3	180	450,1998,3325	TT,TC,CC		31.5886,12.5824,25.0996	possibly-damaging	57/422	74058832	2898,8648	1971	3802	5773	SO:0001583	missense	122970	exon1			GACGCCCGCGGCG	BC031799	CCDS9817.1	14q24.1	2011-02-16			ENSG00000177465	ENSG00000177465		"""Acyl CoA thioesterases"""	19748	protein-coding gene	gene with protein product		614314				16103133, 16940157	Standard	NM_152331		Approved	FLJ31235, PTE-Ib, PTE2B	uc001xoo.3	Q8N9L9	OTTHUMG00000169485	ENST00000326303.4:c.169C>T	14.37:g.74058832C>T	ENSP00000323071:p.Arg57Cys	1	0		26	17	NM_152331	0	0	0	0	0	Q17RF4|Q5BKT6|Q86TX0|Q86TX1|Q96N88	Missense_Mutation	SNP	ENST00000326303.4	37	CCDS9817.1	873	0.39972527472527475	60	0.12195121951219512	175	0.48342541436464087	366	0.6398601398601399	272	0.35883905013192613	C	13.86	2.362653	0.41902	0.125824	0.315886	ENSG00000177465	ENST00000326303	T	0.70516	-0.49	4.93	-9.85	0.00476	Acyl-CoA thioester hydrolase/bile acid-CoA amino acid N-acetyltransferase (1);	2.024500	0.02238	N	0.065442	T	0.00012	0.0000	L	0.53249	1.67	0.80722	P	0.0	P	0.51351	0.944	P	0.53954	0.738	T	0.48536	-0.9027	9	0.56958	D	0.05	-7.9166	15.5626	0.76262	0.2094:0.6193:0.1713:0.0	rs3742819	57	Q8N9L9	ACOT4_HUMAN	C	57	ENSP00000323071:R57C	ENSP00000323071:R57C	R	+	1	0	ACOT4	73128585	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.196000	0.03041	-2.884000	0.00318	-0.502000	0.04539	CGC	T|0.002;G|0.599		0.761	ACOT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404298.2	NM_152331	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	0	0		33	33	NM_001127258	0	0	0	0	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
KIF26A	26153	hgsc.bcm.edu	37	14	104644099	104644099	+	Silent	SNP	T	T	C	rs2497297	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr14:104644099T>C	ENST00000423312.2	+	12	4974	c.4974T>C	c.(4972-4974)agT>agC	p.S1658S	KIF26A_ENST00000315264.7_Silent_p.S1519S	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1658					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGGCAGCAGTGGCTATGAGA	0.711													C|||	2031	0.405551	0.5764	0.2911	5008	,	,		13449	0.3185		0.3718	False		,,,				2504	0.3804				p.S1658S		.											.	KIF26A-24	0			c.T4974C						.	C		1381,1865		360,661,602	3.0	4.0	4.0		4974	-0.8	1.0	14	dbSNP_100	4	2221,5011		464,1293,1859	no	coding-synonymous	KIF26A	NM_015656.1		824,1954,2461	CC,CT,TT		30.7107,42.5447,34.3768		1658/1883	104644099	3602,6876	1623	3616	5239	SO:0001819	synonymous_variant	26153	exon12			CAGCAGTGGCTAT	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4974T>C	14.37:g.104644099T>C		0	0		11	6	NM_015656	0	0	13	19	6	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.603;C|0.397		0.711	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
ARRDC4	91947	hgsc.bcm.edu	37	15	98504326	98504326	+	Missense_Mutation	SNP	A	A	G	rs12101554	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr15:98504326A>G	ENST00000268042.6	+	1	399	c.235A>G	c.(235-237)Acc>Gcc	p.T79A	ARRDC4_ENST00000538249.1_Intron	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	79			T -> A (in dbSNP:rs12101554). {ECO:0000269|PubMed:15489334}.		positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CTCGGCCAGCACCGCGGCCCT	0.786													g|||	3817	0.762181	0.5976	0.7118	5008	,	,		7745	0.88		0.7485	False		,,,				2504	0.9131				p.T79A		.											.	ARRDC4-90	0			c.A235G						.		ALA/THR	934,448		327,280,84	1.0	1.0	1.0		235	0.8	0.0	15	dbSNP_120	1	2287,687		920,447,120	no	missense	ARRDC4	NM_183376.2	58	1247,727,204	GG,GA,AA		23.1002,32.4168,26.056	benign	79/419	98504326	3221,1135	691	1487	2178	SO:0001583	missense	91947	exon1			GCCAGCACCGCGG	BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.235A>G	15.37:g.98504326A>G	ENSP00000268042:p.Thr79Ala	0	0		11	11	NM_183376	0	0	0	1	1	Q6NSI9	Missense_Mutation	SNP	ENST00000268042.6	37	CCDS10377.1	1613	0.7385531135531136	289	0.5873983739837398	255	0.7044198895027625	512	0.8951048951048951	557	0.7348284960422163	g	3.442	-0.113882	0.06881	0.675832	0.768998	ENSG00000140450	ENST00000268042	T	0.07567	3.18	4.08	0.777	0.18538	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.46222	P	0.0010670000000000401	B	0.02656	0.0	B	0.01281	0.0	T	0.39522	-0.9610	8	0.02654	T	1	-4.3851	2.5111	0.04657	0.2812:0.0:0.3307:0.3881	rs12101554;rs17845860;rs17858835;rs57152335	79	Q8NCT1	ARRD4_HUMAN	A	79	ENSP00000268042:T79A	ENSP00000268042:T79A	T	+	1	0	ARRDC4	96305330	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	-0.193000	0.09573	0.288000	0.22398	-0.370000	0.07254	ACC	A|0.263;G|0.737		0.786	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313535.1	NM_183376	
RPS2	6187	hgsc.bcm.edu	37	16	2014528	2014528	+	Silent	SNP	G	G	A	rs17135712	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:2014528G>A	ENST00000343262.4	-	2	155	c.99C>T	c.(97-99)atC>atT	p.I33I	RPS2_ENST00000529806.1_Silent_p.I33I|RNF151_ENST00000321392.3_5'Flank|RNF151_ENST00000569210.2_5'Flank|RPS2_ENST00000526522.1_Silent_p.I33I|RPS2_ENST00000530225.1_Silent_p.I33I|SNORA64_ENST00000384674.1_RNA|SNORA10_ENST00000384084.1_RNA|SNHG9_ENST00000459373.1_lincRNA|RNF151_ENST00000569714.1_5'Flank	NM_002952.3	NP_002943.2	P15880	RS2_HUMAN	ribosomal protein S2	33	Arg/Gly-rich.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of transferase activity (GO:0051347)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CCCGGCCCCGGATGCCACTGC	0.751													G|||	533	0.10643	0.0045	0.1873	5008	,	,		12219	0.0149		0.1143	False		,,,				2504	0.273				p.I33I		.											.	RPS2-90	0			c.C99T						.	G		74,3152		0,74,1539	5.0	8.0	7.0		99	-2.2	0.3	16	dbSNP_123	7	745,6175		36,673,2751	no	coding-synonymous	RPS2	NM_002952.3		36,747,4290	AA,AG,GG		10.7659,2.2939,8.0721		33/294	2014528	819,9327	1613	3460	5073	SO:0001819	synonymous_variant	6187	exon2			GCCCCGGATGCCA	AB007147	CCDS10452.1	16p13.3	2011-04-05			ENSG00000140988	ENSG00000140988		"""S ribosomal proteins"""	10404	protein-coding gene	gene with protein product		603624				9582194	Standard	NM_002952		Approved	LLREP3, S2	uc002cno.2	P15880	OTTHUMG00000128708	ENST00000343262.4:c.99C>T	16.37:g.2014528G>A		0	0		31	16	NM_002952	1	0	82	270	187	B2R5G0|D3DU82|Q3MIB1	Silent	SNP	ENST00000343262.4	37	CCDS10452.1																																																																																			G|0.933;A|0.067		0.751	RPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250613.2	NM_002952	
MEFV	4210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	3304219	3304219	+	Silent	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:3304219C>T	ENST00000219596.1	-	2	888	c.849G>A	c.(847-849)ccG>ccA	p.P283P	MEFV_ENST00000339854.4_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000536379.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	283					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CCCCTCCATCCGGAGTGGGCC	0.547																																					p.P283P		.											.	MEFV-228	0			c.G849A						.						78.0	89.0	85.0					16																	3304219		2197	4300	6497	SO:0001819	synonymous_variant	4210	exon2			TCCATCCGGAGTG	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.849G>A	16.37:g.3304219C>T		55	0		78	42	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			.		0.547	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
GGA2	23062	hgsc.bcm.edu	37	16	23521643	23521643	+	Splice_Site	SNP	G	G	C	rs17844840|rs1071685	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:23521643G>C	ENST00000309859.4	-	1	172	c.90C>G	c.(88-90)ctC>ctG	p.L30L	GGA2_ENST00000567468.1_Splice_Site_p.L30L	NM_015044.4	NP_055859.1	Q9UJY4	GGA2_HUMAN	golgi-associated, gamma adaptin ear containing, ARF binding protein 2	30					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(48;0.0386)		GCTACTCACTGAGCCACAGCT	0.781													G|||	3460	0.690895	0.5756	0.7291	5008	,	,		7234	0.6964		0.8131	False		,,,				2504	0.6881				p.L30L		.											.	GGA2-91	0			c.C90G						.						1.0	1.0	1.0					16																	23521643		725	1470	2195	SO:0001630	splice_region_variant	23062	exon1			CTCACTGAGCCAC	AF190863	CCDS10611.1	16p12	2010-02-12	2010-02-12		ENSG00000103365	ENSG00000103365			16064	protein-coding gene	gene with protein product		606005				10747088, 10749927	Standard	NM_015044		Approved	VEAR, KIAA1080	uc002dlq.3	Q9UJY4	OTTHUMG00000096957	ENST00000309859.4:c.91+1C>G	16.37:g.23521643G>C		0	0		8	8	NM_015044	0	0	0	0	0	D3DWF0|O14564|Q9NYN2|Q9UPS2	Silent	SNP	ENST00000309859.4	37	CCDS10611.1																																																																																			G|0.500;C|0.500		0.781	GGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214019.1		Silent
ATXN2L	11273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	28842312	28842312	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:28842312C>T	ENST00000336783.4	+	10	1407	c.1240C>T	c.(1240-1242)Cgg>Tgg	p.R414W	ATXN2L_ENST00000340394.8_Missense_Mutation_p.R414W|ATXN2L_ENST00000564304.1_Missense_Mutation_p.R414W|ATXN2L_ENST00000382686.4_Missense_Mutation_p.R414W|ATXN2L_ENST00000395547.2_Missense_Mutation_p.R414W|ATXN2L_ENST00000570200.1_Missense_Mutation_p.R414W|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000325215.6_Missense_Mutation_p.R414W	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	414					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						AAAGGCACAACGGCCTCTGAG	0.478																																					p.R414W		.											.	ATXN2L-92	0			c.C1240T						.						48.0	46.0	47.0					16																	28842312		2197	4300	6497	SO:0001583	missense	11273	exon10			GCACAACGGCCTC		CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.1240C>T	16.37:g.28842312C>T	ENSP00000338718:p.Arg414Trp	24	0		25	9	NM_148414	0	0	0	0	0	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	ENST00000336783.4	37	CCDS10641.1	.	.	.	.	.	.	.	.	.	.	.	24.5	4.533104	0.85812	.	.	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000382686;ENST00000325215	T;T;T;T;T	0.51817	0.7;0.69;0.7;0.7;0.71	5.65	3.54	0.40534	.	0.000000	0.64402	D	0.000003	T	0.64853	0.2636	M	0.62723	1.935	0.51767	D	0.999931	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.83275	0.996;0.996;0.99;0.99;0.996;0.996;0.99;0.996	T	0.69723	-0.5068	10	0.72032	D	0.01	-18.0289	14.3896	0.66970	0.2654:0.7346:0.0:0.0	.	414;414;414;414;414;414;414;414	Q8WWM7-6;Q8WWM7-5;Q63ZY4;Q8WWM7;Q8WWM7-2;Q8WWM7-4;A8K1R6;Q8WWM7-3	.;.;.;ATX2L_HUMAN;.;.;.;.	W	414	ENSP00000341459:R414W;ENSP00000378917:R414W;ENSP00000338718:R414W;ENSP00000372133:R414W;ENSP00000315650:R414W	ENSP00000315650:R414W	R	+	1	2	ATXN2L	28749813	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.829000	0.39121	1.484000	0.48361	0.563000	0.77884	CGG	.		0.478	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214139.1	NM_007245	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	ADAD2_ENST00000567413.1_3'UTR|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000561900.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	0	0		17	11	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	1	0		22	18	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	1	0		22	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	1	0		22	18	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	1	0		22	18	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
CDH15	1013	hgsc.bcm.edu	37	16	89258747	89258747	+	Missense_Mutation	SNP	A	A	C	rs75791347	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:89258747A>C	ENST00000289746.2	+	11	1815	c.1750A>C	c.(1750-1752)Aag>Cag	p.K584Q		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	584	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCGCTGCGGCAAGGACGGCGT	0.751													c|||	2269	0.453075	0.3616	0.3804	5008	,	,		8209	0.6528		0.4304	False		,,,				2504	0.4458				p.K584Q		.											.	CDH15-523	0			c.A1750C						.		GLN/LYS	719,2255		126,467,894	2.0	3.0	2.0		1750	-4.4	0.0	16	dbSNP_131	2	1977,4371		402,1173,1599	no	missense	CDH15	NM_004933.2	53	528,1640,2493	CC,CA,AA		31.1437,24.1762,28.9208	benign	584/815	89258747	2696,6626	1487	3174	4661	SO:0001583	missense	1013	exon11			TGCGGCAAGGACG	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.1750A>C	16.37:g.89258747A>C	ENSP00000289746:p.Lys584Gln	0	0		5	5	NM_004933	0	0	0	0	0		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	1014	0.4642857142857143	172	0.34959349593495936	127	0.35082872928176795	372	0.6503496503496503	343	0.4525065963060686	c	3.132	-0.178252	0.06380	0.241762	0.311437	ENSG00000129910	ENST00000289746	T	0.56941	0.43	4.6	-4.43	0.03568	Cadherin (1);	1.872270	0.03679	N	0.245167	T	0.00012	0.0000	N	0.05383	-0.06	0.80722	P	0.0	B	0.06786	0.001	B	0.08055	0.003	T	0.38802	-0.9644	9	0.18276	T	0.48	.	3.3286	0.07076	0.1871:0.1478:0.4907:0.1744	.	584	P55291	CAD15_HUMAN	Q	584	ENSP00000289746:K584Q	ENSP00000289746:K584Q	K	+	1	0	CDH15	87786248	0.000000	0.05858	0.000000	0.03702	0.049000	0.14656	-0.609000	0.05635	-0.999000	0.03442	-0.675000	0.03792	AAG	A|0.532;C|0.468		0.751	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933	
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000466740.2_RNA|AC108004.3_ENST00000599026.1_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		1	0		29	26	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	0	0		7	7	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	7579311	7579311	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:7579311C>A	ENST00000269305.4	-	4	565		c.e4+1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(26)|p.0?(8)|p.V73fs*9(1)|p.Y126fs*11(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCAACTGACCGTGCAAGTC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											.	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	38	Unknown(26)|Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - In frame(1)	lung(12)|breast(5)|upper_aerodigestive_tract(4)|bone(4)|ovary(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|urinary_tract(1)|oesophagus(1)|pancreas(1)	c.375+1G>T	GRCh37	CS951538	TP53	S		.						66.0	61.0	63.0					17																	7579311		2203	4300	6503	SO:0001630	splice_region_variant	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AACTGACCGTGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1G>T	17.37:g.7579311C>A		189	0		125	107	NM_000546	0	0	0	6	6	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	ENST00000269305.4	37	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.954926	0.73902	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.3	4.3	0.51218	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6586	0.68852	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7520036	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.208000	0.72165	2.403000	0.81681	0.655000	0.94253	.	.		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	Intron
FOXN1	8456	broad.mit.edu	37	17	26851082	26851082	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:26851082G>T	ENST00000226247.2	+	1	124	c.95G>T	c.(94-96)gGc>gTc	p.G32V	FOXN1_ENST00000579795.1_Missense_Mutation_p.G32V	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	32					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					CAGGCACCGGGCCTCCCAGGC	0.677																																					p.G32V		.											.	FOXN1-226	0			c.G95T						.						14.0	15.0	15.0					17																	26851082		2200	4298	6498	SO:0001583	missense	8456	exon1			CACCGGGCCTCCC	Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.95G>T	17.37:g.26851082G>T	ENSP00000226247:p.Gly32Val	65	0		102	5	NM_003593	0	0	0	0	0	B2R9Q7|O15352	Missense_Mutation	SNP	ENST00000226247.2	37	CCDS11232.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059664	0.76074	.	.	ENSG00000109101	ENST00000226247	D	0.94092	-3.35	5.03	5.03	0.67393	.	0.089274	0.48767	D	0.000178	D	0.92685	0.7675	L	0.27053	0.805	0.58432	D	0.999998	D	0.58268	0.982	P	0.58172	0.834	D	0.93464	0.6813	10	0.72032	D	0.01	.	14.2151	0.65788	0.0:0.0:1.0:0.0	.	32	O15353	FOXN1_HUMAN	V	32	ENSP00000226247:G32V	ENSP00000226247:G32V	G	+	2	0	FOXN1	23875209	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	3.717000	0.54911	2.503000	0.84419	0.561000	0.74099	GGC	.		0.677	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255832.1		
MYO18A	399687	broad.mit.edu	37	17	27437604	27437604	+	Silent	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:27437604G>T	ENST00000527372.1	-	18	3117	c.2937C>A	c.(2935-2937)ggC>ggA	p.G979G	MYO18A_ENST00000533112.1_Silent_p.G979G|MYO18A_ENST00000354329.4_Silent_p.G979G|MYO18A_ENST00000531253.1_Silent_p.G979G	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	979	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.G979G(2)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCGTGGCACTGCCTGCGCGGC	0.627																																					p.G979G	Esophageal Squamous(182;472 2015 7001 15270 22562)	.											.	MYO18A-22	2	Substitution - coding silent(2)	endometrium(2)	c.C2937A						.						39.0	43.0	42.0					17																	27437604		1981	4171	6152	SO:0001819	synonymous_variant	399687	exon18			GGCACTGCCTGCG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2937C>A	17.37:g.27437604G>T		17	0		40	4	NM_078471	0	0	1	1	0	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	37	CCDS45642.1																																																																																			.		0.627	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
ATAD5	79915	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29187537	29187537	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:29187537G>A	ENST00000321990.4	+	10	3421	c.3043G>A	c.(3043-3045)Gag>Aag	p.E1015K	CTD-2349P21.11_ENST00000580873.1_RNA|RNU6-298P_ENST00000390888.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1015					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GAAACCAAATGAGTATTCAAA	0.358																																					p.E1015K		.											.	ATAD5-93	0			c.G3043A						.						63.0	64.0	64.0					17																	29187537		2203	4300	6503	SO:0001583	missense	79915	exon10			CCAAATGAGTATT		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.3043G>A	17.37:g.29187537G>A	ENSP00000313171:p.Glu1015Lys	123	0		96	20	NM_024857	0	0	0	0	0	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913239	0.33815	.	.	ENSG00000176208	ENST00000321990	T	0.10192	2.9	5.45	4.47	0.54385	.	0.745401	0.12754	N	0.441920	T	0.19167	0.0460	M	0.70595	2.14	0.30529	N	0.767648	D;P	0.57899	0.981;0.726	P;B	0.54026	0.74;0.191	T	0.02698	-1.1122	10	0.15499	T	0.54	.	6.565	0.22507	0.0898:0.0:0.73:0.1803	.	1015;1015	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	K	1015	ENSP00000313171:E1015K	ENSP00000313171:E1015K	E	+	1	0	ATAD5	26211663	1.000000	0.71417	0.974000	0.42286	0.841000	0.47740	3.453000	0.52978	2.709000	0.92574	0.585000	0.79938	GAG	.		0.358	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256206.2	NM_024857	
GPR179	440435	broad.mit.edu	37	17	36499001	36499001	+	Silent	SNP	C	C	T	rs368375083		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:36499001C>T	ENST00000342292.4	-	1	692	c.672G>A	c.(670-672)acG>acA	p.T224T		NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	224					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TCACCTGCTGCGTGTCCCCCA	0.607																																					p.T224T		.											.	GPR179-93	0			c.G672A						.	C		0,4174		0,0,2087	79.0	85.0	83.0		672	-3.7	0.4	17		83	2,8432		0,2,4215	no	coding-synonymous	GPR179	NM_001004334.2		0,2,6302	TT,TC,CC		0.0237,0.0,0.0159		224/2368	36499001	2,12606	2087	4217	6304	SO:0001819	synonymous_variant	440435	exon1			CTGCTGCGTGTCC		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.672G>A	17.37:g.36499001C>T		171	2		121	4	NM_001004334	0	0	0	0	0		Silent	SNP	ENST00000342292.4	37	CCDS42308.1																																																																																			.		0.607	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
TBX21	30009	hgsc.bcm.edu	37	17	45810919	45810919	+	Missense_Mutation	SNP	C	C	G	rs2240017	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:45810919C>G	ENST00000177694.1	+	1	310	c.99C>G	c.(97-99)caC>caG	p.H33Q		NM_013351.1	NP_037483.1	Q9UL17	TBX21_HUMAN	T-box 21	33			H -> Q (in dbSNP:rs2240017). {ECO:0000269|PubMed:15806396}.		cellular response to organic substance (GO:0071310)|lymphocyte migration (GO:0072676)|multicellular organismal development (GO:0007275)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(1)|large_intestine(3)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	22						ACCCGCAGCACCGCTACTTCT	0.771													C|||	250	0.0499201	0.0076	0.0865	5008	,	,		8307	0.1062		0.0199	False		,,,				2504	0.0542				p.H33Q		.											.	TBX21-90	0			c.C99G	GRCh37	CM042119	TBX21	M	rs2240017	.	C	GLN/HIS	12,2300		0,12,1144	1.0	2.0	2.0		99	0.4	1.0	17	dbSNP_98	2	86,5180		0,86,2547	no	missense	TBX21	NM_013351.1	24	0,98,3691	GG,GC,CC		1.6331,0.519,1.2932	benign	33/536	45810919	98,7480	1156	2633	3789	SO:0001583	missense	30009	exon1			GCAGCACCGCTAC	AF093098	CCDS11514.1	17q21.2	2008-06-23				ENSG00000073861		"""T-boxes"""	11599	protein-coding gene	gene with protein product		604895					Standard	NM_013351		Approved	TBLYM, T-bet	uc002ilv.1	Q9UL17		ENST00000177694.1:c.99C>G	17.37:g.45810919C>G	ENSP00000177694:p.His33Gln	0	0		17	16	NM_013351	0	0	0	0	0		Missense_Mutation	SNP	ENST00000177694.1	37	CCDS11514.1	94	0.04304029304029304	8	0.016260162601626018	20	0.055248618784530384	56	0.0979020979020979	10	0.013192612137203167	C	6.598	0.478682	0.12521	0.00519	0.016331	ENSG00000073861	ENST00000177694	D	0.84873	-1.91	3.64	0.45	0.16624	.	1.114810	0.06919	N	0.809058	T	0.05640	0.0148	N	0.14661	0.345	0.37472	P	0.084368	B	0.11235	0.004	B	0.09377	0.004	T	0.22382	-1.0218	9	0.18276	T	0.48	.	5.3817	0.16196	0.0:0.5926:0.0:0.4074	rs2240017;rs2240017	33	Q9UL17	TBX21_HUMAN	Q	33	ENSP00000177694:H33Q	ENSP00000177694:H33Q	H	+	3	2	TBX21	43165918	0.000000	0.05858	0.964000	0.40570	0.049000	0.14656	0.245000	0.18142	-0.053000	0.13289	-0.339000	0.08088	CAC	C|0.189;G|0.811		0.771	TBX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441365.1	NM_013351	
TBX2	6909	broad.mit.edu	37	17	59479224	59479224	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr17:59479224G>T	ENST00000240328.3	+	2	856	c.575G>T	c.(574-576)aGc>aTc	p.S192I	RP11-332H18.4_ENST00000592009.1_RNA|RP11-332H18.4_ENST00000589814.1_RNA|RP11-332H18.4_ENST00000590421.1_RNA|RP11-332H18.4_ENST00000591313.1_RNA|RP11-332H18.5_ENST00000585765.1_RNA	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2	192					aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(7)|ovary(1)	9						CACCCAGACAGCCCAGCCACG	0.597																																					p.S192I	GBM(3;187 253 11467 14965 23079)	.											.	TBX2-226	0			c.G575T						.						64.0	52.0	56.0					17																	59479224		2203	4300	6503	SO:0001583	missense	6909	exon2			CAGACAGCCCAGC	AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.575G>T	17.37:g.59479224G>T	ENSP00000240328:p.Ser192Ile	170	2		120	10	NM_005994	0	0	1	1	0	Q16424|Q7Z647	Missense_Mutation	SNP	ENST00000240328.3	37	CCDS11627.2	.	.	.	.	.	.	.	.	.	.	G	34	5.339208	0.95783	.	.	ENSG00000121068	ENST00000240328;ENST00000424871	D	0.91011	-2.77	4.92	4.92	0.64577	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.97486	0.9177	H	0.99011	4.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99120	1.0849	10	0.87932	D	0	.	17.2793	0.87124	0.0:0.0:1.0:0.0	.	192;129	Q13207;Q59FT1	TBX2_HUMAN;.	I	192;167	ENSP00000240328:S192I	ENSP00000240328:S192I	S	+	2	0	TBX2	56834006	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.856000	0.86956	2.551000	0.86045	0.561000	0.74099	AGC	.		0.597	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346977.2	NM_005994	
TMEM200C	645369	hgsc.bcm.edu	37	18	5890571	5890571	+	Missense_Mutation	SNP	T	T	C	rs7506026	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr18:5890571T>C	ENST00000581347.2	-	3	2137	c.1492A>G	c.(1492-1494)Agc>Ggc	p.S498G	RP11-945C19.4_ENST00000577694.1_RNA|TMEM200C_ENST00000383490.2_Missense_Mutation_p.S498G|RP11-945C19.4_ENST00000580845.1_RNA|RP11-945C19.4_ENST00000582939.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	498	Pro-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						GCCAGAGGGCTGGAGTCCGGG	0.791													T|||	237	0.0473243	0.0847	0.0375	5008	,	,		7356	0.001		0.0775	False		,,,				2504	0.0204				p.S498G		.											.	.	0			c.A1492G						.	T	GLY/SER	155,2477		3,149,1164	3.0	3.0	3.0		1492	-1.2	0.0	18	dbSNP_116	3	267,5869		4,259,2805	no	missense	TMEM200C	NM_001080209.1	56	7,408,3969	CC,CT,TT		4.3514,5.8891,4.813	benign	498/622	5890571	422,8346	1316	3068	4384	SO:0001583	missense	645369	exon1			GAGGGCTGGAGTC		CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.1492A>G	18.37:g.5890571T>C	ENSP00000463375:p.Ser498Gly	1	0		10	8	NM_001080209	0	0	0	0	0		Missense_Mutation	SNP	ENST00000581347.2	37	CCDS45825.1	128	0.05860805860805861	46	0.09349593495934959	17	0.04696132596685083	3	0.005244755244755245	62	0.08179419525065963	T	13.97	2.397165	0.42512	0.058891	0.043514	ENSG00000206432	ENST00000383490	.	.	.	4.37	-1.18	0.09617	.	.	.	.	.	T	0.00496	0.0016	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22800	-1.0206	8	0.08599	T	0.76	.	4.9842	0.14182	0.1362:0.3204:0.0:0.5434	rs7506026	498	A6NKL6	T200C_HUMAN	G	498	.	ENSP00000372982:S498G	S	-	1	0	TMEM200C	5880571	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.166000	0.09954	-0.178000	0.10672	0.459000	0.35465	AGC	T|0.941;C|0.059		0.791	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441917.4	NM_001080209	
MADCAM1	8174	bcgsc.ca	37	19	501701	501701	+	Missense_Mutation	SNP	G	G	A	rs71171990|rs72970252	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:501701G>A	ENST00000215637.3	+	4	746	c.700G>A	c.(700-702)Gac>Aac	p.D234N	MADCAM1_ENST00000346144.4_Intron|AC005775.2_ENST00000592413.1_RNA|MADCAM1_ENST00000382683.4_Intron|MADCAM1_ENST00000587541.1_Missense_Mutation_p.D15N	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	234	5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|Mucin-like.				aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGCCTCCCGACACCACCTC	0.652																																					p.D234N		.											.	MADCAM1-90	0			c.G700A						.						31.0	45.0	40.0					19																	501701		2203	4299	6502	SO:0001583	missense	8174	exon4			CCTCCCGACACCA	U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.700G>A	19.37:g.501701G>A	ENSP00000215637:p.Asp234Asn	187	3		228	14	NM_130760	0	0	0	1	1	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	ENST00000215637.3	37	CCDS12028.1	308	0.14102564102564102	38	0.07723577235772358	55	0.15193370165745856	90	0.15734265734265734	125	0.16490765171503957	g	8.795	0.931415	0.18131	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637	T	0.10382	2.88	4.28	-4.55	0.03441	.	3.221950	0.01471	N	0.016293	T	0.00039	0.0001	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.37641	-0.9697	9	0.13853	T	0.58	.	12.1068	0.53818	0.7972:0.0:0.2028:0.0	.	234	Q13477	MADCA_HUMAN	N	258;250;242;234	ENSP00000215637:D234N	ENSP00000215637:D234N	D	+	1	0	MADCAM1	452701	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.470000	0.06639	-0.806000	0.04398	-0.199000	0.12753	GAC	G|0.879;A|0.121		0.652	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451884.1	NM_130760	
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	TCF3_ENST00000395423.3_Silent_p.G385G|TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000344749.5_Silent_p.G436G|TCF3_ENST00000453954.2_Silent_p.G352G|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		0	0		38	17	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000453954.2_Silent_p.S350S|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		0	0		37	37	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619348	1619348	+	Silent	SNP	G	G	A	rs386805766|rs1052696	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:1619348G>A	ENST00000262965.5	-	15	1637	c.1293C>T	c.(1291-1293)ggC>ggT	p.G431G	TCF3_ENST00000395423.3_Silent_p.G380G|TCF3_ENST00000588136.1_Silent_p.G431G|TCF3_ENST00000344749.5_Silent_p.G431G|TCF3_ENST00000453954.2_Silent_p.G347G|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGACATGGGGCCGGTGAAAC	0.736			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	536	0.107029	0.0371	0.0432	5008	,	,		13774	0.254		0.0706	False		,,,				2504	0.1329				p.G431G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1293T						.	G	,	155,4211		3,149,2031	13.0	15.0	14.0		1293,1293	-0.6	0.1	19	dbSNP_86	14	512,7976		18,476,3750	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	21,625,5781	AA,AG,GG		6.032,3.5502,5.189	,	431/652,431/655	1619348	667,12187	2183	4244	6427	SO:0001819	synonymous_variant	6929	exon15			CATGGGGCCGGTG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1293C>T	19.37:g.1619348G>A		0	0		33	19	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.903;A|0.097		0.736	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619350	1619350	+	Missense_Mutation	SNP	C	C	T	rs386805766|rs1052692	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:1619350C>T	ENST00000262965.5	-	15	1635	c.1291G>A	c.(1291-1293)Ggc>Agc	p.G431S	TCF3_ENST00000395423.3_Missense_Mutation_p.G380S|TCF3_ENST00000588136.1_Missense_Mutation_p.G431S|TCF3_ENST00000344749.5_Missense_Mutation_p.G431S|TCF3_ENST00000453954.2_Missense_Mutation_p.G347S|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACATGGGGCCGGTGAAACCT	0.741			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	564	0.11262	0.056	0.0476	5008	,	,		13830	0.254		0.0716	False		,,,				2504	0.1319				p.G431S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.G1291A						.	C	SER/GLY,SER/GLY	215,4155		5,205,1975	13.0	15.0	14.0		1291,1291	-0.7	0.0	19	dbSNP_86	14	530,7974		19,492,3741	yes	missense,missense	TCF3	NM_001136139.2,NM_003200.3	56,56	24,697,5716	TT,TC,CC		6.2324,4.9199,5.7869	benign,benign	431/652,431/655	1619350	745,12129	2185	4252	6437	SO:0001583	missense	6929	exon15			TGGGGCCGGTGAA	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1291G>A	19.37:g.1619350C>T	ENSP00000262965:p.Gly431Ser	0	0		35	20	NM_003200	0	0	0	0	0	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	ENST00000262965.5	37	CCDS12074.1	219	0.10027472527472528	18	0.036585365853658534	14	0.03867403314917127	142	0.24825174825174826	45	0.059366754617414245	C	11.78	1.740783	0.30865	0.049199	0.062324	ENSG00000071564	ENST00000262965;ENST00000344749;ENST00000453954;ENST00000395423	T;T;T	0.57907	0.37;0.37;0.37	4.29	-0.72	0.11195	.	0.354219	0.29342	N	0.012425	T	0.00012	0.0000	L	0.48260	1.515	0.80722	P	0.0	B;P;B;B	0.38827	0.304;0.649;0.048;0.085	B;B;B;B	0.26416	0.056;0.069;0.014;0.011	T	0.18999	-1.0319	9	0.23891	T	0.37	-16.7082	4.654	0.12608	0.1526:0.572:0.0:0.2754	rs1052692;rs3170423	431;431;380;368	P15923-2;P15923;Q2TB39;Q6PJU3	.;TFE2_HUMAN;.;.	S	431;431;431;380	ENSP00000262965:G431S;ENSP00000344375:G431S;ENSP00000378813:G380S	ENSP00000262965:G431S	G	-	1	0	TCF3	1570350	0.000000	0.05858	0.031000	0.17742	0.007000	0.05969	-1.118000	0.03280	0.264000	0.21851	-0.258000	0.10820	GGC	C|0.901;T|0.099		0.741	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
REXO1	57455	hgsc.bcm.edu	37	19	1828401	1828401	+	Silent	SNP	G	G	A	rs185543381	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:1828401G>A	ENST00000170168.4	-	2	481	c.387C>T	c.(385-387)ccC>ccT	p.P129P	REXO1_ENST00000587524.1_5'UTR	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	129						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		Tggggccgcggggcgccaggg	0.726													.|||	13	0.00259585	0.0	0.0058	5008	,	,		11580	0.0		0.008	False		,,,				2504	0.001				p.P129P		.											.	REXO1-90	0			c.C387T						.	G		8,4274		0,8,2133	8.0	10.0	9.0		387	-2.1	0.0	19		9	54,8244		1,52,4096	no	coding-synonymous	REXO1	NM_020695.3		1,60,6229	AA,AG,GG		0.6508,0.1868,0.4928		129/1222	1828401	62,12518	2141	4149	6290	SO:0001819	synonymous_variant	57455	exon2			GCCGCGGGGCGCC	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.387C>T	19.37:g.1828401G>A		0	0		120	71	NM_020695	0	0	0	3	3	Q9ULT2	Silent	SNP	ENST00000170168.4	37	CCDS32866.1																																																																																			G|0.997;A|0.003		0.726	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449200.1	NM_020695	
KANK3	256949	hgsc.bcm.edu	37	19	8400651	8400651	+	Silent	SNP	C	C	G	rs11669559	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:8400651C>G	ENST00000593649.1	-	3	125	c.60G>C	c.(58-60)ccG>ccC	p.P20P	KANK3_ENST00000330915.3_Silent_p.P20P			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	20										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						cggcggggaccgggcacaggc	0.692													C|||	700	0.139776	0.2466	0.1297	5008	,	,		8967	0.0327		0.1272	False		,,,				2504	0.1258				p.P20P		.											.	KANK3-90	0			c.G60C						.						1.0	1.0	1.0					19																	8400651		1078	2073	3151	SO:0001819	synonymous_variant	256949	exon3			GGGGACCGGGCAC	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.60G>C	19.37:g.8400651C>G		1	0		9	6	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				C|0.880;G|0.120		0.692	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
ADAMTS10	81794	broad.mit.edu	37	19	8651052	8651052	+	Missense_Mutation	SNP	G	G	T	rs200370843		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:8651052G>T	ENST00000597188.1	-	22	2884	c.2614C>A	c.(2614-2616)Ctg>Atg	p.L872M	ADAMTS10_ENST00000595838.1_Missense_Mutation_p.L359M|ADAMTS10_ENST00000270328.4_Missense_Mutation_p.L872M	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	872	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L872M(1)		NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						CTTTTGGGCAGCTTGCTGTGG	0.672											OREG0025221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L872M		.											.	ADAMTS10-229	1	Substitution - Missense(1)	kidney(1)	c.C2614A						.																																			SO:0001583	missense	81794	exon22			TGGGCAGCTTGCT	AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.2614C>A	19.37:g.8651052G>T	ENSP00000471851:p.Leu872Met	51	2	81	103	10	NM_030957	0	0	2	2	0	M0QZE4	Missense_Mutation	SNP	ENST00000597188.1	37	CCDS12206.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208318	0.39003	.	.	ENSG00000142303	ENST00000270328;ENST00000393912	T	0.61392	0.11	4.14	3.09	0.35607	.	0.297372	0.29335	U	0.012455	T	0.28632	0.0709	N	0.04880	-0.145	0.28154	N	0.929281	B;B;B	0.31026	0.304;0.121;0.23	B;B;B	0.27076	0.076;0.063;0.053	T	0.15636	-1.0430	10	0.66056	D	0.02	.	2.2309	0.03996	0.1033:0.1625:0.4193:0.315	.	626;872;359	Q59FE5;Q9H324;E9PCI6	.;ATS10_HUMAN;.	M	872;626	ENSP00000270328:L872M	ENSP00000270328:L872M	L	-	1	2	ADAMTS10	8557052	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.702000	0.47102	0.918000	0.36919	0.561000	0.74099	CTG	.		0.672	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460085.3	NM_030957	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9057171	9057171	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:9057171T>C	ENST00000397910.4	-	3	30478	c.30275A>G	c.(30274-30276)gAt>gGt	p.D10092G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10094	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTCTCTGTATCTGTGGTGAC	0.458																																					p.D10092G		.											.	MUC16-566	0			c.A30275G						.						114.0	110.0	111.0					19																	9057171		1955	4152	6107	SO:0001583	missense	94025	exon3			TCTGTATCTGTGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30275A>G	19.37:g.9057171T>C	ENSP00000381008:p.Asp10092Gly	125	0		224	112	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	7.135	0.580657	0.13686	.	.	ENSG00000181143	ENST00000397910	T	0.27720	1.65	2.79	-3.82	0.04281	.	.	.	.	.	T	0.16085	0.0387	L	0.27053	0.805	.	.	.	B	0.20988	0.05	B	0.20767	0.031	T	0.27606	-1.0069	8	0.87932	D	0	.	0.9759	0.01426	0.17:0.3363:0.1733:0.3205	.	10092	B5ME49	.	G	10092	ENSP00000381008:D10092G	ENSP00000381008:D10092G	D	-	2	0	MUC16	8918171	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-1.845000	0.01677	-1.145000	0.02858	0.460000	0.39030	GAT	.		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
TMED1	11018	broad.mit.edu	37	19	10946806	10946806	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:10946806A>C	ENST00000214869.2	-	1	160	c.62T>G	c.(61-63)gTg>gGg	p.V21G	TMED1_ENST00000588289.1_5'Flank|TMED1_ENST00000591695.1_Missense_Mutation_p.V21G|C19orf38_ENST00000592854.1_5'Flank	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	21					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						CGCCCCTCCCACCTCCACTGG	0.682																																					p.V21G		.											.	TMED1-155	0			c.T62G						.						7.0	8.0	7.0					19																	10946806		2142	4189	6331	SO:0001583	missense	11018	exon1			CCTCCCACCTCCA	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.62T>G	19.37:g.10946806A>C	ENSP00000214869:p.Val21Gly	94	17		143	22	NM_006858	0	0	12	12	0		Missense_Mutation	SNP	ENST00000214869.2	37	CCDS12249.1	.	.	.	.	.	.	.	.	.	.	A	5.417	0.262161	0.10239	.	.	ENSG00000099203	ENST00000214869	T	0.32023	1.47	4.73	2.55	0.30701	.	0.428864	0.20045	N	0.100436	T	0.11965	0.0291	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.04013	0.001	T	0.12192	-1.0557	10	0.24483	T	0.36	-7.5505	3.3292	0.07077	0.6091:0.2245:0.1663:0.0	.	21	Q13445	TMED1_HUMAN	G	21	ENSP00000214869:V21G	ENSP00000214869:V21G	V	-	2	0	TMED1	10807806	0.000000	0.05858	0.012000	0.15200	0.016000	0.09150	0.496000	0.22499	1.996000	0.58369	0.533000	0.62120	GTG	.		0.682	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
PLPPR2	64748	broad.mit.edu	37	19	11472132	11472132	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:11472132G>T	ENST00000251473.5	+	6	1007	c.631G>T	c.(631-633)Gcc>Tcc	p.A211S	DKFZP761J1410_ENST00000591608.1_Missense_Mutation_p.A186S	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					CAAGGATGCGGCCCTCTGCGC	0.692																																					p.A211S		.											.	LPPR2-153	0			c.G631T						.						26.0	29.0	28.0					19																	11472132		2199	4277	6476	SO:0001583	missense	0	exon6			GATGCGGCCCTCT																												ENST00000251473.5:c.631G>T	19.37:g.11472132G>T	ENSP00000251473:p.Ala211Ser	15	0		164	14	NM_022737	0	0	18	18	0		Missense_Mutation	SNP	ENST00000251473.5	37	CCDS12258.1	.	.	.	.	.	.	.	.	.	.	g	33	5.243323	0.95272	.	.	ENSG00000105520	ENST00000251473	T	0.75477	-0.94	5.36	5.36	0.76844	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	N	0.16166	0.38	0.80722	D	1	P;P	0.45902	0.851;0.868	P;P	0.59012	0.58;0.85	T	0.64415	-0.6413	10	0.02654	T	1	-25.3512	17.8761	0.88825	0.0:0.0:1.0:0.0	.	186;211	Q96GM1-2;Q96GM1	.;LPPR2_HUMAN	S	211	ENSP00000251473:A211S	ENSP00000251473:A211S	A	+	1	0	AC024575.1	11333132	1.000000	0.71417	0.969000	0.41365	0.979000	0.70002	7.161000	0.77505	2.524000	0.85096	0.550000	0.68814	GCC	.		0.692	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458779.1		
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		0	0		34	14	NM_012088	0	0	7	7	0		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	0	0		6	6	NM_006003	0	0	0	0	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	FBXO17_ENST00000595329.1_Silent_p.P14P|SARS2_ENST00000448145.2_5'Flank|CTC-360G5.8_ENST00000599996.1_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		0	0		32	7	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
ZNF229	7772	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44934458	44934458	+	Silent	SNP	G	G	A	rs185368876	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:44934458G>A	ENST00000588931.1	-	6	931	c.498C>T	c.(496-498)atC>atT	p.I166I	ZNF229_ENST00000291187.4_Silent_p.I160I|ZNF229_ENST00000591289.1_Intron|CTC-512J12.4_ENST00000588655.1_RNA	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				TTTCTAGACCGATAAGCCCAT	0.488													g|||	3	0.000599042	0.0015	0.0014	5008	,	,		19056	0.0		0.0	False		,,,				2504	0.0				p.I166I		.											.	ZNF229-94	0			c.C498T						.						101.0	95.0	96.0					19																	44934458		1865	4115	5980	SO:0001819	synonymous_variant	7772	exon6			TAGACCGATAAGC	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.498C>T	19.37:g.44934458G>A		117	0		190	104	NM_014518	0	0	1	8	7	B2RWN3|Q59FV2|Q86WL9	Silent	SNP	ENST00000588931.1	37	CCDS42574.1																																																																																			G|0.999;A|0.001		0.488	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1	NM_014518	
BCL3	602	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	45260388	45260388	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:45260388G>A	ENST00000164227.5	+	4	878	c.634G>A	c.(634-636)Gcg>Acg	p.A212T		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	212					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				CGCTCACCTGGCGTGCGAGCA	0.667			T	IGH@	CLL																																p.A212T		.		Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	.	BCL3-848	0			c.G634A						.						13.0	10.0	11.0					19																	45260388		2156	4219	6375	SO:0001583	missense	602	exon4			CACCTGGCGTGCG	M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.634G>A	19.37:g.45260388G>A	ENSP00000164227:p.Ala212Thr	23	0		129	67	NM_005178	0	0	22	57	35		Missense_Mutation	SNP	ENST00000164227.5	37	CCDS12642.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.762506|4.762506	0.89932|0.89932	.|.	.|.	ENSG00000069399|ENSG00000069399	ENST00000403534;ENST00000164227|ENST00000444487	D|.	0.81996|.	-1.56|.	4.95|4.95	4.95|4.95	0.65309|0.65309	Ankyrin repeat-containing domain (3);|.	0.000000|.	0.41938|.	D|.	0.000790|.	T|T	0.52191|0.52191	0.1719|0.1719	N|N	0.24115|0.24115	0.695|0.695	0.36531|0.36531	D|D	0.87071|0.87071	D|.	0.76494|.	0.999|.	D|.	0.65140|.	0.932|.	T|T	0.57230|0.57230	-0.7847|-0.7847	10|5	0.56958|.	D|.	0.05|.	-34.1771|-34.1771	15.6871|15.6871	0.77421|0.77421	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	212|.	P20749|.	BCL3_HUMAN|.	T|D	172;212|95	ENSP00000164227:A212T|.	ENSP00000164227:A212T|.	A|G	+|+	1|2	0|0	BCL3|BCL3	49952228|49952228	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	4.539000|4.539000	0.60657|0.60657	2.295000|2.295000	0.77249|0.77249	0.305000|0.305000	0.20034|0.20034	GCG|GGC	.		0.667	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322976.1	NM_005178	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N|ERCC2_ENST00000221481.6_3'UTR	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	1	0		39	21	NM_000400	0	0	10	21	11	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
RASIP1	54922	hgsc.bcm.edu	37	19	49232226	49232226	+	Missense_Mutation	SNP	G	G	A	rs2287922	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:49232226G>A	ENST00000222145.4	-	5	2005	c.1801C>T	c.(1801-1803)Cgc>Tgc	p.R601C	RASIP1_ENST00000594232.1_5'Flank	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	601	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.		R -> C (in dbSNP:rs2287922). {ECO:0000269|PubMed:15031288}.		angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CGGGCCAGGCGGCCCAGCAGT	0.731													G|||	1076	0.214856	0.1157	0.2997	5008	,	,		8786	0.0198		0.4791	False		,,,				2504	0.2178				p.R601C		.											.	RASIP1-228	0			c.C1801T						.	G	CYS/ARG	456,2624		82,292,1166	2.0	3.0	3.0		1801	4.2	1.0	19	dbSNP_100	3	2661,3381		645,1371,1005	yes	missense	RASIP1	NM_017805.2	180	727,1663,2171	AA,AG,GG		44.0417,14.8052,34.1701	probably-damaging	601/964	49232226	3117,6005	1540	3021	4561	SO:0001583	missense	54922	exon5			CCAGGCGGCCCAG	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1801C>T	19.37:g.49232226G>A	ENSP00000222145:p.Arg601Cys	0	0		10	10	NM_017805	0	0	0	3	3	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	37	CCDS12731.1	571	0.26144688644688646	65	0.13211382113821138	127	0.35082872928176795	21	0.03671328671328671	358	0.47229551451187335	G	17.28	3.350878	0.61183	0.148052	0.440417	ENSG00000105538	ENST00000222145	T	0.27557	1.66	4.17	4.17	0.49024	Dilute (1);	0.331247	0.23983	N	0.042644	T	0.00012	0.0000	L	0.39898	1.24	0.22701	P	0.99883638	D	0.76494	0.999	P	0.54590	0.756	T	0.48328	-0.9045	9	0.66056	D	0.02	-0.9078	9.7493	0.40466	0.0:0.0:0.7933:0.2067	rs2287922	601	Q5U651	RAIN_HUMAN	C	601	ENSP00000222145:R601C	ENSP00000222145:R601C	R	-	1	0	RASIP1	53924038	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	3.181000	0.50903	2.023000	0.59567	0.462000	0.41574	CGC	G|0.738;A|0.262		0.731	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
ZNF473	25888	broad.mit.edu	37	19	50548742	50548742	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:50548742G>C	ENST00000595661.1	+	6	1537	c.1042G>C	c.(1042-1044)Gag>Cag	p.E348Q	ZNF473_ENST00000391821.2_Missense_Mutation_p.E348Q|ZNF473_ENST00000270617.3_Missense_Mutation_p.E348Q|CTD-2126E3.3_ENST00000599914.1_RNA|ZNF473_ENST00000445728.3_Missense_Mutation_p.E336Q|CTD-2126E3.3_ENST00000599410.1_RNA|ZNF473_ENST00000601364.1_Intron			Q8WTR7	ZN473_HUMAN	zinc finger protein 473	348	Interaction with SLBP/pre-mRNA complex.				gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)		GAAACGCTATGAGTGTTCCAA	0.488																																					p.E348Q		.											.	ZNF473-91	0			c.G1042C						.						79.0	70.0	73.0					19																	50548742		2203	4300	6503	SO:0001583	missense	25888	exon5			CGCTATGAGTGTT	AB032967	CCDS33077.1	19q13.33	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	23239	protein-coding gene	gene with protein product						11782445	Standard	NM_015428		Approved	KIAA1141, DKFZP434N043, HZFP100	uc002prn.3	Q8WTR7		ENST00000595661.1:c.1042G>C	19.37:g.50548742G>C	ENSP00000472808:p.Glu348Gln	138	0		203	6	NM_015428	0	0	9	9	0	A8K8T7|Q9ULS9|Q9Y4Q7	Missense_Mutation	SNP	ENST00000595661.1	37	CCDS33077.1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117151	0.37339	.	.	ENSG00000142528	ENST00000270617;ENST00000391821;ENST00000445728	T;T;T	0.75938	-0.98;-0.98;-0.98	4.06	0.319	0.15873	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.337981	0.21408	N	0.075029	T	0.47930	0.1472	N	0.05177	-0.1	0.09310	N	1	B	0.27013	0.166	B	0.25614	0.062	T	0.37596	-0.9699	10	0.35671	T	0.21	-4.0608	7.6792	0.28502	0.0938:0.3106:0.5957:0.0	.	348	Q8WTR7	ZN473_HUMAN	Q	348;348;336	ENSP00000270617:E348Q;ENSP00000375697:E348Q;ENSP00000388961:E336Q	ENSP00000270617:E348Q	E	+	1	0	ZNF473	55240554	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-0.490000	0.06482	0.184000	0.20083	0.655000	0.94253	GAG	.		0.488	ZNF473-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464833.1	XM_046390	
CTU1	90353	hgsc.bcm.edu	37	19	51602298	51602298	+	Missense_Mutation	SNP	C	C	G	rs12983578	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:51602298C>G	ENST00000421832.2	-	3	651	c.607G>C	c.(607-609)Gag>Cag	p.E203Q		NM_145232.3	NP_660275.2			cytosolic thiouridylase subunit 1											large_intestine(2)|lung(1)|urinary_tract(1)	4						gcgcccccctcgccgggagag	0.726													C|||	357	0.0712859	0.0129	0.0663	5008	,	,		5363	0.0625		0.166	False		,,,				2504	0.0654				p.E203Q		.											.	CTU1-68	0			c.G607C						.	C	GLN/GLU	80,3254		0,80,1587	2.0	3.0	3.0		607	3.7	1.0	19	dbSNP_121	3	703,5807		27,649,2579	no	missense	CTU1	NM_145232.3	29	27,729,4166	GG,GC,CC		10.7988,2.3995,7.9541	probably-damaging	203/349	51602298	783,9061	1667	3255	4922	SO:0001583	missense	90353	exon3			CCCCCTCGCCGGG		CCDS12824.1	19q13.41	2013-05-31	2013-05-31	2009-08-19		ENSG00000142544			29590	protein-coding gene	gene with protein product		612694	"""ATP binding domain 3"", ""cytosolic thiouridylase subunit 1 homolog (S. pombe)"""	ATPBD3		19017811	Standard	NM_145232		Approved	MGC17332, NCS6	uc010eop.3	Q7Z7A3		ENST00000421832.2:c.607G>C	19.37:g.51602298C>G	ENSP00000390011:p.Glu203Gln	0	0		8	8	NM_145232	0	0	0	4	4		Missense_Mutation	SNP	ENST00000421832.2	37	CCDS12824.1	217	0.09935897435897435	20	0.04065040650406504	27	0.07458563535911603	34	0.05944055944055944	136	0.17941952506596306	.	17.62	3.434094	0.62955	0.023995	0.107988	ENSG00000142544	ENST00000421832	T	0.43294	0.95	3.66	3.66	0.41972	Rossmann-like alpha/beta/alpha sandwich fold (1);tRNA(Ile)-lysidine/2-thiocytidine synthase (1);	0.000000	0.85682	D	0.000000	T	0.00178	0.0005	M	0.69523	2.12	0.23991	P	0.99624278	D	0.69078	0.997	D	0.66084	0.941	T	0.09574	-1.0668	9	0.46703	T	0.11	-14.0205	7.3785	0.26841	0.0:0.873:0.0:0.127	rs12983578	203	Q7Z7A3	CTU1_HUMAN	Q	203	ENSP00000390011:E203Q	ENSP00000390011:E203Q	E	-	1	0	CTU1	56294110	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	3.267000	0.51577	1.733000	0.51620	0.505000	0.49811	GAG	C|0.900;G|0.100		0.726	CTU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464292.1	NM_145232	
PPP6R1	22870	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55758252	55758252	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:55758252G>A	ENST00000412770.2	-	2	786	c.220C>T	c.(220-222)Cgc>Tgc	p.R74C	PPP6R1_ENST00000587283.1_Missense_Mutation_p.R74C	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	74	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						CACTTGTAGCGCAGCCGCTCC	0.612																																					p.R74C		.											.	PPP6R1-67	0			c.C220T						.						19.0	23.0	21.0					19																	55758252		2112	4221	6333	SO:0001583	missense	22870	exon2			TGTAGCGCAGCCG	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.220C>T	19.37:g.55758252G>A	ENSP00000414202:p.Arg74Cys	99	2		138	54	NM_014931	0	0	0	1	1	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	ENST00000412770.2	37	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167893	0.57476	.	.	ENSG00000105063	ENST00000444538;ENST00000412770	T	0.54071	0.59	4.4	3.36	0.38483	.	0.000000	0.64402	D	0.000009	T	0.74230	0.3689	M	0.90309	3.105	0.54753	D	0.999981	D	0.89917	1.0	D	0.71414	0.973	T	0.78894	-0.2024	10	0.62326	D	0.03	-26.3743	11.546	0.50694	0.0896:0.0:0.9104:0.0	.	74	Q9UPN7	PP6R1_HUMAN	C	74	ENSP00000414202:R74C	ENSP00000414202:R74C	R	-	1	0	PPP6R1	60450064	1.000000	0.71417	0.971000	0.41717	0.557000	0.35523	4.524000	0.60552	1.229000	0.43630	0.561000	0.74099	CGC	.		0.612	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	0	0		18	17	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF134	7693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58132312	58132312	+	Silent	SNP	A	A	G			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr19:58132312A>G	ENST00000396161.5	+	3	1135	c.825A>G	c.(823-825)ctA>ctG	p.L275L		NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	275					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		ACTCCAATCTAATTGTACACC	0.408																																					p.L275L		.											.	ZNF134-226	0			c.A825G						.						83.0	87.0	86.0					19																	58132312		2196	4300	6496	SO:0001819	synonymous_variant	7693	exon3			CAATCTAATTGTA	U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.825A>G	19.37:g.58132312A>G		75	0		119	53	NM_003435	0	0	7	20	13	Q9Y4B2	Silent	SNP	ENST00000396161.5	37	CCDS42638.1																																																																																			.		0.408	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466808.1	NM_003435	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000404168.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		0	0		10	10	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
PKDCC	91461	hgsc.bcm.edu	37	2	42275726	42275726	+	Silent	SNP	C	C	G	rs11891679	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr2:42275726C>G	ENST00000294964.5	+	1	567	c.387C>G	c.(385-387)cgC>cgG	p.R129R		NM_138370.2	NP_612379.2			protein kinase domain containing, cytoplasmic											breast(2)|kidney(1)|lung(5)	8						cgggcccgcgcctggGCTGCG	0.816													C|||	1218	0.243211	0.3359	0.1671	5008	,	,		5594	0.0873		0.2773	False		,,,				2504	0.2975				p.R129R		.											.	PKDCC-67	0			c.C387G						.						1.0	2.0	2.0					2																	42275726		396	1081	1477	SO:0001819	synonymous_variant	91461	exon1			CCCGCGCCTGGGC		CCDS33186.2	2p21	2014-01-28	2012-12-07		ENSG00000162878	ENSG00000162878			25123	protein-coding gene	gene with protein product	"""vertebrate lonesome kinase"""	614150	"""protein kinase domain containing, cytoplasmic homolog (mouse)"""			19097194, 19465597	Standard	NM_138370		Approved	SgK493, Vlk	uc002rsg.3	Q504Y2	OTTHUMG00000152303	ENST00000294964.5:c.387C>G	2.37:g.42275726C>G		0	0		7	7	NM_138370	0	0	0	0	0		Silent	SNP	ENST00000294964.5	37	CCDS33186.2																																																																																			C|0.762;G|0.238		0.816	PKDCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325745.3		
SOCS5	9655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	46987103	46987103	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr2:46987103G>C	ENST00000306503.5	+	2	1606	c.1434G>C	c.(1432-1434)agG>agC	p.R478S	SOCS5_ENST00000394861.2_Missense_Mutation_p.R478S	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	478	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.			R -> M (in Ref. 7; AAH32862). {ECO:0000305}.	cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CACTAAATAGGACTTTCCCTT	0.428																																					p.R478S		.											.	SOCS5-659	0			c.G1434C						.						98.0	93.0	94.0					2																	46987103		2203	4300	6503	SO:0001583	missense	9655	exon2			AAATAGGACTTTC	AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.1434G>C	2.37:g.46987103G>C	ENSP00000305133:p.Arg478Ser	119	0		119	99	NM_144949	0	0	0	1	1	Q53SD4|Q8IYZ4	Missense_Mutation	SNP	ENST00000306503.5	37	CCDS1830.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066412	0.36470	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	T;T	0.39787	1.06;1.06	5.43	3.62	0.41486	SOCS protein, C-terminal (2);SH2 motif (1);	0.000000	0.85682	D	0.000000	T	0.66066	0.2752	M	0.89214	3.015	0.58432	D	0.999998	D	0.89917	1.0	D	0.81914	0.995	T	0.69117	-0.5230	10	0.72032	D	0.01	-22.5227	9.3281	0.38005	0.2223:0.0:0.7777:0.0	.	478	O75159	SOCS5_HUMAN	S	478	ENSP00000305133:R478S;ENSP00000378330:R478S	ENSP00000305133:R478S	R	+	3	2	SOCS5	46840607	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	1.926000	0.40084	0.839000	0.34971	0.655000	0.94253	AGG	.		0.428	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250791.2		
MRPL53	116540	bcgsc.ca	37	2	74699702	74699702	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr2:74699702G>A	ENST00000258105.7	-	1	747	c.86C>T	c.(85-87)tCg>tTg	p.S29L	MRPL53_ENST00000409710.1_Missense_Mutation_p.S29L	NM_053050.4	NP_444278.1	Q96EL3	RM53_HUMAN	mitochondrial ribosomal protein L53	29						mitochondrion (GO:0005739)|ribosome (GO:0005840)				central_nervous_system(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5						GTACCTCGTCGATTCCACGTT	0.597																																					p.S29L		.											.	MRPL53-90	0			c.C86T						.						116.0	106.0	109.0					2																	74699702		2203	4300	6503	SO:0001583	missense	116540	exon1			CTCGTCGATTCCA	BC012163	CCDS1944.1	2p13.1	2012-09-13			ENSG00000204822	ENSG00000204822		"""Mitochondrial ribosomal proteins / large subunits"""	16684	protein-coding gene	gene with protein product		611857				11551941	Standard	NM_053050		Approved		uc002sln.3	Q96EL3	OTTHUMG00000129961	ENST00000258105.7:c.86C>T	2.37:g.74699702G>A	ENSP00000258105:p.Ser29Leu	338	0		287	11	NM_053050	0	0	5	5	0		Missense_Mutation	SNP	ENST00000258105.7	37	CCDS1944.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497248	0.64186	.	.	ENSG00000204822	ENST00000258105;ENST00000409710	T;T	0.60797	0.68;0.16	5.02	5.02	0.67125	.	0.360669	0.29466	N	0.012061	T	0.56277	0.1974	L	0.59436	1.845	0.80722	D	1	P	0.45011	0.848	B	0.42653	0.394	T	0.60611	-0.7229	10	0.51188	T	0.08	-12.1502	13.6971	0.62587	0.0:0.0:1.0:0.0	.	29	Q96EL3	RM53_HUMAN	L	29	ENSP00000258105:S29L;ENSP00000386920:S29L	ENSP00000258105:S29L	S	-	2	0	MRPL53	74553210	0.384000	0.25164	0.945000	0.38365	0.464000	0.32679	4.683000	0.61679	2.597000	0.87782	0.609000	0.83330	TCG	.		0.597	MRPL53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252225.2	NM_053050	
ATOH8	84913	hgsc.bcm.edu	37	2	85981761	85981761	+	Missense_Mutation	SNP	T	T	C	rs17851881	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr2:85981761T>C	ENST00000306279.3	+	1	745	c.449T>C	c.(448-450)cTg>cCg	p.L150P		NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	150	Pro-rich.		L -> P (in dbSNP:rs17851881). {ECO:0000269|PubMed:12419857, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						GAGCCGGGTCTGCGTCCTCGC	0.786													T|||	2860	0.571086	0.4758	0.6383	5008	,	,		10130	0.7421		0.6093	False		,,,				2504	0.4366				p.L150P		.											.	ATOH8-90	0			c.T449C						.	T	PRO/LEU	1790,1646		523,744,451	5.0	7.0	6.0		449	2.5	0.8	2	dbSNP_123	6	3836,2834		1197,1442,696	no	missense	ATOH8	NM_032827.6	98	1720,2186,1147	CC,CT,TT		42.4888,47.9045,44.3301	possibly-damaging	150/322	85981761	5626,4480	1718	3335	5053	SO:0001583	missense	84913	exon1			CGGGTCTGCGTCC	AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.449T>C	2.37:g.85981761T>C	ENSP00000304676:p.Leu150Pro	0	0		6	6	NM_032827	0	0	0	0	0	Q504S2|Q659B0	Missense_Mutation	SNP	ENST00000306279.3	37	CCDS1985.1	1347	0.6167582417582418	233	0.4735772357723577	232	0.6408839779005525	433	0.756993006993007	449	0.5923482849604221	T	13.11	2.140335	0.37825	0.520955	0.575112	ENSG00000168874	ENST00000306279	D	0.94650	-3.48	3.6	2.45	0.29901	.	0.166402	0.23793	N	0.044509	T	0.00012	0.0000	N	0.24115	0.695	0.26047	P	0.9815344	B;B	0.10296	0.003;0.001	B;B	0.08055	0.002;0.003	T	0.45352	-0.9267	9	0.72032	D	0.01	-10.2738	5.5522	0.17097	0.0:0.126:0.0:0.874	rs17851881	150;150	Q96SQ7;Q96SQ7-2	ATOH8_HUMAN;.	P	150	ENSP00000304676:L150P	ENSP00000304676:L150P	L	+	2	0	ATOH8	85835272	0.913000	0.31002	0.756000	0.31282	0.353000	0.29299	1.683000	0.37638	0.758000	0.33059	0.374000	0.22700	CTG	T|0.382;C|0.618		0.786	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252496.1	NM_032827	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		0	0		20	20	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
SNED1	25992	hgsc.bcm.edu	37	2	242011084	242011084	+	Missense_Mutation	SNP	T	T	C	rs17440466	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr2:242011084T>C	ENST00000310397.8	+	25	3683	c.3683T>C	c.(3682-3684)cTg>cCg	p.L1228P	SNED1_ENST00000342631.6_Missense_Mutation_p.L1228P|SNED1_ENST00000405547.3_Missense_Mutation_p.L1228P|SNED1_ENST00000401884.1_Missense_Mutation_p.L1228P|MTERFD2_ENST00000464344.2_5'Flank	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	1228			L -> P (in dbSNP:rs17440466).		cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CTGCCGGAGCTGCGCCTGCTC	0.726													T|||	550	0.109824	0.0227	0.0821	5008	,	,		7723	0.1885		0.171	False		,,,				2504	0.1033				p.L1228P		.											.	SNED1-72	0			c.T3683C						.	T	PRO/LEU	148,3636		7,134,1751	5.0	6.0	6.0		3683	4.4	1.0	2	dbSNP_123	6	1058,6892		57,944,2974	no	missense	SNED1	NM_001080437.1	98	64,1078,4725	CC,CT,TT		13.3082,3.9112,10.2778	probably-damaging	1228/1414	242011084	1206,10528	1892	3975	5867	SO:0001583	missense	25992	exon25			CGGAGCTGCGCCT	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.3683T>C	2.37:g.242011084T>C	ENSP00000308893:p.Leu1228Pro	1	0		18	17	NM_001080437	0	0	0	6	6	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Missense_Mutation	SNP	ENST00000310397.8	37	CCDS46562.1	255	0.11675824175824176	17	0.034552845528455285	27	0.07458563535911603	105	0.18356643356643357	106	0.13984168865435356	T	13.43	2.236189	0.39498	0.039112	0.133082	ENSG00000162804	ENST00000401884;ENST00000405547;ENST00000310397;ENST00000342631	D;D;D;D	0.83992	-1.72;-1.79;-1.76;-1.72	4.36	4.36	0.52297	.	0.000000	0.34025	N	0.004340	T	0.01156	0.0038	M	0.67953	2.075	0.09310	P	0.99999566469	D;D;D;D	0.76494	0.992;0.996;0.999;0.96	P;D;D;P	0.83275	0.857;0.918;0.996;0.613	T	0.33904	-0.9850	9	0.37606	T	0.19	.	11.3537	0.49602	0.0:0.0:0.0:1.0	rs17440466;rs17440466	1228;1228;1228;1228	Q8TER0-3;Q8TER0-5;B5MEF5;Q8TER0	.;.;.;SNED1_HUMAN	P	1228	ENSP00000384871:L1228P;ENSP00000386007:L1228P;ENSP00000308893:L1228P;ENSP00000342992:L1228P	ENSP00000308893:L1228P	L	+	2	0	SNED1	241659757	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	1.160000	0.31761	1.727000	0.51537	0.383000	0.25322	CTG	T|0.877;C|0.123		0.726	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
SLC4A11	83959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	3209573	3209573	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr20:3209573C>G	ENST00000380056.3	-	16	2198	c.2151G>C	c.(2149-2151)tgG>tgC	p.W717C	SLC4A11_ENST00000539553.2_Missense_Mutation_p.W701C|SLC4A11_ENST00000380059.3_Missense_Mutation_p.W744C|SLC4A11_ENST00000488544.1_Intron	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	717	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CGGCATGGATCCAAGGCAGCC	0.622																																					p.W744C	NSCLC(190;922 2139 10266 10292 38692)	.											.	SLC4A11-91	0			c.G2232C						.						141.0	117.0	126.0					20																	3209573		2202	4300	6502	SO:0001583	missense	83959	exon17			ATGGATCCAAGGC	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.2151G>C	20.37:g.3209573C>G	ENSP00000369396:p.Trp717Cys	218	0		202	26	NM_001174090	0	0	2	2	0	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.295137	0.81025	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	D;D;D	0.82803	-1.65;-1.65;-1.65	5.03	5.03	0.67393	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93841	0.8030	H	0.94222	3.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95399	0.8488	10	0.87932	D	0	.	18.7421	0.91777	0.0:1.0:0.0:0.0	.	701;744;717	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	C	744;717;701	ENSP00000369399:W744C;ENSP00000369396:W717C;ENSP00000441370:W701C	ENSP00000369396:W717C	W	-	3	0	SLC4A11	3157573	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.757000	0.85209	2.515000	0.84797	0.462000	0.41574	TGG	.		0.622	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1		
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		10	5	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
GATA5	140628	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	61048581	61048581	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr20:61048581C>T	ENST00000252997.2	-	3	638	c.577G>A	c.(577-579)Ggg>Agg	p.G193R		NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	193					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			GACAGGGCCCCGCAGTTGACA	0.672																																					p.G193R		.											.	GATA5-90	0			c.G577A						.						48.0	41.0	43.0					20																	61048581		2195	4295	6490	SO:0001583	missense	140628	exon3			GGGCCCCGCAGTT	BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.577G>A	20.37:g.61048581C>T	ENSP00000252997:p.Gly193Arg	227	2		248	76	NM_080473	0	0	0	0	0	D9ZGF7|Q17RE2|Q86VU4	Missense_Mutation	SNP	ENST00000252997.2	37	CCDS13499.1	.	.	.	.	.	.	.	.	.	.	C	34	5.375648	0.95923	.	.	ENSG00000130700	ENST00000370545;ENST00000540404;ENST00000252997	D	0.99667	-6.34	4.78	4.78	0.61160	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (5);	0.000000	0.85682	D	0.000000	D	0.99573	0.9846	M	0.77616	2.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98085	1.0406	10	0.87932	D	0	-12.0291	17.8743	0.88821	0.0:1.0:0.0:0.0	.	193	Q9BWX5	GATA5_HUMAN	R	193;213;193	ENSP00000252997:G193R	ENSP00000252997:G193R	G	-	1	0	GATA5	60481976	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.676000	0.84012	2.218000	0.71995	0.556000	0.70494	GGG	.		0.672	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080038.2	NM_080473	
OGFR	11054	hgsc.bcm.edu	37	20	61444569	61444569	+	Silent	SNP	A	A	G	rs3204348		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr20:61444569A>G	ENST00000290291.6	+	7	1627	c.1602A>G	c.(1600-1602)ccA>ccG	p.P534P	OGFR_ENST00000370461.1_Silent_p.P482P	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	534	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GGGACGAGCCAGCCGAGAGCC	0.721																																					p.P534P		.											.	OGFR-68	0			c.A1602G						.						11.0	17.0	15.0					20																	61444569		2124	4201	6325	SO:0001819	synonymous_variant	11054	exon7			CGAGCCAGCCGAG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1602A>G	20.37:g.61444569A>G		17	0		66	4	NM_007346	0	0	135	147	12	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	CCDS13504.1																																																																																			A|0.979;G|0.021		0.721	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
KCNQ2	3785	broad.mit.edu	37	20	62038077	62038077	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr20:62038077T>G	ENST00000359125.2	-	17	2713	c.2539A>C	c.(2539-2541)Acc>Ccc	p.T847P	KCNQ2_ENST00000359689.1_Missense_Mutation_p.T847P|KCNQ2_ENST00000354587.3_Missense_Mutation_p.T855P|KCNQ2_ENST00000370224.1_Missense_Mutation_p.T855P|KCNQ2_ENST00000357249.2_Missense_Mutation_p.T829P|KCNQ2_ENST00000344462.4_Missense_Mutation_p.T816P|KCNQ2_ENST00000360480.3_Missense_Mutation_p.T819P	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	847					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.T847P(1)		biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CCGCACGGGGTACAGAGGTCG	0.697																																					p.T847P		.											.	KCNQ2-92	1	Substitution - Missense(1)	prostate(1)	c.A2539C						.						20.0	21.0	20.0					20																	62038077		2185	4296	6481	SO:0001583	missense	3785	exon17			ACGGGGTACAGAG	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.2539A>C	20.37:g.62038077T>G	ENSP00000352035:p.Thr847Pro	22	4		51	18	NM_172107	0	0	0	0	0	O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	ENST00000359125.2	37	CCDS13520.1	.	.	.	.	.	.	.	.	.	.	T	12.28	1.889657	0.33348	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224	T;T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	4.95	4.95	0.65309	.	0.121043	0.56097	D	0.000030	T	0.39886	0.1095	L	0.31926	0.97	0.42790	D	0.99389	B;B;B;B	0.19200	0.01;0.016;0.013;0.034	B;B;B;B	0.21360	0.009;0.013;0.009;0.034	T	0.31475	-0.9942	10	0.59425	D	0.04	-48.4727	14.5952	0.68400	0.0:0.0:0.0:1.0	.	819;829;816;847	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	P	829;847;817;855;847;816;819;843;855	ENSP00000349789:T829P;ENSP00000352035:T847P;ENSP00000359246:T817P;ENSP00000346601:T855P;ENSP00000352718:T847P;ENSP00000399612:T816P;ENSP00000353668:T819P;ENSP00000339611:T843P;ENSP00000359244:T855P	ENSP00000339611:T843P	T	-	1	0	KCNQ2	61508521	1.000000	0.71417	1.000000	0.80357	0.091000	0.18340	3.506000	0.53364	1.867000	0.54127	0.402000	0.26972	ACC	.		0.697	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1	NM_172109	
MX2	4600	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	42749766	42749766	+	Silent	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr21:42749766C>T	ENST00000330714.3	+	3	484	c.300C>T	c.(298-300)tgC>tgT	p.C100C	MX2_ENST00000543692.1_Silent_p.C100C	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	100					cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				TGCGCCCCTGCATTGACCTCA	0.637																																					p.C100C		.											.	MX2-92	0			c.C300T						.						86.0	79.0	81.0					21																	42749766		2203	4300	6503	SO:0001819	synonymous_variant	4600	exon3			CCCCTGCATTGAC		CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.300C>T	21.37:g.42749766C>T		144	0		176	25	NM_002463	0	0	1	1	0	B7Z5D3|D3DSI7	Silent	SNP	ENST00000330714.3	37	CCDS13672.1																																																																																			.		0.637	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195147.1	NM_002463	
RRP1	8568	bcgsc.ca	37	21	45211298	45211298	+	Missense_Mutation	SNP	C	C	A	rs201407956	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr21:45211298C>A	ENST00000497547.1	+	2	318	c.201C>A	c.(199-201)gaC>gaA	p.D67E		NM_003683.5	NP_003674.1	P05386	RLA1_HUMAN	ribosomal RNA processing 1	0					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|lung(4)|stomach(2)	8				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)		GGATGCAGGACAAGCCACTCC	0.517																																					p.D67E		.											.	RRP1-90	0			c.C201A						.						66.0	74.0	71.0					21																	45211298		2082	4202	6284	SO:0001583	missense	8568	exon2			GCAGGACAAGCCA	U79775	CCDS42951.1	21q22.3	2013-07-02	2013-07-02		ENSG00000160214	ENSG00000160214			18785	protein-coding gene	gene with protein product	"""DNA segment on chromosome 21 (unique) 2056 expressed sequence"", ""Nnp1 homolog, nucleolar protein (Drosophila)"""	610653	"""ribosomal RNA processing 1 homolog (S. cerevisiae)"""			10830953, 10341208	Standard	NM_003683		Approved	NNP-1, Nop52, NOP52, RRP1A, D21S2056E	uc002zds.2	P56182	OTTHUMG00000086884	ENST00000497547.1:c.201C>A	21.37:g.45211298C>A	ENSP00000417464:p.Asp67Glu	145	19		189	40	NM_003683	0	0	36	37	1	A6NIB2	Missense_Mutation	SNP	ENST00000497547.1	37	CCDS42951.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992367	0.74703	.	.	ENSG00000160214	ENST00000497547;ENST00000400387	T	0.68624	-0.34	4.86	2.98	0.34508	.	0.045823	0.85682	N	0.000000	T	0.79811	0.4510	H	0.96604	3.85	0.53688	D	0.999979	P;P	0.46784	0.79;0.884	P;P	0.49252	0.45;0.604	T	0.80106	-0.1521	10	0.87932	D	0	.	7.2428	0.26106	0.0:0.5783:0.3313:0.0904	.	67;67	B4DZM3;P56182	.;RRP1_HUMAN	E	67	ENSP00000417464:D67E	ENSP00000383237:D67E	D	+	3	2	RRP1	44035726	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.181000	0.32017	0.420000	0.25954	0.650000	0.86243	GAC	C|0.998;A|0.002		0.517	RRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195680.1	NM_003683	
ADARB1	104	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	46640924	46640924	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr21:46640924G>A	ENST00000360697.3	+	9	2056	c.2041G>A	c.(2041-2043)Ggc>Agc	p.G681S	ADARB1_ENST00000437626.1_3'UTR|ADARB1_ENST00000389863.4_Missense_Mutation_p.G681S|ADARB1_ENST00000348831.4_Missense_Mutation_p.G641S|ADARB1_ENST00000539173.1_Missense_Mutation_p.G681S			P78563	RED1_HUMAN	adenosine deaminase, RNA-specific, B1	681	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|positive regulation of viral genome replication (GO:0045070)|regulation of cell cycle (GO:0051726)|RNA processing (GO:0006396)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA adenosine deaminase activity (GO:0003726)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(1)	17				Colorectal(79;0.115)		GCGTGTGCACGGCAAGGTACT	0.587																																					p.G681S		.											.	ADARB1-91	0			c.G2041A						.						64.0	45.0	51.0					21																	46640924		2203	4300	6503	SO:0001583	missense	104	exon11			GTGCACGGCAAGG	U76420	CCDS33589.1, CCDS33590.1, CCDS42970.1	21q22.3	2012-03-22	2010-06-24		ENSG00000197381	ENSG00000197381	3.5.-.-		226	protein-coding gene	gene with protein product	"""RED1 homolog (rat)"""	601218	"""adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)"""			9143496, 14759252	Standard	NR_027672		Approved	ADAR2, DRADA2, ADAR2g, DRABA2, RED1, hRED1, ADAR2a-L1, ADAR2a-L2, ADAR2a-L3, ADAR2a, ADAR2b, ADAR2c, ADAR2d	uc002zgy.2	P78563	OTTHUMG00000090295	ENST00000360697.3:c.2041G>A	21.37:g.46640924G>A	ENSP00000353920:p.Gly681Ser	102	1		134	34	NM_015834	0	0	0	0	0	A6NFK8|A6NJ84|C3TTQ1|C3TTQ2|C9JUP4|G5E9B4|O00395|O00465|O00691|O00692|P78555|Q4AE79|Q6P0M9|Q8NFD1	Missense_Mutation	SNP	ENST00000360697.3	37	CCDS33589.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.65|14.65	2.598151|2.598151	0.46318|0.46318	.|.	.|.	ENSG00000197381|ENSG00000197381	ENST00000539173;ENST00000389863;ENST00000348831;ENST00000360697|ENST00000539917	D;D;D;D|.	0.92911|.	-3.13;-3.13;-3.13;-3.13|.	4.59|4.59	3.71|3.71	0.42584|0.42584	Adenosine deaminase/editase (3);|.	0.912313|.	0.09563|.	N|.	0.785321|.	T|T	0.40694|0.40694	0.1127|0.1127	N|N	0.16233|0.16233	0.39|0.39	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.28324|.	0.207;0.009;0.003;0.043|.	B;B;B;B|.	0.21917|.	0.037;0.01;0.004;0.022|.	T|T	0.19160|0.19160	-1.0314|-1.0314	10|6	0.40728|0.28530	T|T	0.16|0.3	-34.553|-34.553	10.7476|10.7476	0.46189|0.46189	0.0954:0.0:0.9046:0.0|0.0954:0.0:0.9046:0.0	.|.	681;641;669;681|.	P78563;Q4AE77;G5E9B4;P78563-3|.	RED1_HUMAN;.;.;.|.	S|Q	681;681;641;681|680	ENSP00000441897:G681S;ENSP00000374513:G681S;ENSP00000015877:G641S;ENSP00000353920:G681S|.	ENSP00000015877:G641S|ENSP00000445318:R680Q	G|R	+|+	1|2	0|0	ADARB1|ADARB1	45465352|45465352	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.846000|0.846000	0.48090|0.48090	2.598000|2.598000	0.46223|0.46223	1.077000|1.077000	0.40990|0.40990	-0.253000|-0.253000	0.11424|0.11424	GGC|CGG	.		0.587	ADARB1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206648.2	NM_015833	
PATZ1	23598	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	31741420	31741420	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr22:31741420C>T	ENST00000266269.5	-	1	798	c.169G>A	c.(169-171)Gcc>Acc	p.A57T	PATZ1_ENST00000351933.4_Missense_Mutation_p.A57T|PATZ1_ENST00000215919.3_Missense_Mutation_p.A57T|AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000405309.3_Missense_Mutation_p.A57T	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	57	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						GCCAGCACGGCGCGGTGCGCT	0.682																																					p.A57T		.											.	PATZ1-590	0			c.G169A						.						23.0	23.0	23.0					22																	31741420		2203	4298	6501	SO:0001583	missense	23598	exon1			GCACGGCGCGGTG	AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.169G>A	22.37:g.31741420C>T	ENSP00000266269:p.Ala57Thr	34	0		116	18	NM_032050	0	0	4	4	0	Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	ENST00000266269.5	37	CCDS13894.1	.	.	.	.	.	.	.	.	.	.	C	31	5.070299	0.93950	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933;ENST00000215919	T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49	4.09	4.09	0.47781	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.067243	0.64402	D	0.000016	T	0.79656	0.4483	L	0.46670	1.46	0.80722	D	1	D;D;D;D	0.89917	0.993;0.993;1.0;0.993	P;P;D;P	0.85130	0.633;0.633;0.997;0.807	T	0.82520	-0.0416	10	0.87932	D	0	-13.1993	15.7205	0.77705	0.0:1.0:0.0:0.0	.	57;57;57;57	Q9HBE1-4;Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;.;PATZ1_HUMAN;.	T	57	ENSP00000266269:A57T;ENSP00000384173:A57T;ENSP00000337520:A57T;ENSP00000215919:A57T	ENSP00000215919:A57T	A	-	1	0	PATZ1	30071420	0.998000	0.40836	1.000000	0.80357	0.967000	0.64934	2.934000	0.48956	1.994000	0.58287	0.485000	0.47835	GCC	.		0.682	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321932.1	NM_032052	
SREBF2	6721	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	42271554	42271554	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr22:42271554delA	ENST00000361204.4	+	7	1378	c.1212delA	c.(1210-1212)ctafs	p.L404fs		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	404	Interaction with LMNA. {ECO:0000250}.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CAGAGCTTCTAAAGGGCATCG	0.512																																					p.L404fs		.											.	SREBF2-154	0			c.1212delA						.						143.0	155.0	151.0					22																	42271554		2203	4300	6503	SO:0001589	frameshift_variant	6721	exon7			GCTTCTAAAGGGC	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1212delA	22.37:g.42271554delA	ENSP00000354476:p.Leu404fs	131	0		79	69	NM_004599	0	0	0	0	0	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Frame_Shift_Del	DEL	ENST00000361204.4	37	CCDS14023.1																																																																																			.		0.512	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
MOV10L1	54456	bcgsc.ca	37	22	50528916	50528916	+	Intron	SNP	C	C	T	rs9617018	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr22:50528916C>T	ENST00000262794.5	+	1	180				MOV10L1_ENST00000395843.1_Intron|MOV10L1_ENST00000545383.1_Intron|MOV10L1_ENST00000395858.3_Intron|MOV10L1_ENST00000475190.1_Intron|MOV10L1_ENST00000540615.1_Silent_p.L4L	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1						ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		TGTCGTTCCTCCCTGTCCGCA	0.617													c|||	825	0.164736	0.0946	0.3127	5008	,	,		15244	0.1944		0.1352	False		,,,				2504	0.1544				p.L4L		.											.	MOV10L1-93	0			c.C12T						.		,,	333,2803		20,293,1255	47.0	49.0	48.0		,12,	0.5	0.0	22	dbSNP_119	48	1056,6108		84,888,2610	no	intron,coding-synonymous,intron	MOV10L1	NM_001164104.1,NM_001164105.1,NM_018995.2	,,	104,1181,3865	TT,TC,CC		14.7404,10.6186,13.4854	,,	,4/1166,	50528916	1389,8911	1568	3582	5150	SO:0001627	intron_variant	54456	exon1			GTTCCTCCCTGTC	AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.97+302C>T	22.37:g.50528916C>T		103	0		71	7	NM_001164105	0	0	0	0	0	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Silent	SNP	ENST00000262794.5	37	CCDS14084.1																																																																																			C|0.845;T|0.155		0.617	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075009.2	NM_018995	
TMEM158	25907	hgsc.bcm.edu	37	3	45267310	45267310	+	Silent	SNP	C	C	T	rs41118	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr3:45267310C>T	ENST00000503771.1	-	1	460	c.210G>A	c.(208-210)gcG>gcA	p.A70A		NM_015444.2	NP_056259.2	Q8WZ71	TM158_HUMAN	transmembrane protein 158 (gene/pseudogene)	70	Poly-Ala.					integral component of membrane (GO:0016021)	peptide binding (GO:0042277)								BRCA - Breast invasive adenocarcinoma(193;0.00839)|KIRC - Kidney renal clear cell carcinoma(197;0.0461)|Kidney(197;0.0576)		acggcgccgccgccgccgccg	0.776													C|||	3274	0.653754	0.2352	0.7723	5008	,	,		3383	0.8423		0.8091	False		,,,				2504	0.7812				p.A70A		.											.	.	0			c.G210A						.						1.0	1.0	1.0					3																	45267310		354	1145	1499	SO:0001819	synonymous_variant	25907	exon1			CGCCGCCGCCGCC	AF438313	CCDS54573.1	3p21.31	2010-03-12	2010-03-12						30293	protein-coding gene	gene with protein product	"""Ras induced senescence 1"""		"""transmembrane protein 158"""			11399754, 11822868	Standard	NM_015444		Approved	RIS1, p40BBp	uc011baf.2	Q8WZ71		ENST00000503771.1:c.210G>A	3.37:g.45267310C>T		0	0		5	5	NM_015444	0	0	0	0	0	Q6PFW5|Q9Y4M1	Silent	SNP	ENST00000503771.1	37	CCDS54573.1																																																																																			C|0.328;T|0.672		0.776	TMEM158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360190.1	NM_015444	
CHDH	55349	hgsc.bcm.edu	37	3	53857917	53857917	+	Missense_Mutation	SNP	T	T	G	rs9001	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr3:53857917T>G	ENST00000315251.6	-	3	556	c.119A>C	c.(118-120)gAg>gCg	p.E40A		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	40			E -> A (in dbSNP:rs9001).		glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	ATAGCTGTACTCGTCCCGGCT	0.761													T|||	1221	0.24381	0.3238	0.2781	5008	,	,		12724	0.3651		0.1004	False		,,,				2504	0.1339				p.E40A		.											.	CHDH-91	0			c.A119C						.	T	ALA/GLU	816,2768		76,664,1052	6.0	6.0	6.0		119	3.8	1.0	3	dbSNP_52	6	469,6875		12,445,3215	no	missense	CHDH	NM_018397.4	107	88,1109,4267	GG,GT,TT		6.3862,22.7679,11.7588	possibly-damaging	40/595	53857917	1285,9643	1792	3672	5464	SO:0001583	missense	55349	exon3			CTGTACTCGTCCC	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.119A>C	3.37:g.53857917T>G	ENSP00000319851:p.Glu40Ala	0	0		8	8	NM_018397	0	0	0	0	0	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	37	CCDS2873.1	536	0.2454212454212454	164	0.3333333333333333	82	0.2265193370165746	201	0.3513986013986014	89	0.11741424802110818	T	14.21	2.467073	0.43839	0.227679	0.063862	ENSG00000016391	ENST00000315251;ENST00000481668;ENST00000467802	T;T;T	0.68479	-0.33;1.42;-0.33	5.03	3.8	0.43715	.	0.330341	0.32134	N	0.006528	T	0.00012	0.0000	N	0.08118	0	0.37702	P	0.07576799999999995	B	0.17465	0.022	B	0.12156	0.007	T	0.12372	-1.0550	9	0.56958	D	0.05	-41.8442	8.4332	0.32771	0.0:0.0:0.1978:0.8022	rs9001;rs3172489;rs58735855;rs9001	40	Q8NE62	CHDH_HUMAN	A	40	ENSP00000319851:E40A;ENSP00000418273:E40A;ENSP00000419863:E40A	ENSP00000319851:E40A	E	-	2	0	CHDH	53832957	0.187000	0.23238	0.988000	0.46212	0.816000	0.46133	1.016000	0.29976	2.240000	0.73641	0.533000	0.62120	GAG	T|0.749;G|0.251		0.761	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
TSC22D2	9819	hgsc.bcm.edu	37	3	150128392	150128392	+	Missense_Mutation	SNP	G	G	A	rs879634	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr3:150128392G>A	ENST00000361875.3	+	1	2271	c.1255G>A	c.(1255-1257)Gct>Act	p.A419T	TSC22D2_ENST00000361136.2_Missense_Mutation_p.A419T	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	419			A -> T (in dbSNP:rs879634).		response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CGGCCAGAATGCTTCCTCGGT	0.771													G|||	952	0.190096	0.2224	0.1657	5008	,	,		13018	0.0407		0.2724	False		,,,				2504	0.2331				p.A419T		.											.	TSC22D2-91	0			c.G1255A						.	G	THR/ALA	435,2751		29,377,1187	2.0	3.0	3.0		1255	1.5	0.0	3	dbSNP_86	3	1458,5444		170,1118,2163	yes	missense	TSC22D2	NM_014779.2	58	199,1495,3350	AA,AG,GG		21.1243,13.6535,18.7649	benign	419/781	150128392	1893,8195	1593	3451	5044	SO:0001583	missense	9819	exon1			CAGAATGCTTCCT	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1255G>A	3.37:g.150128392G>A	ENSP00000354543:p.Ala419Thr	0	0		27	27	NM_014779	0	0	0	0	0	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	ENST00000361875.3	37	CCDS3149.1	433	0.19826007326007325	126	0.25609756097560976	72	0.19889502762430938	23	0.04020979020979021	212	0.2796833773087071	G	1.438	-0.568481	0.03910	0.136535	0.211243	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.30182	1.54;1.54	3.57	1.47	0.22746	.	0.687211	0.12935	N	0.427041	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B;B	0.10296	0.003;0.001	B;B	0.09377	0.004;0.002	T	0.33599	-0.9862	9	0.51188	T	0.08	.	6.993	0.24765	0.0:0.4503:0.379:0.1707	rs879634;rs3749399;rs58335631	419;419	O75157-2;O75157	.;T22D2_HUMAN	T	419	ENSP00000354543:A419T;ENSP00000354893:A419T	ENSP00000354893:A419T	A	+	1	0	TSC22D2	151611082	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.305000	0.19254	0.805000	0.34159	0.557000	0.71058	GCT	G|0.797;A|0.203		0.771	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000357123.2	NM_014779	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388726	1388726	+	Missense_Mutation	SNP	T	T	C	rs199689156	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:1388726T>C	ENST00000324803.4	+	1	3387	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	143					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGCGGAGTGCC	0.697																																					p.C143R		.											.	CRIPAK-90	0			c.T427C						.						38.0	37.0	37.0					4																	1388726		1908	3685	5593	SO:0001583	missense	285464	exon1			TGCCCATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.427T>C	4.37:g.1388726T>C	ENSP00000323978:p.Cys143Arg	5	0		125	20	NM_175918	0	0	2	2	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.608|8.608	0.888529|0.888529	0.17540|0.17540	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	0.948|0.948	-0.668|-0.668	0.11392|0.11392	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.12860|0.12860	0.0312|0.0312	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.27594|.	0.182|.	B|.	0.13407|.	0.009|.	T|T	0.30621|0.30621	-0.9972|-0.9972	9|6	0.51188|0.06365	T|T	0.08|0.9	.|.	4.4755|4.4755	0.11733|0.11733	0.0:0.2357:0.0:0.7643|0.0:0.2357:0.0:0.7643	.|.	143|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	143|126	ENSP00000323978:C143R|.	ENSP00000323978:C143R|ENSP00000372402:M126T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378726|1378726	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	-0.703000|-0.703000	0.05063|0.05063	-0.155000|-0.155000	0.11098|0.11098	0.102000|0.102000	0.15555|0.15555	TGC|ATG	T|0.980;C|0.020		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		2	0		60	31	NM_175918	0	0	2	13	11	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		3	0		22	16	NM_175918	0	0	10	21	11	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
DRD5	1816	ucsc.edu	37	4	9784617	9784617	+	Missense_Mutation	SNP	T	T	C	rs112029473	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:9784617T>C	ENST00000304374.2	+	1	1360	c.964T>C	c.(964-966)Tgc>Cgc	p.C322R		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	322					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GGTCCCTTTCTGCAGTGGACA	0.582																																					p.C322R		.											.	DRD5-91	0			c.T964C						.						80.0	81.0	81.0					4																	9784617		2203	4300	6503	SO:0001583	missense	1816	exon1			CCTTTCTGCAGTG	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.964T>C	4.37:g.9784617T>C	ENSP00000306129:p.Cys322Arg	101	4		76	9	NM_000798	0	0	0	0	0	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	t	18.40	3.614823	0.66672	.	.	ENSG00000169676	ENST00000304374	T	0.73047	-0.71	4.73	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86928	0.6051	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89813	0.3983	10	0.66056	D	0.02	.	13.5854	0.61928	0.0:0.0:0.0:1.0	.	322	P21918	DRD5_HUMAN	R	322	ENSP00000306129:C322R	ENSP00000306129:C322R	C	+	1	0	DRD5	9393715	1.000000	0.71417	0.985000	0.45067	0.918000	0.54935	7.506000	0.81665	1.990000	0.58119	0.377000	0.23210	TGC	T|0.500;C|0.500		0.582	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
PCDH7	5099	broad.mit.edu;bcgsc.ca	37	4	30724413	30724413	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:30724413G>A	ENST00000361762.2	+	1	2377	c.1369G>A	c.(1369-1371)Gtg>Atg	p.V457M	PCDH7_ENST00000543491.1_Missense_Mutation_p.V457M	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	457	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CGAGAACGGGGTGGTCACCTG	0.642																																					p.V457M		.											.	PCDH7-229	0			c.G1369A						.						71.0	55.0	60.0					4																	30724413		2203	4300	6503	SO:0001583	missense	5099	exon1			AACGGGGTGGTCA	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1369G>A	4.37:g.30724413G>A	ENSP00000355243:p.Val457Met	193	1		209	16	NM_032457	0	0	0	0	0	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	37	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.11|17.11	3.304874|3.304874	0.60305|0.60305	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000511884|ENST00000361762;ENST00000543491;ENST00000333135	T|T;T	0.23348|0.51817	1.91|0.69;0.69	5.16|5.16	5.16|5.16	0.70880|0.70880	.|Cadherin (4);Cadherin-like (1);	.|.	.|.	.|.	.|.	T|T	0.57695|0.57695	0.2071|0.2071	L|L	0.34521|0.34521	1.04|1.04	0.46396|0.46396	D|D	0.99902|0.99902	.|P;D;D	.|0.57571	.|0.954;0.975;0.98	.|P;P;P	.|0.62885	.|0.851;0.851;0.908	T|T	0.56926|0.56926	-0.7898|-0.7898	7|9	0.87932|0.48119	D|T	0|0.1	.|.	18.841|18.841	0.92184|0.92184	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|457;410;457	.|F5GWJ1;O60245-3;O60245	.|.;.;PCDH7_HUMAN	D|M	146|457;457;410	ENSP00000427066:G146D|ENSP00000355243:V457M;ENSP00000441802:V457M	ENSP00000427066:G146D|ENSP00000330302:V410M	G|V	+|+	2|1	0|0	PCDH7|PCDH7	30333511|30333511	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.303000|5.303000	0.65738|0.65738	2.679000|2.679000	0.91253|0.91253	0.655000|0.655000	0.94253|0.94253	GGT|GTG	.		0.642	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
NMU	10874	hgsc.bcm.edu	37	4	56502304	56502304	+	Missense_Mutation	SNP	G	G	T	rs35771241	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:56502304G>T	ENST00000264218.3	-	1	161	c.56C>A	c.(55-57)gCg>gAg	p.A19E	NMU_ENST00000515325.1_Intron|NMU_ENST00000505262.1_Missense_Mutation_p.A19E|NMU_ENST00000507338.1_Missense_Mutation_p.A19E|NMU_ENST00000511469.1_Missense_Mutation_p.A19E	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	19					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		gagcGGGGACGCCGCGGCCAC	0.761													G|||	88	0.0175719	0.0038	0.0245	5008	,	,		10083	0.0		0.0577	False		,,,				2504	0.0082				p.A19E		.											.	NMU-650	0			c.C56A	GRCh37	CM066152	NMU	M	rs35771241	.	G	GLU/ALA	34,3224		0,34,1595	5.0	7.0	6.0		56	1.1	0.0	4	dbSNP_126	6	262,5824		1,260,2782	no	missense	NMU	NM_006681.2	107	1,294,4377	TT,TG,GG		4.305,1.0436,3.1678	benign	19/175	56502304	296,9048	1629	3043	4672	SO:0001583	missense	10874	exon1			GGGGACGCCGCGG	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.56C>A	4.37:g.56502304G>T	ENSP00000264218:p.Ala19Glu	0	0		12	11	NM_006681	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	64	0.029304029304029304	6	0.012195121951219513	16	0.04419889502762431	0	0.0	42	0.055408970976253295	G	14.57	2.576146	0.45902	0.010436	0.04305	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.38887	1.11;1.25;1.19;1.18	2.89	1.06	0.20224	.	0.337479	0.19087	U	0.123078	T	0.03959	0.0111	L	0.44542	1.39	0.09310	N	1	D	0.54397	0.966	P	0.45195	0.473	T	0.03784	-1.1004	10	0.52906	T	0.07	-8.0688	3.8411	0.08914	0.1476:0.2562:0.5962:0.0	rs35771241	19	P48645	NMU_HUMAN	E	19	ENSP00000422399:A19E;ENSP00000264218:A19E;ENSP00000424246:A19E;ENSP00000422870:A19E	ENSP00000264218:A19E	A	-	2	0	NMU	56197061	0.000000	0.05858	0.001000	0.08648	0.273000	0.26683	-0.032000	0.12266	0.255000	0.21593	0.195000	0.17529	GCG	G|0.970;T|0.030		0.761	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		0	0		9	8	NM_001029870	0	0	0	0	0	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
MTTP	4547	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	100512918	100512918	+	Silent	SNP	A	A	G			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:100512918A>G	ENST00000265517.5	+	6	932	c.729A>G	c.(727-729)ctA>ctG	p.L243L	MTTP_ENST00000457717.1_Silent_p.L243L|MTTP_ENST00000511045.1_Silent_p.L270L			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	243	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TGAATTTCCTACAAACCATTA	0.303																																					p.L243L		.											.	MTTP-93	0			c.A729G						.						65.0	64.0	65.0					4																	100512918		2203	4300	6503	SO:0001819	synonymous_variant	4547	exon7			TTTCCTACAAACC		CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.729A>G	4.37:g.100512918A>G		130	0		117	92	NM_000253	0	0	0	2	2	A8K428|Q08AM4|Q6P5T3	Silent	SNP	ENST00000265517.5	37	CCDS3651.1																																																																																			.		0.303	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253662.3		
IL2	3558	ucsc.edu;bcgsc.ca	37	4	123372913	123372913	+	Silent	SNP	C	C	T	rs1051753		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:123372913C>T	ENST00000226730.4	-	4	740	c.456G>A	c.(454-456)ctG>ctA	p.L152L		NM_000586.3	NP_000577.2	P60568	IL2_HUMAN	interleukin 2	152					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|immune response (GO:0006955)|natural killer cell activation (GO:0030101)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of heart contraction (GO:0045822)|negative regulation of inflammatory response (GO:0050728)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of T cell homeostatic proliferation (GO:0046013)|T cell differentiation (GO:0030217)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|cytokine activity (GO:0005125)|glycosphingolipid binding (GO:0043208)|growth factor activity (GO:0008083)|interleukin-2 receptor binding (GO:0005134)|kinase activator activity (GO:0019209)			endometrium(2)|large_intestine(4)|lung(6)|skin(1)	13				LUSC - Lung squamous cell carcinoma(721;0.185)	Pseudoephedrine(DB00852)	ATTATCAAGTCAGTGTTGAGA	0.313			T	TNFRSF17	intestinal T-cell lymphoma																																p.L152L		.		Dom	yes		4	4q26-q27	3558	interleukin 2		L	.	IL2-659	0			c.G456A						.						94.0	88.0	90.0					4																	123372913		2203	4300	6503	SO:0001819	synonymous_variant	3558	exon4			TCAAGTCAGTGTT	U25676	CCDS3726.1	4q26-q27	2011-07-14			ENSG00000109471	ENSG00000109471		"""Interleukins and interleukin receptors"""	6001	protein-coding gene	gene with protein product	"""T cell growth factor"""	147680				3260003	Standard	NM_000586		Approved	IL-2, TCGF	uc003ier.3	P60568	OTTHUMG00000133075	ENST00000226730.4:c.456G>A	4.37:g.123372913C>T		218	3		138	117	NM_000586	0	0	0	0	0	P01585	Silent	SNP	ENST00000226730.4	37	CCDS3726.1																																																																																			C|1.000;|0.000		0.313	IL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256715.2		
FRG1	2483	bcgsc.ca	37	4	190876277	190876277	+	Nonsense_Mutation	SNP	A	A	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr4:190876277A>T	ENST00000226798.4	+	5	625	c.403A>T	c.(403-405)Aga>Tga	p.R135*	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	135					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.R135*(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		AATTGGACCAAGAGAACAATG	0.358																																					p.R135X		.											.	FRG1-90	1	Substitution - Nonsense(1)	skin(1)	c.A403T						.						89.0	89.0	89.0					4																	190876277		2203	4300	6503	SO:0001587	stop_gained	2483	exon5			GGACCAAGAGAAC	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.403A>T	4.37:g.190876277A>T	ENSP00000226798:p.Arg135*	341	7		345	15	NM_004477	0	0	161	161	0	A8K775	Nonsense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	37	6.057581	0.97241	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	.	.	.	4.04	2.81	0.32909	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-5.2304	8.7138	0.34399	0.7565:0.2435:0.0:0.0	.	.	.	.	X	135;72	.	ENSP00000226798:R135X	R	+	1	2	FRG1	191113271	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.691000	0.54720	1.599000	0.50093	0.462000	0.41574	AGA	.		0.358	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
LRRC14B	389257	hgsc.bcm.edu	37	5	191992	191992	+	Silent	SNP	G	G	A	rs34710524	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:191992G>A	ENST00000328278.3	+	1	367	c.339G>A	c.(337-339)acG>acA	p.T113T		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	113										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						CTGACCTCACGGGCATCCGAG	0.741													G|||	110	0.0219649	0.0023	0.0346	5008	,	,		13465	0.0		0.0746	False		,,,				2504	0.0082				p.T113T		.											.	LRRC14B-69	0			c.G339A						.	G		35,2869		0,35,1417	2.0	3.0	2.0		339	-10.1	0.0	5	dbSNP_126	2	366,5908		2,362,2773	no	coding-synonymous	LRRC14B	NM_001080478.1		2,397,4190	AA,AG,GG		5.8336,1.2052,4.3691		113/515	191992	401,8777	1452	3137	4589	SO:0001819	synonymous_variant	389257	exon1			CCTCACGGGCATC		CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.339G>A	5.37:g.191992G>A		0	0		9	4	NM_001080478	0	0	0	0	0		Silent	SNP	ENST00000328278.3	37	CCDS47184.1																																																																																			G|0.975;A|0.025		0.741	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000365393.2	NM_001080478	
PDCD6	10016	hgsc.bcm.edu	37	5	271858	271869	+	In_Frame_Del	DEL	CCGGCCCTGGGG	CCGGCCCTGGGG	-	rs529816592|rs147793210|rs201564379	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	CCGGCCCTGGGG	CCGGCCCTGGGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:271858_271869delCCGGCCCTGGGG	ENST00000264933.4	+	1	123_134	c.23_34delCCGGCCCTGGGG	c.(22-36)cccggccctggggcc>ccc	p.GPGA9del	CTD-2083E4.6_ENST00000512642.1_RNA|PDCD6_ENST00000505221.1_In_Frame_Del_p.GPGA9del|PDCD6_ENST00000509581.1_In_Frame_Del_p.GPGA9del|PDCD6_ENST00000507528.1_In_Frame_Del_p.GPGA9del	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	9					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.A12_G15delAGPG(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			TCTTACCGCCCCGGCCCTGGGGCCGGCCCTGG	0.741														513	0.102436	0.1316	0.1657	5008	,	,		10520	0.0546		0.0905	False		,,,				2504	0.0798				p.8_12del		.											.	PDCD6-290	2	Deletion - In frame(2)	breast(2)	c.23_34del						.			265,2557		60,145,1206						2.2	1.0		dbSNP_126	6	779,5791		158,463,2664	no	coding	PDCD6	NM_013232.3		218,608,3870	A1A1,A1R,RR		11.8569,9.3905,11.1158				1044,8348				SO:0001651	inframe_deletion	10016	exon1			ACCGCCCCGGCCC	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.23_34delCCGGCCCTGGGG	5.37:g.271858_271869delCCGGCCCTGGGG	ENSP00000264933:p.Gly9_Ala12del	2	1		40	11	NM_013232	0	0	0	0	0	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	In_Frame_Del	DEL	ENST00000264933.4	37	CCDS3854.1																																																																																			.		0.741	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5140632	5140632	+	Silent	SNP	T	T	C	rs270208	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:5140632T>C	ENST00000274181.7	+	1	190	c.52T>C	c.(52-54)Ttg>Ctg	p.L18L	CTD-2297D10.2_ENST00000512155.1_RNA|ADAMTS16_ENST00000511368.1_Silent_p.L18L|CTD-2297D10.1_ENST00000514848.1_RNA	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	18					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTGGATGCTGTTGGCGCAGGT	0.766													C|||	3127	0.624401	0.6747	0.6571	5008	,	,		8861	0.8065		0.501	False		,,,				2504	0.4724				p.L18L		.											.	ADAMTS16-275	0			c.T52C						.	C		2046,874		775,496,189	2.0	5.0	4.0		52	1.2	1.0	5	dbSNP_79	4	3653,3047		1121,1411,818	no	coding-synonymous	ADAMTS16	NM_139056.2		1896,1907,1007	CC,CT,TT		45.4776,29.9315,40.7588		18/1225	5140632	5699,3921	1460	3350	4810	SO:0001819	synonymous_variant	170690	exon1			ATGCTGTTGGCGC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.52T>C	5.37:g.5140632T>C		0	0		8	8	NM_139056	0	0	0	0	0	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																			T|0.352;C|0.648		0.766	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	NSUN2_ENST00000539938.1_5'Flank|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G|SRD5A1_ENST00000504286.1_3'UTR|NSUN2_ENST00000506139.1_5'Flank	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		0	0		10	7	NM_001047	0	0	1	1	0	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
ZFYVE16	9765	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	79733160	79733160	+	Missense_Mutation	SNP	A	A	G	rs141062809		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:79733160A>G	ENST00000338008.5	+	3	836	c.656A>G	c.(655-657)tAt>tGt	p.Y219C	ZFYVE16_ENST00000510158.1_Missense_Mutation_p.Y219C|ZFYVE16_ENST00000505560.1_Missense_Mutation_p.Y219C	NM_001284236.1|NM_014733.3	NP_001271165.1|NP_055548	Q7Z3T8	ZFY16_HUMAN	zinc finger, FYVE domain containing 16	219					BMP signaling pathway (GO:0030509)|endosomal transport (GO:0016197)|protein targeting to lysosome (GO:0006622)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|early endosome membrane (GO:0031901)|intracellular membrane-bounded organelle (GO:0043231)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein transporter activity (GO:0008565)			breast(4)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|liver(1)|lung(6)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.6e-46)|Epithelial(54;2.02e-41)|all cancers(79;5.05e-36)		TCAGATTCCTATAATTACAGT	0.294																																					p.Y219C	Melanoma(150;1452 1854 16018 17851 37292)	.											.	ZFYVE16-90	0			c.A656G						.	A	CYS/TYR,CYS/TYR	1,4389		0,1,2194	25.0	28.0	27.0		656,656	1.4	0.2	5	dbSNP_134	27	1,8575		0,1,4287	no	missense,missense	ZFYVE16	NM_001105251.1,NM_014733.3	194,194	0,2,6481	GG,GA,AA		0.0117,0.0228,0.0154	benign,benign	219/1540,219/1540	79733160	2,12964	2195	4288	6483	SO:0001583	missense	9765	exon4			ATTCCTATAATTA	AB002303	CCDS4050.1	5q14.1	2012-09-20			ENSG00000039319	ENSG00000039319		"""Zinc fingers, FYVE domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20756	protein-coding gene	gene with protein product	"""endofin"", ""protein phosphatase 1, regulatory subunit 69"""	608880				11546807	Standard	NM_014733		Approved	KIAA0305, PPP1R69	uc003kgq.4	Q7Z3T8	OTTHUMG00000108178	ENST00000338008.5:c.656A>G	5.37:g.79733160A>G	ENSP00000337159:p.Tyr219Cys	69	0		143	49	NM_001105251	0	0	1	1	0	O15023|Q5H9U2|Q7LAU7|Q86T69|Q8N5L3|Q8NEK3	Missense_Mutation	SNP	ENST00000338008.5	37	CCDS4050.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.950487	0.00051	2.28E-4	1.17E-4	ENSG00000039319	ENST00000338008;ENST00000510158;ENST00000505560	T;T;T	0.35421	1.31;1.31;1.31	5.24	1.35	0.21983	.	0.549975	0.17956	N	0.156346	T	0.10252	0.0251	N	0.01048	-1.04	0.19775	N	0.999958	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21143	-1.0254	10	0.34782	T	0.22	-0.0064	3.3999	0.07320	0.1495:0.1353:0.575:0.1402	.	219;219	Q7Z3T8-3;Q7Z3T8	.;ZFY16_HUMAN	C	219	ENSP00000337159:Y219C;ENSP00000423663:Y219C;ENSP00000426848:Y219C	ENSP00000337159:Y219C	Y	+	2	0	ZFYVE16	79768916	0.940000	0.31905	0.197000	0.23402	0.289000	0.27227	0.934000	0.28910	0.026000	0.15269	-1.550000	0.00899	TAT	A|1.000;G|0.000		0.294	ZFYVE16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226982.2	NM_014733	
MSH3	4437	hgsc.bcm.edu	37	5	79950712	79950738	+	In_Frame_Del	DEL	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA	-	rs2431220|rs2001675|rs2405876|rs2405877|rs201874762|rs144776112|rs1574197|rs148550291|rs201906899|rs535056167|rs60484572|rs70991168|rs201149584	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENST00000265081.6	+	1	246_272	c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	c.(166-192)gcggccgcagcggccgcagcgcccccadel	p.AAAAAAAPP56del	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	56	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		agcggctgcagcggccgcagcggccgcagcgCCCCCAGCGCCCCCAG	0.705								Mismatch excision repair (MMR)																													p.56_64del	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.166_192del						.																																			SO:0001651	inframe_deletion	4437	exon1			GCTGCAGCGGCCG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	5.37:g.79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENSP00000265081:p.Ala56_Pro64del	12	0		45	0	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	ENST00000265081.6	37	CCDS34195.1																																																																																			.		0.705	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
MSH3	4437	hgsc.bcm.edu	37	5	79950715	79950715	+	Missense_Mutation	SNP	G	G	C	rs144776112|rs201874762		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:79950715G>C	ENST00000265081.6	+	1	249	c.169G>C	c.(169-171)Gcc>Ccc	p.A57P	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	57	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ggctgcagcggccgcagcggc	0.692								Mismatch excision repair (MMR)																													p.A57P	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.G169C						.						7.0	7.0	7.0					5																	79950715		2089	4077	6166	SO:0001583	missense	4437	exon1			GCAGCGGCCGCAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.169G>C	5.37:g.79950715G>C	ENSP00000265081:p.Ala57Pro	12	0		52	8	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	362	0.16575091575091574	115	0.23373983739837398	67	0.1850828729281768	32	0.055944055944055944	148	0.19525065963060687	-	0.222	-1.028222	0.02045	.	.	ENSG00000113318	ENST00000265081	D	0.87256	-2.23	.	.	.	.	.	.	.	.	T	0.00039	0.0001	N	0.03608	-0.345	0.80722	P	0.0	.	.	.	.	.	.	T	0.02983	-1.1086	3	.	.	.	.	.	.	.	.	57	P20585	MSH3_HUMAN	P	57	ENSP00000265081:A57P	.	A	+	1	0	MSH3	79986471	0.041000	0.20044	0.049000	0.19019	0.152000	0.21847	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	GCC	G|0.834;C|0.166		0.692	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
MSH3	4437	hgsc.bcm.edu	37	5	79950718	79950718	+	Missense_Mutation	SNP	G	G	C	rs148550291		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:79950718G>C	ENST00000265081.6	+	1	252	c.172G>C	c.(172-174)Gca>Cca	p.A58P	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	58	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		tgcagcggccgcagcggccgc	0.706								Mismatch excision repair (MMR)																													p.A58P	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.G172C						.						6.0	7.0	6.0					5																	79950718		2077	4042	6119	SO:0001583	missense	4437	exon1			GCGGCCGCAGCGG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.172G>C	5.37:g.79950718G>C	ENSP00000265081:p.Ala58Pro	10	0		49	7	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	355	0.16254578754578755	114	0.23170731707317074	67	0.1850828729281768	27	0.0472027972027972	147	0.19393139841688653	-	7.967	0.748328	0.15710	.	.	ENSG00000113318	ENST00000265081	D	0.87256	-2.23	.	.	.	.	.	.	.	.	T	0.00073	0.0002	N	0.19112	0.55	0.09310	N	1	B	0.22983	0.078	B	0.11329	0.006	T	0.00891	-1.1525	6	.	.	.	.	.	.	.	.	58	P20585	MSH3_HUMAN	P	58	ENSP00000265081:A58P	.	A	+	1	0	MSH3	79986474	0.036000	0.19791	0.017000	0.16124	0.213000	0.24496	0.000000	0.12993	-0.982000	0.03515	0.000000	0.15137	GCA	G|0.837;C|0.162		0.706	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
MSH3	4437	hgsc.bcm.edu	37	5	79950724	79950724	+	Missense_Mutation	SNP	G	G	C	rs70991168|rs2001675	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:79950724G>C	ENST00000265081.6	+	1	258	c.178G>C	c.(178-180)Gcc>Ccc	p.A60P	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	60	Poly-Ala.		Missing. {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8942985}.		ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		ggccgcagcggccgcagcgCC	0.706								Mismatch excision repair (MMR)					G|||	104	0.0207668	0.0703	0.0086	5008	,	,		6209	0.001		0.003	False		,,,				2504	0.001				p.A60P	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.G178C						.						5.0	6.0	6.0					5																	79950724		2048	3971	6019	SO:0001583	missense	4437	exon1			GCAGCGGCCGCAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.178G>C	5.37:g.79950724G>C	ENSP00000265081:p.Ala60Pro	8	0		45	5	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	ENST00000265081.6	37	CCDS34195.1	386	0.17673992673992675	112	0.22764227642276422	76	0.20994475138121546	57	0.09965034965034965	141	0.18601583113456466	G	4.951	0.176580	0.09443	.	.	ENSG00000113318	ENST00000265081	D	0.87256	-2.23	2.67	-0.189	0.13260	.	.	.	.	.	T	0.00073	0.0002	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.25667	0.131	B	0.26517	0.07	T	0.01956	-1.1240	7	.	.	.	.	8.8041	0.34927	0.0:0.0:0.6183:0.3817	rs2001675;rs2405878;rs13182328	60	P20585	MSH3_HUMAN	P	60	ENSP00000265081:A60P	.	A	+	1	0	MSH3	79986480	0.010000	0.17322	0.501000	0.27601	0.264000	0.26372	-0.184000	0.09698	-0.480000	0.06803	0.000000	0.15137	GCC	G|0.177;C|0.823		0.706	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
MSH3	4437	hgsc.bcm.edu	37	5	79950742	79950750	+	In_Frame_Del	DEL	CCCCCAGCT	CCCCCAGCT	-	rs144629981|rs3045983|rs557874766|rs1047489	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	CCCCCAGCT	CCCCCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:79950742_79950750delCCCCCAGCT	ENST00000265081.6	+	1	276_284	c.196_204delCCCCCAGCT	c.(196-204)cccccagctdel	p.PPA66del	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	66					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		gCCCCCAGCGCCCCCAGCTCCCGCCTTCC	0.732								Mismatch excision repair (MMR)						1174	0.234425	0.2874	0.2061	5008	,	,		7173	0.0565		0.2535	False		,,,				2504	0.3466				p.66_68del	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.196_204del						.		,	1105,2179		342,421,879					,	4.0	1.0		dbSNP_102	4	1941,4615		567,807,1904	no	coding,utr-5	DHFR,MSH3	NM_002439.3,NM_000791.3	,	909,1228,2783	A1A1,A1R,RR		29.6065,33.648,30.9553	,	,		3046,6794				SO:0001651	inframe_deletion	4437	exon1			CCAGCGCCCCCAG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.196_204delCCCCCAGCT	5.37:g.79950742_79950750delCCCCCAGCT	ENSP00000265081:p.Pro66_Ala68del	1	0		28	19	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	ENST00000265081.6	37	CCDS34195.1																																																																																			.		0.732	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
RGMB	285704	hgsc.bcm.edu	37	5	98109838	98109838	+	Missense_Mutation	SNP	A	A	C	rs2662263	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:98109838A>C	ENST00000513185.1	+	1	500	c.64A>C	c.(64-66)Agc>Cgc	p.S22R	RGMB-AS1_ENST00000505362.1_RNA|RGMB-AS1_ENST00000515003.1_RNA|RGMB-AS1_ENST00000505677.1_RNA|RGMB-AS1_ENST00000498871.2_RNA|RGMB_ENST00000308234.7_Missense_Mutation_p.S63R|RGMB-AS1_ENST00000501938.2_RNA|RGMB_ENST00000504776.1_3'UTR			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	22				S -> R (in Ref. 3; AAH67736). {ECO:0000305}.	axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		gcagcgccgcagccccgggct	0.741													C|||	4970	0.992412	1.0	0.9885	5008	,	,		8183	1.0		0.9791	False		,,,				2504	0.9908				p.S63R		.											.	.	0			c.A187C						.						1.0	1.0	1.0					5																	98109838		379	926	1305	SO:0001583	missense	285704	exon3			CGCCGCAGCCCCG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.64A>C	5.37:g.98109838A>C	ENSP00000423256:p.Ser22Arg	0	0		8	8	NM_001012761	0	0	0	2	2	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		2084	0.9542124542124543	469	0.9532520325203252	342	0.9447513812154696	557	0.9737762237762237	716	0.9445910290237467	C	10.21	1.287484	0.23478	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.93019	-3.14;-3.15	4.16	2.33	0.28932	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	8	0.11794	T	0.64	-0.2125	4.3815	0.11297	0.1608:0.5981:0.1551:0.0861	rs2662263;rs61109719	22	Q6NW40	RGMB_HUMAN	R	63;22	ENSP00000308219:S63R;ENSP00000423256:S22R	ENSP00000308219:S63R	S	+	1	0	RGMB	98137738	0.902000	0.30710	0.372000	0.25991	0.345000	0.29048	0.380000	0.20602	0.144000	0.18951	-0.371000	0.07208	AGC	T|0.046;G|0.950		0.741	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
DND1	373863	hgsc.bcm.edu	37	5	140052320	140052320	+	Missense_Mutation	SNP	T	T	C	rs201446376	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:140052320T>C	ENST00000542735.1	-	3	357	c.314A>G	c.(313-315)tAc>tGc	p.Y105C		NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	105	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCGAGCTGTAGCGGGCATA	0.687																																					p.Y105C		.											.	DND1-90	0			c.A314G						.						9.0	11.0	10.0					5																	140052320		2177	4273	6450	SO:0001583	missense	373863	exon3			GAGCTGTAGCGGG	AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.314A>G	5.37:g.140052320T>C	ENSP00000445366:p.Tyr105Cys	5	0		76	5	NM_194249	0	0	2	2	0		Missense_Mutation	SNP	ENST00000542735.1	37	CCDS4236.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009699	0.54361	.	.	ENSG00000256453	ENST00000542735	T	0.21191	2.02	5.71	5.71	0.89125	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000005	T	0.60573	0.2279	H	0.97365	3.99	0.58432	D	0.999997	D	0.57899	0.981	D	0.63033	0.91	T	0.76116	-0.3077	10	0.87932	D	0	-15.4633	15.6328	0.76926	0.0:0.0:0.0:1.0	.	105	Q8IYX4	DND1_HUMAN	C	105	ENSP00000445366:Y105C	ENSP00000445366:Y105C	Y	-	2	0	DND1	140032504	1.000000	0.71417	1.000000	0.80357	0.203000	0.24098	7.940000	0.87693	2.180000	0.69256	0.377000	0.23210	TAC	T|0.983;C|0.016		0.687	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251669.2	NM_194249	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		2	0		167	40	NM_018930	0	0	24	24	0	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
N4BP3	23138	broad.mit.edu	37	5	177547312	177547312	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr5:177547312A>C	ENST00000274605.5	+	3	823	c.464A>C	c.(463-465)cAc>cCc	p.H155P		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	155						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGGCCTGCCACCCGCCCCTG	0.706																																					p.H155P		.											.	N4BP3-90	0			c.A464C						.						12.0	16.0	15.0					5																	177547312		2191	4268	6459	SO:0001583	missense	23138	exon3			CCTGCCACCCGCC	AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.464A>C	5.37:g.177547312A>C	ENSP00000274605:p.His155Pro	34	3		126	34	NM_015111	0	0	1	1	0	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Missense_Mutation	SNP	ENST00000274605.5	37	CCDS34307.1	.	.	.	.	.	.	.	.	.	.	A	13.23	2.173783	0.38413	.	.	ENSG00000145911	ENST00000274605	T	0.00488	7.04	5.13	5.13	0.70059	.	0.606451	0.18171	N	0.149458	T	0.00210	0.0006	N	0.08118	0	0.40081	D	0.976137	P	0.39282	0.666	B	0.32022	0.139	D	0.85323	0.1085	10	0.26408	T	0.33	-45.7286	7.5062	0.27547	0.9064:0.0:0.0936:0.0	.	155	O15049	N4BP3_HUMAN	P	155	ENSP00000274605:H155P	ENSP00000274605:H155P	H	+	2	0	N4BP3	177479918	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	0.799000	0.27028	2.155000	0.67459	0.533000	0.62120	CAC	.		0.706	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373552.2	NM_015111	
RNF39	80352	hgsc.bcm.edu	37	6	30039098	30039098	+	Silent	SNP	T	T	C	rs2301754	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr6:30039098T>C	ENST00000244360.6	-	4	1150	c.1053A>G	c.(1051-1053)gaA>gaG	p.E351E	RNF39_ENST00000376751.3_Intron	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	351	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										GCAGGGTGGGTTCGGGTGCCG	0.741													c|||	958	0.191294	0.2988	0.1744	5008	,	,		11049	0.1905		0.0954	False		,,,				2504	0.1575				p.E351E	NSCLC(8;188 360 1520 20207 31481)	.											.	RNF39-226	0			c.A1053G						.		,	576,2276		53,470,903	6.0	7.0	7.0		1053,	0.7	0.8	6	dbSNP_100	7	494,4604		36,422,2091	no	coding-synonymous,intron	RNF39	NM_025236.3,NM_170769.2	,	89,892,2994	CC,CT,TT		9.6901,20.1964,13.4591	,	351/421,	30039098	1070,6880	1426	2549	3975	SO:0001819	synonymous_variant	80352	exon4			GGTGGGTTCGGGT	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.1053A>G	6.37:g.30039098T>C		0	0		17	14	NM_025236	0	0	0	0	0	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Silent	SNP	ENST00000244360.6	37	CCDS4673.1																																																																																			G|0.184;C|0.001		0.741	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
RNF39	80352	hgsc.bcm.edu	37	6	30039364	30039364	+	Missense_Mutation	SNP	C	C	A	rs11753382	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr6:30039364C>A	ENST00000244360.6	-	4	884	c.787G>T	c.(787-789)Ggc>Tgc	p.G263C	RNF39_ENST00000376751.3_Missense_Mutation_p.G263C	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	263	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CGCTTGGGGCCGTCAGGGGGC	0.741													c|||	749	0.149561	0.2489	0.134	5008	,	,		10967	0.1528		0.0447	False		,,,				2504	0.1309				p.G263C	NSCLC(8;188 360 1520 20207 31481)	.											.	RNF39-226	0			c.G787T						.		CYS/GLY,CYS/GLY	414,2026		21,372,827	3.0	2.0	2.0		787,787	0.5	0.1	6	dbSNP_120	2	229,4029		6,217,1906	yes	missense,missense	RNF39	NM_025236.3,NM_170769.2	159,159	27,589,2733	AA,AC,CC		5.3781,16.9672,9.5999	benign,benign	263/421,263/355	30039364	643,6055	1220	2129	3349	SO:0001583	missense	80352	exon4			TGGGGCCGTCAGG	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.787G>T	6.37:g.30039364C>A	ENSP00000244360:p.Gly263Cys	1	0		15	15	NM_025236	0	0	0	0	0	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	CCDS4673.1	299	0.13690476190476192	120	0.24390243902439024	56	0.15469613259668508	90	0.15734265734265734	33	0.04353562005277045	c	11.55	1.672102	0.29693	0.169672	0.053781	ENSG00000204618	ENST00000376751;ENST00000244360	T;T	0.10382	2.88;2.88	4.7	0.543	0.17179	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);B30.2/SPRY domain (1);	0.296117	0.23738	N	0.045041	T	0.03348	0.0097	N	0.19112	0.55	0.48696	P	3.009999999999957E-4	B;P	0.48407	0.06;0.91	B;P	0.47626	0.092;0.552	T	0.41305	-0.9516	9	0.56958	D	0.05	-19.3451	7.7639	0.28968	0.0:0.4441:0.0:0.5559	rs11753382	263;263	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	C	263	ENSP00000365942:G263C;ENSP00000244360:G263C	ENSP00000244360:G263C	G	-	1	0	RNF39	30147343	0.003000	0.15002	0.059000	0.19551	0.050000	0.14768	0.158000	0.16422	-0.104000	0.12154	0.466000	0.42574	GGC	C|0.862;A|0.138		0.741	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
RNF39	80352	hgsc.bcm.edu	37	6	30039373	30039373	+	Missense_Mutation	SNP	G	G	C	rs61754472	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr6:30039373G>C	ENST00000244360.6	-	4	875	c.778C>G	c.(778-780)Ccc>Gcc	p.P260A	RNF39_ENST00000376751.3_Missense_Mutation_p.P260A	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	260	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										CCGTCAGGGGGCGCGGGCGTC	0.736													g|||	121	0.0241613	0.0045	0.0663	5008	,	,		11328	0.0357		0.0149	False		,,,				2504	0.0184				p.P260A	NSCLC(8;188 360 1520 20207 31481)	.											.	RNF39-226	0			c.C778G						.		ALA/PRO,ALA/PRO	6,2398		0,6,1196	2.0	2.0	2.0		778,778	4.7	0.0	6	dbSNP_129	2	48,4134		0,48,2043	yes	missense,missense	RNF39	NM_025236.3,NM_170769.2	27,27	0,54,3239	CC,CG,GG		1.1478,0.2496,0.8199	possibly-damaging,possibly-damaging	260/421,260/355	30039373	54,6532	1202	2091	3293	SO:0001583	missense	80352	exon4			CAGGGGGCGCGGG	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.778C>G	6.37:g.30039373G>C	ENSP00000244360:p.Pro260Ala	1	0		13	12	NM_025236	0	0	0	0	0	A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	CCDS4673.1	74	0.03388278388278388	4	0.008130081300813009	28	0.07734806629834254	30	0.05244755244755245	12	0.0158311345646438	g	11.90	1.775599	0.31411	0.002496	0.011478	ENSG00000204618	ENST00000376751;ENST00000244360	T;T	0.10005	2.92;2.92	4.7	4.7	0.59300	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.000000	0.43919	D	0.000507	T	0.10766	0.0263	L	0.28014	0.82	0.09310	N	1	D;P	0.56035	0.974;0.728	D;B	0.62955	0.909;0.42	T	0.05699	-1.0869	10	0.52906	T	0.07	-26.5225	15.5749	0.76368	0.0:0.0:1.0:0.0	rs61754472	260;260	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	A	260	ENSP00000365942:P260A;ENSP00000244360:P260A	ENSP00000244360:P260A	P	-	1	0	RNF39	30147352	0.994000	0.37717	0.021000	0.16686	0.029000	0.11900	4.595000	0.61048	2.339000	0.79563	0.466000	0.42574	CCC	G|0.966;C|0.034		0.736	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769	
TNXB	7148	bcgsc.ca	37	6	32017173	32017173	+	Missense_Mutation	SNP	G	G	C	rs41270450	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr6:32017173G>C	ENST00000375244.3	-	28	9832	c.9631C>G	c.(9631-9633)Cgt>Ggt	p.R3211G	TNXB_ENST00000375247.2_Missense_Mutation_p.R3209G			P22105	TENX_HUMAN	tenascin XB	3256					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CCCCTGACACGCACCACCTGG	0.687													G|||	112	0.0223642	0.0008	0.0303	5008	,	,		15893	0.003		0.0726	False		,,,				2504	0.0143				p.R3209G		.											.	TNXB-90	0			c.C9625G						.	G	GLY/ARG	30,2550		0,30,1260	58.0	62.0	61.0		9625	4.4	1.0	6	dbSNP_127	61	238,4860		2,234,2313	no	missense	TNXB	NM_019105.6	125	2,264,3573	CC,CG,GG		4.6685,1.1628,3.4905	benign	3209/4243	32017173	268,7410	1290	2549	3839	SO:0001583	missense	7148	exon28			TGACACGCACCAC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.9631C>G	6.37:g.32017173G>C	ENSP00000364393:p.Arg3211Gly	115	1		145	6	NM_019105	0	0	8	8	0	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	37		79	0.036172161172161175	1	0.0020325203252032522	14	0.03867403314917127	2	0.0034965034965034965	62	0.08179419525065963	G	6.181	0.401533	0.11696	0.011628	0.046685	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.58060	0.36;0.36	4.43	4.43	0.53597	.	0.000000	0.48286	D	0.000181	T	0.38878	0.1057	M	0.83852	2.665	0.80722	P	0.0	B	0.22146	0.065	B	0.19148	0.024	T	0.44034	-0.9354	9	0.19147	T	0.46	.	13.9686	0.64225	0.0:0.0:1.0:0.0	rs41270450;rs61740266	3209	P22105-3	.	G	3211;3209	ENSP00000364393:R3211G;ENSP00000364396:R3209G	ENSP00000364393:R3211G	R	-	1	0	TNXB	32125151	0.954000	0.32549	0.993000	0.49108	0.003000	0.03518	3.096000	0.50243	2.011000	0.59026	0.313000	0.20887	CGT	G|0.940;C|0.060		0.687	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		0	0		15	15	NM_000287	0	0	0	17	17	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
POU3F2	5454	hgsc.bcm.edu	37	6	99283376	99283376	+	Silent	SNP	T	T	G	rs195860	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr6:99283376T>G	ENST00000328345.5	+	1	797	c.627T>G	c.(625-627)ggT>ggG	p.G209G		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	209					astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		AGCCGGCCGGTCTGCACCACC	0.736													G|||	4460	0.890575	0.8994	0.9121	5008	,	,		6412	0.9544		0.8598	False		,,,				2504	0.8292				p.G209G		.											.	POU3F2-90	0			c.T627G						.	G		3186,306		1453,280,13	4.0	4.0	4.0		627	3.1	1.0	6	dbSNP_79	4	6282,930		2738,806,62	no	coding-synonymous	POU3F2	NM_005604.2		4191,1086,75	GG,GT,TT		12.8952,8.7629,11.5471		209/444	99283376	9468,1236	1746	3606	5352	SO:0001819	synonymous_variant	5454	exon1			GGCCGGTCTGCAC	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.627T>G	6.37:g.99283376T>G		0	0		9	9	NM_005604	0	0	0	0	0	Q14960|Q86V54|Q9UJL0	Silent	SNP	ENST00000328345.5	37	CCDS5040.1																																																																																			T|0.089;G|0.911		0.736	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041586.2		
MICALL2	79778	hgsc.bcm.edu	37	7	1484587	1484587	+	Silent	SNP	C	C	T	rs80020804	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:1484587C>T	ENST00000297508.7	-	6	1294	c.1119G>A	c.(1117-1119)ccG>ccA	p.P373P	MICALL2_ENST00000405088.4_Silent_p.P161P	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	373	Mediates targeting to the cell plasma membrane. {ECO:0000250}.|Necessary and sufficient for interaction with actinins. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGGTGTGGCCGGGCGAGGGT	0.697													C|||	469	0.0936502	0.1135	0.2406	5008	,	,		11834	0.0288		0.0765	False		,,,				2504	0.047				p.P373P		.											.	MICALL2-90	0			c.G1119A						.			336,3580		12,312,1634	4.0	5.0	4.0		1119	-4.4	0.0	7	dbSNP_131	4	481,7387		12,457,3465	no	coding-synonymous	MICALL2	NM_182924.3		24,769,5099	TT,TC,CC		6.1134,8.5802,6.9331		373/905	1484587	817,10967	1958	3934	5892	SO:0001819	synonymous_variant	79778	exon6			TGTGGCCGGGCGA	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1119G>A	7.37:g.1484587C>T		0	0		24	13	NM_182924	0	0	0	0	0	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	CCDS5324.1																																																																																			C|0.893;T|0.107		0.697	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
SP8	221833	hgsc.bcm.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	GCC	GCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022				p.165_165del		.											.	SP8-91	2	Deletion - In frame(2)	central_nervous_system(2)	c.493_495del						.		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833	exon2			GGAGGAGCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	14	0		63	32	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000578994.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		21	21	NM_002047	0	0	0	23	23	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
KPNA7	402569	broad.mit.edu	37	7	98790650	98790650	+	Missense_Mutation	SNP	T	T	G	rs202149995		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:98790650T>G	ENST00000327442.6	-	5	667	c.628A>C	c.(628-630)Acc>Ccc	p.T210P		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	210					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)	p.T210P(1)		breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						ACCGGCAGGGTGGGTGAAATC	0.393																																					p.T210P		.											.	KPNA7-158	1	Substitution - Missense(1)	endometrium(1)	c.A628C						.						83.0	75.0	77.0					7																	98790650		692	1591	2283	SO:0001583	missense	402569	exon5			GCAGGGTGGGTGA		CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.628A>C	7.37:g.98790650T>G	ENSP00000330878:p.Thr210Pro	43	5		74	11	NM_001145715	0	0	0	0	0	A4D277	Missense_Mutation	SNP	ENST00000327442.6	37	CCDS47651.1	.	.	.	.	.	.	.	.	.	.	T	9.708	1.156414	0.21454	.	.	ENSG00000185467	ENST00000327442	T	0.69806	-0.43	5.2	-0.796	0.10912	Armadillo-like helical (1);Armadillo-type fold (1);	0.561916	0.20348	N	0.094114	T	0.50803	0.1637	L	0.31371	0.925	0.09310	N	1	P	0.38370	0.628	P	0.46076	0.503	T	0.40308	-0.9570	10	0.34782	T	0.22	2.8056	0.5695	0.00693	0.245:0.2206:0.1255:0.4088	.	210	A9QM74	IMA8_HUMAN	P	210	ENSP00000330878:T210P	ENSP00000330878:T210P	T	-	1	0	KPNA7	98628586	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.299000	0.08254	-0.186000	0.10533	-0.490000	0.04691	ACC	.		0.393	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335118.1	NM_001145715	
RELN	5649	broad.mit.edu;bcgsc.ca	37	7	103183277	103183277	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:103183277G>C	ENST00000428762.1	-	43	6731	c.6572C>G	c.(6571-6573)tCt>tGt	p.S2191C	RELN_ENST00000343529.5_Missense_Mutation_p.S2191C|RELN_ENST00000424685.2_Missense_Mutation_p.S2191C	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2191					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACACTTTCGAGATGGTTTCCC	0.398																																					p.S2191C	NSCLC(146;835 1944 15585 22231 52158)	.											.	RELN-574	0			c.C6572G						.						97.0	94.0	95.0					7																	103183277		2203	4300	6503	SO:0001583	missense	5649	exon43			TTTCGAGATGGTT		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6572C>G	7.37:g.103183277G>C	ENSP00000392423:p.Ser2191Cys	101	0		134	6	NM_173054	0	0	0	0	0	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	37	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	19.28	3.797930	0.70567	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.26067	1.76;1.76;1.76	5.79	5.79	0.91817	Neuraminidase (1);	0.062942	0.64402	D	0.000003	T	0.43211	0.1237	L	0.31065	0.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.989	T	0.30679	-0.9970	10	0.72032	D	0.01	.	20.0367	0.97561	0.0:0.0:1.0:0.0	.	2191;2191	P78509-2;P78509	.;RELN_HUMAN	C	2191	ENSP00000392423:S2191C;ENSP00000345694:S2191C;ENSP00000388446:S2191C	ENSP00000345694:S2191C	S	-	2	0	RELN	102970513	1.000000	0.71417	0.995000	0.50966	0.980000	0.70556	8.950000	0.93019	2.727000	0.93392	0.591000	0.81541	TCT	.		0.398	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	4	0		66	18	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
TAS2R41	259287	broad.mit.edu	37	7	143175290	143175290	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:143175290G>T	ENST00000408916.1	+	1	325	c.325G>T	c.(325-327)Gtg>Ttg	p.V109L	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	109					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					CCTGTTCTGTGTGAAGATTGC	0.557																																					p.V109L		.											.	TAS2R41-92	0			c.G325T						.						86.0	85.0	85.0					7																	143175290		2008	4181	6189	SO:0001583	missense	259287	exon1			TTCTGTGTGAAGA	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.325G>T	7.37:g.143175290G>T	ENSP00000386201:p.Val109Leu	85	0		112	3	NM_176883	0	0	0	0	0	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Missense_Mutation	SNP	ENST00000408916.1	37	CCDS43663.1	.	.	.	.	.	.	.	.	.	.	G	7.626	0.677788	0.14841	.	.	ENSG00000221855	ENST00000408916	T	0.34667	1.35	5.7	-11.4	0.00090	.	0.769546	0.11336	U	0.574526	T	0.14960	0.0361	N	0.21617	0.685	0.09310	N	1	B	0.31581	0.329	B	0.33690	0.168	T	0.12142	-1.0559	10	0.02654	T	1	.	9.4046	0.38453	0.1479:0.2842:0.5007:0.0672	.	109	P59536	T2R41_HUMAN	L	109	ENSP00000386201:V109L	ENSP00000386201:V109L	V	+	1	0	TAS2R41	142885412	0.000000	0.05858	0.000000	0.03702	0.333000	0.28666	-1.496000	0.02291	-4.546000	0.00043	-0.910000	0.02820	GTG	.		0.557	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1		
TAS2R41	259287	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	143175367	143175367	+	Silent	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:143175367G>T	ENST00000408916.1	+	1	402	c.402G>T	c.(400-402)ctG>ctT	p.L134L	EPHA1-AS1_ENST00000429289.1_RNA	NM_176883.2	NP_795364.2	P59536	T2R41_HUMAN	taste receptor, type 2, member 41	134					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(2)|skin(1)	18	Melanoma(164;0.15)					CCTGGCTCCTGTTGGGCTCTG	0.473																																					p.L134L		.											.	TAS2R41-92	0			c.G402T						.						54.0	54.0	54.0					7																	143175367		1920	4140	6060	SO:0001819	synonymous_variant	259287	exon1			GCTCCTGTTGGGC	AF494232	CCDS43663.1	7q34	2012-08-22			ENSG00000221855	ENSG00000221855		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18883	protein-coding gene	gene with protein product		613965				12379855	Standard	NM_176883		Approved	T2R59	uc003wdc.1	P59536	OTTHUMG00000155892	ENST00000408916.1:c.402G>T	7.37:g.143175367G>T		90	0		93	42	NM_176883	0	0	0	0	0	P59550|Q495I2|Q50KJ5|Q50KJ6|Q50KJ7|Q645W7	Silent	SNP	ENST00000408916.1	37	CCDS43663.1																																																																																			.		0.473	TAS2R41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342149.1		
KMT2C	58508	bcgsc.ca	37	7	151970951	151970951	+	Splice_Site	SNP	C	C	T	rs201009236		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:151970951C>T	ENST00000262189.6	-	7	1069	c.851G>A	c.(850-852)cGa>cAa	p.R284Q	KMT2C_ENST00000355193.2_Splice_Site_p.R284Q	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	284					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										AAATGCACATCGCTGAAAGGG	0.393																																					p.R284Q		.											.	MLL3-1398	0			c.G851A						.						54.0	51.0	52.0					7																	151970951		2202	4299	6501	SO:0001630	splice_region_variant	58508	exon7			GCACATCGCTGAA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.850-1G>A	7.37:g.151970951C>T		185	3		178	20	NM_170606	0	0	0	0	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	14.49	2.551821	0.45487	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.70631	-0.5;-0.5	4.87	4.87	0.63330	Zinc finger, PHD-type (1);	0.258206	0.20689	N	0.087494	T	0.78381	0.4274	M	0.69463	2.115	0.80722	D	1	D	0.58970	0.984	P	0.52159	0.691	T	0.81093	-0.1089	10	0.59425	D	0.04	.	18.3752	0.90433	0.0:1.0:0.0:0.0	.	284	Q8NEZ4	MLL3_HUMAN	Q	284	ENSP00000262189:R284Q;ENSP00000347325:R284Q	ENSP00000262189:R284Q	R	-	2	0	MLL3	151601884	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.773000	0.55333	2.423000	0.82170	0.650000	0.86243	CGA	C|0.750;T|0.250		0.393	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		Missense_Mutation
HR	55806	hgsc.bcm.edu	37	8	21983231	21983231	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:21983231G>T	ENST00000381418.4	-	4	2900	c.1420C>A	c.(1420-1422)Cag>Aag	p.Q474K	HR_ENST00000312841.8_Missense_Mutation_p.Q474K	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	474					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		AGACTGGCCTGGCCATCTTGG	0.597																																					p.Q474K		.											.	HR-154	0			c.C1420A						.						50.0	45.0	47.0					8																	21983231		2203	4300	6503	SO:0001583	missense	55806	exon4			TGGCCTGGCCATC	AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.1420C>A	8.37:g.21983231G>T	ENSP00000370826:p.Gln474Lys	120	0		96	5	NM_018411	0	0	0	0	0	Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	ENST00000381418.4	37	CCDS6022.1	.	.	.	.	.	.	.	.	.	.	G	2.826	-0.243644	0.05906	.	.	ENSG00000168453	ENST00000381418;ENST00000312841	T;T	0.70516	-0.49;-0.49	5.19	1.5	0.22942	.	0.660669	0.14601	N	0.309609	T	0.41719	0.1171	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18999	-1.0319	10	0.12766	T	0.61	-7.4025	4.1454	0.10214	0.0:0.1951:0.2243:0.5806	.	474;474	O43593-2;O43593	.;HAIR_HUMAN	K	474	ENSP00000370826:Q474K;ENSP00000326765:Q474K	ENSP00000326765:Q474K	Q	-	1	0	HR	22039176	0.069000	0.21087	0.022000	0.16811	0.050000	0.14768	0.343000	0.19944	0.369000	0.24510	0.491000	0.48974	CAG	.		0.597	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214213.1		
TNFRSF10A	8797	broad.mit.edu;bcgsc.ca	37	8	23060257	23060257	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:23060257G>A	ENST00000221132.3	-	3	485	c.421C>T	c.(421-423)Cat>Tat	p.H141Y		NM_003844.3	NP_003835.3	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily, member 10a	141			H -> R (in dbSNP:rs6557634). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:9082980}.		activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|signal transduction (GO:0007165)|TRAIL-activated apoptotic signaling pathway (GO:0036462)	integral component of membrane (GO:0016021)	death receptor activity (GO:0005035)|protease binding (GO:0002020)|receptor activity (GO:0004872)|TRAIL binding (GO:0045569)|transcription factor binding (GO:0008134)			NS(2)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|skin(1)	16		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		GCTCCAGGATGTTCTGATCTA	0.483																																					p.H141Y		.											.	TNFRSF10A-1086	0			c.C421T						.						147.0	134.0	138.0					8																	23060257		2203	4300	6503	SO:0001583	missense	8797	exon3			CAGGATGTTCTGA	U90875	CCDS6039.1	8p21	2006-02-22			ENSG00000104689	ENSG00000104689		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11904	protein-coding gene	gene with protein product		603611				9311998, 9082980	Standard	NM_003844		Approved	DR4, Apo2, TRAILR-1, CD261	uc003xda.3	O00220	OTTHUMG00000097843	ENST00000221132.3:c.421C>T	8.37:g.23060257G>A	ENSP00000221132:p.His141Tyr	193	0		177	7	NM_003844	0	0	0	0	0	A8K5I4|Q53Y72|Q96E62	Missense_Mutation	SNP	ENST00000221132.3	37	CCDS6039.1	.	.	.	.	.	.	.	.	.	.	G	7.383	0.629129	0.14257	.	.	ENSG00000104689	ENST00000221132	T	0.42900	0.96	3.48	-3.79	0.04320	.	1.045100	0.07583	U	0.920699	T	0.20536	0.0494	N	0.17474	0.49	0.09310	N	1	B	0.23316	0.083	B	0.15484	0.013	T	0.14420	-1.0473	10	0.41790	T	0.15	.	2.525	0.04689	0.115:0.3725:0.3096:0.2029	.	141	O00220	TR10A_HUMAN	Y	141	ENSP00000221132:H141Y	ENSP00000221132:H141Y	H	-	1	0	TNFRSF10A	23116202	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.445000	0.02401	-0.919000	0.03803	-0.122000	0.15005	CAT	.		0.483	TNFRSF10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215133.2	NM_003844	
CHD7	55636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	61766037	61766037	+	Silent	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:61766037G>A	ENST00000423902.2	+	31	7232	c.6753G>A	c.(6751-6753)tcG>tcA	p.S2251S	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2251	Glu-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ACGATAAGTCGGAAGAGTCTT	0.542																																					p.S2251S		.											.	CHD7-141	0			c.G6753A						.						60.0	63.0	62.0					8																	61766037		2032	4160	6192	SO:0001819	synonymous_variant	55636	exon31			TAAGTCGGAAGAG	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6753G>A	8.37:g.61766037G>A		219	0		169	142	NM_017780	0	0	0	0	0	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	37	CCDS47865.1																																																																																			.		0.542	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
FAM83H	286077	hgsc.bcm.edu	37	8	144809268	144809268	+	Missense_Mutation	SNP	C	C	T	rs56148058	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:144809268C>T	ENST00000388913.3	-	5	2488	c.2363G>A	c.(2362-2364)aGc>aAc	p.S788N		NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H	788					biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CAGCAGGCAGCTCTCGAGGCT	0.731													C|||	116	0.0231629	0.0038	0.0115	5008	,	,		10561	0.0268		0.0229	False		,,,				2504	0.0542				p.S788N		.											.	FAM83H-92	0			c.G2363A						.	C	ASN/SER	14,3668		0,14,1827	3.0	3.0	3.0		2363	3.4	1.0	8	dbSNP_129	3	185,7199		1,183,3508	yes	missense	FAM83H	NM_198488.3	46	1,197,5335	TT,TC,CC		2.5054,0.3802,1.7983	probably-damaging	788/1180	144809268	199,10867	1841	3692	5533	SO:0001583	missense	286077	exon5			AGGCAGCTCTCGA	AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.2363G>A	8.37:g.144809268C>T	ENSP00000373565:p.Ser788Asn	0	0		7	7	NM_198488	0	0	0	1	1	A0JLS2|Q8N4W0	Missense_Mutation	SNP	ENST00000388913.3	37	CCDS6410.2	45	0.020604395604395604	2	0.0040650406504065045	5	0.013812154696132596	20	0.03496503496503497	18	0.023746701846965697	c	17.95	3.513746	0.64522	0.003802	0.025054	ENSG00000180921	ENST00000388913	T	0.22134	1.97	4.26	3.37	0.38596	.	1.065800	0.07442	U	0.897448	T	0.09202	0.0227	L	0.32530	0.975	0.28653	N	0.90656	P	0.50943	0.94	P	0.47915	0.561	T	0.19192	-1.0313	10	0.35671	T	0.21	.	13.5524	0.61740	0.0:0.8431:0.1569:0.0	rs56148058	788	Q6ZRV2	FA83H_HUMAN	N	788	ENSP00000373565:S788N	ENSP00000373565:S788N	S	-	2	0	FAM83H	144881256	1.000000	0.71417	0.996000	0.52242	0.570000	0.35934	2.978000	0.49305	0.900000	0.36469	0.491000	0.48974	AGC	C|0.978;T|0.022		0.731	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257632.2	NM_198488	
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	RP11-429J17.8_ENST00000532625.1_RNA|SCRIB_ENST00000356994.2_Silent_p.P1450P|SCRIB_ENST00000546337.1_5'Flank|SCRIB_ENST00000377533.3_Silent_p.P1369P|RP11-429J17.8_ENST00000527139.1_RNA|RP11-429J17.8_ENST00000534089.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		0	0		4	4	NM_015356	0	0	0	11	11	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
EPPK1	83481	bcgsc.ca	37	8	144940290	144940290	+	Missense_Mutation	SNP	C	C	G	rs201976887		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:144940290C>G	ENST00000525985.1	-	2	7203	c.7132G>C	c.(7132-7134)Gac>Cac	p.D2378H				P58107	EPIPL_HUMAN	epiplakin 1	2378						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCGCTGGGGTCGGCCAGGACG	0.682																																					p.D2378H		.											.	EPPK1-25	0			c.G7132C						.	C	HIS/ASP	51,4341	20.2+/-43.8	0,51,2145	315.0	292.0	300.0		7132	3.6	0.8	8		300	22,8530	7.1+/-27.0	0,22,4254	no	missense	EPPK1	NM_031308.1	81	0,73,6399	GG,GC,CC		0.2572,1.1612,0.564	probably-damaging	2378/2420	144940290	73,12871	2196	4276	6472	SO:0001583	missense	83481	exon1			TGGGGTCGGCCAG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.7132G>C	8.37:g.144940290C>G	ENSP00000436337:p.Asp2378His	146	4		256	30	NM_031308	0	0	2	2	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	22.4	4.279155	0.80692	0.011612	0.002572	ENSG00000227184	ENST00000525985	T	0.74737	-0.87	4.43	3.56	0.40772	.	.	.	.	.	D	0.83133	0.5188	M	0.89785	3.06	0.42176	D	0.991666	D	0.89917	1.0	D	0.91635	0.999	D	0.86316	0.1689	9	0.62326	D	0.03	.	10.4012	0.44231	0.0:0.9038:0.0:0.0962	.	2378	E9PPU0	.	H	2378	ENSP00000436337:D2378H	ENSP00000436337:D2378H	D	-	1	0	EPPK1	145012278	1.000000	0.71417	0.773000	0.31616	0.942000	0.58702	7.555000	0.82223	1.223000	0.43536	0.591000	0.81541	GAC	.		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
EPPK1	83481	hgsc.bcm.edu;broad.mit.edu	37	8	144940551	144940551	+	Missense_Mutation	SNP	C	C	T	rs201579633	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:144940551C>T	ENST00000525985.1	-	2	6942	c.6871G>A	c.(6871-6873)Gtg>Atg	p.V2291M				P58107	EPIPL_HUMAN	epiplakin 1	2291						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.V2291M(1)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCGCCCACCACGCCCGCGGCC	0.721													C|||	4	0.000798722	0.0008	0.0014	5008	,	,		74279	0.0		0.001	False		,,,				2504	0.001				p.V2291M		.											.	EPPK1-25	1	Substitution - Missense(1)	lung(1)	c.G6871A						.	C	MET/VAL	0,4334		0,0,2167	74.0	75.0	74.0		6871	2.8	1.0	8		74	3,8495		0,3,4246	no	missense	EPPK1	NM_031308.1	21	0,3,6413	TT,TC,CC		0.0353,0.0,0.0234	benign	2291/2420	144940551	3,12829	2167	4249	6416	SO:0001583	missense	83481	exon1			CCACCACGCCCGC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6871G>A	8.37:g.144940551C>T	ENSP00000436337:p.Val2291Met	12	0		118	22	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	19.09	3.760308	0.69763	0.0	3.53E-4	ENSG00000227184	ENST00000525985	T	0.69435	-0.4	4.63	2.79	0.32731	.	.	.	.	.	T	0.72574	0.3477	L	0.43757	1.38	0.29276	N	0.870372	D	0.56968	0.978	P	0.61477	0.889	T	0.67975	-0.5531	9	0.66056	D	0.02	.	12.5997	0.56491	0.0:0.5022:0.4978:0.0	.	2291	E9PPU0	.	M	2291	ENSP00000436337:V2291M	ENSP00000436337:V2291M	V	-	1	0	EPPK1	145012539	0.000000	0.05858	1.000000	0.80357	0.999000	0.98932	-0.768000	0.04715	0.545000	0.28902	0.586000	0.80456	GTG	.		0.721	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000357649.2_Silent_p.A1973A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		2	0		29	5	NM_201380	0	0	2	2	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		17	16	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
C9orf66	157983	hgsc.bcm.edu	37	9	214719	214719	+	Silent	SNP	C	C	T	rs115610637	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr9:214719C>T	ENST00000382387.2	-	1	1174	c.678G>A	c.(676-678)gcG>gcA	p.A226A	DOCK8_ENST00000432829.2_5'Flank|DOCK8_ENST00000453981.1_5'Flank	NM_152569.2	NP_689782.2	Q5T8R8	CI066_HUMAN	chromosome 9 open reading frame 66	226	Arg-rich.									central_nervous_system(1)|cervix(1)|kidney(1)|skin(1)	4	all_lung(41;0.218)	all_cancers(5;2.09e-12)|all_epithelial(5;6.16e-09)|all_lung(10;1.15e-08)|Lung NSC(10;1.91e-08)|Acute lymphoblastic leukemia(5;0.00457)|all_hematologic(5;0.0332)|Breast(48;0.0646)|Prostate(43;0.137)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		AGGCCAGTTCCGCGCTGGGCC	0.801													C|||	65	0.0129792	0.0015	0.0115	5008	,	,		9667	0.0		0.0437	False		,,,				2504	0.0112				p.A226A		.											.	C9orf66-514	0			c.G678A						.	C		12,3136		0,12,1562	3.0	3.0	3.0		678	-2.7	0.1	9	dbSNP_132	3	227,6207		3,221,2993	no	coding-synonymous	C9orf66	NM_152569.2		3,233,4555	TT,TC,CC		3.5281,0.3812,2.4943		226/296	214719	239,9343	1574	3217	4791	SO:0001819	synonymous_variant	157983	exon1			CAGTTCCGCGCTG	AK055720	CCDS6439.1	9p24.3	2008-02-05			ENSG00000183784	ENSG00000183784			26436	protein-coding gene	gene with protein product							Standard	NM_152569		Approved	FLJ31158	uc003zge.4	Q5T8R8	OTTHUMG00000021017	ENST00000382387.2:c.678G>A	9.37:g.214719C>T		0	0		8	6	NM_152569	0	0	0	0	0	Q96NB0	Silent	SNP	ENST00000382387.2	37	CCDS6439.1																																																																																			C|0.983;T|0.017		0.801	C9orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055436.1	NM_152569	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		0	0		50	22	NM_024896	0	0	4	5	1	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
FAM120AOS	158293	hgsc.bcm.edu	37	9	96214852	96214852	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr9:96214852C>T	ENST00000375412.5	-	1	1022	c.140G>A	c.(139-141)cGc>cAc	p.R47H	FAM120A_ENST00000277165.6_Intron|FAM120A_ENST00000333936.5_Intron|FAM120A_ENST00000375389.3_Intron|FAM120AOS_ENST00000479094.1_5'Flank|FAM120AOS_ENST00000423591.1_5'Flank|FAM120A_ENST00000340893.4_Intron	NM_198841.2	NP_942138.2	Q5T036	F120S_HUMAN	family with sequence similarity 120A opposite strand	47	Arg-rich.									kidney(1)|large_intestine(1)|lung(3)|skin(1)	6						GTGCAGGCCGCGCGCTGCCCA	0.746																																					p.R47H		.											.	FAM120AOS-90	0			c.G140A						.						6.0	8.0	7.0					9																	96214852		1807	3732	5539	SO:0001583	missense	158293	exon1			AGGCCGCGCGCTG	AK056096	CCDS6705.1	9q22.32	2008-02-05	2006-07-04	2006-07-04	ENSG00000188938	ENSG00000188938			23389	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 10 opposite strand"""	C9orf10OS		14585507	Standard	NM_198841		Approved		uc004atu.4	Q5T036	OTTHUMG00000020251	ENST00000375412.5:c.140G>A	9.37:g.96214852C>T	ENSP00000364561:p.Arg47His	3	0		23	10	NM_198841	0	0	0	0	0	A6NN20	Missense_Mutation	SNP	ENST00000375412.5	37	CCDS6705.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301428	0.40694	.	.	ENSG00000188938	ENST00000375412	T	0.55052	0.54	3.01	-6.01	0.02199	.	.	.	.	.	T	0.24547	0.0595	N	0.08118	0	0.09310	N	0.99999	B	0.11235	0.004	B	0.04013	0.001	T	0.15838	-1.0423	9	0.87932	D	0	-2.0471	2.967	0.05910	0.1053:0.3237:0.3614:0.2095	.	47	Q5T036	F120S_HUMAN	H	47	ENSP00000364561:R47H	ENSP00000364561:R47H	R	-	2	0	FAM120AOS	95254673	0.000000	0.05858	0.000000	0.03702	0.203000	0.24098	-2.024000	0.01436	-2.022000	0.00938	-0.218000	0.12543	CGC	.		0.746	FAM120AOS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053154.1		
SLC44A1	23446	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	108120655	108120655	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr9:108120655G>A	ENST00000374720.3	+	7	948	c.701G>A	c.(700-702)aGg>aAg	p.R234K	SLC44A1_ENST00000343170.7_Missense_Mutation_p.R26K|SLC44A1_ENST00000374723.1_Missense_Mutation_p.R234K|SLC44A1_ENST00000374724.1_Missense_Mutation_p.R234K	NM_080546.3	NP_536856.2	Q8WWI5	CTL1_HUMAN	solute carrier family 44 (choline transporter), member 1	234					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	38					Choline(DB00122)	GTGATAATCAGGTATATATCA	0.328																																					p.R234K		.											.	SLC44A1-94	0			c.G701A						.						221.0	208.0	212.0					9																	108120655		2203	4300	6503	SO:0001583	missense	23446	exon7			TAATCAGGTATAT	AJ420812	CCDS6763.1, CCDS75868.1	9q31.2	2014-01-28	2013-07-17	2005-09-06	ENSG00000070214	ENSG00000070214		"""CD molecules"", ""Solute carriers"""	18798	protein-coding gene	gene with protein product		606105	"""CDW92 antigen"""	CDW92		11698453, 10677542	Standard	NM_080546		Approved	CDw92, CTL1, CHTL1, CD92	uc004bcn.3	Q8WWI5	OTTHUMG00000020421	ENST00000374720.3:c.701G>A	9.37:g.108120655G>A	ENSP00000363852:p.Arg234Lys	99	0		91	45	NM_080546	0	0	27	35	8	A6NLZ9|Q5VUB3|Q8WVB0|Q96KU3|Q9NY69	Missense_Mutation	SNP	ENST00000374720.3	37	CCDS6763.1	.	.	.	.	.	.	.	.	.	.	G	33	5.193644	0.94960	.	.	ENSG00000070214	ENST00000374723;ENST00000374720;ENST00000374724;ENST00000343170	T;T;T;T	0.22539	2.73;2.72;2.73;1.95	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.47600	0.1454	M	0.69823	2.125	0.40992	D	0.984866	D;D;P	0.71674	0.998;0.998;0.765	D;D;B	0.68353	0.957;0.957;0.285	T	0.43048	-0.9415	10	0.54805	T	0.06	-6.3711	19.2464	0.93904	0.0:0.0:1.0:0.0	.	234;234;234	Q8WWI5-3;Q8WWI5-2;Q8WWI5	.;.;CTL1_HUMAN	K	234;234;234;26	ENSP00000363855:R234K;ENSP00000363852:R234K;ENSP00000363856:R234K;ENSP00000341856:R26K	ENSP00000341856:R26K	R	+	2	0	SLC44A1	107160476	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.379000	0.97198	2.625000	0.88918	0.643000	0.83706	AGG	.		0.328	SLC44A1-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053500.1	NM_080546	
PTGS1	5742	hgsc.bcm.edu;broad.mit.edu	37	9	125133492	125133497	+	In_Frame_Del	DEL	TCCTGC	TCCTGC	-	rs534752292	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	TCCTGC	TCCTGC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr9:125133492_125133497delTCCTGC	ENST00000362012.2	+	2	40_45	c.35_40delTCCTGC	c.(34-42)ttcctgctc>ttc	p.LL15del	PTGS1_ENST00000223423.4_In_Frame_Del_p.LL15del|PTGS1_ENST00000540753.1_5'UTR|RP11-498E2.9_ENST00000602325.1_RNA	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	15					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTCTTGCTGTTCCTGCTCCTGCTCCC	0.665														9	0.00179712	0.0	0.0029	5008	,	,		11342	0.0		0.007	False		,,,				2504	0.0				p.12_14del		.											.	PTGS1-228	0			c.35_40del						.		,	8,4256		1,6,2125					,	0.2	1.0			67	60,8194		1,58,4068	no	coding,coding	PTGS1	NM_080591.1,NM_000962.2	,	2,64,6193	A1A1,A1R,RR		0.7269,0.1876,0.5432	,	,		68,12450				SO:0001651	inframe_deletion	5742	exon2			TGCTGTTCCTGCT	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.35_40delTCCTGC	9.37:g.125133498_125133503delTCCTGC	ENSP00000354612:p.Leu15_Leu16del	12	0		36	12	NM_001271164	0	0	0	0	0	A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	In_Frame_Del	DEL	ENST00000362012.2	37	CCDS6842.1																																																																																			.		0.665	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1		
CRB2	286204	hgsc.bcm.edu	37	9	126135831	126135831	+	Silent	SNP	T	T	C	rs7848449	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr9:126135831T>C	ENST00000373631.3	+	10	3022	c.3021T>C	c.(3019-3021)gcT>gcC	p.A1007A	CRB2_ENST00000359999.3_Silent_p.A1007A|CRB2_ENST00000373629.2_Silent_p.A675A	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	1007	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						TCCTGCTGGCTGAGAACTTCA	0.766													C|||	691	0.137979	0.2436	0.1383	5008	,	,		8285	0.0556		0.0944	False		,,,				2504	0.1247				p.A1007A		.											.	CRB2-91	0			c.T3021C						.	C		511,2581		46,419,1081	6.0	6.0	6.0		3021	-6.8	0.9	9	dbSNP_116	6	457,5659		17,423,2618	no	coding-synonymous	CRB2	NM_173689.5		63,842,3699	CC,CT,TT		7.4722,16.5265,10.5126		1007/1286	126135831	968,8240	1546	3058	4604	SO:0001819	synonymous_variant	286204	exon10			GCTGGCTGAGAAC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.3021T>C	9.37:g.126135831T>C		0	0		19	9	NM_173689	0	0	0	0	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Silent	SNP	ENST00000373631.3	37	CCDS6852.2																																																																																			T|0.886;C|0.114		0.766	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053990.3	NM_173689	
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	0	0		5	5	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
ARSE	415	bcgsc.ca	37	X	2856155	2856155	+	Missense_Mutation	SNP	C	C	T	rs35143646	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chrX:2856155C>T	ENST00000381134.3	-	9	1336	c.1270G>A	c.(1270-1272)Ggc>Agc	p.G424S	ARSE_ENST00000540563.1_Missense_Mutation_p.G379S|ARSE_ENST00000545496.1_Missense_Mutation_p.G449S	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	424			G -> S (in dbSNP:rs35143646). {ECO:0000269|Ref.2}.		cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGCACCTCGCCGCCCGCCAGC	0.602													C|||	2169	0.57457	0.059	0.415	3775	,	,		11186	0.6786		0.5278	False		,,,				2504	0.6012				p.G424S		.											.	ARSE-131	0			c.G1270A						.	C	SER/GLY	687,3144		65,474,83,1093,484	52.0	55.0	54.0		1270	3.5	0.0	X	dbSNP_126	54	4504,2211		1084,1066,1270,277,591	no	missense	ARSE	NM_000047.2	56	1149,1540,1353,1370,1075	TT,TC,T,CC,C		32.9263,17.9327,49.2225	benign	424/590	2856155	5191,5355	2199	4288	6487	SO:0001583	missense	415	exon9			CCTCGCCGCCCGC	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.1270G>A	X.37:g.2856155C>T	ENSP00000370526:p.Gly424Ser	101	1		194	7	NM_000047	0	0	0	0	0	Q53FT2|Q53FU8	Missense_Mutation	SNP	ENST00000381134.3	37	CCDS14122.1	951	0.5732368896925859	22	0.046413502109704644	94	0.3671875	255	0.796875	275	0.5308880308880309	c	10.51	1.369388	0.24771	0.179327	0.670737	ENSG00000157399	ENST00000540563;ENST00000545496;ENST00000381134	D;D;D	0.93859	-3.3;-3.3;-3.3	3.46	3.46	0.39613	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.055865	0.64402	D	0.000001	T	0.00012	0.0000	L	0.56769	1.78	0.22424	P	0.999114817	P;P;P	0.50819	0.931;0.939;0.905	P;B;P	0.46299	0.511;0.41;0.49	T	0.48502	-0.9030	9	0.20519	T	0.43	.	14.3929	0.66991	0.0:1.0:0.0:0.0	rs35143646;rs60405351	379;449;424	F5H324;F5GYY5;P51690	.;.;ARSE_HUMAN	S	379;449;424	ENSP00000438198:G379S;ENSP00000441417:G449S;ENSP00000370526:G424S	ENSP00000370526:G424S	G	-	1	0	ARSE	2866155	1.000000	0.71417	0.017000	0.16124	0.005000	0.04900	6.335000	0.72949	1.355000	0.45865	0.540000	0.68198	GGC	C|0.503;T|0.497		0.602	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055643.1	NM_000047	
TCEANC	170082	bcgsc.ca	37	X	13681638	13681638	+	Silent	SNP	C	C	T	rs5935649	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chrX:13681638C>T	ENST00000380600.1	+	2	1098	c.1011C>T	c.(1009-1011)aaC>aaT	p.N337N	TCEANC_ENST00000490617.1_3'UTR|TCEANC_ENST00000314720.4_Silent_p.N367N|TCEANC_ENST00000544987.1_Silent_p.N337N|TCEANC_ENST00000545566.1_Silent_p.N337N			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	337					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						TAATTTGTAACGAATGTGGGG	0.418													C|||	2100	0.556291	0.3177	0.402	3775	,	,		16245	0.496		0.3847	False		,,,				2504	0.5256				p.N367N		.											.	TCEANC-41	0			c.C1101T						.	C		1312,2059		229,629,225,550,330	58.0	49.0	52.0		1101	1.4	1.0	X	dbSNP_114	52	3403,3051		652,1171,928,523,834	no	coding-synonymous	TCEANC	NM_152634.2		881,1800,1153,1073,1164	TT,TC,T,CC,C		47.273,38.9202,47.9898		367/382	13681638	4715,5110	1963	4108	6071	SO:0001819	synonymous_variant	170082	exon4			TTGTAACGAATGT		CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.1011C>T	X.37:g.13681638C>T		111	1		96	5	NM_152634	0	0	0	0	0	A6NI06|B2RDM3	Silent	SNP	ENST00000380600.1	37																																																																																				C|0.470;T|0.530		0.418	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055796.1	NM_152634	
TEX13A	56157	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	104463887	104463887	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chrX:104463887G>A	ENST00000413579.1	-	5	1100	c.989C>T	c.(988-990)cCt>cTt	p.P330L	TEX13A_ENST00000372578.3_Missense_Mutation_p.L331F|IL1RAPL2_ENST00000344799.4_Intron|TEX13A_ENST00000372575.1_Missense_Mutation_p.L331F|IL1RAPL2_ENST00000372582.1_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	330							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						AGGCAGCTGAGGCGGAACTGG	0.537																																					p.P330L		.											.	TEX13A-132	0			c.C989T						.						107.0	101.0	103.0					X																	104463887		2155	4261	6416	SO:0001583	missense	56157	exon5			AGCTGAGGCGGAA	AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.989C>T	X.37:g.104463887G>A	ENSP00000399753:p.Pro330Leu	79	1		71	61	NM_031274	0	0	0	0	0	B1B1G8|Q32NB6	Missense_Mutation	SNP	ENST00000413579.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.091|5.091	0.202458|0.202458	0.09652|0.09652	.|.	.|.	ENSG00000133149|ENSG00000133149	ENST00000372578;ENST00000372575|ENST00000413579	.|.	.|.	.|.	2.68|2.68	1.76|1.76	0.24704|0.24704	.|.	.|2.083830	.|0.02569	.|N	.|0.097623	T|T	0.31295|0.31295	0.0792|0.0792	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|B	.|0.15719	.|0.014	.|B	.|0.14023	.|0.01	T|T	0.19877|0.19877	-1.0292|-1.0292	6|9	0.87932|0.42905	D|T	0|0.14	.|.	5.9922|5.9922	0.19472|0.19472	0.0:0.0:0.693:0.307|0.0:0.0:0.693:0.307	.|.	.|330	.|Q9BXU3	.|TX13A_HUMAN	F|L	331|330	.|.	ENSP00000361656:L331F|ENSP00000399753:P330L	L|P	-|-	1|2	0|0	TEX13A|TEX13A	104350543|104350543	0.016000|0.016000	0.18221|0.18221	0.002000|0.002000	0.10522|0.10522	0.003000|0.003000	0.03518|0.03518	1.981000|1.981000	0.40628|0.40628	0.515000|0.515000	0.28320|0.28320	0.436000|0.436000	0.28706|0.28706	CTC|CCT	.		0.537	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_031274	
MAMLD1	10046	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	149678251	149678251	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chrX:149678251G>C	ENST00000370401.2	+	7	2614	c.2304G>C	c.(2302-2304)agG>agC	p.R768S	MAMLD1_ENST00000432680.2_Missense_Mutation_p.G621A|MAMLD1_ENST00000426613.2_Missense_Mutation_p.R743S|MAMLD1_ENST00000455522.2_Missense_Mutation_p.R208S|MAMLD1_ENST00000262858.5_Missense_Mutation_p.R768S			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	768					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					CAGAGATCAGGTCTTATGGCA	0.443																																					p.R768S		.											.	MAMLD1-130	0			c.G2304C						.						166.0	143.0	151.0					X																	149678251		2203	4300	6503	SO:0001583	missense	10046	exon6			GATCAGGTCTTAT	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.2304G>C	X.37:g.149678251G>C	ENSP00000359428:p.Arg768Ser	96	0		75	62	NM_005491	0	0	0	14	14	B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	ENST00000370401.2	37	CCDS14693.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.78|16.78	3.217072|3.217072	0.58560|0.58560	.|.	.|.	ENSG00000013619|ENSG00000013619	ENST00000432680|ENST00000445612;ENST00000370401;ENST00000262858;ENST00000426613;ENST00000455522	T|T;T;T;T	0.70749|0.64260	-0.51|-0.09;-0.09;-0.08;0.32	4.77|4.77	2.55|2.55	0.30701|0.30701	.|.	.|0.188276	.|0.35936	.|N	.|0.002888	T|T	0.71517|0.71517	0.3349|0.3349	.|.	.|.	.|.	0.27244|0.27244	N|N	0.959073|0.959073	P|P;D;D	0.40731|0.61080	0.728|0.782;0.989;0.989	B|B;D;D	0.43445|0.75020	0.42|0.349;0.985;0.985	T|T	0.61559|0.61559	-0.7038|-0.7038	8|9	0.06365|0.87932	T|D	0.9|0	0.7331|0.7331	4.3773|4.3773	0.11277|0.11277	0.5243:0.0:0.4757:0.0|0.5243:0.0:0.4757:0.0	.|.	621|640;743;768	Q13495-3|F6WVG1;Q13495-4;Q13495	.|.;.;MAMD1_HUMAN	A|S	621|640;768;768;743;208	ENSP00000414517:G621A|ENSP00000359428:R768S;ENSP00000262858:R768S;ENSP00000397438:R743S;ENSP00000389106:R208S	ENSP00000414517:G621A|ENSP00000262858:R768S	G|R	+|+	2|3	0|2	MAMLD1|MAMLD1	149428909|149428909	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.983000|0.983000	0.72400|0.72400	1.438000|1.438000	0.35002|0.35002	0.931000|0.931000	0.37242|0.37242	0.529000|0.529000	0.55759|0.55759	GGT|AGG	.		0.443	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060844.2	NM_005491	
FLNA	2316	hgsc.bcm.edu	37	X	153599572	153599572	+	Silent	SNP	G	G	C	rs398123619		TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chrX:153599572G>C	ENST00000369850.3	-	2	278	c.42C>G	c.(40-42)ggC>ggG	p.G14G	FLNA_ENST00000344736.4_Silent_p.G14G|FLNA_ENST00000422373.1_Silent_p.G14G|FLNA_ENST00000360319.4_Silent_p.G14G	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	14	Actin-binding.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCGGAGCCGCGCCTGCTGCGC	0.716																																					p.G14G		.											.	FLNA-599	0			c.C42G						.						6.0	7.0	7.0					X																	153599572		1964	3932	5896	SO:0001819	synonymous_variant	2316	exon2			AGCCGCGCCTGCT	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.42C>G	X.37:g.153599572G>C		5	0		81	68	NM_001456	0	0	0	1	1	E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	ENST00000369850.3	37	CCDS48194.1																																																																																			.		0.716	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058942.3		
TCHH	7062	broad.mit.edu	37	1	152084175	152084176	+	In_Frame_Ins	INS	-	-	TGCTGCTCGCGCCTCTCC			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:152084175_152084176insTGCTGCTCGCGCCTCTCC	ENST00000368804.1	-	2	1516_1517	c.1517_1518insGGAGAGGCGCGAGCAGCA	c.(1516-1518)caa>caGGAGAGGCGCGAGCAGCAa	p.506_506Q>QERREQQ		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	506	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCCGCCTTAGTTGCTGCTCGCG	0.644																																					p.Q506delinsQERREQQ		.											.	TCHH-72	0			c.1518_1519insGGAGAGGCGCGAGCAGCA						.																																			SO:0001652	inframe_insertion	7062	exon3			CCTTAGTTGCTGC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1500_1517dupGGAGAGGCGCGAGCAGCA	1.37:g.152084175_152084176insTGCTGCTCGCGCCTCTCC	ENSP00000357794:p.GluArgArgGluGlnGln506dup	68	0		58	19	NM_007113	0	0	0	0	0	Q5VUI3	In_Frame_Ins	INS	ENST00000368804.1	37	CCDS41396.1																																																																																			.		0.644	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
SLC30A1	7779	hgsc.bcm.edu	37	1	211749358	211749359	+	Frame_Shift_Ins	INS	-	-	TAATTATTTCTACAAATGCTTTGCAGGGGTCAGGGAAACATGGATTC			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr1:211749358_211749359insTAATTATTTCTACAAATGCTTTGCAGGGGTCAGGGAAACATGGATTC	ENST00000367001.4	-	2	1024_1025	c.895_896insGAATCCATGTTTCCCTGACCCCTGCAAAGCATTTGTAGAAATAATTA	c.(895-897)aatfs	p.N299fs		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	299					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		ATGAGTACTATTAATTATTTCT	0.381																																					p.N299_S300delinsRIHVSLTPAKHLX		.											.	SLC30A1-93	0			c.896_897insGAATCCATGTTTCCCTGACCCCTGCAAAGCATTTGTAGAAATAATTA						.																																			SO:0001589	frameshift_variant	7779	exon2			GTACTATTAATTA	AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.849_895dupGAATCCATGTTTCCCTGACCCCTGCAAAGCATTTGTAGAAATAATTA	1.37:g.211749358_211749359insTAATTATTTCTACAAATGCTTTGCAGGGGTCAGGGAAACATGGATTC	ENSP00000355968:p.Asn299fs	66	0		46	0	NM_021194	0	0	0	0	0	Q0VAK9|Q9BZF6	Nonsense_Mutation	INS	ENST00000367001.4	37	CCDS1499.1																																																																																			.		0.381	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104738.2		
FARP2	9855	broad.mit.edu	37	2	242433486	242433487	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr2:242433486_242433487insG	ENST00000264042.3	+	27	3281_3282	c.3111_3112insG	c.(3112-3114)ggcfs	p.G1038fs	STK25_ENST00000478403.1_5'Flank|STK25_ENST00000316586.4_3'UTR	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	1038					actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TCGTGCAGGATGGCCCCCAACC	0.634																																					p.D1037fs		.											.	FARP2-93	0			c.3111_3112insG						.																																			SO:0001589	frameshift_variant	9855	exon27			GCAGGATGGCCCC	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.3113dupG	2.37:g.242433488_242433488dupG	ENSP00000264042:p.Gly1038fs	260	0		242	10	NM_014808	0	0	0	0	0	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Frame_Shift_Ins	INS	ENST00000264042.3	37	CCDS33424.1																																																																																			.		0.634	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
SON	6651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	34926429	34926430	+	Frame_Shift_Ins	INS	-	-	TT			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr21:34926429_34926430insTT	ENST00000356577.4	+	3	5367_5368	c.4892_4893insTT	c.(4891-4896)tctttafs	p.L1632fs	SON_ENST00000290239.6_Frame_Shift_Ins_p.L1632fs|SON_ENST00000381692.2_Intron|SON_ENST00000300278.4_Frame_Shift_Ins_p.L1632fs|SON_ENST00000381679.4_Frame_Shift_Ins_p.L1632fs	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1632					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GTTGATTTATCTTTAACTACTC	0.386																																					p.S1631fs		.											.	SON-97	0			c.4892_4893insTT						.																																			SO:0001589	frameshift_variant	6651	exon3			ATTTATCTTTAAC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.4893_4894dupTT	21.37:g.34926430_34926431dupTT	ENSP00000348984:p.Leu1632fs	85	0		112	17	NM_032195	0	0	0	0	0	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Frame_Shift_Ins	INS	ENST00000356577.4	37	CCDS13629.1																																																																																			.		0.386	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
FNDC3B	64778	hgsc.bcm.edu	37	3	172050900	172050901	+	Frame_Shift_Ins	INS	-	-	ACACTGGAGAGGATTTAACCTGTACTGTG			TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr3:172050900_172050901insACACTGGAGAGGATTTAACCTGTACTGTG	ENST00000336824.4	+	14	1675_1676	c.1576_1577insACACTGGAGAGGATTTAACCTGTACTGTG	c.(1576-1578)tacfs	p.-535fs	FNDC3B_ENST00000415807.2_Frame_Shift_Ins_p.-535fs|FNDC3B_ENST00000416957.1_Frame_Shift_Ins_p.-535fs	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B						cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		CCACCCAAAATACACTGGAGAG	0.351																																					p.Y526fs		.											.	FNDC3B-155	0			c.1576_1577insACACTGGAGAGGATTTAACCTGTACTGTG						.																																			SO:0001589	frameshift_variant	64778	exon14			CCAAAATACACTG	AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.1577_1605dupACACTGGAGAGGATTTAACCTGTACTGTG	3.37:g.172050900_172050901insACACTGGAGAGGATTTAACCTGTACTGTG	ENSP00000338523:p.Val535fs	59	0		26	0	NM_001135095	0	0	0	0	0	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Frame_Shift_Ins	INS	ENST00000336824.4	37	CCDS3217.1																																																																																			.		0.351	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345618.2	NM_022763	
FZD1	8321	hgsc.bcm.edu	37	7	90894459	90894460	+	In_Frame_Ins	INS	-	-	CCG	rs71292991|rs139480179	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr7:90894459_90894460insCCG	ENST00000287934.2	+	1	677_678	c.264_265insCCG	c.(265-267)ccg>CCGccg	p.89_89P>PP		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	89	Poly-Pro.				autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Q88_P89insP(2)|p.Q88_P89insA(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			cggggcAGCAACCGCCGCCGCC	0.743														1874	0.374201	0.4047	0.4625	5008	,	,		10872	0.2986		0.4294	False		,,,				2504	0.2914				p.Q88delinsQP		.											.	FZD1-658	3	Insertion - In frame(3)	breast(2)|liver(1)	c.264_265insCCG						.			1606,5,2563		359,2,886,0,3,837						0.6	1.0		dbSNP_134	11	3182,3,4959		703,0,1776,1,1,1591	no	codingComplex	FZD1	NM_003505.1		1062,2,2662,1,4,2428	A1A1,A1A2,A1R,A2A2,A2R,RR		39.1085,38.5961,38.9349				4788,8,7522				SO:0001652	inframe_insertion	8321	exon1			GCAGCAACCGCCG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.274_276dupCCG	7.37:g.90894466_90894468dupCCG	ENSP00000287934:p.Pro93dup	2	1		36	17	NM_003505	0	0	0	0	0	A4D1E8|O94815|Q549T8	In_Frame_Ins	INS	ENST00000287934.2	37	CCDS5620.1																																																																																			-|0.606;CCG|0.394		0.743	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
TTLL11	158135	hgsc.bcm.edu	37	9	124855330	124855331	+	In_Frame_Ins	INS	-	-	TGGCCT	rs3833704|rs201653732	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr9:124855330_124855331insTGGCCT	ENST00000373776.3	-	1	554_555	c.367_368insAGGCCA	c.(367-369)aca>aAGGCCAca	p.122_123insKA	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_In_Frame_Ins_p.122_123insKA	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	122					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						cgtctccgctgtggcctcggcc	0.762														678	0.135383	0.1044	0.1254	5008	,	,		10384	0.0367		0.2773	False		,,,				2504	0.1401				p.T123delinsKAT		.											.	TTLL11-112	0			c.368_369insAGGCCA						.		,	363,1875		124,115,880					,	-4.8	0.0		dbSNP_107	2	1330,3776		463,404,1686	no	coding,coding	TTLL11	NM_194252.2,NM_001139442.1	,	587,519,2566	A1A1,A1R,RR		26.0478,16.2198,23.0528	,	,		1693,5651				SO:0001652	inframe_insertion	158135	exon1			TCCGCTGTGGCCT	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.362_367dupAGGCCA	9.37:g.124855331_124855336dupTGGCCT	ENSP00000362881:p.Ala122_Thr123insLysAla	1	0		29	10	NM_001139442	0	0	0	0	0		In_Frame_Ins	INS	ENST00000373776.3	37	CCDS6834.2																																																																																			-|0.843;TGGCCT|0.157		0.762	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
TPSD1	23430	hgsc.bcm.edu	37	16	1306346	1306347	+	Missense_Mutation	DNP	CG	CG	GC	rs2005937|rs3865205	byFrequency	TCGA-OR-A5JG-01A-11D-A29I-10	TCGA-OR-A5JG-10A-01D-A29L-10	CG	CG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	f116898f-b9c5-4d6c-9fec-7dc95857b8e9	037f76d1-c3d3-4513-a77b-2c2c8aea8963	g.chr16:1306346_1306347CG>GC	ENST00000211076.3	+	1	213_214	c.65_66CG>GC	c.(64-66)cCG>cGC	p.P22R	TPSD1_ENST00000397534.2_Missense_Mutation_p.P15R|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	22			P -> R (in dbSNP:rs3865205). {ECO:0000269|PubMed:9920877}.			extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				CTGGCGAGCCCGGCCTACGTGG	0.723																																					p.P22R		.											.	TPSD1-90	0			c.G66C						.																																			SO:0001583	missense	23430	exon1			GAGCCCGGCCTAC	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	Exception_encountered	16.37:g.1306346_1306347delinsGC	ENSP00000211076:p.Pro22Arg	21	0		254	0	NM_012217	0	0	0	0	0	O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	DNP	ENST00000211076.3	37	CCDS10432.1																																																																																			.		0.723	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2		
