#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SRM	6723	hgsc.bcm.edu	37	1	11119899	11119899	+	Silent	SNP	T	T	C	rs7545802		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:11119899T>C	ENST00000376957.2	-	1	182	c.102A>G	c.(100-102)tcA>tcG	p.S34S		NM_003132.2	NP_003123.2	P19623	SPEE_HUMAN	spermidine synthase	34	PABS.				cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)|spermidine synthase activity (GO:0004766)			large_intestine(1)|lung(1)|urinary_tract(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)	CCACCTGCAGTGACAGGGCCT	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		7294	1.0		1.0	False		,,,				2504	1.0				p.S34S		.											.	SRM-90	0			c.A102G						.						8.0	10.0	10.0					1																	11119899		1613	3461	5074	SO:0001819	synonymous_variant	6723	exon1			CTGCAGTGACAGG	BC033106	CCDS125.1	1p36-p22	2010-11-08			ENSG00000116649	ENSG00000116649	2.5.1.16		11296	protein-coding gene	gene with protein product		182891		SRML1		2344393	Standard	NM_003132		Approved	SPS1	uc001arz.1	P19623	OTTHUMG00000002119	ENST00000376957.2:c.102A>G	1.37:g.11119899T>C		0	0		10	10	NM_003132	0	0	0	22	22	B1AKP9|Q15511	Silent	SNP	ENST00000376957.2	37	CCDS125.1																																																																																			T|0.001;C|0.999		0.761	SRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006056.1	NM_003132	
AKR7L	246181	hgsc.bcm.edu	37	1	19600479	19600501	+	RNA	DEL	TGCGGCGCTGGTGGGCGCGTCCA	TGCGGCGCTGGTGGGCGCGTCCA	-	rs573930529	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	TGCGGCGCTGGTGGGCGCGTCCA	TGCGGCGCTGGTGGGCGCGTCCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:19600479_19600501delTGCGGCGCTGGTGGGCGCGTCCA	ENST00000429712.1	-	0	187_209				AKR7L_ENST00000420396.2_RNA			Q8NHP1	ARK74_HUMAN	aldo-keto reductase family 7-like							extracellular vesicular exosome (GO:0070062)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6						CGCGCGTGACTGCGGCGCTGGTGGGCGCGTCCATGCGGCGCCC	0.722														155	0.0309505	0.0	0.0202	5008	,	,		16736	0.0476		0.0288	False		,,,				2504	0.0654				.		.											.	AKR7L-90	0			.						.			8,4132		1,6,2063						1.0	0.0			23	91,7993		9,73,3960	no	intergenic				10,79,6023	A1A1,A1R,RR		1.1257,0.1932,0.8099				99,12125						246181	.			CGTGACTGCGGCG			1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454			24056	protein-coding gene	gene with protein product		608478				12879023	Standard	NR_040288		Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520		1.37:g.19600479_19600501delTGCGGCGCTGGTGGGCGCGTCCA		27	0		62	19	.	0	0	0	0	0	Q5U614	RNA	DEL	ENST00000429712.1	37																																																																																				.		0.722	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000007163.3	NM_201252	
RPS6KA1	6195	hgsc.bcm.edu	37	1	26856462	26856462	+	Silent	SNP	T	T	G	rs11800553	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:26856462T>G	ENST00000374168.2	+	1	205	c.51T>G	c.(49-51)ccT>ccG	p.P17P	RPS6KA1_ENST00000374166.4_Silent_p.P17P|RPS6KA1_ENST00000374162.2_5'Flank|RPS6KA1_ENST00000526792.1_5'Flank	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	17					axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		AGCTAGTGCCTCTGGACCCGG	0.786													G|||	4691	0.936701	0.9259	0.9179	5008	,	,		6031	0.9583		0.9553	False		,,,				2504	0.9233				p.P17P		.											.	RPS6KA1-510	0			c.T51G						.						2.0	2.0	2.0					1																	26856462		1084	2070	3154	SO:0001819	synonymous_variant	6195	exon1			AGTGCCTCTGGAC	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.51T>G	1.37:g.26856462T>G		0	0		5	5	NM_002953	0	0	0	0	0	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	37	CCDS284.1																																																																																			T|0.065;G|0.935		0.786	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		7	7	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
AGL	178	bcgsc.ca	37	1	100358103	100358103	+	Missense_Mutation	SNP	C	C	T	rs3753494	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:100358103C>T	ENST00000294724.4	+	24	3677	c.3199C>T	c.(3199-3201)Cct>Tct	p.P1067S	AGL_ENST00000370163.3_Missense_Mutation_p.P1067S|AGL_ENST00000370161.2_Missense_Mutation_p.P1051S|AGL_ENST00000361915.3_Missense_Mutation_p.P1067S|AGL_ENST00000361522.4_Missense_Mutation_p.P1050S|AGL_ENST00000370165.3_Missense_Mutation_p.P1067S|AGL_ENST00000361302.3_Missense_Mutation_p.P1051S	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	1067			P -> S (in dbSNP:rs3753494).		carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		AATGGATGTACCTTATAGGTT	0.378													C|||	554	0.110623	0.1203	0.0951	5008	,	,		15854	0.0278		0.1551	False		,,,				2504	0.1483				p.P1067S		.											.	AGL-92	0			c.C3199T						.	C	SER/PRO,SER/PRO,SER/PRO,SER/PRO,SER/PRO,SER/PRO	557,3849	249.0+/-256.6	36,485,1682	99.0	94.0	96.0		3199,3199,3199,3199,3148,3151	5.2	0.4	1	dbSNP_107	96	1257,7343	251.5+/-278.0	96,1065,3139	yes	missense,missense,missense,missense,missense,missense	AGL	NM_000028.2,NM_000642.2,NM_000643.2,NM_000644.2,NM_000645.2,NM_000646.2	74,74,74,74,74,74	132,1550,4821	TT,TC,CC		14.6163,12.6419,13.9474	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1067/1533,1067/1533,1067/1533,1067/1533,1050/1516,1051/1517	100358103	1814,11192	2203	4300	6503	SO:0001583	missense	178	exon24			GATGTACCTTATA	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.3199C>T	1.37:g.100358103C>T	ENSP00000294724:p.Pro1067Ser	128	1		112	6	NM_000644	0	0	5	5	0	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	37	CCDS759.1	237	0.10851648351648352	69	0.1402439024390244	43	0.11878453038674033	13	0.022727272727272728	112	0.14775725593667546	C	13.10	2.137783	0.37728	0.126419	0.146163	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.74947	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.89	5.2	5.2	0.72013	.	0.111526	0.64402	D	0.000006	T	0.66703	0.2816	M	0.67953	2.075	0.09310	P	0.999999999670201	B;B;B	0.26318	0.12;0.12;0.146	B;B;B	0.29353	0.047;0.047;0.101	T	0.66460	-0.5918	9	0.37606	T	0.19	.	19.1022	0.93277	0.0:1.0:0.0:0.0	rs3753494;rs17449932;rs52793848;rs56862711;rs3753494	1050;1051;1067	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	S	1067;1067;1067;1067;1051;1051;1050	ENSP00000355106:P1067S;ENSP00000359184:P1067S;ENSP00000359182:P1067S;ENSP00000294724:P1067S;ENSP00000354971:P1051S;ENSP00000359180:P1051S;ENSP00000354635:P1050S	ENSP00000294724:P1067S	P	+	1	0	AGL	100130691	1.000000	0.71417	0.412000	0.26496	0.008000	0.06430	7.230000	0.78097	2.553000	0.86117	0.573000	0.79308	CCT	C|0.869;T|0.131		0.378	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
CHIA	27159	bcgsc.ca	37	1	111861974	111861974	+	Missense_Mutation	SNP	T	T	C	rs2275254	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:111861974T>C	ENST00000369740.1	+	11	1164	c.1061T>C	c.(1060-1062)tTt>tCt	p.F354S	CHIA_ENST00000343320.6_Missense_Mutation_p.F354S|CHIA_ENST00000451398.2_Missense_Mutation_p.F193S|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000483391.1_Missense_Mutation_p.F193S|CHIA_ENST00000430615.1_Missense_Mutation_p.F246S|CHIA_ENST00000353665.6_Missense_Mutation_p.F193S	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	354			F -> S (in dbSNP:rs2275254). {ECO:0000269|PubMed:19435888}.		apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		CACAACAAATTTGGAGGCGCC	0.502													T|||	2215	0.442292	0.3154	0.3098	5008	,	,		19337	0.38		0.5954	False		,,,				2504	0.6145				p.F354S		.											.	CHIA-91	0			c.T1061C						.	T	SER/PHE,SER/PHE	1541,2865	484.0+/-359.9	262,1017,924	84.0	78.0	80.0		737,1061	3.8	0.6	1	dbSNP_100	80	4956,3644	623.4+/-397.5	1446,2064,790	yes	missense,missense	CHIA	NM_021797.2,NM_201653.2	155,155	1708,3081,1714	CC,CT,TT		42.3721,34.975,49.9539	probably-damaging,probably-damaging	246/369,354/477	111861974	6497,6509	2203	4300	6503	SO:0001583	missense	27159	exon11			ACAAATTTGGAGG	AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.1061T>C	1.37:g.111861974T>C	ENSP00000358755:p.Phe354Ser	163	1		155	5	NM_201653	0	0	3	3	0	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	ENST00000369740.1	37	CCDS41368.1	943	0.4317765567765568	152	0.3089430894308943	136	0.3756906077348066	187	0.3269230769230769	468	0.6174142480211082	T	14.39	2.521585	0.44866	0.34975	0.576279	ENSG00000134216	ENST00000422815;ENST00000483391;ENST00000369740;ENST00000343320;ENST00000451398;ENST00000353665;ENST00000489524;ENST00000430615	T;T;T;T;T;T;T;T	0.05717	3.4;3.4;3.4;3.4;3.4;3.4;3.4;3.4	4.96	3.8	0.43715	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.417964	0.20116	N	0.098901	T	0.19248	0.0462	M	0.92122	3.275	0.30347	P	0.785122	D	0.89917	1.0	D	0.85130	0.997	T	0.12268	-1.0554	9	0.66056	D	0.02	-7.9225	9.3552	0.38161	0.1605:0.0:0.0:0.8395	rs2275254;rs17718176;rs52821641;rs58142838;rs2275254	354	Q9BZP6	CHIA_HUMAN	S	298;193;354;354;193;193;193;246	ENSP00000387671:F298S;ENSP00000436946:F193S;ENSP00000358755:F354S;ENSP00000341828:F354S;ENSP00000390476:F193S;ENSP00000338970:F193S;ENSP00000433309:F193S;ENSP00000391132:F246S	ENSP00000341828:F354S	F	+	2	0	CHIA	111663497	1.000000	0.71417	0.620000	0.29132	0.296000	0.27459	3.465000	0.53064	0.796000	0.33947	0.533000	0.62120	TTT	T|0.537;C|0.463		0.502	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030710.1		
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	0	0		9	5	NM_053055	0	0	0	2	2	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	0	0		6	4	NM_022371	0	0	0	0	0	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
C1orf106	55765	bcgsc.ca	37	1	200878026	200878026	+	Missense_Mutation	SNP	A	A	T	rs41313912	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:200878026A>T	ENST00000367342.4	+	7	1198	c.998A>T	c.(997-999)tAt>tTt	p.Y333F	C1orf106_ENST00000413687.2_Missense_Mutation_p.Y248F	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	333	Pro-rich.									endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GACCACCCCTATGAGAAGCCC	0.632													A|||	19	0.00379393	0.0008	0.0043	5008	,	,		16132	0.0		0.0139	False		,,,				2504	0.001				p.Y347F		.											.	C1orf106-93	0			c.A1040T						.	A	PHE/TYR,PHE/TYR	15,4389		0,15,2187	29.0	32.0	31.0		743,998	5.2	1.0	1	dbSNP_127	31	102,8494		0,102,4196	yes	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	22,22	0,117,6383	TT,TA,AA		1.1866,0.3406,0.9	probably-damaging,probably-damaging	248/579,333/664	200878026	117,12883	2202	4298	6500	SO:0001583	missense	55765	exon7			ACCCCTATGAGAA	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.998A>T	1.37:g.200878026A>T	ENSP00000356311:p.Tyr333Phe	153	1		133	5	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		13	0.005952380952380952	1	0.0020325203252032522	3	0.008287292817679558	0	0.0	9	0.011873350923482849	A	19.42	3.824420	0.71143	0.003406	0.011866	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.68025	-0.3;-0.27	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000001	T	0.73690	0.3619	M	0.71581	2.175	0.43351	D	0.99541	D	0.63880	0.993	D	0.72625	0.978	T	0.78809	-0.2058	10	0.56958	D	0.05	-31.5498	12.5324	0.56122	1.0:0.0:0.0:0.0	rs41313912	333	Q3KP66	CA106_HUMAN	F	333;248	ENSP00000356311:Y333F;ENSP00000392105:Y248F	ENSP00000356311:Y333F	Y	+	2	0	C1orf106	199144649	1.000000	0.71417	0.998000	0.56505	0.822000	0.46500	7.002000	0.76304	1.942000	0.56320	0.460000	0.39030	TAT	A|0.992;T|0.008		0.632	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
PLXNA2	5362	broad.mit.edu	37	1	208390763	208390763	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr1:208390763A>G	ENST00000367033.3	-	2	1262	c.505T>C	c.(505-507)Tac>Cac	p.Y169H		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	169	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		ATCACCCCGTACATGGTGCCC	0.587																																					p.Y169H		.											.	PLXNA2-92	0			c.T505C						.						168.0	169.0	168.0					1																	208390763		2203	4300	6503	SO:0001583	missense	5362	exon2			CCCCGTACATGGT	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.505T>C	1.37:g.208390763A>G	ENSP00000356000:p.Tyr169His	158	0		98	4	NM_025179	0	0	0	0	0	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	37	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	A	11.45	1.643889	0.29246	.	.	ENSG00000076356	ENST00000367033	T	0.10960	2.82	5.71	4.54	0.55810	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.170176	0.41500	D	0.000864	T	0.28962	0.0719	M	0.66939	2.045	0.58432	D	0.999995	D;D	0.69078	0.997;0.985	D;P	0.72982	0.979;0.854	T	0.00953	-1.1502	10	0.59425	D	0.04	.	11.5225	0.50560	0.714:0.2859:0.0:0.0	.	223;169	O75051-2;O75051	.;PLXA2_HUMAN	H	169	ENSP00000356000:Y169H	ENSP00000356000:Y169H	Y	-	1	0	PLXNA2	206457386	1.000000	0.71417	0.989000	0.46669	0.522000	0.34438	6.993000	0.76245	0.943000	0.37553	0.460000	0.39030	TAC	.		0.587	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
GPRIN2	9721	bcgsc.ca	37	10	46999863	46999863	+	Missense_Mutation	SNP	C	C	G	rs4445576	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr10:46999863C>G	ENST00000374317.1	+	3	1256	c.983C>G	c.(982-984)tCc>tGc	p.S328C	GPRIN2_ENST00000374314.4_Missense_Mutation_p.S328C	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	328			S -> C (in dbSNP:rs4445576).							breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						GCAGAGGCATCCCCGCTGTCA	0.652													C|||	825	0.164736	0.1021	0.3285	5008	,	,		36299	0.004		0.3042	False		,,,				2504	0.1554				p.S328C		.											.	GPRIN2-90	0			c.C983G						.	C	CYS/SER	471,3935		0,471,1732	56.0	59.0	58.0		983	3.2	0.0	10	dbSNP_111	58	2030,6570		1,2028,2271	yes	missense	GPRIN2	NM_014696.3	112	1,2499,4003	GG,GC,CC		23.6047,10.69,19.2296	probably-damaging	328/459	46999863	2501,10505	2203	4300	6503	SO:0001583	missense	9721	exon3			AGGCATCCCCGCT	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.983C>G	10.37:g.46999863C>G	ENSP00000363436:p.Ser328Cys	77	0		56	4	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	386	0.17673992673992675	56	0.11382113821138211	102	0.281767955801105	0	0.0	228	0.3007915567282322	C	11.15	1.553761	0.27739	0.1069	0.236047	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03889	3.77;3.77	3.15	3.15	0.36227	.	0.474723	0.15845	N	0.241802	T	0.00012	0.0000	L	0.51422	1.61	0.09310	N	1	D	0.65815	0.995	P	0.55824	0.785	T	0.47959	-0.9076	10	0.54805	T	0.06	.	12.1335	0.53957	0.0:1.0:0.0:0.0	rs4445576	328	O60269	GRIN2_HUMAN	C	328	ENSP00000363436:S328C;ENSP00000363433:S328C	ENSP00000363433:S328C	S	+	2	0	GPRIN2	46419869	.	.	0.005000	0.12908	0.392000	0.30506	.	.	1.788000	0.52465	0.313000	0.20887	TCC	C|0.822;G|0.178		0.652	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
WDFY4	57705	broad.mit.edu	37	10	50040722	50040722	+	Silent	SNP	C	C	A	rs12761517	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr10:50040722C>A	ENST00000325239.5	+	38	6658	c.6631C>A	c.(6631-6633)Cgg>Agg	p.R2211R	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2211						integral component of membrane (GO:0016021)		p.R2211W(2)		NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GATGCCCGGGCGGCAGGCCAA	0.522													C|||	408	0.0814696	0.0318	0.0836	5008	,	,		19204	0.002		0.1491	False		,,,				2504	0.1595				p.R2211R		.											.	WDFY4-22	2	Substitution - Missense(2)	central_nervous_system(2)	c.C6631A						.	C		72,1312		3,66,623	60.0	59.0	59.0		6631	0.6	0.7	10	dbSNP_121	59	439,2743		35,369,1187	no	coding-synonymous	WDFY4	NM_020945.1		38,435,1810	AA,AC,CC		13.7964,5.2023,11.1914		2211/3185	50040722	511,4055	692	1591	2283	SO:0001819	synonymous_variant	57705	exon39			CCCGGGCGGCAGG	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.6631C>A	10.37:g.50040722C>A		128	0		112	3	NM_020945	0	0	0	0	0	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	ENST00000325239.5	37	CCDS44385.1	179	0.08195970695970696	25	0.0508130081300813	38	0.10497237569060773	1	0.0017482517482517483	115	0.1517150395778364	C	9.268	1.044939	0.19748	0.052023	0.137964	ENSG00000128815	ENST00000312002	.	.	.	5.54	0.653	0.17828	.	.	.	.	.	T	0.00524	0.0017	.	.	.	0.20074	P	0.9999330134	.	.	.	.	.	.	T	0.32877	-0.9890	3	.	.	.	.	14.1056	0.65088	0.5696:0.4304:0.0:0.0	rs12761517;rs17772129;rs12761517	.	.	.	E	1301	.	.	A	+	2	0	WDFY4	49710728	0.101000	0.21875	0.745000	0.31077	0.989000	0.77384	-0.004000	0.12878	0.327000	0.23409	0.655000	0.94253	GCG	A|0.092;C|0.908;T|0.000		0.522	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
MUC2	4583	hgsc.bcm.edu	37	11	1093255	1093255	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr11:1093255G>A	ENST00000441003.2	+	30	5101	c.5074G>A	c.(5074-5076)Ggc>Agc	p.G1692S	MUC2_ENST00000359061.5_Missense_Mutation_p.G1659S|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.632																																					p.G1692S		.											.	MUC2-90	0			c.G5074A						.						103.0	146.0	130.0					11																	1093255		1824	3301	5125	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5074G>A	11.37:g.1093255G>A	ENSP00000415183:p.Gly1692Ser	97	0		75	5	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	2.038	-0.420660	0.04734	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.08193	3.12;3.21	0.851	-1.7	0.08159	.	1.185760	0.07126	U	0.844791	T	0.02807	0.0084	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.42464	-0.9450	9	0.07482	T	0.82	.	1.4251	0.02321	0.4158:0.0:0.2617:0.3225	.	1692	E7EUV1	.	S	1692;1659	ENSP00000415183:G1692S;ENSP00000351956:G1659S	ENSP00000351956:G1659S	G	+	1	0	MUC2	1083255	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.153000	0.10144	-0.885000	0.03971	-1.109000	0.02080	GGC	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
WT1	7490	broad.mit.edu	37	11	32417887	32417887	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr11:32417887G>A	ENST00000379079.2	-	7	802	c.529C>T	c.(529-531)Cgc>Tgc	p.R177C	WT1_ENST00000530998.1_Missense_Mutation_p.R160C|WT1_ENST00000332351.3_Missense_Mutation_p.R389C|WT1_ENST00000448076.3_Missense_Mutation_p.R389C	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	321					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			ATGAAGGGGCGTTTCTCACTG	0.537			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																												p.R389C		.	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	.	WT1-6891	0			c.C1165T						.						134.0	114.0	121.0					11																	32417887		2202	4299	6501	SO:0001583	missense	7490	exon7	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated	AGGGGCGTTTCTC		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.529C>T	11.37:g.32417887G>A	ENSP00000368370:p.Arg177Cys	120	0		71	3	NM_024424	0	0	0	0	0	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	ENST00000379079.2	37	CCDS55751.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.605282|4.605282	0.87157|0.87157	.|.	.|.	ENSG00000184937|ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076|ENST00000527882	D;D;D;D;D|.	0.89810|.	-2.57;-2.57;-2.57;-2.57;-2.57|.	6.17|6.17	6.17|6.17	0.99709|0.99709	Wilm&apos (1);s tumour protein, N-terminal (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	0.000000|.	0.64402|.	U|.	0.000004|.	T|T	0.70727|0.70727	0.3257|0.3257	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.91635|.	0.998;0.999;0.998;0.999;0.998|.	T|T	0.66658|0.66658	-0.5868|-0.5868	10|5	0.87932|.	D|.	0|.	.|.	15.581|15.581	0.76439|0.76439	0.0:0.0:0.8623:0.1377|0.0:0.0:0.8623:0.1377	.|.	377;321;394;160;177|.	P19544-8;P19544;P19544-7;B3KSA5;P19544-6|.	.;WT1_HUMAN;.;.;.|.	C|M	177;389;160;372;389|79	ENSP00000368370:R177C;ENSP00000331327:R389C;ENSP00000435307:R160C;ENSP00000415516:R372C;ENSP00000413452:R389C|.	ENSP00000331327:R389C|.	R|T	-|-	1|2	0|0	WT1|WT1	32374463|32374463	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.336000|4.336000	0.59304|0.59304	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CGC|ACG	.		0.537	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000095434.1	NM_000378	
CHRM1	1128	bcgsc.ca	37	11	62677220	62677220	+	Silent	SNP	G	G	A	rs2067480	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr11:62677220G>A	ENST00000306960.3	-	2	1894	c.1353C>T	c.(1351-1353)tcC>tcT	p.S451S	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	451					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	TGCGGTGCACGGAGCCAGGGC	0.657													G|||	401	0.0800719	0.0113	0.268	5008	,	,		16994	0.0843		0.0915	False		,,,				2504	0.0235				p.S451S		.											.	CHRM1-90	0			c.C1353T						.	G		95,4307	76.8+/-115.0	1,93,2107	81.0	88.0	85.0		1353	-9.1	0.0	11	dbSNP_96	85	776,7820	183.7+/-231.9	40,696,3562	no	coding-synonymous	CHRM1	NM_000738.2		41,789,5669	AA,AG,GG		9.0275,2.1581,6.701		451/461	62677220	871,12127	2201	4298	6499	SO:0001819	synonymous_variant	1128	exon2			GTGCACGGAGCCA	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.1353C>T	11.37:g.62677220G>A		127	0		82	4	NM_000738	0	0	0	0	0	Q96RH1	Silent	SNP	ENST00000306960.3	37	CCDS8040.1																																																																																			G|0.931;A|0.069		0.657	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396178.1	NM_000738	
ZNHIT2	741	hgsc.bcm.edu	37	11	64884742	64884742	+	Silent	SNP	C	C	G			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr11:64884742C>G	ENST00000310597.4	-	1	428	c.384G>C	c.(382-384)ccG>ccC	p.P128P	AP003068.12_ENST00000527789.1_RNA	NM_014205.2	NP_055020.1	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT-type containing 2	128							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						TCCACCACCACGGCCGCCATG	0.716																																					p.P128P		.											.	ZNHIT2-153	0			c.G384C						.						6.0	9.0	8.0					11																	64884742		1837	3775	5612	SO:0001819	synonymous_variant	741	exon1			CCACCACGGCCGC		CCDS8094.1	11q13	2012-08-08	2010-09-15	2004-07-14	ENSG00000174276	ENSG00000174276		"""Zinc fingers, HIT-type"""	1177	protein-coding gene	gene with protein product		604575	"""chromosome 11 open reading frame 5"", ""zinc finger, HIT domain containing 2"""	C11orf5			Standard	NM_014205		Approved	FON	uc001ocw.3	Q9UHR6	OTTHUMG00000165604	ENST00000310597.4:c.384G>C	11.37:g.64884742C>G		1	0		5	5	NM_014205	0	0	0	23	23	Q3SY14|Q8IUV0	Silent	SNP	ENST00000310597.4	37	CCDS8094.1																																																																																			.		0.716	ZNHIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385260.1	NM_014205	
ROBO3	64221	broad.mit.edu	37	11	124740559	124740559	+	Missense_Mutation	SNP	C	C	T	rs151168595	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr11:124740559C>T	ENST00000397801.1	+	6	1160	c.968C>T	c.(967-969)aCg>aTg	p.T323M	ROBO3_ENST00000538940.1_Missense_Mutation_p.T301M	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	323	Ig-like C2-type 3.				axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GATGAGGGAACGTACACCTGT	0.607													C|||	12	0.00239617	0.0	0.0029	5008	,	,		19829	0.0		0.003	False		,,,				2504	0.0072				p.T323M		.											.	ROBO3-113	0			c.C968T						.	C	MET/THR	2,4314		0,2,2156	51.0	56.0	55.0		968	4.2	0.8	11	dbSNP_134	55	17,8483		0,17,4233	yes	missense	ROBO3	NM_022370.3	81	0,19,6389	TT,TC,CC		0.2,0.0463,0.1483	possibly-damaging	323/1387	124740559	19,12797	2158	4250	6408	SO:0001583	missense	64221	exon6			AGGGAACGTACAC	AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.968C>T	11.37:g.124740559C>T	ENSP00000380903:p.Thr323Met	239	1		245	8	NM_022370	0	0	0	0	0		Missense_Mutation	SNP	ENST00000397801.1	37	CCDS44755.1	4	0.0018315018315018315	0	0.0	1	0.0027624309392265192	0	0.0	3	0.00395778364116095	C	19.91	3.914247	0.72983	4.63E-4	0.002	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.68181	-0.31;-0.31	4.21	4.21	0.49690	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.37715	N	0.001972	T	0.74786	0.3762	L	0.50919	1.6	0.80722	D	1	D	0.69078	0.997	P	0.62491	0.903	T	0.74355	-0.3692	10	0.37606	T	0.19	.	16.7004	0.85348	0.0:1.0:0.0:0.0	.	323	Q96MS0	ROBO3_HUMAN	M	323;301	ENSP00000380903:T323M;ENSP00000441797:T301M	ENSP00000380903:T323M	T	+	2	0	ROBO3	124245769	1.000000	0.71417	0.796000	0.32109	0.682000	0.39822	5.821000	0.69257	2.344000	0.79699	0.462000	0.41574	ACG	C|0.998;T|0.002		0.607	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387091.1	XM_370663	
APOLD1	81575	hgsc.bcm.edu	37	12	12939892	12939892	+	Missense_Mutation	SNP	G	G	A	rs4763876	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr12:12939892G>A	ENST00000326765.6	+	2	216	c.146G>A	c.(145-147)cGg>cAg	p.R49Q	APOLD1_ENST00000356591.4_Missense_Mutation_p.R18Q	NM_001130415.1	NP_001123887.1	Q96LR9	APLD1_HUMAN	apolipoprotein L domain containing 1	49	Arg-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|endothelial cell activation (GO:0042118)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|regulation of endothelial cell differentiation (GO:0045601)|response to hypoxia (GO:0001666)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	5		Prostate(47;0.0632)		BRCA - Breast invasive adenocarcinoma(232;0.0338)|GBM - Glioblastoma multiforme(207;0.149)		GACGCGCTGCGGCGCTTCCAG	0.771													G|||	290	0.0579073	0.0038	0.1527	5008	,	,		11940	0.0278		0.0736	False		,,,				2504	0.0787				p.R49Q		.											.	APOLD1-91	0			c.G146A						.	G	GLN/ARG,GLN/ARG	17,1923		1,15,954	1.0	1.0	1.0		146,53	4.9	1.0	12	dbSNP_111	1	243,4437		1,241,2098	no	missense,missense	APOLD1	NM_001130415.1,NM_030817.2	43,43	2,256,3052	AA,AG,GG		5.1923,0.8763,3.9275	probably-damaging,probably-damaging	49/280,18/249	12939892	260,6360	970	2340	3310	SO:0001583	missense	81575	exon2			CGCTGCGGCGCTT	AL136783	CCDS8654.1, CCDS44833.1	12p13.2	2006-02-03	2006-01-23		ENSG00000178878	ENSG00000178878			25268	protein-coding gene	gene with protein product		612456				11230166	Standard	NM_030817		Approved	FLJ25138, DKFZP434F0318	uc001rau.4	Q96LR9	OTTHUMG00000153561	ENST00000326765.6:c.146G>A	12.37:g.12939892G>A	ENSP00000324277:p.Arg49Gln	0	0		10	6	NM_001130415	0	0	0	1	1	Q8IVR2|Q9H0I5	Missense_Mutation	SNP	ENST00000326765.6	37	CCDS44833.1	125	0.05723443223443223	3	0.006097560975609756	45	0.12430939226519337	16	0.027972027972027972	61	0.08047493403693931	G	21.6	4.179961	0.78564	0.008763	0.051923	ENSG00000178878	ENST00000326765;ENST00000356591	T;T	0.01347	4.99;4.99	4.94	4.94	0.65067	.	0.080970	0.50627	U	0.000113	T	0.00039	0.0001	L	0.32530	0.975	0.34201	P	0.32682599999999995	P;P	0.47910	0.82;0.902	B;B	0.42959	0.21;0.403	T	0.55829	-0.8079	9	0.56958	D	0.05	-17.5552	9.1508	0.36962	0.1061:0.0:0.8939:0.0	rs4763876	18;49	A0AVN6;Q96LR9	.;APLD1_HUMAN	Q	49;18	ENSP00000324277:R49Q;ENSP00000348998:R18Q	ENSP00000324277:R49Q	R	+	2	0	APOLD1	12831159	0.996000	0.38824	0.995000	0.50966	0.635000	0.38103	2.225000	0.42954	2.454000	0.82982	0.579000	0.79373	CGG	G|0.943;A|0.057		0.771	APOLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331627.1	NM_030817	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		280	26		345	23	NM_032704	0	1	307	920	612		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
MARCH9	92979	hgsc.bcm.edu	37	12	58149446	58149446	+	Silent	SNP	C	C	T	rs1689582	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr12:58149446C>T	ENST00000266643.5	+	1	566	c.135C>T	c.(133-135)ggC>ggT	p.G45G	MARCH9_ENST00000548358.1_5'Flank	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	45					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			ccTTCGCTGGCTGCTCCACCC	0.801													C|||	4639	0.926318	0.789	0.9755	5008	,	,		3828	0.998		0.999	False		,,,				2504	0.9284				p.G45G		.											.	MARCH9-492	0			c.C135T						.						1.0	1.0	1.0					12																	58149446		343	936	1279	SO:0001819	synonymous_variant	92979	exon1			CGCTGGCTGCTCC	BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.135C>T	12.37:g.58149446C>T		0	0		4	4	NM_138396	0	0	0	0	0	B2R9U9|Q86VN5|Q96GG2	Silent	SNP	ENST00000266643.5	37	CCDS31847.1																																																																																			T|0.004;G|0.064		0.801	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409244.1	NM_138396	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337183	96337183	+	Missense_Mutation	SNP	A	A	G	rs7955450	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr12:96337183A>G	ENST00000266736.2	+	1	113	c.7A>G	c.(7-9)Agc>Ggc	p.S3G	CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank|CCDC38_ENST00000549752.1_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	3			S -> G (in dbSNP:rs7955450). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15221005, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16541075}.		cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						CGACATGGCAAGCGGCCACAG	0.736													G|||	3598	0.71845	0.702	0.6888	5008	,	,		10480	0.9554		0.6004	False		,,,				2504	0.6391				p.S3G		.											.	AMDHD1-90	0			c.A7G						.						2.0	3.0	3.0					12																	96337183		1177	2379	3556	SO:0001583	missense	144193	exon1			ATGGCAAGCGGCC	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.7A>G	12.37:g.96337183A>G	ENSP00000266736:p.Ser3Gly	0	0		12	12	NM_152435	0	0	0	1	1	A8K463|Q68CI8	Missense_Mutation	SNP	ENST00000266736.2	37	CCDS9057.1	1561	0.7147435897435898	348	0.7073170731707317	233	0.643646408839779	540	0.9440559440559441	440	0.5804749340369393	G	5.553	0.286982	0.10513	.	.	ENSG00000139344	ENST00000266736	T	0.30714	1.52	4.39	-8.69	0.00855	.	0.734274	0.13810	N	0.361153	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28427	-1.0044	9	0.21540	T	0.41	.	1.8829	0.03231	0.44:0.0902:0.1959:0.2739	rs7955450;rs17856824;rs58541549;rs7955450	3	Q96NU7	HUTI_HUMAN	G	3	ENSP00000266736:S3G	ENSP00000266736:S3G	S	+	1	0	AMDHD1	94861314	0.000000	0.05858	0.000000	0.03702	0.134000	0.20937	-0.592000	0.05747	-2.316000	0.00645	-1.140000	0.01884	AGC	A|0.273;G|0.727		0.736	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
BTBD11	121551	hgsc.bcm.edu	37	12	107713511	107713511	+	Missense_Mutation	SNP	G	G	C	rs961498	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr12:107713511G>C	ENST00000280758.5	+	1	1322	c.794G>C	c.(793-795)gGg>gCg	p.G265A	BTBD11_ENST00000420571.2_Missense_Mutation_p.G265A|BTBD11_ENST00000490090.2_Missense_Mutation_p.G265A	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	265						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGTGGCCCTGGGTCAGGCTCG	0.751													G|||	1975	0.394369	0.2194	0.4539	5008	,	,		9398	0.4127		0.492	False		,,,				2504	0.4693				p.G265A		.											.	BTBD11-93	0			c.G794C						.	G	ALA/GLY	786,2720		135,516,1102	5.0	3.0	3.0		794	4.2	0.1	12	dbSNP_86	3	2882,3822		730,1422,1200	no	missense	BTBD11	NM_001018072.1	60	865,1938,2302	CC,CG,GG		42.9893,22.4187,35.9256	benign	265/1105	107713511	3668,6542	1753	3352	5105	SO:0001583	missense	121551	exon1			GCCCTGGGTCAGG	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.794G>C	12.37:g.107713511G>C	ENSP00000280758:p.Gly265Ala	0	0		8	8	NM_001018072	0	0	0	0	0	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	ENST00000280758.5	37	CCDS31893.1	899	0.4116300366300366	119	0.241869918699187	158	0.43646408839779005	241	0.42132867132867136	381	0.5026385224274407	G	11.75	1.731449	0.30684	0.224187	0.429893	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090	T;T;T	0.33865	1.39;1.48;1.43	4.15	4.15	0.48705	Histone-fold (1);	0.272599	0.26478	N	0.024144	T	0.00012	0.0000	L	0.52905	1.665	0.09310	P	1.0	B;B;B	0.28971	0.229;0.088;0.143	B;B;B	0.29176	0.099;0.017;0.061	T	0.47898	-0.9081	9	0.54805	T	0.06	.	13.8733	0.63634	0.0:0.0:1.0:0.0	rs961498	265;265;265	A6QL63-2;A6QL63;A6QL63-3	.;BTBDB_HUMAN;.	A	265	ENSP00000280758:G265A;ENSP00000413889:G265A;ENSP00000447319:G265A	ENSP00000280758:G265A	G	+	2	0	BTBD11	106237641	0.973000	0.33851	0.080000	0.20451	0.808000	0.45660	2.685000	0.46959	2.308000	0.77769	0.549000	0.68633	GGG	G|0.588;C|0.412		0.751	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
ACACB	32	bcgsc.ca	37	12	109673448	109673448	+	Missense_Mutation	SNP	A	A	T	rs113524436	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr12:109673448A>T	ENST00000338432.7	+	33	4561	c.4442A>T	c.(4441-4443)gAt>gTt	p.D1481V	ACACB_ENST00000377854.5_Missense_Mutation_p.D1411V|ACACB_ENST00000543201.1_Missense_Mutation_p.D147V|ACACB_ENST00000377848.3_Missense_Mutation_p.D1481V			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1481					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AGAGCAAGAGATGAGGTATGG	0.393													A|||	10	0.00199681	0.0	0.0014	5008	,	,		20150	0.0		0.005	False		,,,				2504	0.0041				p.D1481V		.											.	ACACB-98	0			c.A4442T						.	A	VAL/ASP	14,4392	21.2+/-45.6	0,14,2189	122.0	114.0	117.0		4442	5.0	1.0	12	dbSNP_132	117	110,8490	59.1+/-120.7	0,110,4190	yes	missense	ACACB	NM_001093.3	152	0,124,6379	TT,TA,AA		1.2791,0.3177,0.9534	probably-damaging	1481/2459	109673448	124,12882	2203	4300	6503	SO:0001583	missense	32	exon32			CAAGAGATGAGGT	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.4442A>T	12.37:g.109673448A>T	ENSP00000341044:p.Asp1481Val	58	0		52	4	NM_001093	0	0	0	0	0	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	37	CCDS31898.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	A	21.5	4.155187	0.78114	0.003177	0.012791	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027;ENST00000543201	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.0	5.0	0.66597	Acetyl-CoA carboxylase, central domain (1);	0.044223	0.85682	D	0.000000	T	0.62720	0.2451	M	0.83953	2.67	0.80722	D	1	D	0.57899	0.981	D	0.69142	0.962	T	0.71699	-0.4514	10	0.54805	T	0.06	.	14.6768	0.68986	1.0:0.0:0.0:0.0	.	1481	O00763	ACACB_HUMAN	V	1481;1481;1411;712;147	ENSP00000341044:D1481V;ENSP00000367079:D1481V;ENSP00000367085:D1411V;ENSP00000444075:D147V	ENSP00000341044:D1481V	D	+	2	0	ACACB	108157831	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	9.224000	0.95209	2.021000	0.59480	0.496000	0.49642	GAT	A|0.992;T|0.008		0.393	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
DNAJC15	29103	bcgsc.ca	37	13	43597865	43597865	+	Missense_Mutation	SNP	A	A	G	rs12015	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr13:43597865A>G	ENST00000379221.2	+	1	527	c.103A>G	c.(103-105)Aga>Gga	p.R35G	DNAJC15_ENST00000474320.1_3'UTR	NM_013238.2	NP_037370.2	Q9Y5T4	DJC15_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 15	35			R -> G (in dbSNP:rs11617079). {ECO:0000269|PubMed:11358853, ECO:0000269|PubMed:15489334}.		cellular response to starvation (GO:0009267)|negative regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902957)|negative regulation of protein complex assembly (GO:0031333)|protein transport (GO:0015031)|regulation of lipid metabolic process (GO:0019216)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(1)|urinary_tract(1)	4		Lung NSC(96;4.3e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0737)		CGACCAGCAGAGACTGGTGAG	0.632													G|||	1181	0.235823	0.4281	0.2219	5008	,	,		8065	0.1002		0.2535	False		,,,				2504	0.1074				p.R35G		.											.	DNAJC15-650	0			c.A103G						.	G	GLY/ARG	1795,2609		375,1045,782	19.0	20.0	20.0		103	0.6	0.0	13	dbSNP_120	20	2062,6538		279,1504,2517	yes	missense	DNAJC15	NM_013238.2	125	654,2549,3299	GG,GA,AA		23.9767,40.7584,29.6601	benign	35/151	43597865	3857,9147	2202	4300	6502	SO:0001583	missense	29103	exon1			CAGCAGAGACTGG	AF126743	CCDS9388.1	13q14.1	2011-09-02	2005-06-30	2005-06-30	ENSG00000120675	ENSG00000120675		"""Heat shock proteins / DNAJ (HSP40)"""	20325	protein-coding gene	gene with protein product		615339	"""DnaJ (Hsp40) homolog, subfamily D, member 1"""	DNAJD1		11358853	Standard	NM_013238		Approved	MCJ	uc001uyy.3	Q9Y5T4	OTTHUMG00000016813	ENST00000379221.2:c.103A>G	13.37:g.43597865A>G	ENSP00000368523:p.Arg35Gly	123	0		138	5	NM_013238	0	0	0	0	0	B2R4L0|Q5T219|Q6X963	Missense_Mutation	SNP	ENST00000379221.2	37	CCDS9388.1	521	0.23855311355311357	180	0.36585365853658536	79	0.21823204419889503	65	0.11363636363636363	197	0.2598944591029024	G	5.877	0.345947	0.11126	0.407584	0.239767	ENSG00000120675	ENST00000379221	T	0.44881	0.91	4.56	0.561	0.17285	.	0.816791	0.11028	N	0.607571	T	0.00012	0.0000	N	0.01168	-0.975	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.46582	-0.9181	9	0.19590	T	0.45	-19.9861	4.356	0.11178	0.4233:0.1645:0.4122:0.0	rs11617079;rs17856341;rs59811457;rs11617079	35	Q9Y5T4	DJC15_HUMAN	G	35	ENSP00000368523:R35G	ENSP00000368523:R35G	R	+	1	2	DNAJC15	42495865	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.682000	0.05185	-0.381000	0.07882	-0.166000	0.13349	AGA	A|0.726;G|0.274		0.632	DNAJC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044709.2	NM_013238	
IRS2	8660	hgsc.bcm.edu	37	13	110435728	110435728	+	Silent	SNP	C	C	G	rs75172981	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr13:110435728C>G	ENST00000375856.3	-	1	3187	c.2673G>C	c.(2671-2673)acG>acC	p.T891T		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	891					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GGGACAGGCGCGTGGGCCTCA	0.721													.|||	135	0.0269569	0.0023	0.0663	5008	,	,		7040	0.0367		0.0278	False		,,,				2504	0.0215				p.T891T	Melanoma(100;613 2409 40847)	.											.	IRS2-1334	0			c.G2673C						.	C		15,4041		0,15,2013	4.0	5.0	4.0		2673	-1.7	1.0	13	dbSNP_131	4	205,7881		2,201,3840	no	coding-synonymous	IRS2	NM_003749.2		2,216,5853	GG,GC,CC		2.5352,0.3698,1.8119		891/1339	110435728	220,11922	2028	4043	6071	SO:0001819	synonymous_variant	8660	exon1			CAGGCGCGTGGGC	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.2673G>C	13.37:g.110435728C>G		0	0		8	5	NM_003749	0	0	0	1	1	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																			C|0.970;G|0.030		0.721	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
SPACA7	122258	broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	113055396	113055396	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr13:113055396T>A	ENST00000283550.3	+	5	430	c.363T>A	c.(361-363)aaT>aaA	p.N121K	SPACA7_ENST00000375699.3_Missense_Mutation_p.N90K	NM_145248.4	NP_660291.2	Q96KW9	SPAC7_HUMAN	sperm acrosome associated 7	121						acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)				large_intestine(5)|lung(4)|skin(3)|urinary_tract(1)	13						ccaatgctaatgcaaatctcc	0.403																																					p.N121K		.											.	SPACA7-154	0			c.T363A						.						119.0	105.0	110.0					13																	113055396		2203	4300	6503	SO:0001583	missense	122258	exon5			TGCTAATGCAAAT	BC016750	CCDS9524.1	13q34	2013-10-11	2011-03-15	2011-03-15	ENSG00000153498	ENSG00000153498			29575	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 28"""	C13orf28		22495889	Standard	NM_145248		Approved		uc001vsd.2	Q96KW9	OTTHUMG00000017365	ENST00000283550.3:c.363T>A	13.37:g.113055396T>A	ENSP00000283550:p.Asn121Lys	74	1		91	31	NM_145248	0	0	0	0	0	Q5T8L1	Missense_Mutation	SNP	ENST00000283550.3	37	CCDS9524.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.823084	0.32237	.	.	ENSG00000153498	ENST00000283550;ENST00000443541;ENST00000375699	T;T;T	0.46819	0.86;0.86;0.86	2.53	-1.69	0.08186	.	.	.	.	.	T	0.26666	0.0652	N	0.24115	0.695	0.09310	N	1	B	0.16603	0.018	B	0.15052	0.012	T	0.17745	-1.0359	9	0.44086	T	0.13	-0.0115	2.178	0.03867	0.2335:0.2944:0.0:0.4721	.	121	Q96KW9	SPAC7_HUMAN	K	121;107;90	ENSP00000283550:N121K;ENSP00000406733:N107K;ENSP00000364851:N90K	ENSP00000283550:N121K	N	+	3	2	SPACA7	112103397	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.700000	0.01905	-0.334000	0.08463	-0.669000	0.03829	AAT	.		0.403	SPACA7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045820.2	NM_145248	
CPNE6	9362	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	24546115	24546115	+	Missense_Mutation	SNP	G	G	A	rs201909603		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr14:24546115G>A	ENST00000397016.2	+	15	1504	c.1193G>A	c.(1192-1194)cGt>cAt	p.R398H	CPNE6_ENST00000537691.1_Missense_Mutation_p.R453H|CPNE6_ENST00000216775.2_Missense_Mutation_p.R398H	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	398	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		GCCTCCTACCGTCGTTGCCTG	0.607																																					p.R398H		.											.	CPNE6-93	0			c.G1193A						.						79.0	71.0	74.0					14																	24546115		2203	4300	6503	SO:0001583	missense	9362	exon14			CCTACCGTCGTTG	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1193G>A	14.37:g.24546115G>A	ENSP00000380211:p.Arg398His	69	0		98	8	NM_006032	0	0	0	0	0	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	ENST00000397016.2	37	CCDS9607.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730839	0.48939	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.25912	1.77;1.77;1.77	5.08	5.08	0.68730	von Willebrand factor, type A (2);Copine (1);	0.000000	0.56097	D	0.000025	T	0.33644	0.0870	L	0.47716	1.5	0.46499	D	0.999075	B;D;D	0.65815	0.282;0.985;0.995	B;P;P	0.57911	0.041;0.734;0.829	T	0.02736	-1.1117	10	0.22109	T	0.4	-42.2874	9.5731	0.39440	0.0958:0.0:0.9042:0.0	.	453;223;398	F5GXN1;B3KWK1;O95741	.;.;CPNE6_HUMAN	H	453;398;398	ENSP00000440077:R453H;ENSP00000380211:R398H;ENSP00000216775:R398H	ENSP00000216775:R398H	R	+	2	0	CPNE6	23615955	0.995000	0.38212	0.992000	0.48379	0.979000	0.70002	2.919000	0.48836	2.353000	0.79882	0.563000	0.77884	CGT	G|0.999;A|0.001		0.607	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071869.5		
TGM1	7051	bcgsc.ca	37	14	24729687	24729687	+	Silent	SNP	C	C	T	rs35755034	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr14:24729687C>T	ENST00000206765.6	-	4	849	c.726G>A	c.(724-726)gaG>gaA	p.E242E	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	242					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GGATGTAGATCTCATTGCGGG	0.587													C|||	291	0.058107	0.0923	0.0231	5008	,	,		20751	0.0754		0.0199	False		,,,				2504	0.0583				p.E242E		.											.	TGM1-91	0			c.G726A						.	C		445,3961	215.8+/-234.7	19,407,1777	103.0	90.0	95.0		726	3.6	1.0	14	dbSNP_126	95	196,8404	85.6+/-148.0	3,190,4107	no	coding-synonymous	TGM1	NM_000359.2		22,597,5884	TT,TC,CC		2.2791,10.0999,4.9285		242/818	24729687	641,12365	2203	4300	6503	SO:0001819	synonymous_variant	7051	exon4			GTAGATCTCATTG	D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.726G>A	14.37:g.24729687C>T		101	0		162	6	NM_000359	0	0	0	0	0	B4DWR7|Q197M4	Silent	SNP	ENST00000206765.6	37	CCDS9622.1																																																																																			C|0.952;T|0.048		0.587	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073160.6	NM_000359	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	4	0		41	13	NM_001127258	0	0	0	0	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		0	0		9	9	NM_001823	0	0	0	51	51	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
C14orf180	400258	hgsc.bcm.edu	37	14	105054934	105054934	+	Silent	SNP	A	A	G	rs12880814	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr14:105054934A>G	ENST00000557649.1	+	5	633	c.297A>G	c.(295-297)ccA>ccG	p.P99P	C14orf180_ENST00000410013.1_Silent_p.P99P|C14orf180_ENST00000331952.2_Intron|RP11-614O9.1_ENST00000556073.1_RNA			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		GGCCCAGGCCACACGGCGGCT	0.731													A|||	2110	0.421326	0.7436	0.2911	5008	,	,		14114	0.6002		0.0994	False		,,,				2504	0.2249				p.P99P		.											.	C14orf180-492	0			c.A297G						.	A		1749,1969		425,899,535	4.0	4.0	4.0		297	-2.2	0.0	14	dbSNP_121	4	533,6777		29,475,3151	no	coding-synonymous	C14orf180	NM_001008404.1		454,1374,3686	GG,GA,AA		7.2914,47.0414,20.6928		99/161	105054934	2282,8746	1859	3655	5514	SO:0001819	synonymous_variant	400258	exon5			CAGGCCACACGGC		CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	ENST00000557649.1:c.297A>G	14.37:g.105054934A>G		0	0		12	12	NM_001008404	0	0	0	0	0		Silent	SNP	ENST00000557649.1	37	CCDS32166.1																																																																																			A|0.615;G|0.385		0.731	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410580.1	NM_001008404	
C14orf180	400258	hgsc.bcm.edu	37	14	105055119	105055127	+	Stop_Codon_Del	DEL	GACGGGCAG	GACGGGCAG	-	rs111285011|rs569942489|rs11278058	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	GACGGGCAG	GACGGGCAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr14:105055119_105055127delGACGGGCAG	ENST00000557649.1	+	0	818_826				C14orf180_ENST00000410013.1_Stop_Codon_Del|C14orf180_ENST00000331952.2_In_Frame_Del_p.TGR153del|RP11-614O9.1_ENST00000556073.1_RNA			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		CTGCGGCTCTgacgggcaggacgggcagg	0.718														3012	0.601438	0.8079	0.6095	5008	,	,		14598	0.6954		0.4235	False		,,,				2504	0.4029				p.161_161del		.											.	C14orf180-492	0			c.482_784del						.			1070,740		494,82,329						3.0	0.1		dbSNP_132	3	1279,3127		502,275,1426	no	coding	C14orf180	NM_001008404.1		996,357,1755	A1A1,A1R,RR		29.0286,40.884,37.7896				2349,3867				SO:0001567	stop_retained_variant	400258	exon5			GGCTCTGACGGGC		CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	Exception_encountered	14.37:g.105055128_105055136delGACGGGCAG		1	0		28	6	NM_001008404	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000557649.1	37	CCDS32166.1																																																																																			-|1.000;|0.000		0.718	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410580.1	NM_001008404	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		16	16	NM_171846	0	0	0	2	2	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
KBTBD13	390594	hgsc.bcm.edu	37	15	65369395	65369395	+	Missense_Mutation	SNP	C	C	T	rs2919358	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr15:65369395C>T	ENST00000432196.2	+	1	242	c.242C>T	c.(241-243)gCc>gTc	p.A81V	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	81					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						CTGCTGCAGGCCGTGGAGTGC	0.736													C|||	2613	0.521765	0.6036	0.5447	5008	,	,		9840	0.7312		0.3887	False		,,,				2504	0.316				p.A81V		.											.	.	0			c.C242T						.	C	VAL/ALA	1463,1441		405,653,394	2.0	3.0	2.0		242	4.6	1.0	15	dbSNP_101	2	2172,4110		500,1172,1469	no	missense	KBTBD13	NM_001101362.2	64	905,1825,1863	TT,TC,CC		34.575,49.6212,39.5711	possibly-damaging	81/459	65369395	3635,5551	1452	3141	4593	SO:0001583	missense	390594	exon1			TGCAGGCCGTGGA		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.242C>T	15.37:g.65369395C>T	ENSP00000388723:p.Ala81Val	0	0		11	6	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	1197	0.5480769230769231	302	0.6138211382113821	191	0.5276243093922652	410	0.7167832167832168	294	0.38786279683377306	C	20.9	4.061996	0.76187	0.503788	0.34575	ENSG00000234438	ENST00000432196	T	0.67865	-0.29	4.6	4.6	0.57074	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.00012	0.0000	N	0.21324	0.655	0.22629	P	0.99891774	P	0.47034	0.889	P	0.50896	0.653	T	0.37753	-0.9692	8	0.26408	T	0.33	.	17.2241	0.86964	0.0:1.0:0.0:0.0	rs2919358	81	C9JR72	KBTBD_HUMAN	V	81	ENSP00000388723:A81V	ENSP00000388723:A81V	A	+	2	0	KBTBD13	63156448	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	7.251000	0.78297	2.390000	0.81377	0.650000	0.86243	GCC	C|0.452;T|0.548		0.736	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79066581	79066581	+	Silent	SNP	G	G	A	rs74405922	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr15:79066581G>A	ENST00000388820.4	-	13	2148	c.1938C>T	c.(1936-1938)gaC>gaT	p.D646D	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	646	Cys-rich.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGACCACGGCGTCCCGCAGCT	0.627													G|||	515	0.102835	0.0	0.2118	5008	,	,		17155	0.3562		0.0	False		,,,				2504	0.0092				p.D646D		.											.	ADAMTS7-226	0			c.C1938T						.	G		9,4167		0,9,2079	18.0	15.0	16.0		1938	1.2	1.0	15	dbSNP_131	16	9,7997		0,9,3994	no	coding-synonymous	ADAMTS7	NM_014272.3		0,18,6073	AA,AG,GG		0.1124,0.2155,0.1478		646/1687	79066581	18,12164	2088	4003	6091	SO:0001819	synonymous_variant	11173	exon13			CACGGCGTCCCGC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1938C>T	15.37:g.79066581G>A		1	0		5	4	NM_014272	0	0	0	2	2	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																			G|0.946;A|0.054		0.627	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
MEFV	4210	hgsc.bcm.edu	37	16	3304626	3304626	+	Missense_Mutation	SNP	C	C	G	rs3743930	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr16:3304626C>G	ENST00000219596.1	-	2	481	c.442G>C	c.(442-444)Gag>Cag	p.E148Q	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000536379.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	148			E -> Q (in arFMF and adFMF; common mutation; associated with S-369 and Q-408 in cis; associated with I-694 in some patients; dbSNP:rs3743930). {ECO:0000269|PubMed:10364520, ECO:0000269|PubMed:10612841, ECO:0000269|PubMed:10737995, ECO:0000269|PubMed:10787449, ECO:0000269|PubMed:10854105, ECO:0000269|PubMed:16378925}.|E -> V (in arFMF). {ECO:0000269|PubMed:16378925}.		inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CTCCCGGCCTCGGGCTGGCTG	0.736													C|||	633	0.126398	0.0204	0.0115	5008	,	,		11465	0.2887		0.0089	False		,,,				2504	0.3047				p.E148Q		.											.	MEFV-228	0			c.G442C	GRCh37	CM981240	MEFV	M	rs3743930	.	C	GLN/GLU,	44,4188		0,44,2072	10.0	12.0	11.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	442,	3.4	0.1	16	dbSNP_107	11	97,8257		0,97,4080	yes	missense,intron	MEFV	NM_000243.2,NM_001198536.1	29,	0,141,6152	GG,GC,CC		1.1611,1.0397,1.1203	probably-damaging,	148/782,	3304626	141,12445	2116	4177	6293	SO:0001583	missense	4210	exon2			CGGCCTCGGGCTG	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.442G>C	16.37:g.3304626C>G	ENSP00000219596:p.Glu148Gln	0	0		18	18	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	37	CCDS10498.1	180	0.08241758241758242	15	0.03048780487804878	4	0.011049723756906077	154	0.2692307692307692	7	0.009234828496042216	C	16.28	3.077868	0.55753	0.010397	0.011611	ENSG00000103313	ENST00000545159;ENST00000219596	T	0.77098	-1.07	4.39	3.44	0.39384	.	0.131490	0.35207	N	0.003372	T	0.00039	0.0001	L	0.36672	1.1	0.37393	P	0.087472	D	0.65815	0.995	P	0.59056	0.851	T	0.03524	-1.1028	9	0.72032	D	0.01	-37.1902	8.7109	0.34382	0.0:0.898:0.0:0.102	rs3743930	148	O15553	MEFV_HUMAN	Q	148	ENSP00000219596:E148Q	ENSP00000219596:E148Q	E	-	1	0	MEFV	3244627	0.103000	0.21917	0.067000	0.19924	0.046000	0.14306	1.142000	0.31540	1.441000	0.47550	0.563000	0.77884	GAG	C|0.239;G|0.761		0.736	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		6	6	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
KCTD19	146212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67335694	67335694	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr16:67335694C>A	ENST00000304372.5	-	5	830	c.775G>T	c.(775-777)Ggt>Tgt	p.G259C	KCTD19_ENST00000562860.1_5'UTR	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	259					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GGCGACATACCCATGTTCATC	0.498																																					p.G259C		.											.	KCTD19-69	0			c.G775T						.						183.0	186.0	185.0					16																	67335694		1926	4134	6060	SO:0001630	splice_region_variant	146212	exon5			ACATACCCATGTT	AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.775+1G>T	16.37:g.67335694C>A		140	0		118	45	NM_001100915	0	0	0	0	0	B4DZ49|Q8N804	Missense_Mutation	SNP	ENST00000304372.5	37	CCDS42179.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.759124	0.69763	.	.	ENSG00000168676	ENST00000304372	T	0.61859	0.07	6.17	6.17	0.99709	.	0.156689	0.45606	D	0.000355	T	0.51975	0.1706	N	0.19112	0.55	0.46149	D	0.998895	P	0.51791	0.948	P	0.48901	0.594	T	0.44528	-0.9322	9	.	.	.	-2.8684	17.5987	0.88020	0.0:1.0:0.0:0.0	.	259	Q17RG1	KCD19_HUMAN	C	259	ENSP00000305702:G259C	.	G	-	1	0	KCTD19	65893195	1.000000	0.71417	1.000000	0.80357	0.542000	0.35054	4.334000	0.59291	2.941000	0.99782	0.655000	0.94253	GGT	.		0.498	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422061.1	XM_085367	Missense_Mutation
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		13	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
RPL13	6137	hgsc.bcm.edu	37	16	89627671	89627671	+	Silent	SNP	C	C	T	rs174035	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr16:89627671C>T	ENST00000393099.3	+	2	390	c.141C>T	c.(139-141)gcC>gcT	p.A47A	RPL13_ENST00000311528.5_Silent_p.A47A|RPL13_ENST00000452368.3_Silent_p.A47A|SNORD68_ENST00000363214.1_RNA|RPL13_ENST00000567815.1_Silent_p.A47A	NM_033251.2	NP_150254.1	P26373	RL13_HUMAN	ribosomal protein L13	47					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|cytosolic ribosome (GO:0022626)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(3)|skin(1)|upper_aerodigestive_tract(2)	6		all_hematologic(23;0.0748)		all cancers(4;1.15e-07)|OV - Ovarian serous cystadenocarcinoma(4;7.8e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0139)		GCCGCATCGCCCCGCGCCCCG	0.741													C|||	720	0.14377	0.1256	0.1282	5008	,	,		12083	0.13		0.1839	False		,,,				2504	0.1524				p.A47A		.											.	RPL13-90	0			c.C141T						.	C	,	382,2954		24,334,1310	3.0	4.0	3.0		141,141	0.9	1.0	16	dbSNP_79	3	1125,5851		71,983,2434	no	coding-synonymous,coding-synonymous	RPL13	NM_000977.3,NM_033251.2	,	95,1317,3744	TT,TC,CC		16.1267,11.4508,14.614	,	47/212,47/212	89627671	1507,8805	1668	3488	5156	SO:0001819	synonymous_variant	6137	exon3			CATCGCCCCGCGC	AB007172	CCDS10979.1, CCDS58492.1	16q24.3	2011-04-06			ENSG00000167526	ENSG00000167526		"""L ribosomal proteins"""	10303	protein-coding gene	gene with protein product		113703				9582194	Standard	NM_000977		Approved	D16S444E, BBC1, L13	uc002fnm.2	P26373	OTTHUMG00000133770	ENST00000393099.3:c.141C>T	16.37:g.89627671C>T		0	0		13	10	NM_001243131	1	1	13	254	239	B4DLX3|F5H1S2|Q3KQT8|Q567Q8|Q9BPX0	Silent	SNP	ENST00000393099.3	37	CCDS10979.1																																																																																			C|0.846;T|0.154		0.741	RPL13-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258294.2	NM_000977	
SPIRE2	84501	bcgsc.ca	37	16	89921057	89921057	+	Missense_Mutation	SNP	A	A	G	rs139065194		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr16:89921057A>G	ENST00000378247.3	+	5	932	c.889A>G	c.(889-891)Atg>Gtg	p.M297V	SPIRE2_ENST00000393062.2_Missense_Mutation_p.M297V	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	297					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		GCGCAAGGTCATGGTGAGCGG	0.652																																					p.M297V		.											.	SPIRE2-90	0			c.A889G						.	A	VAL/MET	0,4390		0,0,2195	61.0	62.0	62.0		889	5.2	1.0	16	dbSNP_134	62	1,8589	1.2+/-3.3	0,1,4294	yes	missense	SPIRE2	NM_032451.1	21	0,1,6489	GG,GA,AA		0.0116,0.0,0.0077	benign	297/715	89921057	1,12979	2195	4295	6490	SO:0001583	missense	84501	exon5			AAGGTCATGGTGA	AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.889A>G	16.37:g.89921057A>G	ENSP00000367494:p.Met297Val	131	0		138	9	NM_032451	0	0	0	0	0	A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Missense_Mutation	SNP	ENST00000378247.3	37	CCDS32516.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.040345	0.75732	0.0	1.16E-4	ENSG00000204991	ENST00000378247;ENST00000393062	T;T	0.49139	0.79;0.79	5.22	5.22	0.72569	.	0.035075	0.85682	D	0.000000	T	0.58793	0.2147	M	0.71036	2.16	0.80722	D	1	B;P;B	0.46859	0.095;0.885;0.095	B;P;B	0.51229	0.09;0.663;0.09	T	0.62779	-0.6782	10	0.54805	T	0.06	-57.4475	14.2172	0.65800	1.0:0.0:0.0:0.0	.	297;249;297	Q8WWL2-2;Q8WWL2-3;Q8WWL2	.;.;SPIR2_HUMAN	V	297	ENSP00000367494:M297V;ENSP00000376782:M297V	ENSP00000367494:M297V	M	+	1	0	SPIRE2	88448558	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.611000	0.61162	2.106000	0.64143	0.459000	0.35465	ATG	A|1.000;G|0.000		0.652	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421843.1	XM_047462	
TM4SF5	9032	broad.mit.edu;bcgsc.ca	37	17	4685848	4685848	+	Nonsense_Mutation	SNP	C	C	G			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr17:4685848C>G	ENST00000270560.3	+	3	340	c.309C>G	c.(307-309)taC>taG	p.Y103*		NM_003963.2	NP_003954.2	O14894	T4S5_HUMAN	transmembrane 4 L six family member 5	103						integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(3)|ovary(1)	6						GTGCCATCTACTGCCTCTCGG	0.597																																					p.Y103X		.											.	TM4SF5-91	0			c.C309G						.						134.0	116.0	122.0					17																	4685848		2203	4300	6503	SO:0001587	stop_gained	9032	exon3			CATCTACTGCCTC	AF027204	CCDS11054.1	17p13.3	2007-01-06	2005-03-21		ENSG00000142484	ENSG00000142484			11857	protein-coding gene	gene with protein product		604657	"""transmembrane 4 superfamily member 5"""			9479038	Standard	NM_003963		Approved		uc002fyw.1	O14894	OTTHUMG00000090776	ENST00000270560.3:c.309C>G	17.37:g.4685848C>G	ENSP00000270560:p.Tyr103*	275	1		181	17	NM_003963	0	0	0	0	0	Q17RW9|Q6IB79	Nonsense_Mutation	SNP	ENST00000270560.3	37	CCDS11054.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045725	0.75846	.	.	ENSG00000142484	ENST00000270560	.	.	.	5.36	-0.0772	0.13720	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.6809	8.9851	0.35988	0.0:0.6028:0.0:0.3972	.	.	.	.	X	103	.	ENSP00000270560:Y103X	Y	+	3	2	TM4SF5	4632595	1.000000	0.71417	0.998000	0.56505	0.907000	0.53573	1.154000	0.31688	0.022000	0.15160	-0.258000	0.10820	TAC	.		0.597	TM4SF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207558.2		
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7574023	7574023	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr17:7574023delC	ENST00000269305.4	-	10	1193	c.1004delG	c.(1003-1005)cgtfs	p.R335fs	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000445888.2_Frame_Shift_Del_p.R335fs|TP53_ENST00000359597.4_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	335	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> G (in a sporadic cancer; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R335fs*2(2)|p.R335fs*10(2)|p.R335L(1)|p.?(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAGCGCTCACGCCCACGGAT	0.522		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R335fs	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	15	Whole gene deletion(8)|Deletion - Frameshift(3)|Insertion - Frameshift(2)|Substitution - Missense(1)|Unknown(1)	large_intestine(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|upper_aerodigestive_tract(1)|stomach(1)	c.1004delG						.						53.0	42.0	46.0					17																	7574023		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon10	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGCTCACGCCCAC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1004delG	17.37:g.7574023delC	ENSP00000269305:p.Arg335fs	157	0		105	69	NM_000546	0	0	0	0	0	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.522	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DHRS11	79154	broad.mit.edu	37	17	34958405	34958405	+	IGR	SNP	A	A	C			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr17:34958405A>C	ENST00000251312.5	+	0	1598				MRM1_ENST00000250156.7_Missense_Mutation_p.T56P|MRM1_ENST00000585770.1_5'UTR	NM_024308.3	NP_077284.2	Q6UWP2	DHR11_HUMAN	dehydrogenase/reductase (SDR family) member 11							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(4)	5						GTTTGGCATGACCCCGTGTCT	0.697																																					p.T56P		.											.	MRM1-90	0			c.A166C						.						63.0	64.0	64.0					17																	34958405		2203	4300	6503	SO:0001628	intergenic_variant	79922	exon1			GGCATGACCCCGT		CCDS11315.2	17q12	2014-05-06			ENSG00000108272	ENSG00000278535		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	28639	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 24C, member 1"""					12975309, 19027726	Standard	NM_024308		Approved	MGC4172, SDR24C1	uc002hnd.3	Q6UWP2	OTTHUMG00000188442		17.37:g.34958405A>C		51	16		77	20	NM_024864	0	0	8	8	0	B2RDZ3|Q9BUC7|Q9H674	Missense_Mutation	SNP	ENST00000251312.5	37	CCDS11315.2	.	.	.	.	.	.	.	.	.	.	T	7.164	0.586358	0.13749	.	.	ENSG00000129282	ENST00000250156	T	0.29655	1.56	4.79	2.38	0.29361	RNA 2-O ribose methyltransferase, substrate binding (2);	0.121018	0.56097	D	0.000034	T	0.14270	0.0345	N	0.08118	0	0.80722	D	1	B	0.22604	0.072	B	0.21360	0.034	T	0.06391	-1.0829	10	0.66056	D	0.02	-7.1167	6.3	0.21107	0.1478:0.0:0.4096:0.4426	.	56	Q6IN84	MRM1_HUMAN	P	56	ENSP00000250156:T56P	ENSP00000250156:T56P	T	+	1	0	MRM1	32032518	1.000000	0.71417	1.000000	0.80357	0.619000	0.37552	0.998000	0.29744	0.404000	0.25506	-0.376000	0.06991	ACC	.		0.697	DHRS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256681.2	NM_024308	
KRT36	8689	bcgsc.ca	37	17	39643646	39643646	+	Missense_Mutation	SNP	G	G	A	rs2301354	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr17:39643646G>A	ENST00000328119.6	-	5	943	c.944C>T	c.(943-945)aCg>aTg	p.T315M	KRT36_ENST00000393986.2_Missense_Mutation_p.T265M	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	315	Coil 2.|Rod.		T -> M (in dbSNP:rs2301354).		regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				CGCGTTGACCGTACGTCTCAG	0.637													G|||	2426	0.484425	0.4024	0.5447	5008	,	,		19858	0.3323		0.5398	False		,,,				2504	0.6524				p.T315M		.											.	KRT36-90	0			c.C944T						.	G	MET/THR	1824,2582	531.5+/-373.2	374,1076,753	76.0	55.0	62.0		944	1.1	0.9	17	dbSNP_100	62	4702,3898	605.3+/-394.9	1277,2148,875	yes	missense	KRT36	NM_003771.4	81	1651,3224,1628	AA,AG,GG		45.3256,41.3981,49.8232	benign	315/468	39643646	6526,6480	2203	4300	6503	SO:0001583	missense	8689	exon5			TTGACCGTACGTC	Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.944C>T	17.37:g.39643646G>A	ENSP00000329165:p.Thr315Met	88	0		74	4	NM_003771	0	0	0	0	0	Q86XG4	Missense_Mutation	SNP	ENST00000328119.6	37	CCDS11395.1	992	0.4542124542124542	192	0.3902439024390244	222	0.6132596685082873	169	0.29545454545454547	409	0.5395778364116095	G	14.11	2.436719	0.43224	0.413981	0.546744	ENSG00000126337	ENST00000393986;ENST00000328119	D;D	0.89343	-2.5;-2.5	5.95	1.13	0.20643	Filament (1);	0.292907	0.24162	N	0.040964	T	0.00012	0.0000	M	0.82132	2.575	0.48288	P	3.790000000000182E-4	P	0.43826	0.818	B	0.41571	0.36	T	0.44997	-0.9291	9	0.72032	D	0.01	.	17.8773	0.88829	0.0:0.0:0.5399:0.4601	rs2301354;rs17581044;rs59835513;rs2301354	315	O76013	KRT36_HUMAN	M	265;315	ENSP00000377555:T265M;ENSP00000329165:T315M	ENSP00000329165:T315M	T	-	2	0	KRT36	36897172	0.000000	0.05858	0.929000	0.37066	0.676000	0.39594	-0.279000	0.08479	0.389000	0.25086	0.655000	0.94253	ACG	G|0.523;A|0.477		0.637	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259508.1	NM_003771	
PRKAR1A	5573	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	66511671	66511695	+	Frame_Shift_Del	DEL	AGAGACCCATGGCATTCCTCAGGGA	AGAGACCCATGGCATTCCTCAGGGA	-	rs201472242|rs281864789|rs548529083|rs145590804		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	AGAGACCCATGGCATTCCTCAGGGA	AGAGACCCATGGCATTCCTCAGGGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr17:66511671_66511695delAGAGACCCATGGCATTCCTCAGGGA	ENST00000589228.1	+	2	259_283	c.131_155delAGAGACCCATGGCATTCCTCAGGGA	c.(130-156)gagagacccatggcattcctcagggaafs	p.ERPMAFLRE44fs	PRKAR1A_ENST00000536854.2_Frame_Shift_Del_p.ERPMAFLRE44fs|PRKAR1A_ENST00000588188.2_Frame_Shift_Del_p.ERPMAFLRE44fs|PRKAR1A_ENST00000358598.2_Frame_Shift_Del_p.ERPMAFLRE44fs|PRKAR1A_ENST00000586397.1_Frame_Shift_Del_p.ERPMAFLRE44fs|PRKAR1A_ENST00000392711.1_Frame_Shift_Del_p.ERPMAFLRE44fs	NM_001276289.1|NM_001278433.1	NP_001263218.1|NP_001265362.1	P10644	KAP0_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, alpha	44	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cardiac muscle cell proliferation (GO:0060038)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|female meiotic division (GO:0007143)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sarcomere organization (GO:0045214)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			adrenal_gland(4)|breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(8)|soft_tissue(2)|stomach(2)|testis(1)|thyroid(2)|upper_aerodigestive_tract(1)	31	Breast(10;1.64e-13)					GCTCGACCTGAGAGACCCATGGCATTCCTCAGGGAATACTTTGAG	0.436			"""T, Mis, N, F, S"""	RET	papillary thyroid	"""myxoma, endocrine, papillary thyroid"""			Primary Pigmented Nodular Adrenocortical Disease, Familial;Carney Complex;Cardiac Myxomas, Familial Clustering of																												p.44_52del	Ovarian(167;637 1670 33025 39608 46699 51856)	.	yes	"""Dom, Rec"""	yes	Carney complex	17	17q23-q24	5573	"""protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)"""		"""E, M"""	.	PRKAR1A-1141	0			c.131_155del	GRCh37	CX056494	PRKAR1A	X		.																																			SO:0001589	frameshift_variant	5573	exon1	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2;Carney syndrome, NAME syndrome, LAMB syndrome, Familial Myxoma syndrome;	GACCTGAGAGACC		CCDS11678.1, CCDS62307.1	17q24.2	2014-09-17	2012-07-31		ENSG00000108946	ENSG00000108946	2.7.11.1		9388	protein-coding gene	gene with protein product	"""Carney complex type 1"""	188830	"""tissue specific extinguisher 1"""	PRKAR1, TSE1		3479018, 10973256	Standard	NM_212471		Approved	CNC1	uc002jhg.4	P10644	OTTHUMG00000180128	ENST00000589228.1:c.131_155delAGAGACCCATGGCATTCCTCAGGGA	17.37:g.66511671_66511695delAGAGACCCATGGCATTCCTCAGGGA	ENSP00000464977:p.Glu44fs	92	0		39	11	NM_001276290	0	0	0	0	0	K7ER48|Q567S7	Frame_Shift_Del	DEL	ENST00000589228.1	37	CCDS11678.1																																																																																			.		0.436	PRKAR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449884.1		
SOCS6	9306	broad.mit.edu;bcgsc.ca	37	18	67993002	67993002	+	Silent	SNP	C	C	T			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr18:67993002C>T	ENST00000397942.3	+	2	1414	c.1098C>T	c.(1096-1098)ccC>ccT	p.P366P	SOCS6_ENST00000582322.1_Silent_p.P366P	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	366					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				GTAGTGGTCCCATGGTTGTGA	0.488																																					p.P366P	Melanoma(84;1024 1361 24382 36583 42651)	.											.	SOCS6-721	0			c.C1098T						.						90.0	86.0	87.0					18																	67993002		2203	4300	6503	SO:0001819	synonymous_variant	9306	exon2			TGGTCCCATGGTT	AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.1098C>T	18.37:g.67993002C>T		215	0		180	7	NM_004232	0	0	13	13	0	Q8WUM3	Silent	SNP	ENST00000397942.3	37	CCDS11998.1																																																																																			.		0.488	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256270.2		
POLRMT	5442	hgsc.bcm.edu	37	19	621561	621561	+	Missense_Mutation	SNP	C	C	A	rs10421235	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:621561C>A	ENST00000588649.2	-	10	2221	c.2137G>T	c.(2137-2139)Gtg>Ttg	p.V713L	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	713					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTCCAGCACGCGCCCGTTG	0.741													C|||	677	0.135184	0.2254	0.0461	5008	,	,		10089	0.0764		0.0258	False		,,,				2504	0.2495				p.V713L		.											.	POLRMT-92	0			c.G2137T						.	C	LEU/VAL	447,3185		14,419,1383	4.0	3.0	3.0		2137	2.1	0.5	19	dbSNP_119	3	143,6993		2,139,3427	no	missense	POLRMT	NM_005035.3	32	16,558,4810	AA,AC,CC		2.0039,12.3073,5.4792	benign	713/1231	621561	590,10178	1816	3568	5384	SO:0001583	missense	5442	exon10			CCAGCACGCGCCC		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.2137G>T	19.37:g.621561C>A	ENSP00000465759:p.Val713Leu	0	0		18	5	NM_005035	0	0	12	12	0	O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	179	0.08195970695970696	98	0.1991869918699187	23	0.06353591160220995	41	0.07167832167832168	17	0.022427440633245383	.	1.831	-0.469877	0.04445	0.123073	0.020039	ENSG00000099821	ENST00000215591	T	0.41400	1.0	4.38	2.07	0.26955	DNA-directed RNA polymerase, helix hairpin domain (1);	0.337088	0.28971	N	0.013545	T	0.00039	0.0001	L	0.28274	0.84	0.40284	P	0.021571000000000007	B	0.21520	0.057	B	0.21708	0.036	T	0.23226	-1.0194	9	0.10636	T	0.68	-21.1616	7.9361	0.29931	0.0:0.4845:0.4232:0.0923	rs10421235	713	O00411	RPOM_HUMAN	L	713	ENSP00000215591:V713L	ENSP00000215591:V713L	V	-	1	0	POLRMT	572561	0.015000	0.18098	0.490000	0.27465	0.466000	0.32739	0.069000	0.14552	0.409000	0.25649	0.455000	0.32223	GTG	C|0.918;A|0.082		0.741	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
SHD	56961	bcgsc.ca	37	19	4280207	4280207	+	Silent	SNP	G	G	C	rs56261530	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:4280207G>C	ENST00000543264.2	+	1	1610	c.147G>C	c.(145-147)gcG>gcC	p.A49A	SHD_ENST00000599689.1_Silent_p.A49A	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	49										breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGAGGACGCGGAGAGCCGCT	0.672													G|||	171	0.0341454	0.0015	0.0389	5008	,	,		13047	0.0		0.0875	False		,,,				2504	0.0552				p.A49A		.											.	SHD-90	0			c.G147C						.	G		54,4352		0,54,2149	21.0	26.0	25.0		147	-9.2	0.0	19	dbSNP_129	25	711,7887		26,659,3614	no	coding-synonymous	SHD	NM_020209.3		26,713,5763	CC,CG,GG		8.2694,1.2256,5.8828		49/341	4280207	765,12239	2203	4299	6502	SO:0001819	synonymous_variant	56961	exon1			GGACGCGGAGAGC	BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.147G>C	19.37:g.4280207G>C		95	1		58	5	NM_020209	0	0	0	0	0	Q96NC2	Silent	SNP	ENST00000543264.2	37	CCDS12125.1																																																																																			G|0.945;C|0.055		0.672	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	NM_020209	
DUS3L	56931	bcgsc.ca	37	19	5789565	5789565	+	Missense_Mutation	SNP	T	T	C	rs2436487	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:5789565T>C	ENST00000309061.7	-	3	649	c.553A>G	c.(553-555)Agg>Ggg	p.R185G	DUS3L_ENST00000590681.1_5'UTR|DUS3L_ENST00000320699.8_Intron	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	185			R -> G (in dbSNP:rs2436487). {ECO:0000269|PubMed:15489334}.				flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						CCCTCGGGCCTCAGGTGGGCC	0.721													C|||	2304	0.460064	0.8177	0.2349	5008	,	,		13189	0.5496		0.1948	False		,,,				2504	0.317				p.R185G		.											.	DUS3L-90	0			c.A553G						.	C	,GLY/ARG	2891,1425		1024,843,291	7.0	12.0	10.0		,553	4.5	0.9	19	dbSNP_100	10	1496,6988		140,1216,2886	no	intron,missense	DUS3L	NM_001161619.1,NM_020175.2	,125	1164,2059,3177	CC,CT,TT		17.6332,33.0167,34.2734	,benign	,185/651	5789565	4387,8413	2158	4242	6400	SO:0001583	missense	56931	exon3			CGGGCCTCAGGTG		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.553A>G	19.37:g.5789565T>C	ENSP00000311977:p.Arg185Gly	9	0		41	35	NM_020175	0	0	0	4	4	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	ENST00000309061.7	37	CCDS32880.1	905	0.4143772893772894	385	0.782520325203252	93	0.2569060773480663	281	0.49125874125874125	146	0.19261213720316622	C	0.773	-0.765146	0.02996	0.669833	0.176332	ENSG00000141994	ENST00000309061	T	0.17370	2.28	4.51	4.51	0.55191	Zinc finger, CCCH-type (1);	0.127872	0.53938	N	0.000056	T	0.00012	0.0000	N	0.00864	-1.135	0.51767	P	6.099999999997774E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.17167	-1.0378	9	0.12766	T	0.61	-2.8966	10.5357	0.45002	0.0:0.9026:0.0:0.0974	rs2436487;rs3760777;rs17845247;rs17858066;rs58221162;rs2436487	185	Q96G46	DUS3L_HUMAN	G	185	ENSP00000311977:R185G	ENSP00000311977:R185G	R	-	1	2	DUS3L	5740565	0.996000	0.38824	0.894000	0.35097	0.121000	0.20230	2.069000	0.41481	0.902000	0.36520	-0.320000	0.08662	AGG	T|0.554;C|0.446		0.721	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451870.2	NM_020175	
KANK2	25959	hgsc.bcm.edu	37	19	11303817	11303817	+	Silent	SNP	G	G	C			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:11303817G>C	ENST00000586659.1	-	4	1253	c.939C>G	c.(937-939)ccC>ccG	p.P313P	KANK2_ENST00000355150.5_Silent_p.P313P|KANK2_ENST00000589359.1_Silent_p.P313P|KANK2_ENST00000432929.2_Silent_p.P313P|KANK2_ENST00000589894.1_Silent_p.P313P			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	313					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CCTGGGGCTGGGGGTCAGCCT	0.716																																					p.P313P		.											.	KANK2-68	0			c.C939G						.						9.0	10.0	9.0					19																	11303817		2153	4218	6371	SO:0001819	synonymous_variant	25959	exon2			GGGCTGGGGGTCA	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.939C>G	19.37:g.11303817G>C		3	0		33	25	NM_015493	0	0	0	1	1	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Silent	SNP	ENST00000586659.1	37	CCDS12255.1																																																																																			.		0.716	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493	
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	1	0		7	7	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
SBSN	374897	bcgsc.ca	37	19	36015652	36015652	+	Silent	SNP	C	C	T	rs17705633	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:36015652C>T	ENST00000452271.2	-	3	1738	c.1710G>A	c.(1708-1710)tcG>tcA	p.S570S	SBSN_ENST00000518157.1_Silent_p.S227S	NM_001166034.1	NP_001159506.1	Q6UWP8	SBSN_HUMAN	suprabasin	570						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				large_intestine(5)|lung(6)|ovary(1)|prostate(2)	14	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCGTGTTGACCGAGGCCTGCA	0.597													C|||	500	0.0998403	0.0825	0.0951	5008	,	,		18374	0.0248		0.1581	False		,,,				2504	0.1442				p.S570S		.											.	SBSN-91	0			c.G1710A						.	C	,,	458,3948	216.1+/-234.9	22,414,1767	131.0	106.0	115.0		1710,447,681	2.0	1.0	19	dbSNP_123	115	1478,7122	280.8+/-294.7	137,1204,2959	no	coding-synonymous,coding-synonymous,coding-synonymous	SBSN	NM_001166034.1,NM_001166035.1,NM_198538.3	,,	159,1618,4726	TT,TC,CC		17.186,10.3949,14.8854	,,	570/591,149/170,227/248	36015652	1936,11070	2203	4300	6503	SO:0001819	synonymous_variant	374897	exon3			GTTGACCGAGGCC	AY358701	CCDS12464.1, CCDS54253.1	19q13.13	2008-02-05							24950	protein-coding gene	gene with protein product		609969				12228223	Standard	NM_198538		Approved	UNQ698, HLAR698	uc002oad.2	Q6UWP8		ENST00000452271.2:c.1710G>A	19.37:g.36015652C>T		177	3		115	5	NM_001166034	0	0	0	0	0	A8K5J0|E9PBV3	Silent	SNP	ENST00000452271.2	37	CCDS54253.1																																																																																			C|0.874;T|0.126		0.597	SBSN-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109463.3	NM_198538	
ZNF567	163081	bcgsc.ca	37	19	37210529	37210529	+	Silent	SNP	A	A	G	rs3108200	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:37210529A>G	ENST00000536254.2	+	6	1125	c.903A>G	c.(901-903)agA>agG	p.R301R	ZNF567_ENST00000360729.4_Silent_p.R270R|ZNF567_ENST00000392163.2_Silent_p.R270R|ZNF567_ENST00000588311.1_Silent_p.R270R|ZNF850_ENST00000589390.1_Intron|ZNF567_ENST00000585696.1_Silent_p.R270R			Q8N184	ZN567_HUMAN	zinc finger protein 567	301					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			ATCATCAGAGAACTCACACAG	0.423													A|||	1345	0.26857	0.3654	0.2032	5008	,	,		20404	0.2113		0.2942	False		,,,				2504	0.2168				p.R270R		.											.	ZNF567-90	0			c.A810G						.	A		1515,2891	478.1+/-358.1	242,1031,930	50.0	52.0	52.0		810	1.5	1.0	19	dbSNP_103	52	2553,6047	414.9+/-351.6	383,1787,2130	no	coding-synonymous	ZNF567	NM_152603.2		625,2818,3060	GG,GA,AA		29.686,34.3849,31.2779		270/617	37210529	4068,8938	2203	4300	6503	SO:0001819	synonymous_variant	163081	exon4			TCAGAGAACTCAC	AK093034	CCDS12495.1, CCDS74349.1	19q13.12	2013-10-08				ENSG00000189042		"""Zinc fingers, C2H2-type"", ""-"""	28696	protein-coding gene	gene with protein product						12477932	Standard	XM_006723064		Approved	MGC45586	uc002oep.4	Q8N184		ENST00000536254.2:c.903A>G	19.37:g.37210529A>G		139	0		87	5	NM_152603	0	0	0	0	0	B3KX49|Q6N044	Silent	SNP	ENST00000536254.2	37																																																																																				A|0.701;G|0.299		0.423	ZNF567-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000453549.1	NM_152603	
BCAT2	587	broad.mit.edu	37	19	49309949	49309949	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:49309949G>T	ENST00000316273.6	-	3	137	c.125C>A	c.(124-126)aCa>aAa	p.T42K	BCAT2_ENST00000598162.1_Missense_Mutation_p.T42K|BCAT2_ENST00000597011.1_Missense_Mutation_p.T2K|BCAT2_ENST00000545387.2_Intron|BCAT2_ENST00000599246.1_Intron|BCAT2_ENST00000601496.1_5'Flank|BCAT2_ENST00000402551.1_Missense_Mutation_p.T2K	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	42					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	AGGCTTCTGTGTCATTTCCAG	0.542																																					p.T42K		.											.	BCAT2-91	0			c.C125A						.						69.0	71.0	70.0					19																	49309949		2203	4300	6503	SO:0001583	missense	587	exon3			TTCTGTGTCATTT	U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.125C>A	19.37:g.49309949G>T	ENSP00000322991:p.Thr42Lys	12	0		15	2	NM_001190	0	0	34	34	0	B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	ENST00000316273.6	37	CCDS12735.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309304	0.40895	.	.	ENSG00000105552	ENST00000316273;ENST00000402551	T;T	0.18338	2.26;2.22	5.17	4.04	0.47022	.	0.181219	0.49305	D	0.000142	T	0.15003	0.0362	M	0.66506	2.035	0.09310	N	1	P;P	0.45348	0.856;0.856	B;B	0.34385	0.181;0.181	T	0.35051	-0.9804	10	0.62326	D	0.03	-18.2764	7.6536	0.28363	0.0:0.2242:0.6144:0.1614	.	42;42	Q53EW7;O15382	.;BCAT2_HUMAN	K	42;2	ENSP00000322991:T42K;ENSP00000385161:T2K	ENSP00000322991:T42K	T	-	2	0	BCAT2	54001761	0.260000	0.24053	0.793000	0.32043	0.966000	0.64601	1.640000	0.37186	2.579000	0.87056	0.650000	0.86243	ACA	.		0.542	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466202.1		
SIGLEC12	89858	bcgsc.ca	37	19	52004743	52004743	+	Missense_Mutation	SNP	G	G	A	rs3810110	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:52004743G>A	ENST00000291707.3	-	1	300	c.245C>T	c.(244-246)gCt>gTt	p.A82V	SIGLEC12_ENST00000598614.1_5'Flank	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)	82	Ig-like V-type 1.		A -> V (in dbSNP:rs3810110).		cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.A82V(1)		NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CACTGCTCGAGCTGGGTTGTT	0.572													g|||	2852	0.569489	0.5522	0.7248	5008	,	,		17154	0.369		0.6322	False		,,,				2504	0.6247				p.A82V		.											.	SIGLEC12-96	1	Substitution - Missense(1)	stomach(1)	c.C245T						.	G	VAL/ALA	2511,1895		723,1065,415	142.0	122.0	129.0		245	-3.7	0.0	19	dbSNP_107	129	5506,3094		1751,2004,545	yes	missense	SIGLEC12	NM_053003.2	64	2474,3069,960	AA,AG,GG		35.9767,43.0095,38.3592	benign	82/596	52004743	8017,4989	2203	4300	6503	SO:0001583	missense	89858	exon1			GCTCGAGCTGGGT	AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.245C>T	19.37:g.52004743G>A	ENSP00000291707:p.Ala82Val	207	2		166	6	NM_053003	0	0	1	1	0	Q8IYH7	Missense_Mutation	SNP	ENST00000291707.3	37	CCDS12833.1	1222	0.5595238095238095	272	0.5528455284552846	253	0.6988950276243094	213	0.3723776223776224	484	0.6385224274406333	.	6.904	0.536379	0.13188	0.569905	0.640233	ENSG00000254521	ENST00000291707	T	0.22539	1.95	2.42	-3.74	0.04385	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00012	0.0000	L	0.38531	1.155	0.80722	P	0.0	B	0.25105	0.118	B	0.12156	0.007	T	0.36480	-0.9746	8	0.66056	D	0.02	.	0.7216	0.00941	0.1573:0.2996:0.2172:0.3259	rs3810110;rs52812455;rs60698567;rs3810110	82	Q96PQ1	SIG12_HUMAN	V	82	ENSP00000291707:A82V	ENSP00000291707:A82V	A	-	2	0	SIGLEC12	56696555	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.317000	0.02707	-0.727000	0.04888	0.395000	0.25975	GCT	G|0.417;A|0.582		0.572	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384641.2	NM_053003	
LILRB3	11025	bcgsc.ca	37	19	54725992	54725992	+	Silent	SNP	G	G	A	rs148339740	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:54725992G>A	ENST00000391750.1	-	5	502	c.366C>T	c.(364-366)agC>agT	p.S122S	LILRB3_ENST00000346401.6_Silent_p.S122S|LILRB3_ENST00000469273.1_5'Flank|LILRB3_ENST00000424807.1_Silent_p.S122S|LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000245620.9_Silent_p.S122S|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000407860.2_Silent_p.S122S|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRA6_ENST00000391735.3_Intron			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	122	Ig-like C2-type 2.		S -> N (in dbSNP:rs3826750). {ECO:0000269|PubMed:9278324}.		cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGTGGGTTTGCTGTAGGCTC	0.592													.|||	959	0.191494	0.1029	0.1744	5008	,	,		13407	0.1071		0.2495	False		,,,				2504	0.3507				p.S122S		.											.	LILRB3-93	0			c.C366T						.						62.0	40.0	48.0					19																	54725992		2132	3919	6051	SO:0001819	synonymous_variant	11025	exon4			GGGTTTGCTGTAG	U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.366C>T	19.37:g.54725992G>A		220	1		117	8	NM_006864	0	0	0	0	0	C9J1P3|C9JIP1|O15471|Q86U49	Silent	SNP	ENST00000391750.1	37	CCDS33105.1																																																																																			G|0.881;A|0.119		0.592	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142844.5	NM_006864	
ZNF419	79744	bcgsc.ca	37	19	58004346	58004346	+	Missense_Mutation	SNP	G	G	C	rs2074076	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr19:58004346G>C	ENST00000221735.7	+	5	607	c.421G>C	c.(421-423)Gag>Cag	p.E141Q	ZNF419_ENST00000424930.2_Missense_Mutation_p.E142Q|ZNF419_ENST00000354197.4_Missense_Mutation_p.E129Q|ZNF419_ENST00000426954.2_Missense_Mutation_p.E129Q|ZNF419_ENST00000347466.6_Missense_Mutation_p.E109Q|ZNF419_ENST00000415379.2_Missense_Mutation_p.E95Q|AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000442920.2_Missense_Mutation_p.E128Q			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	141			E -> Q (in dbSNP:rs2074076). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		AAAAAGACAAGAGGGCAGGGT	0.507													G|||	3484	0.695687	0.5794	0.7262	5008	,	,		19751	0.6984		0.6839	False		,,,				2504	0.8405				p.E142Q		.											.	ZNF419-90	0			c.G424C						.	G	GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU,GLN/GLU	2618,1788	628.1+/-395.0	781,1056,366	60.0	63.0	62.0		424,385,382,325,286,283,421	0.3	0.0	19	dbSNP_96	62	5967,2633	681.2+/-403.7	2035,1897,368	no	missense,missense,missense,missense,missense,missense,missense	ZNF419	NM_001098491.1,NM_001098492.1,NM_001098493.1,NM_001098494.1,NM_001098495.1,NM_001098496.1,NM_024691.3	29,29,29,29,29,29,29	2816,2953,734	CC,CG,GG		30.6163,40.581,33.992	benign,benign,benign,benign,benign,benign,benign	142/512,129/499,128/498,109/479,96/466,95/465,141/511	58004346	8585,4421	2203	4300	6503	SO:0001583	missense	79744	exon5			AGACAAGAGGGCA	AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.421G>C	19.37:g.58004346G>C	ENSP00000221735:p.Glu141Gln	339	1		289	11	NM_001098491	0	0	8	8	0	B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Missense_Mutation	SNP	ENST00000221735.7	37	CCDS54326.1	1477	0.6762820512820513	290	0.5894308943089431	258	0.712707182320442	410	0.7167832167832168	519	0.6846965699208444	G	2.762	-0.257605	0.05791	0.59419	0.693837	ENSG00000105136	ENST00000284020;ENST00000524372;ENST00000424930;ENST00000426954;ENST00000354197;ENST00000442920;ENST00000517598;ENST00000347466;ENST00000415379;ENST00000521754;ENST00000221735;ENST00000521137	T;T;T;T;T;T;T;T;T	0.06849	3.37;3.38;3.32;3.38;3.25;3.25;5.4;3.36;6.97	2.48	0.261	0.15592	.	.	.	.	.	T	0.00012	0.0000	L	0.35793	1.09	0.80722	P	0.0	P;B;B;P;P;B	0.45827	0.596;0.0;0.0;0.743;0.867;0.0	B;B;B;B;P;B	0.44897	0.099;0.002;0.003;0.356;0.463;0.001	T	0.08953	-1.0697	8	0.21014	T	0.42	.	6.0755	0.19913	0.3047:0.0:0.6953:0.0	rs2074076;rs12983132;rs58731055	95;128;129;142;109;141	E9PFX9;E9PCP4;E9PET3;E9PED0;Q96HQ0-2;Q96HQ0	.;.;.;.;.;ZN419_HUMAN	Q	144;129;142;129;129;128;142;109;95;96;141;108	ENSP00000388864:E142Q;ENSP00000390916:E129Q;ENSP00000346136:E129Q;ENSP00000414709:E128Q;ENSP00000299860:E109Q;ENSP00000392129:E95Q;ENSP00000428523:E96Q;ENSP00000221735:E141Q;ENSP00000429628:E108Q	ENSP00000221735:E141Q	E	+	1	0	ZNF419	62696158	0.029000	0.19370	0.008000	0.14137	0.319000	0.28217	0.923000	0.28757	0.353000	0.24079	0.205000	0.17691	GAG	G|0.324;C|0.676		0.507	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378506.1	NM_024691	
SDC1	6382	hgsc.bcm.edu	37	2	20403998	20403998	+	Missense_Mutation	SNP	G	G	A	rs141315088	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr2:20403998G>A	ENST00000254351.4	-	3	447	c.203C>T	c.(202-204)aCg>aTg	p.T68M	SDC1_ENST00000482879.1_5'UTR|SDC1_ENST00000403076.1_Missense_Mutation_p.T68M|SDC1_ENST00000381150.1_Missense_Mutation_p.T68M	NM_002997.4	NP_002988	P18827	SDC1_HUMAN	syndecan 1	68					canonical Wnt signaling pathway (GO:0060070)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|myoblast development (GO:0048627)|odontogenesis (GO:0042476)|phototransduction, visible light (GO:0007603)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to toxic substance (GO:0009636)|retinoid metabolic process (GO:0001523)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|striated muscle cell development (GO:0055002)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|skin(2)	21	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)			OV - Ovarian serous cystadenocarcinoma(76;0.221)		CAGGAGCTGCGTGTCCTTCCA	0.632													g|||	26	0.00519169	0.0	0.013	5008	,	,		15015	0.004		0.003	False		,,,				2504	0.0102				p.T68M		.											.	SDC1-95	0			c.C203T						.		MET/THR,MET/THR	1,4401		0,1,2200	91.0	99.0	96.0		203,203	-9.0	0.0	2	dbSNP_134	96	24,8572		0,24,4274	yes	missense,missense	SDC1	NM_001006946.1,NM_002997.4	81,81	0,25,6474	AA,AG,GG		0.2792,0.0227,0.1923	benign,benign	68/311,68/311	20403998	25,12973	2201	4298	6499	SO:0001583	missense	6382	exon3			AGCTGCGTGTCCT	AJ551176	CCDS1697.1	2p24.1	2008-02-05			ENSG00000115884	ENSG00000115884		"""CD molecules"", ""Proteoglycans / Cell Surface : Syndecans"""	10658	protein-coding gene	gene with protein product	"""syndecan proteoglycan 1"""	186355		SDC			Standard	XM_005262621		Approved	CD138, syndecan, SYND1	uc002rdo.1	P18827	OTTHUMG00000090751	ENST00000254351.4:c.203C>T	2.37:g.20403998G>A	ENSP00000254351:p.Thr68Met	2	0		6	4	NM_002997	0	0	18	18	0	D6W523|Q53QV0|Q546D3|Q96HB7	Missense_Mutation	SNP	ENST00000254351.4	37	CCDS1697.1	6	0.0027472527472527475	0	0.0	3	0.008287292817679558	1	0.0017482517482517483	2	0.002638522427440633	g	4.794	0.147658	0.09134	2.27E-4	0.002792	ENSG00000115884	ENST00000254351;ENST00000381150;ENST00000403076;ENST00000429035	T;T;T;T	0.35605	2.12;2.12;1.32;1.3	4.52	-9.04	0.00734	.	1.649880	0.03028	N	0.151650	T	0.09992	0.0245	N	0.02011	-0.69	0.09310	N	1	B;B	0.21753	0.06;0.007	B;B	0.16722	0.016;0.011	T	0.37526	-0.9702	10	0.87932	D	0	0.3402	9.9701	0.41749	0.3539:0.0:0.5378:0.1083	.	68;68	E9PHH3;P18827	.;SDC1_HUMAN	M	68;68;68;76	ENSP00000254351:T68M;ENSP00000370542:T68M;ENSP00000384613:T68M;ENSP00000400773:T76M	ENSP00000254351:T68M	T	-	2	0	SDC1	20267479	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.582000	0.05814	-2.058000	0.00895	-2.058000	0.00401	ACG	G|0.997;A|0.003		0.632	SDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207495.1	NM_001006946	
ADCY3	109	bcgsc.ca	37	2	25046090	25046090	+	Silent	SNP	T	T	C	rs1127568	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr2:25046090T>C	ENST00000260600.5	-	17	3722	c.2871A>G	c.(2869-2871)tcA>tcG	p.S957S	RP11-443B20.1_ENST00000606114.1_RNA|ADCY3_ENST00000405392.1_Silent_p.S544S	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	957					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					AGTCAAAATCTGAGATGATTT	0.502													C|||	3462	0.691294	0.5295	0.7695	5008	,	,		20373	0.879		0.668	False		,,,				2504	0.6851				p.S957S		.											.	ADCY3-94	0			c.A2871G						.	C		2405,2001	561.5+/-380.7	642,1121,440	102.0	87.0	92.0		2871	-8.2	0.7	2	dbSNP_86	92	5729,2871	450.6+/-362.4	1927,1875,498	no	coding-synonymous	ADCY3	NM_004036.3		2569,2996,938	CC,CT,TT		33.3837,45.4153,37.4596		957/1145	25046090	8134,4872	2203	4300	6503	SO:0001819	synonymous_variant	109	exon17			AAAATCTGAGATG	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.2871A>G	2.37:g.25046090T>C		150	0		128	7	NM_004036	0	0	0	0	0	B3KT86|Q53T54|Q9UDB1	Silent	SNP	ENST00000260600.5	37	CCDS1715.1																																																																																			T|0.343;C|0.656		0.502	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
KHK	3795	broad.mit.edu	37	2	27317364	27317364	+	Missense_Mutation	SNP	C	C	T	rs201995559		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr2:27317364C>T	ENST00000260599.6	+	3	742	c.229C>T	c.(229-231)Cgc>Tgc	p.R77C	KHK_ENST00000260598.5_Intron|KHK_ENST00000490823.1_3'UTR	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	77					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGATGACCTCCGCCGCTATTC	0.597																																					p.R77C		.											.	KHK-115	0			c.C229T						.	C	CYS/ARG,	0,4406		0,0,2203	87.0	86.0	87.0		229,	5.6	1.0	2		87	2,8598	2.2+/-6.3	0,2,4298	yes	missense,intron	KHK	NM_000221.2,NM_006488.2	180,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,	77/299,	27317364	2,13004	2203	4300	6503	SO:0001583	missense	3795	exon3			GACCTCCGCCGCT		CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.229C>T	2.37:g.27317364C>T	ENSP00000260599:p.Arg77Cys	78	0		65	4	NM_000221	0	0	8	8	0	Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Missense_Mutation	SNP	ENST00000260599.6	37	CCDS1734.1	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418243	0.62622	0.0	2.33E-4	ENSG00000138030	ENST00000260599;ENST00000429697	T;T	0.77750	-1.12;-1.12	5.63	5.63	0.86233	Carbohydrate/purine kinase (1);	0.245199	0.37761	N	0.001949	T	0.79052	0.4381	L	0.51422	1.61	0.80722	D	1	D;D	0.57899	0.981;0.981	P;P	0.48952	0.596;0.596	T	0.78902	-0.2021	10	0.42905	T	0.14	-9.1514	17.1653	0.86814	0.0:1.0:0.0:0.0	.	77;77	Q6IBK2;P50053	.;KHK_HUMAN	C	77	ENSP00000260599:R77C;ENSP00000404741:R77C	ENSP00000260599:R77C	R	+	1	0	KHK	27170868	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.414000	0.52693	2.649000	0.89929	0.561000	0.74099	CGC	.		0.597	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214196.1		
CD8B	926	hgsc.bcm.edu	37	2	87088950	87088950	+	Silent	SNP	C	C	T	rs539876702		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr2:87088950C>T	ENST00000390655.6	-	1	97	c.39G>A	c.(37-39)ctG>ctA	p.L13L	AC111200.1_ENST00000441646.1_5'Flank|CD8B_ENST00000393761.2_Silent_p.L13L|CD8B_ENST00000393759.2_Silent_p.L13L|CD8B_ENST00000431506.2_Silent_p.L13L|CD8B_ENST00000349455.3_Silent_p.L13L|CD8B_ENST00000331469.2_Silent_p.L13L	NM_004931.4	NP_004922.1	P10966	CD8B_HUMAN	CD8b molecule	13					immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						CCTTACCTGTCAGCTGCGCGG	0.756													C|||	1	0.000199681	0.0	0.0	5008	,	,		7376	0.001		0.0	False		,,,				2504	0.0				p.L13L		.											.	CD8B-92	0			c.G39A						.						1.0	1.0	1.0					2																	87088950		670	1778	2448	SO:0001819	synonymous_variant	926	exon1			ACCTGTCAGCTGC		CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000390655.6:c.39G>A	2.37:g.87088950C>T		1	0		6	6	NM_004931	0	0	0	0	0	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Silent	SNP	ENST00000390655.6	37	CCDS1997.1																																																																																			.		0.756	CD8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330402.1	NM_172099	
RNF149	284996	hgsc.bcm.edu	37	2	101925026	101925026	+	Missense_Mutation	SNP	T	T	C	rs11123868	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr2:101925026T>C	ENST00000295317.3	-	1	132	c.25A>G	c.(25-27)Agc>Ggc	p.S9G	MIR5696_ENST00000578474.1_RNA	NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	9			S -> G (in dbSNP:rs11123868). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GCCCCGACGCTGGCTTCGCGC	0.726													C|||	2397	0.478634	0.7678	0.4582	5008	,	,		13525	0.3175		0.3917	False		,,,				2504	0.3579				p.S9G	Colon(25;331 612 6521 7355 31028)	.											.	RNF149-290	0			c.A25G						.	C	GLY/SER	1794,1350		547,700,325	4.0	6.0	5.0		25	-2.5	0.0	2	dbSNP_120	5	2382,4344		496,1390,1477	no	missense	RNF149	NM_173647.3	56	1043,2090,1802	CC,CT,TT		35.4148,42.9389,42.31	benign	9/401	101925026	4176,5694	1572	3363	4935	SO:0001583	missense	284996	exon1			CGACGCTGGCTTC	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.25A>G	2.37:g.101925026T>C	ENSP00000295317:p.Ser9Gly	0	0		5	5	NM_173647	0	0	0	1	1	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	37	CCDS2051.1	1023	0.4684065934065934	378	0.7682926829268293	162	0.44751381215469616	189	0.3304195804195804	294	0.38786279683377306	C	1.566	-0.535355	0.04082	0.570611	0.354148	ENSG00000163162	ENST00000295317	T	0.08634	3.07	3.96	-2.45	0.06481	.	4.553570	0.01792	N	0.032390	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.30327	-0.9982	9	0.16896	T	0.51	.	7.6769	0.28490	0.0:0.1603:0.4369:0.4028	rs11123868;rs17856944;rs56755384	9	Q8NC42	RN149_HUMAN	G	9	ENSP00000295317:S9G	ENSP00000295317:S9G	S	-	1	0	RNF149	101291458	0.000000	0.05858	0.003000	0.11579	0.044000	0.14063	-0.581000	0.05820	-0.783000	0.04534	-0.374000	0.07098	AGC	T|0.543;C|0.457		0.726	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000356688.4_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		0	0		7	7	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
CNTNAP5	129684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	125521361	125521361	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr2:125521361C>G	ENST00000431078.1	+	15	2708	c.2344C>G	c.(2344-2346)Cgt>Ggt	p.R782G		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	782	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGGTCCCTTGCGTTGCTATGG	0.453																																					p.R782G		.											.	CNTNAP5-524	0			c.C2344G						.						81.0	77.0	78.0					2																	125521361		1894	4114	6008	SO:0001583	missense	129684	exon15			CCCTTGCGTTGCT	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2344C>G	2.37:g.125521361C>G	ENSP00000399013:p.Arg782Gly	85	0		82	11	NM_130773	0	0	0	0	0	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	19.96	3.923826	0.73213	.	.	ENSG00000155052	ENST00000431078	T	0.13538	2.58	5.57	5.57	0.84162	.	0.121470	0.37261	N	0.002169	T	0.31295	0.0792	M	0.88105	2.93	0.46701	D	0.999166	P	0.48407	0.91	P	0.45753	0.492	T	0.19160	-1.0314	10	0.38643	T	0.18	.	18.9255	0.92541	0.0:1.0:0.0:0.0	.	782	Q8WYK1	CNTP5_HUMAN	G	782	ENSP00000399013:R782G	ENSP00000399013:R782G	R	+	1	0	CNTNAP5	125237831	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.962000	0.70364	2.804000	0.96469	0.655000	0.94253	CGT	.		0.453	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
AQP12B	653437	bcgsc.ca	37	2	241622195	241622195	+	Silent	SNP	T	T	C	rs184458523	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr2:241622195T>C	ENST00000407834.3	-	1	122	c.60A>G	c.(58-60)gcA>gcG	p.A20A		NM_001102467.1	NP_001095937.1	A6NM10	AQ12B_HUMAN	aquaporin 12B	20						integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|lung(8)|ovary(1)	13		all_epithelial(40;1.71e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;2.2e-31)|all cancers(36;1.08e-28)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.52e-06)|Lung(119;0.00163)|LUSC - Lung squamous cell carcinoma(224;0.008)|Colorectal(34;0.0124)|COAD - Colon adenocarcinoma(134;0.0757)		CCCGCCTGGCTGCCTCACAGA	0.672																																					p.A20A		.											.	.	0			c.A60G						.			66,4230		3,60,2085	43.0	50.0	48.0		60	1.3	0.2	2		48	171,8367		8,155,4106	no	coding-synonymous	AQP12B	NM_001102467.1		11,215,6191	CC,CT,TT		2.0028,1.5363,1.8467		20/308	241622195	237,12597	2148	4269	6417	SO:0001819	synonymous_variant	653437	exon1			CCTGGCTGCCTCA	BC041460	CCDS46560.1	2q37.3	2007-12-14	2005-05-26	2005-05-26	ENSG00000185176	ENSG00000185176		"""Ion channels / Aquaporins"""	6096	protein-coding gene	gene with protein product			"""insulin synthesis associated 3"""	INSSA3			Standard	NM_001102467		Approved		uc010fzj.3	A6NM10	OTTHUMG00000152263	ENST00000407834.3:c.60A>G	2.37:g.241622195T>C		100	2		64	26	NM_001102467	0	0	0	0	0	A4QPB9	Silent	SNP	ENST00000407834.3	37	CCDS46560.1																																																																																			T|0.907;C|0.093		0.672	AQP12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325625.1		
FAM182A	284800	broad.mit.edu	37	20	26061818	26061818	+	RNA	SNP	G	G	C	rs112101451		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr20:26061818G>C	ENST00000376398.2	+	0	838					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GATTTCTCCTGCTTAGAAATG	0.463																																					.		.											.	.	0			.						.						12.0	11.0	11.0					20																	26061818		692	1579	2271			284800	.			TCTCCTGCTTAGA	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061818G>C		59	1		61	6	.	0	0	0	0	0	A2RRD0|Q8N947	RNA	SNP	ENST00000376398.2	37		.	.	.	.	.	.	.	.	.	.	N	7.694	0.691703	0.15039	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.47322	0.1439	.	.	.	0.30118	N	0.805912	.	.	.	.	.	.	T	0.53092	-0.8487	4	0.87932	D	0	.	.	.	.	.	.	.	.	S	57	.	ENSP00000246000:C57S	C	+	2	0	FAM182A	26009818	1.000000	0.71417	0.427000	0.26684	0.468000	0.32798	0.774000	0.26675	0.451000	0.26802	0.123000	0.15791	TGC	G|0.994;C|0.006		0.463	FAM182A-001	KNOWN	basic	lincRNA	processed_transcript	OTTHUMT00000078473.2		
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		1	0		17	15	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
CYP24A1	1591	hgsc.bcm.edu;bcgsc.ca	37	20	52788140	52788140	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr20:52788140C>T	ENST00000216862.3	-	3	912	c.519G>A	c.(517-519)atG>atA	p.M173I	CYP24A1_ENST00000395955.3_Missense_Mutation_p.M173I|CYP24A1_ENST00000395954.3_Missense_Mutation_p.M31I	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	173					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	TGTCCAGCTTCATCACTTCCC	0.517																																					p.M173I		.											.	CYP24A1-228	0			c.G519A						.						197.0	198.0	198.0					20																	52788140		2203	4300	6503	SO:0001583	missense	1591	exon3			CAGCTTCATCACT	U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.519G>A	20.37:g.52788140C>T	ENSP00000216862:p.Met173Ile	82	0		52	4	NM_000782	0	0	0	0	0	Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	ENST00000216862.3	37	CCDS33491.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017540	0.35606	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	T;T;T	0.78816	0.01;5.1;-1.21	4.56	4.56	0.56223	.	0.333602	0.37669	N	0.001990	T	0.70684	0.3252	L	0.40543	1.245	0.32246	N	0.572054	B;B;B	0.17667	0.007;0.002;0.023	B;B;B	0.15484	0.008;0.003;0.013	T	0.72786	-0.4188	10	0.39692	T	0.17	-15.9871	15.9787	0.80089	0.0:1.0:0.0:0.0	.	173;173;31	Q32ML3;Q07973;Q5I2W7	.;CP24A_HUMAN;.	I	173;173;31	ENSP00000216862:M173I;ENSP00000379285:M173I;ENSP00000379284:M31I	ENSP00000216862:M173I	M	-	3	0	CYP24A1	52221547	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.939000	0.48995	2.087000	0.62958	0.558000	0.71614	ATG	.		0.517	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079769.2		
DIDO1	11083	hgsc.bcm.edu	37	20	61512420	61512420	+	Missense_Mutation	SNP	C	C	T	rs201746991	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr20:61512420C>T	ENST00000266070.4	-	16	5213	c.4888G>A	c.(4888-4890)Gag>Aag	p.E1630K	DIDO1_ENST00000395343.1_Missense_Mutation_p.E1630K	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1630					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CCGTCCTGCTCGGACCCCGCT	0.726													C|||	22	0.00439297	0.0	0.0	5008	,	,		12011	0.0188		0.0	False		,,,				2504	0.0031				p.E1630K	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	.											.	DIDO1-96	0			c.G4888A						.	C	LYS/GLU,LYS/GLU	1,3821		0,1,1910	8.0	10.0	9.0		4888,4888	-2.7	0.0	20	dbSNP_134	9	1,7731		0,1,3865	no	missense,missense	DIDO1	NM_001193369.1,NM_033081.2	56,56	0,2,5775	TT,TC,CC		0.0129,0.0262,0.0173	benign,benign	1630/2241,1630/2241	61512420	2,11552	1911	3866	5777	SO:0001583	missense	11083	exon16			CCTGCTCGGACCC	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4888G>A	20.37:g.61512420C>T	ENSP00000266070:p.Glu1630Lys	1	0		12	9	NM_001193369	0	0	1	1	0	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	10	0.004578754578754579	0	0.0	0	0.0	10	0.017482517482517484	0	0.0	C	6.464	0.453849	0.12283	2.62E-4	1.29E-4	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.07908	3.15;3.15	5.06	-2.67	0.06059	.	1.370700	0.05547	N	0.566787	T	0.01421	0.0046	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.04013	0.001	T	0.39210	-0.9625	10	0.07325	T	0.83	-0.0292	2.2889	0.04134	0.0969:0.2824:0.2501:0.3707	.	1630	Q9BTC0	DIDO1_HUMAN	K	1630	ENSP00000266070:E1630K;ENSP00000378752:E1630K	ENSP00000266070:E1630K	E	-	1	0	DIDO1	60982865	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.685000	0.05167	-0.683000	0.05190	0.655000	0.94253	GAG	C|0.995;T|0.005		0.726	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		0	0		6	5	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SEC14L4	284904	ucsc.edu;bcgsc.ca	37	22	30891250	30891250	+	Silent	SNP	T	T	C	rs9606738	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr22:30891250T>C	ENST00000255858.7	-	5	497	c.414A>G	c.(412-414)caA>caG	p.Q138Q	SEC14L4_ENST00000540456.1_Silent_p.Q123Q|RP4-539M6.14_ENST00000610156.1_RNA|SEC14L4_ENST00000381982.3_Silent_p.Q138Q|SEC14L4_ENST00000392772.2_Silent_p.Q84Q|RP4-539M6.14_ENST00000442126.1_RNA	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	138	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	CCTTCTGAGTTTGCAGCTCAC	0.617													C|||	803	0.160343	0.1505	0.2867	5008	,	,		19102	0.0397		0.2296	False		,,,				2504	0.137				p.Q138Q		.											.	SEC14L4-91	0			c.A414G						.	C	,	732,3674		57,618,1528	47.0	41.0	43.0		414,414	2.8	0.3	22	dbSNP_119	43	1948,6652		219,1510,2571	no	coding-synonymous,coding-synonymous	SEC14L4	NM_001161368.1,NM_174977.3	,	276,2128,4099	CC,CT,TT		22.6512,16.6137,20.6059	,	138/361,138/407	30891250	2680,10326	2203	4300	6503	SO:0001819	synonymous_variant	284904	exon5			CTGAGTTTGCAGC	AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.414A>G	22.37:g.30891250T>C		69	0		52	5	NM_001161368	0	0	0	0	0	A5D6W7|A6NCV4	Silent	SNP	ENST00000255858.7	37	CCDS13878.1																																																																																			T|0.824;C|0.176		0.617	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321946.1	NM_174977	
SEC14L4	284904	bcgsc.ca	37	22	30891294	30891294	+	Missense_Mutation	SNP	G	G	C	rs9606739	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr22:30891294G>C	ENST00000255858.7	-	5	453	c.370C>G	c.(370-372)Cgc>Ggc	p.R124G	SEC14L4_ENST00000540456.1_Missense_Mutation_p.R109G|RP4-539M6.14_ENST00000610156.1_RNA|SEC14L4_ENST00000381982.3_Missense_Mutation_p.R124G|SEC14L4_ENST00000392772.2_Missense_Mutation_p.R70G|RP4-539M6.14_ENST00000442126.1_RNA	NM_001161368.1|NM_174977.3	NP_001154840.1|NP_777637.1	Q9UDX3	S14L4_HUMAN	SEC14-like 4 (S. cerevisiae)	124	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.		R -> G (in dbSNP:rs9606739).			integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|pancreas(1)|skin(1)	21					Vitamin E(DB00163)	ACTTTGATGCGCTTCCGGATC	0.572													G|||	744	0.148562	0.1082	0.2839	5008	,	,		20716	0.0397		0.2296	False		,,,				2504	0.136				p.R124G		.											.	SEC14L4-91	0			c.C370G						.	G	GLY/ARG,GLY/ARG	563,3843	250.0+/-257.2	34,495,1674	73.0	63.0	67.0		370,370	2.6	0.1	22	dbSNP_119	67	1937,6663	340.1+/-323.5	217,1503,2580	yes	missense,missense	SEC14L4	NM_001161368.1,NM_174977.3	125,125	251,1998,4254	CC,CG,GG		22.5233,12.778,19.2219	possibly-damaging,possibly-damaging	124/361,124/407	30891294	2500,10506	2203	4300	6503	SO:0001583	missense	284904	exon5			TGATGCGCTTCCG	AY158085	CCDS13878.1, CCDS54517.1	22q12.1	2003-03-10			ENSG00000133488	ENSG00000133488			20627	protein-coding gene	gene with protein product		612825					Standard	NM_174977		Approved	TAP3, dJ130H16.5	uc003aid.2	Q9UDX3	OTTHUMG00000151258	ENST00000255858.7:c.370C>G	22.37:g.30891294G>C	ENSP00000255858:p.Arg124Gly	101	0		63	4	NM_001161368	0	0	0	0	0	A5D6W7|A6NCV4	Missense_Mutation	SNP	ENST00000255858.7	37	CCDS13878.1	340	0.15567765567765568	63	0.12804878048780488	85	0.23480662983425415	22	0.038461538461538464	170	0.22427440633245382	g	12.30	1.897920	0.33535	0.12778	0.225233	ENSG00000133488	ENST00000255858;ENST00000540456;ENST00000392772;ENST00000381982	T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99	4.9	2.62	0.31277	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.077270	0.52532	D	0.000077	T	0.00073	0.0002	L	0.54323	1.7	0.09310	P	1.0	B;P;B	0.45902	0.089;0.868;0.054	B;P;B	0.46718	0.167;0.525;0.039	T	0.02464	-1.1155	9	0.26408	T	0.33	-11.5328	11.6741	0.51419	0.0:0.0:0.4656:0.5344	rs9606739;rs17670888;rs52812792;rs9606739	70;109;124	B3KSF0;G3V1L4;Q9UDX3	.;.;S14L4_HUMAN	G	124;109;70;124	ENSP00000255858:R124G;ENSP00000440848:R109G;ENSP00000376525:R70G;ENSP00000371412:R124G	ENSP00000255858:R124G	R	-	1	0	SEC14L4	29221294	0.996000	0.38824	0.144000	0.22314	0.468000	0.32798	2.707000	0.47143	1.161000	0.42604	0.655000	0.94253	CGC	G|0.832;C|0.167		0.572	SEC14L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321946.1	NM_174977	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		4	4	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
MUC4	4585	broad.mit.edu	37	3	195506460	195506460	+	Missense_Mutation	SNP	G	G	C	rs113130007	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr3:195506460G>C	ENST00000463781.3	-	2	12450	c.11991C>G	c.(11989-11991)caC>caG	p.H3997Q	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H3997Q	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H3997Q(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGGGGTGGCGTGACCTGTGG	0.602													.|||	3	0.000599042	0.0015	0.0	5008	,	,		9092	0.0		0.0	False		,,,				2504	0.001				p.H3997Q		.											.	MUC4-90	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	c.C11991G						.						13.0	10.0	11.0					3																	195506460		669	1476	2145	SO:0001583	missense	4585	exon2			GGTGGCGTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11991C>G	3.37:g.195506460G>C	ENSP00000417498:p.His3997Gln	67	2		45	7	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.646	0.120143	0.08881	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33216	1.42;1.51	0.764	-0.332	0.12675	.	0.000000	0.25267	U	0.031920	T	0.16642	0.0400	N	0.19112	0.55	0.09310	N	1	B	0.29988	0.264	B	0.35899	0.213	T	0.21552	-1.0242	9	.	.	.	.	5.1972	0.15245	0.2456:0.0:0.7544:0.0	.	3869	E7ESK3	.	Q	3997	ENSP00000417498:H3997Q;ENSP00000420243:H3997Q	.	H	-	3	2	MUC4	196991239	0.000000	0.05858	0.001000	0.08648	0.185000	0.23345	-0.425000	0.07017	-0.110000	0.12022	0.064000	0.15345	CAC	G|0.006;C|0.994		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CRIPAK	285464	bcgsc.ca	37	4	1388817	1388817	+	Missense_Mutation	SNP	C	C	G	rs200606324	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:1388817C>G	ENST00000324803.4	+	1	3478	c.518C>G	c.(517-519)cCa>cGa	p.P173R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	173					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGTGGAGTG	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		18475	0.0992		0.0378	False		,,,				2504	0.271				p.P173R		.											.	CRIPAK-90	0			c.C518G						.						192.0	130.0	151.0					4																	1388817		2194	4201	6395	SO:0001583	missense	285464	exon1			CGTGCCCATGTGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.518C>G	4.37:g.1388817C>G	ENSP00000323978:p.Pro173Arg	19	0		101	28	NM_175918	0	0	49	49	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	c	1.909	-0.451230	0.04572	.	.	ENSG00000179979	ENST00000324803	T	0.19250	2.16	1.25	0.276	0.15663	Post-SET domain (1);	.	.	.	.	T	0.08358	0.0208	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40079	-0.9582	9	0.17369	T	0.5	.	4.4738	0.11726	0.0:0.5796:0.2425:0.1779	.	173	Q8N1N5	CRPAK_HUMAN	R	173	ENSP00000323978:P173R	ENSP00000323978:P173R	P	+	2	0	CRIPAK	1378817	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.368000	0.07543	-0.338000	0.08413	-1.976000	0.00459	CCA	CATGT|0.500;GACGC|0.500		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	bcgsc.ca	37	4	1388819	1388819	+	Missense_Mutation	SNP	T	T	C	rs144797159	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:1388819T>C	ENST00000324803.4	+	1	3480	c.520T>C	c.(520-522)Tgt>Cgt	p.C174R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	174					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGTGGAGTGCC	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		17297	0.0992		0.0378	False		,,,				2504	0.271				p.C174R		.											.	CRIPAK-90	0			c.T520C						.						191.0	130.0	151.0					4																	1388819		2194	4196	6390	SO:0001583	missense	285464	exon1			TGCCCATGTGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.520T>C	4.37:g.1388819T>C	ENSP00000323978:p.Cys174Arg	19	0		100	23	NM_175918	0	0	42	43	1	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	2.950|2.950	-0.216975|-0.216975	0.06101|0.06101	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	1.25|1.25	-0.146|-0.146	0.13432|0.13432	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.15825|0.15825	0.0381|0.0381	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.20052|.	0.041|.	B|.	0.11329|.	0.006|.	T|T	0.24977|0.24977	-1.0145|-1.0145	9|6	0.66056|0.27082	D|T	0.02|0.32	.|.	4.6847|4.6847	0.12752|0.12752	0.0:0.2124:0.0:0.7876|0.0:0.2124:0.0:0.7876	.|.	174|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	174|157	ENSP00000323978:C174R|.	ENSP00000323978:C174R|ENSP00000372402:M157T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378819|1378819	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.014000|0.014000	0.08584|0.08584	-0.160000|-0.160000	0.10041|0.10041	-0.013000|-0.013000	0.14199|0.14199	0.102000|0.102000	0.15555|0.15555	TGT|ATG	T|0.950;C|0.050		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388867	1388867	+	Missense_Mutation	SNP	A	A	C	rs76058011	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:1388867A>C	ENST00000324803.4	+	1	3528	c.568A>C	c.(568-570)Atc>Ctc	p.I190L		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	190					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			TGCCCGCCTGATCACACGTGC	0.662													N|||	145	0.0289537	0.0174	0.0447	5008	,	,		14453	0.0099		0.0586	False		,,,				2504	0.0225				p.I190L		.											.	CRIPAK-90	0			c.A568C						.						246.0	170.0	197.0					4																	1388867		2172	3827	5999	SO:0001583	missense	285464	exon1			CGCCTGATCACAC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.568A>C	4.37:g.1388867A>C	ENSP00000323978:p.Ile190Leu	29	0		106	15	NM_175918	0	0	0	33	33	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	4.910	0.169067	0.09339	.	.	ENSG00000179979	ENST00000324803	T	0.19394	2.15	1.25	-1.56	0.08532	.	.	.	.	.	T	0.06917	0.0176	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34004	-0.9846	9	0.10636	T	0.68	.	0.5937	0.00732	0.3976:0.2382:0.1983:0.1659	.	190	Q8N1N5	CRPAK_HUMAN	L	190	ENSP00000323978:I190L	ENSP00000323978:I190L	I	+	1	0	CRIPAK	1378867	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.558000	0.00923	-1.849000	0.01171	-2.030000	0.00424	ATC	A|0.994;C|0.006		0.662	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
MSANTD1	345222	hgsc.bcm.edu	37	4	3250964	3250964	+	Silent	SNP	C	C	A	rs371508114	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:3250964C>A	ENST00000438480.2	+	1	1762	c.15C>A	c.(13-15)gcC>gcA	p.A5A	MSANTD1_ENST00000507492.1_Intron|MSANTD1_ENST00000510580.1_Silent_p.A5A	NM_001042690.1	NP_001036155.1	Q6ZTZ1	MSD1_HUMAN	Myb/SANT-like DNA-binding domain containing 1	5										endometrium(1)|lung(2)	3						TGCGTGGGGCCGGGCCGGGGC	0.697													C|||	6	0.00119808	0.0008	0.0014	5008	,	,		11218	0.0		0.004	False		,,,				2504	0.0				p.A5A		.											.	.	0			c.C15A						.						1.0	2.0	1.0					4																	3250964		1044	2255	3299	SO:0001819	synonymous_variant	345222	exon1			TGGGGCCGGGCCG		CCDS47003.1	4p16.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000188981	ENSG00000188981			33741	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 44"""	C4orf44			Standard	NM_001042690		Approved	LOC345222	uc003ggs.3	Q6ZTZ1	OTTHUMG00000159977	ENST00000438480.2:c.15C>A	4.37:g.3250964C>A		1	0		14	6	NM_001042690	0	0	0	0	0	C9J6V0	Silent	SNP	ENST00000438480.2	37	CCDS47003.1																																																																																			.		0.697	MSANTD1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370924.1	NM_001012982	
PSAPL1	768239	bcgsc.ca	37	4	7435194	7435194	+	Silent	SNP	G	G	A	rs12498567	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:7435194G>A	ENST00000319098.4	-	1	1506	c.1413C>T	c.(1411-1413)ggC>ggT	p.G471G	SORCS2_ENST00000511199.1_Intron|SORCS2_ENST00000507866.2_Intron|SORCS2_ENST00000329016.9_Intron	NM_001085382.1	NP_001078851.1	Q6NUJ1	SAPL1_HUMAN	prosaposin-like 1 (gene/pseudogene)	471	Saposin B-type 4. {ECO:0000255|PROSITE- ProRule:PRU00415}.				sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|lysosome (GO:0005764)				lung(4)	4						GGGTCCTGGGGCCGTGGCAGG	0.642													G|||	577	0.115216	0.1036	0.1138	5008	,	,		17473	0.1111		0.1839	False		,,,				2504	0.0654				p.G471G		.											.	PSAPL1-68	0			c.C1413T						.	G	,	490,3460		32,426,1517	19.0	22.0	21.0		1413,	-1.3	0.0	4	dbSNP_120	21	1450,6834		121,1208,2813	no	coding-synonymous,intron	SORCS2,PSAPL1	NM_001085382.1,NM_020777.2	,	153,1634,4330	AA,AG,GG		17.5036,12.4051,15.8574	,	471/522,	7435194	1940,10294	1975	4142	6117	SO:0001819	synonymous_variant	768239	exon1			CCTGGGGCCGTGG	DQ991252	CCDS47009.1	4p16.1	2010-03-12	2010-03-12			ENSG00000178597			33131	protein-coding gene	gene with protein product			"""prosaposin-like 1"""				Standard	NM_001085382		Approved		uc011bwj.2	Q6NUJ1		ENST00000319098.4:c.1413C>T	4.37:g.7435194G>A		32	0		56	4	NM_001085382	0	0	0	0	0	A0A184|Q8N7T4	Silent	SNP	ENST00000319098.4	37	CCDS47009.1																																																																																			G|0.868;A|0.132		0.642	PSAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358859.1		
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	0	0		7	7	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
SOD3	6649	hgsc.bcm.edu	37	4	24801354	24801354	+	Silent	SNP	C	C	T	rs8192291	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:24801354C>T	ENST00000382120.3	+	2	416	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L		NM_003102.2	NP_003093.2	P08294	SODE_HUMAN	superoxide dismutase 3, extracellular	71					removal of superoxide radicals (GO:0019430)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	copper ion binding (GO:0005507)|heparin binding (GO:0008201)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			prostate(1)|urinary_tract(1)	2		Breast(46;0.0503)				GTCGGCCACGCTGGACGCCGC	0.726													C|||	994	0.198482	0.0968	0.1585	5008	,	,		11823	0.3512		0.2028	False		,,,				2504	0.2025				p.L71L		.											.	SOD3-90	0			c.C211T						.	C		341,3293		12,317,1488	4.0	5.0	5.0		211	0.7	0.0	4	dbSNP_117	5	1103,6325		63,977,2674	no	coding-synonymous	SOD3	NM_003102.2		75,1294,4162	TT,TC,CC		14.8492,9.3836,13.0537		71/241	24801354	1444,9618	1817	3714	5531	SO:0001819	synonymous_variant	6649	exon2			GCCACGCTGGACG		CCDS3430.1	4p15.2	2012-09-20			ENSG00000109610	ENSG00000109610	1.15.1.1		11181	protein-coding gene	gene with protein product		185490					Standard	NM_003102		Approved	EC-SOD	uc003gqz.3	P08294	OTTHUMG00000128565	ENST00000382120.3:c.211C>T	4.37:g.24801354C>T		0	0		21	18	NM_003102	0	0	0	2	2	Q5U781|Q6FHA2	Silent	SNP	ENST00000382120.3	37	CCDS3430.1																																																																																			C|0.777;T|0.223		0.726	SOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250416.1		
TMEM165	55858	hgsc.bcm.edu	37	4	56262374	56262374	+	Silent	SNP	A	A	G	rs1128141	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:56262374A>G	ENST00000381334.5	+	1	251	c.18A>G	c.(16-18)ccA>ccG	p.P6P	SRD5A3-AS1_ENST00000598819.1_RNA|SRD5A3-AS1_ENST00000592823.1_RNA|SRD5A3-AS1_ENST00000599135.1_RNA|SRD5A3-AS1_ENST00000601433.1_RNA|TMEM165_ENST00000542052.1_5'UTR|TMEM165_ENST00000506198.1_Silent_p.P6P	NM_018475.4	NP_060945.2	Q9HC07	TM165_HUMAN	transmembrane protein 165	6					cellular calcium ion homeostasis (GO:0006874)|Golgi calcium ion transport (GO:0032472)|protein N-linked glycosylation (GO:0006487)|regulation of lysosomal lumen pH (GO:0035751)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(1)|kidney(1)|large_intestine(2)	4	Lung NSC(11;0.00545)|Glioma(25;0.08)|all_neural(26;0.101)|all_epithelial(27;0.135)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0103)			CCGCGGCTCCAGGGAACGGCC	0.751													a|||	3782	0.755192	0.8654	0.7176	5008	,	,		8141	0.6776		0.6511	False		,,,				2504	0.82				p.P6P		.											.	TMEM165-514	0			c.A18G						.						1.0	2.0	2.0					4																	56262374		1230	2885	4115	SO:0001819	synonymous_variant	55858	exon1			GGCTCCAGGGAAC	AF183409	CCDS3499.1	4q12	2014-03-13			ENSG00000134851	ENSG00000134851			30760	protein-coding gene	gene with protein product	"""TPA regulated locus"""	614726				3202867, 22683087, 23575229	Standard	NM_018475		Approved	TMPT27, TPARL, GDT1	uc003hax.3	Q9HC07	OTTHUMG00000128735	ENST00000381334.5:c.18A>G	4.37:g.56262374A>G		0	0		5	4	NM_018475	0	0	2	4	2	A8K3P8|B4DHW1|Q9BTN9|Q9NZ34	Silent	SNP	ENST00000381334.5	37	CCDS3499.1																																																																																			T|0.293;G|0.003		0.751	TMEM165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250646.4	NM_018475	
UTP3	57050	hgsc.bcm.edu	37	4	71554691	71554693	+	In_Frame_Del	DEL	GGA	GGA	-	rs146575538|rs61104402	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	GGA	GGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:71554691_71554693delGGA	ENST00000254803.2	+	1	496_498	c.297_299delGGA	c.(295-300)ggggag>ggg	p.E105del		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	105	Glu-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			ggaatgcgggggaggaggaggag	0.576														35	0.00698882	0.0197	0.0043	5008	,	,		23033	0.002		0.001	False		,,,				2504	0.0031				p.99_100del		.											.	UTP3-226	0			c.297_299del						.			0,251,4015		0,0,0,0,251,1882						-0.6	0.0		dbSNP_134	50	1,543,7710		0,0,1,6,531,3589	no	codingComplex	UTP3	NM_020368.2		0,0,1,6,782,5471	A1A1,A1A2,A1R,A2A2,A2R,RR		6.5907,5.8837,6.3498				1,794,11725				SO:0001651	inframe_deletion	57050	exon1			TGCGGGGGAGGAG	AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.297_299delGGA	4.37:g.71554700_71554702delGGA	ENSP00000254803:p.Glu105del	284	3		346	12	NM_020368	0	0	0	0	0	Q6FI82	In_Frame_Del	DEL	ENST00000254803.2	37	CCDS3546.1																																																																																			.		0.576	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252163.2	NM_020368	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662231	77662231	+	Missense_Mutation	SNP	C	C	T	rs3733245	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:77662231C>T	ENST00000296043.6	+	5	3858	c.2905C>T	c.(2905-2907)Cgg>Tgg	p.R969W		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	969	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CGTGGGGCTGCGGAGCCCCGA	0.771													C|||	42	0.00838658	0.0	0.0	5008	,	,		10024	0.0387		0.0	False		,,,				2504	0.0031				p.R969W		.											.	SHROOM3-93	0			c.C2905T						.						3.0	4.0	4.0					4																	77662231		1781	3493	5274	SO:0001583	missense	57619	exon5			GGGCTGCGGAGCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2905C>T	4.37:g.77662231C>T	ENSP00000296043:p.Arg969Trp	0	0		19	12	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	ENST00000296043.6	37	CCDS3579.2	25	0.011446886446886446	2	0.0040650406504065045	0	0.0	21	0.03671328671328671	2	0.002638522427440633	C	13.09	2.133589	0.37630	.	.	ENSG00000138771	ENST00000296043	T	0.45668	0.89	4.86	-0.812	0.10853	Apx/shroom, ASD1 (2);	0.781690	0.11064	N	0.603680	T	0.08268	0.0206	L	0.43701	1.375	0.34023	D	0.652879	B;B;B	0.29232	0.128;0.238;0.128	B;B;B	0.25614	0.046;0.062;0.046	T	0.26224	-1.0109	10	0.56958	D	0.05	-9.0468	6.8401	0.23957	0.398:0.4442:0.0:0.1577	rs3733245	793;969;747	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	W	969	ENSP00000296043:R969W	ENSP00000296043:R969W	R	+	1	2	SHROOM3	77881255	0.966000	0.33281	0.795000	0.32087	0.612000	0.37316	0.270000	0.18607	0.087000	0.17167	0.563000	0.77884	CGG	G|0.989;A|0.011		0.771	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
COQ2	27235	hgsc.bcm.edu	37	4	84205872	84205872	+	Missense_Mutation	SNP	C	C	A	rs6818847	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:84205872C>A	ENST00000311469.4	-	1	195	c.196G>T	c.(196-198)Gtg>Ttg	p.V66L	COQ2_ENST00000311461.7_Missense_Mutation_p.V16L|COQ2_ENST00000439031.2_Missense_Mutation_p.V29L	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	16					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				GCCAGTGCCACAGCCCGCAGG	0.766													C|||	3254	0.64976	0.3775	0.647	5008	,	,		9689	0.8879		0.7227	False		,,,				2504	0.6994				p.V66L		.											.	COQ2-92	0			c.G196T						.	C	LEU/VAL	1570,1290		474,622,334	2.0	3.0	3.0		196	-2.7	0.0	4	dbSNP_116	3	4779,1627		1892,995,316	no	missense	COQ2	NM_015697.7	32	2366,1617,650	AA,AC,CC		25.3981,45.1049,31.4807	benign	66/422	84205872	6349,2917	1430	3203	4633	SO:0001583	missense	27235	exon1			GTGCCACAGCCCG		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.196G>T	4.37:g.84205872C>A	ENSP00000310873:p.Val66Leu	0	0		8	8	NM_015697	0	0	0	0	0	O95331|Q1JQ78|Q684R2	Missense_Mutation	SNP	ENST00000311469.4	37	CCDS47090.2	1475	0.6753663003663004	219	0.4451219512195122	244	0.6740331491712708	490	0.8566433566433567	522	0.6886543535620053	C	5.506	0.278257	0.10403	0.548951	0.746019	ENSG00000173085	ENST00000311469;ENST00000439031;ENST00000311461	T;T;T	0.77098	-1.07;-1.03;-1.0	3.59	-2.74	0.05932	.	2.205390	0.02429	N	0.083323	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	8	0.07813	T	0.8	-2.056	4.7989	0.13287	0.0:0.2608:0.3311:0.4081	rs6818847;rs17850399;rs17858544	16	E2QRG7	.	L	66;29;16	ENSP00000310873:V66L;ENSP00000409275:V29L;ENSP00000311835:V16L	ENSP00000311835:V16L	V	-	1	0	COQ2	84424896	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.921000	0.01569	-0.746000	0.04766	0.467000	0.42956	GTG	C|0.324;A|0.676		0.766	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
RBM46	166863	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	155720332	155720332	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:155720332C>T	ENST00000281722.3	+	4	1253	c.1018C>T	c.(1018-1020)Cac>Tac	p.H340Y	RBM46_ENST00000510397.1_Missense_Mutation_p.H340Y|RBM46_ENST00000514866.1_Missense_Mutation_p.H340Y	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	340							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				AGAAGAGAGCCACCCAAAAAC	0.413																																					p.H340Y		.											.	RBM46-69	0			c.C1018T						.						70.0	75.0	73.0					4																	155720332		2203	4300	6503	SO:0001583	missense	166863	exon4			GAGAGCCACCCAA	BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.1018C>T	4.37:g.155720332C>T	ENSP00000281722:p.His340Tyr	130	0		232	14	NM_144979	0	0	0	0	0	B3KWU8|B4DZ27	Missense_Mutation	SNP	ENST00000281722.3	37	CCDS3790.1	.	.	.	.	.	.	.	.	.	.	C	7.736	0.700231	0.15106	.	.	ENSG00000151962	ENST00000514866;ENST00000281722;ENST00000510397	T;T;T	0.15952	2.4;2.38;2.54	6.17	4.47	0.54385	.	0.351259	0.33938	N	0.004411	T	0.08714	0.0216	L	0.36672	1.1	0.09310	N	1	B;P;B	0.42078	0.0;0.77;0.0	B;B;B	0.29598	0.001;0.104;0.001	T	0.22836	-1.0205	10	0.02654	T	1	-1.4286	10.3414	0.43879	0.1233:0.798:0.0:0.0787	.	340;340;340	B4DZ27;B3KWU8;Q8TBY0	.;.;RBM46_HUMAN	Y	340	ENSP00000424500:H340Y;ENSP00000281722:H340Y;ENSP00000422813:H340Y	ENSP00000281722:H340Y	H	+	1	0	RBM46	155939782	0.015000	0.18098	0.910000	0.35882	0.993000	0.82548	0.638000	0.24674	0.953000	0.37825	0.655000	0.94253	CAC	.		0.413	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365259.1	NM_144979	
FSTL5	56884	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	162380371	162380371	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr4:162380371G>A	ENST00000306100.5	-	14	2145	c.1709C>T	c.(1708-1710)aCa>aTa	p.T570I	FSTL5_ENST00000536695.1_Missense_Mutation_p.T569I|FSTL5_ENST00000427802.2_Missense_Mutation_p.T560I|FSTL5_ENST00000379164.4_Missense_Mutation_p.T569I	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	570						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TACCTGTAGTGTTGGTGATGT	0.363																																					p.T570I		.											.	FSTL5-158	0			c.C1709T						.						131.0	120.0	123.0					4																	162380371		2203	4300	6503	SO:0001583	missense	56884	exon14			TGTAGTGTTGGTG	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1709C>T	4.37:g.162380371G>A	ENSP00000305334:p.Thr570Ile	88	0		119	27	NM_020116	0	0	0	0	0	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	ENST00000306100.5	37	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	g	17.24	3.339780	0.60963	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.23348	1.91;1.91;1.91;1.91	5.18	5.18	0.71444	WD40/YVTN repeat-like-containing domain (1);	0.046902	0.85682	D	0.000000	T	0.41534	0.1163	M	0.76574	2.34	0.48087	D	0.999585	B;D;B	0.55385	0.379;0.971;0.335	B;P;B	0.48677	0.07;0.586;0.071	T	0.46470	-0.9189	10	0.87932	D	0	.	18.0748	0.89424	0.0:0.0:1.0:0.0	.	560;569;570	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	I	570;569;560;569	ENSP00000305334:T570I;ENSP00000368462:T569I;ENSP00000389270:T560I;ENSP00000440409:T569I	ENSP00000305334:T570I	T	-	2	0	FSTL5	162599821	1.000000	0.71417	0.307000	0.25127	0.687000	0.40016	7.231000	0.78106	2.567000	0.86603	0.645000	0.84053	ACA	.		0.363	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
PDCD6	10016	hgsc.bcm.edu	37	5	271858	271869	+	In_Frame_Del	DEL	CCGGCCCTGGGG	CCGGCCCTGGGG	-	rs529816592|rs147793210|rs201564379	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	CCGGCCCTGGGG	CCGGCCCTGGGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr5:271858_271869delCCGGCCCTGGGG	ENST00000264933.4	+	1	123_134	c.23_34delCCGGCCCTGGGG	c.(22-36)cccggccctggggcc>ccc	p.GPGA9del	PDCD6_ENST00000507528.1_In_Frame_Del_p.GPGA9del|CTD-2083E4.6_ENST00000512642.1_RNA|PDCD6_ENST00000509581.1_In_Frame_Del_p.GPGA9del|PDCD6_ENST00000505221.1_In_Frame_Del_p.GPGA9del	NM_001267556.1|NM_001267558.1|NM_013232.3	NP_001254485.1|NP_001254487.1|NP_037364.1	O75340	PDCD6_HUMAN	programmed cell death 6	9					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)	p.A12_G15delAGPG(2)		breast(2)|endometrium(1)|large_intestine(4)|lung(1)	8			Epithelial(17;0.00193)|OV - Ovarian serous cystadenocarcinoma(19;0.00489)|all cancers(22;0.00511)|Lung(60;0.113)			TCTTACCGCCCCGGCCCTGGGGCCGGCCCTGG	0.741														513	0.102436	0.1316	0.1657	5008	,	,		10520	0.0546		0.0905	False		,,,				2504	0.0798				p.8_12del		.											.	PDCD6-290	2	Deletion - In frame(2)	breast(2)	c.23_34del						.			265,2557		60,145,1206						2.2	1.0		dbSNP_126	6	779,5791		158,463,2664	no	coding	PDCD6	NM_013232.3		218,608,3870	A1A1,A1R,RR		11.8569,9.3905,11.1158				1044,8348				SO:0001651	inframe_deletion	10016	exon1			ACCGCCCCGGCCC	AF035606	CCDS3854.1, CCDS58940.1, CCDS58941.1, CCDS75222.1, CCDS75223.1	5p15.33	2013-01-10			ENSG00000249915	ENSG00000249915		"""EF-hand domain containing"""	8765	protein-coding gene	gene with protein product	"""apoptosis-linked gene-2"""	601057				8560270	Standard	NM_013232		Approved	ALG-2, PEF1B	uc003jat.1	O75340	OTTHUMG00000090283	ENST00000264933.4:c.23_34delCCGGCCCTGGGG	5.37:g.271858_271869delCCGGCCCTGGGG	ENSP00000264933:p.Gly9_Ala12del	2	2		18	6	NM_013232	0	0	0	0	0	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	In_Frame_Del	DEL	ENST00000264933.4	37	CCDS3854.1																																																																																			.		0.741	PDCD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206609.2	NM_013232	
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G|NSUN2_ENST00000539938.1_5'Flank|NSUN2_ENST00000506139.1_5'Flank|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000504286.1_3'UTR|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		0	0		9	9	NM_001047	0	0	0	0	0	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
MSH3	4437	hgsc.bcm.edu	37	5	79950712	79950738	+	In_Frame_Del	DEL	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA	-	rs2431220|rs2001675|rs2405876|rs2405877|rs201874762|rs144776112|rs1574197|rs148550291|rs201906899|rs535056167|rs60484572|rs70991168|rs201149584	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr5:79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENST00000265081.6	+	1	246_272	c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	c.(166-192)gcggccgcagcggccgcagcgcccccadel	p.AAAAAAAPP56del	DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000505337.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	56	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		agcggctgcagcggccgcagcggccgcagcgCCCCCAGCGCCCCCAG	0.705								Mismatch excision repair (MMR)																													p.56_64del	Melanoma(88;1010 1399 13793 26548 36275)	.											.	MSH3-661	0			c.166_192del						.																																			SO:0001651	inframe_deletion	4437	exon1			GCTGCAGCGGCCG	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	5.37:g.79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENSP00000265081:p.Ala56_Pro64del	13	0		42	0	NM_002439	0	0	0	0	0	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	ENST00000265081.6	37	CCDS34195.1																																																																																			.		0.705	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369471.1	NM_002439	
GPR98	84059	broad.mit.edu;ucsc.edu	37	5	89943537	89943537	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr5:89943537C>A	ENST00000405460.2	+	17	3341	c.3245C>A	c.(3244-3246)cCg>cAg	p.P1082Q		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1082	Calx-beta 8. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GATGGTATCCCGGAAACAGAT	0.363																																					p.P1082Q		.											.	GPR98-103	0			c.C3245A						.						119.0	115.0	116.0					5																	89943537		1847	4092	5939	SO:0001583	missense	84059	exon17			GTATCCCGGAAAC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3245C>A	5.37:g.89943537C>A	ENSP00000384582:p.Pro1082Gln	63	1		124	14	NM_032119	0	0	0	0	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560307	0.65538	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.32515	1.45	5.64	5.64	0.86602	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.62221	0.2410	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.66456	-0.5919	10	0.87932	D	0	.	19.6995	0.96047	0.0:1.0:0.0:0.0	.	1082	Q8WXG9	GPR98_HUMAN	Q	1082	ENSP00000384582:P1082Q	ENSP00000296619:P1082Q	P	+	2	0	GPR98	89979293	1.000000	0.71417	0.976000	0.42696	0.015000	0.08874	7.333000	0.79214	2.652000	0.90054	0.650000	0.86243	CCG	.		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
SAR1B	51128	bcgsc.ca	37	5	133945288	133945288	+	Silent	SNP	C	C	T	rs140899111	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr5:133945288C>T	ENST00000402673.2	-	5	599	c.321G>A	c.(319-321)agG>agA	p.R107R	SAR1B_ENST00000507419.1_Silent_p.R39R|SAR1B_ENST00000439578.1_Silent_p.R107R|SAR1B_ENST00000509937.1_Silent_p.R39R|SAR1B_ENST00000502539.1_Silent_p.R39R	NM_016103.3	NP_057187.1	Q9Y6B6	SAR1B_HUMAN	secretion associated, Ras related GTPase 1B	107					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|GTP catabolic process (GO:0006184)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			kidney(2)|lung(2)|urinary_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACTCTAACAGCCTTTCGTGGT	0.393													C|||	4	0.000798722	0.0	0.0	5008	,	,		20631	0.0		0.004	False		,,,				2504	0.0				p.R107R		.											.	SAR1B-227	0			c.G321A						.	C	,	1,4405	2.1+/-5.4	0,1,2202	129.0	118.0	122.0		321,321	1.9	1.0	5	dbSNP_134	122	15,8585	11.2+/-40.8	0,15,4285	no	coding-synonymous,coding-synonymous	SAR1B	NM_001033503.2,NM_016103.3	,	0,16,6487	TT,TC,CC		0.1744,0.0227,0.123	,	107/199,107/199	133945288	16,12990	2203	4300	6503	SO:0001819	synonymous_variant	51128	exon6			TAACAGCCTTTCG	AF092130	CCDS4177.1	5q31.1	2014-03-07	2014-03-07	2005-10-21	ENSG00000152700	ENSG00000152700			10535	protein-coding gene	gene with protein product		607690	"""SAR1a gene homolog (S. cerevisiae) 2"", ""SAR1a gene homolog 2 (S. cerevisiae)"", ""SAR1 homolog B (S. cerevisiae)"""	SARA2			Standard	NM_001033503		Approved		uc003kzr.3	Q9Y6B6	OTTHUMG00000129114	ENST00000402673.2:c.321G>A	5.37:g.133945288C>T		126	0		156	6	NM_001033503	0	0	220	220	0	D3DQA4|Q567T4	Silent	SNP	ENST00000402673.2	37	CCDS4177.1																																																																																			C|0.999;T|0.001		0.393	SAR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251158.2	NM_016103	
PROB1	389333	hgsc.bcm.edu	37	5	138730037	138730037	+	Missense_Mutation	SNP	T	T	C	rs11748963	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr5:138730037T>C	ENST00000434752.2	-	1	848	c.734A>G	c.(733-735)cAg>cGg	p.Q245R		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	245																	CGCGGCGGCCTGCAGGGGGCC	0.781													T|||	1773	0.354034	0.146	0.2839	5008	,	,		10752	0.6151		0.3042	False		,,,				2504	0.4673				p.Q245R		.											.	.	0			c.A734G						.						5.0	7.0	6.0					5																	138730037		671	1537	2208	SO:0001583	missense	389333	exon1			GCGGCCTGCAGGG	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.734A>G	5.37:g.138730037T>C	ENSP00000416033:p.Gln245Arg	1	0		13	6	NM_001161546	0	0	0	0	0	B4E007	Missense_Mutation	SNP	ENST00000434752.2	37	CCDS54909.1	803	0.3676739926739927	105	0.21341463414634146	108	0.2983425414364641	366	0.6398601398601399	224	0.2955145118733509	T	21.8	4.205823	0.79127	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.26	4.26	0.50523	.	.	.	.	.	T	0.00012	0.0000	L	0.36672	1.1	0.33628	P	0.39427599999999996	D	0.76494	0.999	D	0.83275	0.996	T	0.45483	-0.9258	7	0.52906	T	0.07	.	11.6588	0.51334	0.0:0.0:0.0:1.0	rs11748963	245	E7EW31	CE065_HUMAN	R	245	.	ENSP00000416033:Q245R	Q	-	2	0	AC135457.1	138757936	0.990000	0.36364	0.998000	0.56505	0.770000	0.43624	2.116000	0.41930	1.919000	0.55581	0.459000	0.35465	CAG	T|0.632;C|0.368		0.781	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470735.1	NM_001161546	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		0	0		6	6	NM_001145115	0	0	0	3	3		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
HIST1H2BK	85236	broad.mit.edu;bcgsc.ca	37	6	27114542	27114542	+	Silent	SNP	C	C	T			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr6:27114542C>T	ENST00000356950.1	-	1	35	c.36G>A	c.(34-36)aaG>aaA	p.K12K	MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000396891.4_Silent_p.K12K|HIST1H2AH_ENST00000377459.1_5'Flank			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	12					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						TCGAGCCCTTCTTGGGCGCGG	0.577																																					p.K12K		.											.	HIST1H2BK-68	0			c.G36A						.						86.0	81.0	83.0					6																	27114542		2203	4300	6503	SO:0001819	synonymous_variant	85236	exon1			GCCCTTCTTGGGC	AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.36G>A	6.37:g.27114542C>T		255	1		333	27	NM_080593	0	0	244	299	55	A8K7P7|Q2VPI7	Silent	SNP	ENST00000356950.1	37	CCDS4621.1																																																																																			.		0.577	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040141.1	NM_080593	
RUNX2	860	hgsc.bcm.edu	37	6	45390514	45390514	+	Silent	SNP	G	G	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr6:45390514G>A	ENST00000371438.1	+	2	601	c.243G>A	c.(241-243)gcG>gcA	p.A81A	RUNX2_ENST00000576263.1_Silent_p.A81A|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371436.6_Silent_p.A81A|RUNX2_ENST00000371432.3_Silent_p.A67A|RUNX2_ENST00000541979.1_Silent_p.A149A|RUNX2_ENST00000465038.2_Silent_p.A81A|RUNX2_ENST00000352853.5_Silent_p.A149A|RUNX2_ENST00000359524.5_Silent_p.A67A	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	81	Poly-Ala.		Missing. {ECO:0000269|PubMed:9182765}.		BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						cggcggcggcggcggctgcgg	0.726																																					p.A81A		.											.	RUNX2-417	0			c.G243A						.						3.0	5.0	5.0					6																	45390514		922	2241	3163	SO:0001819	synonymous_variant	860	exon3			GGCGGCGGCGGCT	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.243G>A	6.37:g.45390514G>A		1	0		13	4	NM_001024630	0	0	0	0	0	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	37	CCDS43467.2																																																																																			.		0.726	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
FAM46A	55603	hgsc.bcm.edu	37	6	82461742	82461742	+	Silent	SNP	G	G	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr6:82461742G>A	ENST00000320172.6	-	2	431	c.117C>T	c.(115-117)ggC>ggT	p.G39G	FAM46A_ENST00000369756.3_Silent_p.G120G|FAM46A_ENST00000369754.3_Silent_p.G58G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		cgaagtcgccgccgccgaagt	0.667																																					p.G39G		.											.	FAM46A-90	0			c.C117T						.						7.0	8.0	8.0					6																	82461742		1601	3424	5025	SO:0001819	synonymous_variant	55603	exon2			GTCGCCGCCGCCG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117C>T	6.37:g.82461742G>A		51	0		152	9	NM_017633	0	0	1	1	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.667	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
WDR27	253769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	170013695	170013695	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr6:170013695T>C	ENST00000448612.1	-	22	2390	c.2281A>G	c.(2281-2283)Att>Gtt	p.I761V	WDR27_ENST00000423258.1_Missense_Mutation_p.I634V|WDR27_ENST00000546525.1_5'UTR|WDR27_ENST00000333572.6_Missense_Mutation_p.I761V	NM_182552.4	NP_872358.4	A2RRH5	WDR27_HUMAN	WD repeat domain 27	731						nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	12		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)		CCATCGCCAATGGCCGTGGTC	0.493																																					p.I761V		.											.	WDR27-69	0			c.A2281G						.						84.0	86.0	86.0					6																	170013695		1950	4138	6088	SO:0001583	missense	253769	exon22			CGCCAATGGCCGT	AK131435	CCDS47520.1, CCDS47520.2, CCDS56459.1	6q27	2013-01-09	2003-06-18		ENSG00000184465	ENSG00000184465		"""WD repeat domain containing"""	21248	protein-coding gene	gene with protein product							Standard	NM_182552		Approved	MGC43690	uc003qwx.3	A2RRH5	OTTHUMG00000016061	ENST00000448612.1:c.2281A>G	6.37:g.170013695T>C	ENSP00000416289:p.Ile761Val	148	0		181	64	NM_182552	0	0	0	3	3	A5PLM8|C9JGV0|Q5T066	Missense_Mutation	SNP	ENST00000448612.1	37	CCDS47520.2	.	.	.	.	.	.	.	.	.	.	t	0.041	-1.282773	0.01398	.	.	ENSG00000184465	ENST00000448612;ENST00000333572;ENST00000423258	T;T;T	0.16457	5.06;2.34;5.06	4.88	-9.23	0.00672	.	1.947270	0.03215	N	0.176622	T	0.02304	0.0071	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.18610	0.002;0.008;0.029	B;B;B	0.11329	0.002;0.006;0.005	T	0.14144	-1.0483	10	0.21540	T	0.41	-1.6724	17.8257	0.88665	0.0:0.6818:0.0:0.3182	.	761;634;761	F2Z2U5;A2RRH5-2;C9JGV0	.;.;.	V	761;761;634	ENSP00000416289:I761V;ENSP00000330265:I761V;ENSP00000397869:I634V	ENSP00000330265:I761V	I	-	1	0	WDR27	169755620	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.700000	0.01905	-1.880000	0.01125	-1.156000	0.01807	ATT	.		0.493	WDR27-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407334.1	NM_182552	
TBP	6908	bcgsc.ca	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		.											.	TBP-91	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		94	2		105	7	NM_003194	0	0	13	13	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
MICALL2	79778	hgsc.bcm.edu	37	7	1484572	1484572	+	Silent	SNP	A	A	G	rs10435184	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr7:1484572A>G	ENST00000297508.7	-	6	1309	c.1134T>C	c.(1132-1134)ggT>ggC	p.G378G	MICALL2_ENST00000405088.4_Silent_p.G166G	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	378	Mediates targeting to the cell plasma membrane. {ECO:0000250}.|Necessary and sufficient for interaction with actinins. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCTCCCCCACCCTGGGGTG	0.716													G|||	4980	0.994409	0.9985	0.9914	5008	,	,		11496	1.0		0.9801	False		,,,				2504	1.0				p.G378G		.											.	MICALL2-90	0			c.T1134C						.			3824,4		1910,4,0	4.0	4.0	4.0		1134	1.5	0.0	7	dbSNP_119	4	7610,92		3759,92,0	yes	coding-synonymous	MICALL2	NM_182924.3		5669,96,0	GG,GA,AA		1.1945,0.1045,0.8326		378/905	1484572	11434,96	1914	3851	5765	SO:0001819	synonymous_variant	79778	exon6			TCCCCCACCCTGG	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1134T>C	7.37:g.1484572A>G		0	0		5	5	NM_182924	0	0	0	5	5	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	CCDS5324.1																																																																																			A|0.009;G|0.991		0.716	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
BRAT1	221927	hgsc.bcm.edu	37	7	2578371	2578371	+	Missense_Mutation	SNP	G	G	A	rs56727079	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr7:2578371G>A	ENST00000340611.4	-	14	2054	c.1798C>T	c.(1798-1800)Ctc>Ttc	p.L600F	BRAT1_ENST00000473879.1_5'UTR	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	600					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						TCTACGGAGAGGATGTGCAGG	0.672													G|||	550	0.109824	0.0613	0.0591	5008	,	,		18473	0.2748		0.0199	False		,,,				2504	0.1339				p.L600F		.											.	BRAT1-229	0			c.C1798T						.	G	PHE/LEU	168,4144		2,164,1990	21.0	24.0	23.0		1798	5.4	0.1	7	dbSNP_129	23	78,8348		0,78,4135	yes	missense	BRAT1	NM_152743.3	22	2,242,6125	AA,AG,GG		0.9257,3.8961,1.9312	probably-damaging	600/822	2578371	246,12492	2156	4213	6369	SO:0001583	missense	221927	exon14			CGGAGAGGATGTG	BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.1798C>T	7.37:g.2578371G>A	ENSP00000339637:p.Leu600Phe	3	0		17	7	NM_152743	0	0	53	82	29	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	ENST00000340611.4	37	CCDS5334.1	214	0.09798534798534798	32	0.06504065040650407	11	0.03038674033149171	156	0.2727272727272727	15	0.01978891820580475	G	14.88	2.668388	0.47677	0.038961	0.009257	ENSG00000106009	ENST00000340611	T	0.51071	0.72	5.44	5.44	0.79542	Armadillo-like helical (1);Armadillo-type fold (1);	0.132337	0.48767	D	0.000164	T	0.00012	0.0000	M	0.74258	2.255	0.23309	P	0.99793193	D	0.89917	1.0	D	0.85130	0.997	T	0.36089	-0.9762	9	0.87932	D	0	-28.4961	7.1458	0.25583	0.2083:0.0:0.7917:0.0	rs56727079;rs61742874	600	Q6PJG6	BRAT1_HUMAN	F	600	ENSP00000339637:L600F	ENSP00000339637:L600F	L	-	1	0	BRAT1	2544897	1.000000	0.71417	0.063000	0.19743	0.190000	0.23558	2.598000	0.46223	2.562000	0.86427	0.555000	0.69702	CTC	G|0.928;A|0.072		0.672	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239305.2	NM_152743	
USP42	84132	hgsc.bcm.edu	37	7	6193521	6193521	+	Missense_Mutation	SNP	G	G	C	rs61729726	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr7:6193521G>C	ENST00000306177.5	+	15	2494	c.2336G>C	c.(2335-2337)cGc>cCc	p.R779P		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	779	Pro-rich.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		CCGCCGCCCCGCGATCCCGGC	0.756													C|||	2895	0.578075	0.8638	0.4121	5008	,	,		10724	0.7331		0.3082	False		,,,				2504	0.4274				p.R779P		.											.	USP42-659	0			c.G2336C						.	C	PRO/ARG	2157,1125		751,655,235	4.0	6.0	5.0		2336	2.6	0.0	7	dbSNP_129	5	1843,5693		290,1263,2215	no	missense	USP42	NM_032172.2	103	1041,1918,2450	CC,CG,GG		24.4559,34.2779,36.9754	benign	779/1317	6193521	4000,6818	1641	3768	5409	SO:0001583	missense	84132	exon15			CGCCCCGCGATCC	AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.2336G>C	7.37:g.6193521G>C	ENSP00000301962:p.Arg779Pro	0	0		15	6	NM_032172	0	0	2	3	1	A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	ENST00000306177.5	37	CCDS47535.1	1188	0.5439560439560439	401	0.8150406504065041	130	0.35911602209944754	440	0.7692307692307693	217	0.2862796833773087	C	10.95	1.494372	0.26774	0.657221	0.244559	ENSG00000106346	ENST00000306177;ENST00000426246	T;T	0.14266	2.52;2.93	5.46	2.59	0.31030	.	0.841331	0.10600	N	0.655737	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09164	-1.0687	9	0.28530	T	0.3	.	2.8136	0.05448	0.1458:0.5508:0.1414:0.162	rs61729726	779;779	Q9H9J4-2;Q9H9J4	.;UBP42_HUMAN	P	779;625	ENSP00000301962:R779P;ENSP00000408217:R625P	ENSP00000301962:R779P	R	+	2	0	USP42	6160046	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.469000	0.22067	0.265000	0.21872	-0.120000	0.15030	CGC	G|0.456;C|0.544		0.756	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324262.3	XM_166526	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000581665.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		13	13	NM_002047	0	0	0	22	22	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
GLI3	2737	hgsc.bcm.edu	37	7	42005678	42005678	+	Missense_Mutation	SNP	G	G	A	rs929387	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr7:42005678G>A	ENST00000395925.3	-	15	3077	c.2993C>T	c.(2992-2994)cCg>cTg	p.P998L	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	998			P -> L (in dbSNP:rs929387). {ECO:0000269|PubMed:10441342, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2118997}.		anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GCCGTGGCCCGGCGCATCGTG	0.746									Pallister-Hall syndrome;Greig Cephalopolysyndactyly				G|||	2111	0.421526	0.1619	0.4424	5008	,	,		11700	0.7688		0.3161	False		,,,				2504	0.5082				p.P998L		.											.	GLI3-1149	0			c.C2993T						.	G	LEU/PRO	654,2960		69,516,1222	4.0	5.0	5.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2993	3.8	0.2	7	dbSNP_86	5	2170,5232		331,1508,1862	no	missense	GLI3	NM_000168.5	98	400,2024,3084	AA,AG,GG		29.3164,18.0963,25.6354	benign	998/1581	42005678	2824,8192	1807	3701	5508	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	TGGCCCGGCGCAT		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2993C>T	7.37:g.42005678G>A	ENSP00000379258:p.Pro998Leu	0	0		6	6	NM_000168	0	0	0	2	2	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	917	0.4198717948717949	75	0.1524390243902439	153	0.42265193370165743	451	0.7884615384615384	238	0.31398416886543534	G	1.729	-0.494582	0.04322	0.180963	0.293164	ENSG00000106571	ENST00000395925	T	0.15256	2.44	4.98	3.83	0.44106	.	0.327528	0.33217	N	0.005158	T	0.00012	0.0000	N	0.05554	-0.025	0.09310	P	0.9999999999224007	B	0.06786	0.001	B	0.04013	0.001	T	0.16247	-1.0409	9	0.17369	T	0.5	.	5.4162	0.16376	0.7624:0.0:0.0842:0.1533	rs929387;rs929387	998	P10071	GLI3_HUMAN	L	998	ENSP00000379258:P998L	ENSP00000379258:P998L	P	-	2	0	GLI3	41972203	1.000000	0.71417	0.171000	0.22900	0.021000	0.10359	4.758000	0.62220	0.733000	0.32492	-0.471000	0.05019	CCG	G|0.565;A|0.435		0.746	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
SSPO	23145	hgsc.bcm.edu	37	7	149489784	149489784	+	RNA	SNP	G	G	T			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr7:149489784G>T	ENST00000378016.2	+	0	5840							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGCCGAGGTCGCCAGTGCCGT	0.697																																					p.R1947L		.											.	.	0			c.G5840T						.						16.0	23.0	21.0					7																	149489784		2035	4146	6181			23145	exon38			GAGGTCGCCAGTG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149489784G>T		30	0		71	5	NM_198455	0	0	0	0	0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																				.		0.697	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
DPP6	1804	hgsc.bcm.edu	37	7	153750019	153750019	+	Silent	SNP	C	C	T	rs554552970	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr7:153750019C>T	ENST00000377770.3	+	1	255	c.114C>T	c.(112-114)ggC>ggT	p.G38G	DPP6_ENST00000404039.1_Intron|DPP6_ENST00000406326.1_Silent_p.G38G|AC006019.3_ENST00000425591.1_RNA			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	38					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AGGACGGCGGCGCAGGAGCCA	0.791													C|||	413	0.0824681	0.0356	0.0994	5008	,	,		4709	0.002		0.1372	False		,,,				2504	0.1605				p.G38G	NSCLC(125;1384 1783 2490 7422 34254)	.											.	DPP6-652	0			c.C114T						.						5.0	7.0	6.0					7																	153750019		678	1541	2219	SO:0001819	synonymous_variant	1804	exon1			CGGCGGCGCAGGA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.114C>T	7.37:g.153750019C>T		0	0		17	12	NM_130797	0	0	0	0	0		Silent	SNP	ENST00000377770.3	37																																																																																				.		0.791	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
FAM135B	51059	bcgsc.ca	37	8	139165272	139165272	+	Silent	SNP	T	T	C	rs7835712|rs71505459	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr8:139165272T>C	ENST00000395297.1	-	13	1616	c.1446A>G	c.(1444-1446)ccA>ccG	p.P482P		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	482										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CATTCTCACCTGGCTCTGGAC	0.393										HNSCC(54;0.14)			C|||	3610	0.720847	0.6853	0.7464	5008	,	,		18415	0.7718		0.6869	False		,,,				2504	0.7331				p.P482P		.											.	FAM135B-31	0			c.A1446G						.	C		2725,1119		982,761,179	119.0	113.0	115.0		1446	-2.6	0.0	8	dbSNP_116	115	5519,2761		1849,1821,470	no	coding-synonymous	FAM135B	NM_015912.3		2831,2582,649	CC,CT,TT		33.3454,29.1103,32.0026		482/1407	139165272	8244,3880	1922	4140	6062	SO:0001819	synonymous_variant	51059	exon13			CTCACCTGGCTCT	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1446A>G	8.37:g.139165272T>C		180	1		146	8	NM_015912	0	0	0	0	0	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	ENST00000395297.1	37	CCDS6375.2																																																																																			T|0.330;C|0.670		0.393	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
FAM135B	51059	bcgsc.ca	37	8	139165289	139165289	+	Missense_Mutation	SNP	T	T	C	rs7835830	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr8:139165289T>C	ENST00000395297.1	-	13	1599	c.1429A>G	c.(1429-1431)Ata>Gta	p.I477V		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	477			I -> V (in dbSNP:rs7835830). {ECO:0000269|PubMed:15489334}.							NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GGACACCTTATAACTTCTTCA	0.373										HNSCC(54;0.14)			T|||	3597	0.718251	0.6785	0.7435	5008	,	,		18307	0.7718		0.6869	False		,,,				2504	0.7311				p.I477V		.											.	FAM135B-31	0			c.A1429G						.	T	VAL/ILE	2661,1135		946,769,183	106.0	100.0	102.0		1429	-2.3	0.0	8	dbSNP_116	102	5511,2753		1840,1831,461	yes	missense	FAM135B	NM_015912.3	29	2786,2600,644	CC,CT,TT		33.3132,29.8999,32.2388	benign	477/1407	139165289	8172,3888	1898	4132	6030	SO:0001583	missense	51059	exon13			ACCTTATAACTTC	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1429A>G	8.37:g.139165289T>C	ENSP00000378710:p.Ile477Val	163	1		129	7	NM_015912	0	0	0	0	0	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	ENST00000395297.1	37	CCDS6375.2	1582	0.7243589743589743	356	0.7235772357723578	254	0.7016574585635359	451	0.7884615384615384	521	0.6873350923482849	T	1.839	-0.467949	0.04476	0.701001	0.666868	ENSG00000147724	ENST00000395297	T	0.13538	2.58	5.3	-2.29	0.06805	.	2.726620	0.00783	N	0.001280	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	B;B;B	0.10296	0.003;0.001;0.0	B;B;B	0.09377	0.004;0.002;0.0	T	0.34403	-0.9830	9	0.19147	T	0.46	2.611	4.4732	0.11722	0.1358:0.0787:0.4948:0.2907	rs7835830;rs59872083;rs7835830	477;477;477	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	V	477	ENSP00000378710:I477V	ENSP00000276737:I477V	I	-	1	0	FAM135B	139234471	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.417000	0.02464	-0.180000	0.10637	0.533000	0.62120	ATA	T|0.289;C|0.711		0.373	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313590.3	NM_015912	
GPR20	2843	broad.mit.edu;bcgsc.ca	37	8	142367099	142367099	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr8:142367099G>A	ENST00000377741.3	-	2	1015	c.925C>T	c.(925-927)Cga>Tga	p.R309*	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	309					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			AAGAGGCCTCGGACGGTGGCC	0.642																																					p.R309X		.											.	GPR20-91	0			c.C925T						.						76.0	65.0	69.0					8																	142367099		2203	4300	6503	SO:0001587	stop_gained	2843	exon2			GGCCTCGGACGGT	U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.925C>T	8.37:g.142367099G>A	ENSP00000366970:p.Arg309*	111	0		146	7	NM_005293	0	0	0	0	0	Q17R96	Nonsense_Mutation	SNP	ENST00000377741.3	37	CCDS34949.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540250	0.85917	.	.	ENSG00000204882	ENST00000377741	.	.	.	5.21	5.21	0.72293	.	0.069606	0.53938	U	0.000046	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.9315	11.5928	0.50955	0.0:0.0:0.7154:0.2846	.	.	.	.	X	309	.	ENSP00000366970:R309X	R	-	1	2	GPR20	142436281	0.955000	0.32602	0.926000	0.36857	0.475000	0.33008	1.856000	0.39389	2.421000	0.82119	0.561000	0.74099	CGA	.		0.642	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378968.1	NM_005293	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		10	10	NM_030895	0	0	0	1	1	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	144997783	144997783	+	Missense_Mutation	SNP	G	G	A	rs74772299	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr8:144997783G>A	ENST00000322810.4	-	31	6894	c.6725C>T	c.(6724-6726)gCg>gTg	p.A2242V	PLEC_ENST00000398774.2_Missense_Mutation_p.A2073V|PLEC_ENST00000356346.3_Missense_Mutation_p.A2091V|PLEC_ENST00000357649.2_Missense_Mutation_p.A2109V|PLEC_ENST00000354589.3_Missense_Mutation_p.A2105V|PLEC_ENST00000354958.2_Missense_Mutation_p.A2083V|PLEC_ENST00000436759.2_Missense_Mutation_p.A2132V|PLEC_ENST00000345136.3_Missense_Mutation_p.A2105V|PLEC_ENST00000527096.1_Missense_Mutation_p.A2128V	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2242	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCGGGACTGCGCCGCCTCACG	0.756													G|||	327	0.0652955	0.0015	0.1354	5008	,	,		9813	0.0437		0.0368	False		,,,				2504	0.1534				p.A2242V		.											.	PLEC-141	0			c.C6725T						.	G	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	31,3509		0,31,1739	5.0	7.0	6.0		6314,6326,6314,6218,6725,6248,6272,6395	2.9	0.0	8	dbSNP_131	6	285,7369		1,283,3543	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	64,64,64,64,64,64,64,64	1,314,5282	AA,AG,GG		3.7235,0.8757,2.8229	benign,benign,benign,benign,benign,benign,benign,benign	2105/4548,2109/4552,2105/4548,2073/4516,2242/4685,2083/4526,2091/4534,2132/4575	144997783	316,10878	1770	3827	5597	SO:0001583	missense	5339	exon31			GACTGCGCCGCCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6725C>T	8.37:g.144997783G>A	ENSP00000323856:p.Ala2242Val	0	0		4	4	NM_201380	0	0	2	3	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	90	0.04120879120879121	1	0.0020325203252032522	43	0.11878453038674033	20	0.03496503496503497	26	0.03430079155672823	G	7.181	0.589567	0.13812	0.008757	0.037235	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.77750	-1.09;-1.09;-1.12;-1.12;-1.1;-1.09;-1.08;-1.09;-1.09	4.76	2.93	0.34026	.	0.181251	0.33110	U	0.005270	T	0.02230	0.0069	L	0.57536	1.79	0.09310	N	1	B;B;B;B;B;B;B;B	0.28971	0.229;0.229;0.229;0.147;0.229;0.229;0.229;0.229	B;B;B;B;B;B;B;B	0.24269	0.052;0.052;0.052;0.023;0.052;0.052;0.052;0.052	T	0.06917	-1.0800	10	0.44086	T	0.13	.	5.8336	0.18594	0.0785:0.1365:0.644:0.141	.	2132;2091;2083;2242;2073;2105;2109;2105	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	V	2105;2109;2105;2073;2242;2083;2091;2132;2128	ENSP00000344848:A2105V;ENSP00000350277:A2109V;ENSP00000346602:A2105V;ENSP00000381756:A2073V;ENSP00000323856:A2242V;ENSP00000347044:A2083V;ENSP00000348702:A2091V;ENSP00000388180:A2132V;ENSP00000434583:A2128V	ENSP00000323856:A2242V	A	-	2	0	PLEC	145069771	0.093000	0.21703	0.001000	0.08648	0.634000	0.38068	2.548000	0.45794	0.419000	0.25927	0.448000	0.29417	GCG	G|0.960;A|0.040		0.756	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998514	144998514	+	Silent	SNP	C	C	T	rs75586449	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr8:144998514C>T	ENST00000322810.4	-	31	6163	c.5994G>A	c.(5992-5994)gcG>gcA	p.A1998A	PLEC_ENST00000398774.2_Silent_p.A1829A|PLEC_ENST00000356346.3_Silent_p.A1847A|PLEC_ENST00000357649.2_Silent_p.A1865A|PLEC_ENST00000354589.3_Silent_p.A1861A|PLEC_ENST00000354958.2_Silent_p.A1839A|PLEC_ENST00000436759.2_Silent_p.A1888A|PLEC_ENST00000345136.3_Silent_p.A1861A|PLEC_ENST00000527096.1_Silent_p.A1884A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1998	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTCGTTCTCCGCCTCCTTCT	0.726													T|||	349	0.0696885	0.0113	0.1412	5008	,	,		11250	0.0437		0.0358	False		,,,				2504	0.1595				p.A1998A		.											.	PLEC-141	0			c.G5994A						.	T	,,,,,,,	38,3548		0,38,1755	7.0	9.0	8.0		5664,5541,5517,5994,5487,5583,5595,5583	-5.2	0.8	8	dbSNP_131	8	272,7344		2,268,3538	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	2,306,5293	TT,TC,CC		3.5714,1.0597,2.7674	,,,,,,,	1888/4575,1847/4534,1839/4526,1998/4685,1829/4516,1861/4548,1865/4552,1861/4548	144998514	310,10892	1793	3808	5601	SO:0001819	synonymous_variant	5339	exon31			GTTCTCCGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5994G>A	8.37:g.144998514C>T		0	0		19	14	NM_201380	0	0	0	1	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.961;T|0.039		0.726	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000527096.1_Silent_p.L1207L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		0	0		26	4	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
NIPSNAP3A	25934	bcgsc.ca	37	9	107515214	107515214	+	Missense_Mutation	SNP	G	G	A	rs2274870	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr9:107515214G>A	ENST00000374767.4	+	3	404	c.299G>A	c.(298-300)cGg>cAg	p.R100Q		NM_015469.1	NP_056284.1	Q9UFN0	NPS3A_HUMAN	nipsnap homolog 3A (C. elegans)	100			R -> Q (in dbSNP:rs2274870). {ECO:0000269|PubMed:14702039}.			cytoplasm (GO:0005737)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	8						ACTGAAGTTCGGAAAGCCTTG	0.343													G|||	3193	0.63758	0.7648	0.7118	5008	,	,		17454	0.5228		0.6173	False		,,,				2504	0.5521				p.R100Q		.											.	NIPSNAP3A-90	0			c.G299A						.	G	GLN/ARG	3317,1089	719.0+/-408.9	1244,829,130	87.0	84.0	85.0		299	1.3	1.0	9	dbSNP_100	85	5471,3129	655.9+/-401.3	1772,1927,601	yes	missense	NIPSNAP3A	NM_015469.1	43	3016,2756,731	AA,AG,GG		36.3837,24.7163,32.4312		100/248	107515214	8788,4218	2203	4300	6503	SO:0001583	missense	25934	exon3			AAGTTCGGAAAGC	BC005935	CCDS6760.1	9q31.3	2003-11-27			ENSG00000136783	ENSG00000136783			23619	protein-coding gene	gene with protein product		608871				12477932	Standard	NM_015469		Approved	DKFZp564D177, FLJ13953, HSPC299, MGC14553		Q9UFN0	OTTHUMG00000020413	ENST00000374767.4:c.299G>A	9.37:g.107515214G>A	ENSP00000363899:p.Arg100Gln	167	0		133	5	NM_015469	0	0	24	24	0	A6NM55|Q5VX32|Q9BRV7|Q9H843|Q9P083	Missense_Mutation	SNP	ENST00000374767.4	37	CCDS6760.1	1409	0.6451465201465202	378	0.7682926829268293	250	0.6906077348066298	317	0.5541958041958042	464	0.6121372031662269	G	21.6	4.179941	0.78564	0.752837	0.636163	ENSG00000136783	ENST00000374767	T	0.67698	-0.28	5.4	1.26	0.21427	Dimeric alpha-beta barrel (1);	0.054700	0.64402	N	0.000001	T	0.00012	0.0000	M	0.92317	3.295	0.28152	P	0.929344	P;P	0.52061	0.95;0.95	P;B	0.51615	0.675;0.43	T	0.42447	-0.9451	9	0.48119	T	0.1	.	6.5591	0.22476	0.2114:0.0:0.6626:0.126	rs2274870;rs60079462;rs2274870	100;100	B4DW81;Q9UFN0	.;NPS3A_HUMAN	Q	100	ENSP00000363899:R100Q	ENSP00000363899:R100Q	R	+	2	0	NIPSNAP3A	106555035	0.970000	0.33590	0.989000	0.46669	0.986000	0.74619	0.876000	0.28092	0.243000	0.21327	0.655000	0.94253	CGG	G|0.331;A|0.669		0.343	NIPSNAP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053484.1	NM_015469	
COL27A1	85301	bcgsc.ca	37	9	116967405	116967405	+	Silent	SNP	G	G	T	rs13290696	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr9:116967405G>T	ENST00000356083.3	+	8	2539	c.2148G>T	c.(2146-2148)ccG>ccT	p.P716P		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	716	Collagen-like 2.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						ATCCTGGACCGGCAGGGCACC	0.667													G|||	399	0.0796725	0.0416	0.0331	5008	,	,		17714	0.0208		0.0785	False		,,,				2504	0.226				p.P716P		.											.	COL27A1-94	0			c.G2148T						.	G		222,4184	132.5+/-169.0	5,212,1986	66.0	53.0	57.0		2148	-10.1	0.0	9	dbSNP_121	57	821,7779	189.3+/-236.1	34,753,3513	no	coding-synonymous	COL27A1	NM_032888.2		39,965,5499	TT,TG,GG		9.5465,5.0386,8.0194		716/1861	116967405	1043,11963	2203	4300	6503	SO:0001819	synonymous_variant	85301	exon8			TGGACCGGCAGGG	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.2148G>T	9.37:g.116967405G>T		68	0		50	4	NM_032888	0	0	1	1	0	Q66K43|Q96JF7	Silent	SNP	ENST00000356083.3	37	CCDS6802.1																																																																																			G|0.931;T|0.069		0.667	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053763.1	NM_032888	
LMX1B	4010	broad.mit.edu	37	9	129376842	129376843	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr9:129376842_129376843insC	ENST00000373474.4	+	1	121_122	c.114_115insC	c.(115-117)cccfs	p.P39fs	RP11-123K19.1_ENST00000432418.1_RNA|RP11-123K19.1_ENST00000451449.2_RNA|LMX1B_ENST00000561065.1_Frame_Shift_Ins_p.P16fs|RP11-123K19.1_ENST00000425370.1_RNA|LMX1B_ENST00000526117.1_Frame_Shift_Ins_p.P39fs|LMX1B_ENST00000355497.5_Frame_Shift_Ins_p.P39fs|LMX1B_ENST00000425646.2_Frame_Shift_Ins_p.P16fs			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	39					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						TGCGCCCCGGGCCCGCCACTCT	0.708									Nail-Patella Syndrome																												p.G38fs	Pancreas(110;1796 2278 18357 20466)	.											.	LMX1B-90	0			c.114_115insC						.																																			SO:0001589	frameshift_variant	4010	exon1	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	CCCCGGGCCCGCC	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.117dupC	9.37:g.129376845_129376845dupC	ENSP00000362573:p.Pro39fs	59	0		119	8	NM_002316	0	0	0	0	0	F8W7W6|O75463|Q5JU95|Q6ISC9	Frame_Shift_Ins	INS	ENST00000373474.4	37	CCDS55342.1																																																																																			.		0.708	LMX1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054123.2		
CACNA1B	774	hgsc.bcm.edu	37	9	140917779	140917779	+	Missense_Mutation	SNP	G	G	T	rs7873074	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr9:140917779G>T	ENST00000371372.1	+	19	2729	c.2584G>T	c.(2584-2586)Gcg>Tcg	p.A862S	CACNA1B_ENST00000371367.5_5'Flank|CACNA1B_ENST00000545473.1_5'Flank|CACNA1B_ENST00000371363.1_Missense_Mutation_p.A862S|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A862S|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A863S|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A863S|CACNA1B_ENST00000277549.5_Missense_Mutation_p.A54S	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	862			A -> S (in dbSNP:rs7873074).		calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CAAGACCCCCGCGGCGGGGGA	0.771													G|||	2138	0.426917	0.7292	0.1383	5008	,	,		8593	0.6339		0.1541	False		,,,				2504	0.2904				p.A862S		.											.	CACNA1B-138	0			c.G2584T						.						1.0	1.0	1.0					9																	140917779		1024	2272	3296	SO:0001583	missense	774	exon19			ACCCCCGCGGCGG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.2584G>T	9.37:g.140917779G>T	ENSP00000360423:p.Ala862Ser	0	0		6	6	NM_001243812	0	0	0	0	0	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	871	0.39880952380952384	351	0.7134146341463414	42	0.11602209944751381	361	0.6311188811188811	117	0.15435356200527706	G	2.404	-0.336886	0.05278	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.96685	-3.87;-3.88;-4.09;-3.88;-3.86;-3.86	2.64	2.64	0.31445	.	607.713000	0.00166	N	0.000000	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P;P;P	0.41748	0.731;0.761;0.612	B;B;B	0.32149	0.071;0.141;0.081	T	0.48559	-0.9025	9	0.07813	T	0.8	.	8.5047	0.33179	0.0:0.0:1.0:0.0	rs7873074;rs57704776	862;863;862	B1AQK4;B1AQK7;B1AQK6	.;.;.	S	862;862;54;862;863;863	ENSP00000360423:A862S;ENSP00000277551:A862S;ENSP00000277549:A54S;ENSP00000360414:A862S;ENSP00000360408:A863S;ENSP00000360406:A863S	ENSP00000277549:A54S	A	+	1	0	CACNA1B	140037600	0.000000	0.05858	0.012000	0.15200	0.095000	0.18619	-0.158000	0.10070	1.290000	0.44636	0.455000	0.32223	GCG	G|0.601;T|0.399		0.771	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
KNDC1	85442	hgsc.bcm.edu	37	10	135012429	135012430	+	Missense_Mutation	DNP	TT	TT	AC	rs386749477|rs3008390|rs3008389	byFrequency	TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr10:135012429_135012430TT>AC	ENST00000304613.3	+	14	2438_2439	c.2417_2418TT>AC	c.(2416-2418)gTT>gAC	p.V806D	KNDC1_ENST00000368572.2_Missense_Mutation_p.V806D|KNDC1_ENST00000368571.2_Missense_Mutation_p.V741D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCACCTGGAGTTGCTTCCGGGG	0.748																																					p.V806D		.											.	KNDC1-229	0			c.T2418C						.																																			SO:0001583	missense	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	Exception_encountered	10.37:g.135012429_135012430delinsAC	ENSP00000304437:p.Val806Asp	0	0		7	0	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	DNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.748	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KDM6B	23135	hgsc.bcm.edu	37	17	7750176	7750177	+	Missense_Mutation	DNP	TT	TT	CC	rs375218857|rs61462443		TCGA-OR-A5JL-01A-11D-A29I-10	TCGA-OR-A5JL-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8f0c115d-1ae8-4660-8454-e09ef9150f48	11736376-4bb5-4a2d-b14a-f01a651e41eb	g.chr17:7750176_7750177TT>CC	ENST00000448097.2	+	9	1082_1083	c.751_752TT>CC	c.(751-753)TTa>CCa	p.L251P	KDM6B_ENST00000254846.5_Missense_Mutation_p.L251P			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	251	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						tccaccaccattaccaccacca	0.614																																					p.L251P		.											.	KDM6B-205	0			c.T752C						.																																			SO:0001583	missense	23135	exon9			CACCATTACCACC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		Exception_encountered	17.37:g.7750176_7750177delinsCC	ENSP00000412513:p.Leu251Pro	19	0		10	1	NM_001080424	0	0	0	0	0	C9IZ40|Q96G33	Missense_Mutation	DNP	ENST00000448097.2	37																																																																																				.		0.614	KDM6B-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000440248.1	XM_043272	
