#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTHFR	4524	bcgsc.ca	37	1	11863057	11863057	+	Silent	SNP	G	G	A	rs2066470	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:11863057G>A	ENST00000376592.1	-	1	245	c.117C>T	c.(115-117)ccC>ccT	p.P39P	MTHFR_ENST00000376590.3_Silent_p.P39P|MTHFR_ENST00000376585.1_Silent_p.P80P|MTHFR_ENST00000376583.3_Silent_p.P80P			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)	39					blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)			NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	CATGCCGCTCGGGGTCCAGGC	0.592													G|||	509	0.101637	0.0719	0.0548	5008	,	,		18607	0.123		0.0984	False		,,,				2504	0.1564				p.P39P		.											.	MTHFR-90	0			c.C117T						.	G		345,4061	180.1+/-208.5	15,315,1873	60.0	57.0	58.0		117	-11.3	0.0	1	dbSNP_94	58	822,7778	190.8+/-237.2	41,740,3519	no	coding-synonymous	MTHFR	NM_005957.4		56,1055,5392	AA,AG,GG		9.5581,7.8302,8.9728		39/657	11863057	1167,11839	2203	4300	6503	SO:0001819	synonymous_variant	4524	exon2			CCGCTCGGGGTCC	BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.117C>T	1.37:g.11863057G>A		81	0		55	4	NM_005957	0	0	0	0	0	B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Silent	SNP	ENST00000376592.1	37	CCDS137.1																																																																																			G|0.910;A|0.090		0.592	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000006538.1	NM_005957	
CELA2B	51032	bcgsc.ca	37	1	15808767	15808767	+	Missense_Mutation	SNP	G	G	A	rs3820071	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:15808767G>A	ENST00000375910.3	+	4	260	c.235G>A	c.(235-237)Ggg>Agg	p.G79R	CELA2B_ENST00000494280.1_3'UTR	NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	79	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		G -> R (in dbSNP:rs3820071). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:3646943}.			extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						CAGCTCCTCCGGGATCTACCG	0.567													G|||	1635	0.326478	0.2776	0.3473	5008	,	,		14119	0.5685		0.2416	False		,,,				2504	0.2157				p.G79R		.											.	CELA2B-91	0			c.G235A						.	G	ARG/GLY	1149,3257	407.5+/-334.3	143,863,1197	61.0	62.0	62.0		235	-6.2	0.2	1	dbSNP_107	62	2113,6487	363.2+/-333.1	270,1573,2457	yes	missense	CELA2B	NM_015849.2	125	413,2436,3654	AA,AG,GG		24.5698,26.0781,25.0807	benign	79/270	15808767	3262,9744	2203	4300	6503	SO:0001583	missense	51032	exon4			TCCTCCGGGATCT		CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.235G>A	1.37:g.15808767G>A	ENSP00000365075:p.Gly79Arg	98	0		78	4	NM_015849	0	0	0	0	0	Q14D16|Q6ISM5|Q96QV5	Missense_Mutation	SNP	ENST00000375910.3	37	CCDS30605.1	741	0.3392857142857143	121	0.2459349593495935	112	0.30939226519337015	311	0.5437062937062938	197	0.2598944591029024	G	0	-2.798414	0.00076	0.260781	0.245698	ENSG00000215704	ENST00000375910;ENST00000375909;ENST00000422901	D;D	0.90261	-2.35;-2.64	3.08	-6.17	0.02091	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.574111	0.15655	N	0.251153	T	0.00012	0.0000	N	0.12887	0.27	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.41484	-0.9506	9	0.02654	T	1	.	0.8149	0.01100	0.2489:0.3212:0.1134:0.3166	rs3820071;rs17214904;rs52801345;rs59821889;rs3820071	79	P08218	CEL2B_HUMAN	R	79;86;98	ENSP00000365075:G79R;ENSP00000399811:G98R	ENSP00000365074:G86R	G	+	1	0	CELA2B	15681354	0.000000	0.05858	0.173000	0.22940	0.003000	0.03518	-1.849000	0.01672	-0.954000	0.03640	-2.217000	0.00297	GGG	G|0.706;A|0.294		0.567	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006448.1	NM_015849	
HSPG2	3339	bcgsc.ca	37	1	22165987	22165987	+	Missense_Mutation	SNP	G	G	A	rs2291827	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:22165987G>A	ENST00000374695.3	-	73	9845	c.9766C>T	c.(9766-9768)Cac>Tac	p.H3256Y		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3256	Ig-like C2-type 18.		H -> Y (in dbSNP:rs2291827).		angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TCCAGCCGGTGCTGCCAGGGC	0.637													G|||	762	0.152157	0.0106	0.1484	5008	,	,		18485	0.1577		0.1928	False		,,,				2504	0.2986				p.H3256Y		.											.	HSPG2-141	0			c.C9766T						.	G	TYR/HIS	174,4232	113.3+/-151.4	5,164,2034	55.0	52.0	53.0		9766	5.5	1.0	1	dbSNP_100	53	1447,7153	276.3+/-292.2	127,1193,2980	yes	missense	HSPG2	NM_005529.5	83	132,1357,5014	AA,AG,GG		16.8256,3.9492,12.4635	benign	3256/4392	22165987	1621,11385	2203	4300	6503	SO:0001583	missense	3339	exon73			GCCGGTGCTGCCA	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.9766C>T	1.37:g.22165987G>A	ENSP00000363827:p.His3256Tyr	159	0		90	5	NM_005529	0	0	4	4	0	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	304	0.1391941391941392	11	0.022357723577235773	62	0.1712707182320442	95	0.1660839160839161	136	0.17941952506596306	G	16.94	3.261475	0.59431	0.039492	0.168256	ENSG00000142798	ENST00000374695	T	0.27402	1.67	5.5	5.5	0.81552	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40469	N	0.001089	T	0.00039	0.0001	N	0.20483	0.58	0.19775	P	0.999953864	B	0.32862	0.387	B	0.35039	0.194	T	0.04153	-1.0973	9	0.02654	T	1	.	17.9616	0.89087	0.0:0.0:1.0:0.0	rs2291827;rs2291827	3256	P98160	PGBM_HUMAN	Y	3256	ENSP00000363827:H3256Y	ENSP00000363827:H3256Y	H	-	1	0	HSPG2	22038574	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.085000	0.64468	2.597000	0.87782	0.563000	0.77884	CAC	G|0.871;A|0.129		0.637	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
AP4B1	10717	bcgsc.ca	37	1	114438951	114438951	+	Missense_Mutation	SNP	A	A	G	rs1217401	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:114438951A>G	ENST00000369569.1	-	8	1719	c.1439T>C	c.(1438-1440)tTg>tCg	p.L480S	AP4B1_ENST00000256658.4_Missense_Mutation_p.L480S|AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000369567.1_Missense_Mutation_p.L312S|AP4B1_ENST00000462591.1_5'UTR	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit	480			L -> S (in dbSNP:rs1217401). {ECO:0000269|PubMed:10066790, ECO:0000269|Ref.3}.		intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAGGCGCAGCAAAGCAGTGAG	0.453													A|||	1888	0.376997	0.8003	0.2536	5008	,	,		20016	0.0794		0.2694	False		,,,				2504	0.3098				p.L480S		.											.	AP4B1-93	0			c.T1439C						.	A	SER/LEU	3017,1389	689.6+/-405.1	1046,925,232	158.0	154.0	155.0		1439	6.0	0.9	1	dbSNP_87	155	2679,5921	430.6+/-356.6	424,1831,2045	yes	missense	AP4B1	NM_006594.2	145	1470,2756,2277	GG,GA,AA		31.1512,31.5252,43.7952	possibly-damaging	480/740	114438951	5696,7310	2203	4300	6503	SO:0001583	missense	10717	exon9			CGCAGCAAAGCAG	AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1439T>C	1.37:g.114438951A>G	ENSP00000358582:p.Leu480Ser	215	3		148	7	NM_006594	0	0	4	4	0	B7Z4X3|Q59EJ4|Q96CL6	Missense_Mutation	SNP	ENST00000369569.1	37	CCDS865.1	756	0.34615384615384615	390	0.7926829268292683	103	0.2845303867403315	54	0.0944055944055944	209	0.2757255936675462	A	15.36	2.810246	0.50421	0.684748	0.311512	ENSG00000134262	ENST00000369567;ENST00000369569;ENST00000256658	T;T;T	0.24538	1.85;1.85;1.85	6.04	6.04	0.98038	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.389021	0.27996	N	0.017016	T	0.09598	0.0236	N	0.10809	0.05	0.09310	P	1.0	B;B;B;B	0.22541	0.071;0.008;0.033;0.001	B;B;B;B	0.30105	0.111;0.02;0.111;0.007	T	0.13442	-1.0509	9	0.52906	T	0.07	-2.4422	16.5885	0.84745	1.0:0.0:0.0:0.0	rs1217401;rs3170575;rs58628725;rs1217401	480;312;480;381	B2RBF6;B1ALD0;Q9Y6B7;B4DTG3	.;.;AP4B1_HUMAN;.	S	312;480;480	ENSP00000358580:L312S;ENSP00000358582:L480S;ENSP00000256658:L480S	ENSP00000256658:L480S	L	-	2	0	AP4B1	114240474	1.000000	0.71417	0.868000	0.34077	0.986000	0.74619	6.230000	0.72301	2.317000	0.78254	0.460000	0.39030	TTG	A|0.589;G|0.411		0.453	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033037.1	NM_006594	
ANKRD35	148741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	145560086	145560086	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:145560086T>C	ENST00000355594.4	+	8	659	c.572T>C	c.(571-573)aTc>aCc	p.I191T	ANKRD35_ENST00000544626.1_3'UTR	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	191										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCGGCTTTGATCCTGGCCTGT	0.572																																					p.I191T	Melanoma(9;127 754 22988 51047)	.											.	ANKRD35-95	0			c.T572C						.						71.0	66.0	68.0					1																	145560086		2203	4300	6503	SO:0001583	missense	148741	exon8			CTTTGATCCTGGC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.572T>C	1.37:g.145560086T>C	ENSP00000347802:p.Ile191Thr	273	0		182	81	NM_144698	0	0	0	0	0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	37	CCDS919.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.143968	0.77888	.	.	ENSG00000198483	ENST00000453670;ENST00000355594	T	0.53640	0.61	5.55	5.55	0.83447	Ankyrin repeat-containing domain (4);	0.120754	0.37304	N	0.002142	T	0.42720	0.1215	N	0.17631	0.505	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.50668	-0.8801	10	0.54805	T	0.06	-12.3025	12.3774	0.55287	0.0:0.0:0.0:1.0	.	191	Q8N283	ANR35_HUMAN	T	100;191	ENSP00000347802:I191T	ENSP00000347802:I191T	I	+	2	0	ANKRD35	144271443	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.183000	0.65065	2.234000	0.73211	0.533000	0.62120	ATC	.		0.572	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
ATP1A4	480	bcgsc.ca	37	1	160134056	160134056	+	Missense_Mutation	SNP	G	G	A	rs17368402	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:160134056G>A	ENST00000368081.4	+	7	1360	c.889G>A	c.(889-891)Gaa>Aaa	p.E297K		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	297			E -> K (in dbSNP:rs17368402).		ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGCTGAGATCGAACACTTCAT	0.537													G|||	225	0.0449281	0.0023	0.0562	5008	,	,		18832	0.002		0.0974	False		,,,				2504	0.0849				p.E297K		.											.	ATP1A4-94	0			c.G889A						.	G	LYS/GLU	100,4306	79.9+/-118.3	0,100,2103	283.0	224.0	244.0		889	1.6	0.0	1	dbSNP_123	244	985,7615	214.2+/-253.9	45,895,3360	yes	missense	ATP1A4	NM_144699.3	56	45,995,5463	AA,AG,GG		11.4535,2.2696,8.3423	benign	297/1030	160134056	1085,11921	2203	4300	6503	SO:0001583	missense	480	exon7			GAGATCGAACACT	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.889G>A	1.37:g.160134056G>A	ENSP00000357060:p.Glu297Lys	299	0		236	11	NM_144699	0	0	0	0	0	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	ENST00000368081.4	37	CCDS1197.1	99	0.04532967032967033	1	0.0020325203252032522	21	0.058011049723756904	1	0.0017482517482517483	76	0.10026385224274406	G	9.009	0.982061	0.18812	0.022696	0.114535	ENSG00000132681	ENST00000368081	D	0.90732	-2.72	4.54	1.62	0.23740	ATPase, P-type, ATPase-associated domain (1);	0.158645	0.53938	N	0.000056	T	0.82148	0.4974	L	0.58302	1.8	0.80722	D	1	B	0.31910	0.346	B	0.34536	0.185	T	0.78209	-0.2293	10	0.87932	D	0	.	10.4681	0.44620	0.0777:0.2542:0.6681:0.0	rs17368402;rs56500076;rs57880353;rs17368402	297	Q13733	AT1A4_HUMAN	K	297	ENSP00000357060:E297K	ENSP00000357060:E297K	E	+	1	0	ATP1A4	158400680	1.000000	0.71417	0.010000	0.14722	0.050000	0.14768	3.911000	0.56378	0.013000	0.14918	-2.387000	0.00228	GAA	G|0.934;A|0.066		0.537	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077415.1	NM_144699	
TOR1AIP1	26092	bcgsc.ca	37	1	179877780	179877780	+	Missense_Mutation	SNP	A	A	C	rs17279712	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:179877780A>C	ENST00000606911.2	+	8	1070	c.879A>C	c.(877-879)caA>caC	p.Q293H	TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.Q294H|TOR1AIP1_ENST00000474875.1_3'UTR|TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.Q294H|TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.Q172H			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	293			Q -> H (in dbSNP:rs17279712).		positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						GGGCCCCACAAACTGCAAGAA	0.323													A|||	189	0.0377396	0.0151	0.0576	5008	,	,		16998	0.002		0.0845	False		,,,				2504	0.0429				p.Q294H		.											.	TOR1AIP1-153	0			c.A882C						.	A	HIS/GLN	91,4315	74.1+/-112.3	0,91,2112	73.0	80.0	78.0		879	-2.5	0.0	1	dbSNP_123	78	536,8064	146.9+/-202.4	19,498,3783	yes	missense	TOR1AIP1	NM_015602.2	24	19,589,5895	CC,CA,AA		6.2326,2.0654,4.8209	benign	293/584	179877780	627,12379	2203	4300	6503	SO:0001583	missense	26092	exon8			CCCACAAACTGCA		CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.879A>C	1.37:g.179877780A>C	ENSP00000476687:p.Gln293His	117	0		88	4	NM_001267578	0	0	3	3	0	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	37	CCDS1335.1	100|100|100	0.045787545787545784|0.045787545787545784|0.045787545787545784	14|14|14	0.028455284552845527|0.028455284552845527|0.028455284552845527	18|18|18	0.049723756906077346|0.049723756906077346|0.049723756906077346	1|1|1	0.0017482517482517483|0.0017482517482517483|0.0017482517482517483	67|67|67	0.08839050131926121|0.08839050131926121|0.08839050131926121	A|A|A	8.824|8.824|8.824	0.938178|0.938178|0.938178	0.18206|0.18206|0.18206	0.020654|0.020654|0.020654	0.062326|0.062326|0.062326	ENSG00000143337|ENSG00000143337|ENSG00000143337	ENST00000447964|ENST00000527391|ENST00000528443;ENST00000271583;ENST00000435319	.|.|T;T;T	.|.|0.25912	.|.|1.77;1.77;1.77	5.39|5.39|5.39	-2.45|-2.45|-2.45	0.06481|0.06481|0.06481	.|.|.	.|.|0.735393	.|.|0.12522	.|.|N	.|.|0.461581	T|T|T	0.00580|0.00580|0.00580	0.0019|0.0019|0.0019	L|L|L	0.50333|0.50333|0.50333	1.59|1.59|1.59	0.80722|0.80722|0.80722	P|P|P	0.0|0.0|0.0	.|.|B	.|.|0.09022	.|.|0.002	.|.|B	.|.|0.12156	.|.|0.007	T|T|T	0.22977|0.22977|0.22977	-1.0201|-1.0201|-1.0201	4|4|8	.|.|.	.|.|.	.|.|.	-0.095|-0.095|-0.095	2.2348|2.2348|2.2348	0.04005|0.04005|0.04005	0.472:0.1223:0.2863:0.1193|0.472:0.1223:0.2863:0.1193|0.472:0.1223:0.2863:0.1193	rs17279712;rs52792036;rs17279712|rs17279712;rs52792036;rs17279712|rs17279712;rs52792036;rs17279712	.|.|293	.|.|Q5JTV8	.|.|TOIP1_HUMAN	T|H|H	47|170|294;294;293	.|.|ENSP00000435365:Q294H;ENSP00000271583:Q294H;ENSP00000393292:Q293H	.|.|.	K|N|Q	+|+|+	2|1|3	0|0|2	TOR1AIP1|TOR1AIP1|TOR1AIP1	178144403|178144403|178144403	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.000000|0.000000|0.000000	0.00434|0.00434|0.00434	-0.023000|-0.023000|-0.023000	0.12456|0.12456|0.12456	-0.482000|-0.482000|-0.482000	0.06782|0.06782|0.06782	-2.720000|-2.720000|-2.720000	0.00132|0.00132|0.00132	AAA|AAC|CAA	A|0.955;C|0.045		0.323	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	NM_015602	
CDC73	79577	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	193119482	193119482	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:193119482T>G	ENST00000367435.3	+	9	1061	c.877T>G	c.(877-879)Tac>Gac	p.Y293D		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	293	Interaction with POLR2A and PAF1.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						CTATAACAGATACGATCAGGA	0.383																																					p.Y293D		.											.	CDC73-1009	0			c.T877G						.						111.0	110.0	110.0					1																	193119482		2203	4300	6503	SO:0001583	missense	79577	exon9			AACAGATACGATC	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.877T>G	1.37:g.193119482T>G	ENSP00000356405:p.Tyr293Asp	89	0		55	25	NM_024529	0	0	0	2	2	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	ENST00000367435.3	37	CCDS1382.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.415011	0.83449	.	.	ENSG00000134371	ENST00000367435;ENST00000445394	T	0.66280	-0.2	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.81555	0.4847	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.85090	0.0951	10	0.72032	D	0.01	-12.7503	13.6203	0.62134	0.0:0.0:0.0:1.0	.	293	Q6P1J9	CDC73_HUMAN	D	293	ENSP00000356405:Y293D	ENSP00000356405:Y293D	Y	+	1	0	CDC73	191386105	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.485000	0.81204	2.112000	0.64535	0.533000	0.62120	TAC	.		0.383	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086696.2	NM_024529	
CFHR1	3078	bcgsc.ca	37	1	196801042	196801042	+	Silent	SNP	G	G	T	rs4230	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:196801042G>T	ENST00000320493.5	+	6	994	c.906G>T	c.(904-906)cgG>cgT	p.R302R	CFHR2_ENST00000367421.3_Intron|CFHR1_ENST00000367424.4_Silent_p.R243R	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	302	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						TGTGTAAACGGGGATATCGTC	0.383													-|||	2541	0.507388	0.6157	0.5187	5008	,	,		12798	0.5437		0.4463	False		,,,				2504	0.3783				p.R302R		.											.	CFHR1-90	0			c.G906T						.	T		2442,1332		1044,354,489	117.0	131.0	127.0		906	0.1	0.0	1	dbSNP_36	127	3358,4906		1015,1328,1789	no	coding-synonymous	CFHR1	NM_002113.2		2059,1682,2278	TT,TG,GG		40.6341,35.2941,48.1808		302/331	196801042	5800,6238	1887	4132	6019	SO:0001819	synonymous_variant	3078	exon6			TAAACGGGGATAT	M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.906G>T	1.37:g.196801042G>T		427	4		64	8	NM_002113	0	0	6	6	0	A8K465|Q3B774|Q9UJ17	Silent	SNP	ENST00000320493.5	37	CCDS1386.1																																																																																			G|0.520;T|0.480		0.383	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	NM_002113	
CFHR1	3078	bcgsc.ca	37	1	196801078	196801078	+	Silent	SNP	A	A	T	rs414628	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:196801078A>T	ENST00000320493.5	+	6	1030	c.942A>T	c.(940-942)cgA>cgT	p.R314R	CFHR2_ENST00000367421.3_Intron|CFHR1_ENST00000367424.4_Silent_p.R255R	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	314	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						ACACATTGCGAACAACATGTT	0.383													-|||	2122	0.423722	0.326	0.5072	5008	,	,		13037	0.5228		0.4433	False		,,,				2504	0.3742				p.R314R		.											.	CFHR1-90	0			c.A942T						.	A		1425,2329		530,365,982	77.0	82.0	80.0		942	1.1	0.0	1	dbSNP_80	80	3341,4909		1008,1325,1792	no	coding-synonymous	CFHR1	NM_002113.2		1538,1690,2774	TT,TA,AA		40.497,37.9595,39.7034		314/331	196801078	4766,7238	1877	4125	6002	SO:0001819	synonymous_variant	3078	exon6			ATTGCGAACAACA	M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.942A>T	1.37:g.196801078A>T		386	3		68	5	NM_002113	0	0	26	26	0	A8K465|Q3B774|Q9UJ17	Silent	SNP	ENST00000320493.5	37	CCDS1386.1																																																																																			A|0.604;T|0.396		0.383	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088251.2	NM_002113	
AVPR1B	553	broad.mit.edu	37	1	206224853	206224853	+	Missense_Mutation	SNP	A	A	C	rs148831426		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:206224853A>C	ENST00000367126.4	+	1	878	c.413A>C	c.(412-414)cAc>cCc	p.H138P	RP11-38J22.3_ENST00000425896.1_RNA	NM_000707.3	NP_000698.1	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	138					activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(3)|prostate(1)|skin(2)	20			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	GCTGTCTGTCACCCCCTGCGC	0.627																																					p.H138P		.											.	AVPR1B-569	0			c.A413C						.						45.0	45.0	45.0					1																	206224853		2203	4300	6503	SO:0001583	missense	553	exon1			TCTGTCACCCCCT	D31833	CCDS73015.1	1q32	2014-05-06			ENSG00000198049	ENSG00000198049		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	896	protein-coding gene	gene with protein product		600264		AVPR3		7929452, 8586456	Standard	NM_000707		Approved		uc001hds.2	P47901	OTTHUMG00000184377	ENST00000367126.4:c.413A>C	1.37:g.206224853A>C	ENSP00000356094:p.His138Pro	90	13		96	17	NM_000707	0	0	0	0	0	B0M0J6|Q5TZ00	Missense_Mutation	SNP	ENST00000367126.4	37	CCDS30994.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193154	0.78902	.	.	ENSG00000198049	ENST00000367126	T	0.40225	1.04	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.71710	0.3372	M	0.92077	3.27	0.58432	D	0.999999	D	0.67145	0.996	D	0.74023	0.982	T	0.79857	-0.1626	10	0.87932	D	0	-38.0354	14.9072	0.70730	1.0:0.0:0.0:0.0	.	138	P47901	V1BR_HUMAN	P	138	ENSP00000356094:H138P	ENSP00000356094:H138P	H	+	2	0	AVPR1B	204391476	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	5.190000	0.65104	2.183000	0.69458	0.421000	0.28195	CAC	A|1.000;G|0.000		0.627	AVPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087996.1	NM_000707	
HLX	3142	hgsc.bcm.edu	37	1	221057963	221057963	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:221057963G>A	ENST00000366903.6	+	4	2885	c.1384G>A	c.(1384-1386)Gag>Aag	p.E462K	HLX_ENST00000549319.1_Missense_Mutation_p.E248K	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	462					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		cggcGCCTCGGAGCTTCTCCC	0.657																																					p.E462K		.											.	HLX-70	0			c.G1384A						.						9.0	12.0	11.0					1																	221057963		2196	4289	6485	SO:0001583	missense	3142	exon4			GCCTCGGAGCTTC	BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.1384G>A	1.37:g.221057963G>A	ENSP00000355870:p.Glu462Lys	4	0		24	22	NM_021958	0	0	11	15	4	B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	CCDS1527.1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951535	0.92660	.	.	ENSG00000136630	ENST00000366903;ENST00000549319	D;D	0.90955	-2.55;-2.76	4.78	4.78	0.61160	.	0.000000	0.38111	N	0.001807	D	0.90909	0.7143	N	0.19112	0.55	0.36032	D	0.839446	D	0.63880	0.993	D	0.70227	0.968	D	0.93691	0.7007	10	0.59425	D	0.04	-34.2739	15.0753	0.72071	0.0:0.0:1.0:0.0	.	462	Q14774	HLX_HUMAN	K	462;248	ENSP00000355870:E462K;ENSP00000449882:E248K	ENSP00000355870:E462K	E	+	1	0	HLX	219124586	0.994000	0.37717	0.534000	0.28014	0.172000	0.22775	3.598000	0.54038	2.360000	0.80028	0.561000	0.74099	GAG	.		0.657	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090902.3	NM_021958	
DNAH14	127602	bcgsc.ca	37	1	225534219	225534219	+	Missense_Mutation	SNP	T	T	C	rs7527925	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr1:225534219T>C	ENST00000445597.2	+	49	8471	c.8471T>C	c.(8470-8472)gTa>gCa	p.V2824A	DNAH14_ENST00000439375.2_Missense_Mutation_p.V3627A|DNAH14_ENST00000430092.1_Missense_Mutation_p.V3627A			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2824					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CTTTGCACTGTAATCATGCAA	0.323													C|||	2650	0.529153	0.6407	0.4697	5008	,	,		17450	0.5089		0.4046	False		,,,				2504	0.5695				p.V3627A		.											.	DNAH14-23	0			c.T10880C						.	C	ALA/VAL	842,542		268,306,118	70.0	60.0	63.0		10880	3.5	0.2	1	dbSNP_116	63	1404,1770		323,758,506	yes	missense	DNAH14	NM_001373.1	64	591,1064,624	CC,CT,TT		44.2344,39.1618,49.276	benign	3627/4516	225534219	2246,2312	692	1587	2279	SO:0001583	missense	127602	exon69			GCACTGTAATCAT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8471T>C	1.37:g.225534219T>C	ENSP00000409472:p.Val2824Ala	162	0		148	5	NM_001373	0	0	0	0	0	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	37		1054	0.4826007326007326	302	0.6138211382113821	165	0.4558011049723757	281	0.49125874125874125	306	0.40369393139841686	C	2.312	-0.357714	0.05138	0.608382	0.442344	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.50001	0.76;0.76;0.76	5.48	3.53	0.40419	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.04013	0.001	T	0.45086	-0.9285	7	0.15066	T	0.55	.	3.7279	0.08481	0.1327:0.5895:0.1289:0.1488	rs7527925;rs52797267;rs56543759;rs61045802;rs7527925	3627	Q0VDD8-4	.	A	2824;3627;3627	ENSP00000409472:V2824A;ENSP00000414402:V3627A;ENSP00000392061:V3627A	ENSP00000414402:V3627A	V	+	2	0	DNAH14	223600842	0.000000	0.05858	0.155000	0.22561	0.949000	0.60115	0.067000	0.14510	0.662000	0.31006	-0.294000	0.09567	GTA	T|0.500;C|0.500		0.323	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
PROSER2	254427	hgsc.bcm.edu	37	10	11912332	11912332	+	Missense_Mutation	SNP	C	C	T	rs12253554	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr10:11912332C>T	ENST00000277570.5	+	4	1389	c.1235C>T	c.(1234-1236)gCg>gTg	p.A412V	PROSER2-AS1_ENST00000453242.1_RNA|PROSER2-AS1_ENST00000445498.1_RNA|PROSER2_ENST00000379200.1_Missense_Mutation_p.A216V	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	412			A -> V (in dbSNP:rs12253554). {ECO:0000269|PubMed:15489334}.														GTGCAGTTCGCGGGCCGCGGC	0.771													C|||	358	0.0714856	0.0946	0.0476	5008	,	,		9233	0.001		0.0775	False		,,,				2504	0.1237				p.A412V		.											.	.	0			c.C1235T						.	C	VAL/ALA	112,1534		0,112,711	1.0	1.0	1.0		1235	5.3	0.9	10	dbSNP_120	1	187,3499		0,187,1656	no	missense	C10orf47	NM_153256.3	64	0,299,2367	TT,TC,CC		5.0733,6.8044,5.6077	possibly-damaging	412/436	11912332	299,5033	823	1843	2666	SO:0001583	missense	254427	exon4			AGTTCGCGGGCCG	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.1235C>T	10.37:g.11912332C>T	ENSP00000277570:p.Ala412Val	0	0		7	4	NM_153256	0	0	0	0	0	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Missense_Mutation	SNP	ENST00000277570.5	37	CCDS7085.1	143	0.06547619047619048	60	0.12195121951219512	22	0.06077348066298342	1	0.0017482517482517483	60	0.079155672823219	C	22.4	4.285312	0.80803	0.068044	0.050733	ENSG00000148426	ENST00000379208;ENST00000277570;ENST00000379202;ENST00000379200	T;T	0.08984	3.03;3.03	5.3	5.3	0.74995	.	0.302100	0.28895	N	0.013796	T	0.00178	0.0005	L	0.29908	0.895	0.35518	P	0.19877100000000003	D	0.62365	0.991	P	0.47044	0.535	T	0.17531	-1.0366	9	0.87932	D	0	-13.0271	17.9268	0.88986	0.0:1.0:0.0:0.0	rs12253554;rs17851504	412	Q86WR7	CJ047_HUMAN	V	318;412;319;216	ENSP00000277570:A412V;ENSP00000368498:A216V	ENSP00000277570:A412V	A	+	2	0	C10orf47	11952338	0.998000	0.40836	0.879000	0.34478	0.186000	0.23388	4.734000	0.62043	2.476000	0.83614	0.313000	0.20887	GCG	C|0.935;T|0.065		0.771	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
SKIDA1	387640	hgsc.bcm.edu	37	10	21805486	21805486	+	Silent	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr10:21805486C>T	ENST00000449193.2	-	4	3518	c.1266G>A	c.(1264-1266)gaG>gaA	p.E422E	SKIDA1_ENST00000444772.3_Silent_p.E343E|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	341						nucleus (GO:0005634)		p.E422E(2)									cctcttcctcctcctcctcct	0.632																																					p.E422E		.											.	.	2	Substitution - coding silent(2)	large_intestine(2)	c.G1266A						.						5.0	6.0	6.0					10																	21805486		1988	4108	6096	SO:0001819	synonymous_variant	387640	exon4			TTCCTCCTCCTCC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1266G>A	10.37:g.21805486C>T		67	0		77	7	NM_207371	0	0	0	0	0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																			.		0.632	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
NFKB2	4791	broad.mit.edu	37	10	104160223	104160223	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr10:104160223G>T	ENST00000369966.3	+	16	2023	c.1773G>T	c.(1771-1773)caG>caT	p.Q591H	NFKB2_ENST00000189444.6_Missense_Mutation_p.Q591H|NFKB2_ENST00000428099.1_Missense_Mutation_p.Q591H	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	591					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)	p.Q591H(1)		NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CTGTGCCCCAGCTGTTGCATA	0.632			T	IGH@	B-NHL																																p.Q591H		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	1	Substitution - Missense(1)	endometrium(1)	c.G1773T						.						23.0	24.0	24.0					10																	104160223		2107	4231	6338	SO:0001583	missense	4791	exon16			GCCCCAGCTGTTG	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1773G>T	10.37:g.104160223G>T	ENSP00000358983:p.Gln591His	75	1		79	6	NM_001077494	0	0	53	59	6	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	37	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	G	11.87	1.766790	0.31320	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	T;T;T	0.35421	1.31;1.31;1.31	4.51	-3.27	0.05048	Ankyrin repeat-containing domain (3);	0.182470	0.47093	D	0.000255	T	0.17577	0.0422	L	0.33485	1.01	0.20307	N	0.999914	B;B	0.21381	0.026;0.055	B;B	0.19148	0.006;0.024	T	0.22556	-1.0213	10	0.14656	T	0.56	.	4.6114	0.12404	0.6265:0.1017:0.1692:0.1026	.	591;591	Q00653;A8K9D9	NFKB2_HUMAN;.	H	591	ENSP00000410256:Q591H;ENSP00000358983:Q591H;ENSP00000189444:Q591H	ENSP00000189444:Q591H	Q	+	3	2	NFKB2	104150213	0.000000	0.05858	0.149000	0.22428	0.323000	0.28346	-1.671000	0.01954	-0.773000	0.04596	0.561000	0.74099	CAG	.		0.632	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
GPAM	57678	bcgsc.ca	37	10	113920465	113920465	+	Silent	SNP	G	G	A	rs2277207	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr10:113920465G>A	ENST00000348367.4	-	16	1853	c.1656C>T	c.(1654-1656)aaC>aaT	p.N552N	GPAM_ENST00000369425.1_Silent_p.N552N|GPAM_ENST00000423155.1_Silent_p.N552N			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	552					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		AAAACTCATCGTTCCTGCTAG	0.453													G|||	2772	0.553514	0.528	0.4553	5008	,	,		19398	0.6002		0.5437	False		,,,				2504	0.6196				p.N552N	Ovarian(161;1017 2606 18293 52943)	.											.	GPAM-92	0			c.C1656T						.	G		2218,2188	590.7+/-387.4	553,1112,538	153.0	126.0	135.0		1656	-12.1	0.0	10	dbSNP_100	135	5045,3555	630.2+/-398.3	1498,2049,753	no	coding-synonymous	GPAM	NM_020918.4		2051,3161,1291	AA,AG,GG		41.3372,49.6596,44.1565		552/829	113920465	7263,5743	2203	4300	6503	SO:0001819	synonymous_variant	57678	exon16			CTCATCGTTCCTG	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1656C>T	10.37:g.113920465G>A		267	3		305	9	NM_001244949	0	0	1	1	0	Q5VW51|Q86TA3	Silent	SNP	ENST00000348367.4	37	CCDS7570.1																																																																																			G|0.445;A|0.555		0.453	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
JAKMIP3	282973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	133951636	133951636	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr10:133951636T>A	ENST00000298622.4	+	8	1436	c.1298T>A	c.(1297-1299)cTg>cAg	p.L433Q		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	433						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CGGGACAAGCTGTTAAGATTC	0.542																																					p.L433Q		.											.	JAKMIP3-23	0			c.T1298A						.						59.0	60.0	59.0					10																	133951636		1983	4155	6138	SO:0001583	missense	282973	exon8			ACAAGCTGTTAAG	AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1298T>A	10.37:g.133951636T>A	ENSP00000298622:p.Leu433Gln	103	0		95	18	NM_001105521	0	0	0	0	0	A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	ENST00000298622.4	37	CCDS44494.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.500129	0.44455	.	.	ENSG00000188385	ENST00000298622	T	0.29397	1.57	4.78	4.78	0.61160	.	0.097810	0.41823	D	0.000801	T	0.49321	0.1550	M	0.71206	2.165	0.45883	D	0.998734	D	0.89917	1.0	D	0.91635	0.999	T	0.44620	-0.9316	10	0.25751	T	0.34	-8.1584	9.1448	0.36925	0.162:0.0:0.0:0.838	.	433	Q5VZ66	JKIP3_HUMAN	Q	433	ENSP00000298622:L433Q	ENSP00000298622:L433Q	L	+	2	0	JAKMIP3	133801626	1.000000	0.71417	0.812000	0.32479	0.205000	0.24178	4.532000	0.60608	1.919000	0.55581	0.529000	0.55759	CTG	.		0.542	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051049.3	NM_194303	
MUC6	4588	bcgsc.ca	37	11	1016871	1016871	+	Missense_Mutation	SNP	G	G	T	rs554068781		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr11:1016871G>T	ENST00000421673.2	-	31	5980	c.5930C>A	c.(5929-5931)cCc>cAc	p.P1977H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1977	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAAGAGAAGGGACTGCTCCC	0.587																																					p.P1977H		.											.	MUC6-23	0			c.C5930A						.						1308.0	1300.0	1302.0					11																	1016871		2203	4299	6502	SO:0001583	missense	4588	exon31			GAGAAGGGACTGC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5930C>A	11.37:g.1016871G>T	ENSP00000406861:p.Pro1977His	1925	43		1100	38	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923756	0.34002	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	2.69	1.71	0.24356	.	.	.	.	.	T	0.14614	0.0353	L	0.29908	0.895	0.09310	N	1	B	0.29212	0.237	B	0.28553	0.091	T	0.22382	-1.0218	9	0.56958	D	0.05	.	7.0992	0.25327	0.0:0.0:0.7301:0.2699	.	1977	Q6W4X9	MUC6_HUMAN	H	1977	ENSP00000406861:P1977H	ENSP00000406861:P1977H	P	-	2	0	MUC6	1006871	0.015000	0.18098	0.001000	0.08648	0.026000	0.11368	1.250000	0.32850	0.416000	0.25844	0.306000	0.20318	CCC	.		0.587	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
RAPSN	5913	ucsc.edu	37	11	47469439	47469439	+	Silent	SNP	A	A	G	rs7111873	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr11:47469439A>G	ENST00000298854.2	-	2	669	c.456T>C	c.(454-456)taT>taC	p.Y152Y	RAPSN_ENST00000524487.1_Silent_p.Y152Y|RAPSN_ENST00000529341.1_Silent_p.Y152Y|RAPSN_ENST00000352508.3_Silent_p.Y152Y	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse	152					positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						TGTTGTGGGCATAGCGCAGGG	0.647													G|||	3133	0.625599	0.3472	0.6902	5008	,	,		21049	0.6587		0.7068	False		,,,				2504	0.8384				p.Y152Y		.											.	RAPSN-91	0			c.T456C						.	G	,	1879,2523	621.2+/-393.7	416,1047,738	46.0	37.0	40.0		456,456	-6.8	0.8	11	dbSNP_116	40	6180,2414	393.4+/-344.3	2225,1730,342	no	coding-synonymous,coding-synonymous	RAPSN	NM_005055.4,NM_032645.4	,	2641,2777,1080	GG,GA,AA		28.0894,42.6851,37.9886	,	152/413,152/354	47469439	8059,4937	2201	4297	6498	SO:0001819	synonymous_variant	5913	exon2			GTGGGCATAGCGC		CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.456T>C	11.37:g.47469439A>G		59	1		48	5	NM_032645	0	0	0	0	0	Q8TDF3|Q9BTD9	Silent	SNP	ENST00000298854.2	37	CCDS7936.1																																																																																			A|0.389;G|0.611		0.647	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391726.1		
CCDC88B	283234	hgsc.bcm.edu	37	11	64112394	64112394	+	Missense_Mutation	SNP	G	G	A	rs143386417	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr11:64112394G>A	ENST00000356786.5	+	14	2425	c.2381G>A	c.(2380-2382)cGg>cAg	p.R794Q	CCDC88B_ENST00000301897.4_5'UTR|CCDC88B_ENST00000463837.1_3'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	794						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GCCCGGCTGCGGGAGGCAGTG	0.746													G|||	31	0.0061901	0.0	0.0058	5008	,	,		14232	0.001		0.0239	False		,,,				2504	0.002				p.R794Q		.											.	CCDC88B-94	0			c.G2381A						.	G	GLN/ARG	8,4228		0,8,2110	8.0	10.0	9.0		2381	2.5	1.0	11	dbSNP_134	9	101,8187		0,101,4043	yes	missense	CCDC88B	NM_032251.5	43	0,109,6153	AA,AG,GG		1.2186,0.1889,0.8703	possibly-damaging	794/1477	64112394	109,12415	2118	4144	6262	SO:0001583	missense	283234	exon14			GGCTGCGGGAGGC	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.2381G>A	11.37:g.64112394G>A	ENSP00000349238:p.Arg794Gln	0	0		14	9	NM_032251	0	0	0	0	0	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	19	0.0086996336996337	0	0.0	1	0.0027624309392265192	1	0.0017482517482517483	17	0.022427440633245383	g	10.59	1.391736	0.25118	0.001889	0.012186	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.24723	1.84	3.45	2.52	0.30459	.	.	.	.	.	T	0.09024	0.0223	L	0.56769	1.78	0.50467	D	0.999871	P;P;P	0.51653	0.553;0.947;0.553	B;B;B	0.41646	0.032;0.362;0.032	T	0.32534	-0.9903	9	0.02654	T	1	.	6.0048	0.19541	0.2573:0.0:0.7427:0.0	.	794;443;794	B2RTU8;A6NC98-3;A6NC98	.;.;CC88B_HUMAN	Q	794	ENSP00000349238:R794Q	ENSP00000349238:R794Q	R	+	2	0	CCDC88B	63868970	0.014000	0.17966	0.998000	0.56505	0.960000	0.62799	0.664000	0.25068	0.747000	0.32809	0.444000	0.29173	CGG	G|0.991;A|0.009		0.746	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104845.1	NM_032251	
C2CD3	26005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73829294	73829294	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr11:73829294C>G	ENST00000334126.7	-	9	1725	c.1499G>C	c.(1498-1500)aGg>aCg	p.R500T	C2CD3_ENST00000313663.7_Missense_Mutation_p.R500T			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	500					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GCCTGCTGACCTCTTCTTCAG	0.408																																					p.R500T		.											.	C2CD3-75	0			c.G1499C						.						115.0	108.0	110.0					11																	73829294		2200	4293	6493	SO:0001583	missense	26005	exon9			GCTGACCTCTTCT	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1499G>C	11.37:g.73829294C>G	ENSP00000334379:p.Arg500Thr	102	0		133	27	NM_015531	0	0	0	0	0	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	C	1.845	-0.466515	0.04476	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.09817	2.94;2.95	5.48	-1.5	0.08691	.	1.036710	0.07503	N	0.907542	T	0.08088	0.0202	L	0.43152	1.355	0.09310	N	1	B;B	0.17465	0.022;0.006	B;B	0.12156	0.005;0.007	T	0.43097	-0.9412	10	0.25106	T	0.35	-1.2647	2.9703	0.05920	0.1234:0.2045:0.1334:0.5386	.	500;500	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	T	500	ENSP00000334379:R500T;ENSP00000323339:R500T	ENSP00000323339:R500T	R	-	2	0	C2CD3	73506942	0.000000	0.05858	0.002000	0.10522	0.636000	0.38137	-0.774000	0.04684	-0.008000	0.14320	0.585000	0.79938	AGG	.		0.408	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
C2CD3	26005	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73829313	73829313	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr11:73829313C>T	ENST00000334126.7	-	9	1706	c.1480G>A	c.(1480-1482)Gat>Aat	p.D494N	C2CD3_ENST00000313663.7_Missense_Mutation_p.D494N			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	494					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					AGCTTATGATCACTTGACTCC	0.398																																					p.D494N		.											.	C2CD3-75	0			c.G1480A						.						118.0	111.0	113.0					11																	73829313		2200	4293	6493	SO:0001583	missense	26005	exon9			TATGATCACTTGA	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1480G>A	11.37:g.73829313C>T	ENSP00000334379:p.Asp494Asn	116	0		141	32	NM_015531	0	0	0	0	0	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	37		.	.	.	.	.	.	.	.	.	.	C	10.69	1.420539	0.25639	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.09911	2.93;2.94	5.63	2.45	0.29901	.	0.734425	0.13451	N	0.386936	T	0.09642	0.0237	L	0.47716	1.5	0.09310	N	1	B;B	0.13594	0.001;0.008	B;B	0.15052	0.003;0.012	T	0.29212	-1.0019	10	0.30078	T	0.28	-2.385	6.7767	0.23624	0.0:0.5441:0.2602:0.1957	.	494;494	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	N	494	ENSP00000334379:D494N;ENSP00000323339:D494N	ENSP00000323339:D494N	D	-	1	0	C2CD3	73506961	0.000000	0.05858	0.088000	0.20740	0.831000	0.47069	0.046000	0.14035	0.761000	0.33130	0.585000	0.79938	GAT	.		0.398	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
PDZRN4	29951	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	41966628	41966628	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr12:41966628A>G	ENST00000402685.2	+	10	2055	c.2047A>G	c.(2047-2049)Atc>Gtc	p.I683V	PDZRN4_ENST00000539469.2_Missense_Mutation_p.I425V|PDZRN4_ENST00000298919.7_Missense_Mutation_p.I423V	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	683							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GTGTCAGAATATCATGCAGGC	0.448																																					p.I683V		.											.	PDZRN4-296	0			c.A2047G						.						99.0	91.0	94.0					12																	41966628		2203	4300	6503	SO:0001583	missense	29951	exon10			CAGAATATCATGC	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2047A>G	12.37:g.41966628A>G	ENSP00000384197:p.Ile683Val	169	2		244	61	NM_001164595	0	0	0	0	0	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	37	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.044479	0.55110	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.78246	-1.16;3.34;3.34	4.49	4.49	0.54785	.	0.151474	0.45126	D	0.000400	D	0.84723	0.5535	L	0.56769	1.78	0.80722	D	1	D;P;P	0.65815	0.995;0.668;0.668	D;P;P	0.74674	0.984;0.465;0.54	D	0.84465	0.0596	10	0.40728	T	0.16	-34.5847	14.4999	0.67714	1.0:0.0:0.0:0.0	.	683;423;425	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	V	683;425;423	ENSP00000384197:I683V;ENSP00000439990:I425V;ENSP00000298919:I423V	ENSP00000298919:I423V	I	+	1	0	PDZRN4	40252895	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	9.287000	0.95975	1.987000	0.57996	0.528000	0.53228	ATC	.		0.448	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
RACGAP1	29127	broad.mit.edu	37	12	50400412	50400412	+	Silent	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr12:50400412G>A	ENST00000427314.2	-	5	316	c.93C>T	c.(91-93)atC>atT	p.I31I	RACGAP1_ENST00000312377.5_Silent_p.I31I|RACGAP1_ENST00000454520.2_Silent_p.I31I|RACGAP1_ENST00000551016.1_Silent_p.I31I|RACGAP1_ENST00000434422.1_Silent_p.I31I|RACGAP1_ENST00000547905.1_Silent_p.I31I	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						TCGCCAACTGGATAAATTCTG	0.403																																					p.I31I		.											.	RACGAP1-227	0			c.C93T						.						53.0	44.0	47.0					12																	50400412		2203	4300	6503	SO:0001819	synonymous_variant	29127	exon5			CAACTGGATAAAT		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.93C>T	12.37:g.50400412G>A		36	0		61	6	NM_013277	0	0	0	0	0		Silent	SNP	ENST00000427314.2	37	CCDS8795.1																																																																																			.		0.403	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	NM_013277	
HOXC11	3227	hgsc.bcm.edu	37	12	54367597	54367597	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr12:54367597C>T	ENST00000546378.1	+	1	688	c.572C>T	c.(571-573)tCc>tTc	p.S191F	HOTAIR_ENST00000424518.1_RNA|HOTAIR_ENST00000455246.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.S191F			O43248	HXC11_HUMAN	homeobox C11	191					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						GGACTGGCGTCCCGGGCTGAG	0.741			T	NUP98	AML																																p.S191F		.		Dom	yes		12	12q13.3	3227	homeo box C11		L	.	HOXC11-683	0			c.C572T						.						4.0	6.0	5.0					12																	54367597		1848	3605	5453	SO:0001583	missense	3227	exon1			TGGCGTCCCGGGC		CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.572C>T	12.37:g.54367597C>T	ENSP00000446680:p.Ser191Phe	0	0		8	6	NM_014212	0	0	0	0	0	A8K7D1|Q96DH2	Missense_Mutation	SNP	ENST00000546378.1	37	CCDS8867.1	.	.	.	.	.	.	.	.	.	.	C	9.237	1.037429	0.19669	.	.	ENSG00000123388	ENST00000546378;ENST00000243082	D;T	0.91740	-2.9;1.77	4.22	4.22	0.49857	.	0.280319	0.40222	N	0.001156	D	0.83797	0.5332	N	0.08118	0	0.41546	D	0.988544	B	0.33073	0.396	B	0.32022	0.139	D	0.86073	0.1539	10	0.87932	D	0	.	15.8882	0.79269	0.0:1.0:0.0:0.0	.	191	O43248	HXC11_HUMAN	F	191	ENSP00000446680:S191F;ENSP00000243082:S191F	ENSP00000243082:S191F	S	+	2	0	HOXC11	52653864	0.987000	0.35691	1.000000	0.80357	0.508000	0.34012	1.585000	0.36600	2.343000	0.79666	0.561000	0.74099	TCC	.		0.741	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358869.2		
GLIPR1	11010	broad.mit.edu	37	12	75892747	75892747	+	Missense_Mutation	SNP	C	C	G	rs200527675		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr12:75892747C>G	ENST00000266659.3	+	6	991	c.790C>G	c.(790-792)Ctt>Gtt	p.L264V	KRR1_ENST00000229214.4_3'UTR	NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	264					cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						TAATTTAGTTCTTTTGGACTA	0.299																																					p.L264V		.											.	GLIPR1-159	0			c.C790G						.						80.0	76.0	77.0					12																	75892747		2201	4299	6500	SO:0001583	missense	11010	exon6			TTAGTTCTTTTGG	U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.790C>G	12.37:g.75892747C>G	ENSP00000266659:p.Leu264Val	30	0		48	3	NM_006851	0	0	29	29	0	A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	ENST00000266659.3	37	CCDS9011.1	.	.	.	.	.	.	.	.	.	.	C	9.351	1.065452	0.20067	.	.	ENSG00000139278	ENST00000266659	T	0.11063	2.81	5.08	-0.44	0.12261	.	1.391670	0.04303	N	0.347721	T	0.10165	0.0249	L	0.47716	1.5	0.09310	N	1	B	0.17038	0.02	B	0.14578	0.011	T	0.36383	-0.9750	10	0.35671	T	0.21	.	3.5194	0.07736	0.4257:0.3533:0.1383:0.0826	.	264	P48060	GLIP1_HUMAN	V	264	ENSP00000266659:L264V	ENSP00000266659:L264V	L	+	1	0	GLIPR1	74179014	0.555000	0.26530	0.001000	0.08648	0.699000	0.40488	0.613000	0.24299	0.026000	0.15269	0.491000	0.48974	CTT	C|0.999;A|0.001		0.299	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405722.1	NM_006851	
PARP4	143	ucsc.edu;bcgsc.ca	37	13	25016762	25016762	+	Missense_Mutation	SNP	G	G	A	rs113301501	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr13:25016762G>A	ENST00000381989.3	-	29	3614	c.3509C>T	c.(3508-3510)aCa>aTa	p.T1170I		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1170					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TGTAAATTGTGTTATGAGAGA	0.289																																					p.T1170I		.											.	PARP4-94	0			c.C3509T						.						81.0	83.0	82.0					13																	25016762		2201	4298	6499	SO:0001583	missense	143	exon29			AATTGTGTTATGA	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3509C>T	13.37:g.25016762G>A	ENSP00000371419:p.Thr1170Ile	77	2		138	22	NM_006437	0	0	4	4	0	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	37	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	g	16.99	3.273741	0.59649	.	.	ENSG00000102699	ENST00000381989	T	0.64803	-0.12	4.65	3.81	0.43845	.	0.193075	0.42053	D	0.000769	T	0.59197	0.2176	M	0.76328	2.33	0.33718	D	0.616609	B	0.32203	0.36	B	0.27796	0.083	T	0.71896	-0.4454	10	0.87932	D	0	-18.9801	10.8642	0.46844	0.0924:0.0:0.9076:0.0	.	1170	Q9UKK3	PARP4_HUMAN	I	1170	ENSP00000371419:T1170I	ENSP00000371419:T1170I	T	-	2	0	PARP4	23914762	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.530000	0.67141	1.207000	0.43291	-0.131000	0.14894	ACA	G|0.935;A|0.065		0.289	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	
AKAP11	11215	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	42874405	42874405	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr13:42874405A>G	ENST00000025301.2	+	8	1698	c.1523A>G	c.(1522-1524)cAt>cGt	p.H508R		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	508					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		CGTACCCACCATACTAATACC	0.299																																					p.H508R		.											.	AKAP11-227	0			c.A1523G						.						68.0	69.0	69.0					13																	42874405		2203	4299	6502	SO:0001583	missense	11215	exon8			CCCACCATACTAA	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.1523A>G	13.37:g.42874405A>G	ENSP00000025301:p.His508Arg	51	0		75	20	NM_016248	0	0	0	0	0	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	A	0.948	-0.707207	0.03230	.	.	ENSG00000023516	ENST00000025301	T	0.48522	0.81	5.63	0.322	0.15888	.	0.610881	0.17589	N	0.168822	T	0.35537	0.0935	M	0.63428	1.95	0.09310	N	1	B	0.14438	0.01	B	0.15052	0.012	T	0.17745	-1.0359	10	0.30854	T	0.27	.	1.9061	0.03278	0.4875:0.2515:0.1395:0.1215	.	508	Q9UKA4	AKA11_HUMAN	R	508	ENSP00000025301:H508R	ENSP00000025301:H508R	H	+	2	0	AKAP11	41772405	0.000000	0.05858	0.003000	0.11579	0.011000	0.07611	0.305000	0.19254	0.473000	0.27368	0.477000	0.44152	CAT	.		0.299	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
CYSLTR2	57105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	13	49281360	49281360	+	Missense_Mutation	SNP	G	G	A	rs201503697		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr13:49281360G>A	ENST00000282018.3	+	1	410	c.407G>A	c.(406-408)cGt>cAt	p.R136H		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	136					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)	p.R136H(1)		endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	AGTGTTGTGCGTTTCCTGGCA	0.473																																					p.R136H		.											.	CYSLTR2-278	1	Substitution - Missense(1)	large_intestine(1)	c.G407A						.	G	HIS/ARG	0,4406		0,0,2203	224.0	214.0	217.0		407	6.1	1.0	13		217	1,8599	1.2+/-3.3	0,1,4299	no	missense	CYSLTR2	NM_020377.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	136/347	49281360	1,13005	2203	4300	6503	SO:0001583	missense	57105	exon1			TTGTGCGTTTCCT	AB038269	CCDS9412.1	13q14.2	2012-08-10			ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	18274	protein-coding gene	gene with protein product		605666				10913337, 1085123	Standard	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	Q9NS75	OTTHUMG00000016906	ENST00000282018.3:c.407G>A	13.37:g.49281360G>A	ENSP00000282018:p.Arg136His	99	0		116	32	NM_020377	0	0	0	0	0	Q9HCQ2	Missense_Mutation	SNP	ENST00000282018.3	37	CCDS9412.1	.	.	.	.	.	.	.	.	.	.	G	35	5.482943	0.96307	0.0	1.16E-4	ENSG00000152207	ENST00000282018	D	0.97161	-4.27	6.08	6.08	0.98989	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000002	D	0.99121	0.9697	H	0.96691	3.865	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99078	1.0836	10	0.87932	D	0	.	19.6516	0.95815	0.0:0.0:1.0:0.0	.	136	Q9NS75	CLTR2_HUMAN	H	136	ENSP00000282018:R136H	ENSP00000282018:R136H	R	+	2	0	CYSLTR2	48179361	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.977000	0.88081	2.894000	0.99253	0.655000	0.94253	CGT	.		0.473	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044894.1		
KLHL28	54813	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45403706	45403706	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr14:45403706T>C	ENST00000396128.4	-	3	1074	c.955A>G	c.(955-957)Att>Gtt	p.I319V	KLHL28_ENST00000355081.2_Missense_Mutation_p.I333V	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	319										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TAGCGAGGAATGTTTAGGGGT	0.363																																					p.I319V		.											.	KLHL28-91	0			c.A955G						.						58.0	56.0	57.0					14																	45403706		2203	4300	6503	SO:0001583	missense	54813	exon3			GAGGAATGTTTAG	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.955A>G	14.37:g.45403706T>C	ENSP00000379434:p.Ile319Val	100	0		132	47	NM_017658	0	0	1	1	0	Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	37	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	T	7.765	0.706318	0.15239	.	.	ENSG00000179454	ENST00000396128;ENST00000355081	T;T	0.73575	-0.76;-0.76	5.38	5.38	0.77491	Kelch-type beta propeller (1);	0.267689	0.43110	D	0.000619	T	0.51312	0.1667	N	0.10733	0.035	0.33131	D	0.543044	B	0.02656	0.0	B	0.01281	0.0	T	0.56080	-0.8038	10	0.45353	T	0.12	.	5.9681	0.19336	0.1469:0.0782:0.0:0.7748	.	319	Q9NXS3	KLH28_HUMAN	V	319;333	ENSP00000379434:I319V;ENSP00000347193:I333V	ENSP00000347193:I333V	I	-	1	0	KLHL28	44473456	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.547000	0.53663	2.157000	0.67596	0.455000	0.32223	ATT	.		0.363	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3		
FANCM	57697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	45639809	45639809	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr14:45639809C>A	ENST00000267430.5	+	12	2105	c.2020C>A	c.(2020-2022)Cta>Ata	p.L674I	FANCM_ENST00000542564.2_Missense_Mutation_p.L648I	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	674					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GCAAAGTAGCCTAAAGAAAGA	0.303								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.L674I		.											.	FANCM-569	0			c.C2020A						.						44.0	48.0	46.0					14																	45639809		2201	4297	6498	SO:0001583	missense	57697	exon12	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AGTAGCCTAAAGA	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.2020C>A	14.37:g.45639809C>A	ENSP00000267430:p.Leu674Ile	98	0		106	34	NM_020937	0	0	0	0	0	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	37	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.440387	0.01098	.	.	ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250	T;T;T	0.18338	2.79;2.79;2.22	5.35	4.22	0.49857	.	2.644850	0.00763	N	0.001158	T	0.16896	0.0406	L	0.33485	1.01	0.20074	N	0.999938	B;B	0.17465	0.022;0.013	B;B	0.11329	0.006;0.006	T	0.33854	-0.9852	10	0.20519	T	0.43	.	9.5651	0.39394	0.0:0.0861:0.0:0.9139	.	648;674	B2RTQ9;Q8IYD8	.;FANCM_HUMAN	I	674;648;190	ENSP00000267430:L674I;ENSP00000442493:L648I;ENSP00000452033:L190I	ENSP00000267430:L674I	L	+	1	2	FANCM	44709559	0.003000	0.15002	0.262000	0.24481	0.075000	0.17131	1.049000	0.30392	0.876000	0.35872	-0.367000	0.07326	CTA	.		0.303	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
FBXO34	55030	bcgsc.ca	37	14	55818706	55818706	+	Missense_Mutation	SNP	T	T	C	rs3742569	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr14:55818706T>C	ENST00000313833.4	+	2	1843	c.1598T>C	c.(1597-1599)cTg>cCg	p.L533P	FBXO34_ENST00000440021.1_Missense_Mutation_p.L533P	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34	533			L -> P (in dbSNP:rs3742569). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.4}.					p.L533P(1)		breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						CCATTTGTACTGCCAGCCTCT	0.502													t|||	1992	0.397764	0.4713	0.3314	5008	,	,		19439	0.3185		0.4245	False		,,,				2504	0.3998				p.L533P		.											.	FBXO34-228	1	Substitution - Missense(1)	stomach(1)	c.T1598C						.	C	PRO/LEU,PRO/LEU	1984,2422	617.4+/-393.0	424,1136,643	130.0	126.0	127.0		1598,1598	-1.4	0.0	14	dbSNP_107	127	3629,4971	625.6+/-397.7	784,2061,1455	yes	missense,missense	FBXO34	NM_017943.3,NM_152231.1	98,98	1208,3197,2098	CC,CT,TT		42.1977,45.0295,43.157	benign,benign	533/712,533/712	55818706	5613,7393	2203	4300	6503	SO:0001583	missense	55030	exon2			TTGTACTGCCAGC	AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.1598T>C	14.37:g.55818706T>C	ENSP00000313159:p.Leu533Pro	202	2		149	8	NM_017943	0	0	1	1	0	Q2VPB5|Q4VBP5|Q86TY4	Missense_Mutation	SNP	ENST00000313833.4	37	CCDS32086.1	857	0.3923992673992674	224	0.45528455284552843	119	0.3287292817679558	191	0.3339160839160839	323	0.4261213720316623	C	0.442	-0.898108	0.02472	0.450295	0.421977	ENSG00000178974	ENST00000313833;ENST00000440021	T;T	0.20069	2.1;2.1	5.49	-1.35	0.09114	.	0.711289	0.12725	N	0.444330	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45512	-0.9256	9	0.42905	T	0.14	-15.7575	11.6878	0.51497	0.0:0.3231:0.0:0.6769	rs3742569;rs17674206;rs52807065;rs61280222;rs3742569	533	Q9NWN3	FBX34_HUMAN	P	533	ENSP00000313159:L533P;ENSP00000394117:L533P	ENSP00000313159:L533P	L	+	2	0	FBXO34	54888459	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.774000	0.04684	-0.553000	0.06158	-0.716000	0.03619	CTG	T|0.582;C|0.418		0.502	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411322.1		
ATG2B	55102	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	96800204	96800204	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr14:96800204G>C	ENST00000359933.4	-	8	1921	c.1028C>G	c.(1027-1029)tCt>tGt	p.S343C		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	343					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		TATTTTGCTAGAATTTTCTAT	0.333																																					p.S343C		.											.	ATG2B-93	0			c.C1028G						.						102.0	94.0	97.0					14																	96800204		1817	4077	5894	SO:0001583	missense	55102	exon8			TTGCTAGAATTTT	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.1028C>G	14.37:g.96800204G>C	ENSP00000353010:p.Ser343Cys	19	0		41	15	NM_018036	0	0	0	0	0	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287679	0.59976	.	.	ENSG00000066739	ENST00000359933	T	0.10860	2.83	5.9	5.9	0.94986	.	0.238344	0.22025	U	0.065669	T	0.09774	0.0240	L	0.27053	0.805	0.30285	N	0.790988	B	0.10296	0.003	B	0.08055	0.003	T	0.03706	-1.1011	10	0.59425	D	0.04	.	13.8831	0.63693	0.078:0.0:0.922:0.0	.	343	Q96BY7	ATG2B_HUMAN	C	343	ENSP00000353010:S343C	ENSP00000353010:S343C	S	-	2	0	ATG2B	95869957	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	3.560000	0.53763	2.793000	0.96121	0.591000	0.81541	TCT	.		0.333	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
MIR382	494331	bcgsc.ca	37	14	101522556	101522556	+	RNA	SNP	T	T	C	rs56103835	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr14:101522556T>C	ENST00000385009.2	-	0	0				MIR323B_ENST00000385269.2_RNA|MIR485_ENST00000385292.2_RNA|MIR134_ENST00000385258.2_RNA	NR_029874.1				microRNA 382																		TGCCACCTCATGGTACTCGGA	0.557													T|||	1492	0.297923	0.025	0.3386	5008	,	,		21172	0.6677		0.1819	False		,,,				2504	0.3763				.		.											.	.	0			.						.	T		146,2990		6,134,1428	135.0	114.0	120.0			-0.4	0.1	14	dbSNP_129	120	1477,5687		144,1189,2249	no	intergenic				150,1323,3677	CC,CT,TT		20.617,4.6556,15.7573			101522556	1623,8677	1568	3582	5150			574410	.			ACCTCATGGTACT			14q32.31	2013-02-12		2008-12-18		ENSG00000207742		"""ncRNAs / Micro RNAs"""	31875	non-coding RNA	RNA, micro				MIRN382			Standard	NR_029874		Approved	hsa-mir-382	uc010awe.3				14.37:g.101522556T>C		331	1		277	8	.	0	0	0	0	0		RNA	SNP	ENST00000385009.2	37																																																																																				T|0.731;C|0.269		0.557	MIR382-201	KNOWN	basic	miRNA	miRNA		NR_029874	
EIF2AK4	440275	bcgsc.ca	37	15	40259848	40259848	+	Missense_Mutation	SNP	A	A	C	rs2291627	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr15:40259848A>C	ENST00000263791.5	+	9	1364	c.1321A>C	c.(1321-1323)Att>Ctt	p.I441L	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.I441L|EIF2AK4_ENST00000559624.1_Missense_Mutation_p.I441L	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	441	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.		I -> L (in dbSNP:rs2291627). {ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:17974005}.		cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		CACCGTCAAGATTACGGACTA	0.468													A|||	1239	0.247404	0.233	0.134	5008	,	,		23651	0.5387		0.0924	False		,,,				2504	0.2065				p.I441L		.											.	EIF2AK4-757	0			c.A1321C						.	A	LEU/ILE	762,3232		68,626,1303	107.0	105.0	106.0		1321	4.5	1.0	15	dbSNP_100	106	739,7611		33,673,3469	yes	missense	EIF2AK4	NM_001013703.2	5	101,1299,4772	CC,CA,AA		8.8503,19.0786,12.1598	benign	441/1650	40259848	1501,10843	1997	4175	6172	SO:0001583	missense	440275	exon9			GTCAAGATTACGG	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.1321A>C	15.37:g.40259848A>C	ENSP00000263791:p.Ile441Leu	184	2		122	6	NM_001013703	0	0	0	0	0	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	37	CCDS42016.1	531	0.24313186813186813	115	0.23373983739837398	45	0.12430939226519337	298	0.5209790209790209	73	0.09630606860158311	A	4.744	0.138332	0.09083	0.190786	0.088503	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.68903	-0.36;-0.36	5.58	4.46	0.54185	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.323593	0.34025	N	0.004327	T	0.00012	0.0000	N	0.02225	-0.63	0.35081	P	0.236591	B;B	0.09022	0.001;0.002	B;B	0.12156	0.007;0.002	T	0.43621	-0.9380	9	0.02654	T	1	-16.4002	4.9105	0.13820	0.5452:0.2912:0.1637:0.0	rs2291627;rs52819941;rs61355221;rs2291627	441;441	Q9P2K8;Q9P2K8-3	E2AK4_HUMAN;.	L	441	ENSP00000263791:I441L;ENSP00000372174:I441L	ENSP00000263791:I441L	I	+	1	0	EIF2AK4	38047140	1.000000	0.71417	0.972000	0.41901	0.798000	0.45092	1.331000	0.33793	1.052000	0.40392	0.533000	0.62120	ATT	C|0.219;N|0.000		0.468	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
ZNF205	7755	hgsc.bcm.edu;broad.mit.edu	37	16	3169885	3169896	+	In_Frame_Del	DEL	CACCCACCAGGG	CACCCACCAGGG	-			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	CACCCACCAGGG	CACCCACCAGGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr16:3169885_3169896delCACCCACCAGGG	ENST00000382192.3	+	7	1429_1440	c.1224_1235delCACCCACCAGGG	c.(1222-1236)gtcacccaccagggc>gtc	p.THQG409del	RP11-473M20.14_ENST00000575139.1_RNA|ZNF205_ENST00000219091.4_In_Frame_Del_p.THQG409del|RP11-473M20.14_ENST00000576490.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	409					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						CGGACTTGGTCACCCACCAGGGCACCCACACG	0.67																																					p.408_412del		.											.	ZNF205-90	0			c.1224_1235del						.																																			SO:0001651	inframe_deletion	7755	exon7			CTTGGTCACCCAC	AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.1224_1235delCACCCACCAGGG	16.37:g.3169885_3169896delCACCCACCAGGG	ENSP00000371627:p.Thr409_Gly412del	8	0		117	52	NM_003456	0	0	0	0	0	A8MZK0|D3DUB4|Q9BU95	In_Frame_Del	DEL	ENST00000382192.3	37	CCDS10494.2																																																																																			.		0.670	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309057.1	NM_003456	
TMC5	79838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	19492710	19492710	+	Silent	SNP	G	G	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr16:19492710G>C	ENST00000396229.2	+	15	3035	c.2286G>C	c.(2284-2286)ctG>ctC	p.L762L	TMC5_ENST00000541464.1_Silent_p.L710L|CTA-363E6.6_ENST00000561762.1_RNA|TMC5_ENST00000542583.2_Silent_p.L762L|TMC5_ENST00000219821.5_Silent_p.L516L|TMC5_ENST00000564959.1_Silent_p.L445L|TMC5_ENST00000561503.1_Silent_p.L403L|TMC5_ENST00000381414.4_Silent_p.L762L	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	762					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						GGATGCAACTGATCACAAGTC	0.423																																					p.L762L		.											.	TMC5-91	0			c.G2286C						.						183.0	157.0	166.0					16																	19492710		2197	4300	6497	SO:0001819	synonymous_variant	79838	exon15			GCAACTGATCACA	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2286G>C	16.37:g.19492710G>C		210	0		248	50	NM_001105249	0	0	0	0	0	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Silent	SNP	ENST00000396229.2	37	CCDS45431.1																																																																																			.		0.423	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		6	6	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
CDH5	1003	bcgsc.ca	37	16	66432424	66432424	+	Silent	SNP	C	C	T	rs3826229|rs386791725	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr16:66432424C>T	ENST00000341529.3	+	10	1699	c.1551C>T	c.(1549-1551)atC>atT	p.I517I	CDH5_ENST00000539168.1_5'UTR	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	517	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.		I -> T (in dbSNP:rs1049970). {ECO:0000269|PubMed:10861224, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7627717}.		adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	TCAAATTCATCTTGAATACTG	0.473													C|||	2079	0.415136	0.3979	0.4409	5008	,	,		21236	0.5506		0.3678	False		,,,				2504	0.3292				p.I517I		.											.	CDH5-525	0			c.C1551T						.	C		96,4306		24,48,2129	150.0	127.0	134.0		1551	3.0	0.9	16	dbSNP_107	134	112,8488		25,62,4213	no	coding-synonymous	CDH5	NM_001795.3		49,110,6342	TT,TC,CC		1.3023,2.1808,1.5998		517/785	66432424	208,12794	2201	4300	6501	SO:0001819	synonymous_variant	1003	exon10			ATTCATCTTGAAT	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.1551C>T	16.37:g.66432424C>T		240	3		289	9	NM_001795	0	0	0	0	0	Q4VAI5|Q4VAI6	Silent	SNP	ENST00000341529.3	37	CCDS10804.1																																																																																			A|0.000;C|0.632;G|0.000;T|0.368		0.473	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268767.1	NM_001795	
ALOX15	246	bcgsc.ca	37	17	4536241	4536241	+	Silent	SNP	T	T	C	rs743646	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:4536241T>C	ENST00000570836.1	-	12	1551	c.1455A>G	c.(1453-1455)acA>acG	p.T485T	ALOX15_ENST00000574640.1_Silent_p.T446T|ALOX15_ENST00000545513.1_Silent_p.T507T|ALOX15_ENST00000293761.3_Silent_p.T485T			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	485	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		CAGCCACGTCTGTCTTATAGT	0.592													T|||	232	0.0463259	0.0045	0.0648	5008	,	,		18952	0.001		0.1342	False		,,,				2504	0.046				p.T485T		.											.	ALOX15-229	0			c.A1455G						.	T		89,4317	73.6+/-111.7	1,87,2115	93.0	85.0	88.0		1455	-3.2	0.0	17	dbSNP_86	88	1057,7543	222.7+/-259.7	66,925,3309	no	coding-synonymous	ALOX15	NM_001140.3		67,1012,5424	CC,CT,TT		12.2907,2.02,8.8113		485/663	4536241	1146,11860	2203	4300	6503	SO:0001819	synonymous_variant	246	exon11			CACGTCTGTCTTA	M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.1455A>G	17.37:g.4536241T>C		126	0		127	6	NM_001140	0	0	0	0	0	A8K2P4|B7ZA11|Q8N6R7|Q99657	Silent	SNP	ENST00000570836.1	37	CCDS11049.1																																																																																			T|0.920;C|0.080		0.592	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207487.2		
KRTAP4-8	728224	ucsc.edu	37	17	39254133	39254133	+	Missense_Mutation	SNP	G	G	T	rs200462175		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:39254133G>T	ENST00000333822.4	-	1	260	c.204C>A	c.(202-204)agC>agA	p.S68R		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	68	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ACACACAGCAGCTGGGGCGAC	0.667																																					p.S68R		.											.	.	0			c.C204A						.						6.0	9.0	8.0					17																	39254133		616	1426	2042	SO:0001583	missense	728224	exon1			ACAGCAGCTGGGG	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.204C>A	17.37:g.39254133G>T	ENSP00000328444:p.Ser68Arg	22	1		87	16	NM_031960	0	0	0	0	0	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	13.88	2.368333	0.42003	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.01963	4.53	3.73	-3.02	0.05446	.	2.601200	0.02242	U	0.065854	T	0.05135	0.0137	M	0.89658	3.05	0.20307	N	0.999915	B	0.11235	0.004	B	0.10450	0.005	T	0.47774	-0.9091	10	0.46703	T	0.11	.	0.2646	0.00223	0.277:0.1441:0.2848:0.2941	.	68	Q9BYQ9	KRA48_HUMAN	R	68	ENSP00000328444:S68R	ENSP00000414561:S68R	S	-	3	2	KRTAP4-8	36507659	0.949000	0.32298	0.011000	0.14972	0.444000	0.32077	1.355000	0.34068	-0.877000	0.04012	0.449000	0.29647	AGC	.		0.667	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
KRTAP4-11	653240	bcgsc.ca	37	17	39274311	39274311	+	Missense_Mutation	SNP	T	T	C	rs425755		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:39274311T>C	ENST00000391413.2	-	1	295	c.257A>G	c.(256-258)aAg>aGg	p.K86R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	86	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.K86R(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCACTGGGGCTTGCAGCAGCT	0.657																																					p.K86R		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.A257G						.																																			SO:0001583	missense	653240	exon1			TGGGGCTTGCAGC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.257A>G	17.37:g.39274311T>C	ENSP00000375232:p.Lys86Arg	43	2		145	29	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	0.090	-1.168142	0.01660	.	.	ENSG00000212721	ENST00000391413	T	0.00591	6.35	4.25	-7.14	0.01527	.	.	.	.	.	T	0.00178	0.0005	N	0.01109	-1.01	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41215	-0.9521	8	0.10111	T	0.7	.	1.4913	0.02457	0.232:0.3447:0.0991:0.3242	rs425755	86	Q9BYQ6	KR411_HUMAN	R	86	ENSP00000375232:K86R	ENSP00000375232:K86R	K	-	2	0	KRTAP4-11	36527837	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.427000	0.06999	-1.427000	0.01992	-2.307000	0.00257	AAG	.		0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-11	653240	broad.mit.edu;bcgsc.ca	37	17	39274319	39274319	+	Missense_Mutation	SNP	G	G	C	rs199712484		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:39274319G>C	ENST00000391413.2	-	1	287	c.249C>G	c.(247-249)agC>agG	p.S83R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	83	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)		p.S83R(1)		endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCTTGCAGCAGCTGGACACAC	0.662																																					p.S83R		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.C249G						.																																			SO:0001583	missense	653240	exon1			GCAGCAGCTGGAC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.249C>G	17.37:g.39274319G>C	ENSP00000375232:p.Ser83Arg	39	0		155	28	NM_033059	0	0	0	0	0	A0AUY2	Missense_Mutation	SNP	ENST00000391413.2	37	CCDS45675.1	.	.	.	.	.	.	.	.	.	.	.	11.88	1.769671	0.31320	.	.	ENSG00000212721	ENST00000391413	T	0.00686	5.85	4.12	0.987	0.19790	.	8.728350	0.01373	U	0.012645	T	0.01835	0.0058	M	0.85710	2.77	0.20489	N	0.999895	B	0.21381	0.055	B	0.12156	0.007	T	0.50676	-0.8800	10	0.66056	D	0.02	.	3.7776	0.08667	0.3083:0.1839:0.5078:0.0	.	83	Q9BYQ6	KR411_HUMAN	R	83	ENSP00000375232:S83R	ENSP00000375232:S83R	S	-	3	2	KRTAP4-11	36527845	0.052000	0.20516	0.390000	0.26220	0.120000	0.20174	0.102000	0.15272	0.075000	0.16796	0.511000	0.50034	AGC	.		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
KRTAP4-6	81871	broad.mit.edu	37	17	39296412	39296412	+	Missense_Mutation	SNP	T	T	A	rs200470462		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:39296412T>A	ENST00000345847.4	-	1	327	c.328A>T	c.(328-330)Agc>Tgc	p.S110C		NM_030976.1	NP_112238.1	Q9BYQ5	KRA46_HUMAN	keratin associated protein 4-6	110	30 X 5 AA repeats of C-C-[IRQVEL]-[SPTR]- [STVQRCP].					keratin filament (GO:0045095)		p.S110C(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(1)|prostate(1)|urinary_tract(1)	9						CTGGAGATGCTGCAGCTGGGA	0.657																																					p.S110C		.											.	.	1	Substitution - Missense(1)	endometrium(1)	c.A328T						.																																			SO:0001583	missense	81871	exon1			AGATGCTGCAGCT	AJ406938	CCDS54125.1	17q21.2	2013-06-25			ENSG00000198090	ENSG00000198090		"""Keratin associated proteins"""	18909	protein-coding gene	gene with protein product			"""keratin associated protein 4-15"""	KRTAP4-15			Standard	NM_030976		Approved	KAP4.6, KAP4.15	uc010cxk.2	Q9BYQ5	OTTHUMG00000133634	ENST00000345847.4:c.328A>T	17.37:g.39296412T>A	ENSP00000328270:p.Ser110Cys	54	1		162	27	NM_030976	0	0	0	0	0	Q9BYR1	Missense_Mutation	SNP	ENST00000345847.4	37	CCDS54125.1	.	.	.	.	.	.	.	.	.	.	.	2.702	-0.270707	0.05716	.	.	ENSG00000198090	ENST00000345847	T	0.00832	5.64	5.04	2.75	0.32379	.	.	.	.	.	T	0.00210	0.0006	N	0.00010	-3.04	0.19300	N	0.999971	.	.	.	.	.	.	T	0.44667	-0.9313	7	0.02654	T	1	.	3.2614	0.06850	0.543:0.0:0.1598:0.2972	.	.	.	.	C	110	ENSP00000328270:S110C	ENSP00000328270:S110C	S	-	1	0	KRTAP4-6	36549938	0.149000	0.22717	0.661000	0.29709	0.064000	0.16182	0.179000	0.16840	0.259000	0.21709	-0.319000	0.08680	AGC	.		0.657	KRTAP4-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257779.1		
KRTAP4-5	85289	ucsc.edu;bcgsc.ca	37	17	39305785	39305785	+	Missense_Mutation	SNP	A	A	T	rs411367		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:39305785A>T	ENST00000343246.4	-	1	269	c.235T>A	c.(235-237)Tgc>Agc	p.C79S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	79	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tggcagcagcaggggcggcag	0.657																																					p.C79S		.											.	KRTAP4-5-90	0			c.T235A						.						12.0	18.0	16.0					17																	39305785		2089	4172	6261	SO:0001583	missense	85289	exon1			AGCAGCAGGGGCG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.235T>A	17.37:g.39305785A>T	ENSP00000340546:p.Cys79Ser	21	0		83	20	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	773	0.35393772893772896	210	0.4268292682926829	126	0.34806629834254144	175	0.30594405594405594	262	0.34564643799472294	.	0.010	-1.763522	0.00651	.	.	ENSG00000198271	ENST00000343246	T	0.00534	6.74	2.78	-5.56	0.02529	.	0.768893	0.10092	N	0.717076	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	9	0.02654	T	1	.	5.4481	0.16548	0.6146:0.0:0.1542:0.2312	rs411367;rs6503604	79	Q9BYR2	KRA45_HUMAN	S	79	ENSP00000340546:C79S	ENSP00000340546:C79S	C	-	1	0	KRTAP4-5	36559311	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-1.272000	0.02427	-2.057000	0.00402	TGC	A|0.354;T|0.646		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305800	39305800	+	Missense_Mutation	SNP	T	T	A	rs141998775		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:39305800T>A	ENST00000343246.4	-	1	254	c.220A>T	c.(220-222)Agc>Tgc	p.S74C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	74	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cggcagcagctggattcacag	0.657																																					p.S74C		.											.	KRTAP4-5-90	0			c.A220T						.						12.0	18.0	16.0					17																	39305800		2056	4148	6204	SO:0001583	missense	85289	exon1			AGCAGCTGGATTC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.220A>T	17.37:g.39305800T>A	ENSP00000340546:p.Ser74Cys	30	0		82	7	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	12.46	1.946118	0.34377	.	.	ENSG00000198271	ENST00000343246	T	0.00633	6.08	3.65	2.55	0.30701	.	.	.	.	.	T	0.01287	0.0042	N	0.25957	0.775	0.22412	N	0.999125	D	0.76494	0.999	D	0.63703	0.917	T	0.57015	-0.7883	9	0.59425	D	0.04	.	7.2679	0.26239	0.0:0.1123:0.0:0.8877	.	74	Q9BYR2	KRA45_HUMAN	C	74	ENSP00000340546:S74C	ENSP00000340546:S74C	S	-	1	0	KRTAP4-5	36559326	0.004000	0.15560	0.084000	0.20598	0.021000	0.10359	-0.223000	0.09177	0.555000	0.29079	0.358000	0.22013	AGC	.		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
ICT1	3396	hgsc.bcm.edu	37	17	73008804	73008804	+	Missense_Mutation	SNP	G	G	T	rs3744206	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:73008804G>T	ENST00000301585.5	+	1	36	c.23G>T	c.(22-24)cGc>cTc	p.R8L		NM_001545.1	NP_001536.1	Q14197	ICT1_HUMAN	immature colon carcinoma transcript 1	8			R -> P (in dbSNP:rs3744206).		mitochondrial translational termination (GO:0070126)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)	aminoacyl-tRNA hydrolase activity (GO:0004045)|translation release factor activity, codon nonspecific (GO:0016150)			NS(1)|central_nervous_system(1)|lung(2)|ovary(1)|urinary_tract(1)	6	all_lung(278;0.226)					AGGTGCCTGCGCTGGGGCCTG	0.697											OREG0024724	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	118	0.0235623	0.0703	0.0101	5008	,	,		10726	0.0		0.0179	False		,,,				2504	0.0				p.R8L		.											.	ICT1-91	0			c.G23T						.	G	LEU/ARG	223,4091		3,217,1937	10.0	9.0	9.0		23	2.2	0.8	17	dbSNP_107	9	274,8156		5,264,3946	no	missense	ICT1	NM_001545.1	102	8,481,5883	TT,TG,GG		3.2503,5.1692,3.8999	benign	8/207	73008804	497,12247	2157	4215	6372	SO:0001583	missense	3396	exon1			GCCTGCGCTGGGG	X81788	CCDS11711.1	17q25	2014-02-12				ENSG00000167862			5359	protein-coding gene	gene with protein product		603000				8575443, 20186120	Standard	NM_001545		Approved	DS-1	uc002jmm.3	Q14197		ENST00000301585.5:c.23G>T	17.37:g.73008804G>T	ENSP00000301585:p.Arg8Leu	1	0	1142	19	15	NM_001545	0	0	1	14	13	B2RAD1|Q53HM7|Q53Y11	Missense_Mutation	SNP	ENST00000301585.5	37	CCDS11711.1	.	.	.	.	.	.	.	.	.	.	G	9.452	1.090738	0.20471	0.051692	0.032503	ENSG00000167862	ENST00000301585	T	0.25749	1.78	5.58	2.2	0.27929	.	0.565130	0.17342	N	0.177719	T	0.01940	0.0061	N	0.14661	0.345	0.09310	N	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.16689	-1.0394	10	0.44086	T	0.13	-4.1944	7.6743	0.28476	0.0:0.1266:0.4103:0.4631	rs3744206	8	Q14197	ICT1_HUMAN	L	8	ENSP00000301585:R8L	ENSP00000301585:R8L	R	+	2	0	ICT1	70520399	0.005000	0.15991	0.830000	0.32933	0.026000	0.11368	0.131000	0.15870	0.674000	0.31244	0.655000	0.94253	CGC	C|0.010;G|0.987;T|0.003		0.697	ICT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445314.1	NM_001545	
AATK	9625	hgsc.bcm.edu	37	17	79096344	79096344	+	Silent	SNP	G	G	A	rs374609689		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:79096344G>A	ENST00000326724.4	-	11	1416	c.1392C>T	c.(1390-1392)gaC>gaT	p.D464D	AATK_ENST00000572339.1_5'Flank|AATK_ENST00000417379.1_Silent_p.D361D|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	464					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCGTCAGCACGTCGTCGCCGT	0.726																																					p.D464D		.											.	AATK-933	0			c.C1392T						.	G	,	0,3114		0,0,1557	3.0	4.0	3.0		1392,1083	4.1	1.0	17		3	13,6709		0,13,3348	no	coding-synonymous,coding-synonymous	AATK	NM_001080395.2,NM_004920.2	,	0,13,4905	AA,AG,GG		0.1934,0.0,0.1322	,	464/1375,361/1272	79096344	13,9823	1557	3361	4918	SO:0001819	synonymous_variant	9625	exon11			CAGCACGTCGTCG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1392C>T	17.37:g.79096344G>A		4	0		15	9	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Silent	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589373	0.28357	0.0	0.001934	ENSG00000181409	ENST00000417379	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	T	0.57080	0.2029	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54576	-0.8273	4	.	.	.	.	7.6056	0.28100	0.1928:0.0:0.8072:0.0	.	.	.	.	M	417	.	.	T	-	2	0	AATK	76710939	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.125000	0.31332	2.111000	0.64477	0.561000	0.74099	ACG	.		0.726	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
TSHZ1	10194	bcgsc.ca	37	18	72998268	72998268	+	Silent	SNP	T	T	C	rs3744909	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr18:72998268T>C	ENST00000580243.1	+	2	1254	c.906T>C	c.(904-906)gaT>gaC	p.D302D	TSHZ1_ENST00000322038.5_Silent_p.D257D			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	302					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GGAAGGAGGATGCCCAGAAGG	0.552													C|||	1432	0.285942	0.1778	0.3732	5008	,	,		19407	0.1677		0.4085	False		,,,				2504	0.3661				p.D257D		.											.	TSHZ1-90	0			c.T771C						.	C		911,3495	738.6+/-411.0	95,721,1387	140.0	113.0	122.0		771	-2.9	1.0	18	dbSNP_107	122	3455,5145	636.2+/-399.1	696,2063,1541	no	coding-synonymous	TSHZ1	NM_005786.4		791,2784,2928	CC,CT,TT		40.1744,20.6764,33.5691		257/1033	72998268	4366,8640	2203	4300	6503	SO:0001819	synonymous_variant	10194	exon2			GGAGGATGCCCAG	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.906T>C	18.37:g.72998268T>C		280	3		117	5	NM_005786	0	0	0	0	0	O60534|Q4LE29|Q53EU4	Silent	SNP	ENST00000580243.1	37																																																																																				T|0.676;C|0.324		0.552	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000444913.1	NM_005786	
MUC16	94025	bcgsc.ca	37	19	9003645	9003645	+	Missense_Mutation	SNP	G	G	A	rs11085777	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:9003645G>A	ENST00000397910.4	-	49	40198	c.39995C>T	c.(39994-39996)aCt>aTt	p.T13332I	MUC16_ENST00000380951.5_5'Flank	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	13334	SEA 9. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGCAGGTTAGTGATGGTAAA	0.488													g|||	1263	0.252196	0.0787	0.3617	5008	,	,		19044	0.2698		0.4135	False		,,,				2504	0.2249				p.T13332I		.											.	MUC16-566	0			c.C39995T						.	G	ILE/THR	527,3511		33,461,1525	231.0	189.0	203.0		39995	-2.8	0.0	19	dbSNP_120	203	3305,5071		659,1987,1542	yes	missense	MUC16	NM_024690.2	89	692,2448,3067	AA,AG,GG		39.458,13.051,30.8684	benign	13332/14508	9003645	3832,8582	2019	4188	6207	SO:0001583	missense	94025	exon49			AGGTTAGTGATGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.39995C>T	19.37:g.9003645G>A	ENSP00000381008:p.Thr13332Ile	284	0		341	11	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	673	0.30815018315018317	48	0.0975609756097561	140	0.3867403314917127	179	0.3129370629370629	306	0.40369393139841686	.	11.64	1.697732	0.30142	0.13051	0.39458	ENSG00000181143	ENST00000397910	T	0.51071	0.72	3.07	-2.8	0.05823	SEA (1);	.	.	.	.	T	0.00012	0.0000	L	0.59436	1.845	.	.	.	B;B	0.31485	0.001;0.325	B;B	0.36186	0.003;0.219	T	0.40059	-0.9583	8	0.87932	D	0	-0.4951	3.1321	0.06426	0.2283:0.0:0.4187:0.353	rs11085777	20977;13332	Q8WXI7;B5ME49	MUC16_HUMAN;.	I	13332	ENSP00000381008:T13332I	ENSP00000381008:T13332I	T	-	2	0	MUC16	8864645	0.137000	0.22531	0.017000	0.16124	0.000000	0.00434	-0.040000	0.12104	-0.543000	0.06240	-1.263000	0.01449	ACT	G|0.687;A|0.313		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NDUFB7	4713	bcgsc.ca	37	19	14677691	14677691	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:14677691C>T	ENST00000215565.2	-	2	228	c.167G>A	c.(166-168)cGg>cAg	p.R56Q		NM_004146.5	NP_004137.2	P17568	NDUB7_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa	56					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						GCAGTAGTCCCGCAGCTGGAG	0.657																																					p.R56Q		.											.	NDUFB7-91	0			c.G167A						.						51.0	41.0	45.0					19																	14677691		2192	4290	6482	SO:0001583	missense	4713	exon2			TAGTCCCGCAGCT		CCDS12314.1	19p13.12	2011-07-04	2002-08-29		ENSG00000099795	ENSG00000099795		"""Mitochondrial respiratory chain complex / Complex I"""	7702	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase B18 subunit"", ""complex I B18 subunit"""	603842	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 (18kD, B18)"""			9763677, 10830904	Standard	NM_004146		Approved	B18, CI-B18, MGC2480	uc002mzg.3	P17568		ENST00000215565.2:c.167G>A	19.37:g.14677691C>T	ENSP00000215565:p.Arg56Gln	47	0		67	4	NM_004146	0	0	775	775	0	Q6ICN9|Q9UI16	Missense_Mutation	SNP	ENST00000215565.2	37	CCDS12314.1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831854	0.71258	.	.	ENSG00000099795	ENST00000215565	T	0.65732	-0.17	4.76	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.81283	0.4790	M	0.92459	3.31	0.80722	D	1	D	0.76494	0.999	D	0.68353	0.957	D	0.84666	0.0709	10	0.87932	D	0	-15.5377	11.0056	0.47633	0.0:0.9081:0.0:0.0919	.	56	P17568	NDUB7_HUMAN	Q	56	ENSP00000215565:R56Q	ENSP00000215565:R56Q	R	-	2	0	NDUFB7	14538691	1.000000	0.71417	0.865000	0.33974	0.327000	0.28475	6.942000	0.75928	1.234000	0.43709	0.585000	0.79938	CGG	.		0.657	NDUFB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466025.1	NM_004146	
OR10H3	26532	bcgsc.ca	37	19	15852363	15852363	+	Missense_Mutation	SNP	G	G	A	rs11670007	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:15852363G>A	ENST00000305892.1	+	1	161	c.161G>A	c.(160-162)cGc>cAc	p.R54H		NM_013938.1	NP_039226.1	O60404	O10H3_HUMAN	olfactory receptor, family 10, subfamily H, member 3	54			R -> H (in dbSNP:rs11670007).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						TGGATTGAACGCAGACTCCAC	0.527													g|||	1308	0.261182	0.4319	0.2752	5008	,	,		23202	0.0119		0.3131	False		,,,				2504	0.2239				p.R54H		.											.	OR10H3-68	0			c.G161A						.	G	HIS/ARG	1796,2610		372,1052,779	413.0	362.0	379.0		161	-4.7	0.2	19	dbSNP_120	379	2472,6128		379,1714,2207	yes	missense	OR10H3	NM_013938.1	29	751,2766,2986	AA,AG,GG		28.7442,40.7626,32.8156	benign	54/317	15852363	4268,8738	2203	4300	6503	SO:0001583	missense	26532	exon1			TTGAACGCAGACT		CCDS12334.1	19p13.1	2012-08-09				ENSG00000171936		"""GPCR / Class A : Olfactory receptors"""	8174	protein-coding gene	gene with protein product							Standard	NM_013938		Approved		uc010xoq.2	O60404		ENST00000305892.1:c.161G>A	19.37:g.15852363G>A	ENSP00000307130:p.Arg54His	295	1		340	10	NM_013938	0	0	0	0	0	Q2HIZ3|Q6IFQ0	Missense_Mutation	SNP	ENST00000305892.1	37	CCDS12334.1	563	0.25778388278388276	198	0.4024390243902439	115	0.31767955801104975	11	0.019230769230769232	239	0.3153034300791557	.	0.009	-1.816832	0.00595	0.407626	0.287442	ENSG00000171936	ENST00000305892	T	0.01084	5.36	2.35	-4.7	0.03288	GPCR, rhodopsin-like superfamily (1);	0.910830	0.09011	N	0.861532	T	0.00012	0.0000	N	0.04820	-0.15	0.80722	P	0.0	B	0.06786	0.001	B	0.06405	0.002	T	0.27468	-1.0073	9	0.10636	T	0.68	.	6.0643	0.19854	0.213:0.265:0.522:0.0	rs11670007;rs52827169;rs61232867;rs11670007	54	O60404	O10H3_HUMAN	H	54	ENSP00000307130:R54H	ENSP00000307130:R54H	R	+	2	0	OR10H3	15713363	0.000000	0.05858	0.225000	0.23894	0.114000	0.19823	-2.725000	0.00808	-0.961000	0.03609	-1.125000	0.01998	CGC	G|0.700;A|0.300		0.527	OR10H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460918.1		
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000587352.1_5'Flank|ANKRD27_ENST00000306065.4_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	0	0		6	6	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
ACTN4	81	ucsc.edu;bcgsc.ca	37	19	39214253	39214253	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:39214253G>T	ENST00000252699.2	+	13	1518		c.e13-1		ACTN4_ENST00000424234.2_Splice_Site|ACTN4_ENST00000390009.3_Splice_Site	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4						actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCGGCCCGCAGCGAGCTGGAT	0.602																																					.	Colon(168;199 1940 10254 46213 46384)	.											.	ACTN4-90	0			c.1443-1G>T						.						36.0	30.0	32.0					19																	39214253		2203	4300	6503	SO:0001630	splice_region_variant	81	exon13			CCCGCAGCGAGCT	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.1443-1G>T	19.37:g.39214253G>T		440	2		560	135	NM_004924	0	0	0	15	15	A4K467|D6PXK4|O76048	Splice_Site	SNP	ENST00000252699.2	37	CCDS12518.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.416915	0.62511	.	.	ENSG00000130402	ENST00000252699;ENST00000445727;ENST00000424234;ENST00000390009	.	.	.	3.9	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1783	0.72934	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACTN4	43906093	1.000000	0.71417	0.959000	0.39883	0.768000	0.43524	9.585000	0.98223	2.176000	0.68965	0.561000	0.74099	.	.		0.602	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268091.1		Intron
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	CTC-360G5.8_ENST00000599996.1_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P|SARS2_ENST00000448145.2_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		0	0		7	5	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
CYP2A7	1549	bcgsc.ca	37	19	41386527	41386527	+	Missense_Mutation	SNP	G	G	A	rs58798281	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:41386527G>A	ENST00000301146.4	-	3	891	c.350C>T	c.(349-351)gCg>gTg	p.A117V	CTC-490E21.12_ENST00000601627.1_Intron|CYP2A7_ENST00000291764.3_Missense_Mutation_p.A66V	NM_000764.2	NP_000755.2	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 7	117						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GTTGCTGAACGCCACGCCTGG	0.697													.|||	2594	0.517971	0.4244	0.6729	5008	,	,		9286	0.4405		0.5169	False		,,,				2504	0.6155				p.A117V		.											.	CYP2A7-93	0			c.C350T						.						14.0	14.0	14.0					19																	41386527		2154	4177	6331	SO:0001583	missense	1549	exon3			CTGAACGCCACGC	NM_000764	CCDS12569.1, CCDS42570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000198077	ENSG00000198077		"""Cytochrome P450s"""	2611	protein-coding gene	gene with protein product		608054	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 7"""			7668294, 15128046	Standard	NM_030589		Approved	CYP2A	uc002opm.3	P20853	OTTHUMG00000182715	ENST00000301146.4:c.350C>T	19.37:g.41386527G>A	ENSP00000301146:p.Ala117Val	23	1		142	55	NM_000764	0	0	0	0	0	Q13121	Missense_Mutation	SNP	ENST00000301146.4	37	CCDS12569.1	919	0.4207875457875458	156	0.3170731707317073	218	0.6022099447513812	234	0.4090909090909091	311	0.4102902374670185	N	0.051	-1.248973	0.01469	.	.	ENSG00000198077	ENST00000301146;ENST00000291764	T;T	0.67865	-0.29;-0.29	2.16	1.06	0.20224	.	0.670270	0.14526	N	0.314179	T	0.00012	0.0000	N	0.04387	-0.21	0.80722	P	0.0	B;B;B	0.15473	0.013;0.011;0.001	B;B;B	0.17979	0.02;0.016;0.013	T	0.45279	-0.9272	9	0.08599	T	0.76	.	8.261	0.31786	0.2665:0.0:0.7335:0.0	rs58798281	117;66;117	B7ZKR0;F8W816;P20853	.;.;CP2A7_HUMAN	V	117;66	ENSP00000301146:A117V;ENSP00000291764:A66V	ENSP00000291764:A66V	A	-	2	0	CYP2A7	46078367	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.684000	0.05173	-0.117000	0.11872	-1.514000	0.00941	GCG	G|0.531;A|0.469		0.697	CYP2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463269.2	NM_030589	
POU2F2	5452	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42603760	42603760	+	Silent	SNP	C	C	T	rs375042716		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:42603760C>T	ENST00000526816.2	-	7	435	c.420G>A	c.(418-420)ccG>ccA	p.P140P	POU2F2_ENST00000389341.5_Silent_p.P140P|POU2F2_ENST00000560398.1_Silent_p.P162P|POU2F2_ENST00000533720.1_Silent_p.P140P|POU2F2_ENST00000560558.1_Silent_p.P101P|POU2F2_ENST00000529952.1_Silent_p.P140P|POU2F2_ENST00000342301.4_Silent_p.P140P|POU2F2_ENST00000529067.1_Silent_p.P140P			P09086	PO2F2_HUMAN	POU class 2 homeobox 2	140					cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	GATTTGGTGTCGGTAGCAGGC	0.602																																					p.P140P		.											.	POU2F2-227	0			c.G420A						.	C	,,	0,4406		0,0,2203	47.0	48.0	47.0		420,420,420	1.6	1.0	19		47	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	POU2F2	NM_001207025.1,NM_001207026.1,NM_002698.3	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	140/480,140/468,140/464	42603760	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5452	exon7			TGGTGTCGGTAGC		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.420G>A	19.37:g.42603760C>T		127	0		166	33	NM_002698	0	0	0	0	0	Q16648|Q7M4M8|Q9BRS4	Silent	SNP	ENST00000526816.2	37	CCDS56095.1																																																																																			.		0.602	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387329.3		
IRGQ	126298	hgsc.bcm.edu	37	19	44098975	44098975	+	Silent	SNP	T	T	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:44098975T>C	ENST00000602269.1	-	1	701	c.516A>G	c.(514-516)gcA>gcG	p.A172A	ZNF576_ENST00000529930.1_5'Flank|ZNF576_ENST00000391965.2_5'Flank|IRGQ_ENST00000601520.1_5'Flank|ZNF576_ENST00000533118.1_5'Flank|IRGQ_ENST00000422989.1_Silent_p.A172A|ZNF576_ENST00000528387.1_5'Flank|SRRM5_ENST00000526798.1_5'Flank|ZNF576_ENST00000525771.1_5'Flank|SRRM5_ENST00000607544.1_5'Flank|ZNF576_ENST00000336564.4_5'Flank|L34079.2_ENST00000594374.1_5'Flank			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	172										endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				GCAGCGCTTCTGCCTGGCTCT	0.662																																					p.A172A		.											.	IRGQ-92	0			c.A516G						.						20.0	22.0	22.0					19																	44098975		2201	4297	6498	SO:0001819	synonymous_variant	126298	exon2			CGCTTCTGCCTGG	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.516A>G	19.37:g.44098975T>C		6	0		59	8	NM_001007561	0	0	0	0	0	B2RNP3	Silent	SNP	ENST00000602269.1	37	CCDS33040.1																																																																																			.		0.662	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561	
ZNF226	7769	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	44680489	44680489	+	Silent	SNP	G	G	C	rs2178342	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:44680489G>C	ENST00000590089.1	+	7	1441	c.1074G>C	c.(1072-1074)acG>acC	p.T358T	ZNF226_ENST00000454662.2_Silent_p.T358T|ZNF226_ENST00000337433.5_Silent_p.T358T|ZNF226_ENST00000588883.1_3'UTR			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	358					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				AGGTCCACACGGCAGAGAAAC	0.468																																					p.T358T	Pancreas(115;581 1665 13228 19278 50070)	.											.	.	0			c.G1074C						.						89.0	96.0	94.0					19																	44680489		2198	4298	6496	SO:0001819	synonymous_variant	7769	exon6			CCACACGGCAGAG	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.1074G>C	19.37:g.44680489G>C		180	1		219	54	NM_001032372	0	0	6	9	3	Q8WWE6|Q96TE6|Q9NS44	Silent	SNP	ENST00000590089.1	37	CCDS46102.1																																																																																			G|0.865;A|0.135		0.468	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
ZNF814	730051	ucsc.edu	37	19	58384418	58384418	+	Silent	SNP	A	A	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:58384418A>G	ENST00000435989.2	-	3	2574	c.2340T>C	c.(2338-2340)tcT>tcC	p.S780S	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	780					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTTCAGCGAAAGATTTTCCAC	0.398																																					p.S780S		.											.	.	0			c.T2340C						.						73.0	61.0	65.0					19																	58384418		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			AGCGAAAGATTTT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2340T>C	19.37:g.58384418A>G		50	0		77	1	NM_001144989	0	0	21	26	5	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.398	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	ucsc.edu	37	19	58384712	58384712	+	Silent	SNP	A	A	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr19:58384712A>G	ENST00000435989.2	-	3	2280	c.2046T>C	c.(2044-2046)caT>caC	p.H682H	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	682					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTTCTCCAGTATGGCCATGCT	0.408																																					p.H682H		.											.	.	0			c.T2046C						.						68.0	57.0	60.0					19																	58384712		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			TCCAGTATGGCCA		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2046T>C	19.37:g.58384712A>G		163	0		223	1	NM_001144989	0	0	10	12	2	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.408	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
NRXN1	9378	hgsc.bcm.edu	37	2	51255090	51255090	+	Missense_Mutation	SNP	G	G	A	rs199784029	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr2:51255090G>A	ENST00000406316.2	-	2	1798	c.322C>T	c.(322-324)Ccg>Tcg	p.P108S	NRXN1_ENST00000402717.3_Missense_Mutation_p.P108S|NRXN1_ENST00000406859.3_Missense_Mutation_p.P108S|NRXN1_ENST00000401669.2_Missense_Mutation_p.P108S|NRXN1_ENST00000405472.3_Missense_Mutation_p.P108S|NRXN1_ENST00000404971.1_Missense_Mutation_p.P108S|NRXN1_ENST00000405581.1_Missense_Mutation_p.P108S	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	108	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TCGTTAACCGGCGTGTCGGCC	0.657													G|||	7	0.00139776	0.0045	0.0	5008	,	,		13666	0.0		0.001	False		,,,				2504	0.0				p.P108S		.											.	NRXN1-92	0			c.C322T						.	G	SER/PRO,SER/PRO	15,4085		0,15,2035	20.0	25.0	24.0		322,322	5.0	1.0	2		24	3,8369		0,3,4183	no	missense,missense	NRXN1	NM_001135659.1,NM_004801.4	74,74	0,18,6218	AA,AG,GG		0.0358,0.3659,0.1443	benign,benign	108/1548,108/1478	51255090	18,12454	2050	4186	6236	SO:0001583	missense	9378	exon2			TAACCGGCGTGTC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.322C>T	2.37:g.51255090G>A	ENSP00000384311:p.Pro108Ser	0	0		9	8	NM_004801	0	0	0	0	0	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	37	CCDS54360.1	3	0.0013736263736263737	3	0.006097560975609756	0	0.0	0	0.0	0	0.0	G	5.865	0.343846	0.11126	0.003659	3.58E-4	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	T;T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	4.97	4.97	0.65823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.179601	0.22887	U	0.054427	T	0.57725	0.2073	L	0.31526	0.94	0.28038	N	0.933868	B;B;B	0.24823	0.007;0.112;0.012	B;B;B	0.28232	0.026;0.087;0.006	T	0.49041	-0.8980	10	0.09338	T	0.73	.	13.0678	0.59043	0.0:0.3018:0.6982:0.0	.	108;108;108	Q9ULB1-3;F8WB18;Q9ULB1	.;.;NRX1A_HUMAN	S	108	ENSP00000385142:P108S;ENSP00000384311:P108S;ENSP00000434015:P108S;ENSP00000385017:P108S;ENSP00000385434:P108S;ENSP00000385681:P108S;ENSP00000385310:P108S	ENSP00000385017:P108S	P	-	1	0	NRXN1	51108594	0.952000	0.32445	0.990000	0.47175	0.392000	0.30506	1.982000	0.40638	2.293000	0.77203	0.563000	0.77884	CCG	G|0.999;A|0.001		0.657	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
TEKT4	150483	hgsc.bcm.edu	37	2	95539831	95539831	+	Missense_Mutation	SNP	T	T	C	rs199573327		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr2:95539831T>C	ENST00000295201.4	+	3	828	c.691T>C	c.(691-693)Tac>Cac	p.Y231H	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	231					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						GGCTCATCCGTACTCCACCAC	0.667																																					p.Y231H		.											.	TEKT4-155	0			c.T691C						.						74.0	71.0	72.0					2																	95539831		2203	4300	6503	SO:0001583	missense	150483	exon3			CATCCGTACTCCA	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.691T>C	2.37:g.95539831T>C	ENSP00000295201:p.Tyr231His	169	0		120	12	NM_144705	0	0	0	0	0		Missense_Mutation	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	5.627	0.300387	0.10678	.	.	ENSG00000163060	ENST00000295201	T	0.02345	4.33	2.24	-1.96	0.07525	.	0.327469	0.33813	N	0.004535	T	0.00845	0.0028	N	0.00801	-1.175	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.55860	-0.8074	10	0.35671	T	0.21	-21.4175	3.0502	0.06167	0.1905:0.3928:0.0:0.4167	.	231	Q8WW24	TEKT4_HUMAN	H	231	ENSP00000295201:Y231H	ENSP00000295201:Y231H	Y	+	1	0	TEKT4	94903558	0.993000	0.37304	0.023000	0.16930	0.013000	0.08279	1.214000	0.32419	-1.071000	0.03145	-0.818000	0.03119	TAC	T|0.998;C|0.002		0.667	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
IL1RL1	9173	bcgsc.ca	37	2	102968007	102968007	+	Missense_Mutation	SNP	G	G	A	rs4988956	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr2:102968007G>A	ENST00000233954.1	+	11	1568	c.1297G>A	c.(1297-1299)Gca>Aca	p.A433T		NM_016232.4	NP_057316.3	Q01638	ILRL1_HUMAN	interleukin 1 receptor-like 1	433	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.		A -> T (in dbSNP:rs4988956). {ECO:0000269|PubMed:10936050}.		immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of macrophage activation (GO:0043032)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|interleukin-1 receptor activity (GO:0004908)|interleukin-33 receptor activity (GO:0002114)|receptor signaling protein activity (GO:0005057)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(3)|urinary_tract(1)	16						TGTAGTCACTGCAGTGGAAAC	0.393													g|||	1930	0.385383	0.7542	0.2853	5008	,	,		19832	0.126		0.4046	False		,,,				2504	0.2055				p.A433T		.											.	IL1RL1-517	0			c.G1297A						.	G	THR/ALA	3105,1301		1100,905,198	72.0	70.0	71.0		1297	2.3	0.0	2	dbSNP_113	71	3346,5254		667,2012,1621	yes	missense	IL1RL1	NM_016232.4	58	1767,2917,1819	AA,AG,GG		38.907,29.5279,49.6002	possibly-damaging	433/557	102968007	6451,6555	2203	4300	6503	SO:0001583	missense	9173	exon11			GTCACTGCAGTGG	D12764	CCDS2057.1, CCDS2058.1, CCDS74548.1	2q12	2013-01-29			ENSG00000115602	ENSG00000115602		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5998	protein-coding gene	gene with protein product	"""homolog of mouse growth stimulation-expressed"""	601203				1482686, 10191101, 16286016	Standard	NM_016232		Approved	ST2, FIT-1, ST2L, ST2V, DER4, T1, IL33R	uc002tbu.1	Q01638	OTTHUMG00000130782	ENST00000233954.1:c.1297G>A	2.37:g.102968007G>A	ENSP00000233954:p.Ala433Thr	217	2		149	8	NM_016232	0	0	0	0	0	A8K6B3|B4E0I3|Q53TU7|Q8NEJ3|Q9ULV7|Q9UQ44	Missense_Mutation	SNP	ENST00000233954.1	37	CCDS2057.1	881	0.4033882783882784	373	0.758130081300813	111	0.30662983425414364	86	0.15034965034965034	311	0.4102902374670185	.	11.74	1.729188	0.30684	0.704721	0.38907	ENSG00000115602	ENST00000233954	T	0.07908	3.15	5.14	2.35	0.29111	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.359848	0.25564	N	0.029816	T	0.00012	0.0000	M	0.68952	2.095	0.58432	P	6.999999999979245E-6	P	0.39883	0.693	B	0.35353	0.201	T	0.04140	-1.0974	9	0.51188	T	0.08	.	6.5963	0.22674	0.1505:0.0:0.7065:0.143	rs4988956;rs52818139;rs4988956	433	Q01638	ILRL1_HUMAN	T	433	ENSP00000233954:A433T	ENSP00000233954:A433T	A	+	1	0	IL1RL1	102334439	0.014000	0.17966	0.005000	0.12908	0.681000	0.39784	1.282000	0.33226	0.186000	0.20125	0.455000	0.32223	GCA	G|0.541;A|0.459		0.393	IL1RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253296.1	NM_016232	
TUBA3E	112714	broad.mit.edu	37	2	130951625	130951625	+	Frame_Shift_Del	DEL	G	G	-	rs76767502	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr2:130951625delG	ENST00000312988.7	-	4	890	c.790delC	c.(790-792)cgcfs	p.R264fs		NM_207312.2	NP_997195	Q6PEY2	TBA3E_HUMAN	tubulin, alpha 3e	264					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|kidney(7)|large_intestine(6)|lung(9)|skin(2)	28	Colorectal(110;0.1)					AAGTGGATGCGGGGGTACGGC	0.602																																					p.R264fs		.											.	TUBA3E-69	0			c.790delC						.						179.0	132.0	148.0					2																	130951625		2203	4300	6503	SO:0001589	frameshift_variant	112714	exon4			GGATGCGGGGGTA	BC057811	CCDS2158.1	2q21.1	2007-03-16			ENSG00000152086	ENSG00000152086		"""Tubulins"""	20765	protein-coding gene	gene with protein product							Standard	NM_207312		Approved		uc002tqv.3	Q6PEY2	OTTHUMG00000131626	ENST00000312988.7:c.790delC	2.37:g.130951625delG	ENSP00000318197:p.Arg264fs	492	0		383	8	NM_207312	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000312988.7	37	CCDS2158.1																																																																																			.		0.602	TUBA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254519.1	NM_207312	
TTN	7273	bcgsc.ca	37	2	179558366	179558366	+	Missense_Mutation	SNP	T	T	C	rs2042995	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr2:179558366T>C	ENST00000591111.1	-	117	30837	c.30613A>G	c.(30613-30615)Att>Gtt	p.I10205V	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.I9278V|TTN_ENST00000589042.1_Missense_Mutation_p.I10522V|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.			I -> V (in Ref. 3; CAD12456 and 9; AAP80791). {ECO:0000305}.	adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTTGGAAATGGCAACGTGA	0.308													C|||	2393	0.477835	0.5877	0.4193	5008	,	,		17705	0.5685		0.2455	False		,,,				2504	0.5164				p.I10522V		.											.	TTN-636	0			c.A31564G						.	C	,VAL/ILE,,	2003,1581		579,845,368	60.0	62.0	61.0		,27832,,	5.8	1.0	2	dbSNP_94	61	1858,6270		194,1470,2400	yes	intron,missense,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,29,,	773,2315,2768	CC,CT,TT		22.8593,44.1127,32.9662	,benign,,	,9278/33424,,	179558366	3861,7851	1792	4064	5856	SO:0001583	missense	7273	exon119			TGGAAATGGCAAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.30613A>G	2.37:g.179558366T>C	ENSP00000465570:p.Ile10205Val	118	1		86	5	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		910	0.4166666666666667	287	0.5833333333333334	133	0.3674033149171271	306	0.534965034965035	184	0.24274406332453827	C	0.877	-0.730053	0.03135	0.558873	0.228593	ENSG00000155657	ENST00000342992;ENST00000414766;ENST00000473181	T	0.60548	0.18	5.85	5.85	0.93711	.	.	.	.	.	T	0.00012	0.0000	N	0.00960	-1.095	0.09310	P	0.9999999999343484	.	.	.	.	.	.	T	0.29027	-1.0025	6	0.87932	D	0	.	9.3114	0.37908	0.0:0.8379:0.0:0.1621	rs2042995;rs56726642;rs2042995	.	.	.	V	9278;400;32	ENSP00000343764:I9278V	ENSP00000343764:I9278V	I	-	1	0	TTN	179266611	0.947000	0.32204	1.000000	0.80357	0.933000	0.57130	1.140000	0.31516	1.498000	0.48600	-0.128000	0.14901	ATT	T|0.582;C|0.418		0.308	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
SH3BP4	23677	bcgsc.ca	37	2	235951819	235951819	+	Silent	SNP	A	A	G	rs3795962	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr2:235951819A>G	ENST00000409212.1	+	4	2913	c.2406A>G	c.(2404-2406)ctA>ctG	p.L802L	SH3BP4_ENST00000392011.2_Silent_p.L802L|SH3BP4_ENST00000344528.4_Silent_p.L802L			Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	802					cellular response to amino acid stimulus (GO:0071230)|endocytosis (GO:0006897)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of GTPase activity (GO:0034260)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|protein localization to lysosome (GO:0061462)|regulation of catalytic activity (GO:0050790)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	GDP-dissociation inhibitor activity (GO:0005092)|identical protein binding (GO:0042802)|Ras GTPase binding (GO:0017016)	p.L802L(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(6)|stomach(3)|urinary_tract(2)	44		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		CGTCCGTCCTAGAAAAGCTGA	0.587													G|||	3767	0.752196	0.9576	0.6499	5008	,	,		22177	0.9157		0.4612	False		,,,				2504	0.6779				p.L802L		.											.	SH3BP4-94	1	Substitution - coding silent(1)	prostate(1)	c.A2406G						.	G		3881,525	224.3+/-240.5	1716,449,38	46.0	46.0	46.0		2406	2.0	1.0	2	dbSNP_107	46	3994,4606	566.4+/-388.7	926,2142,1232	no	coding-synonymous	SH3BP4	NM_014521.2		2642,2591,1270	GG,GA,AA		46.4419,11.9156,39.451		802/964	235951819	7875,5131	2203	4300	6503	SO:0001819	synonymous_variant	23677	exon4			CGTCCTAGAAAAG	AF147747	CCDS2513.1	2q37.1-q37.2	2008-05-15			ENSG00000130147	ENSG00000130147			10826	protein-coding gene	gene with protein product		605611				10644451	Standard	NM_014521		Approved		uc002vvp.3	Q9P0V3	OTTHUMG00000133292	ENST00000409212.1:c.2406A>G	2.37:g.235951819A>G		379	4		217	7	NM_014521	0	0	2	2	0	O95082|Q309A3|Q53QD0|Q53TD1	Silent	SNP	ENST00000409212.1	37	CCDS2513.1																																																																																			G|0.647;N|0.001		0.587	SH3BP4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329763.1		
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		.											.	KIF1A-91	0			c.G2751T						.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		167	0		251	15	NM_001244008	0	0	0	0	0	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
FAM182B	728882	broad.mit.edu	37	20	25755549	25755549	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr20:25755549C>A	ENST00000376403.1	-	3	785	c.407G>T	c.(406-408)gGc>gTc	p.G136V	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	136										lung(1)	1						TGGTCTGCAGCCTTCCTGGGA	0.716																																					.		.											.	.	0			.						.																																			SO:0001583	missense	728882	.			CTGCAGCCTTCCT			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.407G>T	20.37:g.25755549C>A	ENSP00000365585:p.Gly136Val	16	0		68	3	.	0	0	1	1	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	1.024	-0.684035	0.03353	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	V	136	.	ENSP00000365585:G136V	G	-	2	0	FAM182B	25703549	0.129000	0.22400	0.158000	0.22627	0.158000	0.22134	-0.337000	0.07852	0.064000	0.16427	0.064000	0.15345	GGC	.		0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
KCNS1	3787	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	43727858	43727858	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr20:43727858C>T	ENST00000306117.1	-	3	416	c.20G>A	c.(19-21)cGg>cAg	p.R7Q	KCNS1_ENST00000537075.1_Missense_Mutation_p.R7Q	NM_002251.3	NP_002242.2	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1	7					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(1)|lung(3)|ovary(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				gtgtgttccccggaccagcag	0.493																																					p.R7Q		.											.	KCNS1-90	0			c.G20A						.						91.0	77.0	82.0					20																	43727858		1327	2309	3636	SO:0001583	missense	3787	exon3			GTTCCCCGGACCA	AF043473	CCDS13342.1	20q12	2011-07-05			ENSG00000124134	ENSG00000124134		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6300	protein-coding gene	gene with protein product		602905				9305895, 16382104	Standard	NM_002251		Approved	Kv9.1	uc002xnc.3	Q96KK3	OTTHUMG00000033079	ENST00000306117.1:c.20G>A	20.37:g.43727858C>T	ENSP00000307694:p.Arg7Gln	102	0		110	19	NM_002251	0	0	0	0	0	A2RUL9|B7ZM31|O43652|Q6DJU6	Missense_Mutation	SNP	ENST00000306117.1	37	CCDS13342.1	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102714	0.56183	.	.	ENSG00000124134	ENST00000306117;ENST00000537075	D;D	0.96522	-4.04;-4.04	4.47	0.257	0.15574	.	5.843670	0.00166	N	0.000006	D	0.89639	0.6773	N	0.08118	0	0.21147	N	0.999777	B	0.02656	0.0	B	0.01281	0.0	T	0.81731	-0.0799	10	0.36615	T	0.2	.	2.8714	0.05618	0.1879:0.2842:0.0:0.528	.	7	Q96KK3	KCNS1_HUMAN	Q	7	ENSP00000307694:R7Q;ENSP00000445595:R7Q	ENSP00000307694:R7Q	R	-	2	0	KCNS1	43161272	0.009000	0.17119	0.834000	0.33040	0.662000	0.39071	0.055000	0.14229	-0.065000	0.13021	0.655000	0.94253	CGG	.		0.493	KCNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080507.3	NM_002251	
SYCP2	10388	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	20	58441568	58441568	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr20:58441568T>G	ENST00000357552.3	-	40	4427	c.4202A>C	c.(4201-4203)cAt>cCt	p.H1401P	SYCP2_ENST00000371001.2_Missense_Mutation_p.H1401P			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1401					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CTGACTTTGATGATTCATTGT	0.308																																					p.H1401P		.											.	SYCP2-525	0			c.A4202C						.						86.0	89.0	88.0					20																	58441568		2203	4297	6500	SO:0001583	missense	10388	exon39			CTTTGATGATTCA	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.4202A>C	20.37:g.58441568T>G	ENSP00000350162:p.His1401Pro	38	0		42	9	NM_014258	0	0	1	1	0	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	37	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	T	3.901	-0.021981	0.07634	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000412613	T;T	0.14144	2.53;2.53	5.3	0.456	0.16655	.	1.217600	0.05561	N	0.569286	T	0.11281	0.0275	L	0.29908	0.895	0.09310	N	1	P	0.43094	0.799	B	0.41764	0.366	T	0.28618	-1.0038	10	0.36615	T	0.2	-0.0944	5.2926	0.15735	0.0:0.288:0.2656:0.4463	.	1401	Q9BX26	SYCP2_HUMAN	P	1401;1401;87	ENSP00000360040:H1401P;ENSP00000350162:H1401P	ENSP00000350162:H1401P	H	-	2	0	SYCP2	57874963	0.000000	0.05858	0.001000	0.08648	0.374000	0.29953	-0.171000	0.09883	0.084000	0.17077	-0.385000	0.06624	CAT	.		0.308	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
BAGE2	85319	bcgsc.ca	37	21	11058322	11058322	+	RNA	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr21:11058322C>T	ENST00000470054.1	-	0	325							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAATGCACATCGCTGAAAGGG	0.383																																					p.D40N		.											.	.	0			c.G118A						.						92.0	70.0	77.0					21																	11058322		692	1591	2283			85319	exon3			GCACATCGCTGAA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058322C>T		331	5		331	11	NM_182482	0	0	0	0	0	A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	37																																																																																				C|0.750;T|0.250		0.383	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
COL6A1	1291	broad.mit.edu	37	21	47401845	47401850	+	In_Frame_Del	DEL	GGCCGT	GGCCGT	-	rs373932797		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr21:47401845_47401850delGGCCGT	ENST00000361866.3	+	1	195_200	c.81_86delGGCCGT	c.(79-87)agggccgtg>agg	p.AV28del		NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	28	N-terminal globular domain.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		AGACCCCGAGGGCCGTGGCCTTCCAG	0.733																																					p.27_29del		.											.	COL6A1-91	0			c.81_86del						.																																			SO:0001651	inframe_deletion	1291	exon1			CCCGAGGGCCGTG	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.81_86delGGCCGT	21.37:g.47401845_47401850delGGCCGT	ENSP00000355180:p.Ala28_Val29del	9	0		120	8	NM_001848	0	0	0	0	0	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	In_Frame_Del	DEL	ENST00000361866.3	37	CCDS13727.1																																																																																			.		0.733	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848	
TFIP11	24144	bcgsc.ca	37	22	26888060	26888060	+	Silent	SNP	G	G	A	rs17850763	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr22:26888060G>A	ENST00000407690.1	-	15	2716	c.2433C>T	c.(2431-2433)atC>atT	p.I811I	TFIP11_ENST00000407431.1_Silent_p.I811I|TFIP11_ENST00000407148.1_Silent_p.I811I|TFIP11_ENST00000405938.1_Silent_p.I811I|SRRD_ENST00000215917.7_3'UTR	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	811					biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						CTCCCCGGTCGATGTAGATCA	0.567													G|||	90	0.0179712	0.0182	0.0259	5008	,	,		21368	0.002		0.0278	False		,,,				2504	0.0184				p.I811I		.											.	TFIP11-90	0			c.C2433T						.	G	,	80,4326	69.8+/-107.6	0,80,2123	115.0	75.0	89.0		2433,2433	-3.2	1.0	22	dbSNP_123	89	336,8264	115.5+/-175.4	7,322,3971	no	coding-synonymous,coding-synonymous	TFIP11	NM_001008697.1,NM_012143.2	,	7,402,6094	AA,AG,GG		3.907,1.8157,3.1985	,	811/838,811/838	26888060	416,12590	2203	4300	6503	SO:0001819	synonymous_variant	24144	exon16			CCGGTCGATGTAG	AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.2433C>T	22.37:g.26888060G>A		388	5		158	9	NM_001008697	0	0	18	18	0	O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Silent	SNP	ENST00000407690.1	37	CCDS13838.1																																																																																			G|0.972;A|0.028		0.567	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320750.1	NM_001008697	
TRANK1	9881	broad.mit.edu	37	3	36874077	36874077	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr3:36874077C>A	ENST00000429976.2	-	21	7112	c.6865G>T	c.(6865-6867)Gcc>Tcc	p.A2289S	TRANK1_ENST00000428977.2_Missense_Mutation_p.A1739S|TRANK1_ENST00000301807.6_Missense_Mutation_p.A1739S	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2289							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)	p.A1739S(1)|p.A1732S(1)|p.A2289S(1)		NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GCTTGCATGGCACTCAGCCAC	0.498																																					p.A2289S		.											.	TRANK1-24	3	Substitution - Missense(3)	skin(3)	c.G6865T						.						67.0	66.0	66.0					3																	36874077		1872	4114	5986	SO:0001583	missense	9881	exon21			GCATGGCACTCAG	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.6865G>T	3.37:g.36874077C>A	ENSP00000416168:p.Ala2289Ser	51	2		69	6	NM_014831	0	0	0	0	0	Q8N8K0	Missense_Mutation	SNP	ENST00000429976.2	37	CCDS46789.2	.	.	.	.	.	.	.	.	.	.	C	18.51	3.639597	0.67244	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.34472	1.36;1.77;1.36	5.16	5.16	0.70880	.	0.000000	0.53938	D	0.000060	T	0.37945	0.1022	L	0.32530	0.975	0.39272	D	0.964402	D	0.58620	0.983	P	0.51016	0.656	T	0.24799	-1.0150	10	0.52906	T	0.07	.	13.3639	0.60671	0.0:0.9239:0.0:0.0761	.	2289	O15050	TRNK1_HUMAN	S	1739;2289;1739	ENSP00000416826:A1739S;ENSP00000416168:A2289S;ENSP00000301807:A1739S	ENSP00000301807:A1739S	A	-	1	0	TRANK1	36849081	0.921000	0.31238	1.000000	0.80357	0.984000	0.73092	1.795000	0.38784	2.574000	0.86865	0.561000	0.74099	GCC	.		0.498	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_014831	
TGM4	7047	bcgsc.ca	37	3	44926931	44926931	+	Missense_Mutation	SNP	G	G	A	rs115097986		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr3:44926931G>A	ENST00000296125.4	+	2	202	c.134G>A	c.(133-135)cGg>cAg	p.R45Q		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	45					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TTTCACCTGCGGCTGGTGCTG	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		18564	0.0		0.001	False		,,,				2504	0.0				p.R45Q		.											.	TGM4-91	0			c.G134A						.						61.0	63.0	63.0					3																	44926931		2203	4300	6503	SO:0001583	missense	7047	exon2			ACCTGCGGCTGGT	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.134G>A	3.37:g.44926931G>A	ENSP00000296125:p.Arg45Gln	277	3		234	7	NM_003241	0	0	0	0	0	Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	37	CCDS2723.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	17.93	3.510249	0.64522	.	.	ENSG00000163810	ENST00000296125	D	0.84730	-1.89	2.77	-1.49	0.08718	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.685215	0.10877	U	0.624250	T	0.64360	0.2591	N	0.19112	0.55	0.09310	N	1	B;B	0.32188	0.295;0.359	B;B	0.23419	0.022;0.046	T	0.55560	-0.8122	10	0.05525	T	0.97	.	6.2147	0.20648	0.6365:0.0:0.3635:0.0	.	45;45	P49221;B4YUQ1	TGM4_HUMAN;.	Q	45	ENSP00000296125:R45Q	ENSP00000296125:R45Q	R	+	2	0	TGM4	44901935	0.000000	0.05858	0.001000	0.08648	0.719000	0.41307	-0.226000	0.09139	-0.298000	0.08921	0.467000	0.42956	CGG	G|0.999;A|0.001		0.557	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241	
FYCO1	79443	bcgsc.ca	37	3	46008087	46008087	+	Silent	SNP	G	G	A	rs13079869	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr3:46008087G>A	ENST00000296137.2	-	8	2944	c.2739C>T	c.(2737-2739)tgC>tgT	p.C913C	FYCO1_ENST00000535325.1_Silent_p.C913C	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	913					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CGGTCAGTGCGCAAACCTGGA	0.632													G|||	529	0.105631	0.0076	0.0605	5008	,	,		20768	0.004		0.1223	False		,,,				2504	0.3579				p.C913C		.											.	FYCO1-91	0			c.C2739T						.	G		109,4297	83.9+/-122.4	0,109,2094	50.0	47.0	48.0		2739	-5.3	0.0	3	dbSNP_121	48	947,7653	205.8+/-248.1	48,851,3401	no	coding-synonymous	FYCO1	NM_024513.2		48,960,5495	AA,AG,GG		11.0116,2.4739,8.1193		913/1479	46008087	1056,11950	2203	4300	6503	SO:0001819	synonymous_variant	79443	exon8			CAGTGCGCAAACC	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2739C>T	3.37:g.46008087G>A		146	1		172	6	NM_024513	0	0	0	0	0	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Silent	SNP	ENST00000296137.2	37	CCDS2734.1																																																																																			G|0.920;A|0.080		0.632	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
BOC	91653	bcgsc.ca	37	3	112991312	112991312	+	Silent	SNP	C	C	T	rs3814398	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr3:112991312C>T	ENST00000495514.1	+	7	1427	c.723C>T	c.(721-723)atC>atT	p.I241I	BOC_ENST00000355385.3_Silent_p.I241I|BOC_ENST00000273395.4_Silent_p.I241I			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	241	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			AAACCATCATCGTCACCAAAG	0.627													C|||	1386	0.276757	0.2073	0.3732	5008	,	,		18873	0.3978		0.1879	False		,,,				2504	0.2689				p.I241I		.											.	BOC-157	0			c.C723T						.	C		902,3504	348.0+/-309.7	94,714,1395	162.0	154.0	157.0		723	-5.9	0.9	3	dbSNP_107	157	1332,7268	261.2+/-283.7	111,1110,3079	no	coding-synonymous	BOC	NM_033254.2		205,1824,4474	TT,TC,CC		15.4884,20.4721,17.1767		241/1115	112991312	2234,10772	2203	4300	6503	SO:0001819	synonymous_variant	91653	exon7			CATCATCGTCACC	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.723C>T	3.37:g.112991312C>T		235	2		232	8	NM_033254	0	0	0	0	0	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	ENST00000495514.1	37	CCDS2971.1																																																																																			C|0.788;T|0.212		0.627	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
SMC4	10051	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	160148837	160148837	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr3:160148837C>G	ENST00000357388.3	+	20	3409	c.2958C>G	c.(2956-2958)atC>atG	p.I986M	SMC4_ENST00000462787.1_Intron|SMC4_ENST00000469762.1_Missense_Mutation_p.I961M|SMC4_ENST00000344722.5_Missense_Mutation_p.I986M|SMC4_ENST00000360111.2_Intron|RP11-432B6.3_ENST00000483754.1_Intron	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	986					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TACCAGAGATCCAGAAAGAAC	0.333																																					p.I986M		.											.	SMC4-291	0			c.C2958G						.						51.0	54.0	53.0					3																	160148837		2203	4297	6500	SO:0001583	missense	10051	exon19			AGAGATCCAGAAA	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2958C>G	3.37:g.160148837C>G	ENSP00000349961:p.Ile986Met	114	0		156	48	NM_005496	0	0	17	19	2	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	37	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	C	10.82	1.459415	0.26248	.	.	ENSG00000113810	ENST00000357388;ENST00000469762;ENST00000344722;ENST00000545277	T;T;T	0.78481	-1.18;-0.85;-1.18	5.94	3.22	0.36961	RecF/RecN/SMC (1);	0.150854	0.64402	D	0.000017	T	0.65626	0.2709	N	0.16790	0.44	0.80722	D	1	B;P;B	0.43542	0.014;0.81;0.075	B;P;B	0.48030	0.102;0.564;0.076	T	0.59653	-0.7414	10	0.35671	T	0.21	-3.016	6.0816	0.19944	0.0:0.5486:0.1214:0.33	.	961;961;986	B3KXX5;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	M	986;961;986;580	ENSP00000349961:I986M;ENSP00000417964:I961M;ENSP00000341382:I986M	ENSP00000341382:I986M	I	+	3	3	SMC4	161631531	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	1.099000	0.31013	0.427000	0.26145	0.650000	0.86243	ATC	.		0.333	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
ZFYVE28	57732	bcgsc.ca	37	4	2275835	2275835	+	Silent	SNP	G	G	A	rs2051561	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:2275835G>A	ENST00000290974.2	-	9	2499	c.2160C>T	c.(2158-2160)ttC>ttT	p.F720F	ZFYVE28_ENST00000515312.1_Silent_p.F650F|ZFYVE28_ENST00000508471.1_Silent_p.F25F|ZFYVE28_ENST00000511071.1_Silent_p.F690F	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	720					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						GGCTGCCGTGGAACCTGGACC	0.642													G|||	1784	0.35623	0.3623	0.513	5008	,	,		14371	0.12		0.5427	False		,,,				2504	0.2883				p.F720F		.											.	ZFYVE28-93	0			c.C2160T						.	G	,,	1557,2849	487.6+/-361.0	256,1045,902	136.0	119.0	125.0		2070,1950,2160	2.8	1.0	4	dbSNP_94	125	4616,3984	599.4+/-394.1	1260,2096,944	no	coding-synonymous,coding-synonymous,coding-synonymous	ZFYVE28	NM_001172656.1,NM_001172659.1,NM_020972.2	,,	1516,3141,1846	AA,AG,GG		46.3256,35.3382,47.4627	,,	690/858,650/818,720/888	2275835	6173,6833	2203	4300	6503	SO:0001819	synonymous_variant	57732	exon9			GCCGTGGAACCTG	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.2160C>T	4.37:g.2275835G>A		274	2		210	9	NM_020972	0	0	14	14	0	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	ENST00000290974.2	37	CCDS33942.1																																																																																			G|0.576;A|0.424		0.642	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000360078.1	XM_035371	
RGS12	6002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	3388163	3388163	+	Splice_Site	SNP	C	C	T	rs147432997	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:3388163C>T	ENST00000344733.5	+	4	2923	c.2019C>T	c.(2017-2019)ggC>ggT	p.G673G	RGS12_ENST00000382788.3_Splice_Site_p.G673G|RGS12_ENST00000538395.1_Splice_Site_p.G15G|RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000306648.7_Splice_Site_p.G71G|RGS12_ENST00000336727.3_Splice_Site_p.G673G|RGS12_ENST00000338806.4_Splice_Site_p.G25G|RGS12_ENST00000543385.1_Intron	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	673					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGTCTGATGGCGGTAAGTCAC	0.373													C|||	3	0.000599042	0.0	0.0	5008	,	,		19773	0.0		0.003	False		,,,				2504	0.0				p.G673G		.											.	RGS12-226	0			c.C2019T						.	C	,,	1,4405	2.1+/-5.4	0,1,2202	155.0	143.0	147.0		2019,75,2019	-3.0	1.0	4	dbSNP_134	147	11,8589	8.4+/-32.0	0,11,4289	yes	coding-synonymous-near-splice,coding-synonymous-near-splice,coding-synonymous-near-splice	RGS12	NM_002926.3,NM_198227.1,NM_198229.2	,,	0,12,6491	TT,TC,CC		0.1279,0.0227,0.0923	,,	673/1377,25/800,673/1448	3388163	12,12994	2203	4300	6503	SO:0001630	splice_region_variant	6002	exon4			TGATGGCGGTAAG	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2020+1C>T	4.37:g.3388163C>T		36	0		54	14	NM_002926	0	0	0	0	0	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Silent	SNP	ENST00000344733.5	37	CCDS3366.1																																																																																			C|0.999;T|0.001		0.373	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	Silent
ATP8A1	10396	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	42466787	42466787	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:42466787G>A	ENST00000381668.5	-	27	2770	c.2539C>T	c.(2539-2541)Cat>Tat	p.H847Y	ATP8A1_ENST00000264449.10_Missense_Mutation_p.H832Y	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	847					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	CAGGCACCATGAATCATCAGT	0.333																																					p.H847Y		.											.	ATP8A1-92	0			c.C2539T						.						73.0	79.0	77.0					4																	42466787		2203	4300	6503	SO:0001583	missense	10396	exon27			CACCATGAATCAT	AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.2539C>T	4.37:g.42466787G>A	ENSP00000371084:p.His847Tyr	127	0		152	37	NM_006095	0	0	1	1	0	Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	ENST00000381668.5	37	CCDS3466.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.573240	0.86542	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.74842	-0.88;-0.88	5.15	5.15	0.70609	HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.90287	0.6962	H	0.95816	3.725	0.80722	D	1	D;D;D	0.69078	0.975;0.997;0.997	P;D;D	0.68039	0.809;0.955;0.955	D	0.93096	0.6504	10	0.87932	D	0	.	19.0038	0.92842	0.0:0.0:1.0:0.0	.	832;847;839	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	Y	847;832	ENSP00000371084:H847Y;ENSP00000264449:H832Y	ENSP00000264449:H832Y	H	-	1	0	ATP8A1	42161544	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.888000	0.87302	2.561000	0.86390	0.460000	0.39030	CAT	.		0.333	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216861.2	NM_006095	
HERC3	8916	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	89589214	89589214	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:89589214A>T	ENST00000402738.1	+	14	1854	c.1615A>T	c.(1615-1617)Aac>Tac	p.N539Y	HERC3_ENST00000264345.3_Missense_Mutation_p.N539Y|HERC3_ENST00000543130.1_Intron	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	539					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GCTGGATACAAACCCCAGCAA	0.408																																					p.N539Y		.											.	HERC3-660	0			c.A1615T						.						97.0	91.0	93.0					4																	89589214		2203	4300	6503	SO:0001583	missense	8916	exon14			GATACAAACCCCA	D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.1615A>T	4.37:g.89589214A>T	ENSP00000385684:p.Asn539Tyr	52	0		51	7	NM_014606	0	0	2	2	0	A8K1S5|Q8IXX3	Missense_Mutation	SNP	ENST00000402738.1	37	CCDS34028.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.276516	0.80580	.	.	ENSG00000138641	ENST00000402738;ENST00000264345	T;T	0.42131	0.98;0.98	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.54351	0.1853	L	0.61218	1.895	0.80722	D	1	D	0.60575	0.988	P	0.53722	0.733	T	0.55147	-0.8186	10	0.48119	T	0.1	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	539	Q15034	HERC3_HUMAN	Y	539	ENSP00000385684:N539Y;ENSP00000264345:N539Y	ENSP00000264345:N539Y	N	+	1	0	HERC3	89808237	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.985000	0.76193	2.371000	0.80710	0.533000	0.62120	AAC	.		0.408	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318081.2	NM_014606	
TLL1	7092	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	4	166981201	166981201	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:166981201C>A	ENST00000061240.2	+	15	2515	c.1868C>A	c.(1867-1869)aCc>aAc	p.T623N	TLL1_ENST00000507499.1_Missense_Mutation_p.T646N	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	623	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		GGACTTCTTACCAAACTTAAC	0.453																																					p.T623N		.											.	TLL1-158	0			c.C1868A						.						70.0	69.0	69.0					4																	166981201		2203	4300	6503	SO:0001583	missense	7092	exon15			TTCTTACCAAACT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1868C>A	4.37:g.166981201C>A	ENSP00000061240:p.Thr623Asn	36	0		32	6	NM_012464	0	0	0	0	0	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	37	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.275513	0.40294	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.20463	2.07;2.07	6.17	3.4	0.38934	CUB (5);	0.137872	0.47852	U	0.000205	T	0.33556	0.0867	M	0.73319	2.225	0.80722	D	1	P;B	0.46395	0.877;0.444	P;P	0.51170	0.661;0.542	T	0.08086	-1.0739	10	0.48119	T	0.1	.	11.5067	0.50471	0.0:0.7017:0.2352:0.0631	.	646;623	E9PD25;O43897	.;TLL1_HUMAN	N	623;646	ENSP00000061240:T623N;ENSP00000426082:T646N	ENSP00000061240:T623N	T	+	2	0	TLL1	167200651	0.999000	0.42202	0.718000	0.30602	0.027000	0.11550	4.674000	0.61612	0.942000	0.37525	-0.165000	0.13383	ACC	.		0.453	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
GALNTL6	442117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	173961210	173961210	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:173961210A>G	ENST00000506823.1	+	13	2422	c.1765A>G	c.(1765-1767)Atg>Gtg	p.M589V	GALNTL6_ENST00000508122.1_Missense_Mutation_p.M572V	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	589					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						ACACATTAATATGACTGTTTT	0.393																																					p.M589V		.											.	GALNTL6-137	0			c.A1765G						.						74.0	72.0	73.0					4																	173961210		2203	4300	6503	SO:0001583	missense	442117	exon13			ATTAATATGACTG		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.1765A>G	4.37:g.173961210A>G	ENSP00000423313:p.Met589Val	50	0		55	14	NM_001034845	0	0	0	0	0	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	37	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	A	6.661	0.490436	0.12702	.	.	ENSG00000174473	ENST00000506823;ENST00000508122	T;T	0.54675	0.57;0.56	5.7	2.0	0.26442	.	0.153878	0.46145	N	0.000314	T	0.39253	0.1071	L	0.40543	1.245	0.36671	D	0.878519	B	0.16166	0.016	B	0.15870	0.014	T	0.30297	-0.9983	10	0.29301	T	0.29	.	9.2523	0.37562	0.7946:0.0:0.2054:0.0	.	589	Q49A17	GLTL6_HUMAN	V	589;572	ENSP00000423313:M589V;ENSP00000423827:M572V	ENSP00000423313:M589V	M	+	1	0	GALNTL6	174197785	1.000000	0.71417	0.999000	0.59377	0.779000	0.44077	1.936000	0.40183	0.434000	0.26340	-0.250000	0.11733	ATG	.		0.393	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362395.1	NM_001034845	
TENM3	55714	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	183609360	183609360	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:183609360G>C	ENST00000511685.1	+	12	2200	c.2077G>C	c.(2077-2079)Ggg>Cgg	p.G693R	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.G693R			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	693	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CGTTTGCATGGGGGGGACGTG	0.592																																					p.G693R		.											.	.	0			c.G2077C						.						109.0	115.0	113.0					4																	183609360		1972	4161	6133	SO:0001583	missense	55714	exon11			TGCATGGGGGGGA	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.2077G>C	4.37:g.183609360G>C	ENSP00000424226:p.Gly693Arg	50	0		39	17	NM_001080477	0	0	0	0	0	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471427	0.43942	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.33654	1.4;1.4	5.02	5.02	0.67125	Epidermal growth factor-like (1);	.	.	.	.	T	0.38983	0.1061	L	0.46819	1.47	0.80722	D	1	P	0.48998	0.918	P	0.45232	0.474	T	0.11131	-1.0600	9	0.33141	T	0.24	.	18.5322	0.90996	0.0:0.0:1.0:0.0	.	693	Q9P273	TEN3_HUMAN	R	693	ENSP00000424226:G693R;ENSP00000385276:G693R	ENSP00000385276:G693R	G	+	1	0	ODZ3	183846354	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	5.487000	0.66863	2.626000	0.88956	0.650000	0.86243	GGG	.		0.592	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
TENM3	55714	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	183710523	183710523	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:183710523G>A	ENST00000511685.1	+	25	5705	c.5582G>A	c.(5581-5583)aGt>aAt	p.S1861N	TENM3_ENST00000406950.2_Missense_Mutation_p.S1861N			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1861					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AAAACATGGAGTTACACATAT	0.438																																					p.S1861N		.											.	.	0			c.G5582A						.						69.0	70.0	70.0					4																	183710523		1950	4135	6085	SO:0001583	missense	55714	exon24			CATGGAGTTACAC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.5582G>A	4.37:g.183710523G>A	ENSP00000424226:p.Ser1861Asn	245	1		266	66	NM_001080477	0	0	0	0	0	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	37	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.378637	0.82682	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.87650	-2.28;-2.28	5.2	5.2	0.72013	.	.	.	.	.	D	0.92867	0.7731	M	0.74647	2.275	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	D	0.92611	0.6099	9	0.51188	T	0.08	.	18.9316	0.92568	0.0:0.0:1.0:0.0	.	1861	Q9P273	TEN3_HUMAN	N	1861	ENSP00000424226:S1861N;ENSP00000385276:S1861N	ENSP00000385276:S1861N	S	+	2	0	ODZ3	183947517	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.567000	0.98161	2.691000	0.91804	0.655000	0.94253	AGT	.		0.438	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
WWC2	80014	bcgsc.ca	37	4	184236868	184236868	+	Missense_Mutation	SNP	G	G	A	rs4862155	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr4:184236868G>A	ENST00000403733.3	+	23	3764	c.3565G>A	c.(3565-3567)Gct>Act	p.A1189T	WWC2_ENST00000448232.2_Missense_Mutation_p.A1213T|WWC2_ENST00000513834.1_Missense_Mutation_p.A1140T|WWC2_ENST00000504005.1_Missense_Mutation_p.A871T|WWC2_ENST00000508747.1_Missense_Mutation_p.A317T	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	1189			A -> T (in dbSNP:rs4862155). {ECO:0000269|PubMed:17974005}.		negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		ATCCCTGCCAGCTGATGATGT	0.363													G|||	195	0.0389377	0.0234	0.0375	5008	,	,		19449	0.0228		0.0537	False		,,,				2504	0.0624				p.A1189T		.											.	WWC2-93	0			c.G3565A						.	G	THR/ALA	121,4285	89.7+/-128.4	3,115,2085	96.0	84.0	88.0		3565	4.5	0.0	4	dbSNP_111	88	544,8056	150.6+/-205.5	21,502,3777	yes	missense	WWC2	NM_024949.5	58	24,617,5862	AA,AG,GG		6.3256,2.7463,5.113	probably-damaging	1189/1193	184236868	665,12341	2203	4300	6503	SO:0001583	missense	80014	exon23			CTGCCAGCTGATG	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.3565G>A	4.37:g.184236868G>A	ENSP00000384222:p.Ala1189Thr	84	0		114	5	NM_024949	0	0	1	1	0	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	ENST00000403733.3	37	CCDS34109.2	88	0.040293040293040296	12	0.024390243902439025	19	0.052486187845303865	18	0.03146853146853147	39	0.051451187335092345	G	13.93	2.384963	0.42308	0.027463	0.063256	ENSG00000151718	ENST00000403733;ENST00000513834;ENST00000448232;ENST00000504005;ENST00000508747	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	5.31	4.47	0.54385	.	0.181999	0.37623	N	0.002003	T	0.19087	0.0458	M	0.78049	2.395	0.80722	D	1	D;B;D;D	0.63046	0.992;0.248;0.992;0.985	P;B;P;P	0.61592	0.891;0.112;0.891;0.802	T	0.54437	-0.8294	10	0.72032	D	0.01	-3.1407	13.9248	0.63955	0.0724:0.0:0.9276:0.0	rs4862155;rs52802328;rs61473673;rs4862155	1213;1189;317;1140	Q6AWC2-6;Q6AWC2;Q6AWC2-7;Q6AWC2-4	.;WWC2_HUMAN;.;.	T	1189;1140;1213;871;317	ENSP00000384222:A1189T;ENSP00000425054:A1140T;ENSP00000398577:A1213T;ENSP00000427569:A871T;ENSP00000420835:A317T	ENSP00000384222:A1189T	A	+	1	0	WWC2	184473862	1.000000	0.71417	0.026000	0.17262	0.166000	0.22503	8.426000	0.90273	1.486000	0.48398	0.655000	0.94253	GCT	G|0.953;A|0.047		0.363	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
ANKH	56172	bcgsc.ca	37	5	14769103	14769103	+	Silent	SNP	G	G	A	rs17251667	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr5:14769103G>A	ENST00000284268.6	-	2	624	c.294C>T	c.(292-294)gcC>gcT	p.A98A		NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	98					locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						TGTGAAAGACGGCAGCGATGG	0.483													G|||	604	0.120607	0.0424	0.1225	5008	,	,		16145	0.0238		0.1829	False		,,,				2504	0.2607				p.A98A		.											.	ANKH-91	0			c.C294T						.	G		264,4142	148.8+/-183.1	7,250,1946	73.0	72.0	72.0		294	-4.0	0.3	5	dbSNP_123	72	1672,6928	307.4+/-308.4	173,1326,2801	no	coding-synonymous	ANKH	NM_054027.4		180,1576,4747	AA,AG,GG		19.4419,5.9918,14.8854		98/493	14769103	1936,11070	2203	4300	6503	SO:0001819	synonymous_variant	56172	exon2			AAAGACGGCAGCG	AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.294C>T	5.37:g.14769103G>A		260	1		170	7	NM_054027	0	0	0	0	0	B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Silent	SNP	ENST00000284268.6	37	CCDS3885.1																																																																																			G|0.877;A|0.123		0.483	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207063.1	NM_054027	
SNX18	112574	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	53839018	53839018	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr5:53839018C>A	ENST00000381410.4	+	2	1821	c.1631C>A	c.(1630-1632)aCc>aAc	p.T544N	SNX18_ENST00000343017.6_3'UTR	NM_001102575.1	NP_001096045.1	Q96RF0	SNX18_HUMAN	sorting nexin 18	0	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				GGAGCTCTTACCAAAGTCAAG	0.393																																					p.T544N		.											.	SNX18-226	0			c.C1631A						.						73.0	71.0	71.0					5																	53839018		1869	4093	5962	SO:0001583	missense	112574	exon2			CTCTTACCAAAGT	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000381410.4:c.1631C>A	5.37:g.53839018C>A	ENSP00000370817:p.Thr544Asn	129	1		209	64	NM_001102575	0	0	0	0	0	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Missense_Mutation	SNP	ENST00000381410.4	37	CCDS43317.1	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926806	0.73327	.	.	ENSG00000178996	ENST00000381410	T	0.13901	2.55	5.72	5.72	0.89469	.	.	.	.	.	T	0.14227	0.0344	.	.	.	0.80722	D	1	B	0.22080	0.064	B	0.22753	0.041	T	0.08269	-1.0730	8	0.27082	T	0.32	.	19.8891	0.96923	0.0:1.0:0.0:0.0	.	544	Q96RF0-2	.	N	544	ENSP00000370817:T544N	ENSP00000370817:T544N	T	+	2	0	SNX18	53874775	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.473000	0.81007	2.689000	0.91719	0.655000	0.94253	ACC	.		0.393	SNX18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214073.2		
FAM172A	83989	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	93111872	93111872	+	Silent	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr5:93111872G>A	ENST00000395965.3	-	10	1243	c.1101C>T	c.(1099-1101)gtC>gtT	p.V367V	FAM172A_ENST00000509739.1_Silent_p.V220V|FAM172A_ENST00000505869.1_Silent_p.V257V|FAM172A_ENST00000509163.1_Silent_p.V321V	NM_032042.5	NP_114431.2	Q8WUF8	F172A_HUMAN	family with sequence similarity 172, member A	367						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9						TACCTGCTGAGACCCGGGGGC	0.383																																					p.V367V		.											.	FAM172A-90	0			c.C1101T						.						104.0	109.0	107.0					5																	93111872		2203	4300	6503	SO:0001819	synonymous_variant	83989	exon10			TGCTGAGACCCGG		CCDS4069.1, CCDS54879.1, CCDS54880.1	5q15	2008-06-16	2008-06-16	2008-06-16	ENSG00000113391	ENSG00000113391			25365	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 21"""	C5orf21		11230166	Standard	NM_032042		Approved	DKFZP564D172	uc010jbd.3	Q8WUF8	OTTHUMG00000131329	ENST00000395965.3:c.1101C>T	5.37:g.93111872G>A		238	0		428	64	NM_032042	0	0	0	0	0	B2R7C6|B4DJ14|B4DLG5|Q9H0U8	Silent	SNP	ENST00000395965.3	37	CCDS4069.1																																																																																			.		0.383	FAM172A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254100.3	NM_032042	
KCTD16	57528	broad.mit.edu	37	5	143853531	143853531	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr5:143853531delA	ENST00000507359.3	+	3	2232	c.1141delA	c.(1141-1143)aaafs	p.K383fs	KCTD16_ENST00000512467.1_Frame_Shift_Del_p.K383fs	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	383					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			CATGAGCAGCAAAAAAAAAGC	0.468																																					p.K381fs		.											.	KCTD16-137	0			c.1141delA						.			51,4211		5,41,2085	53.0	63.0	59.0			4.8	1.0	5		61	75,8177		18,39,4069	no	frameshift	KCTD16	NM_020768.3		23,80,6154	A1A1,A1R,RR		0.9089,1.1966,1.0069			143853531	126,12388	2203	4300	6503	SO:0001589	frameshift_variant	57528	exon4			AGCAGCAAAAAAA	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1141delA	5.37:g.143853531delA	ENSP00000426548:p.Lys383fs	73	0		164	7	NM_020768	0	0	0	0	0	Q9P2M9	Frame_Shift_Del	DEL	ENST00000507359.3	37	CCDS34260.1																																																																																			.		0.468	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3	XM_098368	
ANXA6	309	broad.mit.edu;bcgsc.ca	37	5	150503872	150503872	+	Silent	SNP	C	C	T	rs138779149	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr5:150503872C>T	ENST00000354546.5	-	15	1340	c.1113G>A	c.(1111-1113)gcG>gcA	p.A371A	ANXA6_ENST00000377751.5_Intron|ANXA6_ENST00000356496.5_Silent_p.A371A|ANXA6_ENST00000523714.1_Silent_p.A339A|ANXA6_ENST00000521512.1_Silent_p.A164A	NM_001155.4	NP_001146.2	P08133	ANXA6_HUMAN	annexin A6	371					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|protein homooligomerization (GO:0051260)|regulation of muscle contraction (GO:0006937)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|cholesterol binding (GO:0015485)|GTP binding (GO:0005525)|ligand-gated ion channel activity (GO:0015276)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|lung(9)	12		Medulloblastoma(196;0.0912)|all_hematologic(541;0.208)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTTTCCGCAGCGCTTTGGCAT	0.612													C|||	8	0.00159744	0.0008	0.0	5008	,	,		16965	0.0		0.007	False		,,,				2504	0.0				p.A371A		.											.	ANXA6-22	0			c.G1113A						.	C	,	6,4018		0,6,2006	66.0	74.0	71.0		1113,1017	-0.9	1.0	5	dbSNP_134	71	48,8294		0,48,4123	no	coding-synonymous,coding-synonymous	ANXA6	NM_001155.4,NM_001193544.1	,	0,54,6129	TT,TC,CC		0.5754,0.1491,0.4367	,	371/674,339/642	150503872	54,12312	2012	4171	6183	SO:0001819	synonymous_variant	309	exon15			CCGCAGCGCTTTG	J03578	CCDS47315.1, CCDS54941.1	5q33.1	2008-02-05			ENSG00000197043	ENSG00000197043		"""Annexins"""	544	protein-coding gene	gene with protein product		114070		ANX6		3258820	Standard	NM_001155		Approved		uc003ltl.2	P08133	OTTHUMG00000164179	ENST00000354546.5:c.1113G>A	5.37:g.150503872C>T		109	0		170	6	NM_001155	0	0	124	124	0	B7Z8A7|D3DQH4|E9PGK1|Q6ZT79	Silent	SNP	ENST00000354546.5	37	CCDS47315.1																																																																																			C|0.997;T|0.003		0.612	ANXA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377668.2	NM_001155	
FAT2	2196	bcgsc.ca	37	5	150908812	150908812	+	Missense_Mutation	SNP	C	C	T	rs7718054	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr5:150908812C>T	ENST00000261800.5	-	14	9965	c.9953G>A	c.(9952-9954)cGg>cAg	p.R3318Q		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	3318	Cadherin 29. {ECO:0000255|PROSITE- ProRule:PRU00043}.		R -> Q (in dbSNP:rs7718054).|R -> W (in dbSNP:rs2304024).		epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAATTGGGGCCGGTGTTCATT	0.522													C|||	349	0.0696885	0.1422	0.0836	5008	,	,		21809	0.0347		0.0398	False		,,,				2504	0.0286				p.R3318Q		.											.	FAT2-96	0			c.G9953A						.	C	GLN/ARG	555,3851	249.3+/-256.8	48,459,1696	142.0	136.0	138.0		9953	-0.4	0.9	5	dbSNP_116	138	308,8292	111.6+/-171.8	4,300,3996	yes	missense	FAT2	NM_001447.2	43	52,759,5692	TT,TC,CC		3.5814,12.5965,6.6354	benign	3318/4350	150908812	863,12143	2203	4300	6503	SO:0001583	missense	2196	exon14			TGGGGCCGGTGTT	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.9953G>A	5.37:g.150908812C>T	ENSP00000261800:p.Arg3318Gln	145	0		235	6	NM_001447	0	0	0	0	0	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	37	CCDS4317.1	151	0.06913919413919414	74	0.15040650406504066	17	0.04696132596685083	25	0.043706293706293704	35	0.04617414248021108	C	10.23	1.292020	0.23564	0.125965	0.035814	ENSG00000086570	ENST00000261800	T	0.60920	0.15	5.78	-0.421	0.12332	Cadherin (3);Cadherin-like (1);	1.332910	0.04805	N	0.434197	T	0.00241	0.0007	N	0.21282	0.65	0.45272	P	0.001727000000000034	B;B	0.13145	0.007;0.006	B;B	0.08055	0.003;0.002	T	0.04961	-1.0915	9	0.41790	T	0.15	.	2.9255	0.05783	0.1012:0.1821:0.2108:0.5058	rs7718054;rs7718054	3318;509	Q9NYQ8;E9PDJ8	FAT2_HUMAN;.	Q	3318	ENSP00000261800:R3318Q	ENSP00000261800:R3318Q	R	-	2	0	FAT2	150889005	0.004000	0.15560	0.947000	0.38551	0.558000	0.35554	-0.060000	0.11712	0.022000	0.15160	0.637000	0.83480	CGG	C|0.927;T|0.073		0.522	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		0	0		6	6	NM_001145115	0	0	0	2	2		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
RREB1	6239	hgsc.bcm.edu	37	6	7230680	7230680	+	Missense_Mutation	SNP	G	G	T	rs9502564	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:7230680G>T	ENST00000349384.6	+	10	2662	c.2348G>T	c.(2347-2349)gGc>gTc	p.G783V	RREB1_ENST00000334984.6_Missense_Mutation_p.G783V|RREB1_ENST00000379938.2_Missense_Mutation_p.G783V|RREB1_ENST00000379933.3_Missense_Mutation_p.G783V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	783			G -> V (in dbSNP:rs9502564). {ECO:0000269|PubMed:15067362, ECO:0000269|PubMed:21703425}.		multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CTGGGCGGGGGCCACAAGGGC	0.697													G|||	2678	0.534744	0.5333	0.4063	5008	,	,		15583	0.7411		0.2893	False		,,,				2504	0.6677				p.G783V		.											.	RREB1-144	0			c.G2348T						.	G	VAL/GLY,VAL/GLY,VAL/GLY,VAL/GLY	2083,2197		552,979,609	9.0	9.0	9.0		2348,2348,2348,2348	5.3	1.0	6	dbSNP_119	9	2599,5719		488,1623,2048	yes	missense,missense,missense,missense	RREB1	NM_001003698.3,NM_001003699.3,NM_001003700.1,NM_001168344.1	109,109,109,109	1040,2602,2657	TT,TG,GG		31.2455,48.6682,37.1646	benign,benign,benign,benign	783/1688,783/1743,783/1477,783/1688	7230680	4682,7916	2140	4159	6299	SO:0001583	missense	6239	exon10			GCGGGGGCCACAA	U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.2348G>T	6.37:g.7230680G>T	ENSP00000305560:p.Gly783Val	1	0		7	7	NM_001003700	0	0	0	0	0	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	ENST00000349384.6	37	CCDS34336.1	1014	0.4642857142857143	249	0.5060975609756098	148	0.4088397790055249	412	0.7202797202797203	205	0.2704485488126649	G	11.15	1.553554	0.27739	0.486682	0.312455	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.09163	3.07;3.07;3.07;3.01	5.32	5.32	0.75619	.	0.278837	0.31370	N	0.007766	T	0.02533	0.0077	N	0.14661	0.345	0.21915	P	0.999474401	B;B;B	0.32653	0.161;0.379;0.328	B;B;B	0.35182	0.079;0.197;0.178	T	0.45512	-0.9256	9	0.13108	T	0.6	-17.3998	11.4207	0.49980	0.0:0.0:0.8202:0.1797	rs9502564	783;783;783	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	V	783	ENSP00000369265:G783V;ENSP00000369270:G783V;ENSP00000305560:G783V;ENSP00000335574:G783V	ENSP00000335574:G783V	G	+	2	0	RREB1	7175679	1.000000	0.71417	0.996000	0.52242	0.833000	0.47200	5.477000	0.66799	2.760000	0.94817	0.655000	0.94253	GGC	G|0.546;T|0.454		0.697	RREB1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352985.1		
BTN3A1	11119	broad.mit.edu;bcgsc.ca	37	6	26408132	26408132	+	Nonsense_Mutation	SNP	A	A	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:26408132A>T	ENST00000289361.6	+	4	1035	c.667A>T	c.(667-669)Aga>Tga	p.R223*	BTN3A1_ENST00000414912.2_Nonsense_Mutation_p.R171*|BTN3A1_ENST00000476549.2_Nonsense_Mutation_p.R223*|BTN3A1_ENST00000425234.2_Nonsense_Mutation_p.R223*	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1	223	Ig-like V-type 2.				activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						CTGTACCATCAGAAGTTCCCT	0.552																																					p.R223X		.											.	BTN3A1-92	0			c.A667T						.						170.0	158.0	162.0					6																	26408132		2203	4300	6503	SO:0001587	stop_gained	11119	exon4			ACCATCAGAAGTT	U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.667A>T	6.37:g.26408132A>T	ENSP00000289361:p.Arg223*	238	0		185	9	NM_007048	0	0	3	3	0	A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Nonsense_Mutation	SNP	ENST00000289361.6	37	CCDS4608.1	.	.	.	.	.	.	.	.	.	.	.	35	5.505602	0.96371	.	.	ENSG00000026950	ENST00000476549;ENST00000289361;ENST00000425234;ENST00000414912	.	.	.	2.0	-0.696	0.11287	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	7.0382	0.25004	0.3416:0.6584:0.0:0.0	.	.	.	.	X	223;223;223;171	.	ENSP00000289361:R223X	R	+	1	2	BTN3A1	26516111	0.000000	0.05858	0.005000	0.12908	0.528000	0.34623	-1.125000	0.03257	-0.187000	0.10516	0.418000	0.28097	AGA	.		0.552	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040112.3		
HLA-A	3105	bcgsc.ca	37	6	29910622	29910622	+	Silent	SNP	C	C	T	rs199501996	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:29910622C>T	ENST00000396634.1	+	4	503	c.162C>T	c.(160-162)gaC>gaT	p.D54D	HLA-A_ENST00000376802.2_Silent_p.D54D|HLA-A_ENST00000376809.5_Silent_p.D54D|HLA-A_ENST00000376806.5_Silent_p.D54D			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	54	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.D54D(2)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						ACGTGGACGACACGCAGTTCG	0.687									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.D54D		.											.	HLA-A-92	2	Substitution - coding silent(2)	prostate(2)	c.C162T						.						47.0	40.0	42.0					6																	29910622		2202	4299	6501	SO:0001819	synonymous_variant	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	GGACGACACGCAG	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.162C>T	6.37:g.29910622C>T		53	1		180	35	NM_001242758	0	0	1111	1111	0	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Silent	SNP	ENST00000396634.1	37	CCDS34373.1																																																																																			C|0.998;T|0.002		0.687	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
HLA-A	3105	bcgsc.ca	37	6	29910688	29910688	+	Missense_Mutation	SNP	A	A	G	rs41544012	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:29910688A>G	ENST00000396634.1	+	4	569	c.228A>G	c.(226-228)atA>atG	p.I76M	HLA-A_ENST00000376802.2_Missense_Mutation_p.I76M|HLA-A_ENST00000376809.5_Missense_Mutation_p.I76M|HLA-A_ENST00000376806.5_Missense_Mutation_p.I76M			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	76	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						CGCCGTGGATAGAGCAGGAGG	0.662									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.I76M		.											.	HLA-A-92	0			c.A228G						.						50.0	52.0	52.0					6																	29910688		2203	4299	6502	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	GTGGATAGAGCAG	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.228A>G	6.37:g.29910688A>G	ENSP00000379873:p.Ile76Met	176	2		211	25	NM_001242758	0	0	349	350	1	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	264	0.12087912087912088	78	0.15853658536585366	37	0.10220994475138122	70	0.12237762237762238	79	0.10422163588390501	.	10.57	1.387103	0.25031	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00008	9.61;9.61;9.61;9.61	3.71	1.8	0.24995	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	4.887320	0.02623	U	0.103442	T	0.00012	0.0000	N	0.00859	-1.14	0.09310	N	1	B;B;B;B;B	0.10296	0.002;0.003;0.003;0.003;0.003	B;B;B;B;B	0.26094	0.02;0.041;0.037;0.066;0.037	T	0.42430	-0.9452	10	0.66056	D	0.02	.	6.565	0.22507	0.2379:0.0:0.7621:0.0	rs41544012	76;76;76;76;76	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	M	76	ENSP00000379873:I76M;ENSP00000366002:I76M;ENSP00000366005:I76M;ENSP00000365998:I76M	ENSP00000348012:I76M	I	+	3	3	HLA-A	30018667	0.000000	0.05858	0.003000	0.11579	0.096000	0.18686	-0.131000	0.10482	0.352000	0.24053	-0.538000	0.04264	ATA	A|0.885;G|0.115		0.662	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
HLA-A	3105	bcgsc.ca	37	6	29910693	29910693	+	Missense_Mutation	SNP	A	A	G	rs41559716	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:29910693A>G	ENST00000396634.1	+	4	574	c.233A>G	c.(232-234)cAg>cGg	p.Q78R	HLA-A_ENST00000376802.2_Missense_Mutation_p.Q78R|HLA-A_ENST00000376809.5_Missense_Mutation_p.Q78R|HLA-A_ENST00000376806.5_Missense_Mutation_p.Q78R			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	78	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.Q78R(2)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TGGATAGAGCAGGAGGGGCCG	0.657									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.Q78R		.											.	HLA-A-92	2	Substitution - Missense(2)	lung(1)|endometrium(1)	c.A233G						.						54.0	57.0	56.0					6																	29910693		2203	4299	6502	SO:0001583	missense	3105	exon2	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	TAGAGCAGGAGGG	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.233A>G	6.37:g.29910693A>G	ENSP00000379873:p.Gln78Arg	178	1		211	23	NM_001242758	0	0	347	347	0	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	37	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	9.798	1.179669	0.21787	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000355767;ENST00000376802	T;T;T;T	0.00784	5.7;5.7;5.7;5.7	3.72	-4.39	0.03611	MHC class I, alpha chain, alpha1/alpha2 (3);MHC classes I/II-like antigen recognition protein (3);MHC class I-like antigen recognition (3);	1.398580	0.06189	N	0.681068	T	0.00815	0.0027	L	0.56280	1.765	0.09310	N	1	B;P;B;P;B	0.42483	0.0;0.781;0.0;0.781;0.0	B;D;B;D;B	0.71184	0.006;0.972;0.01;0.972;0.01	T	0.44952	-0.9294	10	0.87932	D	0	.	0.9552	0.01384	0.3504:0.1689:0.3159:0.1647	rs41559716	78;78;78;78;78	P13746;Q5SRN7;P16188;Q5SRN5;P04439	1A11_HUMAN;.;1A30_HUMAN;.;1A03_HUMAN	R	78	ENSP00000379873:Q78R;ENSP00000366002:Q78R;ENSP00000366005:Q78R;ENSP00000365998:Q78R	ENSP00000348012:Q78R	Q	+	2	0	HLA-A	30018672	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.990000	0.03732	-0.910000	0.03847	-0.450000	0.05554	CAG	A|0.979;G|0.021		0.657	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
IP6K3	117283	bcgsc.ca	37	6	33703230	33703230	+	Silent	SNP	G	G	A	rs545787	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:33703230G>A	ENST00000293756.4	-	2	350	c.24C>T	c.(22-24)gaC>gaT	p.D8D	IP6K3_ENST00000451316.1_Silent_p.D8D	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	8					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						TGTCCCCGGCGTCTGCGCTGT	0.607													G|||	1672	0.333866	0.7171	0.2378	5008	,	,		19059	0.0675		0.331	False		,,,				2504	0.1616				p.D8D		.											.	IP6K3-240	0			c.C24T						.	G	,	2841,1565	654.5+/-399.8	909,1023,271	48.0	37.0	41.0		24,24	-10.5	0.0	6	dbSNP_83	41	3127,5473	468.6+/-367.3	593,1941,1766	no	coding-synonymous,coding-synonymous	IP6K3	NM_001142883.1,NM_054111.4	,	1502,2964,2037	AA,AG,GG		36.3605,35.5197,45.8865	,	8/411,8/411	33703230	5968,7038	2203	4300	6503	SO:0001819	synonymous_variant	117283	exon3			CCCGGCGTCTGCG	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.24C>T	6.37:g.33703230G>A		76	1		64	5	NM_001142883	0	0	0	0	0	Q96MQ9	Silent	SNP	ENST00000293756.4	37	CCDS34435.1																																																																																			G|0.599;A|0.401		0.607	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
TULP1	7287	bcgsc.ca	37	6	35477025	35477025	+	Missense_Mutation	SNP	C	C	G	rs2064318	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:35477025C>G	ENST00000229771.6	-	8	862	c.783G>C	c.(781-783)aaG>aaC	p.K261N	TULP1_ENST00000322263.4_Missense_Mutation_p.K208N	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	261			K -> N (in dbSNP:rs2064318). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17962469, ECO:0000269|PubMed:9096357, ECO:0000269|PubMed:9462751}.|K -> T (in RP14).		dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						TTTGATTGCTCTTCTTTATCA	0.587													G|||	4199	0.838458	0.913	0.8833	5008	,	,		19103	0.8641		0.7863	False		,,,				2504	0.7331				p.K261N	GBM(55;1027 1091 11115 23439)	.											.	TULP1-92	0			c.G783C						.	G	ASN/LYS	3921,485	226.2+/-241.8	1746,429,28	378.0	350.0	359.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	783	3.7	1.0	6	dbSNP_94	359	7033,1567	295.0+/-302.2	2879,1275,146	yes	missense	TULP1	NM_003322.3	94	4625,1704,174	GG,GC,CC		18.2209,11.0077,15.7773	benign	261/543	35477025	10954,2052	2203	4300	6503	SO:0001583	missense	7287	exon8			ATTGCTCTTCTTT	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.783G>C	6.37:g.35477025C>G	ENSP00000229771:p.Lys261Asn	114	1		107	8	NM_003322	0	0	2	2	0	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	ENST00000229771.6	37	CCDS4807.1	1865	0.8539377289377289	448	0.9105691056910569	324	0.8950276243093923	494	0.8636363636363636	599	0.7902374670184696	G	0.119	-1.127509	0.01770	0.889923	0.817791	ENSG00000112041	ENST00000229771;ENST00000322263	T;T	0.80123	-1.32;-1.34	4.6	3.73	0.42828	.	0.386813	0.27807	N	0.017773	T	0.16171	0.0389	N	0.00186	-1.895	0.42916	P	0.005730000000000013	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.18398	-1.0338	9	0.02654	T	1	.	6.5805	0.22591	0.0977:0.1794:0.7229:0.0	rs2064318;rs57875686	208;261	O00294-2;O00294	.;TULP1_HUMAN	N	261;208	ENSP00000229771:K261N;ENSP00000319414:K208N	ENSP00000229771:K261N	K	-	3	2	TULP1	35585003	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	0.813000	0.27225	0.571000	0.29365	-0.357000	0.07601	AAG	C|0.349;G|0.651		0.587	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040307.2		
TMEM30A	55754	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	75968594	75968594	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:75968594G>A	ENST00000230461.6	-	6	1123	c.794C>T	c.(793-795)gCa>gTa	p.A265V	TMEM30A_ENST00000370050.5_Missense_Mutation_p.A146V|TMEM30A_ENST00000475111.2_Missense_Mutation_p.A229V	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	265					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AGTAGGTAATGCTGCAGTACG	0.383																																					p.A265V		.											.	TMEM30A-90	0			c.C794T						.						108.0	101.0	103.0					6																	75968594		2203	4300	6503	SO:0001583	missense	55754	exon6			GGTAATGCTGCAG	AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.794C>T	6.37:g.75968594G>A	ENSP00000230461:p.Ala265Val	126	0		129	9	NM_018247	0	0	3	3	0	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	ENST00000230461.6	37	CCDS4983.1	.	.	.	.	.	.	.	.	.	.	G	36	5.643024	0.96704	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.86142	0.5862	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89379	0.3680	9	0.72032	D	0.01	.	19.4728	0.94969	0.0:0.0:1.0:0.0	.	229;265	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	V	265;249;146;229	.	ENSP00000230461:A265V	A	-	2	0	TMEM30A	76025314	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.605000	0.88082	0.591000	0.81541	GCA	.		0.383	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041248.2	NM_018247	
LAMA2	3908	broad.mit.edu	37	6	129691085	129691085	+	Nonsense_Mutation	SNP	G	G	T	rs138303386		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:129691085G>T	ENST00000421865.2	+	34	4958	c.4909G>T	c.(4909-4911)Gag>Tag	p.E1637*		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1637	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.E1637K(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TCAGCTGGCAGAGGGCAATCT	0.448																																					p.E1637X		.											.	LAMA2-162	1	Substitution - Missense(1)	endometrium(1)	c.G4909T						.						81.0	84.0	83.0					6																	129691085		2203	4300	6503	SO:0001587	stop_gained	3908	exon34			CTGGCAGAGGGCA	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.4909G>T	6.37:g.129691085G>T	ENSP00000400365:p.Glu1637*	50	0		69	4	NM_000426	0	0	0	0	0	Q14736|Q5VUM2|Q93022	Nonsense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	G	46	12.167815	0.99643	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	.	.	.	5.98	5.98	0.97165	.	0.108387	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	14.5778	0.68262	0.0:0.2528:0.7472:0.0	.	.	.	.	X	1637	.	ENSP00000346769:E1637X	E	+	1	0	LAMA2	129732778	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.153000	0.58118	2.838000	0.97847	0.655000	0.94253	GAG	G|1.000;A|0.000		0.448	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
IGF2R	3482	ucsc.edu	37	6	160454109	160454109	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:160454109C>A	ENST00000356956.1	+	9	1329	c.1181C>A	c.(1180-1182)gCa>gAa	p.A394E		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	394					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CAAGTCAAAGCAGCAGGAAGA	0.413																																					p.A394E		.											.	IGF2R-118	0			c.C1181A						.						97.0	88.0	91.0					6																	160454109		2203	4300	6503	SO:0001583	missense	3482	exon9			TCAAAGCAGCAGG	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.1181C>A	6.37:g.160454109C>A	ENSP00000349437:p.Ala394Glu	48	0		45	4	NM_000876	0	0	0	0	0	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.072085	0.55646	.	.	ENSG00000197081	ENST00000356956	T	0.02067	4.47	4.67	2.31	0.28768	Mannose-6-phosphate receptor, binding (1);	0.372428	0.28057	N	0.016764	T	0.00580	0.0019	N	0.08118	0	0.23232	N	0.998074	P	0.35821	0.523	B	0.39562	0.303	T	0.48281	-0.9049	10	0.66056	D	0.02	-11.5191	7.3327	0.26592	0.0:0.1784:0.0:0.8216	.	394	P11717	MPRI_HUMAN	E	394	ENSP00000349437:A394E	ENSP00000349437:A394E	A	+	2	0	IGF2R	160374099	1.000000	0.71417	0.982000	0.44146	0.722000	0.41435	2.831000	0.48144	0.280000	0.22209	-0.367000	0.07326	GCA	.		0.413	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		0	0		8	8	NM_175922	0	0	0	0	0		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
TCP10L2	401285	broad.mit.edu	37	6	167592576	167592576	+	Silent	SNP	G	G	A	rs60976240	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:167592576G>A	ENST00000366832.2	+	6	866	c.735G>A	c.(733-735)acG>acA	p.T245T		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	245										endometrium(1)|kidney(2)|lung(3)	6						AGGCCGCCACGCTGCAGGAGC	0.582													G|||	3206	0.640176	0.7617	0.6614	5008	,	,		17779	0.5694		0.5984	False		,,,				2504	0.5767				p.T245T		.											.	.	0			c.G735A						.						23.0	28.0	27.0					6																	167592576		692	1591	2283	SO:0001819	synonymous_variant	401285	exon6			CGCCACGCTGCAG		CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.735G>A	6.37:g.167592576G>A		72	0		90	4	NM_001145121	0	0	0	0	0		Silent	SNP	ENST00000366832.2	37	CCDS47514.1																																																																																			G|0.425;A|0.575		0.582	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5	XR_040749	
TBP	6908	mdanderson.org	37	6	170871043	170871043	+	Silent	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr6:170871043G>A	ENST00000392092.2	+	3	498	c.219G>A	c.(217-219)caG>caA	p.Q73Q	TBP_ENST00000230354.6_Silent_p.Q73Q|TBP_ENST00000540980.1_Silent_p.Q53Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	73	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q73Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcaacagcaacagcagc	0.562																																					p.Q73Q		.											.	TBP-91	1	Substitution - coding silent(1)	endometrium(1)	c.G219A						.						17.0	21.0	20.0					6																	170871043		1987	3877	5864	SO:0001819	synonymous_variant	6908	exon3			GCAACAGCAACAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.219G>A	6.37:g.170871043G>A		48	0		56	13	NM_003194	0	0	436	441	5	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.562	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
MRPL32	64983	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	42971992	42971992	+	Silent	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr7:42971992C>T	ENST00000223324.2	+	1	194	c.7C>T	c.(7-9)Ctg>Ttg	p.L3L	PSMA2_ENST00000445517.1_5'Flank|PSMA2_ENST00000442788.1_5'Flank|PSMA2_ENST00000538645.1_5'Flank|PSMA2_ENST00000223321.4_5'Flank	NM_031903.2	NP_114109.1	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32	3					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)	10						GAAAATGGCGCTGGCCATGCT	0.627																																					p.L3L		.											.	MRPL32-90	0			c.C7T						.						57.0	61.0	59.0					7																	42971992		2203	4300	6503	SO:0001819	synonymous_variant	64983	exon1			ATGGCGCTGGCCA	AB051343	CCDS5468.1	7p14	2012-09-13			ENSG00000106591	ENSG00000106591		"""Mitochondrial ribosomal proteins / large subunits"""	14035	protein-coding gene	gene with protein product		611839				11543634	Standard	NM_031903		Approved	HSPC283, L32mt, MRP-L32, bMRP-59b	uc003tia.3	Q9BYC8	OTTHUMG00000155180	ENST00000223324.2:c.7C>T	7.37:g.42971992C>T		86	0		110	24	NM_031903	0	0	17	23	6	Q96Q68|Q9P098	Silent	SNP	ENST00000223324.2	37	CCDS5468.1																																																																																			.		0.627	MRPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338669.1	NM_031903	
AZGP1	563	broad.mit.edu;bcgsc.ca	37	7	99564732	99564732	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr7:99564732G>A	ENST00000292401.4	-	4	927	c.791C>T	c.(790-792)tCc>tTc	p.S264F	AZGP1_ENST00000483612.1_5'UTR|AZGP1_ENST00000411734.1_3'UTR	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	264	Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					CACCACCCAGGACTGGTAAGT	0.637																																					p.S264F		.											.	AZGP1-515	0			c.C791T						.						73.0	55.0	61.0					7																	99564732		2203	4300	6503	SO:0001583	missense	563	exon4			ACCCAGGACTGGT	BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.791C>T	7.37:g.99564732G>A	ENSP00000292401:p.Ser264Phe	238	1		349	14	NM_001185	0	0	0	0	0	D6W5T8|O60386|Q5XKQ4|Q8N4N0	Missense_Mutation	SNP	ENST00000292401.4	37	CCDS5680.1	.	.	.	.	.	.	.	.	.	.	G	12.10	1.836385	0.32421	.	.	ENSG00000160862	ENST00000292401	T	0.02812	4.15	2.17	1.03	0.20045	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.620952	0.12281	U	0.482886	T	0.06234	0.0161	L	0.46741	1.465	0.80722	D	1	D	0.59767	0.986	P	0.59703	0.862	T	0.50048	-0.8873	10	0.87932	D	0	.	2.9355	0.05814	0.1916:0.2999:0.5085:0.0	.	264	P25311	ZA2G_HUMAN	F	264	ENSP00000292401:S264F	ENSP00000292401:S264F	S	-	2	0	AZGP1	99402668	0.002000	0.14202	0.995000	0.50966	0.171000	0.22731	0.208000	0.17415	1.130000	0.42092	0.313000	0.20887	TCC	.		0.637	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059387.4	NM_001185	
CADPS2	93664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	122056123	122056123	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr7:122056123G>C	ENST00000449022.2	-	18	2591	c.2572C>G	c.(2572-2574)Cat>Gat	p.H858D	CADPS2_ENST00000313070.7_Missense_Mutation_p.H855D|RP5-1101C3.1_ENST00000591140.1_RNA|CADPS2_ENST00000334010.7_Missense_Mutation_p.H859D|CADPS2_ENST00000412584.2_Missense_Mutation_p.H855D|RP5-1101C3.1_ENST00000593910.1_RNA	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	858	Interaction with DRD2.				cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						ACCTCTGCATGATGCTCTTCA	0.448																																					p.H865D		.											.	CADPS2-94	0			c.C2593G						.						60.0	57.0	58.0					7																	122056123		1895	4114	6009	SO:0001583	missense	93664	exon19			CTGCATGATGCTC		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.2572C>G	7.37:g.122056123G>C	ENSP00000398481:p.His858Asp	46	0		59	12	NM_001167940	0	0	0	0	0	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	37	CCDS55158.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	23.6|23.6|23.6	4.440057|4.440057|4.440057	0.83993|0.83993|0.83993	.|.|.	.|.|.	ENSG00000081803|ENSG00000081803|ENSG00000081803	ENST00000360097;ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022|ENST00000462699|ENST00000397721	T;T;T;T|.|.	0.53206|.|.	0.63;0.66;0.63;0.63|.|.	5.86|5.86|5.86	5.86|5.86|5.86	0.93980|0.93980|0.93980	Calcium-dependent secretion activator (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.75917|0.75917|.	0.3915|0.3915|.	M|M|M	0.67397|0.67397|0.67397	2.05|2.05|2.05	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;D|.|.	0.76494|.|.	0.997;0.999;0.997;0.989|.|.	D;D;D;D|.|.	0.83275|.|.	0.996;0.953;0.996;0.985|.|.	T|T|.	0.72724|0.72724|.	-0.4207|-0.4207|.	10|5|.	0.87932|.|.	D|.|.	0|.|.	-19.2254|-19.2254|-19.2254	20.1813|20.1813|20.1813	0.98205|0.98205|0.98205	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	865;855;858;855|.|.	B7ZM57;Q86UW7-2;Q86UW7;Q86UW7-3|.|.	.;.;CAPS2_HUMAN;.|.|.	D|M|X	31;855;859;866;822;855;858|51|503	ENSP00000325581:H855D;ENSP00000333940:H859D;ENSP00000400401:H855D;ENSP00000398481:H858D|.|.	ENSP00000325581:H855D|.|.	H|I|S	-|-|-	1|3|2	0|3|0	CADPS2|CADPS2|CADPS2	121843359|121843359|121843359	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.997000|0.997000|0.997000	0.53966|0.53966|0.53966	0.959000|0.959000|0.959000	0.62525|0.62525|0.62525	8.945000|8.945000|8.945000	0.92985|0.92985|0.92985	2.763000|2.763000|2.763000	0.94921|0.94921|0.94921	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	CAT|ATC|TCA	.		0.448	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
IQUB	154865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	123105042	123105042	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr7:123105042G>A	ENST00000466202.1	-	10	2179	c.1603C>T	c.(1603-1605)Cag>Tag	p.Q535*	IQUB_ENST00000434450.1_Nonsense_Mutation_p.Q535*|IQUB_ENST00000324698.6_Nonsense_Mutation_p.Q535*	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	535					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						AGAATTTCCTGAGTTAGTTTA	0.323																																					p.Q535X		.											.	IQUB-156	0			c.C1603T						.						115.0	126.0	122.0					7																	123105042		2203	4298	6501	SO:0001587	stop_gained	154865	exon10			TTTCCTGAGTTAG	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1603C>T	7.37:g.123105042G>A	ENSP00000417769:p.Gln535*	57	0		68	12	NM_178827	0	0	0	0	0	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Nonsense_Mutation	SNP	ENST00000466202.1	37	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	G	37	6.137039	0.97315	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	.	.	.	5.41	5.41	0.78517	.	0.340572	0.34828	N	0.003660	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	16.582	0.84717	0.0:0.13:0.87:0.0	.	.	.	.	X	535	.	ENSP00000324882:Q535X	Q	-	1	0	IQUB	122892278	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	2.682000	0.46934	2.702000	0.92279	0.643000	0.83706	CAG	.		0.323	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	
OR6B1	135946	bcgsc.ca	37	7	143701516	143701516	+	Missense_Mutation	SNP	C	C	T	rs7787378	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr7:143701516C>T	ENST00000408922.2	+	1	495	c.427C>T	c.(427-429)Cgc>Tgc	p.R143C		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	143			R -> C (in dbSNP:rs7787378).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					GCTCTGCTTCCGCCTCGCTCT	0.562													C|||	813	0.16234	0.0764	0.3674	5008	,	,		21958	0.2411		0.0885	False		,,,				2504	0.1278				p.R143C		.											.	OR6B1-91	0			c.C427T						.	C	CYS/ARG	303,3985		11,281,1852	80.0	83.0	82.0		427	5.3	0.5	7	dbSNP_116	82	796,7768		49,698,3535	yes	missense	OR6B1	NM_001005281.1	180	60,979,5387	TT,TC,CC		9.2947,7.0662,8.5512	benign	143/312	143701516	1099,11753	2144	4282	6426	SO:0001583	missense	135946	exon1			TGCTTCCGCCTCG		CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.427C>T	7.37:g.143701516C>T	ENSP00000386151:p.Arg143Cys	152	0		223	7	NM_001005281	0	0	0	0	0	A4D2G2|B9EH47|Q6IFP6|Q96R38	Missense_Mutation	SNP	ENST00000408922.2	37	CCDS43667.1	358	0.16391941391941392	38	0.07723577235772358	111	0.30662983425414364	141	0.2465034965034965	68	0.08970976253298153	C	8.409	0.843804	0.16963	0.070662	0.092947	ENSG00000221813	ENST00000408922	T	0.00123	8.7	5.26	5.26	0.73747	GPCR, rhodopsin-like superfamily (1);	0.415982	0.17515	U	0.171466	T	0.00012	0.0000	L	0.28458	0.855	0.41184	P	0.013746000000000036	B	0.09022	0.002	B	0.18561	0.022	T	0.50955	-0.8766	9	0.34782	T	0.22	.	14.2547	0.66043	0.0:1.0:0.0:0.0	rs7787378;rs52795515;rs7787378	143	O95007	OR6B1_HUMAN	C	143	ENSP00000386151:R143C	ENSP00000386151:R143C	R	+	1	0	OR6B1	143332449	0.022000	0.18835	0.511000	0.27724	0.142000	0.21351	1.965000	0.40471	2.739000	0.93911	0.655000	0.94253	CGC	C|0.853;N|0.000		0.562	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349566.1		
CTAGE4	100128553	broad.mit.edu	37	7	143882673	143882673	+	Missense_Mutation	SNP	C	C	T	rs201010806	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr7:143882673C>T	ENST00000486333.1	+	1	2115	c.2077C>T	c.(2077-2079)Ctt>Ttt	p.L693F		NM_198495.2	NP_940897.2	Q8IX94	CTGE4_HUMAN	CTAGE family, member 4	693	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(1)|ovary(2)	3						TGGCCCTGGCCTTATTCCTCC	0.488																																					p.L693F		.											.	.	0			c.C2077T						.						3.0	4.0	4.0					7																	143882673		116	650	766	SO:0001583	missense	100128553	exon1			CCTGGCCTTATTC	AF338232	CCDS55176.1	7q35	2009-10-15			ENSG00000225932	ENSG00000225932			24772	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 4"""	608910				12839582, 11149944	Standard	NM_198495		Approved	FLJ43692, cTAGE-4	uc010lpc.3	Q8IX94	OTTHUMG00000157997	ENST00000486333.1:c.2077C>T	7.37:g.143882673C>T	ENSP00000419539:p.Leu693Phe	57	1		95	4	NM_198495	0	0	0	1	1	A8K871|O95046	Missense_Mutation	SNP	ENST00000486333.1	37	CCDS55176.1	.	.	.	.	.	.	.	.	.	.	.	0.639	-0.814097	0.02798	.	.	ENSG00000225932	ENST00000486333	T	0.05447	3.44	.	.	.	.	.	.	.	.	T	0.00666	0.0022	N	0.00016	-2.855	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36625	-0.9740	7	0.02654	T	1	.	.	.	.	.	693	Q8IX94	CTGE4_HUMAN	F	693	ENSP00000419539:L693F	ENSP00000419539:L693F	L	+	1	0	CTAGE4	143513606	0.830000	0.29337	0.003000	0.11579	0.003000	0.03518	0.348000	0.20031	-1.497000	0.01826	-1.514000	0.00941	CTT	.		0.488	CTAGE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349970.1	NM_198495	
PDIA4	9601	hgsc.bcm.edu	37	7	148725417	148725417	+	Missense_Mutation	SNP	G	G	T	rs368592590	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr7:148725417G>T	ENST00000286091.4	-	1	316	c.84C>A	c.(82-84)gaC>gaA	p.D28E		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	28	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			GCTCACCCTCGTCCGGGCCCT	0.766													G|||	3	0.000599042	0.0	0.0	5008	,	,		9672	0.0		0.003	False		,,,				2504	0.0				p.D28E		.											.	PDIA4-524	0			c.C84A						.	G	GLU/ASP	2,3246		0,2,1622	4.0	6.0	6.0		84	4.7	0.9	7		6	6,5918		0,6,2956	no	missense	PDIA4	NM_004911.4	45	0,8,4578	TT,TG,GG		0.1013,0.0616,0.0872	benign	28/646	148725417	8,9164	1624	2962	4586	SO:0001583	missense	9601	exon1			ACCCTCGTCCGGG	BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.84C>A	7.37:g.148725417G>T	ENSP00000286091:p.Asp28Glu	0	0		11	4	NM_004911	0	0	0	0	0	A8K4K6|Q549T6	Missense_Mutation	SNP	ENST00000286091.4	37	CCDS5893.1	.	.	.	.	.	.	.	.	.	.	G	5.261	0.233586	0.09969	6.16E-4	0.001013	ENSG00000155660	ENST00000286091;ENST00000413966	T;T	0.45668	2.28;0.89	5.58	4.69	0.59074	Thioredoxin-like fold (1);	1.385570	0.04197	N	0.329265	T	0.25195	0.0612	N	0.08118	0	0.24603	N	0.993766	B	0.20887	0.049	B	0.17979	0.02	T	0.12066	-1.0562	10	0.02654	T	1	.	11.8705	0.52517	0.0822:0.0:0.9178:0.0	.	28	P13667	PDIA4_HUMAN	E	28	ENSP00000286091:D28E;ENSP00000408628:D28E	ENSP00000286091:D28E	D	-	3	2	PDIA4	148356350	0.691000	0.27709	0.932000	0.37286	0.283000	0.27025	1.045000	0.30341	1.344000	0.45657	0.655000	0.94253	GAC	.		0.766	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317077.1	NM_004911	
COL14A1	7373	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	121290694	121290694	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr8:121290694C>T	ENST00000297848.3	+	28	3628	c.3358C>T	c.(3358-3360)Cga>Tga	p.R1120*	COL14A1_ENST00000247781.3_Nonsense_Mutation_p.R1025*|COL14A1_ENST00000309791.4_Nonsense_Mutation_p.R1120*	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TAAGTATGTTCGAGATACCTT	0.398																																					p.R1120X		.											.	COL14A1-543	0			c.C3358T						.						88.0	80.0	83.0					8																	121290694		2203	4300	6503	SO:0001587	stop_gained	7373	exon28			TATGTTCGAGATA		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3358C>T	8.37:g.121290694C>T	ENSP00000297848:p.Arg1120*	163	2		241	44	NM_021110	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	43	9.881912	0.99286	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	.	.	.	5.4	5.4	0.78164	.	0.057304	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.894	0.79322	0.1358:0.8642:0.0:0.0	.	.	.	.	X	1120;1120;1025	.	ENSP00000247781:R1025X	R	+	1	2	COL14A1	121359875	0.992000	0.36948	1.000000	0.80357	0.902000	0.53008	2.592000	0.46171	2.692000	0.91855	0.650000	0.86243	CGA	.		0.398	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
PLEC	5339	hgsc.bcm.edu	37	8	144999417	144999417	+	Silent	SNP	C	C	T	rs55836855	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr8:144999417C>T	ENST00000322810.4	-	31	5260	c.5091G>A	c.(5089-5091)gcG>gcA	p.A1697A	PLEC_ENST00000436759.2_Silent_p.A1587A|PLEC_ENST00000527096.1_Silent_p.A1583A|PLEC_ENST00000356346.3_Silent_p.A1546A|PLEC_ENST00000398774.2_Silent_p.A1528A|PLEC_ENST00000354589.3_Silent_p.A1560A|PLEC_ENST00000345136.3_Silent_p.A1560A|PLEC_ENST00000357649.2_Silent_p.A1564A|PLEC_ENST00000354958.2_Silent_p.A1538A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1697	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GTACCTGCCGCGCTCGCTCCA	0.741													C|||	1156	0.230831	0.028	0.2954	5008	,	,		8861	0.1429		0.4274	False		,,,				2504	0.3476				p.A1697A		.											.	PLEC-141	0			c.G5091A						.	C	,,,,,,,	258,3112		16,226,1443	6.0	7.0	7.0		4761,4638,4614,5091,4584,4680,4692,4680	-9.4	0.1	8	dbSNP_129	7	2520,4470		444,1632,1419	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	460,1858,2862	TT,TC,CC		36.0515,7.6558,26.8147	,,,,,,,	1587/4575,1546/4534,1538/4526,1697/4685,1528/4516,1560/4548,1564/4552,1560/4548	144999417	2778,7582	1685	3495	5180	SO:0001819	synonymous_variant	5339	exon31			CTGCCGCGCTCGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.5091G>A	8.37:g.144999417C>T		0	0		9	9	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.731;T|0.269		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000214893.5_5'UTR|ERMP1_ENST00000381506.3_5'Flank	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		0	0		7	5	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
NTRK2	4915	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	87570307	87570307	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr9:87570307C>G	ENST00000323115.4	+	15	2352	c.1999C>G	c.(1999-2001)Ctg>Gtg	p.L667V	NTRK2_ENST00000376213.1_Missense_Mutation_p.L667V|NTRK2_ENST00000376214.1_Missense_Mutation_p.L683V|NTRK2_ENST00000277120.3_Missense_Mutation_p.L683V			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	667	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CATGGTCTACCTGGCGTCCCA	0.627										TSP Lung(25;0.17)																											p.L683V		.											.	NTRK2-1404	0			c.C2047G						.						54.0	50.0	52.0					9																	87570307		2203	4300	6503	SO:0001583	missense	4915	exon19			GTCTACCTGGCGT	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1999C>G	9.37:g.87570307C>G	ENSP00000314586:p.Leu667Val	108	1		130	30	NM_006180	0	0	0	0	0	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	ENST00000323115.4	37	CCDS35050.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366892	0.82463	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000277120;ENST00000323115	D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0	4.98	4.07	0.47477	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.96037	0.8709	M	0.88241	2.94	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.91635	0.999;0.962;0.992	D	0.96116	0.9081	10	0.87932	D	0	.	11.1562	0.48489	0.0:0.8532:0.0:0.1468	.	667;683;713	Q16620;Q16620-4;Q59GJ1	NTRK2_HUMAN;.;.	V	683;667;683;667	ENSP00000365387:L683V;ENSP00000365386:L667V;ENSP00000277120:L683V;ENSP00000314586:L667V	ENSP00000277120:L683V	L	+	1	2	NTRK2	86760127	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.931000	0.40134	2.320000	0.78422	0.655000	0.94253	CTG	.		0.627	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052882.1		
SVEP1	79987	bcgsc.ca	37	9	113261483	113261483	+	Missense_Mutation	SNP	C	C	T	rs872665	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr9:113261483C>T	ENST00000401783.2	-	7	1855	c.1519G>A	c.(1519-1521)Gtc>Atc	p.V507I	SVEP1_ENST00000467821.1_5'UTR|SVEP1_ENST00000374469.1_Missense_Mutation_p.V484I|SVEP1_ENST00000302728.8_Missense_Mutation_p.V507I|SVEP1_ENST00000374461.1_Missense_Mutation_p.V484I	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	507	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.		V -> I (in dbSNP:rs872665).		cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GATATGATGACATCTTTGGGC	0.463													C|||	1340	0.267572	0.3533	0.2622	5008	,	,		18368	0.1825		0.2535	False		,,,				2504	0.2577				p.V507I		.											.	SVEP1-75	0			c.G1519A						.	C	ILE/VAL	1226,2836		190,846,995	54.0	53.0	54.0		1519	5.9	1.0	9	dbSNP_86	54	2174,6228		277,1620,2304	yes	missense	SVEP1	NM_153366.3	29	467,2466,3299	TT,TC,CC		25.8748,30.1822,27.2786	probably-damaging	507/3572	113261483	3400,9064	2031	4201	6232	SO:0001583	missense	79987	exon7			TGATGACATCTTT	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1519G>A	9.37:g.113261483C>T	ENSP00000384917:p.Val507Ile	149	0		160	6	NM_153366	0	0	0	0	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	553	0.2532051282051282	170	0.34552845528455284	90	0.24861878453038674	102	0.17832167832167833	191	0.2519788918205805	C	6.191	0.403446	0.11754	0.301822	0.258748	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.91	5.91	0.95273	Complement control module (2);Sushi/SCR/CCP (2);	0.116309	0.64402	D	0.000020	T	0.00012	0.0000	L	0.36672	1.1	0.27382	P	0.9553831	D;B;D	0.67145	0.983;0.355;0.996	P;B;D	0.77557	0.753;0.1;0.99	T	0.03433	-1.1037	9	0.02654	T	1	.	19.0678	0.93119	0.0:1.0:0.0:0.0	rs872665;rs3818765;rs52802511;rs60471347;rs872665	507;507;507	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	I	507;484;507;484	ENSP00000384917:V507I;ENSP00000363593:V484I;ENSP00000304118:V507I;ENSP00000363585:V484I	ENSP00000304118:V507I	V	-	1	0	SVEP1	112301304	1.000000	0.71417	1.000000	0.80357	0.214000	0.24535	2.265000	0.43311	2.813000	0.96785	0.655000	0.94253	GTC	C|0.731;T|0.269		0.463	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
GPR144	347088	broad.mit.edu	37	9	127230891	127230891	+	Missense_Mutation	SNP	G	G	A	rs10760365	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr9:127230891G>A	ENST00000334810.1	+	14	2248	c.2248G>A	c.(2248-2250)Gtg>Atg	p.V750M				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	750					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GTGGAGGAAGGTGGTAGCTGT	0.622													G|||	2605	0.520168	0.5371	0.5274	5008	,	,		16910	0.6171		0.4195	False		,,,				2504	0.4959				p.V750M		.											.	.	0			c.G2248A						.	G	MET/VAL	661,723		154,353,185	98.0	84.0	88.0		2248	4.9	1.0	9	dbSNP_120	88	1390,1792		305,780,506	yes	missense	GPR144	NM_001161808.1	21	459,1133,691	AA,AG,GG		43.6832,47.7601,44.919	probably-damaging	750/964	127230891	2051,2515	692	1591	2283	SO:0001583	missense	347088	exon14			AGGAAGGTGGTAG	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2248G>A	9.37:g.127230891G>A	ENSP00000335156:p.Val750Met	86	0		88	3	NM_001161808	0	0	0	0	0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	1132|1132	0.5183150183150184|0.5183150183150184	242|242	0.491869918699187|0.491869918699187	185|185	0.511049723756906|0.511049723756906	381|381	0.666083916083916|0.666083916083916	324|324	0.42744063324538256|0.42744063324538256	G|G	17.72|17.72	3.459464|3.459464	0.63401|0.63401	0.477601|0.477601	0.436832|0.436832	ENSG00000180264|ENSG00000180264	ENST00000446588|ENST00000334810	.|T	.|0.49432	.|0.78	4.94|4.94	4.94|4.94	0.65067|0.65067	.|GPCR, family 2-like (1);	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.72894|0.72894	2.215|2.215	0.22610|0.22610	P|P	0.99893717|0.99893717	D|D	0.63046|0.76494	0.992|0.999	P|D	0.56865|0.87578	0.808|0.998	T|T	0.50311|0.50311	-0.8843|-0.8843	7|8	0.44086|0.72032	T|D	0.13|0.01	.|.	16.7766|16.7766	0.85552|0.85552	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	rs10760365;rs57939835;rs10760365|rs10760365;rs57939835;rs10760365	18|750	A1E4E8|Q7Z7M1	.|GP144_HUMAN	D|M	18|750	.|ENSP00000335156:V750M	ENSP00000414478:G18D|ENSP00000335156:V750M	G|V	+|+	2|1	0|0	GPR144|GPR144	126270712|126270712	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.233000|0.233000	0.25261|0.25261	8.590000|8.590000	0.90821|0.90821	2.278000|2.278000	0.76064|0.76064	0.561000|0.561000	0.74099|0.74099	GGT|GTG	G|0.465;A|0.535		0.622	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
GPR144	347088	broad.mit.edu;bcgsc.ca	37	9	127231774	127231774	+	Missense_Mutation	SNP	C	C	G	rs1570580	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr9:127231774C>G	ENST00000334810.1	+	16	2506	c.2506C>G	c.(2506-2508)Cgc>Ggc	p.R836G				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	836					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						CCGCCGTGCCCGCATGTTGAG	0.642													C|||	2965	0.592053	0.5787	0.6326	5008	,	,		17817	0.7629		0.4245	False		,,,				2504	0.5777				p.R836G		.											.	.	0			c.C2506G						.	C	GLY/ARG	704,680		176,352,164	29.0	36.0	34.0		2506	1.2	1.0	9	dbSNP_88	34	1401,1781		311,779,501	yes	missense	GPR144	NM_001161808.1	125	487,1131,665	GG,GC,CC		44.0289,49.1329,46.1016	probably-damaging	836/964	127231774	2105,2461	692	1591	2283	SO:0001583	missense	347088	exon16			CGTGCCCGCATGT	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2506C>G	9.37:g.127231774C>G	ENSP00000335156:p.Arg836Gly	178	0		212	8	NM_001161808	0	0	0	0	0	Q86SL4|Q8NH12	Missense_Mutation	SNP	ENST00000334810.1	37	CCDS48016.1	1273	0.5828754578754579	274	0.556910569105691	217	0.5994475138121547	453	0.791958041958042	329	0.4340369393139842	C	17.23	3.336372	0.60963	0.508671	0.440289	ENSG00000180264	ENST00000334810	T	0.52983	0.64	4.46	1.17	0.20885	GPCR, family 2-like (1);	.	.	.	.	T	0.00012	0.0000	L	0.39326	1.205	0.42109	P	0.008624999999999994	D	0.60575	0.988	P	0.61722	0.893	T	0.33137	-0.9880	8	0.56958	D	0.05	.	3.8566	0.08978	0.366:0.4211:0.0:0.2129	rs1570580;rs57102571;rs1570580	836	Q7Z7M1	GP144_HUMAN	G	836	ENSP00000335156:R836G	ENSP00000335156:R836G	R	+	1	0	GPR144	126271595	0.973000	0.33851	0.994000	0.49952	0.800000	0.45204	4.077000	0.57598	0.330000	0.23485	0.462000	0.41574	CGC	C|0.409;G|0.591		0.642	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054026.2	NM_182611	
TAB3	257397	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	30873289	30873289	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chrX:30873289T>C	ENST00000378933.1	-	3	670	c.493A>G	c.(493-495)Aca>Gca	p.T165A	TAB3_ENST00000288422.2_Missense_Mutation_p.T165A|TAB3-AS2_ENST00000445240.1_RNA|TAB3_ENST00000378928.1_5'Flank|TAB3_ENST00000378930.3_Missense_Mutation_p.T165A|TAB3_ENST00000378932.2_Missense_Mutation_p.T165A	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	165	Pro-rich.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						TTCATTCCTGTTTGCATGGAA	0.463																																					p.T165A	Pancreas(164;1598 1985 29022 43301 49529)	.											.	TAB3-131	0			c.A493G						.						221.0	160.0	180.0					X																	30873289		2202	4300	6502	SO:0001583	missense	257397	exon6			TTCCTGTTTGCAT	AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.493A>G	X.37:g.30873289T>C	ENSP00000368215:p.Thr165Ala	236	0		226	101	NM_152787	0	0	0	0	0	A6NDD9|Q6VQR0	Missense_Mutation	SNP	ENST00000378933.1	37	CCDS14226.1	.	.	.	.	.	.	.	.	.	.	T	5.207	0.223697	0.09863	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932	T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6	5.01	5.01	0.66863	.	0.102941	0.43416	D	0.000578	T	0.44477	0.1295	N	0.08118	0	0.29960	N	0.819511	B;B	0.28971	0.229;0.147	B;B	0.27608	0.081;0.037	T	0.41875	-0.9484	10	0.07482	T	0.82	-4.426	9.2515	0.37557	0.0:0.0:0.2563:0.7437	.	165;165	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	A	165	ENSP00000368215:T165A;ENSP00000368212:T165A;ENSP00000288422:T165A;ENSP00000368214:T165A	ENSP00000288422:T165A	T	-	1	0	TAB3	30783210	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.224000	0.42945	1.777000	0.52277	0.486000	0.48141	ACA	.		0.463	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056173.1	NM_152787	
DMD	1756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	31792220	31792220	+	Silent	SNP	A	A	G			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chrX:31792220A>G	ENST00000357033.4	-	51	7605	c.7399T>C	c.(7399-7401)Ttg>Ctg	p.L2467L	DMD_ENST00000359836.1_Silent_p.L7L|DMD_ENST00000343523.2_Silent_p.L7L|DMD_ENST00000378677.2_Silent_p.L2463L|DMD_ENST00000474231.1_Silent_p.L7L|DMD_ENST00000541735.1_Silent_p.L7L|DMD_ENST00000378707.3_Silent_p.L7L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2467					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGTACCTCCAACATCAAGGAA	0.443																																					p.L2467L		.											.	DMD-265	0			c.T7399C						.						97.0	81.0	86.0					X																	31792220		2202	4300	6502	SO:0001819	synonymous_variant	1756	exon51			CCTCCAACATCAA	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.7399T>C	X.37:g.31792220A>G		96	0		135	13	NM_004006	0	0	0	0	0	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	37	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	A	9.470	1.095353	0.20471	.	.	ENSG00000198947	ENST00000465285	.	.	.	5.08	2.66	0.31614	.	.	.	.	.	T	0.54854	0.1884	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46638	-0.9177	4	.	.	.	.	6.7503	0.23483	0.7674:0.1517:0.081:0.0	.	.	.	.	A	195	.	.	V	-	2	0	DMD	31702141	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.376000	0.34306	0.581000	0.29539	0.481000	0.45027	GTT	.		0.443	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
CCDC22	28952	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	49099775	49099775	+	Silent	SNP	C	C	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chrX:49099775C>T	ENST00000376227.3	+	6	731	c.561C>T	c.(559-561)ccC>ccT	p.P187P	CCDC22_ENST00000496651.1_3'UTR	NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	187										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						AGGCGAGTCCCCTGCTGCTTC	0.662																																					p.P187P		.											.	CCDC22-130	0			c.C561T						.						33.0	24.0	27.0					X																	49099775		2201	4299	6500	SO:0001819	synonymous_variant	28952	exon6			GAGTCCCCTGCTG	BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.561C>T	X.37:g.49099775C>T		144	0		157	75	NM_014008	0	0	12	20	8	A8K7G1	Silent	SNP	ENST00000376227.3	37	CCDS14322.1																																																																																			.		0.662	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060822.1	NM_014008	
MTMR8	55613	bcgsc.ca	37	X	63488902	63488902	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chrX:63488902G>T	ENST00000374852.3	-	14	1697	c.1630C>A	c.(1630-1632)Cca>Aca	p.P544T	MTMR8_ENST00000453546.1_Intron	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	544						nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(2)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						TCTTCTGGTGGCTCATCACGG	0.433																																					p.P544T		.											.	MTMR8-195	2	Whole gene deletion(2)	ovary(1)|large_intestine(1)	c.C1630A						.						51.0	48.0	49.0					X																	63488902		2203	4296	6499	SO:0001583	missense	55613	exon14			CTGGTGGCTCATC	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1630C>A	X.37:g.63488902G>T	ENSP00000363985:p.Pro544Thr	62	1		116	5	NM_017677	0	0	0	0	0	Q5JT99|Q9NXP6	Missense_Mutation	SNP	ENST00000374852.3	37	CCDS14379.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.418|8.418	0.845687|0.845687	0.16963|0.16963	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000442913|ENST00000374852;ENST00000247400	.|D	.|0.94046	.|-3.34	2.48|2.48	-1.83|-1.83	0.07833|0.07833	.|.	.|0.000000	.|0.42294	.|U	.|0.000732	T|T	0.78836|0.78836	0.4346|0.4346	N|N	0.08118|0.08118	0|0	0.19575|0.19575	N|N	0.999965|0.999965	.|B	.|0.13145	.|0.007	.|B	.|0.08055	.|0.003	T|T	0.66248|0.66248	-0.5971|-0.5971	5|10	.|0.30854	.|T	.|0.27	.|.	1.6439|1.6439	0.02758|0.02758	0.1408:0.3821:0.2818:0.1953|0.1408:0.3821:0.2818:0.1953	.|.	.|544	.|Q96EF0	.|MTMR8_HUMAN	D|T	347|544;430	.|ENSP00000363985:P544T	.|ENSP00000247400:P430T	A|P	-|-	2|1	0|0	MTMR8|MTMR8	63405627|63405627	0.049000|0.049000	0.20398|0.20398	0.279000|0.279000	0.24732|0.24732	0.967000|0.967000	0.64934|0.64934	-0.599000|-0.599000	0.05700|0.05700	-0.665000|-0.665000	0.05317|0.05317	0.529000|0.529000	0.55759|0.55759	GCC|CCA	.		0.433	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677	
TRMT2B	79979	broad.mit.edu	37	X	100297093	100297093	+	Silent	SNP	T	T	C			TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chrX:100297093T>C	ENST00000372936.3	-	3	958	c.186A>G	c.(184-186)aaA>aaG	p.K62K	TRMT2B_ENST00000338687.7_Silent_p.K62K|TRMT2B_ENST00000478422.1_Intron|TRMT2B-AS1_ENST00000443801.2_RNA|TRMT2B_ENST00000372931.5_Silent_p.K62K|TRMT2B_ENST00000545398.1_Silent_p.K62K|TRMT2B_ENST00000372939.1_Silent_p.K62K|TRMT2B_ENST00000372935.1_Silent_p.K62K	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	62						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)			breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						TTTTTTGTCCTTTCTGACATT	0.493																																					p.K62K		.											.	TRMT2B-131	0			c.A186G						.						164.0	133.0	144.0					X																	100297093		2203	4300	6503	SO:0001819	synonymous_variant	79979	exon2			TTGTCCTTTCTGA	BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.186A>G	X.37:g.100297093T>C		80	1		106	6	NM_001167972	0	0	0	0	0	A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Silent	SNP	ENST00000372936.3	37	CCDS14477.1																																																																																			.		0.493	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057512.1	NM_024917	
Unknown	0	bcgsc.ca	37	Y	21154569	21154569	+	IGR	SNP	A	A	G	rs17855271		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chrY:21154569A>G								TTTY14 (114455 upstream) : RNU6-255P (26299 downstream)																							GCCCCAGCCCAAGCCTGGCCA	0.612																																					p.L9L		.											.	.	0			c.T27C						.																																			SO:0001628	intergenic_variant	100133941	exon1			CAGCCCAAGCCTG																													Y.37:g.21154569A>G		64	0		55	7	NM_013230	0	0	1	1	0		Silent	SNP		37																																																																																				.	0	0.612								
KRTAP4-3	85290	bcgsc.ca	37	17	39324229	39324230	+	In_Frame_Ins	INS	-	-	GCAGCAGGTGGTCAG	rs58564583|rs369617852	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr17:39324229_39324230insGCAGCAGGTGGTCAG	ENST00000391356.2	-	1	194_195	c.195_196insCTGACCACCTGCTGC	c.(193-198)tgcagg>tgcCTGACCACCTGCTGCagg	p.64_65insCLTTC		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	64	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].		C -> CCCLTTCCRTTCCRPSCCISSCCRPSCCISSCCKPS (in allele KAP3-v1).		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			caggtggtcctgcagcagctgg	0.629																																					p.R66delinsLTTCCR		.											.	KRTAP4-3-22	0			c.196_197insCTGACCACCTGCTGC						.			169,589,1746		24,2,119,170,247,690						-9.3	0.0		dbSNP_134	4	951,38,4927		39,1,872,6,25,2015	no	codingComplex	KRTAP4-3	NM_033187.1		63,3,991,176,272,2705	A1A1,A1A2,A1R,A2A2,A2R,RR		16.7174,30.2716,20.7482				1120,627,6673				SO:0001652	inframe_insertion	85290	exon1			TGGTCCTGCAGCA	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.195_196insCTGACCACCTGCTGC	17.37:g.39324229_39324230insGCAGCAGGTGGTCAG	ENSP00000375151:p.Cys64_Cys65insCysLeuThrThrCys	146	0		163	23	NM_033187	0	0	0	0	0		In_Frame_Ins	INS	ENST00000391356.2	37	CCDS42331.1																																																																																			.		0.629	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257784.1		
TEKT4	150483	broad.mit.edu	37	2	95539829	95539830	+	Frame_Shift_Ins	INS	-	-	G	rs149873671		TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr2:95539829_95539830insG	ENST00000295201.4	+	3	826_827	c.689_690insG	c.(688-693)ccgtacfs	p.Y231fs	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	231					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.P230P(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CAGGCTCATCCGTACTCCACCA	0.663																																					p.P230fs		.											.	TEKT4-155	1	Substitution - coding silent(1)	lung(1)	c.689_690insG						.																																			SO:0001589	frameshift_variant	150483	exon3			CTCATCCGTACTC	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.690dupG	2.37:g.95539830_95539830dupG	ENSP00000295201:p.Tyr231fs	183	0		126	10	NM_144705	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000295201.4	37	CCDS2005.1																																																																																			.		0.663	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
SOAT2	8435	hgsc.bcm.edu	37	12	53509339	53509340	+	Silent	DNP	GC	GC	TT	rs34924760|rs3219200|rs3219199	byFrequency	TCGA-OR-A5JX-01A-11D-A29I-10	TCGA-OR-A5JX-10B-01D-A29L-10	GC	GC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	e1df717d-71b3-48cf-bb10-d94f741cb2a1	6821dc2c-2d56-428f-9be5-397a135f4404	g.chr12:53509339_53509340GC>TT	ENST00000301466.3	+	6	669_670	c.609_610GC>TT	c.(607-612)ctGCta>ctTTta	p.203_204LL>LL		NM_003578.3	NP_003569.1	O75908	SOAT2_HUMAN	sterol O-acyltransferase 2	203					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|intestinal cholesterol absorption (GO:0030299)|macrophage derived foam cell differentiation (GO:0010742)|very-low-density lipoprotein particle assembly (GO:0034379)	brush border (GO:0005903)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|transferase activity, transferring acyl groups (GO:0016746)			endometrium(5)|kidney(3)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	18					Hesperetin(DB01094)	GCTGTGCGCTGCTAGCCGCCCA	0.713																																					p.A202A		.											.	SOAT2-91	0			c.C610T						.																																			SO:0001819	synonymous_variant	8435	exon6			GCGCTGCTAGCCG	AF059203	CCDS8847.1	12q13.13	2012-09-20			ENSG00000167780	ENSG00000167780	2.3.1.26		11178	protein-coding gene	gene with protein product		601311				9756920	Standard	NM_003578		Approved	ACAT2	uc001sbv.3	O75908	OTTHUMG00000169774	Exception_encountered	12.37:g.53509339_53509340delinsTT		0	0		17	7	NM_003578	0	0	0	0	0	F5H7W4|I6L9H9|Q4VB99|Q4VBA1|Q96TD4|Q9UNR2	Silent	DNP	ENST00000301466.3	37	CCDS8847.1																																																																																			C|0.787;T|0.213		0.713	SOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405817.1		
