#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ACTRT2	140625	bcgsc.ca	37	1	2938569	2938569	+	Silent	SNP	C	C	T	rs35806103	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:2938569C>T	ENST00000378404.2	+	1	524	c.319C>T	c.(319-321)Ctg>Ttg	p.L107L		NM_080431.4	NP_536356.3	Q8TDY3	ACTT2_HUMAN	actin-related protein T2	107						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_cancers(77;0.00205)|all_epithelial(69;0.0011)|Ovarian(185;0.0634)|Lung NSC(156;0.0893)|all_lung(157;0.0909)	all_epithelial(116;2.66e-20)|all_lung(118;1.56e-08)|Lung NSC(185;2.54e-06)|Breast(487;0.00156)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;7.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.15e-22)|GBM - Glioblastoma multiforme(42;1.1e-12)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.000329)|BRCA - Breast invasive adenocarcinoma(365;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.125)		CGACCAGCCCCTGCTTGCAAC	0.597													C|||	186	0.0371406	0.1074	0.0418	5008	,	,		18299	0.0		0.0149	False		,,,				2504	0.0				p.L107L		.											.	ACTRT2-90	0			c.C319T						.	C		396,4010	197.1+/-221.3	10,376,1817	78.0	77.0	77.0		319	1.9	0.5	1	dbSNP_126	77	92,8508	52.3+/-112.8	0,92,4208	no	coding-synonymous	ACTRT2	NM_080431.4		10,468,6025	TT,TC,CC		1.0698,8.9877,3.7521		107/378	2938569	488,12518	2203	4300	6503	SO:0001819	synonymous_variant	140625	exon1			CAGCCCCTGCTTG	AF440740, AB057364	CCDS45.1	1p36.3	2008-02-05	2005-11-22		ENSG00000169717	ENSG00000169717			24026	protein-coding gene	gene with protein product		608535				11750065, 12243744	Standard	NM_080431		Approved	Arp-T2, ARPM2, FLJ25424	uc001ajz.3	Q8TDY3	OTTHUMG00000000562	ENST00000378404.2:c.319C>T	1.37:g.2938569C>T		154	2		109	5	NM_080431	0	0	0	0	0	B1AN52|Q8NHS6|Q8TDG1	Silent	SNP	ENST00000378404.2	37	CCDS45.1																																																																																			C|0.963;T|0.037		0.597	ACTRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001331.1	NM_080431	
LRRC38	126755	broad.mit.edu	37	1	13802325	13802325	+	Missense_Mutation	SNP	T	T	C	rs3013105	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:13802325T>C	ENST00000376085.3	-	2	1328	c.874A>G	c.(874-876)Aag>Gag	p.K292E		NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	292			K -> E (in dbSNP:rs3013105).		ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CAGTCATCCTTGTCCTCGTCT	0.557													C|||	2314	0.462061	0.5242	0.3357	5008	,	,		20308	0.62		0.3837	False		,,,				2504	0.3855				p.K292E		.											.	.	0			c.A874G						.																																			SO:0001583	missense	126755	exon2			CATCCTTGTCCTC	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.874A>G	1.37:g.13802325T>C	ENSP00000365253:p.Lys292Glu	103	1		81	4	NM_001010847	0	0	0	0	0	Q96B32	Missense_Mutation	SNP	ENST00000376085.3	37	CCDS53269.1	1039	0.4757326007326007	254	0.516260162601626	134	0.3701657458563536	362	0.6328671328671329	289	0.3812664907651715	.	0.018	-1.483234	0.01027	.	.	ENSG00000162494	ENST00000376085	T	0.59224	0.28	5.25	5.25	0.73442	.	0.491849	0.20946	N	0.082822	T	0.00012	0.0000	N	0.00246	-1.78	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.46005	-0.9222	9	0.02654	T	1	.	5.2956	0.15751	0.1637:0.6687:0.0:0.1676	rs3013105;rs3795751;rs60739508;rs3013105	292	Q5VT99	LRC38_HUMAN	E	292	ENSP00000365253:K292E	ENSP00000365253:K292E	K	-	1	0	LRRC38	13674912	0.048000	0.20356	0.701000	0.30321	0.084000	0.17831	1.002000	0.29796	1.225000	0.43566	-0.215000	0.12644	AAG	C|0.487;N|0.000		0.557	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
MED8	112950	ucsc.edu	37	1	43850152	43850152	+	3'UTR	SNP	C	C	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:43850152C>T	ENST00000372457.4	-	0	1411				MED8_ENST00000290663.6_Missense_Mutation_p.G292E|RP1-92O14.6_ENST00000436713.1_RNA	NM_001001653.2|NM_201542.3	NP_001001653.1|NP_963836.2	Q96G25	MED8_HUMAN	mediator complex subunit 8						gene expression (GO:0010467)|protein ubiquitination (GO:0016567)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(2)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	9	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATTTTTTTTTCCTTCCTGGCC	0.502																																					p.G292E		.											.	MED8-68	0			c.G875A						.						68.0	69.0	69.0					1																	43850152		2203	4300	6503	SO:0001624	3_prime_UTR_variant	112950	exon8			TTTTTTCCTTCCT	AF521562, BC010543	CCDS486.2, CCDS487.2, CCDS60108.1	1p34.1	2008-02-05	2007-07-30		ENSG00000159479	ENSG00000159479			19971	protein-coding gene	gene with protein product		607956	"""mediator of RNA polymerase II transcription, subunit 8 homolog (S. cerevisiae)"""			12149480, 9671713	Standard	NM_052877		Approved	MGC17544, MGC19641, ARC32	uc001cje.2	Q96G25	OTTHUMG00000007421	ENST00000372457.4:c.*561G>A	1.37:g.43850152C>T		127	1		128	4	NM_052877	0	0	3	4	1	A9IZ91|A9IZ92|Q5JUY8|Q96FQ4	Missense_Mutation	SNP	ENST00000372457.4	37	CCDS487.2	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.592633	0.00008	.	.	ENSG00000159479	ENST00000290663	.	.	.	0.217	-0.433	0.12287	.	7.968160	0.00166	N	0.000005	T	0.29945	0.0749	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13495	-1.0507	7	0.87932	D	0	.	.	.	.	.	292	Q96G25-2	.	E	292	.	ENSP00000290663:G292E	G	-	2	0	MED8	43622739	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.988000	0.01482	-1.916000	0.01075	-1.892000	0.00534	GGA	.		0.502	MED8-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318959.1	NM_052877	
HRNR	388697	bcgsc.ca	37	1	152189029	152189029	+	Silent	SNP	A	A	G	rs76438416	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:152189029A>G	ENST00000368801.2	-	3	5151	c.5076T>C	c.(5074-5076)caT>caC	p.H1692H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1692					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCAGACCCATGCTGACCAT	0.617																																					p.H1692H		.											.	HRNR-93	0			c.T5076C						.						63.0	73.0	69.0					1																	152189029		1645	3201	4846	SO:0001819	synonymous_variant	388697	exon3			AGACCCATGCTGA	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5076T>C	1.37:g.152189029A>G		575	26		399	42	NM_001009931	0	0	7	7	0	Q5DT20|Q5U1F4	Silent	SNP	ENST00000368801.2	37	CCDS30859.1																																																																																			A|0.993;G|0.007		0.617	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
RABGAP1L	9910	broad.mit.edu	37	1	174210750	174210750	+	Silent	SNP	G	G	A	rs144504710		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:174210750G>A	ENST00000251507.4	+	5	846	c.672G>A	c.(670-672)tcG>tcA	p.S224S	RABGAP1L_ENST00000357444.6_Silent_p.S187S|RABGAP1L_ENST00000367689.3_5'UTR	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						CCCATGGTTCGGAAGAATTTC	0.353													A|||	1	0.000199681	0.0	0.0	5008	,	,		16012	0.0		0.001	False		,,,				2504	0.0				p.S224S		.											.	RABGAP1L-540	0			c.G672A						.	A		0,4406		0,0,2203	78.0	76.0	77.0		672	4.3	1.0	1	dbSNP_134	77	9,8591	818.5+/-406.9	0,9,4291	no	coding-synonymous	RABGAP1L	NM_014857.4		0,9,6494	AA,AG,GG		0.1047,0.0,0.0692		224/816	174210750	9,12997	2203	4300	6503	SO:0001819	synonymous_variant	9910	exon5			TGGTTCGGAAGAA	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.672G>A	1.37:g.174210750G>A		87	0		100	4	NM_014857	0	0	6	6	0	B7ZAA4	Silent	SNP	ENST00000251507.4	37	CCDS1314.1																																																																																			G|0.999;A|0.001		0.353	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084497.1	NM_001243765	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	0	0		6	4	NM_022371	0	0	0	2	2	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
OBSCN	84033	hgsc.bcm.edu	37	1	228504670	228504670	+	Missense_Mutation	SNP	C	C	T	rs11810627	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:228504670C>T	ENST00000422127.1	+	51	13590	c.13546C>T	c.(13546-13548)Cgg>Tgg	p.R4516W	OBSCN_ENST00000366709.4_Missense_Mutation_p.R1635W|OBSCN_ENST00000284548.11_Missense_Mutation_p.R4516W|OBSCN_ENST00000366707.4_Missense_Mutation_p.R2150W|OBSCN_ENST00000570156.2_Missense_Mutation_p.R5473W	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4516	Ig-like 46.		R -> W (in dbSNP:rs11810627).		apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCTCTGCGCGGCTCACCGT	0.736													c|||	1654	0.330272	0.2791	0.4006	5008	,	,		13971	0.249		0.4861	False		,,,				2504	0.273				p.R5473W		.											.	OBSCN-403	0			c.C16417T						.		TRP/ARG,TRP/ARG	923,2833		165,593,1120	5.0	6.0	6.0		13546,13546	-1.0	0.0	1	dbSNP_120	6	3333,4245		861,1611,1317	yes	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	101,101	1026,2204,2437	TT,TC,CC		43.9826,24.574,37.5507	probably-damaging,probably-damaging	4516/7969,4516/6621	228504670	4256,7078	1878	3789	5667	SO:0001583	missense	84033	exon62			TCTGCGCGGCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13546C>T	1.37:g.228504670C>T	ENSP00000409493:p.Arg4516Trp	0	0		22	19	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	774	0.3543956043956044	137	0.2784552845528455	144	0.39779005524861877	134	0.23426573426573427	359	0.4736147757255937	c	11.94	1.787178	0.31593	0.24574	0.439826	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.77098	-1.07;-1.07;0.2;0.2	5.41	-0.971	0.10303	Immunoglobulin subtype (1);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.167607	0.36519	N	0.002550	T	0.00012	0.0000	L	0.41824	1.3	0.50632	P	1.1499999999997623E-4	B;B	0.22541	0.071;0.067	B;B	0.12156	0.007;0.007	T	0.42275	-0.9461	9	0.45353	T	0.12	.	10.3619	0.43998	0.6084:0.317:0.0:0.0747	rs11810627	4516;4516	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	W	4516;4516;2150;1635	ENSP00000284548:R4516W;ENSP00000409493:R4516W;ENSP00000355668:R2150W;ENSP00000355670:R1635W	ENSP00000284548:R4516W	R	+	1	2	OBSCN	226571293	0.968000	0.33430	0.013000	0.15412	0.016000	0.09150	2.032000	0.41127	-0.028000	0.13850	0.550000	0.68814	CGG	C|0.643;T|0.357		0.736	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ARID4B	51742	broad.mit.edu	37	1	235377221	235377221	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:235377221G>T	ENST00000264183.3	-	17	2201	c.1704C>A	c.(1702-1704)tgC>tgA	p.C568*	ARID4B_ENST00000366603.2_Nonsense_Mutation_p.C568*|ARID4B_ENST00000349213.3_Intron	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	568				C -> S (in Ref. 4; BAA89794). {ECO:0000305}.	histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			CTGGTGGATAGCACTCAAACT	0.428																																					p.C568X		.											.	ARID4B-228	0			c.C1704A						.						290.0	278.0	282.0					1																	235377221		2203	4300	6503	SO:0001587	stop_gained	51742	exon17			TGGATAGCACTCA	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.1704C>A	1.37:g.235377221G>T	ENSP00000264183:p.Cys568*	118	0		116	4	NM_016374	0	0	6	6	0	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Nonsense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.734459|5.734459	0.96865|0.96865	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000444620|ENST00000391856;ENST00000366603;ENST00000264183;ENST00000439834	.|.	.|.	.|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	.|0.147363	.|0.64402	.|D	.|0.000005	T|.	0.35711|.	0.0941|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.32824|.	-0.9892|.	3|.	.|0.05525	.|T	.|0.97	-5.8813|-5.8813	13.9636|13.9636	0.64196|0.64196	0.0724:0.0:0.9276:0.0|0.0724:0.0:0.9276:0.0	.|.	.|.	.|.	.|.	D|X	4|568	.|.	.|ENSP00000264183:C568X	A|C	-|-	2|3	0|2	ARID4B|ARID4B	233443844|233443844	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.324000|5.324000	0.65863|0.65863	2.665000|2.665000	0.90641|0.90641	0.650000|0.650000	0.86243|0.86243	GCT|TGC	.		0.428	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095566.3	NM_016374	
ZP4	57829	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	238048868	238048868	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr1:238048868C>T	ENST00000366570.4	-	8	1141	c.983G>A	c.(982-984)gGc>gAc	p.G328D	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	328	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GTAGTAAGAGCCATAGTTTTT	0.483																																					p.G328D	NSCLC(166;160 2029 11600 18754 19936)	.											.	ZP4-93	0			c.G983A						.						54.0	53.0	54.0					1																	238048868		2203	4300	6503	SO:0001583	missense	57829	exon8			TAAGAGCCATAGT	U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.983G>A	1.37:g.238048868C>T	ENSP00000355529:p.Gly328Asp	160	0		161	27	NM_021186	0	0	0	0	0	B2RAE1	Missense_Mutation	SNP	ENST00000366570.4	37	CCDS1615.1	.	.	.	.	.	.	.	.	.	.	C	9.901	1.206890	0.22205	.	.	ENSG00000116996	ENST00000366570	D	0.81739	-1.53	4.95	3.04	0.35103	Zona pellucida sperm-binding protein (3);	1.013960	0.07885	N	0.970119	T	0.80904	0.4713	M	0.66939	2.045	0.09310	N	1	P	0.37276	0.589	P	0.46208	0.507	T	0.63332	-0.6661	10	0.12430	T	0.62	-0.263	6.1484	0.20298	0.3281:0.5835:0.0:0.0884	.	328	Q12836	ZP4_HUMAN	D	328	ENSP00000355529:G328D	ENSP00000355529:G328D	G	-	2	0	ZP4	236115491	0.000000	0.05858	0.049000	0.19019	0.064000	0.16182	-0.677000	0.05215	0.475000	0.27415	0.655000	0.94253	GGC	.		0.483	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095476.1		
WDR37	22884	hgsc.bcm.edu	37	10	1094906	1094906	+	5'Flank	SNP	C	C	T	rs7091756	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr10:1094906C>T	ENST00000358220.1	+	0	0				IDI1_ENST00000491735.1_5'UTR|IDI1_ENST00000381344.3_Missense_Mutation_p.C13Y			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37											breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ccgggccgcgcAGCCAATCGC	0.721													C|||	154	0.0307508	0.0038	0.0317	5008	,	,		13577	0.0		0.0368	False		,,,				2504	0.092				p.C13Y		.											.	IDI1-90	0			c.G38A						.	C	TYR/CYS	42,3924		1,40,1942	4.0	6.0	5.0		38	-3.5	0.0	10	dbSNP_116	5	362,7338		7,348,3495	no	missense	IDI1	NM_004508.2	194	8,388,5437	TT,TC,CC		4.7013,1.059,3.4631	benign	13/285	1094906	404,11262	1983	3850	5833	SO:0001631	upstream_gene_variant	3422	exon1			GCCGCGCAGCCAA	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540		10.37:g.1094906C>T	Exception_encountered	1	0		7	6	NM_004508	0	0	0	3	3	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	CCDS7057.1	45	0.020604395604395604	5	0.01016260162601626	9	0.024861878453038673	0	0.0	31	0.040897097625329816	C	0.031	-1.335823	0.01287	0.01059	0.047013	ENSG00000067064	ENST00000381344	.	.	.	1.77	-3.54	0.04653	.	3.373570	0.01792	U	0.032349	T	0.01940	0.0061	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17715	-1.0360	8	0.02654	T	1	.	4.1354	0.10169	0.0:0.2425:0.3482:0.4093	rs7091756;rs7091756	13	Q13907-2	.	Y	13	.	ENSP00000370748:C13Y	C	-	2	0	IDI1	1084906	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.721000	0.01870	-1.854000	0.01163	-0.350000	0.07774	TGC	C|0.981;T|0.019		0.721	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	42	0		67	11	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
NRXN2	9379	broad.mit.edu;bcgsc.ca	37	11	64428611	64428611	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr11:64428611C>A	ENST00000377551.1	-	9	2010	c.1799G>T	c.(1798-1800)gGc>gTc	p.G600V	NRXN2_ENST00000265459.6_Splice_Site_p.G600V|NRXN2_ENST00000496291.1_5'UTR|AP001092.4_ENST00000433606.1_RNA|NRXN2_ENST00000409571.1_Splice_Site_p.G593V|NRXN2_ENST00000377559.3_Splice_Site_p.G569V			Q9P2S2	NRX2A_HUMAN	neurexin 2	600	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGAGATGGAGCCTGGGAATCA	0.597																																					p.G600V		.											.	NRXN2-232	0			c.G1799T						.						26.0	30.0	28.0					11																	64428611		2198	4296	6494	SO:0001630	splice_region_variant	9379	exon10			ATGGAGCCTGGGA		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1799-1G>T	11.37:g.64428611C>A		74	0		35	8	NM_015080	0	0	0	0	0	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377931	0.82682	.	.	ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	4.8	4.8	0.61643	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.43416	U	0.000570	D	0.83087	0.5178	L	0.52905	1.665	0.80722	D	1	D;D;D	0.89917	1.0;0.987;0.999	D;P;D	0.97110	1.0;0.884;0.994	D	0.84799	0.0783	10	0.87932	D	0	.	15.3943	0.74778	0.0:1.0:0.0:0.0	.	569;600;346	Q9P2S2-2;Q9P2S2;E7EV67	.;NRX2A_HUMAN;.	V	600;569;600;569;593	ENSP00000366774:G600V;ENSP00000366782:G569V;ENSP00000265459:G600V;ENSP00000386416:G593V	ENSP00000265459:G600V	G	-	2	0	NRXN2	64185187	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	5.772000	0.68889	2.496000	0.84212	0.555000	0.69702	GGC	.		0.597	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	Missense_Mutation
DPAGT1	1798	broad.mit.edu	37	11	118969143	118969143	+	Frame_Shift_Del	DEL	A	A	-	rs35482889		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr11:118969143delA	ENST00000409993.2	-	7	2249	c.698delT	c.(697-699)ttcfs	p.F233fs	DPAGT1_ENST00000445653.1_5'Flank|DPAGT1_ENST00000354202.4_Frame_Shift_Del_p.F233fs|H2AFX_ENST00000530167.1_5'Flank|DPAGT1_ENST00000432443.2_Frame_Shift_Del_p.F126fs			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	233					cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)	p.?(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		CAAAGTGGTGAAAAAAAAGGG	0.438																																					p.F233fs		.											.	DPAGT1-221	1	Unknown(1)	skin(1)	c.698delT						.						197.0	180.0	186.0					11																	118969143		2200	4295	6495	SO:0001589	frameshift_variant	1798	exon5			GTGGTGAAAAAAA	Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.698delT	11.37:g.118969143delA	ENSP00000386597:p.Phe233fs	215	0		183	7	NM_001382	0	0	0	0	0	O15216|Q86WV9|Q9BWE6	Frame_Shift_Del	DEL	ENST00000409993.2	37	CCDS8411.1																																																																																			.		0.438	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331527.2	NM_001382	
TAS2R43	259289	ucsc.edu	37	12	11244194	11244194	+	Missense_Mutation	SNP	T	T	C	rs71443637	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr12:11244194T>C	ENST00000531678.1	-	1	718	c.635A>G	c.(634-636)cAt>cGt	p.H212R	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	212				H -> R (in Ref. 1; AAM19328, 3; AAU21145 and 5; AAI17424). {ECO:0000305}.	detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TCCTTTACCATGGAGCTGCAT	0.408													.|||	3114	0.621805	0.0998	0.7104	5008	,	,		13446	0.9425		0.7525	False		,,,				2504	0.7996				p.H212R		.											.	TAS2R43-1	0			c.A635G						.						123.0	99.0	107.0					12																	11244194		2155	4165	6320	SO:0001583	missense	259289	exon1			TTACCATGGAGCT	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.635A>G	12.37:g.11244194T>C	ENSP00000431719:p.His212Arg	18	0		29	4	NM_176884	0	0	1	1	0	P59546|Q645X4	Missense_Mutation	SNP	ENST00000531678.1	37	CCDS53749.1	949	0.43452380952380953	28	0.056910569105691054	163	0.45027624309392267	439	0.7674825174825175	319	0.420844327176781	-	2.129	-0.399500	0.04865	.	.	ENSG00000255374	ENST00000531678	T	0.00737	5.76	1.45	-1.32	0.09201	.	.	.	.	.	T	0.00012	0.0000	M	0.86178	2.8	0.80722	P	0.0	.	.	.	.	.	.	T	0.07028	-1.0794	6	0.52906	T	0.07	.	4.3248	0.11034	0.0:0.4339:0.0:0.5661	.	.	.	.	R	212	ENSP00000431719:H212R	ENSP00000431719:H212R	H	-	2	0	TAS2R43	11135461	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.381000	0.07417	-0.374000	0.07967	-1.273000	0.01405	CAT	T|0.599;C|0.401		0.408	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
SLCO1A2	6579	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	21445134	21445134	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr12:21445134G>T	ENST00000307378.6	-	13	2294	c.1574C>A	c.(1573-1575)tCt>tAt	p.S525Y	SLCO1A2_ENST00000458504.1_Missense_Mutation_p.S393Y|SLCO1A2_ENST00000390670.3_Missense_Mutation_p.S523Y|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.S525Y|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.S393Y	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	525					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.S525Y(1)		breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	GGCAGCCAAAGAATAAATGAA	0.378																																					p.S525Y		.											.	SLCO1A2-157	1	Substitution - Missense(1)	large_intestine(1)	c.C1574A						.						35.0	35.0	35.0					12																	21445134		2203	4300	6503	SO:0001583	missense	6579	exon13			GCCAAAGAATAAA		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.1574C>A	12.37:g.21445134G>T	ENSP00000305974:p.Ser525Tyr	42	0		51	16	NM_134431	0	0	0	0	0	Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	37	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183382	0.78677	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;1.01	5.09	5.09	0.68999	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.300687	0.37261	N	0.002177	T	0.81702	0.4878	M	0.92555	3.32	0.51482	D	0.999922	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	D	0.85969	0.1475	10	0.72032	D	0.01	.	16.8549	0.86003	0.0:0.0:1.0:0.0	.	523;525	P46721-2;P46721	.;SO1A2_HUMAN	Y	525;525;393;393;523	ENSP00000305974:S525Y;ENSP00000393973:S525Y;ENSP00000394854:S393Y;ENSP00000439401:S393Y;ENSP00000375088:S523Y	ENSP00000305974:S525Y	S	-	2	0	SLCO1A2	21336401	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.336000	0.79245	2.646000	0.89796	0.563000	0.77884	TCT	.		0.378	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
HNRNPA1	3178	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54676958	54676958	+	Missense_Mutation	SNP	G	G	A	rs375259222		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr12:54676958G>A	ENST00000340913.6	+	8	900	c.847G>A	c.(847-849)Ggg>Agg	p.G283R	HNRNPA1_ENST00000547276.1_Intron|RP11-968A15.8_ENST00000553061.1_RNA|HNRNPA1_ENST00000330752.8_Intron|HNRNPA1_ENST00000546500.1_Intron	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	283	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						TGGCTATGGCGGGAGTGGCAG	0.562																																					p.G283R	Colon(83;502 1289 8436 16406 24870)	.											.	HNRNPA1-93	0			c.G847A						.						41.0	56.0	51.0					12																	54676958		2015	4156	6171	SO:0001583	missense	3178	exon8			TATGGCGGGAGTG	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.847G>A	12.37:g.54676958G>A	ENSP00000341826:p.Gly283Arg	73	0		97	36	NM_031157	0	0	17	26	9	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	ENST00000340913.6	37	CCDS44909.1	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518781	0.64634	.	.	ENSG00000135486	ENST00000340913	D	0.86769	-2.17	3.73	3.73	0.42828	.	.	.	.	.	D	0.89181	0.6642	M	0.72624	2.21	0.80722	D	1	D	0.63880	0.993	P	0.55011	0.766	D	0.86186	0.1609	9	0.14656	T	0.56	.	13.8264	0.63352	0.0:0.0:1.0:0.0	.	283	P09651	ROA1_HUMAN	R	283	ENSP00000341826:G283R	ENSP00000341826:G283R	G	+	1	0	HNRNPA1	52963225	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.291000	0.78721	2.382000	0.81193	0.455000	0.32223	GGG	.		0.562	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
CLN5	1203	hgsc.bcm.edu	37	13	77566090	77566090	+	Missense_Mutation	SNP	C	C	T	rs77416795	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr13:77566090C>T	ENST00000377453.3	+	1	1296	c.4C>T	c.(4-6)Cgc>Tgc	p.R2C		NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	0					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		AGGTGTCATGCGCCGGAACCT	0.706													C|||	698	0.139377	0.1293	0.2608	5008	,	,		12735	0.1071		0.0994	False		,,,				2504	0.1411				p.R2C		.											.	CLN5-91	0			c.C4T						.	C	CYS/ARG	400,3146		17,366,1390	3.0	4.0	3.0		4	2.1	0.0	13	dbSNP_131	3	731,6513		40,651,2931	yes	missense	CLN5	NM_006493.2	180	57,1017,4321	TT,TC,CC		10.0911,11.2803,10.4819		2/408	77566090	1131,9659	1773	3622	5395	SO:0001583	missense	1203	exon1			GTCATGCGCCGGA		CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.4C>T	13.37:g.77566090C>T	ENSP00000366673:p.Arg2Cys	0	0		10	4	NM_006493	0	0	0	0	0	B3KQK7	Missense_Mutation	SNP	ENST00000377453.3	37	CCDS9456.1	275	0.1259157509157509	67	0.13617886178861788	74	0.20441988950276244	58	0.10139860139860139	76	0.10026385224274406	C	14.02	2.409456	0.42715	0.112803	0.100911	ENSG00000102805	ENST00000377453	T	0.35605	1.3	3.0	2.13	0.27403	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.13845	-1.0494	5	0.87932	D	0	.	3.9634	0.09421	0.2315:0.6377:0.0:0.1308	.	.	.	.	C	2	ENSP00000366673:R2C	ENSP00000366673:R2C	R	+	1	0	CLN5	76464091	0.002000	0.14202	0.006000	0.13384	0.017000	0.09413	0.035000	0.13797	0.794000	0.33899	0.462000	0.41574	CGC	C|0.873;T|0.127		0.706	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493647	77493647	+	Silent	SNP	A	A	G	rs61991619|rs371633333	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr14:77493647A>G	ENST00000238647.3	-	1	1387	c.489T>C	c.(487-489)gcT>gcC	p.A163A		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	163	Poly-Ala.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.A164delA(1)		endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GTTCCACCgcagcggcggcgg	0.746													A|||	835	0.166733	0.1059	0.2651	5008	,	,		5410	0.1012		0.2435	False		,,,				2504	0.1677				p.A163A		.											.	IRF2BPL-90	1	Deletion - In frame(1)	prostate(1)	c.T489C						.	A		127,3983		4,119,1932	5.0	6.0	6.0		489	-2.5	0.4	14	dbSNP_129	6	755,7295		112,531,3382	no	coding-synonymous	IRF2BPL	NM_024496.2		116,650,5314	GG,GA,AA		9.3789,3.09,7.2533		163/797	77493647	882,11278	2055	4025	6080	SO:0001819	synonymous_variant	64207	exon1			CACCGCAGCGGCG	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.489T>C	14.37:g.77493647A>G		0	0		4	4	NM_024496	0	0	0	0	0	Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	ENST00000238647.3	37	CCDS9854.1																																																																																			A|0.819;G|0.181		0.746	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
MAPKBP1	23005	bcgsc.ca	37	15	42115152	42115152	+	Silent	SNP	C	C	T	rs61729966	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr15:42115152C>T	ENST00000456763.2	+	29	3544	c.3348C>T	c.(3346-3348)tcC>tcT	p.S1116S	MAPKBP1_ENST00000221214.6_Silent_p.S993S|MAPKBP1_ENST00000260357.7_Silent_p.S949S|MAPKBP1_ENST00000514566.1_Silent_p.S1110S|MAPKBP1_ENST00000457542.2_Silent_p.S1110S|RP11-23P13.4_ENST00000510176.1_RNA	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	1116	Poly-Ser.									breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CATCCCCATCCTCCTCAAGCC	0.607													c|||	9	0.00179712	0.0008	0.0029	5008	,	,		20234	0.0		0.006	False		,,,				2504	0.0				p.S1116S		.											.	MAPKBP1-589	0			c.C3348T						.	C	,	6,4400		0,6,2197	98.0	90.0	93.0		3348,3330	0.4	0.7	15	dbSNP_129	93	52,8548		0,52,4248	no	coding-synonymous,coding-synonymous	MAPKBP1	NM_001128608.1,NM_014994.2	,	0,58,6445	TT,TC,CC		0.6047,0.1362,0.4459	,	1116/1515,1110/1509	42115152	58,12948	2203	4300	6503	SO:0001819	synonymous_variant	23005	exon29			CCCATCCTCCTCA	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.3348C>T	15.37:g.42115152C>T		54	0		58	4	NM_001128608	0	0	5	5	0	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Silent	SNP	ENST00000456763.2	37	CCDS45239.1																																																																																			C|0.995;T|0.005		0.607	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000359745.1	NM_014994	
HAGH	3029	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1872357	1872357	+	Missense_Mutation	SNP	G	G	T	rs115850237		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr16:1872357G>T	ENST00000397356.3	-	3	664	c.258C>A	c.(256-258)gaC>gaA	p.D86E	HAGH_ENST00000566709.1_Missense_Mutation_p.D38E|HAGH_ENST00000455446.2_Missense_Mutation_p.D86E|HAGH_ENST00000397353.2_Missense_Mutation_p.D38E	NM_005326.4	NP_005317.2	Q16775	GLO2_HUMAN	hydroxyacylglutathione hydrolase	86					glutathione biosynthetic process (GO:0006750)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			kidney(2)|lung(1)|ovary(1)|skin(1)	5		Hepatocellular(780;0.00335)			Glutathione(DB00143)	TTCTCGCCGCGTCCACGACCT	0.632																																					p.D86E	Pancreas(55;1048 1176 25227 40124 41333)	.											.	HAGH-91	0			c.C258A						.						114.0	82.0	93.0					16																	1872357		2199	4300	6499	SO:0001583	missense	3029	exon3			CGCCGCGTCCACG	X90999	CCDS32366.1, CCDS10447.2, CCDS66900.1	16p13.3	2012-10-02	2003-11-04		ENSG00000063854	ENSG00000063854	3.1.2.6		4805	protein-coding gene	gene with protein product		138760	"""hydroxyacyl glutathione hydrolase"""			3025077, 7327557	Standard	NM_001286249		Approved	GLO2, GLXII, HAGH1	uc002cna.3	Q16775	OTTHUMG00000128662	ENST00000397356.3:c.258C>A	16.37:g.1872357G>T	ENSP00000380514:p.Asp86Glu	38	0		38	10	NM_005326	0	0	0	0	0	A8K290|B4DP33|B4DRA7|E7EN93	Missense_Mutation	SNP	ENST00000397356.3	37	CCDS10447.2	.	.	.	.	.	.	.	.	.	.	g	0.625	-0.819724	0.02776	.	.	ENSG00000063854	ENST00000455446;ENST00000397356;ENST00000397353	D;D;D	0.95447	-3.71;-3.71;-3.71	5.23	-5.08	0.02929	Beta-lactamase-like (2);	0.216148	0.49305	N	0.000147	T	0.80385	0.4613	N	0.05534	-0.03	0.22581	N	0.998966	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.10450	0.005;0.0;0.0;0.0	T	0.76868	-0.2800	10	0.02654	T	1	-7.288	1.6016	0.02675	0.1878:0.2951:0.3245:0.1926	.	86;86;38;86	E7EN93;B4DT01;Q16775-2;Q16775	.;.;.;GLO2_HUMAN	E	86;86;38	ENSP00000406552:D86E;ENSP00000380514:D86E;ENSP00000380511:D38E	ENSP00000380511:D38E	D	-	3	2	HAGH	1812358	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-1.620000	0.02046	-1.035000	0.03291	-0.834000	0.03071	GAC	G|1.000;A|0.000		0.632	HAGH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250548.2	NM_005326	
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000562103.1_5'UTR|ZNF598_ENST00000563630.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	0	0		8	8	NM_178167	0	0	0	5	5	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		0	0		11	11	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
DNAH3	55567	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	21042562	21042562	+	Silent	SNP	G	G	C			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr16:21042562G>C	ENST00000261383.3	-	37	5243	c.5244C>G	c.(5242-5244)ccC>ccG	p.P1748P	DNAH3_ENST00000415178.1_Silent_p.P1748P	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	1748	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TGATAGCCTTGGGGTTGATGA	0.517																																					p.P1748P		.											.	DNAH3-167	0			c.C5244G						.						132.0	102.0	112.0					16																	21042562		2201	4300	6501	SO:0001819	synonymous_variant	55567	exon37			AGCCTTGGGGTTG	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.5244C>G	16.37:g.21042562G>C		99	0		112	20	NM_017539	0	0	0	0	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	ENST00000261383.3	37	CCDS10594.1																																																																																			.		0.517	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
FHOD1	29109	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	16	67268118	67268118	+	Silent	SNP	G	G	C			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr16:67268118G>C	ENST00000258201.4	-	13	1735	c.1488C>G	c.(1486-1488)ccC>ccG	p.P496P		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	496	FH1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		CAGGGCTCTGGGGTGTTCTGG	0.642																																					p.P496P		.											.	FHOD1-221	0			c.C1488G						.						34.0	42.0	39.0					16																	67268118		2198	4299	6497	SO:0001819	synonymous_variant	29109	exon13			GCTCTGGGGTGTT	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.1488C>G	16.37:g.67268118G>C		11	0		15	8	NM_013241	0	0	6	6	0	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Silent	SNP	ENST00000258201.4	37	CCDS10834.1																																																																																			.		0.642	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	1	0		14	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
APRT	353	broad.mit.edu	37	16	88873552	88873552	+	IGR	SNP	A	A	C			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr16:88873552A>C	ENST00000378364.3	-	0	947				CDT1_ENST00000301019.4_Missense_Mutation_p.T406P	NM_000485.2	NP_000476.1	P07741	APT_HUMAN	adenine phosphoribosyltransferase						adenine salvage (GO:0006168)|AMP salvage (GO:0044209)|cellular response to insulin stimulus (GO:0032869)|grooming behavior (GO:0007625)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	adenine binding (GO:0002055)|adenine phosphoribosyltransferase activity (GO:0003999)|AMP binding (GO:0016208)			cervix(1)|endometrium(1)|liver(1)	3				BRCA - Breast invasive adenocarcinoma(80;0.0477)	Adenine(DB00173)|Adenosine monophosphate(DB00131)	CCCACCAGCCACCCCGCCTGC	0.697																																					p.T406P		.											.	CDT1-227	0			c.A1216C						.						18.0	24.0	22.0					16																	88873552		2189	4293	6482	SO:0001628	intergenic_variant	81620	exon8			CCAGCCACCCCGC		CCDS32511.1, CCDS45546.1	16q24	2012-10-02				ENSG00000198931	2.4.2.7		626	protein-coding gene	gene with protein product		102600					Standard	NM_000485		Approved		uc002flv.3	P07741			16.37:g.88873552A>C		19	1		72	15	NM_030928	0	0	2	2	0	G5E9J2|Q3KP55|Q68DF9	Missense_Mutation	SNP	ENST00000378364.3	37	CCDS32511.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.073836	0.36566	.	.	ENSG00000167513	ENST00000301019	T	0.78364	-1.17	4.76	-0.0541	0.13815	.	0.322580	0.28927	N	0.013691	T	0.67363	0.2885	M	0.73319	2.225	0.09310	N	0.999999	B	0.16166	0.016	B	0.10450	0.005	T	0.52866	-0.8518	10	0.30854	T	0.27	.	1.8931	0.03252	0.3451:0.1579:0.3614:0.1356	.	406	Q9H211	CDT1_HUMAN	P	406	ENSP00000301019:T406P	ENSP00000301019:T406P	T	+	1	0	CDT1	87401053	0.000000	0.05858	0.006000	0.13384	0.038000	0.13279	0.015000	0.13355	0.004000	0.14682	0.459000	0.35465	ACC	.		0.697	APRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430000.2	NM_000485	
CHRNE	1145	hgsc.bcm.edu	37	17	4799079	4799079	+	IGR	SNP	G	G	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr17:4799079G>T	ENST00000293780.4	-	0	2455				MINK1_ENST00000347992.7_Missense_Mutation_p.G1077C|MINK1_ENST00000355280.6_Missense_Mutation_p.G1106C|MINK1_ENST00000453408.3_Missense_Mutation_p.G1086C	NM_000080.3	NP_000071.1	Q04844	ACHE_HUMAN	cholinergic receptor, nicotinic, epsilon (muscle)						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)	12					Galantamine(DB00674)	GAAGAAGCAGGGCTGGACCAC	0.557																																					p.G1106C		.											.	MINK1-943	0			c.G3316T						.						42.0	48.0	46.0					17																	4799079		1991	4157	6148	SO:0001628	intergenic_variant	50488	exon27			AAGCAGGGCTGGA	X66403	CCDS11058.1	17p13.2	2012-02-11	2012-02-07		ENSG00000108556	ENSG00000108556		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1966	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, epsilon (muscle)"""	100725	"""cholinergic receptor, nicotinic, epsilon"""			7688301	Standard	NM_000080		Approved	ACHRE	uc002fzk.1	Q04844	OTTHUMG00000090778		17.37:g.4799079G>T		69	0		70	5	NM_153827	0	0	62	62	0	D3DTK6	Missense_Mutation	SNP	ENST00000293780.4	37	CCDS11058.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617334	0.87359	.	.	ENSG00000141503	ENST00000355280;ENST00000453408;ENST00000347992;ENST00000542906	T;T;T	0.04970	3.52;3.52;3.52	4.87	4.87	0.63330	Citron-like (3);	0.058459	0.64402	D	0.000002	T	0.29028	0.0721	M	0.84433	2.695	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.91635	0.987;0.999;0.998;0.999	T	0.04216	-1.0968	10	0.87932	D	0	.	15.5409	0.76048	0.0:0.0:1.0:0.0	.	1069;1086;1106;1077	Q8N4C8-2;Q8N4C8-4;Q8N4C8;Q8N4C8-3	.;.;MINK1_HUMAN;.	C	1106;1086;1077;66	ENSP00000347427:G1106C;ENSP00000406487:G1086C;ENSP00000269296:G1077C	ENSP00000269296:G1077C	G	+	1	0	MINK1	4739855	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.657000	0.98554	2.531000	0.85337	0.591000	0.81541	GGC	.		0.557	CHRNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207560.3		
SOX15	6665	hgsc.bcm.edu	37	17	7492611	7492611	+	Silent	SNP	G	G	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr17:7492611G>T	ENST00000250055.2	-	1	877	c.384C>A	c.(382-384)ggC>ggA	p.G128G	SOX15_ENST00000538513.2_Silent_p.G128G|FXR2_ENST00000573057.1_5'Flank|MPDU1_ENST00000423172.2_Intron|SOX15_ENST00000570788.1_Silent_p.G128G	NM_006942.1	NP_008873.1	O60248	SOX15_HUMAN	SRY (sex determining region Y)-box 15	128					cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|male gonad development (GO:0008584)|myoblast development (GO:0048627)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue regeneration (GO:0043403)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)	2						AAGGTCCGGCGCCCGAGCTCT	0.721											OREG0024139	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G128G		.											.	SOX15-135	0			c.C384A						.						9.0	10.0	10.0					17																	7492611		2190	4263	6453	SO:0001819	synonymous_variant	6665	exon1			TCCGGCGCCCGAG	AJ006222	CCDS32549.1	17p13.1	2014-08-12	2002-07-22	2002-07-26	ENSG00000129194	ENSG00000129194		"""SRY (sex determining region Y)-boxes"""	11196	protein-coding gene	gene with protein product		601297	"""SRY (sex determining region Y)-box 20"""	SOX20		8978787, 9730625	Standard	NM_006942		Approved	SOX27, SOX26	uc002ghz.1	O60248	OTTHUMG00000178146	ENST00000250055.2:c.384C>A	17.37:g.7492611G>T		5	0	642	67	4	NM_006942	0	0	0	0	0	B4DWU7|D3DTQ0|P35717|Q9Y6W7	Silent	SNP	ENST00000250055.2	37	CCDS32549.1																																																																																			.		0.721	SOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440757.1	NM_006942	
CD300LG	146894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	41930365	41930365	+	Silent	SNP	C	C	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr17:41930365C>T	ENST00000317310.4	+	3	506	c.465C>T	c.(463-465)acC>acT	p.T155T	CD300LG_ENST00000586233.1_Intron|CD300LG_ENST00000377203.4_Intron|CD300LG_ENST00000293396.8_Intron|CD300LG_ENST00000539718.1_Silent_p.T155T	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	155					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CTCAGCAAACCCAGCCCCCAG	0.582																																					p.T155T		.											.	CD300LG-90	0			c.C465T						.						135.0	125.0	128.0					17																	41930365		2203	4300	6503	SO:0001819	synonymous_variant	146894	exon3			GCAAACCCAGCCC	BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.465C>T	17.37:g.41930365C>T		100	0		79	15	NM_145273	0	0	0	0	0	B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Silent	SNP	ENST00000317310.4	37	CCDS11470.1																																																																																			.		0.582	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457646.1	NM_145273	
QRICH2	84074	bcgsc.ca	37	17	74288472	74288472	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr17:74288472T>C	ENST00000262765.5	-	4	2017	c.1838A>G	c.(1837-1839)cAt>cGt	p.H613R		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	613	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TGCCAAACCATGCTGATCCAC	0.537																																					p.H613R		.											.	QRICH2-94	0			c.A1838G						.						154.0	127.0	136.0					17																	74288472		2203	4300	6503	SO:0001583	missense	84074	exon4			AAACCATGCTGAT	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1838A>G	17.37:g.74288472T>C	ENSP00000262765:p.His613Arg	241	5		218	15	NM_032134	0	0	0	0	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	N	0.026	-1.373471	0.01214	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.20881	2.04	4.92	-9.83	0.00482	.	.	.	.	.	T	0.06645	0.0170	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.70328	-0.4902	9	0.23302	T	0.38	5.7062	9.5631	0.39383	0.05:0.3282:0.1059:0.5158	.	613;613	B5MD94;Q9H0J4	.;QRIC2_HUMAN	R	613	ENSP00000262765:H613R	ENSP00000262765:H613R	H	-	2	0	QRICH2	71800067	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-9.501000	0.00011	-9.456000	0.00000	-5.076000	0.00001	CAT	.		0.537	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
QRICH2	84074	bcgsc.ca	37	17	74288508	74288508	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr17:74288508T>A	ENST00000262765.5	-	4	1981	c.1802A>T	c.(1801-1803)gAt>gTt	p.D601V		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	601	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						ACCATGCTGATCTGCACCAGG	0.537																																					p.D601V		.											.	QRICH2-94	0			c.A1802T						.						168.0	134.0	145.0					17																	74288508		2203	4300	6503	SO:0001583	missense	84074	exon4			TGCTGATCTGCAC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1802A>T	17.37:g.74288508T>A	ENSP00000262765:p.Asp601Val	253	5		222	16	NM_032134	0	0	1	1	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	T	8.120	0.780708	0.16120	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.21734	1.99	4.82	-9.63	0.00544	.	.	.	.	.	T	0.06735	0.0172	N	0.16478	0.41	0.09310	N	1	P;B	0.37276	0.589;0.138	B;B	0.33454	0.164;0.033	T	0.14200	-1.0481	9	0.18710	T	0.47	0.7097	1.6345	0.02739	0.4588:0.2138:0.0952:0.2322	.	601;601	B5MD94;Q9H0J4	.;QRIC2_HUMAN	V	601	ENSP00000262765:D601V	ENSP00000262765:D601V	D	-	2	0	QRICH2	71800103	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.623000	0.00059	-2.309000	0.00651	-0.444000	0.05651	GAT	.		0.537	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
NPTX1	4884	hgsc.bcm.edu	37	17	78449948	78449948	+	Missense_Mutation	SNP	C	C	T	rs144443274	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr17:78449948C>T	ENST00000306773.4	-	1	456	c.299G>A	c.(298-300)gGc>gAc	p.G100D	NPTX1_ENST00000575212.1_Intron	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	100					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			ccgggcctcgccggcTCCGGG	0.721													C|||	393	0.0784744	0.0091	0.098	5008	,	,		6949	0.0238		0.173	False		,,,				2504	0.1176				p.G100D		.											.	NPTX1-90	0			c.G299A						.	C	ASP/GLY	146,4108		4,138,1985	11.0	15.0	14.0		299	2.1	1.0	17	dbSNP_134	14	1445,6809		128,1189,2810	no	missense	NPTX1	NM_002522.3	94	132,1327,4795	TT,TC,CC		17.5067,3.4321,12.7199	benign	100/433	78449948	1591,10917	2127	4127	6254	SO:0001583	missense	4884	exon1			GCCTCGCCGGCTC	U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.299G>A	17.37:g.78449948C>T	ENSP00000307549:p.Gly100Asp	0	0		5	4	NM_002522	0	0	0	0	0	B3KXH3|Q5FWE6	Missense_Mutation	SNP	ENST00000306773.4	37	CCDS32762.1	196	0.08974358974358974	6	0.012195121951219513	42	0.11602209944751381	10	0.017482517482517484	138	0.1820580474934037	C	14.35	2.508706	0.44660	0.034321	0.175067	ENSG00000171246	ENST00000306773	T	0.10382	2.88	3.44	2.11	0.27256	.	0.738536	0.13049	N	0.417861	T	0.00012	0.0000	N	0.14661	0.345	0.34958	P	0.24807100000000004	P	0.43287	0.802	B	0.35413	0.202	T	0.37174	-0.9717	9	0.15066	T	0.55	-13.6643	4.112	0.10063	0.0:0.5355:0.2155:0.249	.	100	Q15818	NPTX1_HUMAN	D	100	ENSP00000307549:G100D	ENSP00000307549:G100D	G	-	2	0	NPTX1	76064543	0.996000	0.38824	0.994000	0.49952	0.971000	0.66376	1.864000	0.39469	1.482000	0.48325	0.484000	0.47621	GGC	C|0.910;T|0.090		0.721	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438051.1		
RNF125	54941	hgsc.bcm.edu	37	18	29598847	29598847	+	Silent	SNP	C	C	T	rs34097443	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr18:29598847C>T	ENST00000217740.3	+	1	513	c.21C>T	c.(19-21)acC>acT	p.T7T	RP11-53I6.2_ENST00000583184.1_RNA	NM_017831.3	NP_060301.2	Q96EQ8	RN125_HUMAN	ring finger protein 125, E3 ubiquitin protein ligase	7					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|lung(4)|upper_aerodigestive_tract(1)	6						TGCTGAGCACCGACAGCGGCA	0.692													C|||	329	0.0656949	0.0182	0.049	5008	,	,		11663	0.2361		0.0129	False		,,,				2504	0.0204				p.T7T		.											.	RNF125-226	0			c.C21T						.	C		73,4317		2,69,2124	13.0	14.0	14.0		21	3.0	1.0	18	dbSNP_126	14	144,8438		1,142,4148	no	coding-synonymous	RNF125	NM_017831.3		3,211,6272	TT,TC,CC		1.6779,1.6629,1.6728		7/233	29598847	217,12755	2195	4291	6486	SO:0001819	synonymous_variant	54941	exon1			GAGCACCGACAGC	AK000463	CCDS11902.1	18q12.1	2013-01-09	2012-02-23		ENSG00000101695	ENSG00000101695		"""RING-type (C3HC4) zinc fingers"""	21150	protein-coding gene	gene with protein product		610432	"""ring finger protein 125"""				Standard	NM_017831		Approved	FLJ20456	uc002kxf.1	Q96EQ8	OTTHUMG00000132266	ENST00000217740.3:c.21C>T	18.37:g.29598847C>T		1	0		82	30	NM_017831	0	0	2	3	1	Q9NX39	Silent	SNP	ENST00000217740.3	37	CCDS11902.1																																																																																			C|0.955;T|0.045		0.692	RNF125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255354.1	NM_017831	
POLRMT	5442	broad.mit.edu	37	19	629898	629898	+	Missense_Mutation	SNP	G	G	A	rs527922669		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr19:629898G>A	ENST00000588649.2	-	3	548	c.464C>T	c.(463-465)gCg>gTg	p.A155V		NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	155					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGGTCAGCGCCTTGAACTC	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		17814	0.0		0.001	False		,,,				2504	0.0				p.A155V		.											.	POLRMT-92	0			c.C464T						.						18.0	18.0	18.0					19																	629898		2201	4292	6493	SO:0001583	missense	5442	exon3			GTCAGCGCCTTGA		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.464C>T	19.37:g.629898G>A	ENSP00000465759:p.Ala155Val	88	1		82	13	NM_005035	0	0	4	9	5	O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	.	.	.	.	.	.	.	.	.	.	A	2.595	-0.294238	0.05568	.	.	ENSG00000099821	ENST00000215591	T	0.45668	0.89	3.29	-6.58	0.01836	.	3.921250	0.00855	N	0.001865	T	0.19644	0.0472	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15235	-1.0444	10	0.23302	T	0.38	0.2577	1.4375	0.02346	0.1656:0.2207:0.3427:0.271	.	155	O00411	RPOM_HUMAN	V	155	ENSP00000215591:A155V	ENSP00000215591:A155V	A	-	2	0	POLRMT	580898	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.875000	0.04205	-3.226000	0.00210	-1.456000	0.01031	GCG	.		0.652	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
MUC16	94025	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	9068139	9068139	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr19:9068139C>A	ENST00000397910.4	-	3	19510	c.19307G>T	c.(19306-19308)gGc>gTc	p.G6436V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6438	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G6436D(1)|p.G2069D(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTTGTCAGGCCAGCAAAAGT	0.507																																					p.G6436V		.											.	MUC16-566	2	Substitution - Missense(2)	lung(2)	c.G19307T						.						269.0	262.0	264.0					19																	9068139		2000	4167	6167	SO:0001583	missense	94025	exon3			GTCAGGCCAGCAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.19307G>T	19.37:g.9068139C>A	ENSP00000381008:p.Gly6436Val	199	1		225	59	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	0.146	-1.097138	0.01843	.	.	ENSG00000181143	ENST00000397910	T	0.03580	3.88	2.15	-4.3	0.03710	.	.	.	.	.	T	0.01765	0.0056	N	0.04508	-0.205	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.44605	-0.9317	8	0.87932	D	0	.	5.6093	0.17396	0.3513:0.4268:0.2219:0.0	.	6436	B5ME49	.	V	6436	ENSP00000381008:G6436V	ENSP00000381008:G6436V	G	-	2	0	MUC16	8929139	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-5.460000	0.00120	-3.240000	0.00207	-1.716000	0.00709	GGC	.		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
PRKCSH	5589	hgsc.bcm.edu	37	19	11558367	11558367	+	Silent	SNP	G	G	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr19:11558367G>A	ENST00000589838.1	+	10	963	c.963G>A	c.(961-963)gaG>gaA	p.E321E	PRKCSH_ENST00000592741.1_Silent_p.E321E|PRKCSH_ENST00000412601.1_Silent_p.E321E|PRKCSH_ENST00000591462.1_Silent_p.E321E|PRKCSH_ENST00000252455.2_Silent_p.E321E|PRKCSH_ENST00000587327.1_Silent_p.E321E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	321	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaggaagaag	0.632																																					p.E321E		.											.	PRKCSH-90	1	Deletion - In frame(1)	central_nervous_system(1)	c.G963A						.						28.0	28.0	28.0					19																	11558367		2200	4298	6498	SO:0001819	synonymous_variant	5589	exon11			GGAGGAGGAGGAA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.963G>A	19.37:g.11558367G>A		46	0		86	7	NM_001001329	0	0	69	69	0	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	ENST00000589838.1	37	CCDS32911.1																																																																																			.		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
LPHN1	22859	broad.mit.edu;bcgsc.ca	37	19	14288434	14288434	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr19:14288434G>A	ENST00000340736.6	-	3	490	c.193C>T	c.(193-195)Cgc>Tgc	p.R65C	LPHN1_ENST00000361434.3_Missense_Mutation_p.R65C	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	65	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TCGTCCGTGCGCCCGTAGTTG	0.607																																					p.R65C		.											.	LPHN1-523	0			c.C193T						.						144.0	112.0	123.0					19																	14288434		2203	4300	6503	SO:0001583	missense	22859	exon3			CCGTGCGCCCGTA	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.193C>T	19.37:g.14288434G>A	ENSP00000340688:p.Arg65Cys	73	0		114	5	NM_001008701	0	0	7	7	0	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	37	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	G	31	5.095100	0.94197	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.22945	1.93;1.93	5.01	5.01	0.66863	D-galactoside/L-rhamnose binding SUEL lectin domain (2);	0.000000	0.85682	D	0.000000	T	0.66489	0.2794	H	0.97265	3.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79940	-0.1591	10	0.87932	D	0	.	15.7972	0.78420	0.0:0.0:1.0:0.0	.	65;65	O94910-2;O94910	.;LPHN1_HUMAN	C	65	ENSP00000340688:R65C;ENSP00000355328:R65C	ENSP00000340688:R65C	R	-	1	0	LPHN1	14149434	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.519000	0.73768	2.324000	0.78689	0.591000	0.81541	CGC	.		0.607	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
ZNF493	284443	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	21607539	21607539	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr19:21607539C>T	ENST00000355504.4	+	2	1960	c.1694C>T	c.(1693-1695)aCt>aTt	p.T565I	ZNF493_ENST00000392288.2_Missense_Mutation_p.T693I|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	565					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						TGTGGCAAAACTTTCTACCGA	0.348																																					p.T693I		.											.	ZNF493-516	0			c.C2078T						.						33.0	36.0	35.0					19																	21607539		2202	4297	6499	SO:0001583	missense	284443	exon4			GCAAAACTTTCTA	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1694C>T	19.37:g.21607539C>T	ENSP00000347691:p.Thr565Ile	64	0		71	7	NM_001076678	0	0	3	7	4	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	37	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	6.870	0.529837	0.13127	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.20881	2.04;2.04	1.05	-0.842	0.10748	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13329	0.0323	L	0.42581	1.335	0.09310	N	0.999998	P;B	0.36577	0.558;0.206	B;B	0.32090	0.14;0.053	T	0.25641	-1.0126	9	0.66056	D	0.02	.	2.5551	0.04758	0.3107:0.3788:0.3105:0.0	.	565;693	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	I	693;565	ENSP00000376110:T693I;ENSP00000347691:T565I	ENSP00000347691:T565I	T	+	2	0	ZNF493	21399379	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-0.040000	0.12104	0.452000	0.26830	0.460000	0.39030	ACT	.		0.348	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
ARHGAP33	115703	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	36275213	36275213	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr19:36275213C>A	ENST00000007510.4	+	16	1705	c.1561C>A	c.(1561-1563)Cct>Act	p.P521T	ARHGAP33_ENST00000314737.5_Missense_Mutation_p.P521T|ARHGAP33_ENST00000378944.5_Missense_Mutation_p.P385T			O14559	RHG33_HUMAN	Rho GTPase activating protein 33	521					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|Rac GTPase activator activity (GO:0030675)			endometrium(7)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	37						CGGCCTCGACCCTGCAGGTAT	0.677																																					p.P521T		.											.	ARHGAP33-229	0			c.C1561A						.						202.0	163.0	176.0					19																	36275213		2203	4300	6503	SO:0001583	missense	115703	exon16			CTCGACCCTGCAG	AY044864	CCDS12477.1, CCDS54254.1	19q13.13	2011-06-29	2010-02-19	2010-02-19		ENSG00000004777		"""Rho GTPase activating proteins"""	23085	protein-coding gene	gene with protein product		614902	"""sorting nexin 26"""	SNX26		12297274, 12461558	Standard	NM_052948		Approved	FLJ39019, TCGAP	uc002obs.2	O14559		ENST00000007510.4:c.1561C>A	19.37:g.36275213C>A	ENSP00000007510:p.Pro521Thr	67	0		88	9	NM_052948	0	0	0	1	1	O14552|O14560|Q6ZSP6|Q96CP3|Q9NT23	Missense_Mutation	SNP	ENST00000007510.4	37		.	.	.	.	.	.	.	.	.	.	C	9.443	1.088675	0.20390	.	.	ENSG00000004777	ENST00000007510;ENST00000314737;ENST00000378944	T;T;T	0.11495	3.1;2.77;3.15	4.9	3.86	0.44501	.	0.426306	0.21561	N	0.072580	T	0.03739	0.0106	N	0.08118	0	0.30297	N	0.789815	B;B;P	0.36837	0.016;0.056;0.571	B;B;B	0.30251	0.024;0.113;0.111	T	0.12993	-1.0526	10	0.29301	T	0.29	.	3.3163	0.07034	0.1777:0.5557:0.1718:0.0948	.	521;385;521	O14559;O14559-10;O14559-11	RHG33_HUMAN;.;.	T	521;521;385	ENSP00000007510:P521T;ENSP00000320038:P521T;ENSP00000368227:P385T	ENSP00000007510:P521T	P	+	1	0	ARHGAP33	40967053	0.001000	0.12720	1.000000	0.80357	0.279000	0.26890	0.179000	0.16840	2.262000	0.75019	0.457000	0.33378	CCT	.		0.677	ARHGAP33-201	KNOWN	basic	protein_coding	protein_coding		NM_052948	
LILRB1	10859	bcgsc.ca	37	19	55143452	55143452	+	Missense_Mutation	SNP	T	T	C	rs1061680	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr19:55143452T>C	ENST00000396331.1	+	6	782	c.425T>C	c.(424-426)aTc>aCc	p.I142T	AC009892.1_ENST00000578908.1_RNA|LILRB1_ENST00000418536.2_Missense_Mutation_p.I142T|LILRB1_ENST00000324602.7_Missense_Mutation_p.I142T|LILRB1_ENST00000396317.1_Missense_Mutation_p.I142T|LILRB1_ENST00000396315.1_Missense_Mutation_p.I142T|LILRB1_ENST00000427581.2_Missense_Mutation_p.I178T|LILRB1_ENST00000396327.3_Missense_Mutation_p.I142T|LILRB1_ENST00000448689.1_Missense_Mutation_p.I142T|LILRB1_ENST00000396321.2_Missense_Mutation_p.I142T|LILRB1_ENST00000396332.4_Missense_Mutation_p.I142T|LILRB1_ENST00000434867.2_Missense_Mutation_p.I142T	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	142	Ig-like C2-type 2.		I -> T (in dbSNP:rs1061680). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:20600445, ECO:0000269|PubMed:9285411}.		cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GGGAATGTAATCCTCCAGTGT	0.552										HNSCC(37;0.09)			N|||	2190	0.4373	0.6059	0.4553	5008	,	,		18519	0.5942		0.2465	False		,,,				2504	0.2311				p.I142T		.											.	LILRB1-137	0			c.T425C						.	C	THR/ILE,THR/ILE,THR/ILE,THR/ILE	2467,1939	549.6+/-377.8	694,1079,430	104.0	101.0	102.0		425,425,425,425	-0.6	0.0	19	dbSNP_86	102	2380,6220	700.8+/-405.2	323,1734,2243	yes	missense,missense,missense,missense	LILRB1	NM_001081637.1,NM_001081638.1,NM_001081639.1,NM_006669.3	89,89,89,89	1017,2813,2673	CC,CT,TT		27.6744,44.0082,37.2674	benign,benign,benign,benign	142/653,142/652,142/652,142/651	55143452	4847,8159	2203	4300	6503	SO:0001583	missense	10859	exon5			ATGTAATCCTCCA	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.425T>C	19.37:g.55143452T>C	ENSP00000379622:p.Ile142Thr	121	1		120	8	NM_001081637	0	0	5	5	0	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	ENST00000396331.1	37	CCDS42617.1	998	0.45695970695970695	313	0.6361788617886179	153	0.42265193370165743	339	0.5926573426573427	193	0.2546174142480211	C	0.004	-2.258264	0.00265	0.559918	0.276744	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.02050	4.48;4.48;4.48;4.48;4.48;4.48;4.48;4.48;4.48;4.48;4.48	1.9	-0.625	0.11548	Immunoglobulin-like fold (1);	0.000000	0.56097	N	0.000039	T	0.00012	0.0000	N	0.00082	-2.215	0.80722	P	0.0	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.001	T	0.13124	-1.0521	9	0.02654	T	1	.	5.3779	0.16176	0.0:0.4992:0.0:0.5008	rs1061680;rs3202770;rs17845472;rs17858351;rs58070294;rs1061680	142;142;142;142;142	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	T	142;142;142;142;142;142;142;142;178;142;142	ENSP00000379614:I142T;ENSP00000391514:I142T;ENSP00000409968:I142T;ENSP00000379622:I142T;ENSP00000379618:I142T;ENSP00000315997:I142T;ENSP00000405243:I142T;ENSP00000379623:I142T;ENSP00000395004:I178T;ENSP00000379610:I142T;ENSP00000379608:I142T	ENSP00000315997:I142T	I	+	2	0	LILRB1	59835264	0.330000	0.24705	0.001000	0.08648	0.002000	0.02628	0.437000	0.21543	-0.405000	0.07599	-1.160000	0.01791	ATC	T|0.567;C|0.433		0.552	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
ZNF154	7710	broad.mit.edu	37	19	58213468	58213468	+	Silent	SNP	T	T	G			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr19:58213468T>G	ENST00000512439.2	-	3	1045	c.849A>C	c.(847-849)acA>acC	p.T283T	ZNF551_ENST00000596085.1_Intron|ZNF154_ENST00000426889.1_Silent_p.T283T|AC003006.7_ENST00000594684.1_Intron|AC003006.7_ENST00000599221.1_Intron			Q13106	ZN154_HUMAN	zinc finger protein 154	283					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(7)|lung(3)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGGAATGATATGTAAAAAACT	0.463																																					p.T283T		.											.	ZNF154-90	0			c.A849C						.						80.0	84.0	83.0					19																	58213468		2200	4298	6498	SO:0001819	synonymous_variant	7710	exon3			ATGATATGTAAAA	U20648	CCDS42639.1	19q13.4	2013-01-08	2006-08-22		ENSG00000179909	ENSG00000179909		"""Zinc fingers, C2H2-type"", ""-"""	12939	protein-coding gene	gene with protein product		604085	"""zinc finger protein 154 (pHZ-92)"""			7557990	Standard	XR_243957		Approved	pHZ-92	uc010euf.3	Q13106	OTTHUMG00000140375	ENST00000512439.2:c.849A>C	19.37:g.58213468T>G		57	0		57	3	NM_001085384	0	0	0	0	0	A7MCY3|Q8IVG7|Q8NAR0	Silent	SNP	ENST00000512439.2	37	CCDS42639.1																																																																																			.		0.463	ZNF154-002	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277102.2		
ANKRD30BL	554226	bcgsc.ca	37	2	133014602	133014602	+	Intron	SNP	G	G	C	rs75245503	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr2:133014602G>C	ENST00000470729.1	-	1	441				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCCACAGACAGGAGGGAGGTA	0.721																																					.		.											.	.	0			.						.						27.0	45.0	39.0					2																	133014602		1553	3578	5131	SO:0001627	intron_variant	100313824	.			CAGACAGGAGGGA			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.984+499C>G	2.37:g.133014602G>C		32	2		84	30	.	0	0	0	0	0	B8ZZL7	RNA	SNP	ENST00000470729.1	37																																																																																				G|0.500;C|0.500		0.721	ANKRD30BL-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000331354.1	NR_027019	
KIF16B	55614	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	16253901	16253901	+	Silent	SNP	C	C	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr20:16253901C>T	ENST00000354981.2	-	26	4108	c.3951G>A	c.(3949-3951)ggG>ggA	p.G1317G	KIF16B_ENST00000355755.3_Silent_p.G1287G|KIF16B_ENST00000378003.2_Silent_p.G502G	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1317					ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						CCTGGCTCTACCCCGTCCCGT	0.557																																					p.G1317G		.											.	KIF16B-291	0			c.G3951A						.						100.0	95.0	97.0					20																	16253901		2203	4300	6503	SO:0001819	synonymous_variant	55614	exon26			GCTCTACCCCGTC	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3951G>A	20.37:g.16253901C>T		79	0		123	34	NM_024704	0	0	3	5	2	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	ENST00000354981.2	37	CCDS13122.1																																																																																			.		0.557	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078104.2	NM_017683	
MYBL2	4605	broad.mit.edu	37	20	42343869	42343869	+	Silent	SNP	C	C	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr20:42343869C>T	ENST00000217026.4	+	13	2047	c.1920C>T	c.(1918-1920)ccC>ccT	p.P640P	MYBL2_ENST00000396863.4_Silent_p.P616P	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	640					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P640P(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGGCCAAGCCCGAGAAGGCAG	0.597																																					p.P640P		.											.	MYBL2-415	1	Substitution - coding silent(1)	lung(1)	c.C1920T						.						142.0	150.0	147.0					20																	42343869		2203	4300	6503	SO:0001819	synonymous_variant	4605	exon13			CAAGCCCGAGAAG		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1920C>T	20.37:g.42343869C>T		148	2		198	5	NM_002466	0	0	1	1	0	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Silent	SNP	ENST00000217026.4	37	CCDS13322.1																																																																																			.		0.597	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
APCDD1L	164284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	57036492	57036492	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr20:57036492G>A	ENST00000371149.3	-	4	1090	c.860C>T	c.(859-861)tCg>tTg	p.S287L	APCDD1L_ENST00000491015.1_5'UTR|APCDD1L_ENST00000439429.1_Missense_Mutation_p.S298L	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	287						integral component of membrane (GO:0016021)				large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			CTCGCACCCCGAGCTGACCCA	0.687																																					p.S287L		.											.	APCDD1L-227	0			c.C860T						.						10.0	10.0	10.0					20																	57036492		2164	4254	6418	SO:0001583	missense	164284	exon4			CACCCCGAGCTGA	AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.860C>T	20.37:g.57036492G>A	ENSP00000360191:p.Ser287Leu	38	0		170	23	NM_153360	0	0	0	0	0		Missense_Mutation	SNP	ENST00000371149.3	37	CCDS13467.1	.	.	.	.	.	.	.	.	.	.	G	1.949	-0.441587	0.04604	.	.	ENSG00000198768	ENST00000371149;ENST00000439429	T;T	0.18174	2.23;2.23	4.44	2.01	0.26516	.	1.721060	0.02886	N	0.133503	T	0.13756	0.0333	L	0.29908	0.895	0.09310	N	1	B;B	0.14805	0.011;0.006	B;B	0.08055	0.003;0.002	T	0.23619	-1.0183	10	0.23302	T	0.38	-1.2958	6.7257	0.23355	0.1959:0.1501:0.654:0.0	.	298;287	F5H6V6;Q8NCL9	.;APCDL_HUMAN	L	287;298	ENSP00000360191:S287L;ENSP00000413261:S298L	ENSP00000360191:S287L	S	-	2	0	APCDD1L	56469898	0.009000	0.17119	0.002000	0.10522	0.011000	0.07611	1.772000	0.38552	0.830000	0.34757	0.563000	0.77884	TCG	.		0.687	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000079881.2	NM_153360	
CABLES2	81928	broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	60966395	60966395	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr20:60966395C>A	ENST00000279101.5	-	9	1214	c.1206G>T	c.(1204-1206)caG>caT	p.Q402H		NM_031215.2	NP_112492.2	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2	402					cell cycle (GO:0007049)|cell division (GO:0051301)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)		cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			endometrium(2)|kidney(1)|lung(6)|pancreas(1)|skin(1)	11	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCTTGCGGTTCTGTTTGCTGA	0.637																																					p.Q402H		.											.	CABLES2-91	0			c.G1206T						.						95.0	96.0	96.0					20																	60966395		2203	4300	6503	SO:0001583	missense	81928	exon9			GCGGTTCTGTTTG	BC003122	CCDS33503.1	20q13.33	2004-01-09	2004-01-09	2004-01-09	ENSG00000149679	ENSG00000149679			16143	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 150"""	C20orf150		12477932	Standard	NM_031215		Approved	dJ908M14.2, ik3-2	uc002ycv.2	Q9BTV7	OTTHUMG00000032912	ENST00000279101.5:c.1206G>T	20.37:g.60966395C>A	ENSP00000279101:p.Gln402His	92	1		120	20	NM_031215	0	0	7	11	4	Q5JWL0|Q9BYK0	Missense_Mutation	SNP	ENST00000279101.5	37	CCDS33503.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.20|16.20	3.055376|3.055376	0.55325|0.55325	.|.	.|.	ENSG00000149679|ENSG00000149679	ENST00000370560;ENST00000279101|ENST00000453274	T|.	0.16457|.	2.34|.	5.56|5.56	4.62|4.62	0.57501|0.57501	Cyclin, N-terminal (1);Cyclin-like (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58264|0.58264	0.2110|0.2110	L|L	0.39566|0.39566	1.225|1.225	0.58432|0.58432	D|D	0.999997|0.999997	B|.	0.20459|.	0.045|.	B|.	0.27076|.	0.076|.	T|T	0.54840|0.54840	-0.8233|-0.8233	10|5	0.46703|.	T|.	0.11|.	-42.2625|-42.2625	14.4078|14.4078	0.67093|0.67093	0.0:0.9285:0.0:0.0714|0.0:0.9285:0.0:0.0714	.|.	402|.	Q9BTV7|.	CABL2_HUMAN|.	H|I	190;402|196	ENSP00000279101:Q402H|.	ENSP00000279101:Q402H|.	Q|R	-|-	3|2	2|0	CABLES2|CABLES2	60399790|60399790	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	1.927000|1.927000	0.40094|0.40094	1.353000|1.353000	0.45828|0.45828	0.561000|0.561000	0.74099|0.74099	CAG|AGA	.		0.637	CABLES2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080027.2	XM_037265	
DIDO1	11083	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	61537287	61537287	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr20:61537287C>G	ENST00000266070.4	-	6	1865	c.1540G>C	c.(1540-1542)Gta>Cta	p.V514L	DIDO1_ENST00000395343.1_Missense_Mutation_p.V514L|DIDO1_ENST00000395340.1_Missense_Mutation_p.V514L|DIDO1_ENST00000354665.4_Missense_Mutation_p.V514L|DIDO1_ENST00000395335.2_Missense_Mutation_p.V514L|DIDO1_ENST00000370368.1_Missense_Mutation_p.V514L|DIDO1_ENST00000370366.1_Missense_Mutation_p.V514L|DIDO1_ENST00000266071.5_Missense_Mutation_p.V514L|DIDO1_ENST00000370371.4_Missense_Mutation_p.V514L	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	514					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TCTGGCTTTACTGCATTGTAA	0.557																																					p.V514L	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	.											.	DIDO1-96	0			c.G1540C						.						165.0	151.0	156.0					20																	61537287		2203	4300	6503	SO:0001583	missense	11083	exon6			GCTTTACTGCATT	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1540G>C	20.37:g.61537287C>G	ENSP00000266070:p.Val514Leu	66	0		87	27	NM_080797	0	0	12	18	6	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	37	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	.	29.5	5.014235	0.93404	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335;ENST00000370371;ENST00000370368;ENST00000354665;ENST00000370366;ENST00000266071	T;T;T;T;T;T;T;T;T	0.39056	2.36;2.36;2.02;2.02;1.1;1.1;1.1;1.14;1.14	5.95	5.95	0.96441	.	0.000000	0.36034	U	0.002834	T	0.67804	0.2932	M	0.74258	2.255	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;0.999;1.0;0.994	D;D;D;D	0.83275	0.961;0.961;0.996;0.978	T	0.67654	-0.5615	10	0.62326	D	0.03	-27.6846	20.3932	0.98965	0.0:1.0:0.0:0.0	.	514;514;514;514	Q9BTC0-2;Q9BTC0-3;Q9BTC0-1;Q9BTC0	.;.;.;DIDO1_HUMAN	L	514	ENSP00000266070:V514L;ENSP00000378752:V514L;ENSP00000378749:V514L;ENSP00000378744:V514L;ENSP00000359397:V514L;ENSP00000359394:V514L;ENSP00000346692:V514L;ENSP00000359391:V514L;ENSP00000266071:V514L	ENSP00000266070:V514L	V	-	1	0	DIDO1	61007732	1.000000	0.71417	0.664000	0.29753	0.749000	0.42624	5.664000	0.68045	2.824000	0.97209	0.655000	0.94253	GTA	.		0.557	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
MN1	4330	broad.mit.edu	37	22	28194900	28194900	+	Silent	SNP	T	T	C	rs202212250|rs530519178	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr22:28194900T>C	ENST00000302326.4	-	1	2586	c.1632A>G	c.(1630-1632)caA>caG	p.Q544Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	544	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgttgct	0.647			T	ETV6	"""AML, meningioma"""								C|||	5	0.000998403	0.0023	0.0	5008	,	,		12597	0.0		0.0	False		,,,				2504	0.002				p.Q544Q		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.A1632G						.																																			SO:0001819	synonymous_variant	4330	exon1			CTGCTGTTGCTGT	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1632A>G	22.37:g.28194900T>C		10	0		21	5	NM_002430	0	1	3	173	169	A9Z1V9	Silent	SNP	ENST00000302326.4	37	CCDS42998.1																																																																																			.		0.647	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	0	0		14	14	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
TADA3	10474	broad.mit.edu	37	3	9831618	9831618	+	Silent	SNP	A	A	C			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr3:9831618A>C	ENST00000301964.2	-	3	795	c.237T>G	c.(235-237)ggT>ggG	p.G79G	TADA3_ENST00000492635.1_5'UTR|TADA3_ENST00000343450.2_Silent_p.G79G|ARPC4_ENST00000397261.3_5'Flank|TADA3_ENST00000440161.1_Silent_p.G79G|ARPC4_ENST00000287613.7_5'Flank|ARPC4_ENST00000498623.2_5'Flank	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	79					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						ATCGTCTGTCACCTTTCTTAT	0.488																																					p.G79G		.											.	TADA3-226	0			c.T237G						.						48.0	48.0	48.0					3																	9831618		2203	4300	6503	SO:0001819	synonymous_variant	10474	exon3			TCTGTCACCTTTC	AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.237T>G	3.37:g.9831618A>C		53	5		47	5	NM_133480	0	0	91	92	1	Q6FI83|Q9UFS2	Silent	SNP	ENST00000301964.2	37	CCDS2583.1																																																																																			.		0.488	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250236.1		
RHOA	387	broad.mit.edu	37	3	49395674	49395679	+	IGR	DEL	GCCGCC	GCCGCC	-	rs71077799|rs56041243|rs139760138|rs17838762	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr3:49395674_49395679delGCCGCC	ENST00000418115.1	-	0	2031				GPX1_ENST00000419349.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000419783.1_In_Frame_Del_p.11_13AAA>A|GPX1_ENST00000496791.1_5'UTR	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)	p.A12_A13delAA(1)		cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CACCGACTGGgccgccgccgccgccg	0.694																																					.		.											.	GPX1-68	1	Deletion - In frame(1)	breast(1)	.						.		,	23,168,347		11,0,1,79,10,168					,	-0.2	0.0		dbSNP_123	2	116,720,1030		46,10,14,333,44,486	no	codingComplex,codingComplex	GPX1	NM_201397.1,NM_000581.2	,	57,10,15,412,54,654	A1A1,A1A2,A1R,A2A2,A2R,RR		44.8017,35.5019,42.7205	,	,		139,888,1377				SO:0001628	intergenic_variant	2876	.			GACTGGGCCGCCG	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395680_49395685delGCCGCC		7	0		35	9	.	0	0	0	0	0	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	In_Frame_Del	DEL	ENST00000418115.1	37	CCDS2795.1																																																																																			.		0.694	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
ROBO2	6092	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	77526667	77526667	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr3:77526667C>G	ENST00000461745.1	+	3	1391	c.491C>G	c.(490-492)aCc>aGc	p.T164S	ROBO2_ENST00000332191.8_Missense_Mutation_p.T164S|ROBO2_ENST00000487694.3_Missense_Mutation_p.T180S	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	164	Ig-like C2-type 2.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCAGAACCCACCATCTACTGG	0.458																																					p.T164S		.											.	ROBO2-328	0			c.C491G						.						81.0	80.0	80.0					3																	77526667		1839	4081	5920	SO:0001583	missense	6092	exon3			AACCCACCATCTA	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.491C>G	3.37:g.77526667C>G	ENSP00000417164:p.Thr164Ser	207	0		189	25	NM_002942	0	0	0	0	0	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	37	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367917	0.61513	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	T;T;T	0.64991	-0.13;-0.13;-0.13	5.58	5.58	0.84498	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.146518	0.31031	N	0.008381	T	0.51856	0.1699	N	0.17901	0.54	0.34398	D	0.694940	B;B;B	0.26258	0.103;0.145;0.103	B;B;B	0.34093	0.124;0.076;0.175	T	0.45891	-0.9230	9	0.11182	T	0.66	.	19.9261	0.97102	0.0:1.0:0.0:0.0	.	180;164;164	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	S	180;180;180;164;164	ENSP00000417335:T180S;ENSP00000417164:T164S;ENSP00000327536:T164S	ENSP00000327536:T164S	T	+	2	0	ROBO2	77609357	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.986000	0.70563	2.789000	0.95967	0.655000	0.94253	ACC	.		0.458	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
SPICE1	152185	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	113187717	113187717	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr3:113187717T>C	ENST00000295872.4	-	9	1040	c.781A>G	c.(781-783)Aga>Gga	p.R261G		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	261					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						GTTTGGAGTCTCTTGACAGCA	0.413																																					p.R261G		.											.	SPICE1-70	0			c.A781G						.						93.0	83.0	86.0					3																	113187717		2203	4300	6503	SO:0001583	missense	152185	exon9			GGAGTCTCTTGAC	AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.781A>G	3.37:g.113187717T>C	ENSP00000295872:p.Arg261Gly	73	0		103	21	NM_144718	0	0	2	3	1	D3DN72|Q8WUX6	Missense_Mutation	SNP	ENST00000295872.4	37	CCDS2973.1	.	.	.	.	.	.	.	.	.	.	T	11.34	1.609350	0.28623	.	.	ENSG00000163611	ENST00000295872	T	0.42513	0.97	5.05	3.88	0.44766	.	0.152408	0.64402	N	0.000019	T	0.42720	0.1215	M	0.74881	2.28	0.46011	D	0.998819	B;B	0.13594	0.008;0.008	B;B	0.17433	0.018;0.018	T	0.40289	-0.9571	10	0.87932	D	0	-8.2512	8.994	0.36041	0.0:0.0891:0.0:0.9109	.	157;261	B3KX77;Q8N0Z3	.;SPICE_HUMAN	G	261	ENSP00000295872:R261G	ENSP00000295872:R261G	R	-	1	2	SPICE1	114670407	1.000000	0.71417	0.999000	0.59377	0.054000	0.15201	2.407000	0.44565	0.845000	0.35118	0.482000	0.46254	AGA	.		0.413	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718	
HCLS1	3059	hgsc.bcm.edu;ucsc.edu	37	3	121351315	121351315	+	Silent	SNP	G	G	A	rs150627065|rs372720825|rs80289672	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr3:121351315G>A	ENST00000314583.3	-	12	1195	c.1104C>T	c.(1102-1104)ccC>ccT	p.P368P	HCLS1_ENST00000473883.1_5'UTR|HCLS1_ENST00000428394.2_Silent_p.P331P	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	368					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		gctcaggctcgggctcaggct	0.607																																					p.P368P		.											.	HCLS1-90	0			c.C1104T	GRCh37	CI045897	HCLS1	I	rs80289672	.						145.0	140.0	142.0					3																	121351315		2203	4300	6503	SO:0001819	synonymous_variant	3059	exon12			AGGCTCGGGCTCA		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.1104C>T	3.37:g.121351315G>A		36	0		42	7	NM_005335	0	0	133	228	95	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	Silent	SNP	ENST00000314583.3	37	CCDS3003.1																																																																																			G|0.936;A|0.064		0.607	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355144.1	NM_005335	
SI	6476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	164709159	164709159	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr3:164709159G>C	ENST00000264382.3	-	44	5152	c.5090C>G	c.(5089-5091)gCt>gGt	p.A1697G		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1697	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TGTGTTTTGAGCTGGCTCTTG	0.368										HNSCC(35;0.089)																											p.A1697G		.											.	SI-104	0			c.C5090G						.						147.0	136.0	140.0					3																	164709159		2203	4300	6503	SO:0001583	missense	6476	exon44			TTTTGAGCTGGCT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.5090C>G	3.37:g.164709159G>C	ENSP00000264382:p.Ala1697Gly	150	0		127	28	NM_001041	0	0	0	0	0	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365923	0.24684	.	.	ENSG00000090402	ENST00000264382	D	0.89939	-2.59	4.78	1.69	0.24217	.	0.253677	0.39909	N	0.001239	D	0.82545	0.5060	L	0.41961	1.31	0.31385	N	0.678558	B	0.06786	0.001	B	0.15052	0.012	T	0.76719	-0.2856	10	0.37606	T	0.19	.	9.6864	0.40100	0.0:0.1272:0.4832:0.3896	.	1697	P14410	SUIS_HUMAN	G	1697	ENSP00000264382:A1697G	ENSP00000264382:A1697G	A	-	2	0	SI	166191853	0.154000	0.22792	0.339000	0.25562	0.767000	0.43475	0.336000	0.19823	0.554000	0.29061	0.467000	0.42956	GCT	.		0.368	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
KLHL6	89857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	183225850	183225850	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr3:183225850A>T	ENST00000341319.3	-	3	941	c.906T>A	c.(904-906)aaT>aaA	p.N302K		NM_130446.2	NP_569713.2	Q8WZ60	KLHL6_HUMAN	kelch-like family member 6	302					B cell receptor signaling pathway (GO:0050853)|germinal center formation (GO:0002467)					breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			TACTCACCTCATTGCCAGAAA	0.498																																					p.N302K		.											.	KLHL6-93	0			c.T906A						.						76.0	69.0	71.0					3																	183225850		2203	4300	6503	SO:0001583	missense	89857	exon3			CACCTCATTGCCA	AF441792	CCDS3245.2	3q27.3	2013-01-30	2013-01-30		ENSG00000172578	ENSG00000172578		"""Kelch-like"", ""BTB/POZ domain containing"""	18653	protein-coding gene	gene with protein product	"""kelch-like protein KLHL6"""	614214	"""kelch-like 6 (Drosophila)"""			11214971, 12617994	Standard	NM_130446		Approved	FLJ00029	uc003flr.3	Q8WZ60	OTTHUMG00000148673	ENST00000341319.3:c.906T>A	3.37:g.183225850A>T	ENSP00000341342:p.Asn302Lys	109	0		130	21	NM_130446	0	0	0	0	0	B2RB31|D3DNS8|Q8N5I1|Q8N892	Missense_Mutation	SNP	ENST00000341319.3	37	CCDS3245.2	.	.	.	.	.	.	.	.	.	.	A	11.85	1.760890	0.31137	.	.	ENSG00000172578	ENST00000341319	T	0.73575	-0.76	5.24	-1.26	0.09376	.	0.415219	0.29609	N	0.011661	T	0.58991	0.2161	L	0.33485	1.01	0.43761	D	0.996279	B	0.15141	0.012	B	0.16289	0.015	T	0.45160	-0.9280	10	0.29301	T	0.29	.	11.7501	0.51843	0.6084:0.0:0.3916:0.0	.	302	Q8WZ60	KLHL6_HUMAN	K	302	ENSP00000341342:N302K	ENSP00000341342:N302K	N	-	3	2	KLHL6	184708544	0.501000	0.26099	0.998000	0.56505	0.982000	0.71751	-0.079000	0.11357	-0.083000	0.12618	0.533000	0.62120	AAT	.		0.498	KLHL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309024.1	NM_130446	
MUC4	4585	bcgsc.ca	37	3	195510833	195510833	+	Missense_Mutation	SNP	G	G	A	rs549569727	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr3:195510833G>A	ENST00000463781.3	-	2	8077	c.7618C>T	c.(7618-7620)Cgt>Tgt	p.R2540C	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.R2540C|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGGCGTGACGTGTGGATAAT	0.572																																					p.R2540C		.											.	MUC4-90	0			c.C7618T						.						191.0	154.0	165.0					3																	195510833		651	1591	2242	SO:0001583	missense	4585	exon2			CGTGACGTGTGGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7618C>T	3.37:g.195510833G>A	ENSP00000417498:p.Arg2540Cys	417	3		414	144	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	6.345	0.431685	0.12045	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32753	1.44;1.45	.	.	.	.	.	.	.	.	T	0.11965	0.0291	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.01281	0.0	T	0.31052	-0.9957	7	.	.	.	.	3.2503	0.06812	0.362:0.0:0.638:0.0	.	2540	E7ESK3	.	C	2540	ENSP00000417498:R2540C;ENSP00000420243:R2540C	.	R	-	1	0	MUC4	196995228	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-3.676000	0.00396	-0.000000	0.14550	0.000000	0.15137	CGT	.		0.572	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
SORCS2	57537	hgsc.bcm.edu	37	4	7725585	7725585	+	Silent	SNP	G	G	A	rs2285779	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr4:7725585G>A	ENST00000507866.2	+	19	2695	c.2586G>A	c.(2584-2586)gaG>gaA	p.E862E	SORCS2_ENST00000329016.9_Silent_p.E690E	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	862	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						GCCACGATGAGGCGGTGCTCT	0.587													G|||	4	0.000798722	0.0	0.0	5008	,	,		18522	0.004		0.0	False		,,,				2504	0.0				p.E862E		.											.	SORCS2-91	0			c.G2586A						.						47.0	49.0	48.0					4																	7725585		2032	4175	6207	SO:0001819	synonymous_variant	57537	exon19			CGATGAGGCGGTG	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2586G>A	4.37:g.7725585G>A		53	0		58	12	NM_020777	0	0	0	0	0	Q9P2L7	Silent	SNP	ENST00000507866.2	37	CCDS47008.1																																																																																			T|0.002;C|0.998		0.587	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	
GPR78	27201	hgsc.bcm.edu	37	4	8583231	8583231	+	Silent	SNP	C	C	A	rs61741008	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr4:8583231C>A	ENST00000382487.4	+	1	939	c.522C>A	c.(520-522)gcC>gcA	p.A174A	GPR78_ENST00000509216.1_Intron	NM_080819.4	NP_543009.2	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	174					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(4)|kidney(4)|large_intestine(1)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26						CCTTCACCGCCACGCTCCATG	0.697													C|||	24	0.00479233	0.0	0.0043	5008	,	,		16694	0.0		0.0189	False		,,,				2504	0.002				p.A174A		.											.	GPR78-516	0			c.C522A						.	C		8,4196		0,8,2094	10.0	11.0	10.0		522	-1.0	0.0	4	dbSNP_129	10	97,8169		0,97,4036	no	coding-synonymous	GPR78	NM_080819.2		0,105,6130	AA,AC,CC		1.1735,0.1903,0.842		174/364	8583231	105,12365	2102	4133	6235	SO:0001819	synonymous_variant	27201	exon1			CACCGCCACGCTC	AF411107	CCDS3403.1	4p16.1	2012-08-21			ENSG00000155269	ENSG00000155269		"""GPCR / Class A : Orphans"""	4528	protein-coding gene	gene with protein product		606921				11574155	Standard	NM_080819		Approved		uc003glk.4	Q96P69	OTTHUMG00000128483	ENST00000382487.4:c.522C>A	4.37:g.8583231C>A		2	0		21	10	NM_080819	0	0	0	0	0	Q8NGV3	Silent	SNP	ENST00000382487.4	37	CCDS3403.1																																																																																			C|0.992;A|0.008		0.697	GPR78-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359201.1		
TECRL	253017	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	65145874	65145874	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr4:65145874C>A	ENST00000381210.3	-	12	1118	c.1008G>T	c.(1006-1008)tgG>tgT	p.W336C	TECRL_ENST00000507440.1_Intron	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	336					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						TCTTTTGTGCCCACAAAGACA	0.244																																					p.W336C		.											.	TECRL-90	0			c.G1008T						.						38.0	40.0	40.0					4																	65145874		2185	4251	6436	SO:0001583	missense	253017	exon12			TTGTGCCCACAAA	AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.1008G>T	4.37:g.65145874C>A	ENSP00000370607:p.Trp336Cys	43	0		46	11	NM_001010874	0	0	0	0	0		Missense_Mutation	SNP	ENST00000381210.3	37	CCDS33990.1	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387012	0.61956	.	.	ENSG00000205678	ENST00000381210	T	0.29917	1.55	5.09	5.09	0.68999	3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.59555	0.2202	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65524	-0.6147	10	0.72032	D	0.01	-8.0499	14.3347	0.66581	0.0:1.0:0.0:0.0	.	336	Q5HYJ1	TECRL_HUMAN	C	336	ENSP00000370607:W336C	ENSP00000370607:W336C	W	-	3	0	TECRL	64828469	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	5.142000	0.64820	2.516000	0.84829	0.650000	0.86243	TGG	.		0.244	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361705.4	NM_001010874	
SLC4A4	8671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	72319242	72319242	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr4:72319242G>T	ENST00000264485.5	+	12	1470	c.1353G>T	c.(1351-1353)aaG>aaT	p.K451N	SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000340595.3_Missense_Mutation_p.K407N|SLC4A4_ENST00000425175.1_Missense_Mutation_p.K451N|SLC4A4_ENST00000512686.1_Missense_Mutation_p.K407N|SLC4A4_ENST00000351898.6_Missense_Mutation_p.K451N	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	451					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	AAGACATAAAGAGGAAAGCGC	0.348																																					p.K451N		.											.	SLC4A4-95	0			c.G1353T						.						189.0	192.0	191.0					4																	72319242		2203	4300	6503	SO:0001583	missense	8671	exon12			CATAAAGAGGAAA	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.1353G>T	4.37:g.72319242G>T	ENSP00000264485:p.Lys451Asn	57	0		59	24	NM_001098484	0	0	0	0	0	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.931460	0.73442	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000512686;ENST00000340595	D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57	6.03	6.03	0.97812	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93569	0.7947	M	0.91300	3.195	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;1.0;0.993;0.99;0.976;0.997	D;D;D;P;D;D	0.85130	0.987;0.997;0.927;0.864;0.93;0.981	D	0.93900	0.7187	10	0.87932	D	0	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	451;451;407;407;431;451	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1-3;Q9Y6R3;Q9Y6R1	.;.;.;.;.;S4A4_HUMAN	N	451;451;451;407;407	ENSP00000264485:K451N;ENSP00000393557:K451N;ENSP00000307349:K451N;ENSP00000422400:K407N;ENSP00000344272:K407N	ENSP00000264485:K451N	K	+	3	2	SLC4A4	72538106	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.618000	0.46393	2.861000	0.98227	0.655000	0.94253	AAG	.		0.348	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
FHDC1	85462	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	153889150	153889150	+	Silent	SNP	G	G	A	rs146044034		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr4:153889150G>A	ENST00000511601.1	+	10	1307	c.1119G>A	c.(1117-1119)acG>acA	p.T373T	FHDC1_ENST00000260008.3_Silent_p.T373T			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	373	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.								ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					TGGAGAACACGGAGGCAGAAC	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		19784	0.001		0.0	False		,,,				2504	0.0				p.T373T		.											.	FHDC1-136	0			c.G1119A						.	G		1,4405	2.1+/-5.4	0,1,2202	179.0	175.0	176.0		1119	-11.7	0.1	4	dbSNP_134	176	0,8600		0,0,4300	no	coding-synonymous	FHDC1	NM_033393.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		373/1144	153889150	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	85462	exon9			GAACACGGAGGCA	AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.1119G>A	4.37:g.153889150G>A		68	0		97	24	NM_033393	0	0	0	0	0		Silent	SNP	ENST00000511601.1	37	CCDS34081.1																																																																																			G|1.000;A|0.000		0.423	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364981.2	NM_033393	
PALLD	23022	broad.mit.edu	37	4	169633067	169633067	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr4:169633067C>A	ENST00000505667.1	+	10	2130	c.1957C>A	c.(1957-1959)Cca>Aca	p.P653T	PALLD_ENST00000512127.1_Missense_Mutation_p.P271T|PALLD_ENST00000335742.7_Missense_Mutation_p.P271T|PALLD_ENST00000261509.6_Missense_Mutation_p.P653T			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	653	Interaction with LASP1. {ECO:0000250}.|Pro-rich.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GCTTGCCAAACCAAAACTGTG	0.403									Pancreatic Cancer, Familial Clustering of																												p.P653T	Esophageal Squamous(109;1482 1532 18347 40239 51172)	.											.	PALLD-94	0			c.C1957A						.						58.0	63.0	61.0					4																	169633067		2203	4300	6503	SO:0001583	missense	23022	exon10	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	GCCAAACCAAAAC	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1957C>A	4.37:g.169633067C>A	ENSP00000425556:p.Pro653Thr	59	1		71	3	NM_001166108	0	0	0	0	0	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648056	0.67358	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127	T;T;T;T	0.79653	-1.29;-0.38;-0.89;-1.18	5.7	4.85	0.62838	.	0.000000	0.31897	U	0.006890	T	0.78534	0.4298	M	0.77313	2.365	0.53005	D	0.999964	B;B;B	0.32653	0.379;0.029;0.379	B;B;B	0.28709	0.093;0.013;0.093	T	0.75548	-0.3279	10	0.12430	T	0.62	.	16.0092	0.80385	0.1356:0.8644:0.0:0.0	.	653;271;653	B7ZMM5;B3KTG2;B2RTX2	.;.;.	T	653;271;653;271	ENSP00000261509:P653T;ENSP00000336735:P271T;ENSP00000425556:P653T;ENSP00000426947:P271T	ENSP00000261509:P653T	P	+	1	0	PALLD	169869642	1.000000	0.71417	0.965000	0.40720	0.736000	0.42039	6.512000	0.73737	1.382000	0.46385	0.655000	0.94253	CCA	.		0.403	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	
PCDHB7	56129	hgsc.bcm.edu	37	5	140554140	140554140	+	Missense_Mutation	SNP	C	C	T	rs13189280		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr5:140554140C>T	ENST00000231137.3	+	1	1898	c.1724C>T	c.(1723-1725)cCg>cTg	p.P575L		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	575	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.		P -> L (in dbSNP:rs13189280).		homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGCACCGAGCCGTTGCCCCGG	0.701																																					p.P575L		.											.	PCDHB7-95	0			c.C1724T						.						31.0	41.0	37.0					5																	140554140		2151	4236	6387	SO:0001583	missense	56129	exon1			CCGAGCCGTTGCC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.1724C>T	5.37:g.140554140C>T	ENSP00000231137:p.Pro575Leu	2	0		43	6	NM_018940	0	0	7	7	0	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	37	CCDS4249.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.012|0.012	-1.676739|-1.676739	0.00751|0.00751	.|.	.|.	ENSG00000113212|ENSG00000113212	ENST00000231137|ENST00000543636	T|.	0.66280|.	-0.2|.	4.3|4.3	3.12|3.12	0.35913|0.35913	Cadherin (1);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.12732|0.12732	0.0309|0.0309	N|N	0.00186|0.00186	-1.895|-1.895	0.37304|0.37304	D|D	0.908829|0.908829	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.23619|0.23619	-1.0183|-1.0183	9|6	0.02654|0.87932	T|D	1|0	.|.	9.8212|9.8212	0.40883|0.40883	0.0:0.0849:0.0:0.9151|0.0:0.0849:0.0:0.9151	rs13189280;rs17844469|rs13189280;rs17844469	575|.	Q9Y5E2|.	PCDB7_HUMAN|.	L|C	575|358	ENSP00000231137:P575L|.	ENSP00000231137:P575L|ENSP00000440828:R358C	P|R	+|+	2|1	0|0	PCDHB7|PCDHB7	140534324|140534324	0.394000|0.394000	0.25246|0.25246	1.000000|1.000000	0.80357|0.80357	0.339000|0.339000	0.28857|0.28857	0.709000|0.709000	0.25734|0.25734	0.605000|0.605000	0.29947|0.29947	-0.637000|-0.637000	0.03976|0.03976	CCG|CGT	C|1.000;|0.000		0.701	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		4	0		54	14	NM_018930	0	0	65	84	19	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
SPINK5	11005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	147480929	147480929	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr5:147480929A>G	ENST00000256084.7	+	14	1274	c.1232A>G	c.(1231-1233)gAa>gGa	p.E411G	SPINK5_ENST00000359874.3_Missense_Mutation_p.E411G|SPINK5_ENST00000476608.1_3'UTR|SPINK5_ENST00000398454.1_Missense_Mutation_p.E411G	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	411	Kazal-like 6. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGCAGAAGAAGAAGAAAAG	0.328																																					p.E411G		.											.	SPINK5-138	0			c.A1232G						.						91.0	81.0	84.0					5																	147480929		1840	4087	5927	SO:0001583	missense	11005	exon14			CAGAAGAAGAAGA	AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.1232A>G	5.37:g.147480929A>G	ENSP00000256084:p.Glu411Gly	164	0		233	35	NM_001127699	0	0	0	0	0	A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	ENST00000256084.7	37	CCDS43382.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.737788	0.49045	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.04317	3.65;3.65;3.65;3.65	2.52	1.3	0.21679	Proteinase inhibitor I1, Kazal (1);Protease inhibitor, Kazal-type (1);	0.590819	0.14227	N	0.332976	T	0.04998	0.0134	L	0.38531	1.155	0.22330	N	0.9992	B;P;P;P	0.44521	0.242;0.837;0.776;0.735	B;P;P;B	0.45913	0.314;0.458;0.497;0.287	T	0.39396	-0.9616	10	0.20046	T	0.44	-9.3844	5.5958	0.17327	0.7143:0.2857:0.0:0.0	.	392;411;411;411	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	G	411;411;392;411	ENSP00000381472:E411G;ENSP00000352936:E411G;ENSP00000421519:E392G;ENSP00000256084:E411G	ENSP00000256084:E411G	E	+	2	0	SPINK5	147461122	0.959000	0.32827	0.943000	0.38184	0.988000	0.76386	0.806000	0.27126	0.362000	0.24319	0.254000	0.18369	GAA	.		0.328	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000259215.2	NM_001127698	
SPDL1	54908	bcgsc.ca	37	5	169028481	169028481	+	Missense_Mutation	SNP	T	T	C	rs3797713	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr5:169028481T>C	ENST00000265295.4	+	11	1801	c.1522T>C	c.(1522-1524)Tac>Cac	p.Y508H		NM_017785.4	NP_060255.3			spindle apparatus coiled-coil protein 1																		AGTTTCTATATACACACCAGT	0.423													C|||	3289	0.656749	0.5893	0.5965	5008	,	,		19612	0.7331		0.672	False		,,,				2504	0.6963				p.Y508H		.											.	.	0			c.T1522C						.	C	HIS/TYR	2606,1800	529.8+/-372.8	766,1074,363	97.0	97.0	97.0		1522	-7.3	0.0	5	dbSNP_107	97	5937,2663	428.9+/-356.0	2053,1831,416	yes	missense	CCDC99	NM_017785.4	83	2819,2905,779	CC,CT,TT		30.9651,40.8534,34.3149	benign	508/606	169028481	8543,4463	2203	4300	6503	SO:0001583	missense	54908	exon11			TCTATATACACAC	BC012568	CCDS4370.1	5q35.1	2012-09-27	2012-09-27	2012-09-27	ENSG00000040275	ENSG00000040275			26010	protein-coding gene	gene with protein product	"""spindly homolog (Drosophila)"""		"""coiled-coil domain containing 99"""	CCDC99		20427577	Standard	NM_017785		Approved	FLJ20364, hSpindly	uc003mae.4	Q96EA4	OTTHUMG00000130438	ENST00000265295.4:c.1522T>C	5.37:g.169028481T>C	ENSP00000265295:p.Tyr508His	91	0		147	6	NM_017785	0	0	5	5	0		Missense_Mutation	SNP	ENST00000265295.4	37	CCDS4370.1	1430	0.6547619047619048	282	0.573170731707317	217	0.5994475138121547	410	0.7167832167832168	521	0.6873350923482849	C	3.767	-0.048465	0.07407	0.591466	0.690349	ENSG00000040275	ENST00000265295;ENST00000274631	T	0.29142	1.58	5.72	-7.3	0.01446	.	1.374820	0.04155	N	0.322065	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33854	-0.9852	9	0.14252	T	0.57	0.2716	1.0777	0.01636	0.1822:0.2729:0.2835:0.2614	rs3797713;rs17856399;rs57787986;rs3797713	430;409;508	B4E393;Q96EA4-2;Q96EA4	.;.;SPDLY_HUMAN	H	508;409	ENSP00000265295:Y508H	ENSP00000265295:Y508H	Y	+	1	0	CCDC99	168961059	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.235000	0.09016	-1.851000	0.01168	-2.830000	0.00107	TAC	T|0.334;C|0.666		0.423	SPDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252829.2	NM_017785	
RREB1	6239	hgsc.bcm.edu	37	6	7230680	7230680	+	Missense_Mutation	SNP	G	G	T	rs9502564	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr6:7230680G>T	ENST00000349384.6	+	10	2662	c.2348G>T	c.(2347-2349)gGc>gTc	p.G783V	RREB1_ENST00000379933.3_Missense_Mutation_p.G783V|RREB1_ENST00000334984.6_Missense_Mutation_p.G783V|RREB1_ENST00000379938.2_Missense_Mutation_p.G783V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	783			G -> V (in dbSNP:rs9502564). {ECO:0000269|PubMed:15067362, ECO:0000269|PubMed:21703425}.		multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGGCGGGGGCCACAAGGGC	0.697													G|||	2678	0.534744	0.5333	0.4063	5008	,	,		15583	0.7411		0.2893	False		,,,				2504	0.6677				p.G783V		.											.	RREB1-144	0			c.G2348T						.	G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	2083,2197		552,979,609	9.0	9.0	9.0		2348,2348,2348,2348	5.3	1.0	6	dbSNP_119	9	2599,5719		488,1623,2048	yes	missense,missense,missense,missense	RREB1	NM_001003698.3,NM_001003699.3,NM_001003700.1,NM_001168344.1	109,109,109,109	1040,2602,2657	TT,TG,GG		31.2455,48.6682,37.1646	benign,benign,benign,benign	783/1688,783/1743,783/1477,783/1688	7230680	4682,7916	2140	4159	6299	SO:0001583	missense	6239	exon10			GCGGGGGCCACAA	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2348G>T	6.37:g.7230680G>T	ENSP00000305560:p.Gly783Val	0	0		7	6	NM_001003700	0	0	0	2	2	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	1014	0.4642857142857143	249	0.5060975609756098	148	0.4088397790055249	412	0.7202797202797203	205	0.2704485488126649	G	11.15	1.553554	0.27739	0.486682	0.312455	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.09163	3.07;3.07;3.07;3.01	5.32	5.32	0.75619	.	0.278837	0.31370	N	0.007766	T	0.02533	0.0077	N	0.14661	0.345	0.21915	P	0.999474401	B;B;B	0.32653	0.161;0.379;0.328	B;B;B	0.35182	0.079;0.197;0.178	T	0.45512	-0.9256	9	0.13108	T	0.6	-17.3998	11.4207	0.49980	0.0:0.0:0.8202:0.1797	rs9502564	783;783;783	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	783	ENSP00000369265:G783V;ENSP00000369270:G783V;ENSP00000305560:G783V;ENSP00000335574:G783V	ENSP00000335574:G783V	G	+	2	0	RREB1	7175679	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	5.477000	0.66799	2.760000	0.94817	0.655000	0.94253	GGC	G|0.546;T|0.454		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51695775	51695775	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr6:51695775G>C	ENST00000371117.3	-	52	8461	c.8186C>G	c.(8185-8187)gCc>gGc	p.A2729G	PKHD1_ENST00000340994.4_Missense_Mutation_p.A2729G	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2729					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGATTCAGGGGCAGAGGTAGA	0.398																																					p.A2729G		.											.	PKHD1-603	0			c.C8186G						.						66.0	62.0	63.0					6																	51695775		2203	4300	6503	SO:0001583	missense	5314	exon52			TCAGGGGCAGAGG	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.8186C>G	6.37:g.51695775G>C	ENSP00000360158:p.Ala2729Gly	47	0		38	25	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	G	7.666	0.685906	0.14973	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87334	-2.04;-2.24	5.32	-4.85	0.03142	.	1.121610	0.06613	N	0.756050	T	0.59676	0.2211	L	0.29908	0.895	0.09310	N	1	B;B;B	0.31125	0.309;0.288;0.272	B;B;B	0.32211	0.073;0.142;0.049	T	0.55823	-0.8080	10	0.37606	T	0.19	.	5.1411	0.14959	0.459:0.0:0.2374:0.3036	.	2729;2729;2729	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	G	2729	ENSP00000360158:A2729G;ENSP00000341097:A2729G	ENSP00000341097:A2729G	A	-	2	0	PKHD1	51803734	0.147000	0.22687	0.014000	0.15608	0.896000	0.52359	-0.440000	0.06888	-1.000000	0.03438	0.655000	0.94253	GCC	.		0.398	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
MAP7	9053	hgsc.bcm.edu	37	6	136682172	136682172	+	Missense_Mutation	SNP	G	G	A	rs2076190	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr6:136682172G>A	ENST00000354570.3	-	12	2082	c.1672C>T	c.(1672-1674)Cgg>Tgg	p.R558W	MAP7_ENST00000454590.1_Missense_Mutation_p.R580W|MAP7_ENST00000544465.1_Missense_Mutation_p.R543W|MAP7_ENST00000438100.2_Missense_Mutation_p.R543W|MAP7_ENST00000432797.2_Missense_Mutation_p.R412W	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	558			R -> W (in dbSNP:rs2076190). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GCCTCCTCCCGCTCGCGCAGC	0.761													G|||	3864	0.771565	0.7156	0.8026	5008	,	,		9294	0.6736		0.8459	False		,,,				2504	0.8497				p.R588W		.											.	MAP7-90	0			c.C1762T						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	3211,1131		1187,837,147	7.0	8.0	8.0		1738,1762,1627,1738,1627,1561,1390,1234,1234,1672	2.8	1.0	6	dbSNP_96	8	7130,1264		3035,1060,102	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	MAP7	NM_001198608.1,NM_001198609.1,NM_001198611.1,NM_001198614.1,NM_001198615.1,NM_001198616.1,NM_001198617.1,NM_001198618.1,NM_001198619.1,NM_003980.4	101,101,101,101,101,101,101,101,101,101	4222,1897,249	AA,AG,GG		15.0584,26.0479,18.805	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	580/772,588/780,543/735,580/772,543/735,521/713,464/656,412/604,412/604,558/750	136682172	10341,2395	2171	4197	6368	SO:0001583	missense	9053	exon12			CCTCCCGCTCGCG	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1672C>T	6.37:g.136682172G>A	ENSP00000346581:p.Arg558Trp	0	0		18	14	NM_001198609	1	0	0	5	4	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	CCDS5178.1	1644	0.7527472527472527	337	0.6849593495934959	282	0.7790055248618785	382	0.6678321678321678	643	0.8482849604221636	G	14.45	2.539239	0.45176	0.739521	0.849416	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	4.89	2.78	0.32641	.	0.296091	0.22491	N	0.059376	T	0.35189	0.0923	M	0.82517	2.595	0.26264	P	0.9785292	D;D;D;D;D;D	0.76494	0.995;0.994;0.995;0.999;0.998;0.998	P;P;P;P;P;P	0.60886	0.751;0.636;0.751;0.809;0.809;0.88	T	0.38779	-0.9645	9	0.52906	T	0.07	-5.3629	10.9226	0.47174	0.0:0.0:0.3457:0.6543	rs2076190;rs2230172;rs6928528	543;543;580;464;521;558	B7Z290;F5H1E2;E9PCP3;F8W783;Q14244-2;Q14244	.;.;.;.;.;MAP7_HUMAN	W	558;580;543;543;412;464	ENSP00000346581:R558W;ENSP00000414712:R580W;ENSP00000445737:R543W;ENSP00000400790:R543W;ENSP00000414879:R412W	ENSP00000344217:R464W	R	-	1	2	MAP7	136723865	0.441000	0.25626	0.960000	0.40013	0.620000	0.37586	1.543000	0.36147	0.988000	0.38734	0.555000	0.69702	CGG	G|0.243;A|0.757		0.761	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
GRID2IP	392862	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	6590955	6590955	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr7:6590955G>A	ENST00000457091.2	-	1	112	c.113C>T	c.(112-114)gCg>gTg	p.A38V		NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	38	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						TCCGGCATGCGCGCTGCTCCC	0.726																																					p.A38V		.											.	.	0			c.C113T						.						7.0	9.0	8.0					7																	6590955		686	1580	2266	SO:0001583	missense	392862	exon1			GCATGCGCGCTGC		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.113C>T	7.37:g.6590955G>A	ENSP00000397351:p.Ala38Val	12	0		64	24	NM_001145118	0	0	0	0	0		Missense_Mutation	SNP	ENST00000457091.2	37	CCDS47537.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879895	0.91740	.	.	ENSG00000215045	ENST00000457091	T	0.66638	-0.22	4.62	4.62	0.57501	PDZ/DHR/GLGF (4);	0.000000	0.32970	U	0.005438	D	0.83073	0.5175	M	0.85945	2.785	0.47476	D	0.999438	D	0.89917	1.0	D	0.87578	0.998	D	0.86343	0.1706	10	0.87932	D	0	.	15.3335	0.74231	0.0:0.0:1.0:0.0	.	38	A4D2P6	GRD2I_HUMAN	V	38	ENSP00000397351:A38V	ENSP00000397351:A38V	A	-	2	0	GRID2IP	6557480	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	8.817000	0.91985	2.292000	0.77174	0.455000	0.32223	GCG	.		0.726	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340534.1	XM_294249	
GARS	2617	hgsc.bcm.edu	37	7	30634548	30634548	+	Missense_Mutation	SNP	C	C	T	rs62636572	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr7:30634548C>T	ENST00000389266.3	+	1	252	c.11C>T	c.(10-12)cCg>cTg	p.P4L	AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000584199.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	4					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	ATGCCCTCTCCGCGTCCAGTG	0.711													C|||	42	0.00838658	0.0	0.0245	5008	,	,		14101	0.0		0.0239	False		,,,				2504	0.001				p.P4L		.											.	GARS-91	0			c.C11T						.	C	LEU/PRO	10,3978		0,10,1984	7.0	8.0	8.0		11	-1.4	0.0	7	dbSNP_129	8	113,8037		0,113,3962	yes	missense	GARS	NM_002047.2	98	0,123,5946	TT,TC,CC		1.3865,0.2508,1.0133	benign	4/740	30634548	123,12015	1994	4075	6069	SO:0001583	missense	2617	exon1			CCTCTCCGCGTCC	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.11C>T	7.37:g.30634548C>T	ENSP00000373918:p.Pro4Leu	0	0		21	10	NM_002047	0	0	3	9	6	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	29	0.013278388278388278	0	0.0	11	0.03038674033149171	0	0.0	18	0.023746701846965697	C	0.026	-1.372300	0.01214	0.002508	0.013865	ENSG00000106105	ENST00000389266	T	0.80566	-1.39	3.33	-1.39	0.08997	.	0.647368	0.15500	N	0.259091	T	0.29817	0.0745	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25641	-1.0126	10	0.10377	T	0.69	0.9595	7.0049	0.24830	0.0:0.4002:0.0:0.5998	rs62636572	4	P41250	SYG_HUMAN	L	4	ENSP00000373918:P4L	ENSP00000373918:P4L	P	+	2	0	GARS	30601073	0.000000	0.05858	0.011000	0.14972	0.317000	0.28152	-0.624000	0.05540	-0.325000	0.08577	-0.133000	0.14855	CCG	C|0.986;T|0.014		0.711	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000584199.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		10	10	NM_002047	0	0	0	37	37	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
BBS9	27241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	33388714	33388714	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr7:33388714C>A	ENST00000242067.6	+	13	1885	c.1364C>A	c.(1363-1365)gCc>gAc	p.A455D	BBS9_ENST00000355070.2_Missense_Mutation_p.A455D|BBS9_ENST00000354265.4_Missense_Mutation_p.A455D|BBS9_ENST00000396127.2_Missense_Mutation_p.A455D|BBS9_ENST00000350941.3_Missense_Mutation_p.A455D	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	455			A -> T (in dbSNP:rs11773504).|A -> V (in dbSNP:rs11773504).		cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			TTGCAAAAAGCCAAATTATCA	0.333									Bardet-Biedl syndrome																												p.A455D		.											.	BBS9-230	0			c.C1364A						.						183.0	162.0	169.0					7																	33388714		2203	4300	6503	SO:0001583	missense	27241	exon13	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AAAAAGCCAAATT		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1364C>A	7.37:g.33388714C>A	ENSP00000242067:p.Ala455Asp	94	0		109	21	NM_014451	0	0	0	0	0	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	ENST00000242067.6	37	CCDS43566.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.771|8.771	0.925902|0.925902	0.18056|0.18056	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000537775|ENST00000434373	T;T;T;T;T|.	0.59638|.	2.54;0.28;0.25;2.54;2.54|.	5.41|5.41	-1.89|-1.89	0.07689|0.07689	.|.	0.669759|.	0.14809|.	N|.	0.297157|.	T|T	0.32102|0.32102	0.0818|0.0818	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	B;B;B;B|.	0.25486|.	0.127;0.127;0.127;0.127|.	B;B;B;B|.	0.33339|.	0.081;0.162;0.081;0.162|.	T|T	0.33085|0.33085	-0.9882|-0.9882	10|5	0.14656|.	T|.	0.56|.	-0.0118|-0.0118	11.3088|11.3088	0.49351|0.49351	0.0:0.3427:0.0:0.6573|0.0:0.3427:0.0:0.6573	.|.	455;455;455;455|.	Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.	.;.;.;PTHB1_HUMAN|.	D|R	455;455;455;455;455;455;455;333|21	ENSP00000242067:A455D;ENSP00000313122:A455D;ENSP00000379433:A455D;ENSP00000347182:A455D;ENSP00000346214:A455D|.	ENSP00000242067:A455D|.	A|S	+|+	2|3	0|2	BBS9|BBS9	33355239|33355239	0.887000|0.887000	0.30362|0.30362	0.929000|0.929000	0.37066|0.37066	0.213000|0.213000	0.24496|0.24496	0.053000|0.053000	0.14184|0.14184	-0.479000|-0.479000	0.06813|0.06813	-0.224000|-0.224000	0.12420|0.12420	GCC|AGC	.		0.333	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329064.1		
POM121	9883	ucsc.edu	37	7	72420448	72420448	+	3'UTR	SNP	C	C	G	rs400282	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr7:72420448C>G	ENST00000395270.1	+	0	5480				NSUN5P2_ENST00000388955.4_RNA	NM_001257190.1	NP_001244119.1	Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.W47S(3)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				CACAGGCATCCATGACATGGG	0.612													.|||	11	0.00219649	0.0015	0.0014	5008	,	,		17883	0.0		0.004	False		,,,				2504	0.0041				.		.											.	NSUN5P2-90	3	Substitution - Missense(3)	large_intestine(1)|lung(1)|kidney(1)	.						.						40.0	44.0	43.0					7																	72420448		2199	4300	6499	SO:0001624	3_prime_UTR_variant	260294	.			GGCATCCATGACA	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000395270.1:c.*1439C>G	7.37:g.72420448C>G		80	4		119	15	.	0	0	25	44	19	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	RNA	SNP	ENST00000395270.1	37	CCDS59059.1																																																																																			C|0.999;G|0.001		0.612	POM121-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252020.1		
ATP6V0E2	155066	hgsc.bcm.edu	37	7	149571095	149571095	+	5'UTR	SNP	G	G	A	rs79377053	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr7:149571095G>A	ENST00000464662.1	+	0	14				ATP6V0E2_ENST00000425642.2_5'Flank|ATP6V0E2-AS1_ENST00000488315.1_RNA|ATP6V0E2_ENST00000606024.1_5'UTR|ATP6V0E2-AS1_ENST00000461019.1_RNA|ATP6V0E2-AS1_ENST00000464939.1_RNA|ATP6V0E2_ENST00000421974.2_Missense_Mutation_p.A30T|ATP6V0E2_ENST00000479613.1_5'UTR|ATP6V0E2_ENST00000456496.2_Missense_Mutation_p.A30T			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2						ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			CTGGGGACCCGCGCACCTGCA	0.716													G|||	682	0.136182	0.3994	0.049	5008	,	,		12396	0.0526		0.0368	False		,,,				2504	0.0307				p.A30T		.											.	.	0			c.G88A						.	G	THR/ALA,THR/ALA	991,2511		116,759,876	4.0	6.0	5.0		88,88	1.7	0.0	7	dbSNP_132	5	266,6746		7,252,3247	no	missense,missense	ATP6V0E2	NM_001100592.1,NM_145230.2	58,58	123,1011,4123	AA,AG,GG		3.7935,28.2981,11.9555	probably-damaging,probably-damaging	30/214,30/131	149571095	1257,9257	1751	3506	5257	SO:0001623	5_prime_UTR_variant	155066	exon1			GGACCCGCGCACC	AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094	ENST00000464662.1:c.-60G>A	7.37:g.149571095G>A		0	0		21	17	NM_001100592	0	0	3	10	7	A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Missense_Mutation	SNP	ENST00000464662.1	37		283	0.1295787545787546	188	0.3821138211382114	21	0.058011049723756904	42	0.07342657342657342	32	0.04221635883905013	G	14.56	2.570645	0.45798	0.282981	0.037935	ENSG00000171130	ENST00000421974;ENST00000456496	.	.	.	2.57	1.67	0.24075	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.43550	P	0.004141999999999979	P	0.40638	0.725	B	0.27608	0.081	T	0.43988	-0.9357	7	0.87932	D	0	.	7.3999	0.26958	0.0:0.2709:0.7291:0.0	.	30	E9PAS2	.	T	30	.	ENSP00000411672:A30T	A	+	1	0	ATP6V0E2	149202028	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.103000	0.15292	0.651000	0.30788	0.563000	0.77884	GCG	G|0.870;A|0.130		0.716	ATP6V0E2-007	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350177.2	NM_145230	
EN2	2020	hgsc.bcm.edu	37	7	155251183	155251183	+	Silent	SNP	G	G	A	rs77846527	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr7:155251183G>A	ENST00000297375.4	+	1	360	c.111G>A	c.(109-111)ccG>ccA	p.P37P	AC008060.8_ENST00000419225.1_lincRNA	NM_001427.3	NP_001418.2	P19622	HME2_HUMAN	engrailed homeobox 2	37					hindbrain development (GO:0030902)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron development (GO:0048666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		gtagcagcCCGGGCGAAGCGG	0.751													g|||	520	0.103834	0.1407	0.0663	5008	,	,		6800	0.0208		0.1113	False		,,,				2504	0.1585				p.P37P		.											.	EN2-90	0			c.G111A						.						2.0	3.0	2.0					7																	155251183		1497	3024	4521	SO:0001819	synonymous_variant	2020	exon1			CAGCCCGGGCGAA		CCDS5940.1	7q36.2	2011-06-20	2007-02-15		ENSG00000164778	ENSG00000164778		"""Homeoboxes / ANTP class : NKL subclass"""	3343	protein-coding gene	gene with protein product		131310					Standard	NM_001427		Approved		uc003wmb.3	P19622	OTTHUMG00000151354	ENST00000297375.4:c.111G>A	7.37:g.155251183G>A		1	0		12	8	NM_001427	0	0	0	0	0	A4D252|Q549U3|Q9UD58	Silent	SNP	ENST00000297375.4	37	CCDS5940.1																																																																																			G|0.911;A|0.089		0.751	EN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322337.1	NM_001427	
CSMD1	64478	broad.mit.edu	37	8	3889601	3889601	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr8:3889601C>A	ENST00000520002.1	-	4	991	c.436G>T	c.(436-438)Gga>Tga	p.G146*	CSMD1_ENST00000537824.1_Nonsense_Mutation_p.G146*|CSMD1_ENST00000602723.1_Nonsense_Mutation_p.G146*|CSMD1_ENST00000542608.1_Nonsense_Mutation_p.G146*|CSMD1_ENST00000602557.1_Nonsense_Mutation_p.G146*|CSMD1_ENST00000539096.1_Nonsense_Mutation_p.G146*|CSMD1_ENST00000400186.3_Nonsense_Mutation_p.G146*			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	146	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CCAGGATTTCCACAAGTGTGG	0.408																																					p.G146X		.											.	CSMD1-86	0			c.G436T						.						77.0	79.0	78.0					8																	3889601		1942	4149	6091	SO:0001587	stop_gained	64478	exon4			GATTTCCACAAGT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.436G>T	8.37:g.3889601C>A	ENSP00000430733:p.Gly146*	44	1		63	10	NM_033225	0	0	0	0	0	Q0H0J5|Q96QU9|Q96RM4	Nonsense_Mutation	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	C	38	7.079076	0.98048	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.	.	.	5.52	5.52	0.82312	.	0.000000	0.46442	U	0.000287	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	18.4147	0.90565	0.0:1.0:0.0:0.0	.	.	.	.	X	146;146;8;146;146;146	.	ENSP00000320445:G8X	G	-	1	0	CSMD1	3877009	1.000000	0.71417	0.981000	0.43875	0.369000	0.29798	7.558000	0.82253	2.612000	0.88384	0.655000	0.94253	GGA	.		0.408	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		1	0	1096	25	8	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		10	9	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000398774.2_Silent_p.L1152L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		0	0		7	6	NM_201380	0	0	0	6	6	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
TUSC1	286319	hgsc.bcm.edu	37	9	25678122	25678122	+	Silent	SNP	G	G	C	rs72631814	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr9:25678122G>C	ENST00000358022.3	-	1	734	c.198C>G	c.(196-198)gcC>gcG	p.A66A		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	66										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		CCGCCAGGTCGGCAAACCGCT	0.776													G|||	885	0.176717	0.1324	0.1772	5008	,	,		7019	0.1151		0.3002	False		,,,				2504	0.1728				p.A66A	Pancreas(19;648 672 25630 30820 31331)	.											.	TUSC1-90	0			c.C198G						.	G		389,3633		24,341,1646	6.0	6.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	198	0.6	1.0	9	dbSNP_130	6	1826,6086		225,1376,2355	no	coding-synonymous	TUSC1	NM_001004125.2		249,1717,4001	CC,CG,GG		23.0789,9.6718,18.5604		66/213	25678122	2215,9719	2011	3956	5967	SO:0001819	synonymous_variant	286319	exon1			CAGGTCGGCAAAC	AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.198C>G	9.37:g.25678122G>C		0	0		26	6	NM_001004125	0	0	1	1	0	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Silent	SNP	ENST00000358022.3	37	CCDS34999.1																																																																																			G|0.807;C|0.193		0.776	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
CEP78	84131	broad.mit.edu	37	9	80851434	80851434	+	Silent	SNP	G	G	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr9:80851434G>T	ENST00000424347.2	+	1	457	c.168G>T	c.(166-168)gcG>gcT	p.A56A	CEP78_ENST00000376597.4_Silent_p.A56A|CEP78_ENST00000415759.2_Silent_p.A56A|CEP78_ENST00000277082.5_Silent_p.A56A|CEP78_ENST00000376598.2_Silent_p.A56A			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	56					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						TGGACTGGGCGCCTCTGCTGA	0.657																																					p.A56A		.											.	CEP78-69	0			c.G168T						.						20.0	23.0	22.0					9																	80851434		1925	4119	6044	SO:0001819	synonymous_variant	84131	exon1			CTGGGCGCCTCTG	BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.168G>T	9.37:g.80851434G>T		27	1		52	6	NM_001098802	0	0	0	0	0	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Silent	SNP	ENST00000424347.2	37																																																																																				.		0.657	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000052766.2	XM_095991	
GPR144	347088	broad.mit.edu;bcgsc.ca	37	9	127230891	127230891	+	Missense_Mutation	SNP	G	G	A	rs10760365	byFrequency	TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chr9:127230891G>A	ENST00000334810.1	+	14	2248	c.2248G>A	c.(2248-2250)Gtg>Atg	p.V750M				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	750					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GTGGAGGAAGGTGGTAGCTGT	0.622													G|||	2605	0.520168	0.5371	0.5274	5008	,	,		16910	0.6171		0.4195	False		,,,				2504	0.4959				p.V750M		.											.	.	0			c.G2248A						.	G	MET/VAL	661,723		154,353,185	98.0	84.0	88.0		2248	4.9	1.0	9	dbSNP_120	88	1390,1792		305,780,506	yes	missense	GPR144	NM_001161808.1	21	459,1133,691	AA,AG,GG		43.6832,47.7601,44.919	probably-damaging	750/964	127230891	2051,2515	692	1591	2283	SO:0001583	missense	347088	exon14			AGGAAGGTGGTAG	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2248G>A	9.37:g.127230891G>A	ENSP00000335156:p.Val750Met	48	0		66	4	NM_001161808	0	0	0	0	0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	1132|1132	0.5183150183150184|0.5183150183150184	242|242	0.491869918699187|0.491869918699187	185|185	0.511049723756906|0.511049723756906	381|381	0.666083916083916|0.666083916083916	324|324	0.42744063324538256|0.42744063324538256	G|G	17.72|17.72	3.459464|3.459464	0.63401|0.63401	0.477601|0.477601	0.436832|0.436832	ENSG00000180264|ENSG00000180264	ENST00000446588|ENST00000334810	.|T	.|0.49432	.|0.78	4.94|4.94	4.94|4.94	0.65067|0.65067	.|GPCR, family 2-like (1);	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.72894|0.72894	2.215|2.215	0.22610|0.22610	P|P	0.99893717|0.99893717	D|D	0.63046|0.76494	0.992|0.999	P|D	0.56865|0.87578	0.808|0.998	T|T	0.50311|0.50311	-0.8843|-0.8843	7|8	0.44086|0.72032	T|D	0.13|0.01	.|.	16.7766|16.7766	0.85552|0.85552	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	rs10760365;rs57939835;rs10760365|rs10760365;rs57939835;rs10760365	18|750	A1E4E8|Q7Z7M1	.|GP144_HUMAN	D|M	18|750	.|ENSP00000335156:V750M	ENSP00000414478:G18D|ENSP00000335156:V750M	G|V	+|+	2|1	0|0	GPR144|GPR144	126270712|126270712	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.233000|0.233000	0.25261|0.25261	8.590000|8.590000	0.90821|0.90821	2.278000|2.278000	0.76064|0.76064	0.561000|0.561000	0.74099|0.74099	GGT|GTG	G|0.465;A|0.535		0.622	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
ZNF630	57232	ucsc.edu	37	X	47918424	47918424	+	Silent	SNP	G	G	T			TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chrX:47918424G>T	ENST00000409324.3	-	5	1633	c.1407C>A	c.(1405-1407)tcC>tcA	p.S469S	ZNF630-AS1_ENST00000436124.1_RNA|ZNF630_ENST00000442455.3_Silent_p.S455S|ZNF630_ENST00000276054.4_Silent_p.S345S	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						GTGACTTCTGGGAAAAGGCCT	0.428																																					p.S469S		.											.	ZNF630-131	0			c.C1407A						.						67.0	66.0	66.0					X																	47918424		2195	4288	6483	SO:0001819	synonymous_variant	57232	exon5			CTTCTGGGAAAAG	AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1407C>A	X.37:g.47918424G>T		18	0		36	4	NM_001037735	0	0	6	6	0	F8WAG4|Q5H8Z5	Silent	SNP	ENST00000409324.3	37	CCDS35237.2																																																																																			.		0.428	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327254.1	NM_001037735	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)	.											.	NUDT10-90	8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A						.						52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A		72	0		129	6	NM_153183	0	0	1	4	3	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																			.		0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056578.1	NM_153183	
RBMX	27316	ucsc.edu	37	X	135961560	135961560	+	Missense_Mutation	SNP	C	C	G	rs80321628		TCGA-OR-A5JV-01A-11D-A29I-10	TCGA-OR-A5JV-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	242948fe-72e8-4487-b3b0-139297360446	b7c4c670-624d-4278-a166-779e9c35cb9e	g.chrX:135961560C>G	ENST00000320676.7	-	2	181	c.27G>C	c.(25-27)aaG>aaC	p.K9N	RBMX_ENST00000562646.1_Missense_Mutation_p.K9N|RBMX_ENST00000570135.1_5'UTR|RBMX_ENST00000565438.1_Intron|SNORD61_ENST00000384252.1_RNA|RBMX_ENST00000431446.3_Missense_Mutation_p.K9N	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	9	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.K9N(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					CAATGAAGAGCTTTCCTGGGC	0.413																																					p.K9N		.											.	RBMX-131	1	Substitution - Missense(1)	pancreas(1)	c.G27C						.						109.0	103.0	105.0					X																	135961560		2203	4300	6503	SO:0001583	missense	27316	exon2			GAAGAGCTTTCCT		CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.27G>C	X.37:g.135961560C>G	ENSP00000359645:p.Lys9Asn	73	5		133	22	NM_001164803	0	0	106	106	0	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Missense_Mutation	SNP	ENST00000320676.7	37	CCDS14661.1	.	.	.	.	.	.	.	.	.	.	.	19.30	3.801463	0.70682	.	.	ENSG00000147274	ENST00000431446;ENST00000320676;ENST00000449161	D;D	0.89050	-2.46;-2.46	4.66	3.78	0.43462	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	U	0.000000	D	0.88507	0.6455	L	0.56340	1.77	0.09310	P	0.9999999999999992	P;B;P	0.46656	0.882;0.278;0.868	P;B;B	0.50270	0.636;0.142;0.311	D	0.91729	0.5395	9	0.72032	D	0.01	.	8.8627	0.35267	0.0:0.7507:0.0:0.2493	.	9;9;9	B4E3U4;P38159;Q8N8Y7	.;HNRPG_HUMAN;.	N	9	ENSP00000411989:K9N;ENSP00000359645:K9N	ENSP00000359645:K9N	K	-	3	2	RBMX	135789226	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.970000	0.29383	1.905000	0.55150	0.508000	0.49915	AAG	.		0.413	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058507.1	NM_002139	
