#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC2A5	6518	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	9118302	9118302	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:9118302G>A	ENST00000377424.4	-	2	220	c.41C>T	c.(40-42)aCg>aTg	p.T14M	SLC2A5_ENST00000535586.1_Intron|SLC2A5_ENST00000377414.3_Missense_Mutation_p.T14M	NM_003039.2	NP_003030.1	P22732	GTR5_HUMAN	solute carrier family 2 (facilitated glucose/fructose transporter), member 5	14					carbohydrate metabolic process (GO:0005975)|cellular response to fructose stimulus (GO:0071332)|fructose transport (GO:0015755)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fructose transmembrane transporter activity (GO:0005353)|glucose transmembrane transporter activity (GO:0005355)			endometrium(6)|kidney(15)|large_intestine(6)|lung(4)|ovary(1)|pancreas(2)|prostate(1)|urinary_tract(1)	36	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.78e-07)|COAD - Colon adenocarcinoma(227;8.83e-05)|Kidney(185;0.000286)|KIRC - Kidney renal clear cell carcinoma(229;0.00103)|STAD - Stomach adenocarcinoma(132;0.0019)|BRCA - Breast invasive adenocarcinoma(304;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		AAGCACAAGCGTCAGCCTCTG	0.552																																					p.T14M		.											.	SLC2A5-517	0			c.C41T						.						75.0	62.0	66.0					1																	9118302		2203	4300	6503	SO:0001583	missense	6518	exon2			ACAAGCGTCAGCC	BC001820	CCDS99.1, CCDS44054.1	1p36.2	2013-05-22			ENSG00000142583	ENSG00000142583		"""Solute carriers"""	11010	protein-coding gene	gene with protein product		138230		GLUT5		9691177	Standard	NM_003039		Approved		uc001apo.3	P22732	OTTHUMG00000001771	ENST00000377424.4:c.41C>T	1.37:g.9118302G>A	ENSP00000366641:p.Thr14Met	321	1		242	92	NM_003039	0	0	0	0	0	Q14770|Q5T977|Q8IVB3	Missense_Mutation	SNP	ENST00000377424.4	37	CCDS99.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194867	0.78902	.	.	ENSG00000142583	ENST00000377424;ENST00000456780;ENST00000377414	T;D	0.90444	-1.36;-2.67	5.29	4.37	0.52481	Major facilitator superfamily domain, general substrate transporter (1);	0.106431	0.64402	D	0.000006	D	0.96197	0.8760	H	0.95816	3.725	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;P;D	0.66602	0.912;0.891;0.945	D	0.96883	0.9647	10	0.87932	D	0	.	13.0946	0.59184	0.0804:0.0:0.9196:0.0	.	14;14;14	B4DIU4;P22732-2;P22732	.;.;GTR5_HUMAN	M	14	ENSP00000366641:T14M;ENSP00000366631:T14M	ENSP00000366631:T14M	T	-	2	0	SLC2A5	9040889	1.000000	0.71417	0.941000	0.38009	0.989000	0.77384	7.104000	0.77024	2.461000	0.83175	0.491000	0.48974	ACG	.		0.552	SLC2A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004932.1	NM_003039	
PTCHD2	57540	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	11574461	11574461	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:11574461T>C	ENST00000294484.6	+	4	1469	c.1331T>C	c.(1330-1332)cTc>cCc	p.L444P	PTCHD2_ENST00000389575.3_Missense_Mutation_p.L444P	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	444					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GTCCAGGTTCTCTATGGGGGG	0.512																																					p.L444P		.											.	PTCHD2-209	0			c.T1331C						.						133.0	131.0	132.0					1																	11574461		1979	4161	6140	SO:0001583	missense	57540	exon4			AGGTTCTCTATGG	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1331T>C	1.37:g.11574461T>C	ENSP00000294484:p.Leu444Pro	90	1		50	21	NM_020780	0	0	0	0	0	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	ENST00000294484.6	37	CCDS41247.1	.	.	.	.	.	.	.	.	.	.	T	19.92	3.915588	0.73098	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.85955	-2.05;-2.05	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.89722	0.6797	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90150	0.4220	10	0.54805	T	0.06	-31.6561	14.2637	0.66102	0.0:0.0:0.0:1.0	.	444	Q9P2K9	PTHD2_HUMAN	P	444	ENSP00000294484:L444P;ENSP00000374226:L444P	ENSP00000294484:L444P	L	+	2	0	PTCHD2	11497048	1.000000	0.71417	0.865000	0.33974	0.836000	0.47400	7.663000	0.83820	2.017000	0.59298	0.533000	0.62120	CTC	.		0.512	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000005770.2	XM_052561	
FAM131C	348487	ucsc.edu	37	1	16385007	16385007	+	Silent	SNP	C	C	T	rs2019769	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:16385007C>T	ENST00000375662.4	-	7	951	c.768G>A	c.(766-768)ggG>ggA	p.G256G	FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C	256	Pro-rich.									large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GGGGGTGGGTCCCACCCTCGG	0.721																																					p.G256G		.											.	FAM131C-514	0			c.G768A						.						3.0	3.0	3.0					1																	16385007		1442	3239	4681	SO:0001819	synonymous_variant	348487	exon7			GTGGGTCCCACCC		CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.768G>A	1.37:g.16385007C>T		11	0		31	9	NM_182623	0	0	35	35	0	Q5T5Q5|Q8N3X3|Q8N9P9	Silent	SNP	ENST00000375662.4	37	CCDS41270.1																																																																																			C|1.000;|0.000		0.721	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026319.1	NM_182623	
UBR4	23352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	19455563	19455563	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:19455563T>A	ENST00000375254.3	-	61	8939	c.8912A>T	c.(8911-8913)cAc>cTc	p.H2971L	UBR4_ENST00000375226.2_Missense_Mutation_p.H2947L|UBR4_ENST00000375267.2_Missense_Mutation_p.H2971L|UBR4_ENST00000375217.2_Missense_Mutation_p.H2964L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2971					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		ACGGACCATGTGCAGCCTAAA	0.512																																					p.H2971L		.											.	UBR4-612	0			c.A8912T						.						98.0	83.0	88.0					1																	19455563		2203	4300	6503	SO:0001583	missense	23352	exon61			ACCATGTGCAGCC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8912A>T	1.37:g.19455563T>A	ENSP00000364403:p.His2971Leu	131	0		88	30	NM_020765	0	0	0	0	0	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	ENST00000375254.3	37	CCDS189.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.827847	0.90955	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000425413;ENST00000417040	T;T;T;T	0.28454	1.63;1.63;1.62;1.61	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.51363	0.1670	M	0.62723	1.935	0.80722	D	1	P	0.50156	0.932	P	0.61397	0.888	T	0.53194	-0.8473	10	0.87932	D	0	.	15.5631	0.76266	0.0:0.0:0.0:1.0	.	2971	Q5T4S7	UBR4_HUMAN	L	2971;2971;2964;2947;579;1657	ENSP00000364403:H2971L;ENSP00000364416:H2971L;ENSP00000364365:H2964L;ENSP00000364374:H2947L	ENSP00000364365:H2964L	H	-	2	0	UBR4	19328150	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.388000	0.79795	2.153000	0.67306	0.460000	0.39030	CAC	.		0.512	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
RNF19B	127544	bcgsc.ca	37	1	33407925	33407925	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:33407925G>A	ENST00000373456.7	-	7	1540	c.1541C>T	c.(1540-1542)gCc>gTc	p.A514V	RNF19B_ENST00000235150.4_Missense_Mutation_p.A513V|RNF19B_ENST00000356990.5_Missense_Mutation_p.A513V	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	514					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TGCAAAGCTGGCCGTTTCGCT	0.488																																					p.A514V		.											.	RNF19B-68	0			c.C1541T						.						120.0	112.0	115.0					1																	33407925		2203	4300	6503	SO:0001583	missense	127544	exon7			AAGCTGGCCGTTT	AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.1541C>T	1.37:g.33407925G>A	ENSP00000362555:p.Ala514Val	157	0		111	6	NM_153341	0	0	3	3	0	B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	ENST00000373456.7	37	CCDS372.2	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160471	0.57368	.	.	ENSG00000116514	ENST00000373456;ENST00000356990;ENST00000235150;ENST00000405457	T;T;T	0.37915	1.17;1.21;1.17	5.11	5.11	0.69529	.	0.111433	0.64402	D	0.000008	T	0.34483	0.0899	L	0.29908	0.895	0.46061	D	0.998846	P;P;B	0.43094	0.754;0.799;0.101	B;B;B	0.42692	0.395;0.395;0.032	T	0.14924	-1.0455	10	0.52906	T	0.07	.	18.9322	0.92571	0.0:0.0:1.0:0.0	.	513;514;513	G3XA82;Q6ZMZ0;E9PAW6	.;RN19B_HUMAN;.	V	514;513;513;412	ENSP00000362555:A514V;ENSP00000349482:A513V;ENSP00000235150:A513V	ENSP00000235150:A513V	A	-	2	0	RNF19B	33180512	1.000000	0.71417	1.000000	0.80357	0.661000	0.39034	7.855000	0.86950	2.538000	0.85594	0.655000	0.94253	GCC	.		0.488	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011465.3	NM_153341	
PRDX1	5052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	45980288	45980290	+	In_Frame_Del	DEL	ATC	ATC	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	ATC	ATC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:45980288_45980290delATC	ENST00000262746.1	-	5	742_744	c.403_405delGAT	c.(403-405)gatdel	p.D135del	PRDX1_ENST00000319248.8_In_Frame_Del_p.D135del|PRDX1_ENST00000372079.1_In_Frame_Del_p.D33del|PRDX1_ENST00000483583.1_5'Flank	NM_002574.3|NM_181696.2	NP_002565.1|NP_859047.1	Q06830	PRDX1_HUMAN	peroxiredoxin 1	135	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell proliferation (GO:0008283)|erythrocyte homeostasis (GO:0034101)|hydrogen peroxide catabolic process (GO:0042744)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of NF-kappaB import into nucleus (GO:0042345)|regulation of stress-activated MAPK cascade (GO:0032872)|removal of superoxide radicals (GO:0019430)|retina homeostasis (GO:0001895)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)	heme binding (GO:0020037)|peroxidase activity (GO:0004601)|poly(A) RNA binding (GO:0044822)|thioredoxin peroxidase activity (GO:0008379)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	12	Acute lymphoblastic leukemia(166;0.155)					GAATACCCTTATCATCAATGATA	0.443																																					p.135_135del		.											.	PRDX1-514	0			c.403_405del						.																																			SO:0001651	inframe_deletion	5052	exon5			ACCCTTATCATCA	BC021683	CCDS522.1	1p34.1	2008-02-05			ENSG00000117450	ENSG00000117450			9352	protein-coding gene	gene with protein product		176763		PAGA		8496166	Standard	NM_181697		Approved	NKEFA	uc021omw.1	Q06830	OTTHUMG00000007738	ENST00000262746.1:c.403_405delGAT	1.37:g.45980291_45980293delATC	ENSP00000262746:p.Asp135del	169	0		107	35	NM_181696	0	0	0	0	0	B5BU26|D3DPZ8|P35703|Q2V576|Q5T154|Q5T155	In_Frame_Del	DEL	ENST00000262746.1	37	CCDS522.1																																																																																			.		0.443	PRDX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020845.1	NM_181697	
PDE4B	5142	ucsc.edu;bcgsc.ca	37	1	66384376	66384376	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:66384376T>A	ENST00000329654.4	+	3	326	c.139T>A	c.(139-141)Tca>Aca	p.S47T	PDE4B_ENST00000371049.3_Missense_Mutation_p.S47T	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	47					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	AAGGTGTTGCTCAGGAAACTT	0.463																																					p.S47T		.											.	PDE4B-92	0			c.T139A						.						95.0	90.0	92.0					1																	66384376		2203	4300	6503	SO:0001583	missense	5142	exon3			TGTTGCTCAGGAA	L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.139T>A	1.37:g.66384376T>A	ENSP00000332116:p.Ser47Thr	269	3		225	99	NM_002600	0	0	0	0	0	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	ENST00000329654.4	37	CCDS632.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.344964	0.61073	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049	T;T;T	0.19105	2.17;2.17;2.17	5.6	5.6	0.85130	.	0.511841	0.21451	N	0.074340	T	0.23133	0.0559	L	0.50333	1.59	0.40382	D	0.97945	P	0.49447	0.924	P	0.57776	0.827	T	0.01879	-1.1255	10	0.22706	T	0.39	.	14.5901	0.68359	0.0:0.0:0.0:1.0	.	47	Q07343	PDE4B_HUMAN	T	47	ENSP00000332116:S47T;ENSP00000342637:S47T;ENSP00000360088:S47T	ENSP00000332116:S47T	S	+	1	0	PDE4B	66156964	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	7.015000	0.76387	2.122000	0.65172	0.528000	0.53228	TCA	.		0.463	PDE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025188.3	NM_002600	
IFI44L	10964	ucsc.edu	37	1	79095482	79095482	+	Nonsense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:79095482T>A	ENST00000370751.5	+	4	784	c.605T>A	c.(604-606)tTg>tAg	p.L202*	IFI44L_ENST00000342282.3_5'UTR|IFI44L_ENST00000476521.1_3'UTR	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	202					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						CGTATTCTTTTGGTGGGTCCA	0.423																																					p.L202X		.											.	IFI44L-90	0			c.T605A						.						122.0	121.0	121.0					1																	79095482		2203	4300	6503	SO:0001587	stop_gained	10964	exon4			TTCTTTTGGTGGG	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.605T>A	1.37:g.79095482T>A	ENSP00000359787:p.Leu202*	65	0		42	4	NM_006820	0	0	0	0	0	Q86TE1|Q96B64|Q99984	Nonsense_Mutation	SNP	ENST00000370751.5	37	CCDS687.2	.	.	.	.	.	.	.	.	.	.	T	18.91	3.724227	0.68959	.	.	ENSG00000137959	ENST00000370751;ENST00000450498	.	.	.	2.95	2.95	0.34219	.	0.225081	0.29383	N	0.012315	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.9064	9.3468	0.38113	0.0:0.0:0.0:1.0	.	.	.	.	X	202;179	.	ENSP00000359787:L202X	L	+	2	0	IFI44L	78868070	0.343000	0.24818	0.943000	0.38184	0.609000	0.37215	5.199000	0.65152	1.590000	0.49995	0.416000	0.27883	TTG	.		0.423	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820	
GBP4	115361	ucsc.edu	37	1	89658754	89658754	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:89658754C>A	ENST00000355754.6	-	5	600	c.503G>T	c.(502-504)aGg>aTg	p.R168M		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	168	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		GGATTTTGCCCTGATTAGCTC	0.463																																					p.R168M		.											.	GBP4-90	0			c.G503T						.						119.0	112.0	114.0					1																	89658754		2203	4300	6503	SO:0001583	missense	115361	exon5			TTTGCCCTGATTA	AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.503G>T	1.37:g.89658754C>A	ENSP00000359490:p.Arg168Met	85	0		42	4	NM_052941	0	0	0	0	0	B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	ENST00000355754.6	37	CCDS721.1	.	.	.	.	.	.	.	.	.	.	C	9.750	1.167272	0.21621	.	.	ENSG00000162654	ENST00000355754	T	0.78246	-1.16	4.92	-0.151	0.13411	Guanylate-binding protein, N-terminal (1);	0.431546	0.25166	N	0.032634	T	0.79305	0.4423	M	0.89658	3.05	0.26940	N	0.966266	D	0.65815	0.995	P	0.60949	0.881	T	0.71090	-0.4693	10	0.40728	T	0.16	.	7.8392	0.29389	0.0:0.4524:0.0:0.5476	.	168	Q96PP9	GBP4_HUMAN	M	168	ENSP00000359490:R168M	ENSP00000359490:R168M	R	-	2	0	GBP4	89431342	0.098000	0.21812	0.097000	0.21041	0.360000	0.29518	0.276000	0.18716	0.087000	0.17167	-0.145000	0.13849	AGG	.		0.463	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029409.1	NM_052941	
NTNG1	22854	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	107691233	107691233	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:107691233C>A	ENST00000370068.1	+	2	864	c.18C>A	c.(16-18)ttC>ttA	p.F6L	NTNG1_ENST00000370065.1_Missense_Mutation_p.F6L|NTNG1_ENST00000370067.1_Missense_Mutation_p.F6L|NTNG1_ENST00000370061.3_Missense_Mutation_p.F6L|NTNG1_ENST00000370070.2_Missense_Mutation_p.F6L|NTNG1_ENST00000542803.1_Missense_Mutation_p.F6L|NTNG1_ENST00000370066.1_Missense_Mutation_p.F6L|NTNG1_ENST00000370074.4_Missense_Mutation_p.F6L|NTNG1_ENST00000370071.2_Missense_Mutation_p.F6L|NTNG1_ENST00000370072.3_Missense_Mutation_p.F6L|NTNG1_ENST00000370073.2_Missense_Mutation_p.F6L			Q9Y2I2	NTNG1_HUMAN	netrin G1	6				F -> S (in Ref. 2; AAQ88731). {ECO:0000305}.	axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		TGTCAAGATTCCTGTCGATTC	0.393																																					p.F6L		.											.	NTNG1-140	0			c.C18A						.						174.0	159.0	164.0					1																	107691233		2203	4300	6503	SO:0001583	missense	22854	exon2			AAGATTCCTGTCG	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.18C>A	1.37:g.107691233C>A	ENSP00000359085:p.Phe6Leu	145	0		119	55	NM_001113228	0	0	0	0	0	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	37	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.475229	0.26511	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.71579	0.95;-0.23;0.91;0.3;0.26;-0.39;-0.58;0.95;-0.38;-0.23;0.34	4.97	4.05	0.47172	.	0.000000	0.51477	D	0.000086	T	0.20820	0.0501	N	0.08118	0	0.34267	D	0.680638	B;B;B;B;B	0.09022	0.0;0.0;0.002;0.0;0.0	B;B;B;B;B	0.08055	0.001;0.001;0.003;0.001;0.001	T	0.10428	-1.0630	10	0.05436	T	0.98	.	7.5723	0.27915	0.0:0.7134:0.1355:0.151	.	6;6;6;6;6	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	L	6	ENSP00000359090:F6L;ENSP00000359088:F6L;ENSP00000440561:F6L;ENSP00000359078:F6L;ENSP00000359089:F6L;ENSP00000359087:F6L;ENSP00000359091:F6L;ENSP00000359085:F6L;ENSP00000359084:F6L;ENSP00000359083:F6L;ENSP00000359082:F6L	ENSP00000294649:F6L	F	+	3	2	NTNG1	107492756	0.977000	0.34250	1.000000	0.80357	0.989000	0.77384	0.703000	0.25646	1.215000	0.43411	0.491000	0.48974	TTC	.		0.393	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917	
ADAMTSL4	54507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150532560	150532560	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:150532560C>T	ENST00000369038.2	+	17	3314	c.3113C>T	c.(3112-3114)cCa>cTa	p.P1038L	ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.P1061L|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.P1038L			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	1038	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GACAGCTCTCCACATTGCCCC	0.617											OREG0013787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1038L		.											.	ADAMTSL4-92	0			c.C3113T						.						162.0	148.0	153.0					1																	150532560		2203	4300	6503	SO:0001583	missense	54507	exon19			GCTCTCCACATTG	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.3113C>T	1.37:g.150532560C>T	ENSP00000358034:p.Pro1038Leu	137	0	1733	262	47	NM_019032	0	0	2	2	0	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	CCDS955.1	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292819	0.40594	.	.	ENSG00000143382	ENST00000271643;ENST00000369039;ENST00000369038	T;T;T	0.42513	0.97;0.97;0.97	5.26	5.26	0.73747	PLAC (2);	.	.	.	.	T	0.36026	0.0952	L	0.38175	1.15	0.49051	D	0.999744	D;P;D	0.89917	1.0;0.876;0.999	D;P;D	0.72625	0.978;0.62;0.966	T	0.13764	-1.0497	9	0.11485	T	0.65	.	11.4557	0.50181	0.1799:0.8201:0.0:0.0	.	999;1061;1038	B7ZMJ3;F8WAD0;Q6UY14	.;.;ATL4_HUMAN	L	1038;1061;1038	ENSP00000271643:P1038L;ENSP00000358035:P1061L;ENSP00000358034:P1038L	ENSP00000271643:P1038L	P	+	2	0	ADAMTSL4	148799184	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.556000	0.45862	2.456000	0.83038	0.561000	0.74099	CCA	.		0.617	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084395.4	NM_019032	
SPTA1	6708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	158632609	158632609	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:158632609C>G	ENST00000368147.4	-	17	2527	c.2347G>C	c.(2347-2349)Gcc>Ccc	p.A783P		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	783					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTTCGGGTGGCCAGTGGCTCT	0.488																																					p.A783P		.											.	SPTA1-142	0			c.G2347C						.						96.0	97.0	97.0					1																	158632609		1919	4136	6055	SO:0001583	missense	6708	exon17			GGGTGGCCAGTGG	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2347G>C	1.37:g.158632609C>G	ENSP00000357129:p.Ala783Pro	150	0		209	44	NM_003126	0	0	0	0	0	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	37	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.364215	0.61513	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.54071	0.59;0.59	4.41	4.41	0.53225	.	0.598725	0.12700	N	0.446403	T	0.53722	0.1814	M	0.70595	2.14	0.47407	D	0.99941	P	0.44659	0.84	P	0.51550	0.673	T	0.52388	-0.8582	10	0.36615	T	0.2	.	13.8662	0.63590	0.0:1.0:0.0:0.0	.	783	P02549	SPTA1_HUMAN	P	783	ENSP00000357130:A783P;ENSP00000357129:A783P	ENSP00000357129:A783P	A	-	1	0	SPTA1	156899233	0.978000	0.34361	0.954000	0.39281	0.522000	0.34438	1.586000	0.36611	2.270000	0.75569	0.655000	0.94253	GCC	.		0.488	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
DUSP12	11266	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	161722196	161722196	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:161722196C>T	ENST00000367943.4	+	4	648	c.616C>T	c.(616-618)Cca>Tca	p.P206S		NM_007240.1	NP_009171.1	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	206					cellular protein modification process (GO:0006464)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of glucokinase activity (GO:0033133)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|lung(1)	5	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			TGCTGTTGACCCAACTACCGT	0.313																																					p.P206S		.											.	DUSP12-226	0			c.C616T						.						111.0	125.0	120.0					1																	161722196		2203	4299	6502	SO:0001583	missense	11266	exon4			GTTGACCCAACTA	AF119226	CCDS1234.1	1q21-q22	2011-06-09			ENSG00000081721	ENSG00000081721		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3067	protein-coding gene	gene with protein product	"""serine/threonine specific protein phosphatase"", ""YVH1 protein-tyrosine phosphatase (S. cerevisiae) ortholog"""	604835				10446167	Standard	XM_005244862		Approved	YVH1, DUSP1	uc001gbo.3	Q9UNI6	OTTHUMG00000034540	ENST00000367943.4:c.616C>T	1.37:g.161722196C>T	ENSP00000356920:p.Pro206Ser	261	2		319	135	NM_007240	0	0	13	20	7	Q5VXA8	Missense_Mutation	SNP	ENST00000367943.4	37	CCDS1234.1	.	.	.	.	.	.	.	.	.	.	C	19.46	3.831995	0.71258	.	.	ENSG00000081721	ENST00000367943	T	0.03951	3.75	4.86	4.86	0.63082	.	0.000000	0.46442	D	0.000285	T	0.16514	0.0397	M	0.87180	2.865	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.02676	-1.1125	9	0.33940	T	0.23	.	15.5468	0.76108	0.0:1.0:0.0:0.0	.	206	Q9UNI6	DUS12_HUMAN	S	206	ENSP00000356920:P206S	ENSP00000356920:P206S	P	+	1	0	DUSP12	159988820	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	5.898000	0.69838	2.528000	0.85240	0.591000	0.81541	CCA	.		0.313	DUSP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083588.1	NM_007240	
PTPN7	5778	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	202122941	202122941	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:202122941G>T	ENST00000308986.5	-	7	759	c.629C>A	c.(628-630)aCa>aAa	p.T210K	PTPN7_ENST00000309017.3_Missense_Mutation_p.T315K|PTPN7_ENST00000543735.1_Missense_Mutation_p.T39K|PTPN7_ENST00000492977.1_5'UTR|PTPN7_ENST00000367279.4_Missense_Mutation_p.T249K|PTPN7_ENST00000544762.1_Intron			P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type 7	210	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|soft_tissue(1)|urinary_tract(1)	13						TTCCTCTTCTGTGGGCCAGTA	0.582																																					p.T315K		.											.	PTPN7-227	0			c.C944A						.						124.0	114.0	118.0					1																	202122941		2203	4300	6503	SO:0001583	missense	5778	exon7			TCTTCTGTGGGCC	BC001746	CCDS1422.1, CCDS1423.1, CCDS1423.2	1q32.1	2011-06-09			ENSG00000143851	ENSG00000143851		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9659	protein-coding gene	gene with protein product		176889				1510684	Standard	NM_002832		Approved	HEPTP, LC-PTP	uc010ppx.2	P35236	OTTHUMG00000035931	ENST00000308986.5:c.629C>A	1.37:g.202122941G>T	ENSP00000311133:p.Thr210Lys	100	0		144	22	NM_002832	0	0	0	0	0	B3KXE1|Q53XK4|Q5SXQ0|Q5SXQ1|Q9BV05	Missense_Mutation	SNP	ENST00000308986.5	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.16|13.16	2.153450|2.153450	0.38021|0.38021	.|.	.|.	ENSG00000143851|ENSG00000143851	ENST00000477625|ENST00000367279;ENST00000309017;ENST00000308986;ENST00000543735;ENST00000477554	.|D;D;D;D;D	.|0.82711	.|-1.64;-1.64;-1.64;-1.64;-1.64	4.91|4.91	4.0|4.0	0.46444|0.46444	.|Protein-tyrosine phosphatase, receptor/non-receptor type (3);	.|0.329046	.|0.26352	.|N	.|0.024877	T|T	0.65069|0.65069	0.2656|0.2656	N|N	0.10809|0.10809	0.05|0.05	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B	.|0.24186	.|0.099;0.002;0.045;0.002;0.008	.|B;B;B;B;B	.|0.27380	.|0.079;0.006;0.041;0.01;0.011	T|T	0.56511|0.56511	-0.7967|-0.7967	5|10	.|0.22109	.|T	.|0.4	.|.	6.9755|6.9755	0.24672|0.24672	0.089:0.0:0.6198:0.2912|0.089:0.0:0.6198:0.2912	.|.	.|284;158;162;210;249	.|B4DZD9;B4DVF0;Q8NFX3;P35236;P35236-2	.|.;.;.;PTN7_HUMAN;.	Q|K	141|249;315;210;39;291	.|ENSP00000356248:T249K;ENSP00000309116:T315K;ENSP00000311133:T210K;ENSP00000444624:T39K;ENSP00000418416:T291K	.|ENSP00000311133:T210K	H|T	-|-	3|2	2|0	PTPN7|PTPN7	200389564|200389564	0.999000|0.999000	0.42202|0.42202	0.987000|0.987000	0.45799|0.45799	0.983000|0.983000	0.72400|0.72400	3.917000|3.917000	0.56424|0.56424	1.180000|1.180000	0.42898|0.42898	0.563000|0.563000	0.77884|0.77884	CAC|ACA	.		0.582	PTPN7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_002832	
KCNH1	3756	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	210857405	210857405	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:210857405T>G	ENST00000271751.4	-	11	2215	c.2188A>C	c.(2188-2190)Atc>Ctc	p.I730L	KCNH1_ENST00000367007.4_Missense_Mutation_p.I703L			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	730	Calmodulin-binding.				myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GGGGGCAAGATCAGGGGGGCC	0.572																																					p.I730L		.											.	KCNH1-94	0			c.A2188C						.						59.0	58.0	59.0					1																	210857405		2203	4300	6503	SO:0001583	missense	3756	exon11			GCAAGATCAGGGG	AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.2188A>C	1.37:g.210857405T>G	ENSP00000271751:p.Ile730Leu	22	0		45	10	NM_172362	0	0	0	0	0	B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	ENST00000271751.4	37	CCDS1496.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.227949	0.39399	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	T;T	0.16597	2.33;2.33	4.49	4.49	0.54785	.	0.101242	0.64402	D	0.000003	T	0.15696	0.0378	L	0.51422	1.61	0.34129	D	0.665068	B;B	0.14438	0.004;0.01	B;B	0.12156	0.007;0.007	T	0.11108	-1.0601	10	0.32370	T	0.25	.	9.2766	0.37703	0.0:0.0859:0.0:0.9141	.	703;730	Q14CL3;O95259	.;KCNH1_HUMAN	L	730;703	ENSP00000271751:I730L;ENSP00000355974:I703L	ENSP00000271751:I730L	I	-	1	0	KCNH1	208924028	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	4.005000	0.57075	1.667000	0.50832	0.379000	0.24179	ATC	.		0.572	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088332.1	NM_002238	
USH2A	7399	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	215821063	215821063	+	Silent	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:215821063G>T	ENST00000307340.3	-	67	14978	c.14592C>A	c.(14590-14592)ctC>ctA	p.L4864L	USH2A_ENST00000366943.2_Silent_p.L4864L	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4864	Fibronectin type-III 34. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CGTGGAATTGGAGTTCATAGC	0.473										HNSCC(13;0.011)																											p.L4864L		.											.	USH2A-115	0			c.C14592A						.						50.0	50.0	50.0					1																	215821063		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon67			GAATTGGAGTTCA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.14592C>A	1.37:g.215821063G>T		29	0		50	10	NM_206933	0	0	0	0	0	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	37	CCDS31025.1																																																																																			.		0.473	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
TRIM11	81559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	228582932	228582932	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr1:228582932T>C	ENST00000284551.6	-	6	1159	c.881A>G	c.(880-882)gAc>gGc	p.D294G	RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000460651.1_5'UTR|TRIM11_ENST00000493030.2_Missense_Mutation_p.D169G	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	294	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				GTTGGCGGTGTCCGGGTCCAA	0.672																																					p.D294G		.											.	TRIM11-658	0			c.A881G						.						16.0	18.0	17.0					1																	228582932		2193	4293	6486	SO:0001583	missense	81559	exon6			GCGGTGTCCGGGT	AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.881A>G	1.37:g.228582932T>C	ENSP00000284551:p.Asp294Gly	25	0		43	9	NM_145214	0	0	20	30	10	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Missense_Mutation	SNP	ENST00000284551.6	37	CCDS31048.1	.	.	.	.	.	.	.	.	.	.	T	14.70	2.614215	0.46631	.	.	ENSG00000154370	ENST00000284551	T	0.04970	3.52	5.29	5.29	0.74685	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.239709	0.29321	N	0.012493	T	0.18425	0.0442	M	0.81682	2.555	0.80722	D	1	B;B	0.29212	0.221;0.237	B;P	0.46362	0.315;0.514	T	0.01578	-1.1320	10	0.48119	T	0.1	.	8.8825	0.35382	0.1667:0.0:0.0:0.8333	.	293;294	Q96F44-3;Q96F44	.;TRI11_HUMAN	G	294	ENSP00000284551:D294G	ENSP00000284551:D294G	D	-	2	0	TRIM11	226649555	0.980000	0.34600	0.642000	0.29436	0.076000	0.17211	3.813000	0.55636	2.130000	0.65690	0.533000	0.62120	GAC	.		0.672	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095995.3	NM_145214	
CCDC3	83643	bcgsc.ca	37	10	12940564	12940564	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr10:12940564T>A	ENST00000378825.3	-	3	791	c.665A>T	c.(664-666)aAg>aTg	p.K222M	CCDC3_ENST00000378839.1_Missense_Mutation_p.K97M	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	222						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			CTTGACCTTCTTCACTCGCTC	0.632																																					p.K222M		.											.	CCDC3-91	0			c.A665T						.						78.0	77.0	77.0					10																	12940564		2203	4300	6503	SO:0001583	missense	83643	exon3			ACCTTCTTCACTC	BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.665A>T	10.37:g.12940564T>A	ENSP00000368102:p.Lys222Met	133	0		137	6	NM_031455	0	0	0	0	0	Q5VYV8|Q5VYV9	Missense_Mutation	SNP	ENST00000378825.3	37	CCDS7093.1	.	.	.	.	.	.	.	.	.	.	T	19.61	3.860052	0.71834	.	.	ENSG00000151468	ENST00000378839;ENST00000378825	T	0.22743	1.94	5.42	5.42	0.78866	.	0.133905	0.49305	D	0.000141	T	0.40595	0.1123	L	0.59436	1.845	0.36316	D	0.85795	D	0.76494	0.999	D	0.63192	0.912	T	0.51426	-0.8707	10	0.72032	D	0.01	-28.5483	14.6402	0.68717	0.0:0.0:0.0:1.0	.	222	Q9BQI4	CCDC3_HUMAN	M	97;222	ENSP00000368116:K97M	ENSP00000368102:K222M	K	-	2	0	CCDC3	12980570	0.999000	0.42202	0.996000	0.52242	0.694000	0.40290	3.398000	0.52579	2.062000	0.61559	0.459000	0.35465	AAG	.		0.632	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046829.1	NM_031455	
HSPA14	51182	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	14909858	14909859	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	TA	TA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr10:14909858_14909859delTA	ENST00000378372.3	+	12	1569_1570	c.1330_1331delTA	c.(1330-1332)tatfs	p.Y444fs		NM_016299.2	NP_057383.2	Q0VDF9	HSP7E_HUMAN	heat shock 70kDa protein 14	444					'de novo' cotranslational protein folding (GO:0051083)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)			breast(4)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	17						CCTTGAACTCTATGAGTCTGAT	0.436																																					p.444_444del		.											.	HSPA14-291	0			c.1330_1331del						.																																			SO:0001589	frameshift_variant	51182	exon12			GAACTCTATGAGT	AF112210	CCDS7103.1, CCDS60487.1	10p13	2011-09-02			ENSG00000187522	ENSG00000187522		"""Heat shock proteins / HSP70"""	29526	protein-coding gene	gene with protein product		610369				12477932	Standard	NM_016299		Approved	HSP70-4, HSP70L1	uc001ind.4	Q0VDF9	OTTHUMG00000017712	ENST00000378372.3:c.1330_1331delTA	10.37:g.14909858_14909859delTA	ENSP00000367623:p.Tyr444fs	120	0		158	60	NM_016299	0	0	0	0	0	A8K8F8|B0YIY9|Q9P0X2|Q9UI07	Frame_Shift_Del	DEL	ENST00000378372.3	37	CCDS7103.1																																																																																			.		0.436	HSPA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046910.1	NM_016299	
OLAH	55301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	15103749	15103749	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr10:15103749G>C	ENST00000378228.3	+	4	444	c.190G>C	c.(190-192)Gaa>Caa	p.E64Q	OLAH_ENST00000378217.3_Missense_Mutation_p.E117Q	NM_001039702.2	NP_001034791.1	Q9NV23	SAST_HUMAN	oleoyl-ACP hydrolase	64					fatty acid biosynthetic process (GO:0006633)		myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)			endometrium(2)|large_intestine(1)|lung(14)|stomach(1)	18						TCCTGGAAGAGAAAGCAGAGT	0.423																																					p.E117Q		.											.	OLAH-68	0			c.G349C						.						117.0	112.0	114.0					10																	15103749		2203	4300	6503	SO:0001583	missense	55301	exon5			GGAAGAGAAAGCA	AK001844	CCDS7106.1, CCDS31152.1	10p13	2010-11-23	2006-07-07	2006-07-07	ENSG00000152463	ENSG00000152463	3.1.2.14		25625	protein-coding gene	gene with protein product			"""thioesterase domain containing 1"""	THEDC1			Standard	NM_018324		Approved	FLJ11106, SAST	uc001inu.2	Q9NV23	OTTHUMG00000017724	ENST00000378228.3:c.190G>C	10.37:g.15103749G>C	ENSP00000367473:p.Glu64Gln	144	0		150	35	NM_018324	0	0	0	0	0	Q5VUB6|Q9NUW1	Missense_Mutation	SNP	ENST00000378228.3	37	CCDS31152.1	.	.	.	.	.	.	.	.	.	.	g	14.62	2.590867	0.46214	.	.	ENSG00000152463	ENST00000428897;ENST00000429028;ENST00000378228;ENST00000378225;ENST00000378217	.	.	.	5.07	5.07	0.68467	Thioesterase (1);	0.000000	0.85682	D	0.000000	T	0.73071	0.3540	L	0.54908	1.71	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.992	T	0.67647	-0.5617	9	0.15952	T	0.53	-27.7099	15.9808	0.80108	0.0:0.0:1.0:0.0	.	64;117	Q9NV23;Q9NV23-2	SAST_HUMAN;.	Q	64;64;64;85;117	.	ENSP00000367462:E117Q	E	+	1	0	OLAH	15143755	1.000000	0.71417	0.995000	0.50966	0.322000	0.28314	4.733000	0.62036	2.364000	0.80123	0.650000	0.86243	GAA	.		0.423	OLAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046964.1	NM_018324	
FRMPD2	143162	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	49440201	49440201	+	Silent	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr10:49440201G>A	ENST00000374201.3	-	10	1427	c.1125C>T	c.(1123-1125)gcC>gcT	p.A375A	FRMPD2_ENST00000407470.4_Silent_p.A344A|FRMPD2_ENST00000305531.3_Silent_p.A351A	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	375	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CCTCGAGGTTGGCAAAGGATG	0.527																																					p.A375A		.											.	FRMPD2-153	0			c.C1125T						.						156.0	142.0	146.0					10																	49440201		2203	4300	6503	SO:0001819	synonymous_variant	143162	exon10			GAGGTTGGCAAAG	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.1125C>T	10.37:g.49440201G>A		124	0		138	47	NM_001018071	0	0	0	0	0	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	ENST00000374201.3	37	CCDS31195.1																																																																																			.		0.527	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047923.3	NM_152428	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	61835910	61835910	+	Missense_Mutation	SNP	T	T	A	rs201650334		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr10:61835910T>A	ENST00000280772.2	-	37	4920	c.4729A>T	c.(4729-4731)Atg>Ttg	p.M1577L	ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1577	Ser-rich.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GGCGAAGACATTGTCCGAAAG	0.463																																					p.M1577L		.											.	ANK3-107	0			c.A4729T						.						203.0	181.0	188.0					10																	61835910		2203	4300	6503	SO:0001583	missense	288	exon37			AAGACATTGTCCG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4729A>T	10.37:g.61835910T>A	ENSP00000280772:p.Met1577Leu	255	0		340	72	NM_020987	0	0	0	0	0	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	T	11.90	1.776680	0.31411	.	.	ENSG00000151150	ENST00000280772	T	0.60797	0.16	5.78	1.62	0.23740	.	0.861607	0.09681	N	0.769743	T	0.42223	0.1193	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15492	-1.0435	10	0.42905	T	0.14	.	10.7522	0.46216	0.0:0.2147:0.0:0.7853	.	1577	Q12955	ANK3_HUMAN	L	1577	ENSP00000280772:M1577L	ENSP00000280772:M1577L	M	-	1	0	ANK3	61505916	1.000000	0.71417	0.995000	0.50966	0.936000	0.57629	3.256000	0.51492	0.419000	0.25927	0.482000	0.46254	ATG	.		0.463	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
CYP26C1	340665	broad.mit.edu	37	10	94828150	94828150	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr10:94828150G>A	ENST00000285949.5	+	6	1265	c.1265G>A	c.(1264-1266)cGc>cAc	p.R422H		NM_183374.2	NP_899230.2	Q6V0L0	CP26C_HUMAN	cytochrome P450, family 26, subfamily C, polypeptide 1	422					anterior/posterior pattern specification (GO:0009952)|central nervous system development (GO:0007417)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|neural crest cell development (GO:0014032)|organelle fusion (GO:0048284)|oxidation-reduction process (GO:0055114)|retinoic acid catabolic process (GO:0034653)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|retinoic acid 4-hydroxylase activity (GO:0008401)|retinoic acid binding (GO:0001972)			central_nervous_system(1)|lung(3)|ovary(1)	5		Colorectal(252;0.122)				GCGGTGTACCGCAGCCCTCCC	0.662																																					p.R422H		.											.	CYP26C1-90	0			c.G1265A						.						23.0	28.0	26.0					10																	94828150		2084	4099	6183	SO:0001583	missense	340665	exon6			TGTACCGCAGCCC		CCDS7425.1	10q23.33	2003-11-20			ENSG00000187553	ENSG00000187553		"""Cytochrome P450s"""	20577	protein-coding gene	gene with protein product		608428					Standard	XR_246086		Approved		uc010qns.2	Q6V0L0	OTTHUMG00000018766	ENST00000285949.5:c.1265G>A	10.37:g.94828150G>A	ENSP00000285949:p.Arg422His	73	0		85	4	NM_183374	0	0	0	0	0	Q5VXH6	Missense_Mutation	SNP	ENST00000285949.5	37	CCDS7425.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081325	0.76528	.	.	ENSG00000187553	ENST00000285949	T	0.70749	-0.51	5.17	3.29	0.37713	.	0.435419	0.26646	N	0.023232	T	0.56426	0.1984	N	0.20685	0.6	0.25997	N	0.982173	P	0.50156	0.932	P	0.46144	0.505	T	0.50955	-0.8766	10	0.51188	T	0.08	-3.5919	7.1406	0.25554	0.3804:0.0:0.6196:0.0	.	422	Q6V0L0	CP26C_HUMAN	H	422	ENSP00000285949:R422H	ENSP00000285949:R422H	R	+	2	0	CYP26C1	94818140	1.000000	0.71417	0.992000	0.48379	0.958000	0.62258	3.253000	0.51469	1.173000	0.42796	0.555000	0.69702	CGC	.		0.662	CYP26C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049409.2	NM_183374	
LMNTD2	256329	hgsc.bcm.edu	37	11	560710	560710	+	Missense_Mutation	SNP	A	A	G	rs200922487	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr11:560710A>G	ENST00000329451.3	-	1	69	c.7T>C	c.(7-9)Tgg>Cgg	p.W3R	RASSF7_ENST00000397583.3_5'Flank|RP11-496I9.1_ENST00000527113.1_RNA|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000397582.3_5'Flank|RASSF7_ENST00000344375.4_5'Flank|RASSF7_ENST00000454668.2_5'Flank|RASSF7_ENST00000431809.1_Intron	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN		3										NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCCGCAGCCACCGCATTTCC	0.736													A|||	12	0.00239617	0.0008	0.0014	5008	,	,		9417	0.0		0.008	False		,,,				2504	0.002				p.W3R		.											.	C11orf35-69	0			c.T7C						.	A	ARG/TRP	6,3474		0,6,1734	3.0	4.0	4.0		7	-5.7	0.0	11		4	34,7044		0,34,3505	yes	missense	C11orf35	NM_173573.2	101	0,40,5239	GG,GA,AA		0.4804,0.1724,0.3789	benign	3/635	560710	40,10518	1740	3539	5279	SO:0001583	missense	256329	exon1			GCAGCCACCGCAT																												ENST00000329451.3:c.7T>C	11.37:g.560710A>G	ENSP00000331167:p.Trp3Arg	3	0		12	8	NM_173573	0	0	0	0	0		Missense_Mutation	SNP	ENST00000329451.3	37	CCDS7701.1	.	.	.	.	.	.	.	.	.	.	A	15.10	2.733365	0.48939	0.001724	0.004804	ENSG00000185522	ENST00000329451	T	0.47177	0.85	2.84	-5.68	0.02436	.	2.983990	0.01494	N	0.017215	T	0.28532	0.0706	N	0.19112	0.55	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.15954	-1.0419	10	0.87932	D	0	.	2.3052	0.04173	0.5472:0.1407:0.1709:0.1412	.	3	Q8IXW0	CK035_HUMAN	R	3	ENSP00000331167:W3R	ENSP00000331167:W3R	W	-	1	0	C11orf35	550710	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.191000	0.01246	-1.245000	0.02513	-1.262000	0.01453	TGG	.		0.736	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254973.2		
DCDC1	341019	broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	31349747	31349747	+	Silent	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr11:31349747T>C	ENST00000452803.1	-	3	282	c.81A>G	c.(79-81)gtA>gtG	p.V27V	DCDC1_ENST00000597505.1_Silent_p.V27V	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	27					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TTTGCTGTAATACTTCCATTG	0.358																																					p.V27V		.											.	DCDC1-91	0			c.A81G						.						111.0	102.0	105.0					11																	31349747		2202	4299	6501	SO:0001819	synonymous_variant	341019	exon3			CTGTAATACTTCC	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.81A>G	11.37:g.31349747T>C		59	0		50	6	NM_181807	0	0	0	0	0	A6PVL6|B7WNX6|Q6ZU04	Silent	SNP	ENST00000452803.1	37	CCDS7872.1																																																																																			.		0.358	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807	
WT1-AS	51352	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	32461206	32461206	+	RNA	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr11:32461206C>A	ENST00000395900.1	+	0	2084				WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000442957.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000494911.1_RNA	NR_023920.1		Q06250	WIT1_HUMAN	WT1 antisense RNA											endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6						CCCCTCTCCCCCAGTTCGCAG	0.602																																					.		.											.	WT1-AS-68	0			.						.																																					51352	.			TCTCCCCCAGTTC	BC002734		11p13	2012-10-19	2012-08-15	2012-01-25	ENSG00000183242	ENSG00000183242		"""Long non-coding RNAs"", ""-"""	18135	non-coding RNA	RNA, long non-coding	"""Wilms tumor associated protein"""	607899	"""Wilms tumor upstream neighbor 1"", ""WT1 antisense RNA (non-protein coding)"""	WIT1		2173145, 8406502, 17210670	Standard	NR_120546		Approved	WIT-1, WT1AS, WT1-AS1	uc010red.2	Q06250	OTTHUMG00000039557		11.37:g.32461206C>A		99	0		82	32	.	0	0	0	0	0	Q4KMY0|Q96A27	RNA	SNP	ENST00000395900.1	37																																																																																				.		0.602	WT1-AS-001	KNOWN	basic	antisense	antisense	OTTHUMT00000095437.1	NR_023920	
OR4C11	219429	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	55371204	55371204	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr11:55371204A>G	ENST00000302231.4	-	1	670	c.646T>C	c.(646-648)Tat>Cat	p.Y216H		NM_001004700.2	NP_001004700.2	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C, member 11	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|prostate(1)|skin(1)	33						ATGACAATATATGAAATTATC	0.403																																					p.Y216H		.											.	OR4C11-69	0			c.T646C						.						78.0	68.0	72.0					11																	55371204		2176	4004	6180	SO:0001583	missense	219429	exon1			CAATATATGAAAT	AB065774	CCDS31503.1	11q11	2012-08-09		2004-03-10	ENSG00000172188	ENSG00000172188		"""GPCR / Class A : Olfactory receptors"""	15167	protein-coding gene	gene with protein product				OR4C11P			Standard	NM_001004700		Approved		uc010rii.2	Q6IEV9	OTTHUMG00000165290	ENST00000302231.4:c.646T>C	11.37:g.55371204A>G	ENSP00000306651:p.Tyr216His	96	0		95	35	NM_001004700	0	0	0	0	0	B9EIL4|Q8NGL8	Missense_Mutation	SNP	ENST00000302231.4	37	CCDS31503.1	.	.	.	.	.	.	.	.	.	.	A	11.79	1.743715	0.30865	.	.	ENSG00000172188	ENST00000302231	T	0.00515	6.87	4.34	4.34	0.51931	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	U	0.000473	T	0.03651	0.0104	H	0.98333	4.205	0.22989	N	0.998468	D	0.89917	1.0	D	0.76071	0.987	T	0.17837	-1.0356	10	0.87932	D	0	.	12.7832	0.57489	1.0:0.0:0.0:0.0	.	216	Q6IEV9	OR4CB_HUMAN	H	216	ENSP00000306651:Y216H	ENSP00000306651:Y216H	Y	-	1	0	OR4C11	55127780	1.000000	0.71417	0.058000	0.19502	0.011000	0.07611	7.445000	0.80570	1.962000	0.57031	0.391000	0.25812	TAT	.		0.403	OR4C11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383268.1	NM_001004700	
CD248	57124	broad.mit.edu;bcgsc.ca	37	11	66084195	66084195	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr11:66084195C>T	ENST00000311330.3	-	1	320	c.304G>A	c.(304-306)Ggc>Agc	p.G102S	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	102	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CACGTGAAGCCGCGCAGTGGG	0.726																																					p.G102S		.											.	CD248-154	0			c.G304A						.						24.0	24.0	24.0					11																	66084195		2132	4198	6330	SO:0001583	missense	57124	exon1			TGAAGCCGCGCAG	AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.304G>A	11.37:g.66084195C>T	ENSP00000308117:p.Gly102Ser	21	0		49	8	NM_020404	0	0	1	1	0	Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	ENST00000311330.3	37	CCDS8134.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700617	0.88924	.	.	ENSG00000174807	ENST00000311330	T	0.16897	2.31	3.96	3.96	0.45880	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.64402	U	0.000001	T	0.28134	0.0694	N	0.25380	0.74	0.54753	D	0.999988	D	0.89917	1.0	D	0.97110	1.0	T	0.06058	-1.0848	10	0.72032	D	0.01	-17.8428	13.5165	0.61543	0.0:1.0:0.0:0.0	.	102	Q9HCU0	CD248_HUMAN	S	102	ENSP00000308117:G102S	ENSP00000308117:G102S	G	-	1	0	CD248	65840771	1.000000	0.71417	0.986000	0.45419	0.932000	0.56968	6.766000	0.74970	2.033000	0.60031	0.491000	0.48974	GGC	.		0.726	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392922.2	NM_020404	
RAB6A	5870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	73441848	73441848	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr11:73441848T>C	ENST00000336083.3	-	2	546	c.91A>G	c.(91-93)Acc>Gcc	p.T31A	RAB6A_ENST00000541588.1_Missense_Mutation_p.T31A|RAB6A_ENST00000536566.1_5'UTR|RAB6A_ENST00000310653.6_Missense_Mutation_p.T31A	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family	31					antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)			large_intestine(2)|lung(2)	4						ATGAATCTGGTGATCAAAGAT	0.308																																					p.T31A		.											.	RAB6A-227	0			c.A91G						.						104.0	105.0	105.0					11																	73441848		2200	4293	6493	SO:0001583	missense	5870	exon2			ATCTGGTGATCAA	AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.91A>G	11.37:g.73441848T>C	ENSP00000336850:p.Thr31Ala	226	0		227	60	NM_002869	0	0	4	9	5	A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Missense_Mutation	SNP	ENST00000336083.3	37	CCDS8224.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.109517	0.77096	.	.	ENSG00000175582	ENST00000310653;ENST00000336083;ENST00000393571;ENST00000541588;ENST00000540771;ENST00000539750;ENST00000535748;ENST00000542366	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.02	4.59	4.59	0.56863	Small GTP-binding protein domain (1);	0.048311	0.85682	D	0.000000	T	0.81019	0.4736	N	0.17764	0.52	0.80722	D	1	D;D;B;B	0.76494	0.971;0.999;0.032;0.104	D;D;B;B	0.80764	0.93;0.994;0.141;0.122	T	0.82208	-0.0571	10	0.52906	T	0.07	.	11.4519	0.50158	0.0:0.0:0.0:1.0	.	31;31;31;31	Q1W5D8;F5H3K7;P20340;P20340-2	.;.;RAB6A_HUMAN;.	A	31	ENSP00000311449:T31A;ENSP00000336850:T31A;ENSP00000445350:T31A;ENSP00000438842:T31A	ENSP00000311449:T31A	T	-	1	0	RAB6A	73119496	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.411000	0.73298	1.927000	0.55829	0.455000	0.32223	ACC	.		0.308	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259241.2		
TAF1D	79101	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	93471576	93471576	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr11:93471576A>C	ENST00000448108.2	-	3	808	c.158T>G	c.(157-159)gTt>gGt	p.V53G	TAF1D_ENST00000546088.1_5'Flank	NM_024116.3	NP_077021.1	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa	53					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(3)|prostate(1)|skin(2)	7						AGGTGTACGAACAAATTTTCG	0.353																																					p.V53G		.											.	TAF1D-90	0			c.T158G						.						75.0	77.0	76.0					11																	93471576		2201	4298	6499	SO:0001583	missense	79101	exon3			GTACGAACAAATT		CCDS8293.1	11q21	2012-05-30	2008-09-30	2008-09-30	ENSG00000166012	ENSG00000166012			28759	protein-coding gene	gene with protein product		612823	"""Josephin domain containing 3"""	JOSD3		15520167, 17318177	Standard	NM_024116		Approved	MGC5306, TAF(I)41	uc001pec.3	Q9H5J8	OTTHUMG00000167451	ENST00000448108.2:c.158T>G	11.37:g.93471576A>C	ENSP00000410409:p.Val53Gly	69	1		79	42	NM_024116	0	0	23	45	22	Q6I9Y6	Missense_Mutation	SNP	ENST00000448108.2	37	CCDS8293.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.357|2.357	-0.347403|-0.347403	0.05208|0.05208	.|.	.|.	ENSG00000166012|ENSG00000166012	ENST00000532455|ENST00000448108	.|.	.|.	.|.	5.04|5.04	2.73|2.73	0.32206|0.32206	.|.	.|0.737545	.|0.12807	.|N	.|0.437466	T|T	0.35480|0.35480	0.0933|0.0933	L|L	0.34521|0.34521	1.04|1.04	0.18873|0.18873	N|N	0.999982|0.999982	.|D	.|0.55605	.|0.972	.|P	.|0.52159	.|0.691	T|T	0.13019|0.13019	-1.0525|-1.0525	5|9	.|0.66056	.|D	.|0.02	-17.0302|-17.0302	6.4523|6.4523	0.21910|0.21910	0.8034:0.0:0.1966:0.0|0.8034:0.0:0.1966:0.0	.|.	.|53	.|Q9H5J8	.|TAF1D_HUMAN	W|G	88|53	.|.	.|ENSP00000314971:V53G	C|V	-|-	3|2	2|0	TAF1D|TAF1D	93111224|93111224	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.007000|0.007000	0.05969|0.05969	0.505000|0.505000	0.22642|0.22642	0.366000|0.366000	0.24427|0.24427	0.482000|0.482000	0.46254|0.46254	TGT|GTT	.		0.353	TAF1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394662.2	NM_024116	
MRE11A	4361	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	94201026	94201026	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr11:94201026G>A	ENST00000323929.3	-	10	1273	c.1051C>T	c.(1051-1053)Cgt>Tgt	p.R351C	MRE11A_ENST00000323977.3_Missense_Mutation_p.R351C|MRE11A_ENST00000407439.3_Missense_Mutation_p.R354C|MRE11A_ENST00000393241.4_Missense_Mutation_p.R351C|MIR548L_ENST00000408303.1_RNA	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	351					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				TTACCCAGACGTTCCCGTTCA	0.338								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																												p.R351C		.											.	MRE11A-722	0			c.C1051T						.						86.0	89.0	88.0					11																	94201026		2201	4298	6499	SO:0001583	missense	4361	exon10	Familial Cancer Database	ATLD	CCAGACGTTCCCG	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.1051C>T	11.37:g.94201026G>A	ENSP00000325863:p.Arg351Cys	169	1		139	28	NM_005591	0	0	10	11	1	O43475	Missense_Mutation	SNP	ENST00000323929.3	37	CCDS8299.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238517	0.79800	.	.	ENSG00000020922	ENST00000323929;ENST00000407439;ENST00000323977;ENST00000393241	T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1	6.06	6.06	0.98353	Mre11, DNA-binding (1);	0.043745	0.85682	D	0.000000	D	0.87537	0.6202	M	0.72118	2.19	0.80722	D	1	D;D;D	0.89917	0.999;0.998;1.0	P;P;D	0.67548	0.896;0.756;0.952	D	0.84911	0.0848	10	0.38643	T	0.18	-14.8308	20.6208	0.99490	0.0:0.0:1.0:0.0	.	354;351;351	B3KTC7;P49959-2;P49959	.;.;MRE11_HUMAN	C	351;354;351;351	ENSP00000325863:R351C;ENSP00000385614:R354C;ENSP00000326094:R351C;ENSP00000376933:R351C	ENSP00000325863:R351C	R	-	1	0	MRE11A	93840674	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.062000	0.57492	2.882000	0.98803	0.655000	0.94253	CGT	.		0.338	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396237.3	NM_005591	
VWF	7450	broad.mit.edu;bcgsc.ca	37	12	6128740	6128740	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:6128740G>C	ENST00000261405.5	-	28	4098	c.3844C>G	c.(3844-3846)Ctg>Gtg	p.L1282V		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1282	VWFA 1; binding site for platelet glycoprotein Ib. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GAGCCATCCAGCAGGAAGACC	0.597																																					p.L1282V		.											.	VWF-163	0			c.C3844G						.						77.0	75.0	76.0					12																	6128740		2203	4300	6503	SO:0001583	missense	7450	exon28			CATCCAGCAGGAA		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3844C>G	12.37:g.6128740G>C	ENSP00000261405:p.Leu1282Val	241	0		221	9	NM_000552	0	0	8	8	0	Q8TCE8|Q99806	Missense_Mutation	SNP	ENST00000261405.5	37	CCDS8539.1	.	.	.	.	.	.	.	.	.	.	.	13.64	2.296104	0.40594	.	.	ENSG00000110799	ENST00000261405	D	0.98329	-4.87	5.15	4.24	0.50183	von Willebrand factor, type A (3);	0.000000	0.34777	N	0.003697	D	0.98639	0.9544	M	0.91249	3.19	0.80722	D	1	D	0.61697	0.99	D	0.79108	0.992	D	0.97350	0.9963	10	0.26408	T	0.33	.	4.4509	0.11619	0.0821:0.2539:0.5228:0.1412	.	1282	P04275	VWF_HUMAN	V	1282	ENSP00000261405:L1282V	ENSP00000261405:L1282V	L	-	1	2	VWF	5999001	0.999000	0.42202	1.000000	0.80357	0.966000	0.64601	0.706000	0.25690	2.688000	0.91661	0.555000	0.69702	CTG	.		0.597	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
C12orf57	113246	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	7053766	7053766	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:7053766G>T	ENST00000229281.5	+	2	279	c.180G>T	c.(178-180)caG>caT	p.Q60H	U47924.31_ENST00000607421.1_RNA|C12orf57_ENST00000540506.2_Missense_Mutation_p.Q25H|PTPN6_ENST00000447931.2_5'Flank|RNU7-1_ENST00000458811.1_RNA|C12orf57_ENST00000542222.1_3'UTR|C12orf57_ENST00000537087.1_Intron|C12orf57_ENST00000544681.1_Missense_Mutation_p.Q60H|PTPN6_ENST00000399448.1_5'Flank	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57	60						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						TGGCCACGCAGATCCAGCAGG	0.627											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q60H		.											.	C12orf57-90	0			c.G180T						.						82.0	65.0	71.0					12																	7053766		2203	4300	6503	SO:0001583	missense	113246	exon2			CACGCAGATCCAG	U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	ENST00000229281.5:c.180G>T	12.37:g.7053766G>T	ENSP00000229281:p.Gln60His	248	0	638	358	93	NM_138425	0	0	171	193	22	B2R4Q6	Missense_Mutation	SNP	ENST00000229281.5	37	CCDS8571.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037762	0.93630	.	.	ENSG00000111678	ENST00000545581;ENST00000229281	T;T	0.79940	-1.32;-1.32	3.74	3.74	0.42951	.	0.000000	0.85682	D	0.000000	D	0.86802	0.6020	M	0.64404	1.975	0.80722	D	1	D	0.69078	0.997	D	0.66847	0.947	D	0.88406	0.3018	10	0.87932	D	0	-14.1499	14.5671	0.68185	0.0:0.0:1.0:0.0	.	60	Q99622	C10_HUMAN	H	60	ENSP00000440602:Q60H;ENSP00000229281:Q60H	ENSP00000229281:Q60H	Q	+	3	2	C12orf57	6924027	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.006000	0.63978	2.373000	0.80994	0.561000	0.74099	CAG	.		0.627	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401959.1	NM_138425	
PIK3C2G	5288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	18491453	18491453	+	Silent	SNP	C	C	T	rs531110246		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:18491453C>T	ENST00000266497.5	+	8	1404	c.1366C>T	c.(1366-1368)Cta>Tta	p.L456L	PIK3C2G_ENST00000538779.1_Silent_p.L456L|PIK3C2G_ENST00000535651.1_Silent_p.L456L|PIK3C2G_ENST00000433979.1_Silent_p.L456L			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	456	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				AGTAAATGAACTAAGTCTAAT	0.313																																					p.L456L		.											.	PIK3C2G-1312	0			c.C1366T						.						133.0	132.0	132.0					12																	18491453		1847	4088	5935	SO:0001819	synonymous_variant	5288	exon9			AATGAACTAAGTC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1366C>T	12.37:g.18491453C>T		192	0		139	29	NM_004570	0	0	0	0	0	A1L3U0	Silent	SNP	ENST00000266497.5	37	CCDS44839.1																																																																																			.		0.313	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401316.1	NM_004570	
SLCO1C1	53919	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	20864373	20864373	+	Missense_Mutation	SNP	C	C	T	rs181627657		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:20864373C>T	ENST00000266509.2	+	5	826	c.458C>T	c.(457-459)cCg>cTg	p.P153L	SLCO1C1_ENST00000381552.1_Missense_Mutation_p.P153L|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.P153L|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.P153L|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.P35L	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	153					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)	p.P153L(1)		NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	AGCATCTCTCCGTGTCTCCTA	0.353													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19515	0.0		0.0	False		,,,				2504	0.0				p.P153L		.											.	SLCO1C1-97	1	Substitution - Missense(1)	large_intestine(1)	c.C458T						.						140.0	135.0	137.0					12																	20864373		2203	4300	6503	SO:0001583	missense	53919	exon5			TCTCTCCGTGTCT	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.458C>T	12.37:g.20864373C>T	ENSP00000266509:p.Pro153Leu	120	1		109	36	NM_017435	0	0	0	0	0	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	ENST00000266509.2	37	CCDS8683.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	10.50	1.367369	0.24771	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.56776	1.16;0.44;1.16;1.16;1.16	4.41	4.41	0.53225	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.229512	0.26026	N	0.026784	T	0.49440	0.1557	N	0.04705	-0.18	0.58432	D	0.999999	D;D;B;B	0.89917	1.0;1.0;0.361;0.201	D;D;B;B	0.74674	0.973;0.984;0.252;0.076	T	0.49925	-0.8887	10	0.19590	T	0.45	.	15.3566	0.74431	0.0:1.0:0.0:0.0	.	35;153;153;153	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	L	153;153;153;153;35	ENSP00000444149:P153L;ENSP00000438665:P153L;ENSP00000266509:P153L;ENSP00000370964:P153L;ENSP00000444527:P35L	ENSP00000266509:P153L	P	+	2	0	SLCO1C1	20755640	1.000000	0.71417	0.979000	0.43373	0.990000	0.78478	3.491000	0.53252	2.270000	0.75569	0.655000	0.94253	CCG	C|0.999;T|0.000		0.353	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		220	8		430	18	NM_032704	0	0	505	749	244		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
ATF1	466	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	51207830	51207830	+	Silent	SNP	T	T	C	rs186674535		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:51207830T>C	ENST00000262053.3	+	5	388	c.366T>C	c.(364-366)agT>agC	p.S122S	ATF1_ENST00000539132.1_5'UTR	NM_005171.4	NP_005162.1	P18846	ATF1_HUMAN	activating transcription factor 1	122					cellular protein complex assembly (GO:0043623)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to cobalt ion (GO:0032025)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/ATF1(347)|FUS/ATF1(4)	breast(1)|large_intestine(1)|ovary(2)	4					Pseudoephedrine(DB00852)	AGTTGGCAAGTCCAGGCACAG	0.408			T	"""EWSR1, FUS"""	"""malignant melanoma of soft parts , angiomatoid fibrous histiocytoma """																																p.S122S		.		Dom	yes		12	12q13	466	activating transcription factor 1		"""E, M"""	.	ATF1-685	0			c.T366C						.						84.0	78.0	80.0					12																	51207830		2203	4300	6503	SO:0001819	synonymous_variant	466	exon5			GGCAAGTCCAGGC	BC029619	CCDS8803.1	12q13	2014-05-13			ENSG00000123268	ENSG00000123268		"""basic leucine zipper proteins"""	783	protein-coding gene	gene with protein product		123803				8401579	Standard	NM_005171		Approved	TREB36	uc001rww.4	P18846		ENST00000262053.3:c.366T>C	12.37:g.51207830T>C		189	0		302	75	NM_005171	0	0	25	32	7	B4DRF9|P25168|Q9H4A8	Silent	SNP	ENST00000262053.3	37	CCDS8803.1																																																																																			T|0.999;G|0.000		0.408	ATF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404285.1	NM_005171	
OR6C2	341416	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	55846356	55846356	+	Missense_Mutation	SNP	G	G	A	rs187562104		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:55846356G>A	ENST00000322678.1	+	1	359	c.359G>A	c.(358-360)cGc>cAc	p.R120H	RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	120					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						TCCTATGACCGCTATGTGGCC	0.428													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21431	0.0		0.0	False		,,,				2504	0.0				p.R120H		.											.	OR6C2-70	0			c.G359A						.						154.0	135.0	141.0					12																	55846356		2203	4300	6503	SO:0001583	missense	341416	exon1			ATGACCGCTATGT	AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.359G>A	12.37:g.55846356G>A	ENSP00000323606:p.Arg120His	85	0		103	19	NM_054105	0	0	0	0	0		Missense_Mutation	SNP	ENST00000322678.1	37	CCDS31824.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	17.21	3.331462	0.60853	.	.	ENSG00000179695	ENST00000322678	T	0.77489	-1.1	5.42	2.65	0.31530	GPCR, rhodopsin-like superfamily (1);	0.204155	0.35067	N	0.003465	T	0.77363	0.4119	M	0.92169	3.28	0.30192	N	0.799431	P	0.45240	0.854	B	0.32624	0.149	T	0.77305	-0.2637	10	0.66056	D	0.02	.	9.7821	0.40653	0.2256:0.0:0.7744:0.0	.	120	Q9NZP2	OR6C2_HUMAN	H	120	ENSP00000323606:R120H	ENSP00000323606:R120H	R	+	2	0	OR6C2	54132623	0.986000	0.35501	0.995000	0.50966	0.916000	0.54674	4.236000	0.58675	0.427000	0.26145	0.609000	0.83330	CGC	G|0.999;A|0.001		0.428	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406676.1	NM_054105	
NABP2	79035	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56622965	56622965	+	Missense_Mutation	SNP	G	G	A	rs371882558		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:56622965G>A	ENST00000380198.2	+	6	1102	c.604G>A	c.(604-606)Ggc>Agc	p.G202S	SLC39A5_ENST00000454355.2_5'Flank|NABP2_ENST00000267023.4_Missense_Mutation_p.G202S|NABP2_ENST00000341463.5_Missense_Mutation_p.G202S|SLC39A5_ENST00000266980.4_5'Flank			Q9BQ15	SOSB1_HUMAN	nucleic acid binding protein 2	202					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)|SOSS complex (GO:0070876)	single-stranded DNA binding (GO:0003697)										TGTTAGTAACGGCAAAGAAAC	0.572																																					p.G202S		.											.	.	0			c.G604A						.						69.0	64.0	66.0					12																	56622965		2203	4300	6503	SO:0001583	missense	79035	exon7			AGTAACGGCAAAG	BC006171	CCDS8911.1	12q13.3	2012-06-19	2012-06-19	2012-06-19	ENSG00000139579	ENSG00000139579			28412	protein-coding gene	gene with protein product	"""single strand DNA-binding protein 1"", ""sensor of single-strand DNA complex subunit B1"""	612104	"""oligonucleotide/oligosaccharide-binding fold containing 2B"""	OBFC2B			Standard	NM_024068		Approved	MGC2731, SSB1, hSSB1, SOSS-B1	uc001ski.3	Q9BQ15	OTTHUMG00000152527	ENST00000380198.2:c.604G>A	12.37:g.56622965G>A	ENSP00000369545:p.Gly202Ser	102	0		155	20	NM_024068	0	0	29	38	9	A6NDF8|Q6XYC8	Missense_Mutation	SNP	ENST00000380198.2	37	CCDS8911.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.009789	0.75046	.	.	ENSG00000139579	ENST00000267023;ENST00000380198;ENST00000341463	T;T;T	0.70631	-0.5;-0.5;-0.5	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000010	T	0.81302	0.4794	L	0.59436	1.845	0.48395	D	0.999643	D	0.89917	1.0	D	0.76071	0.987	T	0.79827	-0.1639	9	.	.	.	-8.668	16.4418	0.83903	0.0:0.0:1.0:0.0	.	202	Q9BQ15	SOSB1_HUMAN	S	202	ENSP00000267023:G202S;ENSP00000369545:G202S;ENSP00000368862:G202S	.	G	+	1	0	OBFC2B	54909232	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.849000	0.69465	2.710000	0.92621	0.655000	0.94253	GGC	.		0.572	NABP2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326610.1	NM_024068	
AVPR1A	552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	63544072	63544072	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:63544072C>A	ENST00000299178.2	-	1	650	c.545G>T	c.(544-546)aGc>aTc	p.S182I		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	182					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	CTGCGGCGTGCTCAGCACGAA	0.652																																					p.S182I		.											.	AVPR1A-946	0			c.G545T						.						52.0	54.0	53.0					12																	63544072		2202	4299	6501	SO:0001583	missense	552	exon1			GGCGTGCTCAGCA	L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.545G>T	12.37:g.63544072C>A	ENSP00000299178:p.Ser182Ile	161	0		282	59	NM_000706	0	0	0	0	0		Missense_Mutation	SNP	ENST00000299178.2	37	CCDS8965.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170900	0.78452	.	.	ENSG00000166148	ENST00000299178	T	0.44482	0.92	5.19	5.19	0.71726	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.72534	0.3472	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79300	-0.1860	9	.	.	.	-34.6864	17.7032	0.88301	0.0:1.0:0.0:0.0	.	182	P37288	V1AR_HUMAN	I	182	ENSP00000299178:S182I	.	S	-	2	0	AVPR1A	61830339	1.000000	0.71417	1.000000	0.80357	0.602000	0.36980	5.912000	0.69948	2.416000	0.81992	0.455000	0.32223	AGC	.		0.652	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1		
LLPH	84298	broad.mit.edu	37	12	66517671	66517671	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:66517671C>T	ENST00000266604.2	-	3	409	c.339G>A	c.(337-339)aaG>aaA	p.K113K	LLPH_ENST00000446587.2_Silent_p.K113K	NM_032338.3	NP_115714.1	Q9BRT6	LLPH_HUMAN	LLP homolog, long-term synaptic facilitation (Aplysia)	113	Lys-rich.						poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|skin(1)	5						TGCTTTTCCCCTTTCTTTTCT	0.428																																					p.K113K		.											.	LLPH-514	0			c.G339A						.						255.0	224.0	235.0					12																	66517671		2203	4300	6503	SO:0001819	synonymous_variant	84298	exon3			TTTCCCCTTTCTT	AK057947	CCDS8974.1	12q14.3	2014-05-09	2008-10-02	2008-10-02	ENSG00000139233	ENSG00000139233			28229	protein-coding gene	gene with protein product	"""human LAPS18-like protein"""		"""chromosome 12 open reading frame 31"""	C12orf31		12477932	Standard	NM_032338		Approved	MGC14817, hLLP	uc010ssw.2	Q9BRT6	OTTHUMG00000168959	ENST00000266604.2:c.339G>A	12.37:g.66517671C>T		69	0		135	5	NM_032338	0	0	258	273	15	Q3B766	Silent	SNP	ENST00000266604.2	37	CCDS8974.1																																																																																			.		0.428	LLPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401752.1	NM_032338	
HCFC2	29915	hgsc.bcm.edu;bcgsc.ca	37	12	104459979	104459990	+	In_Frame_Del	DEL	AGATATCCCTCC	AGATATCCCTCC	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	AGATATCCCTCC	AGATATCCCTCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:104459979_104459990delAGATATCCCTCC	ENST00000229330.4	+	2	302_313	c.198_209delAGATATCCCTCC	c.(196-210)ggagatatccctcca>gga	p.DIPP67del	GLT8D2_ENST00000548660.1_5'Flank	NM_013320.2	NP_037452.1	Q9Y5Z7	HCFC2_HUMAN	host cell factor C2	67					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						CTGTTAGAGGAGATATCCCTCCAGGCTGTGCT	0.387																																					p.66_70del	Esophageal Squamous(184;1814 2036 4771 6974 15702)	.											.	HCFC2-92	0			c.198_209del						.																																			SO:0001651	inframe_deletion	29915	exon2			TAGAGGAGATATC	AF117210	CCDS9097.1	12q23.3	2011-03-30			ENSG00000111727	ENSG00000111727			24972	protein-coding gene	gene with protein product		607926				10196288	Standard	NM_013320		Approved	HCF-2	uc001tkj.4	Q9Y5Z7	OTTHUMG00000170175	ENST00000229330.4:c.198_209delAGATATCCCTCC	12.37:g.104459979_104459990delAGATATCCCTCC	ENSP00000229330:p.Asp67_Pro70del	98	0		134	5	NM_013320	0	0	0	0	0	B2R8Q5|C0H5X3	In_Frame_Del	DEL	ENST00000229330.4	37	CCDS9097.1																																																																																			.		0.387	HCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407780.1	NM_013320	
FAM222A	84915	hgsc.bcm.edu	37	12	110206245	110206245	+	Missense_Mutation	SNP	G	G	A	rs201640109		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr12:110206245G>A	ENST00000538780.1	+	3	1227	c.511G>A	c.(511-513)Ggc>Agc	p.G171S	FAM222A-AS1_ENST00000541723.1_RNA|FAM222A_ENST00000358906.3_Missense_Mutation_p.G171S|FAM222A-AS1_ENST00000541460.1_RNA	NM_032829.2	NP_116218.2	Q5U5X8	F222A_HUMAN	family with sequence similarity 222, member A	171	Pro-rich.																TCCACCACCCGGCCTGCCCGC	0.726																																					p.G171S		.											.	.	0			c.G511A						.	G	SER/GLY	1,4235		0,1,2117	9.0	11.0	11.0		511	-4.5	0.5	12		11	11,8239		0,11,4114	yes	missense	C12orf34	NM_032829.2	56	0,12,6231	AA,AG,GG		0.1333,0.0236,0.0961	benign	171/453	110206245	12,12474	2118	4125	6243	SO:0001583	missense	84915	exon3			CCACCCGGCCTGC	AK027627	CCDS9133.1	12q24.11	2012-04-27	2012-04-27	2012-04-27	ENSG00000139438	ENSG00000139438			25915	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 34"""	C12orf34		12477932	Standard	NM_032829		Approved	FLJ14721	uc001tpd.2	Q5U5X8	OTTHUMG00000169260	ENST00000538780.1:c.511G>A	12.37:g.110206245G>A	ENSP00000443292:p.Gly171Ser	0	0		30	18	NM_032829	0	0	8	16	8	Q8NCD5|Q96SP6	Missense_Mutation	SNP	ENST00000538780.1	37	CCDS9133.1	.	.	.	.	.	.	.	.	.	.	G	3.792	-0.043398	0.07452	2.36E-4	0.001333	ENSG00000139438	ENST00000538780;ENST00000358906	T;T	0.28895	1.59;1.59	3.68	-4.48	0.03515	.	0.267927	0.40064	N	0.001185	T	0.12390	0.0301	N	0.22421	0.69	0.22240	N	0.999261	B	0.02656	0.0	B	0.04013	0.001	T	0.37663	-0.9696	10	0.07325	T	0.83	-7.7634	7.5383	0.27723	0.5651:0.0:0.4349:0.0	.	171	Q5U5X8	CL034_HUMAN	S	171	ENSP00000443292:G171S;ENSP00000351783:G171S	ENSP00000351783:G171S	G	+	1	0	C12orf34	108690628	0.461000	0.25783	0.535000	0.28026	0.693000	0.40251	1.087000	0.30865	-0.237000	0.09739	-0.948000	0.02665	GGC	.		0.726	FAM222A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403175.1	NM_032829	
GAS6	2621	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	114529971	114529971	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr13:114529971T>C	ENST00000327773.6	-	12	1621	c.1475A>G	c.(1474-1476)tAc>tGc	p.Y492C	GAS6_ENST00000418959.3_Missense_Mutation_p.Y193C|GAS6_ENST00000355761.4_Missense_Mutation_p.Y438C|GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000357389.3_Missense_Mutation_p.Y535C|GAS6_ENST00000450766.1_Missense_Mutation_p.Y219C	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	535	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				AGACTTACTGTAGTCCAGGCT	0.577																																					p.Y492C		.											.	GAS6-650	0			c.A1475G						.						105.0	84.0	91.0					13																	114529971		2203	4298	6501	SO:0001583	missense	2621	exon12			TTACTGTAGTCCA		CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.1475A>G	13.37:g.114529971T>C	ENSP00000331831:p.Tyr492Cys	149	0		125	53	NM_000820	0	0	0	0	0	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	ENST00000327773.6	37	CCDS45072.1	.	.	.	.	.	.	.	.	.	.	T	14.36	2.511576	0.44660	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000450766;ENST00000418959;ENST00000327773	D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59	4.55	4.55	0.56014	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	D	0.91355	0.7273	M	0.84948	2.725	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	D	0.92764	0.6226	9	0.87932	D	0	-33.722	13.9043	0.63823	0.0:0.0:0.0:1.0	.	535;219;492	Q14393;B3KVL4;Q14393-2	GAS6_HUMAN;.;.	C	535;438;219;193;492	ENSP00000349962:Y535C;ENSP00000348003:Y438C;ENSP00000416498:Y219C;ENSP00000400117:Y193C;ENSP00000331831:Y492C	ENSP00000331831:Y492C	Y	-	2	0	GAS6	113583972	1.000000	0.71417	0.014000	0.15608	0.126000	0.20510	5.347000	0.65998	1.686000	0.51046	0.379000	0.24179	TAC	.		0.577	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000045946.2	NM_000820	
EFS	10278	bcgsc.ca	37	14	23834217	23834217	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr14:23834217C>T	ENST00000216733.3	-	1	625	c.18G>A	c.(16-18)tcG>tcA	p.S6S	EFS_ENST00000429593.2_Splice_Site_p.S6S|EFS_ENST00000351354.3_Splice_Site_p.S6S	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	6	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		GTGGACTCACCGACGTGGCAA	0.647																																					p.S6S		.											.	EFS-153	0			c.G18A						.						34.0	30.0	31.0					14																	23834217		2196	4291	6487	SO:0001630	splice_region_variant	10278	exon1			ACTCACCGACGTG	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.18+1G>A	14.37:g.23834217C>T		198	4		186	70	NM_032459	0	0	0	0	0	B2RAJ7|B4DJ56|E9PGU2|O43282	Silent	SNP	ENST00000216733.3	37	CCDS9595.1																																																																																			.		0.647	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071770.2		Silent
PCK2	5106	ucsc.edu	37	14	24568382	24568382	+	Silent	SNP	C	C	T	rs200826292		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr14:24568382C>T	ENST00000216780.4	+	5	1057	c.789C>T	c.(787-789)tgC>tgT	p.C263C	NRL_ENST00000561028.1_Intron|PCK2_ENST00000558096.1_Silent_p.C129C|PCK2_ENST00000561286.1_Silent_p.C129C|PCK2_ENST00000396973.4_Silent_p.C263C|PCK2_ENST00000559250.1_Silent_p.C275C|PCK2_ENST00000545054.2_Silent_p.C129C	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	263					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		GCAAGAAGTGCTTTGCCCTAC	0.647																																					p.C263C		.											.	PCK2-227	0			c.C789T						.						57.0	52.0	54.0					14																	24568382		2203	4300	6503	SO:0001819	synonymous_variant	5106	exon5			GAAGTGCTTTGCC	AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.789C>T	14.37:g.24568382C>T		48	0		45	4	NM_004563	0	0	24	24	0	O43253|Q86U01|Q9BV62	Silent	SNP	ENST00000216780.4	37	CCDS9609.1																																																																																			C|0.999;T|0.001		0.647	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071900.3	NM_001018073	
NPAS3	64067	broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	33684463	33684463	+	Silent	SNP	T	T	C	rs138614075		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr14:33684463T>C	ENST00000356141.4	+	3	216	c.216T>C	c.(214-216)taT>taC	p.Y72Y	NPAS3_ENST00000341321.4_Silent_p.Y72Y|NPAS3_ENST00000551492.1_Silent_p.Y79Y|NPAS3_ENST00000547068.1_5'UTR|NPAS3_ENST00000551008.1_5'UTR|NPAS3_ENST00000346562.2_Silent_p.Y42Y|NPAS3_ENST00000548645.1_Silent_p.Y42Y|NPAS3_ENST00000357798.5_Silent_p.Y42Y			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	72	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TTGAGTTCTATGAATTGGCCA	0.458																																					p.Y72Y		.											.	NPAS3-93	0			c.T216C						.	T	,,,	0,4406		0,0,2203	92.0	94.0	93.0		216,126,126,126	3.6	1.0	14	dbSNP_134	93	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NPAS3	NM_001164749.1,NM_001165893.1,NM_022123.2,NM_173159.2	,,,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,,,	72/934,42/904,42/902,42/921	33684463	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64067	exon3			GTTCTATGAATTG	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.216T>C	14.37:g.33684463T>C		141	1		97	30	NM_001164749	0	0	0	0	0	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	ENST00000356141.4	37	CCDS53891.1																																																																																			T|1.000;C|0.000		0.458	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
ARID4A	5926	broad.mit.edu	37	14	58831394	58831394	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr14:58831394T>A	ENST00000355431.3	+	20	2960	c.2587T>A	c.(2587-2589)Tca>Aca	p.S863T	ARID4A_ENST00000348476.3_Missense_Mutation_p.S863T|ARID4A_ENST00000395168.3_Missense_Mutation_p.S863T|ARID4A_ENST00000431317.2_Missense_Mutation_p.S863T	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	863					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						ACTAGGACAATCATCGCCAGA	0.333																																					p.S863T		.											.	ARID4A-231	0			c.T2587A						.						52.0	49.0	50.0					14																	58831394		2203	4300	6503	SO:0001583	missense	5926	exon20			GGACAATCATCGC	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2587T>A	14.37:g.58831394T>A	ENSP00000347602:p.Ser863Thr	109	0		104	3	NM_002892	0	0	3	3	0	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	37	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	T	9.651	1.141510	0.21205	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.14893	2.51;2.51;2.5;2.51;2.47	6.02	4.88	0.63580	.	0.673742	0.15093	N	0.280965	T	0.13543	0.0328	L	0.43152	1.355	0.22648	N	0.998893	B;B;B	0.26547	0.152;0.094;0.152	B;B;B	0.28011	0.074;0.039;0.085	T	0.35201	-0.9798	10	0.08179	T	0.78	-0.298	8.2189	0.31530	0.0:0.0728:0.1437:0.7835	.	863;863;863	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	T	863;863;863;863;541	ENSP00000347602:S863T;ENSP00000344556:S863T;ENSP00000378597:S863T;ENSP00000397368:S863T;ENSP00000416053:S541T	ENSP00000344556:S863T	S	+	1	0	ARID4A	57901147	0.850000	0.29656	0.995000	0.50966	0.985000	0.73830	1.159000	0.31749	1.112000	0.41740	0.528000	0.53228	TCA	.		0.333	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
PAPLN	89932	broad.mit.edu	37	14	73712814	73712814	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr14:73712814G>T	ENST00000554301.1	+	4	428	c.265G>T	c.(265-267)Gag>Tag	p.E89*	PAPLN_ENST00000555445.1_Nonsense_Mutation_p.E89*|RNU6-419P_ENST00000517030.1_RNA|PAPLN_ENST00000427855.1_Nonsense_Mutation_p.E89*|PAPLN_ENST00000381166.3_Nonsense_Mutation_p.E89*|RP4-647C14.2_ENST00000554614.1_RNA|PAPLN_ENST00000340738.5_Nonsense_Mutation_p.E89*			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	89						basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		CTTCCGGGCCGAGCAGTGCGC	0.751																																					p.E89X		.											.	PAPLN-70	0			c.G265T						.						8.0	10.0	10.0					14																	73712814		2171	4260	6431	SO:0001587	stop_gained	89932	exon5			CGGGCCGAGCAGT	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.265G>T	14.37:g.73712814G>T	ENSP00000451803:p.Glu89*	49	0		105	6	NM_173462	0	0	0	0	0	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Nonsense_Mutation	SNP	ENST00000554301.1	37		.	.	.	.	.	.	.	.	.	.	G	37	6.120561	0.97300	.	.	ENSG00000100767	ENST00000340738;ENST00000427855;ENST00000381166;ENST00000394134;ENST00000554301;ENST00000555445	.	.	.	4.07	2.14	0.27477	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	13.3082	0.60365	0.0:0.2958:0.7041:0.0	.	.	.	.	X	89	.	ENSP00000216658:E89X	E	+	1	0	PAPLN	72782567	1.000000	0.71417	0.945000	0.38365	0.773000	0.43773	3.798000	0.55522	0.330000	0.23485	0.462000	0.41574	GAG	.		0.751	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000413182.1	NM_173462	
ABCD4	5826	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	74763089	74763089	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr14:74763089C>A	ENST00000356924.4	-	5	632	c.489G>T	c.(487-489)aaG>aaT	p.K163N	ABCD4_ENST00000557554.1_Intron|ABCD4_ENST00000557588.1_Missense_Mutation_p.K163N|ABCD4_ENST00000298816.7_Missense_Mutation_p.K76N|AC005519.4_ENST00000554532.2_RNA	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	163	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		AGATGATGAGCTTGCTGGCCA	0.612																																					p.K163N		.											.	ABCD4-292	0			c.G489T						.						117.0	95.0	103.0					14																	74763089		2203	4300	6503	SO:0001583	missense	5826	exon5			GATGAGCTTGCTG	AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.489G>T	14.37:g.74763089C>A	ENSP00000349396:p.Lys163Asn	77	0		78	23	NM_005050	0	0	3	4	1	A8K5L7|Q6IAQ0|Q96E75	Missense_Mutation	SNP	ENST00000356924.4	37	CCDS9828.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.64|14.64	2.596964|2.596964	0.46318|0.46318	.|.	.|.	ENSG00000119688|ENSG00000119688	ENST00000356924;ENST00000298816;ENST00000557588|ENST00000556971	D;D;D|.	0.99557|.	-6.16;-6.16;-6.16|.	4.82|4.82	1.99|1.99	0.26369|0.26369	ABC transporter, N-terminal (1);ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);|.	0.400427|.	0.30455|.	N|.	0.009592|.	T|T	0.58061|0.58061	0.2096|0.2096	M|M	0.62723|0.62723	1.935|1.935	0.43021|0.43021	D|D	0.994579|0.994579	B;B;B|.	0.30914|.	0.119;0.3;0.16|.	B;B;B|.	0.36092|.	0.108;0.217;0.217|.	T|T	0.51671|0.51671	-0.8676|-0.8676	10|5	0.16420|.	T|.	0.52|.	.|.	5.7084|5.7084	0.17921|0.17921	0.0:0.6315:0.141:0.2275|0.0:0.6315:0.141:0.2275	.|.	76;163;163|.	F8W7M4;A8K5L7;O14678|.	.;.;ABCD4_HUMAN|.	N|I	163;76;163|123	ENSP00000349396:K163N;ENSP00000298816:K76N;ENSP00000451993:K163N|.	ENSP00000298816:K76N|.	K|S	-|-	3|2	2|0	ABCD4|ABCD4	73832842|73832842	0.999000|0.999000	0.42202|0.42202	0.984000|0.984000	0.44739|0.44739	0.694000|0.694000	0.40290|0.40290	0.697000|0.697000	0.25556|0.25556	0.232000|0.232000	0.21100|0.21100	-0.182000|-0.182000	0.12963|0.12963	AAG|AGC	.		0.612	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314382.1	NM_005050	
TMEM63C	57156	broad.mit.edu	37	14	77685876	77685876	+	Silent	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr14:77685876T>A	ENST00000298351.4	+	4	330	c.186T>A	c.(184-186)gcT>gcA	p.A62A	RP11-463C8.4_ENST00000557752.1_3'UTR	NM_020431.2	NP_065164.2	Q9P1W3	CSC1_HUMAN	transmembrane protein 63C	62					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)	integral component of membrane (GO:0016021)	calcium activated cation channel activity (GO:0005227)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(1)	23			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)		TCCGGAAAGCTGCGTGGGACT	0.592																																					p.A62A		.											.	.	0			c.T186A						.						128.0	135.0	133.0					14																	77685876		2118	4233	6351	SO:0001819	synonymous_variant	57156	exon4			GAAAGCTGCGTGG		CCDS45141.1	14q24.3	2014-05-30	2005-07-25	2005-07-25	ENSG00000165548	ENSG00000165548			23787	protein-coding gene	gene with protein product	"""calcium permeable stress-gated cation channel 1 homolog (Arabidopsis)"""		"""chromosome 14 open reading frame 171"""	C14orf171		24503647	Standard	NM_020431		Approved	DKFZp434P0111, CSC1, hsCSC1	uc001xtf.2	Q9P1W3	OTTHUMG00000171557	ENST00000298351.4:c.186T>A	14.37:g.77685876T>A		138	0		115	4	NM_020431	0	0	1	1	0	B2RN22|B3KWJ5|Q86TS3|Q86TS4|Q9NSQ4|Q9P1W1	Silent	SNP	ENST00000298351.4	37	CCDS45141.1																																																																																			.		0.592	TMEM63C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414193.1		
UNC13C	440279	broad.mit.edu	37	15	54586242	54586242	+	Missense_Mutation	SNP	T	T	A	rs368603444		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr15:54586242T>A	ENST00000260323.11	+	10	3968	c.3968T>A	c.(3967-3969)aTg>aAg	p.M1323K	UNC13C_ENST00000537900.1_Missense_Mutation_p.M1321K|UNC13C_ENST00000545554.1_Missense_Mutation_p.M1323K	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1323					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AGTGGAGAAATGGATGTCTGG	0.348																																					p.M1323K		.											.	UNC13C-51	0			c.T3968A						.						226.0	229.0	228.0					15																	54586242		1867	4099	5966	SO:0001583	missense	440279	exon9			GAGAAATGGATGT	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3968T>A	15.37:g.54586242T>A	ENSP00000260323:p.Met1323Lys	84	0		73	4	NM_001080534	0	0	0	0	0	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.510114	0.85282	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.70164	-0.46;-0.46;-0.46	5.91	5.91	0.95273	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.82669	0.5087	M	0.83483	2.645	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.70016	0.967;0.949	D	0.85215	0.1023	10	0.72032	D	0.01	.	15.5312	0.75964	0.0:0.0:0.0:1.0	.	1323;1323	F5H090;Q8NB66	.;UN13C_HUMAN	K	1323;1323;1321	ENSP00000260323:M1323K;ENSP00000438156:M1323K;ENSP00000442569:M1321K	ENSP00000260323:M1323K	M	+	2	0	UNC13C	52373534	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.997000	0.88414	2.270000	0.75569	0.528000	0.53228	ATG	.		0.348	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
RORA	6095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	60797800	60797800	+	Silent	SNP	C	C	T	rs199818399		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr15:60797800C>T	ENST00000335670.6	-	6	949	c.849G>A	c.(847-849)tcG>tcA	p.S283S	RP11-219B17.1_ENST00000558140.1_RNA|RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000261523.5_Silent_p.S316S|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000309157.4_Silent_p.S308S|RORA_ENST00000449337.2_Silent_p.S228S|RP11-219B17.1_ENST00000501579.2_RNA	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	283	Ligand-binding.				angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						TTTCCAGATGCGATTTAGATA	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		18885	0.0		0.0	False		,,,				2504	0.001				p.S316S		.											.	RORA-290	0			c.G948A						.	C	,,,	1,4405	2.1+/-5.4	0,1,2202	126.0	130.0	128.0		924,948,849,684	-11.9	0.2	15		128	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	RORA	NM_002943.3,NM_134260.2,NM_134261.2,NM_134262.2	,,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,,	308/549,316/557,283/524,228/469	60797800	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6095	exon7			CAGATGCGATTTA	U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.849G>A	15.37:g.60797800C>T		109	0		99	31	NM_134260	0	0	12	18	6	P35397|P35399|P45445|Q495X4|Q96H83	Silent	SNP	ENST00000335670.6	37	CCDS10177.1																																																																																			.		0.378	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256142.2		
IGDCC4	57722	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	65703500	65703500	+	Silent	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr15:65703500C>A	ENST00000352385.2	-	2	488	c.279G>T	c.(277-279)ctG>ctT	p.L93L		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	93	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GGGACAGCCACAGGGAACCAT	0.642																																					p.L93L		.											.	IGDCC4-93	0			c.G279T						.						63.0	50.0	54.0					15																	65703500		2201	4299	6500	SO:0001819	synonymous_variant	57722	exon2			CAGCCACAGGGAA		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.279G>T	15.37:g.65703500C>A		157	0		195	62	NM_020962	0	0	0	0	0	Q9HCE4	Silent	SNP	ENST00000352385.2	37	CCDS10206.1																																																																																			.		0.642	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
ARIH1	25820	broad.mit.edu	37	15	72873082	72873082	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr15:72873082C>A	ENST00000379887.4	+	12	1540	c.1226C>A	c.(1225-1227)gCa>gAa	p.A409E	ARIH1_ENST00000562891.1_3'UTR	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	409					cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.A409E(4)		endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						CGATCTAGGGCAGCCCTGCAG	0.383																																					p.A409E		.											.	ARIH1-226	4	Substitution - Missense(4)	prostate(2)|kidney(2)	c.C1226A						.						57.0	49.0	52.0					15																	72873082		2198	4297	6495	SO:0001583	missense	25820	exon12			CTAGGGCAGCCCT	AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.1226C>A	15.37:g.72873082C>A	ENSP00000369217:p.Ala409Glu	93	1		90	6	NM_005744	0	0	0	0	0	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Missense_Mutation	SNP	ENST00000379887.4	37	CCDS10244.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155042	0.78114	.	.	ENSG00000166233	ENST00000379887;ENST00000299305	D	0.83673	-1.75	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.78629	0.4313	L	0.43701	1.375	0.80722	D	1	B	0.32467	0.372	B	0.23018	0.043	T	0.77225	-0.2666	10	0.54805	T	0.06	.	20.0756	0.97742	0.0:1.0:0.0:0.0	.	409	Q9Y4X5	ARI1_HUMAN	E	409;379	ENSP00000369217:A409E	ENSP00000299305:A379E	A	+	2	0	ARIH1	70660136	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.394000	0.79862	2.763000	0.94921	0.650000	0.86243	GCA	.		0.383	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257350.1	NM_005744	
SLC28A1	9154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	85438269	85438269	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr15:85438269C>T	ENST00000286749.3	+	5	466	c.376C>T	c.(376-378)Cgc>Tgc	p.R126C	SLC28A1_ENST00000394573.1_Missense_Mutation_p.R126C|SLC28A1_ENST00000537703.1_Missense_Mutation_p.R48C|SLC28A1_ENST00000537624.1_Missense_Mutation_p.R126C|SLC28A1_ENST00000538177.1_Missense_Mutation_p.R126C|SLC28A1_ENST00000537216.1_Missense_Mutation_p.R126C|SLC28A1_ENST00000338602.2_Missense_Mutation_p.R126C			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	126					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	CCTGGGCCACCGCCTGCTGAA	0.612																																					p.R126C		.											.	SLC28A1-93	0			c.C376T						.						69.0	71.0	70.0					15																	85438269		2203	4299	6502	SO:0001583	missense	9154	exon6			GGCCACCGCCTGC	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.376C>T	15.37:g.85438269C>T	ENSP00000286749:p.Arg126Cys	122	0		151	40	NM_201651	0	0	0	0	0	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	ENST00000286749.3	37	CCDS10334.1	.	.	.	.	.	.	.	.	.	.	C	5.731	0.319325	0.10845	.	.	ENSG00000156222	ENST00000338602;ENST00000537216;ENST00000538177;ENST00000537624;ENST00000286749;ENST00000394573;ENST00000537703	T;T;T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36	4.34	-2.36	0.06663	.	0.634997	0.17722	N	0.164192	T	0.72137	0.3423	L	0.34521	1.04	0.09310	N	1	P;P;D;P;P;D	0.65815	0.877;0.951;0.995;0.951;0.738;0.99	B;P;P;B;B;P	0.51657	0.39;0.663;0.676;0.208;0.302;0.556	T	0.65442	-0.6167	10	0.52906	T	0.07	-13.694	5.3338	0.15947	0.4403:0.1715:0.3882:0.0	.	126;126;126;48;126;126	B7Z533;F5H560;B7Z3L6;B7Z3M4;O00337;O00337-2	.;.;.;.;S28A1_HUMAN;.	C	126;126;126;126;126;126;48	ENSP00000341629:R126C;ENSP00000440546:R126C;ENSP00000443752:R126C;ENSP00000444700:R126C;ENSP00000286749:R126C;ENSP00000378074:R126C;ENSP00000443764:R48C	ENSP00000286749:R126C	R	+	1	0	SLC28A1	83239273	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	-0.314000	0.08092	-0.567000	0.06046	-1.193000	0.01689	CGC	.		0.612	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2		
MSLN	10232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	818658	818658	+	Silent	SNP	G	G	A	rs201197109	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr16:818658G>A	ENST00000382862.3	+	17	1913	c.1818G>A	c.(1816-1818)tcG>tcA	p.S606S	MIR662_ENST00000384847.1_RNA|MSLN_ENST00000563941.1_Silent_p.S598S|MSLN_ENST00000566549.1_Silent_p.S598S|MSLN_ENST00000545450.2_Silent_p.S598S	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	606					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				AGGCCCTCTCGGGGACGCCCT	0.706													G|||	8	0.00159744	0.0	0.0	5008	,	,		13099	0.0079		0.0	False		,,,				2504	0.0				p.S606S		.											.	MSLN-91	0			c.G1818A						.	G	,,	0,4384		0,0,2192	67.0	60.0	63.0		1794,1794,1818	-4.5	0.0	16		63	2,8576	2.2+/-6.3	0,2,4287	no	coding-synonymous,coding-synonymous,coding-synonymous	MSLN	NM_001177355.1,NM_005823.5,NM_013404.4	,,	0,2,6479	AA,AG,GG		0.0233,0.0,0.0154	,,	598/623,598/623,606/631	818658	2,12960	2192	4289	6481	SO:0001819	synonymous_variant	10232	exon17			CCTCTCGGGGACG	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.1818G>A	16.37:g.818658G>A		43	0		63	19	NM_013404	0	0	0	0	0	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Silent	SNP	ENST00000382862.3	37	CCDS32356.1																																																																																			G|0.999;A|0.001		0.706	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109253.2		
SPNS1	83985	broad.mit.edu	37	16	28992830	28992830	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr16:28992830T>C	ENST00000311008.11	+	6	1080	c.703T>C	c.(703-705)Ttc>Ctc	p.F235L	RP11-264B17.3_ENST00000569969.1_RNA|SPNS1_ENST00000352260.7_Missense_Mutation_p.F213L|SPNS1_ENST00000565975.1_Missense_Mutation_p.F280L|RP11-264B17.4_ENST00000567209.1_RNA|SPNS1_ENST00000323081.8_Missense_Mutation_p.F162L|SPNS1_ENST00000561868.1_3'UTR|SPNS1_ENST00000334536.8_Missense_Mutation_p.F235L	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)	235					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						TCTGCTGCTGTTCCTGGTAGT	0.642											OREG0023712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F235L		.											.	SPNS1-90	0			c.T703C						.						64.0	65.0	65.0					16																	28992830		2197	4300	6497	SO:0001583	missense	83985	exon6			CTGCTGTTCCTGG	BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.703T>C	16.37:g.28992830T>C	ENSP00000309945:p.Phe235Leu	99	0	806	128	3	NM_001142451	0	0	85	86	1	B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Missense_Mutation	SNP	ENST00000311008.11	37	CCDS10646.1	.	.	.	.	.	.	.	.	.	.	T	16.57	3.159281	0.57368	.	.	ENSG00000169682	ENST00000311008;ENST00000334536;ENST00000352260;ENST00000323081	T;T;T;T	0.56611	0.59;0.45;0.45;0.59	4.91	3.81	0.43845	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.215254	0.40144	N	0.001167	T	0.22044	0.0531	N	0.04373	-0.215	0.37322	D	0.909619	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.11329	0.003;0.001;0.006;0.001	T	0.20638	-1.0269	10	0.02654	T	1	.	5.6913	0.17831	0.17:0.0:0.1773:0.6526	.	162;213;235;235	Q9H2V7-4;Q9H2V7-3;Q9H2V7;Q9H2V7-2	.;.;SPNS1_HUMAN;.	L	235;235;213;162	ENSP00000309945:F235L;ENSP00000335494:F235L;ENSP00000306050:F213L;ENSP00000318228:F162L	ENSP00000309945:F235L	F	+	1	0	SPNS1	28900331	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	0.231000	0.17872	0.887000	0.36136	0.533000	0.62120	TTC	.		0.642	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254690.2	NM_032038	
LONP2	83752	ucsc.edu	37	16	48295433	48295433	+	Silent	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr16:48295433G>A	ENST00000285737.4	+	5	915	c.822G>A	c.(820-822)gaG>gaA	p.E274E	LONP2_ENST00000535754.1_Silent_p.E230E	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TCATGCTAGAGAAAAAAATAC	0.338																																					p.E274E		.											.	LONP2-90	0			c.G822A						.						132.0	131.0	132.0					16																	48295433		2200	4300	6500	SO:0001819	synonymous_variant	83752	exon5			GCTAGAGAAAAAA	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.822G>A	16.37:g.48295433G>A		223	0		260	2	NM_031490	0	0	14	20	6		Silent	SNP	ENST00000285737.4	37	CCDS10734.1																																																																																			.		0.338	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
SALL1	6299	broad.mit.edu	37	16	51171231	51171231	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr16:51171231T>G	ENST00000251020.4	-	3	3800	c.3767A>C	c.(3766-3768)cAg>cCg	p.Q1256P	SALL1_ENST00000440970.1_Missense_Mutation_p.Q1159P|SALL1_ENST00000541611.1_Missense_Mutation_p.Q79P|SALL1_ENST00000566102.1_3'UTR	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1256					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GCCACCGTTCTGAATGACGGA	0.572																																					p.Q1256P	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1-98	0			c.A3767C						.						86.0	77.0	80.0					16																	51171231		2198	4300	6498	SO:0001583	missense	6299	exon3			CCGTTCTGAATGA	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3767A>C	16.37:g.51171231T>G	ENSP00000251020:p.Gln1256Pro	87	0		95	4	NM_002968	0	0	0	0	0	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	T	17.54	3.414439	0.62511	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559;ENST00000541611	T;T;T	0.54866	0.55;0.55;0.55	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	M	0.76727	2.345	0.80722	D	1	D;D	0.71674	0.998;0.988	D;P	0.75484	0.986;0.885	T	0.76130	-0.3072	10	0.72032	D	0.01	.	15.6652	0.77225	0.0:0.0:0.0:1.0	.	1256;79	Q9NSC2;F5H733	SALL1_HUMAN;.	P	1256;1159;1220;79	ENSP00000251020:Q1256P;ENSP00000407914:Q1159P;ENSP00000442827:Q79P	ENSP00000251020:Q1256P	Q	-	2	0	SALL1	49728732	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.032000	0.88838	2.104000	0.64026	0.523000	0.50628	CAG	.		0.572	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
EDC4	23644	broad.mit.edu	37	16	67917881	67917881	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr16:67917881C>A	ENST00000358933.5	+	29	4275	c.4036C>A	c.(4036-4038)Cac>Aac	p.H1346N	NRN1L_ENST00000339176.3_5'Flank|CTC-479C5.10_ENST00000572067.1_lincRNA|NRN1L_ENST00000576147.1_5'Flank	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	1346					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.H1346N(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		GGCCGTGATGCACCTGGACCA	0.637											OREG0023890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H1346N		.											.	EDC4-92	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	c.C4036A						.						66.0	59.0	61.0					16																	67917881		2198	4300	6498	SO:0001583	missense	23644	exon29			GTGATGCACCTGG	U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.4036C>A	16.37:g.67917881C>A	ENSP00000351811:p.His1346Asn	54	2	1103	114	8	NM_014329	0	1	202	213	10	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	ENST00000358933.5	37	CCDS10849.1	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625078	0.46840	.	.	ENSG00000038358	ENST00000358933	.	.	.	5.24	5.24	0.73138	.	0.043316	0.85682	D	0.000000	T	0.40815	0.1132	N	0.12569	0.235	0.45962	D	0.998783	B	0.06786	0.001	B	0.06405	0.002	T	0.24297	-1.0164	9	0.15499	T	0.54	-16.5403	18.7721	0.91896	0.0:1.0:0.0:0.0	.	1346	Q6P2E9	EDC4_HUMAN	N	1346	.	ENSP00000351811:H1346N	H	+	1	0	EDC4	66475382	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.627000	0.61276	2.622000	0.88805	0.655000	0.94253	CAC	.		0.637	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268874.2	NM_014329	
NTN1	9423	broad.mit.edu;bcgsc.ca	37	17	9143050	9143050	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:9143050G>C	ENST00000173229.2	+	7	1687	c.1580G>C	c.(1579-1581)cGc>cCc	p.R527P	NTN1_ENST00000546090.1_Missense_Mutation_p.R527P|NTN1_ENST00000538852.1_Missense_Mutation_p.R527P	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1	527	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						GGCACGAGCCGCATCCGCCGC	0.607																																					p.R527P		.											.	NTN1-90	0			c.G1580C						.						56.0	50.0	52.0					17																	9143050		2203	4300	6503	SO:0001583	missense	9423	exon7			CGAGCCGCATCCG	U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.1580G>C	17.37:g.9143050G>C	ENSP00000173229:p.Arg527Pro	163	3		128	60	NM_004822	0	0	0	0	0	E9KL51	Missense_Mutation	SNP	ENST00000173229.2	37	CCDS11148.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930776	0.52866	.	.	ENSG00000065320	ENST00000173229;ENST00000538852;ENST00000546090	T;T;T	0.30981	1.51;1.51;1.51	4.29	4.29	0.51040	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.000000	0.85682	D	0.000000	T	0.27063	0.0663	L	0.33668	1.02	0.54753	D	0.999987	B	0.18310	0.027	B	0.25506	0.061	T	0.05550	-1.0878	10	0.34782	T	0.22	.	16.3384	0.83074	0.0:0.0:1.0:0.0	.	527	O95631	NET1_HUMAN	P	527	ENSP00000173229:R527P;ENSP00000443259:R527P;ENSP00000441611:R527P	ENSP00000173229:R527P	R	+	2	0	NTN1	9083775	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.329000	0.96413	1.920000	0.55613	0.596000	0.82720	CGC	.		0.607	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252583.1		
MYO15A	51168	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	18062646	18062646	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:18062646A>G	ENST00000205890.5	+	54	9552	c.9214A>G	c.(9214-9216)Acc>Gcc	p.T3072A	MYO15A_ENST00000451725.2_5'Flank|MYO15A_ENST00000418233.3_Missense_Mutation_p.T336A	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	3072	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.|Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CAAGATGGCCACCGACATGTT	0.597																																					p.T3072A		.											.	MYO15A-97	0			c.A9214G						.						88.0	95.0	93.0					17																	18062646		2132	4229	6361	SO:0001583	missense	51168	exon53			ATGGCCACCGACA	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.9214A>G	17.37:g.18062646A>G	ENSP00000205890:p.Thr3072Ala	101	0		83	33	NM_016239	0	0	0	0	0	B4DFC7	Missense_Mutation	SNP	ENST00000205890.5	37	CCDS42271.1	.	.	.	.	.	.	.	.	.	.	A	9.395	1.076535	0.20227	.	.	ENSG00000091536	ENST00000205890;ENST00000418233;ENST00000556535	D;D	0.94613	-2.21;-3.47	4.94	1.53	0.23141	MyTH4 domain (2);	.	.	.	.	D	0.85936	0.5813	N	0.11756	0.17	0.19575	N	0.999966	B;B;B	0.12630	0.002;0.003;0.006	B;B;B	0.10450	0.003;0.004;0.005	T	0.72401	-0.4305	9	0.19590	T	0.45	.	8.321	0.32130	0.5575:0.0:0.4425:0.0	.	61;336;3072	B4DLV9;B4DFC7;Q9UKN7	.;.;MYO15_HUMAN	A	3072;61;26	ENSP00000205890:T3072A;ENSP00000451782:T26A	ENSP00000205890:T3072A	T	+	1	0	MYO15A	18003371	0.005000	0.15991	0.289000	0.24876	0.974000	0.67602	0.299000	0.19138	0.255000	0.21593	0.379000	0.24179	ACC	.		0.597	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
LRRC37B	114659	broad.mit.edu	37	17	30348897	30348897	+	Silent	SNP	C	C	T	rs200519924		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:30348897C>T	ENST00000341671.7	+	1	737	c.732C>T	c.(730-732)aaC>aaT	p.N244N	LRRC37B_ENST00000327564.7_Silent_p.N271N|LRRC37B_ENST00000584368.1_Silent_p.N256N|LRRC37B_ENST00000394713.3_Silent_p.N244N|LRRC37B_ENST00000543378.2_Silent_p.N162N	NM_052888.2	NP_443120.2	Q96QE4	LR37B_HUMAN	leucine rich repeat containing 37B	244						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	29		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.111)|Ovarian(249;0.182)|Breast(31;0.244)				TCCGGGTGAACGCAGATGAGC	0.488													.|||	1	0.000199681	0.0	0.0	5008	,	,		18748	0.001		0.0	False		,,,				2504	0.0				p.N244N		.											.	LRRC37B-92	0			c.C732T						.	C		2,4404		0,2,2201	92.0	107.0	102.0		732	-2.7	0.0	17		102	2,8598		0,2,4298	no	coding-synonymous	LRRC37B	NM_052888.2		0,4,6499	TT,TC,CC		0.0233,0.0454,0.0308		244/948	30348897	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	114659	exon1			GGTGAACGCAGAT	AJ314647	CCDS32609.1	17q11.2	2006-11-29		2005-08-09	ENSG00000185158	ENSG00000185158			29070	protein-coding gene	gene with protein product	"""KIAA0563-related"""					11468690, 10843809	Standard	NM_052888		Approved		uc002hgu.3	Q96QE4	OTTHUMG00000132785	ENST00000341671.7:c.732C>T	17.37:g.30348897C>T		118	0		105	4	NM_052888	0	0	1	1	0	Q17RC9|Q5YKG6	Silent	SNP	ENST00000341671.7	37	CCDS32609.1																																																																																			C|0.999;T|0.000		0.488	LRRC37B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446508.1	NM_052888	
LASP1	3927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	37070576	37070576	+	Splice_Site	SNP	A	A	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:37070576A>C	ENST00000318008.6	+	5	688		c.e5-1		LASP1_ENST00000433206.2_Splice_Site|LASP1_ENST00000435347.3_Splice_Site	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1						ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						CTGACCTTGCAGATAAAATAC	0.582			T	MLL	AML																																.		.		Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	.	LASP1-522	0			c.358-2A>C						.						25.0	28.0	27.0					17																	37070576		2201	4300	6501	SO:0001630	splice_region_variant	3927	exon5			CCTTGCAGATAAA		CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.358-1A>C	17.37:g.37070576A>C		259	0		385	90	NM_006148	0	0	0	0	0	B4DGQ0|Q96ED2|Q96IG0	Splice_Site	SNP	ENST00000318008.6	37	CCDS11331.1	.	.	.	.	.	.	.	.	.	.	A	17.56	3.421280	0.62622	.	.	ENSG00000002834	ENST00000318008;ENST00000433206;ENST00000435347;ENST00000419929	.	.	.	5.24	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.6975	0.40167	0.9177:0.0:0.0823:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LASP1	34324102	1.000000	0.71417	0.984000	0.44739	0.944000	0.59088	8.488000	0.90458	0.838000	0.34948	0.460000	0.39030	.	.		0.582	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256890.3	NM_006148	Intron
ARL4D	379	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	41477602	41477602	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:41477602T>C	ENST00000320033.4	+	2	709	c.502T>C	c.(502-504)Tgc>Cgc	p.C168R		NM_001661.3	NP_001652.2	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D	168					GTP catabolic process (GO:0006184)|protein secretion (GO:0009306)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		TGTGCAAGGCTGCAGCGCTGT	0.627																																					p.C168R		.											.	ARL4D-228	0			c.T502C						.						12.0	13.0	13.0					17																	41477602		2198	4290	6488	SO:0001583	missense	379	exon2			CAAGGCTGCAGCG	AB060692	CCDS11463.1	17q21.31	2014-05-09	2005-11-03	2005-11-03	ENSG00000175906	ENSG00000175906		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	656	protein-coding gene	gene with protein product		600732	"""ADP-ribosylation factor 4-like"""	ARF4L		7590735	Standard	NM_001661		Approved		uc002idt.3	P49703		ENST00000320033.4:c.502T>C	17.37:g.41477602T>C	ENSP00000322628:p.Cys168Arg	60	0		68	24	NM_001661	0	0	2	3	1	B2RC59|D3DX43	Missense_Mutation	SNP	ENST00000320033.4	37	CCDS11463.1	.	.	.	.	.	.	.	.	.	.	T	11.85	1.762520	0.31228	.	.	ENSG00000175906	ENST00000320033	D	0.83506	-1.73	5.04	3.95	0.45737	.	0.000000	0.85682	D	0.000000	D	0.91331	0.7266	H	0.95712	3.71	0.80722	D	1	D	0.58620	0.983	P	0.60886	0.88	D	0.90648	0.4580	10	0.87932	D	0	-16.4835	6.6616	0.23016	0.1534:0.0:0.16:0.6866	.	168	P49703	ARL4D_HUMAN	R	168	ENSP00000322628:C168R	ENSP00000322628:C168R	C	+	1	0	ARL4D	38833128	0.995000	0.38212	1.000000	0.80357	0.004000	0.04260	1.275000	0.33144	0.924000	0.37069	-0.490000	0.04691	TGC	.		0.627	ARL4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453481.2	NM_001661	
HEXIM2	124790	broad.mit.edu;bcgsc.ca	37	17	43247039	43247039	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:43247039G>A	ENST00000307275.3	+	4	1160	c.724G>A	c.(724-726)Ggc>Agc	p.G242S	HEXIM2_ENST00000592695.1_Missense_Mutation_p.G242S|RP13-890H12.2_ENST00000589451.1_RNA|HEXIM2_ENST00000591576.1_Missense_Mutation_p.G242S|RP13-890H12.2_ENST00000589796.1_RNA	NM_144608.1	NP_653209.1	Q96MH2	HEXI2_HUMAN	hexamethylene bis-acetamide inducible 2	242	Interaction with CCNT1, HEXIM1 and HEXIM2.				negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			endometrium(1)|large_intestine(3)|lung(1)	5						GGCGTGCACCGGCCAGCAGTC	0.662																																					p.G242S		.											.	HEXIM2-90	0			c.G724A						.						7.0	6.0	6.0					17																	43247039		1934	3799	5733	SO:0001583	missense	124790	exon4			TGCACCGGCCAGC	AK056946	CCDS11496.1	17q21.31	2011-07-29	2011-07-29			ENSG00000168517			28591	protein-coding gene	gene with protein product		615695				12832472	Standard	NM_144608		Approved	FLJ32384	uc002iih.1	Q96MH2		ENST00000307275.3:c.724G>A	17.37:g.43247039G>A	ENSP00000302276:p.Gly242Ser	119	1		138	7	NM_144608	0	0	11	12	1	D3DX66	Missense_Mutation	SNP	ENST00000307275.3	37	CCDS11496.1	.	.	.	.	.	.	.	.	.	.	G	2.723	-0.266142	0.05754	.	.	ENSG00000168517	ENST00000307275	.	.	.	4.39	-1.71	0.08133	.	0.842838	0.10933	N	0.618199	T	0.11495	0.0280	N	0.02960	-0.455	0.09310	N	1	B	0.15141	0.012	B	0.10450	0.005	T	0.33033	-0.9884	9	0.12103	T	0.63	-3.4353	4.1963	0.10445	0.3652:0.0:0.4596:0.1753	.	242	Q96MH2	HEXI2_HUMAN	S	242	.	ENSP00000302276:G242S	G	+	1	0	HEXIM2	40602822	0.000000	0.05858	0.001000	0.08648	0.262000	0.26303	-0.228000	0.09114	-0.161000	0.10983	0.462000	0.41574	GGC	.		0.662	HEXIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450181.1	NM_144608	
KANSL1	284058	broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	44249233	44249233	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:44249233T>C	ENST00000262419.6	-	2	747	c.277A>G	c.(277-279)Aag>Gag	p.K93E	KANSL1_ENST00000393476.3_5'UTR|KANSL1_ENST00000574590.1_Missense_Mutation_p.K93E|KANSL1_ENST00000432791.1_Missense_Mutation_p.K93E|KANSL1_ENST00000572904.1_Missense_Mutation_p.K93E|KANSL1_ENST00000575318.1_Missense_Mutation_p.K93E|KANSL1_ENST00000576248.1_5'Flank	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	93					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AAAGACTCCTTTGAGGGAACA	0.468																																					p.K93E		.											.	.	0			c.A277G						.						111.0	139.0	130.0					17																	44249233		2203	4300	6503	SO:0001583	missense	284058	exon2			ACTCCTTTGAGGG	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.277A>G	17.37:g.44249233T>C	ENSP00000262419:p.Lys93Glu	216	1		206	54	NM_001193466	0	0	6	7	1	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	ENST00000262419.6	37	CCDS11503.1	.	.	.	.	.	.	.	.	.	.	T	18.86	3.714345	0.68730	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.26223	1.75;1.75	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.38957	0.1060	L	0.29908	0.895	0.80722	D	1	D;D	0.67145	0.994;0.996	P;D	0.76071	0.879;0.987	T	0.20605	-1.0270	10	0.62326	D	0.03	-14.9155	13.6649	0.62389	0.0:0.0:0.0:1.0	.	93;93	C9JHY2;Q7Z3B3	.;K1267_HUMAN	E	93	ENSP00000262419:K93E;ENSP00000387393:K93E	ENSP00000262419:K93E	K	-	1	0	KIAA1267	41605010	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.258000	0.65479	2.244000	0.73946	0.533000	0.62120	AAG	T|1.000;C|0.000		0.468	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440274.1	NM_015443	
EVPL	2125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	74004100	74004100	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:74004100G>A	ENST00000301607.3	-	22	5439	c.5186C>T	c.(5185-5187)tCg>tTg	p.S1729L	EVPL_ENST00000586740.1_Missense_Mutation_p.S1751L|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1729	Globular 2.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						ACAGGGCCCCGAGGTGGTGAC	0.642																																					p.S1729L		.											.	EVPL-93	0			c.C5186T						.						56.0	56.0	56.0					17																	74004100		2203	4300	6503	SO:0001583	missense	2125	exon22			GGCCCCGAGGTGG	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.5186C>T	17.37:g.74004100G>A	ENSP00000301607:p.Ser1729Leu	81	0		119	33	NM_001988	0	0	0	0	0	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	37	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	G	9.473	1.096021	0.20552	.	.	ENSG00000167880	ENST00000301607	T	0.66815	-0.23	4.94	0.00808	0.14073	.	0.481934	0.21663	N	0.070984	T	0.50973	0.1647	L	0.48642	1.525	0.23445	N	0.997665	B;B	0.10296	0.003;0.001	B;B	0.06405	0.002;0.001	T	0.32025	-0.9922	10	0.14252	T	0.57	-1.4573	8.2183	0.31526	0.5647:0.0:0.4353:0.0	.	1751;1729	B7ZLH8;Q92817	.;EVPL_HUMAN	L	1729	ENSP00000301607:S1729L	ENSP00000301607:S1729L	S	-	2	0	EVPL	71515695	0.068000	0.21057	0.967000	0.41034	0.986000	0.74619	0.974000	0.29436	0.145000	0.18977	0.561000	0.74099	TCG	.		0.642	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
ST6GALNAC1	55808	ucsc.edu;bcgsc.ca	37	17	74625598	74625598	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:74625598C>T	ENST00000156626.7	-	2	526	c.327G>A	c.(325-327)ccG>ccA	p.P109P	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	109					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						CCTGCTCCTCCGGCGGTGCCT	0.587																																					p.P109P		.											.	ST6GALNAC1-90	0			c.G327A						.						128.0	117.0	121.0					17																	74625598		2203	4300	6503	SO:0001819	synonymous_variant	55808	exon2			CTCCTCCGGCGGT	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.327G>A	17.37:g.74625598C>T		212	2		240	55	NM_018414	0	0	0	1	1	Q6UW90|Q9NSC6	Silent	SNP	ENST00000156626.7	37	CCDS11748.1																																																																																			.		0.587	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	NM_018414	
ST6GALNAC1	55808	broad.mit.edu	37	17	74625786	74625786	+	Missense_Mutation	SNP	G	G	T	rs368078651	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:74625786G>T	ENST00000156626.7	-	2	338	c.139C>A	c.(139-141)Cgc>Agc	p.R47S	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	47					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						TTCTCTGTGCGTTGATGCCTA	0.433																																					p.R47S		.											.	ST6GALNAC1-90	0			c.C139A						.						96.0	91.0	93.0					17																	74625786		2203	4300	6503	SO:0001583	missense	55808	exon2			CTGTGCGTTGATG	Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.139C>A	17.37:g.74625786G>T	ENSP00000156626:p.Arg47Ser	66	0		49	8	NM_018414	0	0	0	0	0	Q6UW90|Q9NSC6	Missense_Mutation	SNP	ENST00000156626.7	37	CCDS11748.1	.	.	.	.	.	.	.	.	.	.	G	6.219	0.408640	0.11812	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.23348	1.94;1.91	3.68	-7.36	0.01417	.	4.891320	0.00166	N	0.000011	T	0.09468	0.0233	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.04013	0.001	T	0.16188	-1.0411	10	0.21540	T	0.41	7.3021	0.5915	0.00728	0.3684:0.2757:0.138:0.2179	.	47	Q9NSC7	SIA7A_HUMAN	S	47	ENSP00000156626:R47S;ENSP00000351991:R47S	ENSP00000156626:R47S	R	-	1	0	ST6GALNAC1	72137381	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.693000	0.01917	-1.873000	0.01135	-1.342000	0.01247	CGC	.		0.433	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450974.1	NM_018414	
B3GNTL1	146712	hgsc.bcm.edu	37	17	80915250	80915257	+	Frame_Shift_Del	DEL	GGCAGTCA	GGCAGTCA	-	rs117451067	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	GGCAGTCA	GGCAGTCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:80915250_80915257delGGCAGTCA	ENST00000320865.3	-	9	852_859	c.839_846delTGACTGCC	c.(838-846)ttgactgccfs	p.LTA280fs	B3GNTL1_ENST00000576599.1_Frame_Shift_Del_p.LTA169fs|B3GNTL1_ENST00000571954.1_5'Flank	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	280							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			GCTGGCTGCCGGCAGTCAAGCTGCGGTA	0.702																																					p.280_282del		.											.	B3GNTL1-92	0			c.839_846del						.																																			SO:0001589	frameshift_variant	146712	exon9			GCTGCCGGCAGTC	AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.839_846delTGACTGCC	17.37:g.80915250_80915257delGGCAGTCA	ENSP00000319979:p.Leu280fs	71	2		202	0	NM_001009905	0	0	0	0	0	Q6GV30|Q8WUT3	Frame_Shift_Del	DEL	ENST00000320865.3	37	CCDS32778.1																																																																																			.		0.702	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438949.1	NM_001009905	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000453954.2_Silent_p.S350S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		0	0		17	5	NM_003200	0	0	18	18	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	2	0		20	14	NM_019107	0	0	13	26	13	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
EVI5L	115704	broad.mit.edu	37	19	7911501	7911501	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:7911501T>C	ENST00000270530.4	+	2	269	c.73T>C	c.(73-75)Tct>Cct	p.S25P	EVI5L_ENST00000538904.2_Missense_Mutation_p.S25P	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	25					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						CTCCCCAACCTCTGACTCCGA	0.657																																					p.S25P		.											.	EVI5L-91	0			c.T73C						.						32.0	34.0	33.0					19																	7911501		2203	4300	6503	SO:0001583	missense	115704	exon1			CCAACCTCTGACT	BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.73T>C	19.37:g.7911501T>C	ENSP00000270530:p.Ser25Pro	87	0		104	4	NM_001159944	0	0	6	6	0	B9A6I9	Missense_Mutation	SNP	ENST00000270530.4	37	CCDS12188.1	.	.	.	.	.	.	.	.	.	.	T	11.82	1.754019	0.31046	.	.	ENSG00000142459	ENST00000270530;ENST00000538904	T;T	0.05717	3.4;3.41	4.78	4.78	0.61160	.	0.070116	0.64402	D	0.000020	T	0.11110	0.0271	L	0.59436	1.845	0.41747	D	0.989641	P;P	0.51351	0.944;0.944	P;P	0.47346	0.544;0.544	T	0.08269	-1.0730	10	0.35671	T	0.21	-14.9537	12.2782	0.54749	0.0:0.0:0.0:1.0	.	25;25	B9A6I9;Q96CN4	.;EVI5L_HUMAN	P	25	ENSP00000270530:S25P;ENSP00000445905:S25P	ENSP00000270530:S25P	S	+	1	0	EVI5L	7817501	0.997000	0.39634	0.907000	0.35723	0.387000	0.30353	4.083000	0.57643	1.788000	0.52465	0.459000	0.35465	TCT	.		0.657	EVI5L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461347.1	NM_145245	
CD320	51293	hgsc.bcm.edu	37	19	8373152	8373152	+	Missense_Mutation	SNP	T	T	C	rs2232775	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:8373152T>C	ENST00000301458.5	-	1	87	c.23A>G	c.(22-24)cAg>cGg	p.Q8R	CD320_ENST00000596246.1_5'UTR|CD320_ENST00000537716.2_Missense_Mutation_p.Q8R	NM_016579.3	NP_057663.1	Q9NPF0	CD320_HUMAN	CD320 molecule	8			Q -> R (in dbSNP:rs2232775). {ECO:0000269|Ref.6}.		cobalamin metabolic process (GO:0009235)|regulation of cell growth (GO:0001558)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)	6						CGCTCCAACCTGCGCCATCCA	0.731													C|||	1026	0.204872	0.472	0.0591	5008	,	,		12375	0.0813		0.0437	False		,,,				2504	0.2403				p.Q8R		.											.	CD320-90	0			c.A23G						.	C	ARG/GLN,ARG/GLN	1254,2810		181,892,959	6.0	7.0	7.0		23,23	1.9	0.0	19	dbSNP_98	7	261,8013		4,253,3880	no	missense,missense	CD320	NM_001165895.1,NM_016579.3	43,43	185,1145,4839	CC,CT,TT		3.1545,30.8563,12.2791	benign,benign	8/241,8/283	8373152	1515,10823	2032	4137	6169	SO:0001583	missense	51293	exon1			CCAACCTGCGCCA	AF161254	CCDS12198.1, CCDS54210.1	19p13.3-p13.2	2008-02-05	2006-03-28			ENSG00000167775		"""CD molecules"""	16692	protein-coding gene	gene with protein product	"""8D6 antigen"""	606475	"""CD320 antigen"""			10727470	Standard	NM_016579		Approved	8D6, 8D6A	uc002mjj.2	Q9NPF0		ENST00000301458.5:c.23A>G	19.37:g.8373152T>C	ENSP00000301458:p.Gln8Arg	1	0		59	23	NM_001165895	0	0	29	44	15	B2RDS5|D6W668|F5H6D3|Q53HF7	Missense_Mutation	SNP	ENST00000301458.5	37	CCDS12198.1	321	0.14697802197802198	223	0.4532520325203252	18	0.049723756906077346	51	0.08916083916083917	29	0.03825857519788918	C	1.030	-0.682008	0.03353	0.308563	0.031545	ENSG00000167775	ENST00000301458;ENST00000537716	D;D	0.95918	-2.91;-3.85	4.09	1.88	0.25563	.	0.730560	0.11271	N	0.581501	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27365	-1.0076	9	0.02654	T	1	-1.2784	3.6347	0.08145	0.2174:0.5698:0.0:0.2129	rs2232775;rs3180350	8;8	F5H6D3;Q9NPF0	.;CD320_HUMAN	R	8	ENSP00000301458:Q8R;ENSP00000437697:Q8R	ENSP00000301458:Q8R	Q	-	2	0	CD320	8279152	0.000000	0.05858	0.003000	0.11579	0.014000	0.08584	-0.149000	0.10204	0.110000	0.17919	-1.212000	0.01626	CAG	T|0.852;C|0.148		0.731	CD320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461366.1	NM_016579	
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		0	0		6	6	NM_198471	0	0	0	0	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
HNRNPM	4670	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	8555234	8555236	+	IGR	DEL	CAT	CAT	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	CAT	CAT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:8555234_8555236delCAT	ENST00000325495.4	+	0	2494				PRAM1_ENST00000255612.3_In_Frame_Del_p.D653del|PRAM1_ENST00000423345.4_In_Frame_Del_p.D654del	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						CAGAAGTCGACATCATCGTACAC	0.66																																					p.654_655del		.											.	.	0			c.1961_1963del						.																																			SO:0001628	intergenic_variant	84106	exon9			AGTCGACATCATC	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383		19.37:g.8555237_8555239delCAT		126	0		185	35	NM_032152	0	0	0	0	0	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	In_Frame_Del	DEL	ENST00000325495.4	37	CCDS12203.1																																																																																			.		0.660	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
NACC1	112939	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	13246265	13246265	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:13246265C>G	ENST00000292431.4	+	2	370	c.244C>G	c.(244-246)Ctc>Gtc	p.L82V		NM_052876.3	NP_443108.1	Q96RE7	NACC1_HUMAN	nucleus accumbens associated 1, BEN and BTB (POZ) domain containing	82	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear body (GO:0016604)|nucleus (GO:0005634)				endometrium(3)|large_intestine(2)|lung(3)|skin(1)	9						CCAGCAGATCCTCAGCTTCTG	0.617																																					p.L82V		.											.	NACC1-90	0			c.C244G						.						36.0	37.0	37.0					19																	13246265		2203	4300	6503	SO:0001583	missense	112939	exon2			CAGATCCTCAGCT	AF395817	CCDS12294.1	19p13.13	2013-01-09	2008-10-03	2008-10-03		ENSG00000160877		"""BEN domain containing"", ""BTB/POZ domain containing"""	20967	protein-coding gene	gene with protein product	"""nucleus accumbens associated 1"", ""BEN domain containing 8"""	610672	"""BTB (POZ) domain containing 14B"""	BTBD14B		12477932	Standard	NM_052876		Approved	NAC1, NAC-1, BEND8, BTBD30	uc002mwm.4	Q96RE7		ENST00000292431.4:c.244C>G	19.37:g.13246265C>G	ENSP00000292431:p.Leu82Val	202	0		344	51	NM_052876	0	0	9	14	5		Missense_Mutation	SNP	ENST00000292431.4	37	CCDS12294.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277095	0.80580	.	.	ENSG00000160877	ENST00000292431	T	0.80738	-1.41	5.21	5.21	0.72293	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000001	D	0.88269	0.6391	M	0.64170	1.965	0.53688	D	0.999978	D	0.76494	0.999	D	0.91635	0.999	D	0.89359	0.3666	10	0.87932	D	0	.	16.346	0.83133	0.0:1.0:0.0:0.0	.	82	Q96RE7	NACC1_HUMAN	V	82	ENSP00000292431:L82V	ENSP00000292431:L82V	L	+	1	0	NACC1	13107265	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.742000	0.85008	2.442000	0.82660	0.650000	0.86243	CTC	.		0.617	NACC1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452879.1	NM_052876	
JAK3	3718	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17954268	17954268	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:17954268T>C	ENST00000527670.1	-	3	370	c.341A>G	c.(340-342)aAg>aGg	p.K114R	JAK3_ENST00000534444.1_Missense_Mutation_p.K114R|JAK3_ENST00000458235.1_Missense_Mutation_p.K114R|JAK3_ENST00000526008.1_5'UTR			P52333	JAK3_HUMAN	Janus kinase 3	114	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	GCGGTGGCACTTCTCCAGCCC	0.557		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.K114R		.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	JAK3-2418	0			c.A341G						.						24.0	21.0	22.0					19																	17954268		2201	4297	6498	SO:0001583	missense	3718	exon4			TGGCACTTCTCCA	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.341A>G	19.37:g.17954268T>C	ENSP00000432511:p.Lys114Arg	212	0		350	57	NM_000215	0	0	0	0	0	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	37	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	T	1.498	-0.552822	0.03996	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.71817	-0.6;-0.6;-0.6	4.78	0.0631	0.14347	Band 4.1 domain (1);FERM domain (1);	0.423150	0.25648	N	0.029227	T	0.38241	0.1033	N	0.05306	-0.075	0.18873	N	0.999985	B;B;B	0.23377	0.084;0.0;0.001	B;B;B	0.21917	0.037;0.002;0.002	T	0.25916	-1.0118	10	0.08179	T	0.78	-4.2902	4.8448	0.13509	0.0:0.1788:0.3213:0.4999	.	114;114;114	B4DK43;P52333-2;P52333	.;.;JAK3_HUMAN	R	114	ENSP00000391676:K114R;ENSP00000432511:K114R;ENSP00000436421:K114R	ENSP00000413248:K114R	K	-	2	0	JAK3	17815268	0.003000	0.15002	0.081000	0.20488	0.774000	0.43823	0.356000	0.20181	-0.014000	0.14175	0.397000	0.26171	AAG	.		0.557	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000306065.4_5'Flank|ANKRD27_ENST00000587352.1_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	0	0		7	7	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
NUMBL	9253	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	41175846	41175846	+	Silent	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:41175846G>A	ENST00000252891.4	-	9	1283	c.1116C>T	c.(1114-1116)gcC>gcT	p.A372A	NUMBL_ENST00000540131.1_Silent_p.A331A|NUMBL_ENST00000598779.1_Silent_p.A331A	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	372					adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			CTCCAGCACTGGCAAAAGATG	0.607																																					p.A372A		.											.	NUMBL-637	0			c.C1116T						.						67.0	60.0	62.0					19																	41175846		2203	4300	6503	SO:0001819	synonymous_variant	9253	exon9			AGCACTGGCAAAA	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1116C>T	19.37:g.41175846G>A		104	0		175	34	NM_004756	0	0	6	6	0	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																			.		0.607	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
PSG9	5678	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	43772123	43772123	+	Silent	SNP	C	C	T	rs376642216		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:43772123C>T	ENST00000270077.3	-	2	339	c.243G>A	c.(241-243)tcG>tcA	p.S81S	PSG9_ENST00000418820.2_Silent_p.S81S|PSG9_ENST00000593948.1_Silent_p.S81S|PSG9_ENST00000596730.1_Silent_p.S81S|PSG9_ENST00000443718.3_Silent_p.S81S|PSG9_ENST00000291752.5_Silent_p.S81S|PSG9_ENST00000244293.7_Silent_p.S81S	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	81	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)		p.S81S(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				CAACTATATACGATATAATGT	0.423																																					p.S81S		.											.	PSG9-92	1	Substitution - coding silent(1)	large_intestine(1)	c.G243A						.	T		0,4406		0,0,2203	176.0	178.0	178.0		243	-0.9	0.0	19		178	4,8596	819.0+/-406.8	0,4,4296	no	coding-synonymous	PSG9	NM_002784.3		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		81/427	43772123	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	5678	exon2			TATATACGATATA	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.243G>A	19.37:g.43772123C>T		161	0		167	28	NM_002784	0	0	0	0	0	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Silent	SNP	ENST00000270077.3	37	CCDS12618.1	.	.	.	.	.	.	.	.	.	.	t	0.903	-0.721690	0.03182	0.0	4.65E-4	ENSG00000183668	ENST00000418820	.	.	.	1.56	-0.884	0.10597	.	.	.	.	.	T	0.21468	0.0517	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.19745	-1.0296	4	.	.	.	.	2.7007	0.05148	0.2008:0.2645:0.0:0.5347	.	.	.	.	H	68	.	.	R	-	2	0	PSG9	48463963	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.734000	0.04893	-2.083000	0.00867	-4.055000	0.00012	CGT	.		0.423	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323065.1	NM_002784	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	0	0		23	14	NM_000400	0	0	6	15	9	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
PNMAL2	57469	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	46997223	46997223	+	Intron	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:46997223G>A	ENST00000377655.2	-	1	734				PNMAL2_ENST00000599531.1_Silent_p.N500N|PNMAL2_ENST00000594749.1_Intron|AC011484.1_ENST00000377652.3_5'Flank			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		CCGACCCCTCGTTGGACCCCA	0.632																																					p.N500N		.											.	PNMAL2-1	0			c.C1500T						.						53.0	56.0	55.0					19																	46997223		1964	4145	6109	SO:0001627	intron_variant	57469	exon1			CCCCTCGTTGGAC	AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.734+765C>T	19.37:g.46997223G>A		76	0		83	11	NM_020709	0	0	5	7	2	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Silent	SNP	ENST00000377655.2	37																																																																																				.		0.632	PNMAL2-201	KNOWN	basic	protein_coding	protein_coding		NM_020709	
TMEM143	55260	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	48866617	48866617	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:48866617G>C	ENST00000293261.3	-	2	511	c.195C>G	c.(193-195)gaC>gaG	p.D65E	TMEM143_ENST00000435956.3_Missense_Mutation_p.D65E|SYNGR4_ENST00000344846.2_5'Flank|TMEM143_ENST00000541566.1_Intron|TMEM143_ENST00000377431.2_Missense_Mutation_p.D65E|TMEM143_ENST00000436660.2_Missense_Mutation_p.D65E|TMEM143_ENST00000598012.1_5'UTR	NM_018273.2	NP_060743.2	Q96AN5	TM143_HUMAN	transmembrane protein 143	65					hematopoietic progenitor cell differentiation (GO:0002244)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	14		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		GCTGGGCCCAGTCGCGGGGCT	0.667																																					p.D65E		.											.	TMEM143-90	0			c.C195G						.						35.0	42.0	39.0					19																	48866617		2203	4298	6501	SO:0001583	missense	55260	exon2			GGCCCAGTCGCGG	AK129801	CCDS12716.1	19q13.32	2008-02-05				ENSG00000161558			25603	protein-coding gene	gene with protein product						12975309	Standard	NM_018273		Approved	FLJ10922	uc002pix.1	Q96AN5		ENST00000293261.3:c.195C>G	19.37:g.48866617G>C	ENSP00000293261:p.Asp65Glu	66	0		90	19	NM_018273	0	0	4	7	3	A8K656|Q6UXY4|Q9NV49	Missense_Mutation	SNP	ENST00000293261.3	37	CCDS12716.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943917	0.73672	.	.	ENSG00000161558	ENST00000293261;ENST00000377431;ENST00000435956;ENST00000436660	T;T	0.53857	0.72;0.6	5.56	0.861	0.19048	.	0.332477	0.27604	N	0.018625	T	0.35537	0.0935	N	0.24115	0.695	0.25158	N	0.990377	B;D;B;P;P	0.54207	0.003;0.965;0.031;0.682;0.457	B;P;B;B;B	0.47044	0.004;0.535;0.019;0.129;0.129	T	0.27088	-1.0084	10	0.62326	D	0.03	-7.255	1.825	0.03119	0.2283:0.1387:0.4901:0.143	.	65;65;65;65;65	B4DG49;B4DPF8;Q96AN5-2;B4DMT0;Q96AN5	.;.;.;.;TM143_HUMAN	E	65	ENSP00000293261:D65E;ENSP00000397038:D65E	ENSP00000293261:D65E	D	-	3	2	TMEM143	53558429	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	0.350000	0.20079	0.091000	0.17302	0.561000	0.74099	GAC	.		0.667	TMEM143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465622.1	NM_018273	
NAPSA	9476	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	50865552	50865552	+	Silent	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:50865552G>C	ENST00000253719.2	-	2	310	c.102C>G	c.(100-102)gtC>gtG	p.V34V	NR1H2_ENST00000600978.1_Intron|NR1H2_ENST00000542413.1_Intron	NM_004851.1	NP_004842.1	O96009	NAPSA_HUMAN	napsin A aspartic peptidase	34					membrane protein proteolysis (GO:0033619)|proteolysis (GO:0006508)|surfactant homeostasis (GO:0043129)	alveolar lamellar body (GO:0097208)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)|peptidase activity (GO:0008233)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0183)		GTCCAGGTTGGACTCGATGAA	0.532																																					p.V34V		.											.	NAPSA-90	0			c.C102G						.						60.0	57.0	58.0					19																	50865552		2203	4300	6503	SO:0001819	synonymous_variant	9476	exon2			AGGTTGGACTCGA	AF090386	CCDS12794.1	19q13.33	2011-08-25				ENSG00000131400			13395	protein-coding gene	gene with protein product	"""kidney-derived aspartic protease-like protein"""	605631					Standard	NM_004851		Approved	NAP1, NAPA, Kdap, KAP	uc002prx.3	O96009		ENST00000253719.2:c.102C>G	19.37:g.50865552G>C		67	0		82	17	NM_004851	0	0	0	0	0	Q8WWD9	Silent	SNP	ENST00000253719.2	37	CCDS12794.1																																																																																			.		0.532	NAPSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464714.1	NM_004851	
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000595669.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	0	0		14	14	NM_001114598	0	0	0	0	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
LRRC4B	94030	hgsc.bcm.edu	37	19	51021057	51021057	+	Missense_Mutation	SNP	A	A	G	rs61751957	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:51021057A>G	ENST00000599957.1	-	3	2110	c.1913T>C	c.(1912-1914)gTg>gCg	p.V638A	LRRC4B_ENST00000389201.3_Missense_Mutation_p.V638A			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	638	Poly-Ala.			AV -> TA (in Ref. 2; AAH56207). {ECO:0000305}.	positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CCCACTGGCCACGGCGGCCGC	0.726													A|||	1071	0.213858	0.1702	0.2579	5008	,	,		10941	0.125		0.2893	False		,,,				2504	0.2556				p.V638A		.											.	LRRC4B-205	0			c.T1913C						.	A	ALA/VAL	591,3051		57,477,1287	13.0	15.0	14.0		1913	-0.8	0.0	19	dbSNP_129	14	2294,5564		347,1600,1982	no	missense	LRRC4B	NM_001080457.1	64	404,2077,3269	GG,GA,AA		29.1932,16.2273,25.087	benign	638/714	51021057	2885,8615	1821	3929	5750	SO:0001583	missense	94030	exon3			CTGGCCACGGCGG	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1913T>C	19.37:g.51021057A>G	ENSP00000471502:p.Val638Ala	1	0		25	6	NM_001080457	0	0	0	0	0	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	484	0.2216117216117216	86	0.17479674796747968	89	0.24585635359116023	74	0.12937062937062938	235	0.3100263852242744	A	2.037	-0.421084	0.04734	0.162273	0.291932	ENSG00000131409	ENST00000389201	T	0.27402	1.67	2.86	-0.757	0.11054	.	0.245138	0.17282	U	0.179967	T	0.00012	0.0000	L	0.36672	1.1	0.47183	P	6.540000000000434E-4	B	0.06786	0.001	B	0.04013	0.001	T	0.44982	-0.9292	9	0.12430	T	0.62	.	6.0652	0.19860	0.596:0.0:0.404:0.0	rs61751957	638	Q9NT99	LRC4B_HUMAN	A	638	ENSP00000373853:V638A	ENSP00000373853:V638A	V	-	2	0	LRRC4B	55712869	1.000000	0.71417	0.038000	0.18304	0.337000	0.28794	2.356000	0.44116	-0.425000	0.07371	-1.467000	0.01014	GTG	A|0.777;G|0.223		0.726	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
ZNF616	90317	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	52620097	52620098	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:52620097_52620098delTT	ENST00000600228.1	-	4	580_581	c.319_320delAA	c.(319-321)aatfs	p.N107fs	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	107					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		TTCTTTATCATTTGTTTCACCA	0.342																																					p.107_107del		.											.	ZNF616-90	0			c.319_320del						.																																			SO:0001589	frameshift_variant	90317	exon4			TTATCATTTGTTT	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.319_320delAA	19.37:g.52620097_52620098delTT	ENSP00000471000:p.Asn107fs	136	0		196	37	NM_178523	0	0	0	0	0	B3KRV1|Q0P658|Q658V7	Frame_Shift_Del	DEL	ENST00000600228.1	37	CCDS33090.1																																																																																			.		0.342	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	XM_030892	
LILRA3	11026	ucsc.edu	37	19	54803750	54803750	+	Missense_Mutation	SNP	G	G	T	rs149807835	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:54803750G>T	ENST00000251390.3	-	3	165	c.74C>A	c.(73-75)cCc>cAc	p.P25H	LILRA3_ENST00000391744.3_Missense_Mutation_p.P25H|LILRA3_ENST00000391745.1_Missense_Mutation_p.P42H	NM_006865.3	NP_006856.3	Q8N6C8	LIRA3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	25					defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			NS(3)|breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CTTGGGGAGGGGCCCTGGAAG	0.597													.|||	11	0.00219649	0.0008	0.0086	5008	,	,		12025	0.0		0.004	False		,,,				2504	0.0				p.P25H		.											.	LILRA3-91	0			c.C74A						.	G	HIS/PRO,HIS/PRO	9,4373		0,9,2182	47.0	47.0	47.0		74,74	0.0	0.0	19	dbSNP_134	47	146,8236		8,130,4053	no	missense,missense	LILRA3	NM_001172654.1,NM_006865.3	77,77	8,139,6235	TT,TG,GG		1.7418,0.2054,1.2144	,	25/376,25/440	54803750	155,12609	2191	4191	6382	SO:0001583	missense	11026	exon3			GGGAGGGGCCCTG	U91926		19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6604	protein-coding gene	gene with protein product		604818				9278324, 9548455	Standard	XM_006710242		Approved	LIR-4, HM43, ILT6, HM31, LIR4, CD85e		Q8N6C8		ENST00000251390.3:c.74C>A	19.37:g.54803750G>T	ENSP00000251390:p.Pro25His	58	0		66	6	NM_001172654	0	0	0	0	0	J3KPM2|O15469|O15470|O75016|Q8N151|Q8N154|Q8NHJ1|Q8NHJ2|Q8NHJ3|Q8NHJ4	Missense_Mutation	SNP	ENST00000251390.3	37	CCDS12887.1	.	.	.	.	.	.	.	.	.	.	G	4.906	0.168293	0.09339	0.002054	0.017418	ENSG00000170866	ENST00000251390;ENST00000391744;ENST00000391745	T;T;T	0.00784	5.7;5.7;5.7	2.5	0.00277	0.14052	Immunoglobulin-like fold (1);	0.651463	0.13424	N	0.388953	T	0.00440	0.0014	L	0.46819	1.47	0.09310	N	1	B;B	0.09022	0.002;0.0	B;B	0.11329	0.006;0.002	T	0.46386	-0.9195	10	0.42905	T	0.14	.	3.0355	0.06121	0.1596:0.0:0.5785:0.2619	.	25;25	E7EU74;Q8N6C8	.;LIRA3_HUMAN	H	25;25;42	ENSP00000251390:P25H;ENSP00000375624:P25H;ENSP00000375625:P42H	ENSP00000251390:P25H	P	-	2	0	LILRA3	59495562	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.137000	0.10389	-0.019000	0.14055	-0.343000	0.07986	CCC	G|0.970;T|0.030		0.597	LILRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140236.1		
ZNF628	89887	hgsc.bcm.edu	37	19	55993260	55993260	+	Missense_Mutation	SNP	A	A	G	rs34864744	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:55993260A>G	ENST00000598519.1	+	3	1253	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	ZNF628_ENST00000391718.2_Missense_Mutation_p.T230A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	234	Pro-rich.			T -> A (in Ref. 2; AAH89449). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		cgccccgggtaccgcctccgc	0.766													N|||	3815	0.761781	0.9387	0.732	5008	,	,		4719	0.4395		0.837	False		,,,				2504	0.7986				p.T234A		.											.	ZNF628-22	0			c.A700G						.						3.0	4.0	4.0					19																	55993260		1771	3509	5280	SO:0001583	missense	89887	exon3			CCGGGTACCGCCT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.700A>G	19.37:g.55993260A>G	ENSP00000469591:p.Thr234Ala	0	0		11	11	NM_033113	0	0	0	0	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	1594	0.7298534798534798	448	0.9105691056910569	272	0.7513812154696132	259	0.4527972027972028	615	0.8113456464379947	.	0.001	-2.964343	0.00049	.	.	ENSG00000197483	ENST00000391718	T	0.08193	3.12	3.0	-0.723	0.11181	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05852	-1.0860	8	0.25106	T	0.35	0.0335	6.0751	0.19911	0.3452:0.3167:0.3381:0.0	rs34864744	230	Q5EBL2	ZN628_HUMAN	A	230	ENSP00000375598:T230A	ENSP00000375598:T230A	T	+	1	0	ZNF628	60685072	0.324000	0.24652	0.001000	0.08648	0.007000	0.05969	-0.265000	0.08644	-0.261000	0.09405	-2.335000	0.00248	ACC	A|0.270;G|0.730		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
ZNF814	730051	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	58385748	58385748	+	Missense_Mutation	SNP	G	G	A	rs145250945		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:58385748G>A	ENST00000435989.2	-	3	1244	c.1010C>T	c.(1009-1011)gCt>gTt	p.A337V	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	337					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A337V(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTGAAGCTAGCATATTTGCT	0.353																																					p.A337V		.											.	.	2	Substitution - Missense(2)	prostate(2)	c.C1010T						.						58.0	51.0	53.0					19																	58385748		692	1591	2283	SO:0001583	missense	730051	exon3			AAGCTAGCATATT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.1010C>T	19.37:g.58385748G>A	ENSP00000410545:p.Ala337Val	110	0		207	70	NM_001144989	0	0	2	2	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	3.777	-0.046344	0.07407	.	.	ENSG00000204514	ENST00000435989	T	0.15372	2.43	2.11	-4.21	0.03812	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07728	0.0194	N	0.21142	0.635	0.09310	N	1	B	0.32781	0.384	B	0.18561	0.022	T	0.05649	-1.0872	9	0.66056	D	0.02	.	3.5015	0.07674	0.0936:0.1206:0.3016:0.4843	.	337	B7Z6K7	ZN814_HUMAN	V	337	ENSP00000410545:A337V	ENSP00000410545:A337V	A	-	2	0	ZNF814	63077560	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.230000	0.01207	-3.525000	0.00147	-3.867000	0.00017	GCT	.		0.353	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF814	730051	ucsc.edu;bcgsc.ca	37	19	58385762	58385762	+	Silent	SNP	C	C	G	rs199732634		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:58385762C>G	ENST00000435989.2	-	3	1230	c.996G>C	c.(994-996)tcG>tcC	p.S332S	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	332					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S332S(2)		NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ATTTGCTAAACGATTTCCCAC	0.358																																					p.S332S		.											.	.	2	Substitution - coding silent(2)	kidney(2)	c.G996C						.						25.0	25.0	25.0					19																	58385762		692	1589	2281	SO:0001819	synonymous_variant	730051	exon3			GCTAAACGATTTC		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.996G>C	19.37:g.58385762C>G		96	1		176	50	NM_001144989	0	0	0	0	0	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		0	0		15	15	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
RAD51AP2	729475	broad.mit.edu;bcgsc.ca	37	2	17699028	17699028	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:17699028G>T	ENST00000399080.2	-	1	678	c.655C>A	c.(655-657)Cca>Aca	p.P219T		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	219										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTATTTGATGGCACAACACTG	0.308																																					p.P219T		.											.	RAD51AP2-23	0			c.C655A						.						75.0	72.0	73.0					2																	17699028		1839	4095	5934	SO:0001583	missense	729475	exon1			TTGATGGCACAAC	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.655C>A	2.37:g.17699028G>T	ENSP00000382030:p.Pro219Thr	66	0		79	5	NM_001099218	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399080.2	37	CCDS42656.1	.	.	.	.	.	.	.	.	.	.	G	4.327	0.060042	0.08339	.	.	ENSG00000214842	ENST00000399080	T	0.34072	1.38	3.91	0.818	0.18778	.	.	.	.	.	T	0.15696	0.0378	N	0.17082	0.46	0.09310	N	1	B	0.28998	0.23	B	0.25140	0.058	T	0.26292	-1.0107	9	0.07990	T	0.79	0.2921	3.832	0.08877	0.2189:0.0:0.3094:0.4717	.	219	Q09MP3	R51A2_HUMAN	T	219	ENSP00000382030:P219T	ENSP00000382030:P219T	P	-	1	0	RAD51AP2	17562509	0.000000	0.05858	0.006000	0.13384	0.997000	0.91878	0.259000	0.18405	0.152000	0.19188	0.655000	0.94253	CCA	.		0.308	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323801.3	NM_001099218	
ITSN2	50618	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24522788	24522788	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:24522788T>C	ENST00000355123.4	-	12	1777	c.1334A>G	c.(1333-1335)gAa>gGa	p.E445G	ITSN2_ENST00000361999.3_Missense_Mutation_p.E445G|ITSN2_ENST00000406921.3_Missense_Mutation_p.E445G	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	445					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCTCGTCTTTCTATGTCTTT	0.294																																					p.E445G		.											.	ITSN2-539	0			c.A1334G						.						123.0	113.0	117.0					2																	24522788		2203	4300	6503	SO:0001583	missense	50618	exon12			CGTCTTTCTATGT	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.1334A>G	2.37:g.24522788T>C	ENSP00000347244:p.Glu445Gly	55	0		75	19	NM_147152	0	0	0	0	0	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	ENST00000355123.4	37	CCDS1710.2	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657799	0.67586	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868;ENST00000445614;ENST00000406921;ENST00000412011	T;T;T;T;D	0.82081	-0.11;-0.09;-0.11;0.35;-1.57	5.76	5.76	0.90799	.	0.000000	0.38164	U	0.001800	D	0.90779	0.7105	M	0.75615	2.305	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.85130	0.997;0.997;0.997;0.994	D	0.91746	0.5408	10	0.87932	D	0	.	16.0501	0.80755	0.0:0.0:0.0:1.0	.	445;445;445;445	Q9NZM3-4;Q9NZM3-3;Q9NZM3-2;Q9NZM3	.;.;.;ITSN2_HUMAN	G	445;445;445;469;445;470	ENSP00000354561:E445G;ENSP00000347244:E445G;ENSP00000370250:E445G;ENSP00000384499:E445G;ENSP00000391224:E470G	ENSP00000347244:E445G	E	-	2	0	ITSN2	24376292	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.698000	0.84413	2.333000	0.79357	0.482000	0.46254	GAA	.		0.294	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
OTOF	9381	hgsc.bcm.edu;bcgsc.ca	37	2	26684681	26684683	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	TCT	TCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:26684681_26684683delTCT	ENST00000272371.2	-	43	5540_5542	c.5414_5416delAGA	c.(5413-5418)aagatc>atc	p.K1805del	OTOF_ENST00000403946.3_In_Frame_Del_p.K1805del|OTOF_ENST00000338581.6_In_Frame_Del_p.K1038del|OTOF_ENST00000402415.3_In_Frame_Del_p.K1115del|OTOF_ENST00000339598.3_In_Frame_Del_p.K1038del	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1805					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGATGACGATCTTCTCCTCCGC	0.596																																					p.1805_1806del	GBM(102;732 1451 20652 24062 31372)	.											.	OTOF-135	0			c.5414_5416del						.																																			SO:0001651	inframe_deletion	9381	exon43			TGACGATCTTCTC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.5414_5416delAGA	2.37:g.26684684_26684686delTCT	ENSP00000272371:p.Lys1805del	224	0		341	75	NM_194248	0	0	0	0	0	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	In_Frame_Del	DEL	ENST00000272371.2	37	CCDS1725.1																																																																																			.		0.596	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
OTOF	9381	broad.mit.edu	37	2	26696027	26696027	+	Missense_Mutation	SNP	G	G	C	rs199904558		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:26696027G>C	ENST00000272371.2	-	29	3832	c.3706C>G	c.(3706-3708)Cgc>Ggc	p.R1236G	OTOF_ENST00000403946.3_Missense_Mutation_p.R1236G|OTOF_ENST00000338581.6_Missense_Mutation_p.R489G|OTOF_ENST00000402415.3_Missense_Mutation_p.R546G|OTOF_ENST00000339598.3_Missense_Mutation_p.R489G	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1236			R -> Q. {ECO:0000269|PubMed:18381613}.		membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGCCGAGCGGTCTGGGGGC	0.687																																					p.R1236G	GBM(102;732 1451 20652 24062 31372)	.											.	OTOF-135	0			c.C3706G						.	G	GLY/ARG,GLY/ARG,GLY/ARG,GLY/ARG	0,4406		0,0,2203	34.0	39.0	37.0		1465,3706,1636,1465	3.7	0.9	2		37	8,8590	6.4+/-24.3	0,8,4291	yes	missense,missense,missense,missense	OTOF	NM_004802.3,NM_194248.2,NM_194322.2,NM_194323.2	125,125,125,125	0,8,6494	CC,CG,GG		0.093,0.0,0.0615	benign,benign,benign,benign	489/1231,1236/1998,546/1308,489/1231	26696027	8,12996	2203	4299	6502	SO:0001583	missense	9381	exon29			CCGAGCGGTCTGG	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3706C>G	2.37:g.26696027G>C	ENSP00000272371:p.Arg1236Gly	92	1		137	5	NM_194248	0	0	0	0	0	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	ENST00000272371.2	37	CCDS1725.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.26|13.26	2.183493|2.183493	0.38609|0.38609	0.0|0.0	9.3E-4|9.3E-4	ENSG00000115155|ENSG00000115155	ENST00000426958|ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	.|T;T;T;T;T	.|0.80304	.|-1.14;-1.14;-1.1;-1.36;-1.36	4.63|4.63	3.72|3.72	0.42706|0.42706	.|C2 calcium/lipid-binding domain, CaLB (1);	.|0.349949	.|0.28016	.|N	.|0.016937	T|T	0.75925|0.75925	0.3916|0.3916	L|L	0.60455|0.60455	1.87|1.87	0.34558|0.34558	D|D	0.712051|0.712051	.|B;B;B;B	.|0.31625	.|0.035;0.003;0.332;0.332	.|B;B;B;B	.|0.34093	.|0.051;0.007;0.175;0.116	T|T	0.77324|0.77324	-0.2630|-0.2630	5|10	.|0.32370	.|T	.|0.25	-6.8859|-6.8859	10.648|10.648	0.45632|0.45632	0.0:0.0:0.5284:0.4716|0.0:0.0:0.5284:0.4716	.|.	.|1236;489;546;489	.|Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	.|OTOF_HUMAN;.;.;.	R|G	91|489;489;546;1236;1236	.|ENSP00000345137:R489G;ENSP00000344521:R489G;ENSP00000383906:R546G;ENSP00000272371:R1236G;ENSP00000385255:R1236G	.|ENSP00000272371:R1236G	P|R	-|-	2|1	0|0	OTOF|OTOF	26549531|26549531	0.014000|0.014000	0.17966|0.17966	0.928000|0.928000	0.36995|0.36995	0.835000|0.835000	0.47333|0.47333	0.048000|0.048000	0.14078|0.14078	0.890000|0.890000	0.36211|0.36211	0.484000|0.484000	0.47621|0.47621	CCG|CGC	G|0.999;C|0.001		0.687	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214047.3		
CRIM1	51232	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	36739479	36739479	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:36739479G>T	ENST00000280527.2	+	10	2089	c.1722G>T	c.(1720-1722)aaG>aaT	p.K574N	RP11-78I14.1_ENST00000609765.1_RNA	NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	574	Antistasin-like 4. {ECO:0000255|PROSITE- ProRule:PRU00582}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				CATGCAGTAAGATCTGCCCCT	0.488																																					p.K574N		.											.	CRIM1-118	0			c.G1722T						.						159.0	154.0	155.0					2																	36739479		2203	4300	6503	SO:0001583	missense	51232	exon10			CAGTAAGATCTGC	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.1722G>T	2.37:g.36739479G>T	ENSP00000280527:p.Lys574Asn	205	0		290	82	NM_016441	0	0	0	0	0	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	ENST00000280527.2	37	CCDS1783.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436500	0.62955	.	.	ENSG00000150938	ENST00000280527	T	0.05855	3.38	5.91	0.481	0.16809	Proteinase inhibitor I14/I15, hirudin/antistatin (1);Proteinase inhibitor I15, antistasin (1);Proteinase inhibitor I15, antistasin-like (2);	0.000000	0.85682	D	0.000000	T	0.19565	0.0470	M	0.78223	2.4	0.58432	D	0.999991	D	0.89917	1.0	D	0.87578	0.998	T	0.00408	-1.1758	10	0.34782	T	0.22	-22.1414	8.9875	0.36003	0.6415:0.0:0.3585:0.0	.	574	Q9NZV1	CRIM1_HUMAN	N	574	ENSP00000280527:K574N	ENSP00000280527:K574N	K	+	3	2	CRIM1	36592983	1.000000	0.71417	0.985000	0.45067	0.957000	0.61999	0.928000	0.28831	-0.144000	0.11314	-0.345000	0.07892	AAG	.		0.488	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	
CCDC142	84865	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	74701812	74701812	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:74701812C>G	ENST00000393965.3	-	9	2510	c.2114G>C	c.(2113-2115)aGc>aCc	p.S705T	MRPL53_ENST00000258105.7_5'Flank|CCDC142_ENST00000290418.4_Missense_Mutation_p.S698T|MRPL53_ENST00000409710.1_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	705										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						TCCTAGTGTGCTTTGCAGCTG	0.627																																					p.S698T		.											.	CCDC142-68	0			c.G2093C						.						55.0	53.0	53.0					2																	74701812		2203	4300	6503	SO:0001583	missense	84865	exon9			AGTGTGCTTTGCA	AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.2114G>C	2.37:g.74701812C>G	ENSP00000377537:p.Ser705Thr	89	0		117	19	NM_032779	0	0	7	8	1	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Missense_Mutation	SNP	ENST00000393965.3	37		.	.	.	.	.	.	.	.	.	.	C	3.324	-0.138175	0.06669	.	.	ENSG00000135637	ENST00000393965;ENST00000290418	T;T	0.53640	0.61;0.62	5.02	2.19	0.27852	.	0.582706	0.18040	N	0.153637	T	0.47930	0.1472	M	0.69823	2.125	0.09310	N	1	B;P	0.40731	0.042;0.728	B;B	0.41764	0.036;0.366	T	0.37842	-0.9688	10	0.51188	T	0.08	-0.8912	9.864	0.41131	0.0:0.7477:0.0:0.2523	.	705;698	Q17RM4;Q17RM4-2	CC142_HUMAN;.	T	705;698	ENSP00000377537:S705T;ENSP00000290418:S698T	ENSP00000290418:S698T	S	-	2	0	CCDC142	74555320	0.231000	0.23751	0.624000	0.29186	0.035000	0.12851	0.397000	0.20883	0.318000	0.23185	-1.814000	0.00607	AGC	.		0.627	CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1	NM_032779	
SLC35F5	80255	broad.mit.edu	37	2	114512866	114512869	+	Frame_Shift_Del	DEL	ACAC	ACAC	-	rs143143202		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:114512866_114512869delACAC	ENST00000245680.2	-	3	559_562	c.146_149delGTGT	c.(145-150)tgtgtafs	p.CV49fs	SLC35F5_ENST00000409342.1_Frame_Shift_Del_p.CV43fs	NM_025181.2	NP_079457.2	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	49					transport (GO:0006810)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)	20						CATGACAAATACACACACCATTTG	0.358																																					p.49_50del		.											.	SLC35F5-90	0			c.146_149del						.																																			SO:0001589	frameshift_variant	80255	exon3			ACAAATACACACA	AF529364	CCDS2119.1	2q14.1	2013-05-22			ENSG00000115084	ENSG00000115084		"""Solute carriers"""	23617	protein-coding gene	gene with protein product							Standard	XM_005263799		Approved	FLJ22004	uc002tku.1	Q8WV83	OTTHUMG00000131361	ENST00000245680.2:c.146_149delGTGT	2.37:g.114512870_114512873delACAC	ENSP00000245680:p.Cys49fs	65	0		78	7	NM_025181	0	0	0	0	0	Q9H6P8|Q9H7D8	Frame_Shift_Del	DEL	ENST00000245680.2	37	CCDS2119.1																																																																																			.		0.358	SLC35F5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254150.1	NM_025181	
DDX18	8886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	118575133	118575133	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:118575133G>T	ENST00000263239.2	+	2	327	c.199G>T	c.(199-201)Gaa>Taa	p.E67*	DDX18_ENST00000474694.1_3'UTR	NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	67					ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GGGCTTATCAGAAACTCAAAA	0.383																																					p.E67X		.											.	DDX18-290	0			c.G199T						.						70.0	78.0	75.0					2																	118575133		2203	4300	6503	SO:0001587	stop_gained	8886	exon2			TTATCAGAAACTC	X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.199G>T	2.37:g.118575133G>T	ENSP00000263239:p.Glu67*	135	0		155	31	NM_006773	0	0	4	4	0	Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Nonsense_Mutation	SNP	ENST00000263239.2	37	CCDS2120.1	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644551	0.67358	.	.	ENSG00000088205	ENST00000263239	.	.	.	4.01	3.12	0.35913	.	1.413330	0.04437	N	0.370179	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-1.42	7.8619	0.29514	0.1149:0.0:0.8851:0.0	.	.	.	.	X	67	.	ENSP00000263239:E67X	E	+	1	0	DDX18	118291603	0.992000	0.36948	0.195000	0.23364	0.008000	0.06430	4.261000	0.58841	1.041000	0.40125	-0.150000	0.13652	GAA	.		0.383	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129632.3	NM_006773	
CNTNAP5	129684	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	125285031	125285031	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:125285031C>A	ENST00000431078.1	+	10	2008	c.1644C>A	c.(1642-1644)gaC>gaA	p.D548E		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	548	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCATCAAAGACAGGTAATTAT	0.393																																					p.D548E		.											.	CNTNAP5-524	0			c.C1644A						.						128.0	125.0	126.0					2																	125285031		1896	4099	5995	SO:0001583	missense	129684	exon10			CAAAGACAGGTAA	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1644C>A	2.37:g.125285031C>A	ENSP00000399013:p.Asp548Glu	108	0		97	23	NM_130773	0	0	0	0	0	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	37	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.441810	0.83993	.	.	ENSG00000155052	ENST00000431078	T	0.75938	-0.98	5.58	5.58	0.84498	Concanavalin A-like lectin/glucanase, subgroup (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.47093	D	0.000257	D	0.88973	0.6583	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90072	0.4164	10	0.54805	T	0.06	.	18.5556	0.91083	0.0:1.0:0.0:0.0	.	548	Q8WYK1	CNTP5_HUMAN	E	548	ENSP00000399013:D548E	ENSP00000399013:D548E	D	+	3	2	CNTNAP5	125001501	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.233000	0.78125	2.629000	0.89072	0.650000	0.86243	GAC	.		0.393	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
ARHGAP15	55843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	144245049	144245049	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:144245049A>C	ENST00000295095.6	+	9	978	c.811A>C	c.(811-813)Aaa>Caa	p.K271Q	RP11-570L15.2_ENST00000546678.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	271					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		TCTGCAAGAAAAAGGACTTAT	0.358																																					p.K271Q		.											.	ARHGAP15-653	0			c.A811C						.						79.0	85.0	83.0					2																	144245049		2203	4300	6503	SO:0001583	missense	55843	exon9			CAAGAAAAAGGAC	AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.811A>C	2.37:g.144245049A>C	ENSP00000295095:p.Lys271Gln	35	0		48	14	NM_018460	0	0	1	1	0	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	ENST00000295095.6	37	CCDS2184.1	.	.	.	.	.	.	.	.	.	.	A	19.33	3.806208	0.70682	.	.	ENSG00000075884	ENST00000295095	T	0.10860	2.83	5.43	5.43	0.79202	Rho GTPase-activating protein domain (1);	0.000000	0.85682	D	0.000000	T	0.17066	0.0410	M	0.82056	2.57	0.54753	D	0.999981	P	0.48162	0.906	B	0.38842	0.283	T	0.04165	-1.0972	10	0.87932	D	0	.	14.0484	0.64719	1.0:0.0:0.0:0.0	.	271	Q53QZ3	RHG15_HUMAN	Q	271	ENSP00000295095:K271Q	ENSP00000295095:K271Q	K	+	1	0	ARHGAP15	143961519	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.350000	0.90069	2.046000	0.60703	0.533000	0.62120	AAA	.		0.358	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254793.2	NM_018460	
FMNL2	114793	hgsc.bcm.edu;bcgsc.ca	37	2	153476031	153476031	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:153476031G>A	ENST00000288670.9	+	15	2003	c.1636G>A	c.(1636-1638)Ggt>Agt	p.G546S	FMNL2_ENST00000475377.2_5'Flank	NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	546	Pro-rich.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						AGTGCAAAATGGTCCAGTAAC	0.552																																					p.G546S		.											.	FMNL2-516	0			c.G1636A						.						21.0	19.0	20.0					2																	153476031		1444	3210	4654	SO:0001583	missense	114793	exon15			CAAAATGGTCCAG	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.1636G>A	2.37:g.153476031G>A	ENSP00000288670:p.Gly546Ser	59	0		52	10	NM_052905	0	0	0	0	0	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	37	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830650	0.71258	.	.	ENSG00000157827	ENST00000288670;ENST00000421344	T	0.21361	2.01	5.01	5.01	0.66863	.	0.431360	0.26136	N	0.026135	T	0.07999	0.0200	N	0.03608	-0.345	0.80722	D	1	B	0.34290	0.447	B	0.26969	0.075	T	0.35599	-0.9782	10	0.22706	T	0.39	.	10.6002	0.45362	0.0:0.1424:0.7101:0.1474	.	546	Q96PY5-3	.	S	546;43	ENSP00000288670:G546S	ENSP00000288670:G546S	G	+	1	0	FMNL2	153184277	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.235000	0.89803	2.317000	0.78254	0.555000	0.69702	GGT	.		0.552	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
KCNH7	90134	broad.mit.edu;bcgsc.ca	37	2	163241222	163241222	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:163241222C>G	ENST00000332142.5	-	13	3037	c.2938G>C	c.(2938-2940)Gat>Cat	p.D980H		NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	980					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CTTCTTTTATCTATGTGCATT	0.423																																					p.D980H	GBM(196;1492 2208 17507 24132 45496)	.											.	KCNH7-95	0			c.G2938C						.						137.0	134.0	135.0					2																	163241222		2203	4299	6502	SO:0001583	missense	90134	exon13			TTTTATCTATGTG	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2938G>C	2.37:g.163241222C>G	ENSP00000331727:p.Asp980His	132	0		201	8	NM_033272	0	0	0	0	0	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	ENST00000332142.5	37	CCDS2219.1	.	.	.	.	.	.	.	.	.	.	C	12.75	2.030090	0.35797	.	.	ENSG00000184611	ENST00000332142	D	0.98666	-5.06	5.3	4.41	0.53225	.	0.355725	0.33253	N	0.005108	D	0.95837	0.8645	N	0.19112	0.55	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	D	0.93007	0.6428	10	0.48119	T	0.1	.	15.5392	0.76027	0.1394:0.8606:0.0:0.0	.	980	Q9NS40	KCNH7_HUMAN	H	980	ENSP00000331727:D980H	ENSP00000331727:D980H	D	-	1	0	KCNH7	162949468	0.997000	0.39634	1.000000	0.80357	0.994000	0.84299	3.847000	0.55895	1.352000	0.45808	0.655000	0.94253	GAT	.		0.423	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255093.1	NM_033272	
CCDC141	285025	broad.mit.edu	37	2	179721022	179721022	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:179721022G>A	ENST00000420890.2	-	18	2944	c.2827C>T	c.(2827-2829)Caa>Taa	p.Q943*	CCDC141_ENST00000295723.5_Nonsense_Mutation_p.Q368*	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	943										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TGCTGAATTTGATATTTAAGC	0.303																																					p.Q943X		.											.	CCDC141-78	0			c.C2827T						.						108.0	104.0	105.0					2																	179721022		2202	4299	6501	SO:0001587	stop_gained	285025	exon18			GAATTTGATATTT	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.2827C>T	2.37:g.179721022G>A	ENSP00000395995:p.Gln943*	77	0		101	6	NM_173648	0	0	0	0	0	H7C0P1|J3KNW6|Q8N8H3	Nonsense_Mutation	SNP	ENST00000420890.2	37		.	.	.	.	.	.	.	.	.	.	G	38	7.165626	0.98107	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723;ENST00000443758	.	.	.	5.91	5.91	0.95273	.	0.000000	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-10.0716	20.3011	0.98612	0.0:0.0:1.0:0.0	.	.	.	.	X	943;387;368;943	.	ENSP00000295723:Q368X	Q	-	1	0	CCDC141	179429267	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	8.295000	0.89937	2.804000	0.96469	0.650000	0.86243	CAA	.		0.303	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_173648	
CASP8	841	broad.mit.edu	37	2	202137439	202137440	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:202137439_202137440delTG	ENST00000432109.2	+	5	679_680	c.490_491delTG	c.(490-492)tgtfs	p.C164fs	CASP8_ENST00000264274.9_Frame_Shift_Del_p.C164fs|CASP8_ENST00000358485.4_Frame_Shift_Del_p.C223fs|CASP8_ENST00000323492.7_Frame_Shift_Del_p.C164fs|CASP8_ENST00000392259.2_Frame_Shift_Del_p.C164fs|CASP8_ENST00000392266.3_Frame_Shift_Del_p.C164fs|CASP8_ENST00000392258.3_Frame_Shift_Del_p.C164fs|CASP8_ENST00000264275.5_Frame_Shift_Del_p.C196fs	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	164	DED 2. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						GAAAAGAGTCTGTGCCCAAATC	0.441										HNSCC(4;0.00038)																											p.223_223del	Melanoma(82;831 1348 20716 36952 40159)	.											.	CASP8-660	0			c.667_668del						.																																			SO:0001589	frameshift_variant	841	exon4			AGAGTCTGTGCCC	U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.490_491delTG	2.37:g.202137441_202137442delTG	ENSP00000412523:p.Cys164fs	68	0		107	11	NM_001080125	0	0	0	0	0	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Frame_Shift_Del	DEL	ENST00000432109.2	37	CCDS2342.1																																																																																			.		0.441	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000336853.2	NM_001228	
CYP20A1	57404	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	204143326	204143326	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:204143326A>G	ENST00000356079.4	+	7	833	c.710A>G	c.(709-711)aAc>aGc	p.N237S	CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Missense_Mutation_p.N245S	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	237						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						GTTTTAAGGAACATCATAAAA	0.318																																					p.N237S		.											.	CYP20A1-90	0			c.A710G						.						76.0	71.0	73.0					2																	204143326		2203	4300	6503	SO:0001583	missense	57404	exon7			TAAGGAACATCAT	AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.710A>G	2.37:g.204143326A>G	ENSP00000348380:p.Asn237Ser	313	0		342	62	NM_177538	0	0	13	19	6	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Missense_Mutation	SNP	ENST00000356079.4	37	CCDS2357.1	.	.	.	.	.	.	.	.	.	.	A	12.70	2.016747	0.35606	.	.	ENSG00000119004	ENST00000356079;ENST00000429815	T;T	0.28454	1.61;1.61	5.42	5.42	0.78866	.	0.307559	0.36482	N	0.002574	T	0.14700	0.0355	N	0.03608	-0.345	0.29444	N	0.858973	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.08513	-1.0718	10	0.14252	T	0.57	-10.9068	15.1576	0.72755	1.0:0.0:0.0:0.0	.	245;237	E9PHG5;Q6UW02	.;CP20A_HUMAN	S	237;245	ENSP00000348380:N237S;ENSP00000407860:N245S	ENSP00000348380:N237S	N	+	2	0	CYP20A1	203851571	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	4.591000	0.61019	2.058000	0.61347	0.533000	0.62120	AAC	.		0.318	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256328.3	NM_020674	
VWC2L	402117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	215279234	215279234	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:215279234G>T	ENST00000312504.5	+	2	1119	c.317G>T	c.(316-318)tGt>tTt	p.C106F	AC107218.3_ENST00000412896.1_RNA|AC107218.3_ENST00000437883.1_RNA|VWC2L_ENST00000427124.1_Missense_Mutation_p.C106F	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	106	VWFC 1. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						AATGGATGCTGTCCTGAGTGC	0.398																																					p.C106F		.											.	.	0			c.G317T						.						58.0	54.0	55.0					2																	215279234		1877	4104	5981	SO:0001583	missense	402117	exon2			GATGCTGTCCTGA	AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.317G>T	2.37:g.215279234G>T	ENSP00000308976:p.Cys106Phe	80	0		112	33	NM_001080500	0	0	0	0	0	A6NC69|B2RUW7|B7X8X1	Missense_Mutation	SNP	ENST00000312504.5	37	CCDS46509.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504001	0.85176	.	.	ENSG00000174453	ENST00000312504;ENST00000427124	T;T	0.75154	-0.91;-0.91	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.82462	0.5042	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	0.988;1.0	D;D	0.91635	0.983;0.999	T	0.83082	-0.0137	10	0.87932	D	0	-2.3868	20.3668	0.98882	0.0:0.0:1.0:0.0	.	106;106	B7ZW27;B2RUY7	.;VWC2L_HUMAN	F	106	ENSP00000308976:C106F;ENSP00000403779:C106F	ENSP00000308976:C106F	C	+	2	0	VWC2L	214987479	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.894000	0.99253	0.655000	0.94253	TGT	.		0.398	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337175.1	NM_001080500	
ZNF142	7701	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	219508012	219508012	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:219508012G>A	ENST00000449707.1	-	8	3648	c.3227C>T	c.(3226-3228)tCt>tTt	p.S1076F	ZNF142_ENST00000411696.2_Missense_Mutation_p.S1076F	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	1076					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CGGGGGAGCAGAGTCCCCATT	0.607																																					p.S1076F	Colon(170;867 1942 8995 15834 18053)	.											.	ZNF142-137	0			c.C3227T						.						57.0	61.0	60.0					2																	219508012		1920	4123	6043	SO:0001583	missense	7701	exon8			GGAGCAGAGTCCC	U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.3227C>T	2.37:g.219508012G>A	ENSP00000408643:p.Ser1076Phe	154	1		222	46	NM_001105537	0	0	0	1	1	Q92510	Missense_Mutation	SNP	ENST00000449707.1	37	CCDS42817.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.719734	0.30503	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.12465	2.68;2.68	3.87	3.87	0.44632	.	0.522462	0.19991	N	0.101550	T	0.16428	0.0395	L	0.29908	0.895	0.36508	D	0.869425	P;P	0.47409	0.895;0.8	P;P	0.49226	0.603;0.548	T	0.09975	-1.0650	10	0.59425	D	0.04	-13.3042	14.1644	0.65466	0.0:0.0:1.0:0.0	.	1076;913	P52746;A8MWU9	ZN142_HUMAN;.	F	1076	ENSP00000408643:S1076F;ENSP00000398798:S1076F	ENSP00000398798:S1076F	S	-	2	0	ZNF142	219216256	0.000000	0.05858	0.921000	0.36526	0.017000	0.09413	-0.027000	0.12371	2.465000	0.83290	0.655000	0.94253	TCT	.		0.607	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336833.1	NM_005081	
CCDC108	255101	broad.mit.edu	37	2	219896232	219896232	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:219896232A>G	ENST00000341552.5	-	7	877	c.794T>C	c.(793-795)tTt>tCt	p.F265S	CCDC108_ENST00000441968.1_Missense_Mutation_p.F265S|CCDC108_ENST00000409865.3_Missense_Mutation_p.F254S|CCDC108_ENST00000410037.1_Missense_Mutation_p.F200S|CCDC108_ENST00000453220.1_Missense_Mutation_p.F265S	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	265						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGGCAGAAAAAGGCCTCAGT	0.622																																					p.F265S		.											.	CCDC108-94	0			c.T794C						.						182.0	185.0	184.0					2																	219896232		2203	4300	6503	SO:0001583	missense	255101	exon7			CAGAAAAAGGCCT	NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.794T>C	2.37:g.219896232A>G	ENSP00000340776:p.Phe265Ser	403	1		588	12	NM_194302	0	0	0	0	0	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	ENST00000341552.5	37	CCDS2430.2	.	.	.	.	.	.	.	.	.	.	a	0.111	-1.138522	0.01742	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000409865;ENST00000410037;ENST00000441164	T;T;T;T;T	0.05649	3.71;3.71;3.71;3.41;3.44	5.15	2.23	0.28157	PapD-like (1);	0.441533	0.16990	N	0.191339	T	0.02455	0.0075	N	0.02539	-0.55	0.54753	D	0.999988	B;B	0.09022	0.002;0.002	B;B	0.01281	0.0;0.0	T	0.43261	-0.9402	10	0.08599	T	0.76	-1.1773	11.6476	0.51269	0.1113:0.4674:0.4213:0.0	.	254;265	E9PG25;Q6ZU64	.;CC108_HUMAN	S	265;265;265;254;200;199	ENSP00000340776:F265S;ENSP00000413377:F265S;ENSP00000409117:F265S;ENSP00000386945:F254S;ENSP00000386258:F200S	ENSP00000340776:F265S	F	-	2	0	CCDC108	219604476	0.042000	0.20092	0.981000	0.43875	0.004000	0.04260	0.415000	0.21181	0.585000	0.29608	-0.745000	0.03516	TTT	.		0.622	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256598.4	NM_194302	
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	230656613	230656613	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:230656613C>T	ENST00000283943.5	-	28	4337	c.4159G>A	c.(4159-4161)Gct>Act	p.A1387T	TRIP12_ENST00000389044.4_Missense_Mutation_p.A1435T|TRIP12_ENST00000389045.3_Missense_Mutation_p.A1117T	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1387					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CAAATACCAGCTCTGCCTAGA	0.378																																					p.A1387T		.											.	TRIP12-572	0			c.G4159A						.						191.0	185.0	187.0					2																	230656613		2203	4300	6503	SO:0001583	missense	9320	exon28			TACCAGCTCTGCC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4159G>A	2.37:g.230656613C>T	ENSP00000283943:p.Ala1387Thr	161	0		255	126	NM_004238	0	0	9	14	5	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	34	5.379425	0.95945	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.49432	0.78;1.14;0.78	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.56232	0.1971	N	0.22421	0.69	0.80722	D	1	D;D;D	0.63880	0.993;0.982;0.993	D;P;D	0.70935	0.971;0.862;0.971	T	0.49925	-0.8887	10	0.26408	T	0.33	.	20.0205	0.97499	0.0:1.0:0.0:0.0	.	1117;1435;1387	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	T	1387;1117;1435	ENSP00000283943:A1387T;ENSP00000373697:A1117T;ENSP00000373696:A1435T	ENSP00000283943:A1387T	A	-	1	0	TRIP12	230364857	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.446000	0.80609	2.712000	0.92718	0.585000	0.79938	GCT	.		0.378	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
NMUR1	10316	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	232393591	232393591	+	Silent	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:232393591C>A	ENST00000305141.4	-	2	274	c.141G>T	c.(139-141)ctG>ctT	p.L47L		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	47					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		ACTTGAGTCTCAGTGCCTCGT	0.602																																					p.L47L		.											.	NMUR1-523	0			c.G141T						.						64.0	53.0	57.0					2																	232393591		2203	4300	6503	SO:0001819	synonymous_variant	10316	exon2			GAGTCTCAGTGCC	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.141G>T	2.37:g.232393591C>A		162	1		209	22	NM_006056	0	0	0	0	0	O43664|Q7LDP6|Q8NE20	Silent	SNP	ENST00000305141.4	37	CCDS2486.1																																																																																			.		0.602	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
DIS3L2	129563	broad.mit.edu	37	2	233194545	233194545	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:233194545T>A	ENST00000409307.1	+	14	1762	c.1762T>A	c.(1762-1764)Ttg>Atg	p.L588M	DIS3L2_ENST00000325385.7_Missense_Mutation_p.L588M|DIS3L2_ENST00000273009.6_Intron					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		GTTCATGCTCTTGGCCAACAT	0.677																																					p.L588M		.											.	DIS3L2-136	0			c.T1762A						.						22.0	26.0	25.0					2																	233194545		1958	4141	6099	SO:0001583	missense	129563	exon15			ATGCTCTTGGCCA	BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.1762T>A	2.37:g.233194545T>A	ENSP00000386799:p.Leu588Met	57	0		74	3	NM_152383	0	0	28	28	0		Missense_Mutation	SNP	ENST00000409307.1	37	CCDS42834.1	.	.	.	.	.	.	.	.	.	.	t	21.4	4.140789	0.77775	.	.	ENSG00000144535	ENST00000325385;ENST00000431466;ENST00000409307;ENST00000424049	T;T;T	0.51325	0.71;0.71;0.71	5.28	-7.68	0.01268	Ribonuclease II/R (2);	0.000000	0.64402	D	0.000013	T	0.68201	0.2975	M	0.83223	2.63	0.49130	D	0.999751	D	0.89917	1.0	D	0.83275	0.996	T	0.76716	-0.2857	10	0.56958	D	0.05	-16.3333	23.5171	0.99983	0.0:0.8556:0.0:0.1444	.	588	Q8IYB7	DI3L2_HUMAN	M	588;588;588;223	ENSP00000315569:L588M;ENSP00000386799:L588M;ENSP00000415419:L223M	ENSP00000315569:L588M	L	+	1	2	DIS3L2	232902789	0.014000	0.17966	0.020000	0.16555	0.996000	0.88848	0.119000	0.15626	-1.720000	0.01380	0.445000	0.29226	TTG	.		0.677	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330988.1	NM_152383	
KIF1A	547	hgsc.bcm.edu	37	2	241696843	241696843	+	Intron	SNP	C	C	A	rs537608637|rs10594016|rs533559120		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:241696843C>A	ENST00000320389.7	-	25	2714				KIF1A_ENST00000498729.2_Missense_Mutation_p.E917D	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A						anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		cctcctcatcctcctcctcct	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		8551	0.0		0.0	False		,,,				2504	0.0				p.E917D		.											.	KIF1A-91	0			c.G2751T						.																																			SO:0001627	intron_variant	547	exon27			CTCATCCTCCTCC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2555+933G>T	2.37:g.241696843C>A		165	0		227	12	NM_001244008	0	0	0	0	0	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	ENST00000320389.7	37	CCDS46561.1	.	.	.	.	.	.	.	.	.	.	C	8.327	0.825706	0.16749	.	.	ENSG00000130294	ENST00000498729;ENST00000373308;ENST00000404283	T;T	0.73047	-0.63;-0.71	4.04	3.16	0.36331	.	.	.	.	.	T	0.50429	0.1615	.	.	.	0.27599	N	0.949023	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.21690	-1.0238	8	0.08381	T	0.77	.	12.6857	0.56946	0.1669:0.833:0.0:0.0	.	917;917	F5H045;Q12756-2	.;.	D	917	ENSP00000438388:E917D;ENSP00000384231:E917D	ENSP00000362405:E917D	E	-	3	2	KIF1A	241345516	0.997000	0.39634	0.999000	0.59377	0.888000	0.51559	0.203000	0.17315	0.685000	0.31468	-0.372000	0.07161	GAG	.		0.682	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
SLC4A11	83959	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	3214626	3214626	+	Silent	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr20:3214626G>A	ENST00000380056.3	-	5	641	c.594C>T	c.(592-594)atC>atT	p.I198I	SLC4A11_ENST00000539553.2_Silent_p.I182I|SLC4A11_ENST00000380059.3_Silent_p.I225I	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	198					bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						TGACCCCTTGGATGGTATCTG	0.657																																					p.I225I	NSCLC(190;922 2139 10266 10292 38692)	.											.	SLC4A11-91	0			c.C675T						.						100.0	98.0	99.0					20																	3214626		2203	4300	6503	SO:0001819	synonymous_variant	83959	exon6			CCCTTGGATGGTA	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.594C>T	20.37:g.3214626G>A		92	0		100	36	NM_001174090	0	0	0	0	0	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Silent	SNP	ENST00000380056.3	37	CCDS13052.1																																																																																			.		0.657	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1		
PCSK2	5126	broad.mit.edu	37	20	17341187	17341187	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr20:17341187G>T	ENST00000262545.2	+	4	722	c.407G>T	c.(406-408)gGg>gTg	p.G136V	PCSK2_ENST00000536609.1_Missense_Mutation_p.G101V|PCSK2_ENST00000377899.1_Missense_Mutation_p.G117V	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	136					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATCAATACTGGGCAAGCTGAT	0.433																																					p.G136V		.											.	PCSK2-157	0			c.G407T						.						91.0	82.0	85.0					20																	17341187		2203	4300	6503	SO:0001583	missense	5126	exon4			ATACTGGGCAAGC	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.407G>T	20.37:g.17341187G>T	ENSP00000262545:p.Gly136Val	176	0		201	7	NM_002594	0	0	0	0	0	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	ENST00000262545.2	37	CCDS13125.1	.	.	.	.	.	.	.	.	.	.	.	23.1	4.375035	0.82682	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.41758	0.99;0.99;0.99	5.95	5.95	0.96441	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.000000	0.85682	D	0.000000	T	0.65565	0.2703	M	0.70842	2.15	0.80722	D	1	D;P	0.76494	0.999;0.935	D;P	0.76071	0.987;0.706	T	0.66551	-0.5895	10	0.87932	D	0	-30.0091	17.8686	0.88804	0.0:0.0:1.0:0.0	.	101;136	B4DFQ3;P16519	.;NEC2_HUMAN	V	117;136;101	ENSP00000367131:G117V;ENSP00000262545:G136V;ENSP00000437458:G101V	ENSP00000262545:G136V	G	+	2	0	PCSK2	17289187	1.000000	0.71417	0.433000	0.26760	0.852000	0.48524	9.370000	0.97159	2.817000	0.96982	0.563000	0.77884	GGG	.		0.433	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078120.2	NM_002594	
HNF4A	3172	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	43057001	43057001	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr20:43057001C>A	ENST00000316099.4	+	9	1245	c.1156C>A	c.(1156-1158)Cac>Aac	p.H386N	HNF4A_ENST00000415691.2_Missense_Mutation_p.H386N|HNF4A_ENST00000316673.4_Missense_Mutation_p.H364N|HNF4A_ENST00000457232.1_Missense_Mutation_p.H364N	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	386					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACCCCATGCCCACCACCCCCT	0.587																																					p.H386N	Colon(79;2 1269 8820 14841 52347)	.											.	HNF4A-227	0			c.C1156A						.						114.0	85.0	95.0					20																	43057001		2203	4300	6503	SO:0001583	missense	3172	exon9			CATGCCCACCACC	X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1156C>A	20.37:g.43057001C>A	ENSP00000312987:p.His386Asn	89	0		119	48	NM_178849	0	0	1	1	0	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	ENST00000316099.4	37	CCDS13330.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467298	0.84533	.	.	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000338692;ENST00000415691	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.93	5.93	0.95920	.	0.213901	0.48286	D	0.000189	T	0.78240	0.4252	M	0.75447	2.3	0.80722	D	1	P;B;P;B;B	0.38020	0.615;0.276;0.462;0.415;0.397	B;B;B;B;B	0.43990	0.334;0.254;0.42;0.199;0.438	T	0.76769	-0.2837	10	0.45353	T	0.12	.	20.3363	0.98740	0.0:1.0:0.0:0.0	.	379;386;386;364;364	Q5QPB7;P41235;F1D8S2;F1D8T0;P41235-6	.;HNF4A_HUMAN;.;.;.	N	364;364;386;416;386	ENSP00000315180:H364N;ENSP00000396216:H364N;ENSP00000312987:H386N;ENSP00000412111:H386N	ENSP00000312987:H386N	H	+	1	0	HNF4A	42490415	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.794000	0.85869	2.814000	0.96858	0.563000	0.77884	CAC	.		0.587	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079363.3		
KCNS1	3787	bcgsc.ca	37	20	43727108	43727108	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr20:43727108A>G	ENST00000306117.1	-	4	701	c.305T>C	c.(304-306)tTc>tCc	p.F102S	KCNS1_ENST00000537075.1_Missense_Mutation_p.F102S	NM_002251.3	NP_002242.2	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1	102					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(1)|lung(3)|ovary(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				GTCGAAGTAGAATTCGCGCGC	0.711																																					p.F102S		.											.	KCNS1-90	0			c.T305C						.						20.0	22.0	21.0					20																	43727108		2181	4257	6438	SO:0001583	missense	3787	exon4			AAGTAGAATTCGC	AF043473	CCDS13342.1	20q12	2011-07-05			ENSG00000124134	ENSG00000124134		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6300	protein-coding gene	gene with protein product		602905				9305895, 16382104	Standard	NM_002251		Approved	Kv9.1	uc002xnc.3	Q96KK3	OTTHUMG00000033079	ENST00000306117.1:c.305T>C	20.37:g.43727108A>G	ENSP00000307694:p.Phe102Ser	91	0		146	6	NM_002251	0	0	0	0	0	A2RUL9|B7ZM31|O43652|Q6DJU6	Missense_Mutation	SNP	ENST00000306117.1	37	CCDS13342.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.662466	0.88251	.	.	ENSG00000124134	ENST00000306117;ENST00000537075	T;T	0.77877	-1.13;-1.13	4.72	4.72	0.59763	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.90188	0.6933	M	0.92122	3.275	0.58432	D	0.999996	D	0.76494	0.999	D	0.81914	0.995	D	0.92577	0.6071	10	0.87932	D	0	.	14.2256	0.65858	1.0:0.0:0.0:0.0	.	102	Q96KK3	KCNS1_HUMAN	S	102	ENSP00000307694:F102S;ENSP00000445595:F102S	ENSP00000307694:F102S	F	-	2	0	KCNS1	43160522	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.038000	0.93771	1.760000	0.52011	0.533000	0.62120	TTC	.		0.711	KCNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080507.3	NM_002251	
SLMO2	51012	broad.mit.edu	37	20	57613555	57613555	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr20:57613555C>T	ENST00000355937.4	-	2	345	c.167G>A	c.(166-168)aGc>aAc	p.S56N	SLMO2_ENST00000371033.5_Missense_Mutation_p.S56N	NM_016045.2	NP_057129.2	Q9Y3B1	SLMO2_HUMAN	slowmo homolog 2 (Drosophila)	56	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)|lung(2)|skin(2)	5	all_lung(29;0.00711)		Colorectal(105;0.109)			CCACTCTGTGCTGAGAAGTCT	0.453																																					p.S56N		.											.	SLMO2-45	0			c.G167A						.						98.0	94.0	95.0					20																	57613555		1909	4126	6035	SO:0001583	missense	51012	exon2			TCTGTGCTGAGAA	AF151865	CCDS42893.1, CCDS58783.1	20q13.32	2008-10-22	2007-02-06	2007-02-06	ENSG00000101166	ENSG00000101166			15892	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 45"""	C20orf45			Standard	NM_016045		Approved	dJ543J19.5, PRELID3B	uc002yam.3	Q9Y3B1	OTTHUMG00000032856	ENST00000355937.4:c.167G>A	20.37:g.57613555C>T	ENSP00000348206:p.Ser56Asn	76	0		74	3	NM_001256403	0	0	23	23	0	E1P5I8|Q5JX17|Q9NUL0	Missense_Mutation	SNP	ENST00000355937.4	37	CCDS42893.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890216	0.91889	.	.	ENSG00000101166	ENST00000355937;ENST00000371033	T;T	0.17528	2.27;2.27	5.36	5.36	0.76844	PRELI/MSF1 (2);	0.077067	0.85682	D	0.000000	T	0.46927	0.1418	M	0.87547	2.89	0.80722	D	1	D;P	0.63880	0.993;0.571	D;B	0.63113	0.911;0.403	T	0.50381	-0.8835	10	0.51188	T	0.08	-6.5515	18.4363	0.90648	0.0:1.0:0.0:0.0	.	56;56	Q5JX17;Q9Y3B1	.;SLMO2_HUMAN	N	56	ENSP00000348206:S56N;ENSP00000360072:S56N	ENSP00000348206:S56N	S	-	2	0	SLMO2	57046950	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.370000	0.79589	2.665000	0.90641	0.655000	0.94253	AGC	.		0.453	SLMO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079897.2	NM_016045	
OGFR	11054	hgsc.bcm.edu	37	20	61444569	61444569	+	Silent	SNP	A	A	G	rs3204348		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr20:61444569A>G	ENST00000290291.6	+	7	1627	c.1602A>G	c.(1600-1602)ccA>ccG	p.P534P	OGFR_ENST00000370461.1_Silent_p.P482P	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	534	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GGGACGAGCCAGCCGAGAGCC	0.721																																					p.P534P		.											.	OGFR-68	0			c.A1602G						.						11.0	17.0	15.0					20																	61444569		2124	4201	6325	SO:0001819	synonymous_variant	11054	exon7			CGAGCCAGCCGAG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1602A>G	20.37:g.61444569A>G		25	0		70	13	NM_007346	0	0	168	211	43	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	CCDS13504.1																																																																																			A|0.979;G|0.021		0.721	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444633	61444633	+	Missense_Mutation	SNP	G	G	A	rs75570150		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr20:61444633G>A	ENST00000290291.6	+	7	1691	c.1666G>A	c.(1666-1668)Gag>Aag	p.E556K	OGFR_ENST00000370461.1_Missense_Mutation_p.E504K	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	556	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.E556K(1)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CGAGCCAGCCGAGAGCCCATC	0.756																																					p.E556K		.											.	OGFR-68	1	Substitution - Missense(1)	skin(1)	c.G1666A						.						6.0	11.0	9.0					20																	61444633		1936	3778	5714	SO:0001583	missense	11054	exon7			CCAGCCGAGAGCC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1666G>A	20.37:g.61444633G>A	ENSP00000290291:p.Glu556Lys	3	0		47	12	NM_007346	0	0	146	146	0	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	A	2.693	-0.272793	0.05716	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.52983	0.64;0.64	0.773	-1.55	0.08558	.	.	.	.	.	T	0.25195	0.0612	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.04013	0.0;0.001;0.0	T	0.12785	-1.0534	9	0.34782	T	0.22	.	5.1465	0.14987	0.4456:0.0:0.5544:0.0	.	556;539;556	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	K	556;536;391;504	ENSP00000290291:E556K;ENSP00000359491:E504K	ENSP00000290291:E556K	E	+	1	0	OGFR	60915078	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.269000	0.00532	-0.808000	0.04387	-1.125000	0.01998	GAG	.		0.756	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444637	61444637	+	Missense_Mutation	SNP	G	G	C	rs78981100		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr20:61444637G>C	ENST00000290291.6	+	7	1695	c.1670G>C	c.(1669-1671)aGc>aCc	p.S557T	OGFR_ENST00000370461.1_Missense_Mutation_p.S505T	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	557	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.S557T(3)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCAGCCGAGAGCCCATCGGAG	0.746																																					p.S557T		.											.	OGFR-68	3	Substitution - Missense(3)	upper_aerodigestive_tract(1)|prostate(1)|skin(1)	c.G1670C						.						5.0	10.0	8.0					20																	61444637		1884	3696	5580	SO:0001583	missense	11054	exon7			CCGAGAGCCCATC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1670G>C	20.37:g.61444637G>C	ENSP00000290291:p.Ser557Thr	3	0		42	10	NM_007346	0	0	140	140	0	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	7.631	0.678796	0.14841	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.40225	1.04;1.04	0.773	0.773	0.18516	.	.	.	.	.	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	P;B;P	0.45594	0.862;0.386;0.862	B;B;B	0.38655	0.278;0.099;0.278	T	0.08868	-1.0701	9	0.09338	T	0.73	3.6159	4.5226	0.11966	0.2481:0.0:0.7519:0.0	.	557;540;557	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	T	557;537;392;505	ENSP00000290291:S557T;ENSP00000359491:S505T	ENSP00000290291:S557T	S	+	2	0	OGFR	60915082	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-1.934000	0.01552	0.687000	0.31509	0.185000	0.17295	AGC	.		0.746	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
DSCAM	1826	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	41539177	41539177	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr21:41539177T>C	ENST00000400454.1	-	16	3463	c.2986A>G	c.(2986-2988)Ata>Gta	p.I996V		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	996	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGAGATGATATAGGCTCCAGG	0.522																																					p.I996V	Melanoma(134;970 1778 1785 21664 32388)	.											.	DSCAM-101	0			c.A2986G						.						106.0	105.0	105.0					21																	41539177		1923	4140	6063	SO:0001583	missense	1826	exon16			ATGATATAGGCTC	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.2986A>G	21.37:g.41539177T>C	ENSP00000383303:p.Ile996Val	131	1		116	30	NM_001271534	0	0	0	0	0	O60468	Missense_Mutation	SNP	ENST00000400454.1	37	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	T	1.572	-0.533911	0.04082	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.56103	0.48;0.48	5.22	2.78	0.32641	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.215374	0.45867	D	0.000340	T	0.28300	0.0699	N	0.16016	0.355	0.22629	N	0.998917	B	0.16166	0.016	B	0.17098	0.017	T	0.26224	-1.0109	10	0.02654	T	1	.	9.7641	0.40550	0.0:0.0:0.3361:0.6639	.	996	O60469	DSCAM_HUMAN	V	996;748	ENSP00000383303:I996V;ENSP00000385342:I748V	ENSP00000383303:I996V	I	-	1	0	DSCAM	40461047	0.916000	0.31088	0.839000	0.33178	0.981000	0.71138	0.653000	0.24902	0.357000	0.24183	0.533000	0.62120	ATA	.		0.522	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
SLC25A18	83733	broad.mit.edu	37	22	18070006	18070006	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr22:18070006G>C	ENST00000327451.6	+	8	1052	c.514G>C	c.(514-516)Gag>Cag	p.E172Q	SLC25A18_ENST00000399813.1_Missense_Mutation_p.E172Q|AC004019.13_ENST00000443935.1_RNA	NM_031481.1	NP_113669.1	Q9H1K4	GHC2_HUMAN	solute carrier family 25 (glutamate carrier), member 18	172						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	symporter activity (GO:0015293)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)	18				Lung(27;0.124)		CATTGCCTGGGAGCTGCTCCG	0.652																																					p.E172Q	Colon(118;1560 1625 18964 29606 50093)	.											.	SLC25A18-90	0			c.G514C						.						80.0	77.0	78.0					22																	18070006		2203	4300	6503	SO:0001583	missense	83733	exon8			GCCTGGGAGCTGC	AY008285	CCDS13744.1	22q11.2	2013-05-22	2012-03-29		ENSG00000182902	ENSG00000182902		"""Solute carriers"""	10988	protein-coding gene	gene with protein product		609303	"""solute carrier family 25 (mitochondrial carrier), member 18"""			11381032, 11897791	Standard	NM_031481		Approved		uc002zmp.1	Q9H1K4	OTTHUMG00000150089	ENST00000327451.6:c.514G>C	22.37:g.18070006G>C	ENSP00000329033:p.Glu172Gln	67	0		54	4	NM_031481	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327451.6	37	CCDS13744.1	.	.	.	.	.	.	.	.	.	.	G	12.45	1.940569	0.34283	.	.	ENSG00000182902	ENST00000327451;ENST00000399813	T;T	0.79352	-1.26;-1.26	5.1	4.06	0.47325	Mitochondrial carrier domain (2);	0.204155	0.50627	D	0.000104	T	0.65780	0.2724	L	0.27975	0.815	0.36689	D	0.879497	B	0.23128	0.08	B	0.28305	0.088	T	0.63265	-0.6676	10	0.17832	T	0.49	.	13.1432	0.59446	0.0808:0.0:0.9192:0.0	.	172	Q9H1K4	GHC2_HUMAN	Q	172	ENSP00000329033:E172Q;ENSP00000382710:E172Q	ENSP00000329033:E172Q	E	+	1	0	SLC25A18	16450006	1.000000	0.71417	0.998000	0.56505	0.898000	0.52572	3.843000	0.55865	1.269000	0.44280	0.485000	0.47835	GAG	.		0.652	SLC25A18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316214.3	NM_031481	
PRRT3	285368	bcgsc.ca	37	3	9990800	9990800	+	Missense_Mutation	SNP	G	G	C	rs59465469	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:9990800G>C	ENST00000412055.1	-	2	1129	c.1000C>G	c.(1000-1002)Cgg>Ggg	p.R334G	PRRT3-AS1_ENST00000431558.1_RNA|PRRT3_ENST00000411976.2_Missense_Mutation_p.R334G	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	334	Pro-rich.		R -> G (in dbSNP:rs59465469). {ECO:0000269|PubMed:14702039}.			integral component of membrane (GO:0016021)		p.R334G(1)		NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						TTAGACGGCCGATCAGGAGCC	0.612													C|||	1910	0.38139	0.8132	0.3256	5008	,	,		17430	0.1558		0.2137	False		,,,				2504	0.2423				p.R334G		.											.	PRRT3-90	1	Substitution - Missense(1)	stomach(1)	c.C1000G						.	C	GLY/ARG	2648,1206		933,782,212	51.0	61.0	58.0		1000	2.2	0.0	3	dbSNP_129	58	2056,6232		268,1520,2356	yes	missense	PRRT3	NM_207351.3	125	1201,2302,2568	CC,CG,GG		24.8069,31.2922,38.7416	benign	334/982	9990800	4704,7438	1927	4144	6071	SO:0001583	missense	285368	exon2			ACGGCCGATCAGG	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.1000C>G	3.37:g.9990800G>C	ENSP00000392511:p.Arg334Gly	13	0		7	6	NM_207351	0	0	1	4	3	Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	ENST00000412055.1	37	CCDS43049.1	803	0.3676739926739927	397	0.806910569105691	123	0.3397790055248619	118	0.2062937062937063	165	0.21767810026385223	C	0.009	-1.814685	0.00600	0.687078	0.248069	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.16324	2.6;2.35	4.03	2.22	0.28083	.	0.272597	0.26967	N	0.021588	T	0.00012	0.0000	N	0.00926	-1.1	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13872	-1.0493	8	.	.	.	-2.0801	6.3107	0.21163	0.0:0.5378:0.3618:0.1004	rs59465469;rs62245482	334;334	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	G	334	ENSP00000392511:R334G;ENSP00000404512:R334G	.	R	-	1	2	PRRT3	9965800	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	0.038000	0.13862	0.272000	0.22027	-0.978000	0.02582	CGG	G|0.674;C|0.326		0.612	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339322.1	NM_207351	
FANCD2	2177	bcgsc.ca	37	3	10108898	10108898	+	Silent	SNP	A	A	G	rs77246387		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:10108898A>G	ENST00000419585.1	+	26	2552	c.2391A>G	c.(2389-2391)gtA>gtG	p.V797V	FANCD2_ENST00000287647.3_Silent_p.V797V|FANCD2_ENST00000383807.1_Silent_p.V797V|FANCD2_ENST00000383806.1_Silent_p.V797V			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	797					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.V797V(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		TGCAGATTGTAAATGCCTTCT	0.368			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.V797V		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2-229	1	Substitution - coding silent(1)	prostate(1)	c.A2391G						.						72.0	63.0	66.0					3																	10108898		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon26	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GATTGTAAATGCC	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2391A>G	3.37:g.10108898A>G		89	0		96	6	NM_001018115	0	0	0	0	0	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																			A|0.909;G|0.091		0.368	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
FANCD2	2177	bcgsc.ca	37	3	10108913	10108913	+	Missense_Mutation	SNP	G	G	T	rs80258959		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:10108913G>T	ENST00000419585.1	+	26	2567	c.2406G>T	c.(2404-2406)caG>caT	p.Q802H	FANCD2_ENST00000287647.3_Missense_Mutation_p.Q802H|FANCD2_ENST00000383807.1_Missense_Mutation_p.Q802H|FANCD2_ENST00000383806.1_Missense_Mutation_p.Q802H			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	802					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)	p.Q802H(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCTTCTGCCAGGAAACATCAC	0.378			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.Q802H		.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2-229	2	Substitution - Missense(2)	prostate(2)	c.G2406T						.						82.0	72.0	75.0					3																	10108913		2203	4300	6503	SO:0001583	missense	2177	exon26	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	CTGCCAGGAAACA	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2406G>T	3.37:g.10108913G>T	ENSP00000398754:p.Gln802His	108	0		128	6	NM_001018115	0	0	3	3	0	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	37	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373535	0.61624	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.44	1.83	0.25207	.	0.551240	0.20789	N	0.085651	T	0.50240	0.1604	M	0.63428	1.95	0.30837	N	0.736052	P;P	0.50710	0.938;0.938	P;P	0.53988	0.739;0.739	T	0.53229	-0.8468	10	0.54805	T	0.06	.	3.6289	0.08124	0.3156:0.0:0.4962:0.1881	.	802;802	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	H	802	ENSP00000287647:Q802H;ENSP00000373318:Q802H;ENSP00000373317:Q802H;ENSP00000398754:Q802H	ENSP00000287647:Q802H	Q	+	3	2	FANCD2	10083913	0.804000	0.28969	0.409000	0.26459	0.904000	0.53231	1.055000	0.30467	0.519000	0.28406	0.585000	0.79938	CAG	G|0.990;T|0.010		0.378	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
GOLGA4	2803	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	37396592	37396592	+	Splice_Site	SNP	A	A	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:37396592A>C	ENST00000361924.2	+	22	6951	c.6577A>C	c.(6577-6579)Acc>Ccc	p.T2193P	GOLGA4_ENST00000356847.4_Splice_Site_p.T2208P|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	2193	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TTTCTTGTAGACCATGGCAAA	0.413																																					p.T2208P		.											.	GOLGA4-93	0			c.A6622C						.						154.0	149.0	150.0					3																	37396592		2203	4299	6502	SO:0001630	splice_region_variant	2803	exon22			TTGTAGACCATGG	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.6577-1A>C	3.37:g.37396592A>C		58	0		75	13	NM_001172713	0	0	0	0	0	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	37	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.476307	0.63737	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.41400	1.1;1.0;1.1	5.82	5.82	0.92795	GRIP (5);	0.000000	0.37483	N	0.002062	T	0.63402	0.2508	M	0.66939	2.045	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.62992	-0.6736	9	.	.	.	.	16.19	0.81981	1.0:0.0:0.0:0.0	.	2193;2208;2193	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	P	2193;2208;2064	ENSP00000354486:T2193P;ENSP00000349305:T2208P;ENSP00000405842:T2064P	.	T	+	1	0	GOLGA4	37371596	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	5.672000	0.68102	2.225000	0.72522	0.460000	0.39030	ACC	.		0.413	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	Missense_Mutation
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	41266104	41266104	+	Missense_Mutation	SNP	G	G	T	rs28931589|rs121913416		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:41266104G>T	ENST00000349496.5	+	3	381	c.101G>T	c.(100-102)gGa>gTa	p.G34V	CTNNB1_ENST00000396183.3_Missense_Mutation_p.G34V|CTNNB1_ENST00000396185.3_Missense_Mutation_p.G34V|CTNNB1_ENST00000405570.1_Missense_Mutation_p.G34V|CTNNB1_ENST00000453024.1_Missense_Mutation_p.G27V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	34			G -> E (in PTR). {ECO:0000269|PubMed:10192393}.|G -> R (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|G -> V (in hepatoblastoma; dbSNP:rs28931589). {ECO:0000269|PubMed:9927029}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G34E(73)|p.G34V(72)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CTGGACTCTGGAATCCATTCT	0.488	G34E(AGS_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.G34V	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	276	Substitution - Missense(145)|Deletion - In frame(105)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(146)|endometrium(30)|large_intestine(27)|stomach(21)|central_nervous_system(20)|skin(8)|pancreas(8)|ovary(6)|small_intestine(2)|lung(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|pituitary(1)|prostate(1)|bone(1)	c.G101T						.						93.0	78.0	83.0					3																	41266104		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACTCTGGAATCCA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.101G>T	3.37:g.41266104G>T	ENSP00000344456:p.Gly34Val	205	1		218	74	NM_001098209	0	0	51	70	19	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450603	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-31.2232	19.9596	0.97236	0.0:0.0:1.0:0.0	rs28931589	34	P35222	CTNB1_HUMAN	V	27;34;34;34;34;27;34;34;34	ENSP00000400508:G27V;ENSP00000385604:G34V;ENSP00000412219:G34V;ENSP00000379486:G34V;ENSP00000344456:G34V;ENSP00000411226:G27V;ENSP00000379488:G34V;ENSP00000409302:G34V;ENSP00000401599:G34V	ENSP00000344456:G34V	G	+	2	0	CTNNB1	41241108	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GGA	G|1.000;T|0.000		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
COL7A1	1294	broad.mit.edu	37	3	48621170	48621170	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:48621170G>A	ENST00000328333.8	-	39	4429	c.4322C>T	c.(4321-4323)cCt>cTt	p.P1441L	COL7A1_ENST00000454817.1_Missense_Mutation_p.P1441L	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1441	Interrupted collagenous region.|Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TTTCTTTCCAGGGGGGCCAAC	0.577																																					p.P1441L		.											.	COL7A1-160	0			c.C4322T	GRCh37	CD993036	COL7A1	D		.						51.0	57.0	55.0					3																	48621170		2203	4300	6503	SO:0001583	missense	1294	exon39			TTTCCAGGGGGGC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.4322C>T	3.37:g.48621170G>A	ENSP00000332371:p.Pro1441Leu	55	0		64	4	NM_000094	0	0	0	0	0	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	37	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	G	9.850	1.193481	0.22037	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.96685	-4.09;-4.09	5.37	3.5	0.40072	.	1.025530	0.07826	N	0.960520	D	0.94941	0.8364	M	0.73319	2.225	0.22424	N	0.999113	B	0.20887	0.049	B	0.14023	0.01	D	0.88290	0.2942	10	0.49607	T	0.09	.	8.4018	0.32590	0.0843:0.1543:0.7614:0.0	.	1441	Q02388	CO7A1_HUMAN	L	1441	ENSP00000332371:P1441L;ENSP00000412569:P1441L	ENSP00000332371:P1441L	P	-	2	0	COL7A1	48596174	0.218000	0.23608	0.724000	0.30704	0.844000	0.47949	2.042000	0.41222	1.263000	0.44181	0.655000	0.94253	CCT	.		0.577	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		7	7	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
KIAA1407	57577	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	113697118	113697120	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	TCT	TCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:113697118_113697120delTCT	ENST00000295878.3	-	16	2665_2667	c.2519_2521delAGA	c.(2518-2523)aagatt>att	p.K840del		NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	840										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						GCCCTGAAAATCTTCTTTTGAAG	0.409																																					p.840_841del		.											.	KIAA1407-92	0			c.2519_2521del						.																																			SO:0001651	inframe_deletion	57577	exon16			TGAAAATCTTCTT	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2519_2521delAGA	3.37:g.113697121_113697123delTCT	ENSP00000295878:p.Lys840del	74	0		99	21	NM_020817	0	0	0	0	0	B4DYL1|Q9P2E0	In_Frame_Del	DEL	ENST00000295878.3	37	CCDS2977.1																																																																																			.		0.409	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
OSBPL11	114885	broad.mit.edu;bcgsc.ca	37	3	125257453	125257453	+	Silent	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:125257453G>A	ENST00000296220.5	-	11	2155	c.1866C>T	c.(1864-1866)aaC>aaT	p.N622N		NM_022776.4	NP_073613.2	Q9BXB4	OSB11_HUMAN	oxysterol binding protein-like 11	622					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|positive regulation of sequestering of triglyceride (GO:0010890)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			NS(1)|breast(1)|cervix(1)|kidney(2)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	27						TGTTGGTGATGTTGTGCTTTA	0.383																																					p.N622N		.											.	OSBPL11-135	0			c.C1866T						.						285.0	247.0	260.0					3																	125257453		2203	4300	6503	SO:0001819	synonymous_variant	114885	exon11			GGTGATGTTGTGC	AF392454	CCDS3033.1	3q21	2013-01-10			ENSG00000144909	ENSG00000144909		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16397	protein-coding gene	gene with protein product		606739					Standard	NM_022776		Approved	ORP-11, ORP11, FLJ13012, FLJ13164	uc003eic.3	Q9BXB4	OTTHUMG00000159571	ENST00000296220.5:c.1866C>T	3.37:g.125257453G>A		131	0		140	9	NM_022776	0	0	3	4	1	A8K9I7	Silent	SNP	ENST00000296220.5	37	CCDS3033.1																																																																																			.		0.383	OSBPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356295.1	NM_022776	
PLXND1	23129	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	129290586	129290586	+	Missense_Mutation	SNP	T	T	C	rs371911654		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:129290586T>C	ENST00000324093.4	-	16	3357	c.3179A>G	c.(3178-3180)aAc>aGc	p.N1060S	PLXND1_ENST00000393239.1_Missense_Mutation_p.N1060S	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1060	IPT/TIG 2.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GAAGGTGAGGTTGCCGTGCAC	0.677																																					p.N1060S	Ovarian(97;366 1484 3738 22084 39045)	.											.	PLXND1-90	0			c.A3179G						.	T	SER/ASN	1,4405	2.1+/-5.4	0,1,2202	55.0	55.0	55.0		3179	3.5	1.0	3		55	0,8598		0,0,4299	no	missense	PLXND1	NM_015103.2	46	0,1,6501	CC,CT,TT		0.0,0.0227,0.0077	benign	1060/1926	129290586	1,13003	2203	4299	6502	SO:0001583	missense	23129	exon16			GTGAGGTTGCCGT	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3179A>G	3.37:g.129290586T>C	ENSP00000317128:p.Asn1060Ser	279	2		422	84	NM_015103	0	0	21	24	3	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	37	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	T	6.555	0.470772	0.12461	2.27E-4	0.0	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.76186	-1.0;-1.0	4.67	3.51	0.40186	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.479039	0.22318	N	0.061653	T	0.60932	0.2307	L	0.31845	0.965	0.38276	D	0.942309	B	0.14438	0.01	B	0.17722	0.019	T	0.53464	-0.8435	10	0.20519	T	0.43	.	10.1035	0.42519	0.0:0.0797:0.0:0.9203	.	1060	Q9Y4D7	PLXD1_HUMAN	S	1060	ENSP00000317128:N1060S;ENSP00000376931:N1060S	ENSP00000317128:N1060S	N	-	2	0	PLXND1	130773276	1.000000	0.71417	0.964000	0.40570	0.161000	0.22273	2.694000	0.47035	0.661000	0.30985	0.459000	0.35465	AAC	.		0.677	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
TMCC1	23023	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	129370603	129370603	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:129370603C>G	ENST00000393238.3	-	6	2023	c.1683G>C	c.(1681-1683)aaG>aaC	p.K561N	TMCC1_ENST00000329333.5_Missense_Mutation_p.K382N|TMCC1_ENST00000426664.2_Missense_Mutation_p.K447N|TMCC1_ENST00000432054.2_Missense_Mutation_p.K237N	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	561						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						GCAGCTCCATCTTGGAGATGC	0.577																																					p.K561N		.											.	TMCC1-91	0			c.G1683C						.						72.0	71.0	71.0					3																	129370603		2203	4300	6503	SO:0001583	missense	23023	exon6			CTCCATCTTGGAG	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1683G>C	3.37:g.129370603C>G	ENSP00000376930:p.Lys561Asn	78	1		82	17	NM_001017395	0	1	17	23	5	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	37	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.141248	0.77775	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.80854	0.4703	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.995	D	0.84372	0.0544	10	0.87932	D	0	-14.08	18.8307	0.92137	0.0:1.0:0.0:0.0	.	382;561	B4DE04;O94876	.;TMCC1_HUMAN	N	237;561;447;382	ENSP00000404711:K237N;ENSP00000376930:K561N;ENSP00000389892:K447N;ENSP00000327349:K382N	ENSP00000327349:K382N	K	-	3	2	TMCC1	130853293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.929000	0.70096	2.689000	0.91719	0.655000	0.94253	AAG	.		0.577	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
RYK	6259	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	133896850	133896850	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:133896850T>C	ENST00000427044.2	-	12	1283	c.673A>G	c.(673-675)Atg>Gtg	p.M225V	RYK_ENST00000296084.4_Missense_Mutation_p.M415V			P34925	RYK_HUMAN	receptor-like tyrosine kinase	411					axon guidance (GO:0007411)|corpus callosum development (GO:0022038)|neuron differentiation (GO:0030182)|neuron projection development (GO:0031175)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of MAPK cascade (GO:0043410)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			lung(1)|ovary(3)	4						CCCCAATTCATGTAAGGCAAT	0.338																																					.		.											.	RYK-1379	0			.						.						99.0	91.0	94.0					3																	133896850		1808	4068	5876	SO:0001583	missense	6259	.			AATTCATGTAAGG	S59184	CCDS75016.1	3q22.1	2012-02-28	2012-02-28		ENSG00000163785	ENSG00000163785	2.7.10.1		10481	protein-coding gene	gene with protein product		600524	"""JTK5A protein tyrosine kinase"", ""RYK receptor-like tyrosine kinase"""	JTK5A		8386829	Standard	NM_001005861		Approved	D3S3195, RYK1, JTK5	uc003eqc.1	P34925	OTTHUMG00000159750	ENST00000427044.2:c.673A>G	3.37:g.133896850T>C	ENSP00000399527:p.Met225Val	142	0		167	86	.	0	0	17	23	6	Q04696	Missense_Mutation	SNP	ENST00000427044.2	37		.	.	.	.	.	.	.	.	.	.	T	11.70	1.716623	0.30413	.	.	ENSG00000163785	ENST00000296084;ENST00000427044	T;D	0.89270	0.77;-2.49	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.036708	0.85682	D	0.000000	D	0.84056	0.5388	L	0.35288	1.05	0.80722	D	1	B;B	0.16802	0.019;0.015	B;B	0.20955	0.032;0.019	T	0.79117	-0.1935	10	0.28530	T	0.3	-9.2237	15.9325	0.79675	0.0:0.0:0.0:1.0	.	411;414	P34925;P34925-2	RYK_HUMAN;.	V	415;225	ENSP00000296084:M415V;ENSP00000399527:M225V	ENSP00000296084:M415V	M	-	1	0	RYK	135379540	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.761000	0.62243	2.169000	0.68431	0.528000	0.53228	ATG	.		0.338	RYK-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001005861	
COPB2	9276	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	139077931	139077931	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:139077931A>T	ENST00000333188.5	-	19	2574	c.2393T>A	c.(2392-2394)tTc>tAc	p.F798Y	COPB2_ENST00000507777.1_Missense_Mutation_p.F769Y	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	798					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						TAATCCAGGGAACAGGTTTTC	0.448																																					p.F798Y		.											.	COPB2-92	0			c.T2393A						.						140.0	143.0	142.0					3																	139077931		2203	4300	6503	SO:0001583	missense	9276	exon19			CCAGGGAACAGGT	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.2393T>A	3.37:g.139077931A>T	ENSP00000329419:p.Phe798Tyr	85	0		105	21	NM_004766	0	1	177	230	52	B4DZI8	Missense_Mutation	SNP	ENST00000333188.5	37	CCDS3108.1	.	.	.	.	.	.	.	.	.	.	A	27.6	4.847141	0.91277	.	.	ENSG00000184432	ENST00000333188;ENST00000507777	T;T	0.80393	-1.37;-1.29	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.90400	0.6995	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91941	0.5563	10	0.72032	D	0.01	-19.7271	15.2407	0.73468	1.0:0.0:0.0:0.0	.	798	P35606	COPB2_HUMAN	Y	798;769	ENSP00000329419:F798Y;ENSP00000422295:F769Y	ENSP00000329419:F798Y	F	-	2	0	COPB2	140560621	1.000000	0.71417	0.996000	0.52242	0.956000	0.61745	8.825000	0.92029	2.010000	0.58986	0.533000	0.62120	TTC	.		0.448	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766	
ZBTB38	253461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	141162487	141162487	+	Silent	SNP	A	A	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:141162487A>T	ENST00000514251.1	+	4	1536	c.1257A>T	c.(1255-1257)ggA>ggT	p.G419G	ZBTB38_ENST00000321464.5_Silent_p.G420G|ZBTB38_ENST00000441582.2_Silent_p.G419G					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						GACAAAATGGAGGTTCATTCA	0.433																																					p.G419G		.											.	ZBTB38-25	0			c.A1257T						.						100.0	96.0	97.0					3																	141162487		1876	4096	5972	SO:0001819	synonymous_variant	253461	exon8			AAATGGAGGTTCA	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1257A>T	3.37:g.141162487A>T		138	0		171	48	NM_001080412	0	0	0	0	0		Silent	SNP	ENST00000514251.1	37	CCDS43157.1																																																																																			.		0.433	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2		
CCNL1	57018	hgsc.bcm.edu;bcgsc.ca	37	3	156868131	156868134	+	Frame_Shift_Del	DEL	AACA	AACA	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	AACA	AACA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:156868131_156868134delAACA	ENST00000295926.3	-	6	829_832	c.711_714delTGTT	c.(709-714)tttgttfs	p.FV237fs	CCNL1_ENST00000479052.1_5'UTR|CCNL1_ENST00000461804.1_Frame_Shift_Del_p.FV237fs	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	237	Cyclin-like 2.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			GTTGAAATCGAACAAACACATTGG	0.363																																					p.237_238del		.											.	CCNL1-659	0			c.711_714del						.																																			SO:0001589	frameshift_variant	57018	exon6			AAATCGAACAAAC	AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.711_714delTGTT	3.37:g.156868135_156868138delAACA	ENSP00000295926:p.Phe237fs	174	1		204	39	NM_020307	0	0	0	0	0	B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Frame_Shift_Del	DEL	ENST00000295926.3	37	CCDS3178.1																																																																																			.		0.363	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351859.1	NM_020307	
CCDC39	339829	ucsc.edu	37	3	180337128	180337128	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:180337128T>A	ENST00000442201.2	-	16	2303	c.2184A>T	c.(2182-2184)caA>caT	p.Q728H	CCDC39_ENST00000273654.4_3'UTR	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	728					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GTTCTTCTAGTTGAATTTTTA	0.274																																					p.Q728H		.											.	CCDC39-72	0			c.A2184T						.						133.0	109.0	116.0					3																	180337128		1736	3977	5713	SO:0001583	missense	339829	exon16			TTCTAGTTGAATT	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.2184A>T	3.37:g.180337128T>A	ENSP00000405708:p.Gln728His	33	0		34	4	NM_181426	0	0	0	0	0	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	37	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	T	12.50	1.957005	0.34565	.	.	ENSG00000145075	ENST00000442201	T	0.80480	-1.38	5.54	1.6	0.23607	.	.	.	.	.	T	0.70710	0.3255	L	0.47716	1.5	0.80722	D	1	B	0.17038	0.02	B	0.21708	0.036	T	0.63883	-0.6536	9	0.59425	D	0.04	.	4.2111	0.10512	0.1249:0.0684:0.1305:0.6762	.	728	Q9UFE4	CCD39_HUMAN	H	728	ENSP00000405708:Q728H	ENSP00000405708:Q728H	Q	-	3	2	CCDC39	181819822	0.994000	0.37717	1.000000	0.80357	0.956000	0.61745	0.145000	0.16157	0.372000	0.24591	-0.256000	0.11100	CAA	.		0.274	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
MCCC1	56922	mdanderson.org	37	3	182733294	182733294	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:182733294G>A	ENST00000265594.4	-	19	2256	c.2110C>T	c.(2110-2112)Cag>Tag	p.Q704*	MCCC1_ENST00000492597.1_Nonsense_Mutation_p.Q595*|MCCC1-AS1_ENST00000471731.2_RNA	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	704	Biotinyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CTGTTGGCCTGAGCACCTTCT	0.443																																					p.Q704X		.											.	MCCC1-92	0			c.C2110T						.						332.0	310.0	317.0					3																	182733294		2203	4300	6503	SO:0001587	stop_gained	56922	exon19			TGGCCTGAGCACC	AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.2110C>T	3.37:g.182733294G>A	ENSP00000265594:p.Gln704*	150	4		258	45	NM_020166	0	0	29	32	3	Q59ES4|Q9H959|Q9NS97	Nonsense_Mutation	SNP	ENST00000265594.4	37	CCDS3241.1	.	.	.	.	.	.	.	.	.	.	G	39	7.879796	0.98539	.	.	ENSG00000078070	ENST00000265594;ENST00000492597;ENST00000392616	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	17.9868	0.89158	0.0:0.0:1.0:0.0	.	.	.	.	X	704;595;554	.	ENSP00000265594:Q704X	Q	-	1	0	MCCC1	184215988	1.000000	0.71417	0.954000	0.39281	0.976000	0.68499	5.982000	0.70532	2.530000	0.85305	0.511000	0.50034	CAG	.		0.443	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350775.1	NM_020166	
ALG3	10195	hgsc.bcm.edu	37	3	183959508	183959508	+	IGR	SNP	A	A	C	rs28606531	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:183959508A>C	ENST00000397676.3	-	0	1528				VWA5B2_ENST00000273794.5_Silent_p.P919P|VWA5B2_ENST00000426955.2_Silent_p.P1137P|EIF2B5_ENST00000444495.1_Intron|MIR1224_ENST00000408193.1_RNA|ALG3_ENST00000463495.1_5'Flank	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGAGGGGCCAGGCCAGGTGG	0.746													A|||	346	0.0690895	0.0204	0.0735	5008	,	,		13734	0.0079		0.1451	False		,,,				2504	0.1166				p.P1137P		.											.	.	0			c.A3411C						.						3.0	4.0	4.0					3																	183959508		597	1420	2017	SO:0001628	intergenic_variant	90113	exon19			GGGGCCAGGCCAG	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959508A>C		2	0		27	12	NM_138345	0	0	2	4	2	A8JZZ6|Q9BT71	Silent	SNP	ENST00000397676.3	37	CCDS46968.1																																																																																			A|0.927;C|0.073		0.746	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
IGF2BP2	10644	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	185407396	185407396	+	Missense_Mutation	SNP	C	C	G	rs148304949		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:185407396C>G	ENST00000382199.2	-	6	519	c.424G>C	c.(424-426)Ggg>Cgg	p.G142R	IGF2BP2_ENST00000346192.3_Missense_Mutation_p.G142R|IGF2BP2_ENST00000494906.1_5'Flank|IGF2BP2_ENST00000457616.2_Missense_Mutation_p.G148R|IGF2BP2_ENST00000421047.2_Missense_Mutation_p.G85R	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	142	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			AACTGATGCCCGCTTAGCTTC	0.592																																					p.G142R		.											.	IGF2BP2-226	0			c.G424C						.						60.0	63.0	62.0					3																	185407396		2203	4300	6503	SO:0001583	missense	10644	exon6			GATGCCCGCTTAG	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.424G>C	3.37:g.185407396C>G	ENSP00000371634:p.Gly142Arg	221	2		319	41	NM_001007225	0	0	14	17	3	A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Missense_Mutation	SNP	ENST00000382199.2	37	CCDS3273.2	.	.	.	.	.	.	.	.	.	.	C	26.1	4.704171	0.88924	.	.	ENSG00000073792	ENST00000382199;ENST00000421047;ENST00000457616;ENST00000346192	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.28	5.28	0.74379	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.105189	0.64402	D	0.000003	T	0.55242	0.1908	M	0.81497	2.545	0.80722	D	1	D;D;D;D;D;D	0.89917	0.996;0.999;0.999;1.0;0.993;0.999	D;D;D;D;D;D	0.77004	0.97;0.987;0.987;0.981;0.931;0.989	T	0.60224	-0.7305	10	0.87932	D	0	-6.6436	18.048	0.89338	0.0:1.0:0.0:0.0	.	79;79;85;148;142;142	Q9Y6M1-5;Q9Y6M1-3;Q9Y6M1-4;F8W930;Q9Y6M1-1;Q9Y6M1	.;.;.;.;.;IF2B2_HUMAN	R	142;85;148;142	ENSP00000371634:G142R;ENSP00000413787:G85R;ENSP00000410242:G148R;ENSP00000320204:G142R	ENSP00000320204:G142R	G	-	1	0	IGF2BP2	186890090	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.818000	0.86416	2.611000	0.88343	0.655000	0.94253	GGG	C|1.000;T|0.000		0.592	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157087.2	NM_006548	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	12	0		63	11	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
ARAP2	116984	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	36130245	36130245	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:36130245C>G	ENST00000303965.4	-	21	4039	c.3550G>C	c.(3550-3552)Gat>Cat	p.D1184H		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1184	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						GCCGTCACATCTTCAAGCTGA	0.388																																					p.D1184H		.											.	ARAP2-93	0			c.G3550C						.						122.0	118.0	119.0					4																	36130245		2203	4300	6503	SO:0001583	missense	116984	exon21			TCACATCTTCAAG	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3550G>C	4.37:g.36130245C>G	ENSP00000302895:p.Asp1184His	222	0		209	72	NM_015230	0	0	0	0	0	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	37	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.747153	0.89663	.	.	ENSG00000047365	ENST00000303965	T	0.20738	2.05	5.65	5.65	0.86999	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.058576	0.64402	D	0.000003	T	0.55401	0.1918	M	0.86740	2.835	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61869	-0.6974	10	0.87932	D	0	.	19.7363	0.96205	0.0:1.0:0.0:0.0	.	1184	Q8WZ64	ARAP2_HUMAN	H	1184	ENSP00000302895:D1184H	ENSP00000302895:D1184H	D	-	1	0	ARAP2	35806640	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.384000	0.79751	2.652000	0.90054	0.650000	0.86243	GAT	.		0.388	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
KIAA1211	57482	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	57180955	57180955	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:57180955G>T	ENST00000504228.1	+	6	1392	c.1287G>T	c.(1285-1287)agG>agT	p.R429S	KIAA1211_ENST00000264229.6_Missense_Mutation_p.R429S|KIAA1211_ENST00000541073.1_Missense_Mutation_p.R422S			Q6ZU35	K1211_HUMAN	KIAA1211	429	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					TTGAGGAGAGGCTCGAAGACC	0.617																																					p.R429S		.											.	KIAA1211-70	0			c.G1287T						.						18.0	25.0	23.0					4																	57180955		2017	4160	6177	SO:0001583	missense	57482	exon8			GGAGAGGCTCGAA	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1287G>T	4.37:g.57180955G>T	ENSP00000423366:p.Arg429Ser	221	1		220	52	NM_020722	0	0	0	0	0	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	37	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	G	9.627	1.135486	0.21123	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.11495	2.77;2.77;2.77	5.03	-8.77	0.00827	.	.	.	.	.	T	0.03136	0.0092	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.44003	-0.9356	9	0.19147	T	0.46	0.7406	5.0846	0.14675	0.3033:0.1094:0.4802:0.1072	.	422;422;429	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	S	429;429;422;339	ENSP00000264229:R429S;ENSP00000423366:R429S;ENSP00000444006:R422S	ENSP00000264229:R429S	R	+	3	2	KIAA1211	56875712	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.337000	0.07852	-0.842000	0.04195	-0.467000	0.05162	AGG	.		0.617	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
LPHN3	23284	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	62936396	62936396	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:62936396G>A	ENST00000514591.1	+	25	4509	c.4180G>A	c.(4180-4182)Gtt>Att	p.V1394I	LPHN3_ENST00000545650.1_Missense_Mutation_p.V1394I|LPHN3_ENST00000514996.1_Missense_Mutation_p.V1428I|LPHN3_ENST00000507164.1_3'UTR|LPHN3_ENST00000508693.1_3'UTR|LPHN3_ENST00000506700.1_3'UTR|LPHN3_ENST00000504896.1_3'UTR|LPHN3_ENST00000511324.1_3'UTR|LPHN3_ENST00000514157.1_3'UTR|LPHN3_ENST00000507625.1_Missense_Mutation_p.V1453I|LPHN3_ENST00000508946.1_Missense_Mutation_p.V1437I|LPHN3_ENST00000509896.1_3'UTR|RP11-84A1.3_ENST00000509461.1_RNA|RP11-84A1.3_ENST00000504135.1_RNA|LPHN3_ENST00000506746.1_Missense_Mutation_p.V1496I|RP11-84A1.3_ENST00000506704.1_RNA|LPHN3_ENST00000512091.2_3'UTR|LPHN3_ENST00000506720.1_Missense_Mutation_p.V1505I			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1372					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CACAGAGAGTGTTACCACCAG	0.537																																					p.V1394I		.											.	LPHN3-508	0			c.G4180A						.						29.0	38.0	35.0					4																	62936396		692	1591	2283	SO:0001583	missense	23284	exon23			GAGAGTGTTACCA	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.4180G>A	4.37:g.62936396G>A	ENSP00000422533:p.Val1394Ile	114	0		72	31	NM_015236	0	0	6	8	2	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	37	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.48|11.48	1.651410|1.651410	0.29336|0.29336	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000502815|ENST00000514591;ENST00000545650;ENST00000295349;ENST00000507625;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.|T;T;T;T;T;T;T	.|0.70516	.|-0.47;-0.47;-0.48;-0.48;-0.49;-0.49;-0.48	5.39|5.39	5.39|5.39	0.77823|0.77823	.|GPCR, family 2, latrophilin, C-terminal (1);	.|0.135868	.|0.49305	.|D	.|0.000157	T|T	0.59307|0.59307	0.2184|0.2184	N|N	0.22421|0.22421	0.69|0.69	0.36608|0.36608	D|D	0.875062|0.875062	.|P;P	.|0.37573	.|0.468;0.6	.|B;B	.|0.39299	.|0.206;0.296	T|T	0.61033|0.61033	-0.7144|-0.7144	5|10	.|0.13853	.|T	.|0.58	.|.	17.3347|17.3347	0.87277|0.87277	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1394;1372	.|E9PE04;Q9HAR2	.|.;LPHN3_HUMAN	Y|I	842|1394;1394;1372;1453;1437;1505;1496;1428	.|ENSP00000422533:V1394I;ENSP00000439831:V1394I;ENSP00000421372:V1453I;ENSP00000421627:V1437I;ENSP00000420931:V1505I;ENSP00000425884:V1496I;ENSP00000424258:V1428I	.|ENSP00000295349:V1372I	C|V	+|+	2|1	0|0	LPHN3|LPHN3	62618991|62618991	0.980000|0.980000	0.34600|0.34600	0.616000|0.616000	0.29078|0.29078	0.987000|0.987000	0.75469|0.75469	4.485000|4.485000	0.60279|0.60279	2.535000|2.535000	0.85469|0.85469	0.591000|0.591000	0.81541|0.81541	TGT|GTT	.		0.537	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
ENAM	10117	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	71510144	71510144	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:71510144G>T	ENST00000396073.3	+	9	3282	c.3001G>T	c.(3001-3003)Gtt>Ttt	p.V1001F	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	1001					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			TCTGGAACAAGTTTTTGAAGA	0.428																																					p.V1001F		.											.	ENAM-93	0			c.G3001T						.						111.0	102.0	105.0					4																	71510144		2203	4300	6503	SO:0001583	missense	10117	exon9			GAACAAGTTTTTG	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.3001G>T	4.37:g.71510144G>T	ENSP00000379383:p.Val1001Phe	296	0		320	78	NM_031889	0	0	0	0	0	Q17RI5|Q9H3D1	Missense_Mutation	SNP	ENST00000396073.3	37	CCDS3544.2	.	.	.	.	.	.	.	.	.	.	G	12.18	1.861949	0.32884	.	.	ENSG00000132464	ENST00000396073	T	0.33216	1.42	5.97	2.15	0.27550	.	0.718117	0.13003	N	0.421508	T	0.12390	0.0301	N	0.02539	-0.55	0.20975	N	0.999811	B	0.28512	0.214	B	0.34536	0.185	T	0.27706	-1.0066	10	0.34782	T	0.22	-0.5003	3.8713	0.09038	0.6692:0.0:0.1696:0.1612	.	1001	Q9NRM1	ENAM_HUMAN	F	1001	ENSP00000379383:V1001F	ENSP00000379383:V1001F	V	+	1	0	ENAM	71729008	0.630000	0.27155	0.978000	0.43139	0.978000	0.69477	0.951000	0.29135	0.149000	0.19098	-0.238000	0.12139	GTT	.		0.428	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252166.3	NM_031889	
WDFY3	23001	broad.mit.edu	37	4	85623617	85623617	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:85623617G>A	ENST00000295888.4	-	56	8892	c.8485C>T	c.(8485-8487)Cgc>Tgc	p.R2829C	WDFY3_ENST00000322366.6_Missense_Mutation_p.R2812C	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2829	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.|Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAGGCCTCGCGCACACTGTGA	0.468																																					p.R2829C		.											.	WDFY3-93	0			c.C8485T						.						60.0	64.0	62.0					4																	85623617		2203	4300	6503	SO:0001583	missense	23001	exon56			CCTCGCGCACACT	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.8485C>T	4.37:g.85623617G>A	ENSP00000295888:p.Arg2829Cys	126	1		135	5	NM_014991	0	0	3	3	0	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	37	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.906106	0.92107	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.64438	-0.1;-0.1;-0.1	5.86	5.86	0.93980	BEACH domain (4);	0.000000	0.85682	D	0.000000	T	0.78155	0.4239	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.77169	-0.2686	10	0.54805	T	0.06	.	20.1823	0.98208	0.0:0.0:1.0:0.0	.	2829	Q8IZQ1	WDFY3_HUMAN	C	2812;2829;432	ENSP00000318466:R2812C;ENSP00000295888:R2829C;ENSP00000424987:R432C	ENSP00000295888:R2829C	R	-	1	0	WDFY3	85842641	1.000000	0.71417	0.988000	0.46212	0.807000	0.45602	4.703000	0.61824	2.771000	0.95319	0.650000	0.86243	CGC	.		0.468	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
DSPP	1834	bcgsc.ca	37	4	88537270	88537270	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:88537270C>T	ENST00000282478.7	+	4	3489	c.3456C>T	c.(3454-3456)gaC>gaT	p.D1152D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1152D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1152	Asp/Ser-rich.			D -> N (in Ref. 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		aaagcagcgacagcagtgaca	0.557																																					p.D1152D		.											.	DSPP-90	0			c.C3456T						.						47.0	61.0	56.0					4																	88537270		1584	2865	4449	SO:0001819	synonymous_variant	1834	exon5			CAGCGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3456C>T	4.37:g.88537270C>T		610	3		591	40	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.557	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	ucsc.edu	37	4	88537435	88537435	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:88537435C>T	ENST00000282478.7	+	4	3654	c.3621C>T	c.(3619-3621)agC>agT	p.S1207S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1207S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1207	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtagtgatagcagtgacagca	0.557																																					p.S1207S		.											.	DSPP-90	0			c.C3621T						.																																			SO:0001819	synonymous_variant	1834	exon5			TGATAGCAGTGAC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3621C>T	4.37:g.88537435C>T		643	4		621	86	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.557	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	ucsc.edu	37	4	88537441	88537441	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:88537441C>T	ENST00000282478.7	+	4	3660	c.3627C>T	c.(3625-3627)gaC>gaT	p.D1209D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D1209D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1209	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		atagcagtgacagcagtgaca	0.552																																					p.D1209D		.											.	DSPP-90	0			c.C3627T						.						45.0	65.0	58.0					4																	88537441		1601	2919	4520	SO:0001819	synonymous_variant	1834	exon5			CAGTGACAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3627C>T	4.37:g.88537441C>T		651	4		624	139	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.552	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	ucsc.edu	37	4	88537456	88537456	+	Silent	SNP	C	C	T	rs111240022		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:88537456C>T	ENST00000282478.7	+	4	3675	c.3642C>T	c.(3640-3642)agC>agT	p.S1214S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S1214S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1214	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gtgacagcagcgacagcagtg	0.562																																					p.S1214S		.											.	DSPP-90	0			c.C3642T						.	C		91,3101		0,91,1505	39.0	60.0	53.0		3642	-6.5	0.0	4	dbSNP_132	53	128,5684		0,128,2778	no	coding-synonymous	DSPP	NM_014208.3		0,219,4283	TT,TC,CC		2.2023,2.8509,2.4323		1214/1302	88537456	219,8785	1596	2906	4502	SO:0001819	synonymous_variant	1834	exon5			CAGCAGCGACAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3642C>T	4.37:g.88537456C>T		639	4		655	311	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.562	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
NDST4	64579	ucsc.edu	37	4	115769495	115769495	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:115769495C>A	ENST00000264363.2	-	9	2495		c.e9-1			NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4						heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GCAGTTGTTCCTGTTACAAAA	0.284																																					.		.											.	NDST4-94	0			c.1817-1G>T						.						72.0	75.0	74.0					4																	115769495		2202	4300	6502	SO:0001630	splice_region_variant	64579	exon10			TTGTTCCTGTTAC	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1817-1G>T	4.37:g.115769495C>A		24	0		30	4	NM_022569	0	0	0	0	0	Q2KHM8	Splice_Site	SNP	ENST00000264363.2	37	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	17.40	3.378926	0.61735	.	.	ENSG00000138653	ENST00000264363	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5612	0.95373	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NDST4	115988944	1.000000	0.71417	0.999000	0.59377	0.604000	0.37047	7.434000	0.80377	2.687000	0.91594	0.655000	0.94253	.	.		0.284	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	Intron
ANKRD50	57182	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	125592202	125592202	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr4:125592202A>G	ENST00000504087.1	-	4	3267	c.2230T>C	c.(2230-2232)Tgt>Cgt	p.C744R	ANKRD50_ENST00000515641.1_Missense_Mutation_p.C565R	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	744										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						TCTTTATCACAATGATCTACT	0.473																																					p.C744R		.											.	ANKRD50-90	0			c.T2230C						.						130.0	113.0	119.0					4																	125592202		2203	4300	6503	SO:0001583	missense	57182	exon4			TATCACAATGATC	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.2230T>C	4.37:g.125592202A>G	ENSP00000425658:p.Cys744Arg	95	0		98	21	NM_020337	0	0	0	0	0	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	37	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	A	2.509	-0.313332	0.05422	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.14640	2.49;2.49	5.42	5.42	0.78866	Ankyrin repeat-containing domain (4);	0.070624	0.85682	D	0.000000	T	0.05960	0.0155	N	0.01742	-0.745	0.80722	D	1	B	0.13594	0.008	B	0.18871	0.023	T	0.40534	-0.9558	10	0.13853	T	0.58	.	15.6174	0.76778	1.0:0.0:0.0:0.0	.	744	Q9ULJ7	ANR50_HUMAN	R	744;565	ENSP00000425658:C744R;ENSP00000425355:C565R	ENSP00000425658:C744R	C	-	1	0	ANKRD50	125811652	1.000000	0.71417	0.971000	0.41717	0.223000	0.24884	8.571000	0.90752	2.275000	0.75901	0.528000	0.53228	TGT	.		0.473	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
CTNND2	1501	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	11082866	11082866	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:11082866G>C	ENST00000304623.8	-	16	2919	c.2730C>G	c.(2728-2730)tgC>tgG	p.C910W	CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.C852W|CTNND2_ENST00000458100.2_Missense_Mutation_p.C477W|CTNND2_ENST00000503622.1_Missense_Mutation_p.C573W|CTNND2_ENST00000511377.1_Missense_Mutation_p.C819W	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	910					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.C910C(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGGCCACCGCGCACACCACAC	0.527																																					p.C910W		.											.	CTNND2-293	1	Substitution - coding silent(1)	large_intestine(1)	c.C2730G						.						126.0	110.0	116.0					5																	11082866		2203	4300	6503	SO:0001583	missense	1501	exon16			CACCGCGCACACC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2730C>G	5.37:g.11082866G>C	ENSP00000307134:p.Cys910Trp	116	1		135	38	NM_001332	0	0	0	0	0	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.28|17.28	3.349833|3.349833	0.61183|0.61183	.|.	.|.	ENSG00000169862|ENSG00000169862	ENST00000538638|ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	.|T;T;T;T;T	.|0.69306	.|-0.39;-0.39;-0.39;-0.39;-0.39	5.04|5.04	-4.39|-4.39	0.03611|0.03611	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.75324	.|0.3834	M|M	0.63428|0.63428	1.95|1.95	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.999;0.998	.|T	.|0.76575	.|-0.2909	.|10	.|0.62326	.|D	.|0.03	.|-15.6584	15.4712|15.4712	0.75441|0.75441	0.8735:0.0:0.1265:0.0|0.8735:0.0:0.1265:0.0	.|.	.|573;502;910	.|B4DRK2;B4DG58;Q9UQB3	.|.;.;CTND2_HUMAN	.|W	-1|910;852;819;477;573	.|ENSP00000307134:C910W;ENSP00000352661:C852W;ENSP00000426510:C819W;ENSP00000391155:C477W;ENSP00000426887:C573W	.|ENSP00000307134:C910W	.|C	-|-	.|3	.|2	CTNND2|CTNND2	11135866|11135866	0.003000|0.003000	0.15002|0.15002	0.793000|0.793000	0.32043|0.32043	0.958000|0.958000	0.62258|0.62258	-0.963000|-0.963000	0.03837|0.03837	-0.659000|-0.659000	0.05359|0.05359	-0.253000|-0.253000	0.11424|0.11424	.|TGC	.		0.527	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
DROSHA	29102	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	31526222	31526222	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:31526222C>A	ENST00000511367.2	-	4	1062	c.818G>T	c.(817-819)aGa>aTa	p.R273I	DROSHA_ENST00000442743.1_Missense_Mutation_p.R273I|DROSHA_ENST00000344624.3_Missense_Mutation_p.R273I|DROSHA_ENST00000513349.1_Missense_Mutation_p.R273I|DROSHA_ENST00000504361.1_5'Flank	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	273	Arg-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						AGATGGTGTTCTCCCTCGGTC	0.572																																					p.R273I		.											.	DROSHA-227	0			c.G818T						.						102.0	104.0	103.0					5																	31526222		2097	4215	6312	SO:0001583	missense	29102	exon4			GGTGTTCTCCCTC	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.818G>T	5.37:g.31526222C>A	ENSP00000425979:p.Arg273Ile	136	1		205	62	NM_013235	0	0	0	0	0	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	ENST00000511367.2	37	CCDS47195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.04|15.04	2.714368|2.714368	0.48622|0.48622	.|.	.|.	ENSG00000113360|ENSG00000113360	ENST00000512076|ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000512302	.|T;T;T;T;T	.|0.55234	.|0.53;0.53;0.53;0.53;0.98	4.55|4.55	4.55|4.55	0.56014|0.56014	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63486|0.63486	0.2515|0.2515	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.69078	.|0.997;0.99;0.99	.|D;D;D	.|0.78314	.|0.991;0.944;0.944	T|T	0.67677|0.67677	-0.5609|-0.5609	5|10	.|0.66056	.|D	.|0.02	-10.6161|-10.6161	17.5219|17.5219	0.87790|0.87790	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|273;273;273	.|Q9NRR4-2;E7EMP9;Q9NRR4	.|.;.;RNC_HUMAN	D|I	102|273;273;273;273;266;266;71	.|ENSP00000425979:R273I;ENSP00000339845:R273I;ENSP00000409335:R273I;ENSP00000424161:R273I;ENSP00000428782:R71I	.|ENSP00000265075:R266I	E|R	-|-	3|2	2|0	DROSHA|DROSHA	31561979|31561979	0.986000|0.986000	0.35501|0.35501	0.184000|0.184000	0.23157|0.23157	0.415000|0.415000	0.31203|0.31203	6.260000|6.260000	0.72502|0.72502	2.348000|2.348000	0.79779|0.79779	0.650000|0.650000	0.86243|0.86243	GAG|AGA	.		0.572	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366561.3	NM_013235	
ZNF131	7690	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	43161463	43161463	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:43161463G>C	ENST00000399534.1	+	5	528	c.484G>C	c.(484-486)Gaa>Caa	p.E162Q	ZNF131_ENST00000509634.1_Missense_Mutation_p.E162Q|ZNF131_ENST00000306938.4_Missense_Mutation_p.E162Q|ZNF131_ENST00000509156.1_Missense_Mutation_p.E162Q|ZNF131_ENST00000505606.2_Missense_Mutation_p.E162Q|ZNF131_ENST00000509931.1_Intron			P52739	ZN131_HUMAN	zinc finger protein 131	162					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						GCCATCTGCAGAATCAGAACC	0.428																																					p.E162Q		.											.	ZNF131-90	0			c.G484C						.						112.0	102.0	105.0					5																	43161463		1898	4126	6024	SO:0001583	missense	7690	exon5			TCTGCAGAATCAG	U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.484G>C	5.37:g.43161463G>C	ENSP00000382450:p.Glu162Gln	214	0		243	67	NM_003432	0	0	3	3	0	B4DRL3|Q6PIF0	Missense_Mutation	SNP	ENST00000399534.1	37		.	.	.	.	.	.	.	.	.	.	G	25.2	4.616080	0.87359	.	.	ENSG00000172262	ENST00000515326;ENST00000509156;ENST00000306938;ENST00000399534;ENST00000505606;ENST00000509634	T;T;T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9;-0.9;-0.9	5.18	5.18	0.71444	.	0.049866	0.85682	D	0.000000	T	0.75488	0.3856	N	0.24115	0.695	0.51233	D	0.99991	D;D	0.61697	0.976;0.99	P;P	0.59487	0.703;0.858	T	0.73257	-0.4040	10	0.26408	T	0.33	-14.8564	18.6914	0.91585	0.0:0.0:1.0:0.0	.	162;162	P52739;P52739-2	ZN131_HUMAN;.	Q	162	ENSP00000422079:E162Q;ENSP00000426504:E162Q;ENSP00000305804:E162Q;ENSP00000382450:E162Q;ENSP00000423945:E162Q;ENSP00000421246:E162Q	ENSP00000305804:E162Q	E	+	1	0	ZNF131	43197220	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.432000	0.80349	2.429000	0.82318	0.650000	0.86243	GAA	.		0.428	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000367982.1	NM_003432	
ISL1	3670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	50680462	50680462	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:50680462A>C	ENST00000230658.7	+	2	701	c.116A>C	c.(115-117)cAt>cCt	p.H39P	CTD-2314G24.2_ENST00000559112.2_RNA|ISL1_ENST00000511384.1_Missense_Mutation_p.H39P	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	39	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				TTGGAATGGCATGCGGCATGT	0.408																																					p.H39P		.											.	ISL1-515	0			c.A116C						.						192.0	181.0	185.0					5																	50680462		1888	4119	6007	SO:0001583	missense	3670	exon2			AATGGCATGCGGC	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.116A>C	5.37:g.50680462A>C	ENSP00000230658:p.His39Pro	233	0		259	43	NM_002202	0	0	27	43	16	P20663|P47894	Missense_Mutation	SNP	ENST00000230658.7	37	CCDS43314.1	.	.	.	.	.	.	.	.	.	.	A	19.87	3.906574	0.72868	.	.	ENSG00000016082	ENST00000230658;ENST00000503187;ENST00000511384	D;D	0.96365	-3.99;-3.99	6.16	6.16	0.99307	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.99042	0.9672	H	0.98786	4.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99160	1.0861	10	0.87932	D	0	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	39	P61371	ISL1_HUMAN	P	39	ENSP00000230658:H39P;ENSP00000422676:H39P	ENSP00000230658:H39P	H	+	2	0	ISL1	50716219	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.305000	0.96197	2.367000	0.80283	0.528000	0.53228	CAT	.		0.408	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
ANKRD34B	340120	ucsc.edu	37	5	79854554	79854554	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:79854554T>A	ENST00000338682.3	-	5	1957	c.1285A>T	c.(1285-1287)Agg>Tgg	p.R429W		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	429				R -> G (in Ref. 1; CAH18341). {ECO:0000305}.		cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		GAACCTCGCCTTTCTAAAACT	0.473																																					p.R429W		.											.	ANKRD34B-69	0			c.A1285T						.						108.0	114.0	112.0					5																	79854554		2203	4300	6503	SO:0001583	missense	340120	exon5			CTCGCCTTTCTAA		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.1285A>T	5.37:g.79854554T>A	ENSP00000339802:p.Arg429Trp	25	0		29	4	NM_001004441	0	0	0	0	0	B2RPH1|Q68D79	Missense_Mutation	SNP	ENST00000338682.3	37	CCDS34194.1	.	.	.	.	.	.	.	.	.	.	T	14.00	2.404536	0.42613	.	.	ENSG00000189127	ENST00000338682	T	0.29917	1.55	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000001	T	0.54711	0.1875	M	0.78456	2.415	0.51233	D	0.999915	D	0.89917	1.0	D	0.81914	0.995	T	0.59721	-0.7401	10	0.87932	D	0	-21.9539	10.5382	0.45018	0.0:0.0752:0.0:0.9248	.	429	A5PLL1	AN34B_HUMAN	W	429	ENSP00000339802:R429W	ENSP00000339802:R429W	R	-	1	2	ANKRD34B	79890310	0.999000	0.42202	1.000000	0.80357	0.173000	0.22820	0.456000	0.21859	2.317000	0.78254	0.460000	0.39030	AGG	.		0.473	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	NM_001004441	
PCDHA7	56141	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140215777	140215777	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:140215777C>T	ENST00000525929.1	+	1	1809	c.1809C>T	c.(1807-1809)taC>taT	p.Y603Y	PCDHA6_ENST00000527624.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000378125.3_Silent_p.Y603Y|PCDHA2_ENST00000526136.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	603	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTCAGGCTACAACGCGTGGC	0.647																																					p.Y603Y	NSCLC(160;258 2013 5070 22440 28951)	.											.	PCDHA7-94	0			c.C1809T						.						143.0	133.0	136.0					5																	140215777		2203	4299	6502	SO:0001819	synonymous_variant	56141	exon1			AGGCTACAACGCG	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1809C>T	5.37:g.140215777C>T		294	0		561	140	NM_031852	0	0	0	0	0	O75282	Silent	SNP	ENST00000525929.1	37	CCDS54918.1																																																																																			.		0.647	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHA9	9752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140389355	140389355	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:140389355A>G	ENST00000532602.1	+	4	3719	c.2686A>G	c.(2686-2688)Atc>Gtc	p.I896V	PCDHA1_ENST00000394633.3_Missense_Mutation_p.I632V|PCDHA6_ENST00000529310.1_Missense_Mutation_p.I896V|PCDHA13_ENST00000289272.2_Missense_Mutation_p.I896V|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.I632V|PCDHA10_ENST00000307360.5_Missense_Mutation_p.I894V|PCDHA8_ENST00000531613.1_Missense_Mutation_p.I896V|PCDHA10_ENST00000506939.2_Missense_Mutation_p.I631V|PCDHA11_ENST00000398640.2_Missense_Mutation_p.I895V|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Missense_Mutation_p.I894V|PCDHAC1_ENST00000253807.2_Missense_Mutation_p.I909V|PCDHA1_ENST00000504120.2_Missense_Mutation_p.I896V|PCDHA5_ENST00000529859.1_Missense_Mutation_p.I882V|PCDHA4_ENST00000530339.1_Missense_Mutation_p.I893V|PCDHA3_ENST00000522353.2_Missense_Mutation_p.I896V|PCDHAC2_ENST00000289269.5_Missense_Mutation_p.I953V|PCDHA12_ENST00000398631.2_Missense_Mutation_p.I887V|PCDHA7_ENST00000525929.1_Missense_Mutation_p.I883V	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	896					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTCCTGCAATCATCTCCAT	0.468																																					p.I953V	Melanoma(55;1800 1972 14909)	.											.	PCDHAC2-26	0			c.A2857G						.						57.0	58.0	58.0					5																	140389355		2203	4300	6503	SO:0001583	missense	56134	exon4			CCTGCAATCATCT	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2686A>G	5.37:g.140389355A>G	ENSP00000436042:p.Ile896Val	136	0		156	42	NM_018899	0	0	0	0	0	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.564866	0.65651	.	.	ENSG00000204970;ENSG00000204970;ENSG00000204969;ENSG00000255408;ENSG00000204967;ENSG00000204965;ENSG00000081842;ENSG00000081842;ENSG00000204963;ENSG00000204962;ENSG00000204961;ENSG00000250120;ENSG00000250120;ENSG00000249158;ENSG00000251664;ENSG00000239389;ENSG00000248383;ENSG00000243232	ENST00000504120;ENST00000394633;ENST00000526136;ENST00000522353;ENST00000530339;ENST00000529859;ENST00000529310;ENST00000527624;ENST00000525929;ENST00000531613;ENST00000532602;ENST00000506939;ENST00000307360;ENST00000398640;ENST00000398631;ENST00000289272;ENST00000253807;ENST00000289269	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.60040	0.47;0.25;0.49;0.48;0.47;0.45;0.49;0.23;0.4;0.54;0.55;0.22;0.4;0.47;0.51;0.6;0.34;0.7	5.67	5.67	0.87782	.	0.000000	0.41396	D	0.000890	T	0.73644	0.3613	M	0.61703	1.905	0.31876	N	0.619141	D;D;P;P;P;P;D;P;P;P;P;P;P;B;P;P;P;P	0.76494	0.985;0.985;0.87;0.87;0.93;0.949;0.999;0.701;0.87;0.568;0.621;0.542;0.79;0.307;0.866;0.949;0.79;0.735	D;P;P;P;P;P;D;B;P;B;B;B;B;B;P;P;B;B	0.80764	0.952;0.826;0.542;0.542;0.542;0.656;0.994;0.403;0.542;0.311;0.245;0.396;0.441;0.217;0.521;0.656;0.387;0.293	T	0.78440	-0.2203	10	0.59425	D	0.04	.	16.2045	0.82114	1.0:0.0:0.0:0.0	.	953;909;896;887;895;894;631;896;896;883;896;632;882;893;896;894;896;632	Q9Y5I4;Q9H158;Q9Y5I0;Q9UN75;Q9Y5I1;Q9Y5I2;Q9Y5I2-2;Q9Y5H5;Q9Y5H6;Q9UN72;Q9UN73;Q9UN73-2;Q9Y5H7;Q9UN74;Q9Y5H8;Q9Y5H9;Q9Y5I3;Q9Y5I3-2	PCDC2_HUMAN;PCDC1_HUMAN;PCDAD_HUMAN;PCDAC_HUMAN;PCDAB_HUMAN;PCDAA_HUMAN;.;PCDA9_HUMAN;PCDA8_HUMAN;PCDA7_HUMAN;PCDA6_HUMAN;.;PCDA5_HUMAN;PCDA4_HUMAN;PCDA3_HUMAN;PCDA2_HUMAN;PCDA1_HUMAN;.	V	896;632;894;896;893;882;896;632;883;896;896;631;894;895;887;896;909;953	ENSP00000420840:I896V;ENSP00000378129:I632V;ENSP00000431748:I894V;ENSP00000429808:I896V;ENSP00000435300:I893V;ENSP00000436557:I882V;ENSP00000433378:I896V;ENSP00000434113:I632V;ENSP00000436426:I883V;ENSP00000434655:I896V;ENSP00000436042:I896V;ENSP00000421030:I631V;ENSP00000304234:I894V;ENSP00000381636:I895V;ENSP00000381628:I887V;ENSP00000289272:I896V;ENSP00000253807:I909V;ENSP00000289269:I953V	ENSP00000304234:I894V	I	+	1	0	PCDHA6;PCDHA7;PCDHA8;PCDHA9;PCDHA2;PCDHA3;PCDHA4;PCDHA5;PCDHA10;PCDHA11;PCDHA12;PCDHA1;PCDHA13;PCDHAC2;PCDHAC1	140369539	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.890000	0.92477	2.288000	0.76882	0.533000	0.62120	ATC	.		0.468	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
ADRA1B	147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	159344848	159344848	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:159344848C>T	ENST00000306675.3	+	1	1059	c.936C>T	c.(934-936)atC>atT	p.I312I		NM_000679.3	NP_000670.1	P35368	ADA1B_HUMAN	adrenoceptor alpha 1B	312					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|adult heart development (GO:0007512)|behavioral response to cocaine (GO:0048148)|blood vessel remodeling (GO:0001974)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|multicellular organismal development (GO:0007275)|negative regulation of glycogen catabolic process (GO:0045818)|organ growth (GO:0035265)|positive regulation of glycogen catabolic process (GO:0045819)|positive regulation of heart rate by epinephrine-norepinephrine (GO:0001996)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of the force of heart contraction by epinephrine-norepinephrine (GO:0001997)|regulation of cardiac muscle contraction (GO:0055117)|regulation of vasoconstriction (GO:0019229)|response to amphetamine (GO:0001975)|response to morphine (GO:0043278)|vasoconstriction of artery involved in baroreceptor response to lowering of systemic arterial blood pressure (GO:0001987)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)|protein heterodimerization activity (GO:0046982)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acepromazine(DB01614)|Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Dapiprazole(DB00298)|Desipramine(DB01151)|Dextroamphetamine(DB01576)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phendimetrazine(DB01579)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Ziprasidone(DB00246)	CCTTCTTCATCGCTCTACCGC	0.463																																					p.I312I		.											.	ADRA1B-522	0			c.C936T						.						101.0	97.0	98.0					5																	159344848		2174	4263	6437	SO:0001819	synonymous_variant	147	exon1			CTTCATCGCTCTA	L31773	CCDS4347.1	5q33.3	2012-08-08	2012-05-09		ENSG00000170214	ENSG00000170214		"""GPCR / Class A : Adrenoceptors : alpha"""	278	protein-coding gene	gene with protein product		104220	"""adrenergic, alpha-1B-, receptor"""				Standard	XM_005265818		Approved		uc003lxt.1	P35368	OTTHUMG00000130327	ENST00000306675.3:c.936C>T	5.37:g.159344848C>T		92	0		139	31	NM_000679	0	0	0	0	0	B0LPE1	Silent	SNP	ENST00000306675.3	37	CCDS4347.1																																																																																			.		0.463	ADRA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252676.1		
DOCK2	1794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	169097591	169097591	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:169097591G>C	ENST00000256935.8	+	4	294	c.214G>C	c.(214-216)Gag>Cag	p.E72Q		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	72					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGTGACAGTTGAGAAAAGAAG	0.368																																					p.E72Q		.											.	DOCK2-97	0			c.G214C						.						105.0	100.0	102.0					5																	169097591		2203	4300	6503	SO:0001583	missense	1794	exon4			ACAGTTGAGAAAA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.214G>C	5.37:g.169097591G>C	ENSP00000256935:p.Glu72Gln	68	0		97	19	NM_004946	0	0	0	0	0	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	37	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.802323	0.50315	.	.	ENSG00000134516	ENST00000256935	T	0.42900	0.96	5.59	5.59	0.84812	.	0.175068	0.49916	D	0.000121	T	0.37073	0.0990	L	0.43646	1.37	0.80722	D	1	B	0.21071	0.051	B	0.16722	0.016	T	0.08932	-1.0698	10	0.33141	T	0.24	.	15.1146	0.72392	0.0:0.141:0.859:0.0	.	72	Q92608	DOCK2_HUMAN	Q	72	ENSP00000256935:E72Q	ENSP00000256935:E72Q	E	+	1	0	DOCK2	169030169	1.000000	0.71417	0.963000	0.40424	0.942000	0.58702	5.381000	0.66208	2.627000	0.88993	0.563000	0.77884	GAG	.		0.368	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
FLT4	2324	broad.mit.edu	37	5	180048764	180048764	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr5:180048764C>T	ENST00000261937.6	-	13	1876	c.1798G>A	c.(1798-1800)Gat>Aat	p.D600N	FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000393347.3_Missense_Mutation_p.D600N|FLT4_ENST00000502649.1_Missense_Mutation_p.D600N	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	600	Ig-like C2-type 6.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCGTGCGCATCGTGCAGCGTG	0.657																																					p.D600N	Colon(97;1075 1466 27033 27547 35871)	.											.	FLT4-1490	0			c.G1798A						.						86.0	76.0	79.0					5																	180048764		2203	4300	6503	SO:0001583	missense	2324	exon13			GCGCATCGTGCAG	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.1798G>A	5.37:g.180048764C>T	ENSP00000261937:p.Asp600Asn	242	0		425	8	NM_182925	0	0	0	0	0	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	ENST00000261937.6	37	CCDS4457.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815183	0.90790	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.76968	-1.06;-1.05;-1.05	4.64	4.64	0.57946	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.86602	0.5972	M	0.67953	2.075	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;0.989;0.989;0.974	D;D;P;P	0.97110	1.0;0.93;0.898;0.806	D	0.85559	0.1226	9	0.34782	T	0.22	.	17.887	0.88858	0.0:1.0:0.0:0.0	.	600;410;600;600	P35916-3;E9PFB0;E9PD35;P35916	.;.;.;VGFR3_HUMAN	N	600;600;600;410	ENSP00000261937:D600N;ENSP00000377016:D600N;ENSP00000426057:D600N	ENSP00000261937:D600N	D	-	1	0	FLT4	179981370	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	5.348000	0.66004	2.300000	0.77407	0.561000	0.74099	GAT	.		0.657	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253527.4		
PRPF4B	8899	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	4037635	4037635	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:4037635C>T	ENST00000337659.6	+	3	1343	c.1243C>T	c.(1243-1245)Cga>Tga	p.R415*	PRPF4B_ENST00000538861.1_Nonsense_Mutation_p.R401*	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	415	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				CTTAAGAACACGACCTCGAGA	0.373																																					p.R415X		.											.	PRPF4B-1308	0			c.C1243T						.						67.0	62.0	64.0					6																	4037635		2203	4300	6503	SO:0001587	stop_gained	8899	exon3			AGAACACGACCTC	U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1243C>T	6.37:g.4037635C>T	ENSP00000337194:p.Arg415*	82	0		74	26	NM_003913	0	0	0	0	0	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Nonsense_Mutation	SNP	ENST00000337659.6	37	CCDS4488.1	.	.	.	.	.	.	.	.	.	.	C	39	7.355370	0.98231	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	.	.	.	5.06	3.26	0.37387	.	0.000000	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1481	0.31124	0.2788:0.6483:0.0:0.0729	.	.	.	.	X	415;401	.	ENSP00000337194:R415X	R	+	1	2	PRPF4B	3982634	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	2.118000	0.41949	0.611000	0.30052	0.650000	0.86243	CGA	.		0.373	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314018.2		
HIST1H3E	8353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26225400	26225400	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:26225400G>C	ENST00000360408.1	+	1	18	c.18G>C	c.(16-18)caG>caC	p.Q6H		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	6					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				GTACTAAGCAGACGGCTCGTA	0.537																																					p.Q6H		.											.	HIST1H3E-68	0			c.G18C						.						73.0	75.0	74.0					6																	26225400		2203	4300	6503	SO:0001583	missense	8353	exon1			TAAGCAGACGGCT	M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.18G>C	6.37:g.26225400G>C	ENSP00000353581:p.Gln6His	300	0		310	88	NM_003532	0	0	0	0	0	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000360408.1	37	CCDS4596.1	.	.	.	.	.	.	.	.	.	.	.	3.335	-0.135846	0.06711	.	.	ENSG00000196966	ENST00000360408	T	0.46819	0.86	4.54	0.528	0.17089	.	.	.	.	.	T	0.31796	0.0808	.	.	.	0.30484	N	0.772043	.	.	.	.	.	.	T	0.22312	-1.0220	6	0.87932	D	0	.	8.1219	0.30976	0.4337:0.0:0.5663:0.0	.	.	.	.	H	6	ENSP00000353581:Q6H	ENSP00000353581:Q6H	Q	+	3	2	HIST1H3E	26333379	1.000000	0.71417	0.962000	0.40283	0.256000	0.26092	0.570000	0.23653	-0.013000	0.14199	-0.339000	0.08088	CAG	.		0.537	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040097.1	NM_003532	
EHMT2	10919	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31854777	31854777	+	Silent	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:31854777G>A	ENST00000375537.4	-	16	2119	c.2113C>T	c.(2113-2115)Ctg>Ttg	p.L705L	EHMT2_ENST00000375530.4_Silent_p.L671L|EHMT2-AS1_ENST00000434689.1_RNA|EHMT2_ENST00000395728.3_Silent_p.L762L|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Silent_p.L728L	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	705					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.L705L(1)		central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						CTGACCTGCAGCAGCACATGG	0.687																																					p.L705L		.											.	EHMT2-91	1	Substitution - coding silent(1)	lung(1)	c.C2113T						.						53.0	60.0	57.0					6																	31854777		1511	2709	4220	SO:0001819	synonymous_variant	10919	exon16			CCTGCAGCAGCAC	AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.2113C>T	6.37:g.31854777G>A		52	1		61	15	NM_006709	0	0	0	0	0	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Silent	SNP	ENST00000375537.4	37	CCDS4725.1	.	.	.	.	.	.	.	.	.	.	G	9.699	1.154062	0.21371	.	.	ENSG00000204371	ENST00000436026	.	.	.	5.39	4.52	0.55395	.	.	.	.	.	T	0.49236	0.1545	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50684	-0.8799	4	.	.	.	.	10.2273	0.43233	0.0:0.1478:0.6988:0.1533	.	.	.	.	V	22	.	.	A	-	2	0	EHMT2	31962756	0.932000	0.31603	1.000000	0.80357	0.998000	0.95712	1.570000	0.36439	1.238000	0.43771	0.655000	0.94253	GCT	.		0.687	EHMT2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076355.5	NM_006709	
DAAM2	23500	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	39867948	39867948	+	Silent	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:39867948C>A	ENST00000398904.2	+	23	2957	c.2775C>A	c.(2773-2775)tcC>tcA	p.S925S	RP11-61I13.3_ENST00000437947.1_RNA|DAAM2_ENST00000538976.1_Silent_p.S924S|RP11-61I13.3_ENST00000420293.1_RNA|RP11-61I13.3_ENST00000606829.1_RNA|DAAM2_ENST00000274867.4_Silent_p.S925S|RP11-61I13.3_ENST00000430595.1_RNA			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	925	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					TCAGCTTCTCCGAGCTGGAGG	0.572																																					p.S925S		.											.	DAAM2-228	0			c.C2775A						.						32.0	35.0	34.0					6																	39867948		2019	4159	6178	SO:0001819	synonymous_variant	23500	exon23			CTTCTCCGAGCTG	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2775C>A	6.37:g.39867948C>A		92	1		108	33	NM_001201427	0	0	6	12	6	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Silent	SNP	ENST00000398904.2	37	CCDS56426.1																																																																																			.		0.572	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
CUL7	9820	broad.mit.edu	37	6	43020160	43020160	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:43020160G>A	ENST00000265348.3	-	2	452	c.367C>T	c.(367-369)Cgg>Tgg	p.R123W	CUL7_ENST00000535468.1_Missense_Mutation_p.R175W			Q14999	CUL7_HUMAN	cullin 7	123					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TCCAGCTGCCGAAGGGCTCTC	0.607																																					p.R175W		.											.	CUL7-229	0			c.C523T						.						84.0	70.0	74.0					6																	43020160		2203	4300	6503	SO:0001583	missense	9820	exon2			GCTGCCGAAGGGC	BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.367C>T	6.37:g.43020160G>A	ENSP00000265348:p.Arg123Trp	107	1		110	4	NM_001168370	0	0	5	5	0	B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	ENST00000265348.3	37	CCDS4881.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429715	0.62844	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.66099	-0.19;-0.18	5.51	4.62	0.57501	.	0.152133	0.46758	D	0.000273	T	0.56396	0.1982	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	0.966;1.0	B;D	0.72982	0.378;0.979	T	0.64368	-0.6424	10	0.87932	D	0	-25.8087	7.8041	0.29191	0.0741:0.0:0.6357:0.2902	.	175;123	F5H0L1;Q14999	.;CUL7_HUMAN	W	123;175	ENSP00000265348:R123W;ENSP00000438788:R175W	ENSP00000265348:R123W	R	-	1	2	CUL7	43128138	0.998000	0.40836	0.979000	0.43373	0.989000	0.77384	2.673000	0.46858	1.263000	0.44181	0.561000	0.74099	CGG	.		0.607	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040575.1	NM_014780	
PKHD1	5314	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	51774212	51774212	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:51774212C>A	ENST00000371117.3	-	40	6826	c.6551G>T	c.(6550-6552)gGa>gTa	p.G2184V	PKHD1_ENST00000340994.4_Missense_Mutation_p.G2184V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2184					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CACTCTGGCTCCCATATCCCT	0.478																																					p.G2184V		.											.	PKHD1-603	0			c.G6551T						.						208.0	198.0	201.0					6																	51774212		2203	4300	6503	SO:0001583	missense	5314	exon40			CTGGCTCCCATAT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.6551G>T	6.37:g.51774212C>A	ENSP00000360158:p.Gly2184Val	165	0		177	52	NM_170724	0	0	0	0	0	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	37	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	.	19.32	3.804513	0.70682	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.93076	-3.04;-3.16	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000001	D	0.96867	0.8977	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.988;0.999	D	0.97334	0.9952	10	0.87932	D	0	.	16.7773	0.85555	0.0:1.0:0.0:0.0	.	2184;2184;2184	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	V	2184	ENSP00000360158:G2184V;ENSP00000341097:G2184V	ENSP00000341097:G2184V	G	-	2	0	PKHD1	51882171	0.998000	0.40836	1.000000	0.80357	0.712000	0.41017	4.319000	0.59197	2.624000	0.88883	0.563000	0.77884	GGA	.		0.478	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
DST	667	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	56336987	56336987	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:56336987G>A	ENST00000361203.3	-	89	21075	c.21068C>T	c.(21067-21069)tCt>tTt	p.S7023F	DST_ENST00000446842.2_Missense_Mutation_p.S6808F|DST_ENST00000370769.4_Missense_Mutation_p.S7134F|DST_ENST00000370754.5_Missense_Mutation_p.S7312F|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.S5046F|DST_ENST00000370788.2_Missense_Mutation_p.S4937F|DST_ENST00000244364.6_Missense_Mutation_p.S4720F			Q03001	DYST_HUMAN	dystonin	7132					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTGTGACCCAGAGGGATACAA	0.463																																					p.S4720F		.											.	DST-523	0			c.C14159T						.						142.0	119.0	126.0					6																	56336987		1889	4129	6018	SO:0001583	missense	667	exon75			GACCCAGAGGGAT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.21068C>T	6.37:g.56336987G>A	ENSP00000354508:p.Ser7023Phe	178	0		182	56	NM_015548	0	0	16	20	4	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	37		.	.	.	.	.	.	.	.	.	.	G	22.3	4.276346	0.80580	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203;ENST00000523943	T;T;T;T;T;T;T	0.65732	0.99;-0.17;-0.17;-0.05;0.78;-0.06;-0.13	6.17	6.17	0.99709	.	0.000000	0.53938	D	0.000056	T	0.76506	0.3997	M	0.66939	2.045	0.35124	D	0.767359	D;D;D;D;P	0.76494	0.976;0.998;0.998;0.999;0.886	P;D;D;D;P	0.83275	0.656;0.979;0.979;0.996;0.725	T	0.74811	-0.3538	9	0.59425	D	0.04	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	5046;7134;7312;7132;4720	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	F	4720;7312;7134;5046;6808;4937;7023;51	ENSP00000244364:S4720F;ENSP00000359790:S7312F;ENSP00000359805:S7134F;ENSP00000400883:S5046F;ENSP00000393645:S6808F;ENSP00000359824:S4937F;ENSP00000354508:S7023F	ENSP00000244364:S4720F	S	-	2	0	DST	56444946	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.230000	0.95299	2.941000	0.99782	0.655000	0.94253	TCT	.		0.463	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
SYNCRIP	10492	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	86324650	86324650	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:86324650T>C	ENST00000369622.3	-	11	2196	c.1696A>G	c.(1696-1698)Aaa>Gaa	p.K566E	SYNCRIP_ENST00000355238.6_Intron|RP11-321N4.5_ENST00000503906.1_Intron	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	566					cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		CCATCAGCTTTGCGCTTTCCT	0.597																																					p.K566E		.											.	SYNCRIP-92	0			c.A1696G						.						151.0	149.0	150.0					6																	86324650		2203	4300	6503	SO:0001583	missense	10492	exon11			CAGCTTTGCGCTT	AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.1696A>G	6.37:g.86324650T>C	ENSP00000358635:p.Lys566Glu	122	1		80	22	NM_006372	0	0	30	53	23	E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	ENST00000369622.3	37	CCDS5005.1	.	.	.	.	.	.	.	.	.	.	T	15.33	2.802843	0.50315	.	.	ENSG00000135316	ENST00000369622	T	0.29655	1.56	5.19	5.19	0.71726	.	0.542019	0.20885	N	0.083923	T	0.44746	0.1308	M	0.68593	2.085	0.58432	D	0.999999	P;P	0.49696	0.88;0.927	P;D	0.67725	0.899;0.953	T	0.44375	-0.9332	10	0.62326	D	0.03	.	15.0433	0.71807	0.0:0.0:0.0:1.0	.	566;531	O60506;O60506-2	HNRPQ_HUMAN;.	E	566	ENSP00000358635:K566E	ENSP00000358635:K566E	K	-	1	0	SYNCRIP	86381369	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.039000	0.88947	1.958000	0.56883	0.460000	0.39030	AAA	.		0.597	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041396.1	NM_006372	
GABRR2	2570	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	89978901	89978901	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:89978901G>C	ENST00000402938.3	-	4	474	c.341C>G	c.(340-342)gCt>gGt	p.A114G	GABRR2_ENST00000602399.1_Missense_Mutation_p.A139G|GABRR2_ENST00000602808.1_5'Flank	NM_002043.3	NP_002034.3	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 2	114					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(10)|prostate(2)|urinary_tract(1)	21		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	GCTGGAGAAAGCTAGCCTCTC	0.517																																					p.A114G		.											.	GABRR2-68	0			c.C341G						.						135.0	129.0	131.0					6																	89978901		2203	4300	6503	SO:0001583	missense	2570	exon4			GAGAAAGCTAGCC		CCDS5020.2, CCDS5020.3	6q15	2012-06-22	2012-02-03		ENSG00000111886	ENSG00000111886		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4091	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 2"""	137162	"""gamma-aminobutyric acid (GABA) receptor, rho 2"""			1315307	Standard	NM_002043		Approved		uc003pnb.3	P28476	OTTHUMG00000015198	ENST00000402938.3:c.341C>G	6.37:g.89978901G>C	ENSP00000386029:p.Ala114Gly	161	0		154	41	NM_002043	0	0	1	1	0	A2BDE4|Q9H153	Missense_Mutation	SNP	ENST00000402938.3	37	CCDS5020.3	.	.	.	.	.	.	.	.	.	.	G	18.16	3.562249	0.65538	.	.	ENSG00000111886	ENST00000402938	.	.	.	5.7	4.83	0.62350	Neurotransmitter-gated ion-channel ligand-binding (3);	0.163918	0.56097	D	0.000028	T	0.51601	0.1684	M	0.67625	2.065	0.38893	D	0.957157	B	0.25850	0.136	B	0.36092	0.217	T	0.53961	-0.8364	8	.	.	.	.	14.9503	0.71067	0.0685:0.0:0.9315:0.0	.	139	P28476	GBRR2_HUMAN	G	139	.	.	A	-	2	0	GABRR2	90035620	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	6.653000	0.74382	1.411000	0.46957	0.655000	0.94253	GCT	.		0.517	GABRR2-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041482.3		
RNF217	154214	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	125404012	125404012	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:125404012T>G	ENST00000521654.2	+	6	1558	c.1558T>G	c.(1558-1560)Tta>Gta	p.L520V	RNF217_ENST00000359704.2_Missense_Mutation_p.F266C|RNF217_ENST00000368414.2_Missense_Mutation_p.L82V|RNF217_ENST00000275184.6_Missense_Mutation_p.L164V|RNF217_ENST00000560949.1_Missense_Mutation_p.L285V			Q8TC41	RN217_HUMAN	ring finger protein 217	520					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		ATCCCTAGGTTTATTTGTATT	0.333																																					p.F266C		.											.	RNF217-68	0			c.T797G						.						124.0	115.0	118.0					6																	125404012		2203	4300	6503	SO:0001583	missense	154214	exon9			CTAGGTTTATTTG	BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.1558T>G	6.37:g.125404012T>G	ENSP00000428698:p.Leu520Val	59	0		71	18	NM_152553	0	0	0	0	0	H7C5V4|Q5TCA4|Q9BX48	Missense_Mutation	SNP	ENST00000521654.2	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	2.576|2.576	-0.298627|-0.298627	0.05532|0.05532	.|.	.|.	ENSG00000146373|ENSG00000146373	ENST00000359704|ENST00000521654;ENST00000368414;ENST00000275184	T|T	0.47528|0.44083	0.84|0.93	5.66|5.66	3.27|3.27	0.37495|0.37495	.|.	0.105394|.	0.42548|.	D|.	0.000690|.	T|T	0.31167|0.31167	0.0788|0.0788	L|L	0.51422|0.51422	1.61|1.61	0.39294|0.39294	D|D	0.964791|0.964791	D|P	0.57257|0.52842	0.979|0.956	P|P	0.46975|0.62184	0.533|0.899	T|T	0.33599|0.33599	-0.9862|-0.9862	10|9	0.87932|0.07030	D|T	0|0.85	.|.	9.7|9.7	0.40180|0.40180	0.0:0.1408:0.0:0.8592|0.0:0.1408:0.0:0.8592	.|.	266|285	Q8TC41|F2Z2M4	RN217_HUMAN|.	C|V	266|285;82;164	ENSP00000352734:F266C|ENSP00000275184:L164V	ENSP00000352734:F266C|ENSP00000275184:L164V	F|L	+|+	2|1	0|2	RNF217|RNF217	125445711|125445711	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	2.151000|2.151000	0.42263|0.42263	0.508000|0.508000	0.28173|0.28173	-0.264000|-0.264000	0.10439|0.10439	TTT|TTA	.		0.333	RNF217-002	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000042063.3	NM_152553	
BCLAF1	9774	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	136582461	136582461	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:136582461T>A	ENST00000531224.1	-	12	2951	c.2699A>T	c.(2698-2700)gAt>gTt	p.D900V	BCLAF1_ENST00000031135.9_Missense_Mutation_p.D118V|BCLAF1_ENST00000392348.2_Missense_Mutation_p.D849V|BCLAF1_ENST00000530767.1_Missense_Mutation_p.D727V|BCLAF1_ENST00000527536.1_Missense_Mutation_p.D851V|BCLAF1_ENST00000353331.4_Missense_Mutation_p.D849V|BCLAF1_ENST00000527759.1_Missense_Mutation_p.D898V|BCLAF1_ENST00000529917.1_5'UTR	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	900					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		CTCTTCTTCATCTTCAACAAT	0.378																																					p.D900V	Colon(142;1534 1789 5427 7063 28491)	.											.	BCLAF1-228	0			c.A2699T						.						246.0	247.0	247.0					6																	136582461		2203	4300	6503	SO:0001583	missense	9774	exon12			TCTTCATCTTCAA	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.2699A>T	6.37:g.136582461T>A	ENSP00000435210:p.Asp900Val	90	0		125	15	NM_014739	0	0	40	40	0	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	ENST00000531224.1	37	CCDS5177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.03|15.03	2.711845|2.711845	0.48517|0.48517	.|.	.|.	ENSG00000029363|ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000031135;ENST00000392348|ENST00000534762	T;T;T;T;T;T;T|.	0.56611|.	4.32;4.32;4.32;2.02;4.32;0.45;4.32|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.225469|.	0.33670|.	N|.	0.004661|.	T|T	0.51924|0.51924	0.1703|0.1703	L|L	0.46157|0.46157	1.445|1.445	0.80722|0.80722	D|D	1|1	P;D;P;P;P|.	0.76494|.	0.933;0.999;0.933;0.933;0.933|.	P;D;P;P;P|.	0.73708|.	0.732;0.981;0.732;0.732;0.623|.	T|T	0.51403|0.51403	-0.8710|-0.8710	10|5	0.72032|.	D|.	0.01|.	-3.3306|-3.3306	15.604|15.604	0.76649|0.76649	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	898;179;849;900;727|.	Q9NYF8-2;B7Z8J9;Q9NYF8-3;Q9NYF8;Q9NYF8-4|.	.;.;.;BCLF1_HUMAN;.|.	V|S	900;849;851;727;898;118;849|166	ENSP00000435210:D900V;ENSP00000229446:D849V;ENSP00000435441:D851V;ENSP00000436501:D727V;ENSP00000434826:D898V;ENSP00000031135:D118V;ENSP00000376159:D849V|.	ENSP00000031135:D118V|.	D|R	-|-	2|3	0|2	BCLAF1|BCLAF1	136624154|136624154	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.548000|6.548000	0.73896|0.73896	2.086000|2.086000	0.62901|0.62901	0.533000|0.533000	0.62120|0.62120	GAT|AGA	.		0.378	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042375.2	NM_014739	
MTHFD1L	25902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	151281517	151281517	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:151281517A>T	ENST00000367321.3	+	18	2184	c.1910A>T	c.(1909-1911)gAc>gTc	p.D637V		NM_001242767.1|NM_001242768.1|NM_015440.4	NP_001229696.1|NP_001229697.1|NP_056255.2	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like	637	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process (GO:0009396)|folic acid-containing compound metabolic process (GO:0006760)|formate metabolic process (GO:0015942)|one-carbon metabolic process (GO:0006730)|oxidation-reduction process (GO:0055114)|tetrahydrofolate interconversion (GO:0035999)|tetrahydrofolate metabolic process (GO:0046653)	membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	29		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		GTGGCCAGTGACAAAAGCGGG	0.567																																					p.D638V		.											.	MTHFD1L-292	0			c.A1913T						.						85.0	66.0	72.0					6																	151281517		2203	4300	6503	SO:0001583	missense	25902	exon18			CCAGTGACAAAAG	BC017477	CCDS5228.1, CCDS56457.1, CCDS75535.1, CCDS75536.1	6q25.1	2010-07-19	2004-12-13	2004-12-14	ENSG00000120254	ENSG00000120254	6.3.4.3		21055	protein-coding gene	gene with protein product	"""10-formyl-THF synthetase"", ""mitochondrial C1-tetrahydrofolate synthase"", ""monofunctional C1-tetrahydrofolate synthase, mitochondrial"""	611427	"""formyltetrahydrofolate synthetase domain containing 1"""	FTHFSDC1		18804703	Standard	NM_015440		Approved	DKFZP586G1517, FLJ21145	uc021zgs.1	Q6UB35	OTTHUMG00000015828	ENST00000367321.3:c.1910A>T	6.37:g.151281517A>T	ENSP00000356290:p.Asp637Val	194	0		226	66	NM_001242767	0	0	3	4	1	Q2TBF3|Q8WVW0|Q96HG8|Q9H789|Q9UFU8	Missense_Mutation	SNP	ENST00000367321.3	37	CCDS5228.1	.	.	.	.	.	.	.	.	.	.	A	18.29	3.591133	0.66219	.	.	ENSG00000120254	ENST00000367321	T	0.24151	1.87	5.81	4.66	0.58398	.	0.133459	0.64402	D	0.000002	T	0.48390	0.1497	M	0.94101	3.495	0.80722	D	1	D;D;D	0.67145	0.996;0.958;0.995	D;D;D	0.69142	0.928;0.936;0.962	T	0.61734	-0.7002	10	0.72032	D	0.01	.	10.8344	0.46679	0.925:0.0:0.0749:0.0	.	638;392;637	B7ZM99;B2RD24;Q6UB35	.;.;C1TM_HUMAN	V	637	ENSP00000356290:D637V	ENSP00000356290:D637V	D	+	2	0	MTHFD1L	151323210	1.000000	0.71417	0.998000	0.56505	0.701000	0.40568	3.032000	0.49736	1.041000	0.40125	0.377000	0.23210	GAC	.		0.567	MTHFD1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042699.1	NM_015440	
SCAF8	22828	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	155126521	155126522	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	TG	TG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:155126521_155126522delTG	ENST00000367178.3	+	9	1458_1459	c.882_883delTG	c.(880-885)tctgtgfs	p.V295fs	SCAF8_ENST00000367186.4_Frame_Shift_Del_p.V361fs|SCAF8_ENST00000417268.1_Frame_Shift_Del_p.V295fs	NM_014892.3	NP_055707.3	Q9UPN6	SCAF8_HUMAN	SR-related CTD-associated factor 8	295	Gln-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase core enzyme binding (GO:0043175)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(15)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	46						TTTCAGAATCTGTGAACAATTC	0.356																																					p.294_295del		.											.	SCAF8-91	0			c.882_883del						.																																			SO:0001589	frameshift_variant	22828	exon9			AGAATCTGTGAAC	AB029039	CCDS5247.1, CCDS69226.1, CCDS75541.1	6q25.1-q25.3	2013-02-12	2011-01-10	2011-01-10	ENSG00000213079	ENSG00000213079		"""RNA binding motif (RRM) containing"""	20959	protein-coding gene	gene with protein product			"""RNA binding motif protein 16"""	RBM16		10470851	Standard	NM_001286189		Approved	KIAA1116	uc003qpz.3	Q9UPN6	OTTHUMG00000015877	ENST00000367178.3:c.882_883delTG	6.37:g.155126523_155126524delTG	ENSP00000356146:p.Val295fs	90	0		91	25	NM_014892	0	0	0	0	0	B7Z888|Q5TBU6|Q6NSK3|Q9BQN8|Q9BX43	Frame_Shift_Del	DEL	ENST00000367178.3	37	CCDS5247.1																																																																																			.		0.356	SCAF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042798.1	NM_014892	
TBP	6908	broad.mit.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																					p.Q60Q		.											.	TBP-91	0			c.G180A						.						43.0	45.0	44.0					6																	170871004		2203	4300	6503	SO:0001819	synonymous_variant	6908	exon3			GCAGCAGCAACAA	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		56	0		62	8	NM_003194	0	0	11	11	0	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
TBP	6908	mdanderson.org	37	6	170871043	170871043	+	Silent	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr6:170871043G>A	ENST00000392092.2	+	3	498	c.219G>A	c.(217-219)caG>caA	p.Q73Q	TBP_ENST00000540980.1_Silent_p.Q53Q|TBP_ENST00000230354.6_Silent_p.Q73Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	73	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q73Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcagcaacagcaacagcagc	0.562																																					p.Q73Q		.											.	TBP-91	1	Substitution - coding silent(1)	endometrium(1)	c.G219A						.						17.0	21.0	20.0					6																	170871043		1987	3877	5864	SO:0001819	synonymous_variant	6908	exon3			GCAACAGCAACAG	M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.219G>A	6.37:g.170871043G>A		47	1		64	15	NM_003194	0	0	61	73	12	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	ENST00000392092.2	37	CCDS5315.1																																																																																			.		0.562	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043271.2	NM_003194	
THSD7A	221981	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	11485690	11485690	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:11485690T>C	ENST00000423059.4	-	13	3313	c.3062A>G	c.(3061-3063)cAt>cGt	p.H1021R	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1021	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TGAATTACCATGGCTGTTACA	0.433										HNSCC(18;0.044)																											p.H1021R		.											.	THSD7A-71	0			c.A3062G						.						275.0	250.0	258.0					7																	11485690		1927	4145	6072	SO:0001583	missense	221981	exon13			TTACCATGGCTGT		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.3062A>G	7.37:g.11485690T>C	ENSP00000406482:p.His1021Arg	159	0		213	42	NM_015204	0	0	0	0	0		Missense_Mutation	SNP	ENST00000423059.4	37	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	T	19.47	3.833633	0.71258	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.59083	0.29	5.63	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.47507	0.1449	L	0.44542	1.39	0.53688	D	0.999977	B	0.13145	0.007	B	0.12156	0.007	T	0.32693	-0.9897	10	0.16420	T	0.52	.	12.9262	0.58262	0.0:0.0:0.1355:0.8645	.	1021	Q9UPZ6	THS7A_HUMAN	R	1021	ENSP00000406482:H1021R	ENSP00000262042:H1021R	H	-	2	0	THSD7A	11452215	1.000000	0.71417	0.997000	0.53966	0.872000	0.50106	7.698000	0.84413	0.945000	0.37605	0.528000	0.53228	CAT	.		0.433	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
BZW2	28969	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	16734601	16734601	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:16734601G>A	ENST00000433922.2	+	8	972	c.794G>A	c.(793-795)cGt>cAt	p.R265H	BZW2_ENST00000258761.3_Missense_Mutation_p.R265H|BZW2_ENST00000407633.1_Missense_Mutation_p.R71H|BZW2_ENST00000432311.1_Intron|AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000452975.2_3'UTR|BZW2_ENST00000405202.1_Missense_Mutation_p.R189H	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	265	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		CTCCAGGAGCGTCTTTCTCAG	0.532																																					p.R265H		.											.	BZW2-92	0			c.G794A						.						57.0	53.0	54.0					7																	16734601		2203	4300	6503	SO:0001583	missense	28969	exon8			AGGAGCGTCTTTC	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.794G>A	7.37:g.16734601G>A	ENSP00000397249:p.Arg265His	51	0		63	15	NM_014038	0	0	75	99	24	A4D123|Q3B779|Q96JW5|Q9H3F7	Missense_Mutation	SNP	ENST00000433922.2	37	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485749	0.63962	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000405202;ENST00000446596;ENST00000407633	T;T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;0.94;-1.34	6.17	5.29	0.74685	eIF4-gamma/eIF5/eIF2-epsilon (1);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.69333	0.3099	N	0.22421	0.69	0.80722	D	1	P;P	0.49783	0.928;0.928	B;B	0.39027	0.288;0.288	T	0.72087	-0.4396	10	0.42905	T	0.14	-3.2458	15.7894	0.78343	0.065:0.0:0.935:0.0	.	265;265	E7ETZ4;Q9Y6E2	.;BZW2_HUMAN	H	265;265;265;189;265;71	ENSP00000403481:R265H;ENSP00000258761:R265H;ENSP00000397249:R265H;ENSP00000385577:R189H;ENSP00000412750:R265H;ENSP00000384617:R71H	ENSP00000258761:R265H	R	+	2	0	BZW2	16701126	1.000000	0.71417	0.943000	0.38184	0.996000	0.88848	3.451000	0.52964	1.626000	0.50381	0.655000	0.94253	CGT	.		0.532	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038	
SP8	221833	hgsc.bcm.edu;mdanderson.org	37	7	20824953	20824953	+	Silent	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:20824953G>C	ENST00000361443.4	-	3	666	c.429C>G	c.(427-429)ggC>ggG	p.G143G	SP8_ENST00000418710.2_Silent_p.G161G	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	143					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						cgccgccgccgcccccgccgc	0.736																																					p.G161G		.											.	SP8-91	0			c.C483G						.						2.0	2.0	2.0					7																	20824953		584	1454	2038	SO:0001819	synonymous_variant	221833	exon2			GCCGCCGCCCCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.429C>G	7.37:g.20824953G>C		11	0		29	16	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.736	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
SP4	6671	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	21469550	21469550	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:21469550C>T	ENST00000222584.3	+	3	985	c.767C>T	c.(766-768)aCc>aTc	p.T256I		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	256					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						GTTGTAACAACCCTACCAATT	0.502																																					p.T256I		.											.	SP4-95	0			c.C767T						.						72.0	68.0	69.0					7																	21469550		2203	4300	6503	SO:0001583	missense	6671	exon3			TAACAACCCTACC		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.767C>T	7.37:g.21469550C>T	ENSP00000222584:p.Thr256Ile	193	0		261	60	NM_003112	0	0	0	0	0	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.542383	0.45280	.	.	ENSG00000105866	ENST00000222584	T	0.09723	2.95	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.14141	0.0342	L	0.51422	1.61	0.58432	D	0.999999	P	0.48694	0.914	B	0.40444	0.329	T	0.01956	-1.1240	10	0.72032	D	0.01	.	18.3502	0.90336	0.0:1.0:0.0:0.0	.	256	Q02446	SP4_HUMAN	I	256	ENSP00000222584:T256I	ENSP00000222584:T256I	T	+	2	0	SP4	21436075	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.498000	0.66931	2.559000	0.86315	0.655000	0.94253	ACC	.		0.502	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211617.2	NM_003112	
KLHL7	55975	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	23163401	23163401	+	Silent	SNP	G	G	A	rs150640353		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:23163401G>A	ENST00000339077.5	+	2	369	c.126G>A	c.(124-126)acG>acA	p.T42T	KLHL7_ENST00000542558.1_Intron|KLHL7_ENST00000545443.1_Silent_p.T20T|KLHL7_ENST00000410047.1_Silent_p.T20T|KLHL7_ENST00000409689.1_De_novo_Start_InFrame|KLHL7_ENST00000539124.1_Intron|KLHL7_ENST00000545771.1_Silent_p.T20T|KLHL7_ENST00000479288.1_Intron|KLHL7_ENST00000322231.7_Silent_p.T20T|KLHL7_ENST00000322275.5_Silent_p.T42T	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	42					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)	p.T20T(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						ATTAGAAAACGTTGTGTGACG	0.373																																					p.T42T		.											.	KLHL7-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G126A						.	G	,,	0,4406		0,0,2203	117.0	106.0	109.0		126,126,	-10.9	0.0	7	dbSNP_134	109	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,utr-5	KLHL7	NM_001031710.2,NM_001172428.1,NM_018846.4	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	42/587,42/167,	23163401	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	55975	exon2			GAAAACGTTGTGT		CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.126G>A	7.37:g.23163401G>A		103	0		98	18	NM_001172428	0	0	0	1	1	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Silent	SNP	ENST00000339077.5	37	CCDS34609.1																																																																																			G|1.000;A|0.000		0.373	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326860.3	NM_018846	
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	47897371	47897371	+	Silent	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:47897371A>G	ENST00000289672.2	-	28	4472	c.4422T>C	c.(4420-4422)caT>caC	p.H1474H		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1474	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GAAGGTTGTAATGAAGAAGGG	0.522																																					p.H1474H		.											.	PKD1L1-145	0			c.T4422C						.						66.0	66.0	66.0					7																	47897371		2203	4300	6503	SO:0001819	synonymous_variant	168507	exon28			GTTGTAATGAAGA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.4422T>C	7.37:g.47897371A>G		81	0		127	26	NM_138295	0	0	0	0	0	Q6UWK1	Silent	SNP	ENST00000289672.2	37	CCDS34633.1																																																																																			.		0.522	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
ABCA13	154664	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	48327569	48327569	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:48327569G>A	ENST00000435803.1	+	20	8873	c.8849G>A	c.(8848-8850)tGg>tAg	p.W2950*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2950					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						AACCCTTCCTGGACCAAGGAC	0.423																																					p.W2950X		.											.	ABCA13-521	0			c.G8849A						.						144.0	141.0	142.0					7																	48327569		1852	4100	5952	SO:0001587	stop_gained	154664	exon20			CTTCCTGGACCAA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.8849G>A	7.37:g.48327569G>A	ENSP00000411096:p.Trp2950*	63	1		87	25	NM_152701	0	0	0	0	0	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	37	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	50	16.402813	0.99862	.	.	ENSG00000179869	ENST00000435803	.	.	.	5.63	1.77	0.24775	.	0.833256	0.09960	N	0.733505	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	11.139	0.48392	0.0:0.0:0.4935:0.5065	.	.	.	.	X	2950	.	ENSP00000411096:W2950X	W	+	2	0	ABCA13	48298115	0.001000	0.12720	0.000000	0.03702	0.976000	0.68499	0.681000	0.25320	0.052000	0.16007	-0.467000	0.05162	TGG	.		0.423	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
GRB10	2887	bcgsc.ca	37	7	50682537	50682537	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:50682537C>T	ENST00000401949.1	-	12	1494	c.1025G>A	c.(1024-1026)aGc>aAc	p.S342N	GRB10_ENST00000402497.1_Missense_Mutation_p.S284N|GRB10_ENST00000335866.3_Missense_Mutation_p.S284N|GRB10_ENST00000398810.2_Missense_Mutation_p.S284N|GRB10_ENST00000407526.1_Missense_Mutation_p.S284N|GRB10_ENST00000402578.1_Missense_Mutation_p.S284N|GRB10_ENST00000398812.2_Missense_Mutation_p.S342N|GRB10_ENST00000439599.1_Missense_Mutation_p.S336N|GRB10_ENST00000406641.1_Missense_Mutation_p.S284N|GRB10_ENST00000357271.5_Missense_Mutation_p.S296N|GRB10_ENST00000403097.1_Missense_Mutation_p.S336N			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	342	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					GAAGATGTTGCTGTCCTCCAG	0.572									Russell-Silver syndrome																												p.S342N		.											.	GRB10-1272	0			c.G1025A						.						119.0	127.0	124.0					7																	50682537		2091	4220	6311	SO:0001583	missense	2887	exon9	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	ATGTTGCTGTCCT		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.1025G>A	7.37:g.50682537C>T	ENSP00000385770:p.Ser342Asn	86	0		126	6	NM_005311	0	0	0	0	0	A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Missense_Mutation	SNP	ENST00000401949.1	37	CCDS43582.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936288	0.73442	.	.	ENSG00000106070	ENST00000398812;ENST00000439599;ENST00000335866;ENST00000398810;ENST00000402578;ENST00000403097;ENST00000406641;ENST00000357271;ENST00000407526;ENST00000401949;ENST00000402497	T;T;T;T;T;T;T;T;T;T;T	0.80994	-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.01;-1.44;-1.01;-1.01;-1.01	5.55	5.55	0.83447	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.034451	0.85682	D	0.000000	T	0.80989	0.4730	L	0.41079	1.255	0.80722	D	1	B;P;B	0.39094	0.125;0.659;0.077	B;P;B	0.45343	0.141;0.477;0.118	T	0.81125	-0.1075	10	0.52906	T	0.07	-27.1964	19.4964	0.95075	0.0:1.0:0.0:0.0	.	336;296;342	Q13322-4;Q13322-2;Q13322	.;.;GRB10_HUMAN	N	342;336;284;284;284;336;284;296;284;342;284	ENSP00000381793:S342N;ENSP00000406716:S336N;ENSP00000338543:S284N;ENSP00000381790:S284N;ENSP00000385189:S284N;ENSP00000385544:S336N;ENSP00000385366:S284N;ENSP00000349818:S296N;ENSP00000385046:S284N;ENSP00000385770:S342N;ENSP00000385748:S284N	ENSP00000338543:S284N	S	-	2	0	GRB10	50650031	1.000000	0.71417	0.997000	0.53966	0.957000	0.61999	6.072000	0.71238	2.610000	0.88304	0.655000	0.94253	AGC	.		0.572	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319157.1		
CROT	54677	ucsc.edu	37	7	86988623	86988623	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:86988623A>G	ENST00000331536.3	+	4	402	c.217A>G	c.(217-219)Aga>Gga	p.R73G	CROT_ENST00000412227.2_Missense_Mutation_p.R73G|CROT_ENST00000442291.1_Missense_Mutation_p.R73G|CROT_ENST00000419147.2_Missense_Mutation_p.R101G	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	73					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	ATTGCTTGAAAGAGCAAAAGG	0.254																																					p.R101G		.											.	CROT-280	0			c.A301G						.						62.0	71.0	68.0					7																	86988623		2203	4289	6492	SO:0001583	missense	54677	exon5			CTTGAAAGAGCAA		CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.217A>G	7.37:g.86988623A>G	ENSP00000331981:p.Arg73Gly	63	0		40	4	NM_001143935	0	0	8	8	0	A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	ENST00000331536.3	37	CCDS5604.1	.	.	.	.	.	.	.	.	.	.	A	19.91	3.915188	0.73098	.	.	ENSG00000005469	ENST00000419147;ENST00000412227;ENST00000331536;ENST00000442291	D;D;D;D	0.90324	-2.65;-2.65;-2.65;-2.65	5.78	3.24	0.37175	.	0.043063	0.85682	D	0.000000	D	0.96071	0.8720	M	0.93594	3.435	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.83275	0.995;0.996;0.978	D	0.96446	0.9330	10	0.72032	D	0.01	-14.6095	12.6576	0.56795	0.7399:0.2601:0.0:0.0	.	101;73;73	E7EQF2;Q9UKG9;Q86V17	.;OCTC_HUMAN;.	G	101;73;73;73	ENSP00000413575:R101G;ENSP00000404867:R73G;ENSP00000331981:R73G;ENSP00000411983:R73G	ENSP00000331981:R73G	R	+	1	2	CROT	86826559	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	5.407000	0.66363	1.106000	0.41623	0.482000	0.46254	AGA	.		0.254	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1	NM_021151	
AKAP9	10142	broad.mit.edu	37	7	91667778	91667778	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:91667778T>C	ENST00000359028.2	+	18	4645	c.4420T>C	c.(4420-4422)Tct>Cct	p.S1474P	AKAP9_ENST00000356239.3_Missense_Mutation_p.S1462P|AKAP9_ENST00000358100.2_Missense_Mutation_p.S1474P			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1474					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AACTGAACTGTCTAGAATATC	0.318			T	BRAF	papillary thyroid																																p.S1462P		.		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	.	AKAP9-755	0			c.T4384C						.						57.0	57.0	57.0					7																	91667778		2203	4300	6503	SO:0001583	missense	10142	exon17			GAACTGTCTAGAA	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.4420T>C	7.37:g.91667778T>C	ENSP00000351922:p.Ser1474Pro	130	0		95	3	NM_005751	0	0	1	1	0	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	ENST00000359028.2	37		.	.	.	.	.	.	.	.	.	.	T	10.36	1.328281	0.24080	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394565	T;T;T	0.03635	3.87;3.87;3.86	5.13	2.54	0.30619	.	0.198599	0.25332	N	0.031439	T	0.07728	0.0194	L	0.60455	1.87	0.20196	N	0.999924	P;P;P;P	0.46220	0.61;0.874;0.852;0.852	B;B;B;P	0.50896	0.193;0.369;0.354;0.653	T	0.08638	-1.0712	10	0.66056	D	0.02	.	7.2638	0.26217	0.1186:0.0:0.233:0.6484	.	1474;1462;1462;1474	Q99996;Q99996-2;Q99996-3;A4D1E4	AKAP9_HUMAN;.;.;.	P	1462;1474;1474;1474;1474	ENSP00000348573:S1462P;ENSP00000351922:S1474P;ENSP00000350813:S1474P	ENSP00000348573:S1462P	S	+	1	0	AKAP9	91505714	0.962000	0.33011	0.459000	0.27081	0.936000	0.57629	1.521000	0.35910	0.876000	0.35872	0.477000	0.44152	TCT	.		0.318	AKAP9-202	KNOWN	basic	protein_coding	protein_coding		NM_005751	
AASS	10157	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	121769438	121769438	+	Silent	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:121769438A>G	ENST00000393376.1	-	2	459	c.364T>C	c.(364-366)Ttg>Ctg	p.L122L	AASS_ENST00000417368.2_Silent_p.L122L|AASS_ENST00000473553.1_Intron			Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase	122	Lysine-ketoglutarate reductase.				cellular nitrogen compound metabolic process (GO:0034641)|L-lysine catabolic process to acetyl-CoA via saccharopine (GO:0033512)|lysine catabolic process (GO:0006554)|protein tetramerization (GO:0051262)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity (GO:0047131)|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity (GO:0047130)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(6)|large_intestine(12)|lung(27)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	54						TCATCCAACAAGCCCATATTG	0.303																																					p.L122L		.											.	AASS-92	0			c.T364C						.						58.0	57.0	57.0					7																	121769438		2202	4300	6502	SO:0001819	synonymous_variant	10157	exon3			CCAACAAGCCCAT	AF229180	CCDS5783.1	7q31.3	2010-12-14			ENSG00000008311	ENSG00000008311			17366	protein-coding gene	gene with protein product		605113				10775527	Standard	NM_005763		Approved	LORSDH, LKRSDH	uc003vkb.3	Q9UDR5	OTTHUMG00000157058	ENST00000393376.1:c.364T>C	7.37:g.121769438A>G		34	0		24	8	NM_005763	0	0	0	0	0	O95462	Silent	SNP	ENST00000393376.1	37	CCDS5783.1																																																																																			.		0.303	AASS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347300.1	NM_005763	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	2	0		33	7	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
ATP6V0E2	155066	hgsc.bcm.edu	37	7	149571095	149571095	+	5'UTR	SNP	G	G	A	rs79377053	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr7:149571095G>A	ENST00000464662.1	+	0	14				ATP6V0E2_ENST00000606024.1_5'UTR|ATP6V0E2_ENST00000479613.1_5'UTR|ATP6V0E2-AS1_ENST00000488315.1_RNA|ATP6V0E2-AS1_ENST00000461019.1_RNA|ATP6V0E2_ENST00000456496.2_Missense_Mutation_p.A30T|ATP6V0E2-AS1_ENST00000464939.1_RNA|ATP6V0E2_ENST00000425642.2_5'Flank|ATP6V0E2_ENST00000421974.2_Missense_Mutation_p.A30T			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2						ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			CTGGGGACCCGCGCACCTGCA	0.716													G|||	682	0.136182	0.3994	0.049	5008	,	,		12396	0.0526		0.0368	False		,,,				2504	0.0307				p.A30T		.											.	.	0			c.G88A						.	G	THR/ALA,THR/ALA	991,2511		116,759,876	4.0	6.0	5.0		88,88	1.7	0.0	7	dbSNP_132	5	266,6746		7,252,3247	no	missense,missense	ATP6V0E2	NM_001100592.1,NM_145230.2	58,58	123,1011,4123	AA,AG,GG		3.7935,28.2981,11.9555	probably-damaging,probably-damaging	30/214,30/131	149571095	1257,9257	1751	3506	5257	SO:0001623	5_prime_UTR_variant	155066	exon1			GGACCCGCGCACC	AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094	ENST00000464662.1:c.-60G>A	7.37:g.149571095G>A		2	0		23	10	NM_001100592	0	0	3	6	3	A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Missense_Mutation	SNP	ENST00000464662.1	37		283	0.1295787545787546	188	0.3821138211382114	21	0.058011049723756904	42	0.07342657342657342	32	0.04221635883905013	G	14.56	2.570645	0.45798	0.282981	0.037935	ENSG00000171130	ENST00000421974;ENST00000456496	.	.	.	2.57	1.67	0.24075	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.43550	P	0.004141999999999979	P	0.40638	0.725	B	0.27608	0.081	T	0.43988	-0.9357	7	0.87932	D	0	.	7.3999	0.26958	0.0:0.2709:0.7291:0.0	.	30	E9PAS2	.	T	30	.	ENSP00000411672:A30T	A	+	1	0	ATP6V0E2	149202028	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.103000	0.15292	0.651000	0.30788	0.563000	0.77884	GCG	G|0.870;A|0.130		0.716	ATP6V0E2-007	KNOWN	alternative_3_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000350177.2	NM_145230	
CSMD1	64478	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	2857496	2857496	+	Silent	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:2857496T>C	ENST00000520002.1	-	54	8745	c.8190A>G	c.(8188-8190)caA>caG	p.Q2730Q	CSMD1_ENST00000602557.1_Silent_p.Q2730Q|CSMD1_ENST00000400186.3_Silent_p.Q2672Q|CSMD1_ENST00000542608.1_Silent_p.Q2671Q|CSMD1_ENST00000537824.1_Silent_p.Q2729Q|CSMD1_ENST00000602723.1_Silent_p.Q2672Q			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2730	Sushi 18. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AGACAGGCGTTTGTCCAGACC	0.473																																					p.Q2729Q		.											.	CSMD1-86	0			c.A8187G						.						176.0	173.0	174.0					8																	2857496		1976	4160	6136	SO:0001819	synonymous_variant	64478	exon53			AGGCGTTTGTCCA			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.8190A>G	8.37:g.2857496T>C		137	0		129	21	NM_033225	0	0	0	0	0	Q0H0J5|Q96QU9|Q96RM4	Silent	SNP	ENST00000520002.1	37		.	.	.	.	.	.	.	.	.	.	T	2.119	-0.401803	0.04865	.	.	ENSG00000183117	ENST00000335551	.	.	.	6.07	-4.41	0.03590	.	.	.	.	.	T	0.51126	0.1656	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50363	-0.8837	4	.	.	.	.	8.5356	0.33362	0.0:0.1951:0.2018:0.6032	.	.	.	.	D	2147	.	.	N	-	1	0	CSMD1	2844903	1.000000	0.71417	0.137000	0.22149	0.220000	0.24768	0.610000	0.24253	-0.842000	0.04195	-0.290000	0.09829	AAC	.		0.473	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ANGPT2	285	broad.mit.edu	37	8	6378801	6378801	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:6378801T>C	ENST00000325203.5	-	4	1171	c.697A>G	c.(697-699)Aaa>Gaa	p.K233E	MCPH1_ENST00000344683.5_Intron|ANGPT2_ENST00000415216.1_Missense_Mutation_p.K233E|ANGPT2_ENST00000338312.6_Missense_Mutation_p.K181E|ANGPT2_ENST00000523120.1_Missense_Mutation_p.K233E			O15123	ANGP2_HUMAN	angiopoietin 2	233					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to growth factor stimulus (GO:0071363)|germ cell development (GO:0007281)|glomerulus vasculature development (GO:0072012)|leukocyte migration (GO:0050900)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of positive chemotaxis (GO:0050928)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|Tie signaling pathway (GO:0048014)	cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		GTCACTATTTTTTTTTCTAGT	0.363																																					p.K233E		.											.	ANGPT2-91	0			c.A697G						.						169.0	160.0	163.0					8																	6378801		2203	4300	6503	SO:0001583	missense	285	exon4			CTATTTTTTTTTC	AF004327	CCDS5958.1, CCDS47761.1	8p23	2013-02-06			ENSG00000091879	ENSG00000091879		"""Fibrinogen C domain containing"""	485	protein-coding gene	gene with protein product		601922				9545648	Standard	NM_001147		Approved	Ang2	uc003wqj.4	O15123	OTTHUMG00000090365	ENST00000325203.5:c.697A>G	8.37:g.6378801T>C	ENSP00000314897:p.Lys233Glu	107	0		129	4	NM_001118887	0	0	3	3	0	A0AV38|A8K205|B7ZLM7|Q9NRR7|Q9P2Y7	Missense_Mutation	SNP	ENST00000325203.5	37	CCDS5958.1	.	.	.	.	.	.	.	.	.	.	T	11.49	1.654010	0.29425	.	.	ENSG00000091879	ENST00000325203;ENST00000415216;ENST00000338312;ENST00000523120	T;T;T;T	0.53640	0.63;0.64;0.61;1.34	5.91	4.05	0.47172	.	0.110549	0.64402	D	0.000006	T	0.27169	0.0666	N	0.11427	0.14	0.31498	N	0.66518	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.003;0.002;0.001;0.001	T	0.17137	-1.0379	10	0.15499	T	0.54	.	12.965	0.58480	0.0:0.0:0.6829:0.3171	.	181;233;233;233	O15123-2;E7EVQ3;O15123-3;O15123	.;.;.;ANGP2_HUMAN	E	233;233;181;233	ENSP00000314897:K233E;ENSP00000400782:K233E;ENSP00000343517:K181E;ENSP00000428023:K233E	ENSP00000314897:K233E	K	-	1	0	ANGPT2	6366209	1.000000	0.71417	0.010000	0.14722	0.577000	0.36160	4.956000	0.63645	0.765000	0.33221	-0.213000	0.12676	AAA	.		0.363	ANGPT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206737.1	NM_001147	
GOT1L1	137362	broad.mit.edu	37	8	37794838	37794838	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:37794838T>C	ENST00000307599.4	-	4	575	c.476A>G	c.(475-477)aAg>aGg	p.K159R	GOT1L1_ENST00000518826.1_5'Flank	NM_152413.2	NP_689626.2	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	159					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)	cytoplasm (GO:0005737)	pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(3)|lung(8)|ovary(1)|prostate(1)	14	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			GCATAGCTTCTTGGGGTCCCA	0.532																																					p.K159R		.											.	GOT1L1-23	0			c.A476G						.						50.0	49.0	49.0					8																	37794838		1889	4111	6000	SO:0001583	missense	137362	exon4			AGCTTCTTGGGGT	BC029504	CCDS47839.1	8p12	2005-09-22			ENSG00000169154	ENSG00000169154			28487	protein-coding gene	gene with protein product						12477932	Standard	NM_152413		Approved	MGC33309	uc011lbj.1	Q8NHS2	OTTHUMG00000164027	ENST00000307599.4:c.476A>G	8.37:g.37794838T>C	ENSP00000303077:p.Lys159Arg	73	0		123	4	NM_152413	0	0	0	0	0	A8MWL4	Missense_Mutation	SNP	ENST00000307599.4	37	CCDS47839.1	.	.	.	.	.	.	.	.	.	.	T	14.18	2.457696	0.43634	.	.	ENSG00000169154	ENST00000307599	D	0.91295	-2.82	5.04	-0.104	0.13605	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	2.762270	0.01167	N	0.006786	D	0.86830	0.6027	L	0.45581	1.43	0.09310	N	1	P	0.34864	0.473	B	0.34991	0.193	T	0.72443	-0.4292	10	0.45353	T	0.12	1.3966	4.5003	0.11860	0.0:0.1858:0.3536:0.4606	.	159	Q8NHS2	AATC2_HUMAN	R	159	ENSP00000303077:K159R	ENSP00000303077:K159R	K	-	2	0	GOT1L1	37913995	0.000000	0.05858	0.000000	0.03702	0.684000	0.39900	-0.220000	0.09215	-0.244000	0.09639	0.449000	0.29647	AAG	.		0.532	GOT1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376823.1	NM_152413	
LSM1	27257	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	38021296	38021298	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	TTC	TTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:38021296_38021298delTTC	ENST00000311351.4	-	4	687_689	c.292_294delGAA	c.(292-294)gaadel	p.E98del	LSM1_ENST00000520755.1_3'UTR|RP11-90P5.7_ENST00000521915.1_RNA|LSM1_ENST00000522515.1_5'UTR|RP11-90P5.2_ENST00000520598.1_RNA	NM_014462.2	NP_055277.1	O15116	LSM1_HUMAN	LSM1, U6 small nuclear RNA associated	98					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(3)|lung(2)	7	Colorectal(12;0.000442)					CCACCCTTTGTTCTTCTAGAATT	0.468																																					p.98_98del		.											.	LSM1-90	0			c.292_294del						.																																			SO:0001651	inframe_deletion	27257	exon4			CCTTTGTTCTTCT	AF000177	CCDS6103.1	8p11.2	2014-02-14	2014-02-14		ENSG00000175324	ENSG00000175324			20472	protein-coding gene	gene with protein product		607281	"""LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae)"""			12515382, 11953827	Standard	NM_014462		Approved	CASM, YJL124C	uc003xkw.3	O15116	OTTHUMG00000164051	ENST00000311351.4:c.292_294delGAA	8.37:g.38021299_38021301delTTC	ENSP00000310596:p.Glu98del	74	0		112	26	NM_014462	0	0	0	0	0	B2R5E6	In_Frame_Del	DEL	ENST00000311351.4	37	CCDS6103.1																																																																																			.		0.468	LSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376965.1	NM_014462	
SLCO5A1	81796	ucsc.edu	37	8	70617290	70617290	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:70617290C>T	ENST00000260126.4	-	6	2304	c.1598G>A	c.(1597-1599)gGc>gAc	p.G533D	SLCO5A1_ENST00000530307.1_Missense_Mutation_p.G478D|SLCO5A1_ENST00000524945.1_Missense_Mutation_p.G533D	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	533						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			GATGTTTATGCCCCCTAGATT	0.443																																					p.G533D		.											.	SLCO5A1-94	0			c.G1598A						.						129.0	119.0	122.0					8																	70617290		2203	4300	6503	SO:0001583	missense	81796	exon5			TTTATGCCCCCTA	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1598G>A	8.37:g.70617290C>T	ENSP00000260126:p.Gly533Asp	20	0		24	4	NM_001146008	0	0	0	0	0	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	37	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	C	33	5.197752	0.94997	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.51574	0.7;0.7;0.7	5.55	5.55	0.83447	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.104990	0.64402	D	0.000004	T	0.75649	0.3878	M	0.89030	3	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.79704	-0.1692	10	0.87932	D	0	.	19.8764	0.96873	0.0:1.0:0.0:0.0	.	478;478;533;533	B4DR09;E9PKK5;Q9H2Y9;G3V1C0	.;.;SO5A1_HUMAN;.	D	533;533;478	ENSP00000260126:G533D;ENSP00000434422:G533D;ENSP00000431611:G478D	ENSP00000260126:G533D	G	-	2	0	SLCO5A1	70779844	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.768000	0.95171	0.655000	0.94253	GGC	.		0.443	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
ANGPT1	284	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	108334173	108334173	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:108334173C>T	ENST00000520734.1	-	3	444	c.159G>A	c.(157-159)gaG>gaA	p.E53E	ANGPT1_ENST00000518386.1_5'UTR|ANGPT1_ENST00000520052.1_Silent_p.E53E			Q15389	ANGP1_HUMAN	angiopoietin 1	253					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TGTCCATCAGCTCCAGTTGCT	0.398																																					p.E253E		.											.	ANGPT1-521	0			c.G759A						.						189.0	174.0	179.0					8																	108334173		2203	4300	6503	SO:0001819	synonymous_variant	284	exon4			CATCAGCTCCAGT	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.159G>A	8.37:g.108334173C>T		182	2		209	39	NM_001199859	0	0	1	1	0	Q5HYA0	Silent	SNP	ENST00000520734.1	37																																																																																				.		0.398	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
CSMD3	114788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	113323220	113323220	+	Silent	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:113323220G>T	ENST00000297405.5	-	50	8116	c.7872C>A	c.(7870-7872)gtC>gtA	p.V2624V	CSMD3_ENST00000455883.2_Silent_p.V2520V|CSMD3_ENST00000343508.3_Silent_p.V2584V|CSMD3_ENST00000352409.3_Silent_p.V2554V	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2624	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GACAGGCAGGGACTGGCGCAT	0.433										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.V2624V		.											.	CSMD3-1132	0			c.C7872A						.						111.0	92.0	98.0					8																	113323220		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon50			GGCAGGGACTGGC	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7872C>A	8.37:g.113323220G>T		88	0		127	30	NM_198123	0	0	0	0	0	Q96PZ3	Silent	SNP	ENST00000297405.5	37	CCDS6315.1																																																																																			.		0.433	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		2	2		18	18	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
SQLE	6713	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	126019726	126019726	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:126019726C>G	ENST00000265896.5	+	4	1717	c.819C>G	c.(817-819)atC>atG	p.I273M	SQLE_ENST00000523430.1_Missense_Mutation_p.I178M	NM_003129.3	NP_003120.2	Q14534	ERG1_HUMAN	squalene epoxidase	273					cellular aromatic compound metabolic process (GO:0006725)|cholesterol biosynthetic process (GO:0006695)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|squalene monooxygenase activity (GO:0004506)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)	14	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		Butenafine(DB01091)|Naftifine(DB00735)|Terbinafine(DB00857)	CTGGAGATATCAAGGTGAGAA	0.368																																					p.I273M		.											.	SQLE-523	0			c.C819G						.						113.0	108.0	109.0					8																	126019726		1864	4080	5944	SO:0001583	missense	6713	exon4			AGATATCAAGGTG	D78130	CCDS47918.1	8q24.1	2014-06-23			ENSG00000104549	ENSG00000104549	1.14.13.132		11279	protein-coding gene	gene with protein product	"""squalene monooxygenase"""	602019				9286711	Standard	NM_003129		Approved		uc011liq.2	Q14534	OTTHUMG00000164990	ENST00000265896.5:c.819C>G	8.37:g.126019726C>G	ENSP00000265896:p.Ile273Met	87	0		120	28	NM_003129	0	0	0	0	0	Q9UEK6	Missense_Mutation	SNP	ENST00000265896.5	37	CCDS47918.1	.	.	.	.	.	.	.	.	.	.	C	4.374	0.068901	0.08436	.	.	ENSG00000104549	ENST00000523430;ENST00000265896;ENST00000541193	T;T	0.43688	0.94;0.94	5.12	3.32	0.38043	.	0.532681	0.21557	N	0.072627	T	0.34193	0.0889	M	0.62723	1.935	0.09310	N	1	B	0.31485	0.325	B	0.29267	0.1	T	0.32613	-0.9900	10	0.46703	T	0.11	-0.0035	3.811	0.08796	0.1618:0.5016:0.0:0.3366	.	273	Q14534	ERG1_HUMAN	M	178;273;78	ENSP00000430331:I178M;ENSP00000265896:I273M	ENSP00000265896:I273M	I	+	3	3	SQLE	126088908	0.004000	0.15560	0.713000	0.30519	0.459000	0.32528	0.042000	0.13949	0.586000	0.29626	0.281000	0.19383	ATC	.		0.368	SQLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381362.1	NM_003129	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		10	10	NM_030895	0	0	0	3	3	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	144998169	144998169	+	Silent	SNP	C	C	T	rs1140522	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:144998169C>T	ENST00000322810.4	-	31	6508	c.6339G>A	c.(6337-6339)gcG>gcA	p.A2113A	PLEC_ENST00000354589.3_Silent_p.A1976A|PLEC_ENST00000354958.2_Silent_p.A1954A|PLEC_ENST00000398774.2_Silent_p.A1944A|PLEC_ENST00000436759.2_Silent_p.A2003A|PLEC_ENST00000356346.3_Silent_p.A1962A|PLEC_ENST00000527096.1_Silent_p.A1999A|PLEC_ENST00000357649.2_Silent_p.A1980A|PLEC_ENST00000345136.3_Silent_p.A1976A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2113	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTCCTCCGCCGCCAGCTGCC	0.741													C|||	1156	0.230831	0.028	0.2968	5008	,	,		12421	0.1429		0.4274	False		,,,				2504	0.3466				p.A2113A		.											.	PLEC-141	0			c.G6339A						.	C	,,,,,,,	297,3657		19,259,1699	5.0	7.0	6.0		6009,5886,5862,6339,5832,5928,5940,5928	-8.9	0.0	8	dbSNP_86	6	2901,4993		551,1799,1597	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	570,2058,3296	TT,TC,CC		36.7494,7.5114,26.9919	,,,,,,,	2003/4575,1962/4534,1954/4526,2113/4685,1944/4516,1976/4548,1980/4552,1976/4548	144998169	3198,8650	1977	3947	5924	SO:0001819	synonymous_variant	5339	exon31			CTCCGCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6339G>A	8.37:g.144998169C>T		0	0		8	8	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.740;T|0.260		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000345136.3_Silent_p.A1969A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		0	0		19	18	NM_201380	0	0	0	4	4	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	144998369	144998369	+	Nonsense_Mutation	SNP	T	T	A	rs570260545		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:144998369T>A	ENST00000322810.4	-	31	6308	c.6139A>T	c.(6139-6141)Aag>Tag	p.K2047*	PLEC_ENST00000354589.3_Nonsense_Mutation_p.K1910*|PLEC_ENST00000354958.2_Nonsense_Mutation_p.K1888*|PLEC_ENST00000398774.2_Nonsense_Mutation_p.K1878*|PLEC_ENST00000436759.2_Nonsense_Mutation_p.K1937*|PLEC_ENST00000356346.3_Nonsense_Mutation_p.K1896*|PLEC_ENST00000527096.1_Nonsense_Mutation_p.K1933*|PLEC_ENST00000357649.2_Nonsense_Mutation_p.K1914*|PLEC_ENST00000345136.3_Nonsense_Mutation_p.K1910*	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2047	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						ACCAGCCCCTTCTGCCGCTCC	0.706																																					p.K2047X		.											.	PLEC-141	0			c.A6139T						.						15.0	18.0	17.0					8																	144998369		2144	4219	6363	SO:0001587	stop_gained	5339	exon31			GCCCCTTCTGCCG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6139A>T	8.37:g.144998369T>A	ENSP00000323856:p.Lys2047*	29	0		110	40	NM_201380	0	0	4	4	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Nonsense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	T	47	13.703654	0.99758	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	.	.	.	4.28	4.28	0.50868	.	0.000000	0.64402	U	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2461	0.60024	0.0:0.0:0.0:1.0	.	.	.	.	X	1910;1914;1910;1878;2047;1888;1896;1937;1933	.	ENSP00000323856:K2047X	K	-	1	0	PLEC	145070357	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.861000	0.56002	1.801000	0.52704	0.448000	0.29417	AAG	.		0.706	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
MROH1	727957	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	145247210	145247210	+	Splice_Site	SNP	A	A	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:145247210A>C	ENST00000528919.1	+	9	976		c.e9-1		MROH1_ENST00000398656.4_Splice_Site|MROH1_ENST00000423230.2_Splice_Site|MROH1_ENST00000326134.5_Splice_Site|MROH1_ENST00000534366.1_Splice_Site	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1																		TACCCGGAGCAGAGCCTGGGC	0.632																																					.		.											.	.	0			c.856-2A>C						.						20.0	25.0	23.0					8																	145247210		2047	4195	6242	SO:0001630	splice_region_variant	727957	exon9			CGGAGCAGAGCCT		CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.856-1A>C	8.37:g.145247210A>C		48	0		46	14	NM_001099281	0	0	0	0	0	C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Splice_Site	SNP	ENST00000528919.1	37	CCDS47938.1	.	.	.	.	.	.	.	.	.	.	A	17.97	3.517509	0.64634	.	.	ENSG00000179832	ENST00000423230;ENST00000398656;ENST00000534366;ENST00000528919;ENST00000326134;ENST00000356585	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1124	0.59281	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HEATR7A	145319198	1.000000	0.71417	0.993000	0.49108	0.650000	0.38633	7.835000	0.86780	1.998000	0.58463	0.460000	0.39030	.	.		0.632	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386183.1	NM_032450	Intron
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		14	14	NM_213605	0	0	0	2	2		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
ARID3C	138715	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	34627865	34627865	+	Silent	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:34627865C>A	ENST00000378909.2	-	1	239	c.147G>T	c.(145-147)ggG>ggT	p.G49G		NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	49					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		cttcctcAGCCCCAACATTCC	0.682																																					p.G49G		.											.	ARID3C-91	0			c.G147T						.						19.0	17.0	17.0					9																	34627865		2183	4246	6429	SO:0001819	synonymous_variant	138715	exon1			CTCAGCCCCAACA		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.147G>T	9.37:g.34627865C>A		71	0		92	51	NM_001017363	0	0	0	0	0		Silent	SNP	ENST00000378909.2	37	CCDS35006.1																																																																																			.		0.682	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348265.1	XM_071061	
C9orf131	138724	broad.mit.edu	37	9	35045280	35045280	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:35045280A>G	ENST00000312292.5	+	2	2701	c.2654A>G	c.(2653-2655)cAg>cGg	p.Q885R	C9orf131_ENST00000421362.2_Missense_Mutation_p.Q837R|C9orf131_ENST00000354479.5_Missense_Mutation_p.Q812R|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	885										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CAAGGGTCTCAGAGAGGGGAG	0.572																																					p.Q885R		.											.	C9orf131-90	0			c.A2654G						.						193.0	201.0	198.0					9																	35045280		2203	4300	6503	SO:0001583	missense	138724	exon2			GGTCTCAGAGAGG	BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.2654A>G	9.37:g.35045280A>G	ENSP00000308279:p.Gln885Arg	88	0		103	4	NM_203299	0	0	0	0	0	A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	ENST00000312292.5	37	CCDS6572.2	.	.	.	.	.	.	.	.	.	.	A	15.01	2.706488	0.48412	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292;ENST00000435140	T;T;T	0.18338	2.23;2.22;2.23	4.19	1.75	0.24633	.	1.111940	0.06905	N	0.806573	T	0.19087	0.0458	M	0.68317	2.08	0.09310	N	1	B;B;B;B	0.24258	0.025;0.025;0.1;0.025	B;B;B;B	0.20767	0.031;0.031;0.031;0.031	T	0.33445	-0.9868	10	0.56958	D	0.05	0.8435	4.3512	0.11157	0.6895:0.2022:0.1082:0.0	.	360;885;812;837	B4DXT9;Q5VYM1;A6NLE6;E9PB26	.;CI131_HUMAN;.;.	R	837;812;885;360	ENSP00000393683:Q837R;ENSP00000346472:Q812R;ENSP00000308279:Q885R	ENSP00000308279:Q885R	Q	+	2	0	C9orf131	35035280	0.000000	0.05858	0.001000	0.08648	0.041000	0.13682	0.286000	0.18902	0.245000	0.21373	0.460000	0.39030	CAG	.		0.572	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052283.5	NM_203299	
TMEM2	23670	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	74347358	74347358	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:74347358T>C	ENST00000377044.4	-	7	2011	c.1472A>G	c.(1471-1473)aAt>aGt	p.N491S	TMEM2_ENST00000377066.5_Missense_Mutation_p.N428S	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	491					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GATCACAATATTCCGGGTAAG	0.443																																					p.N491S		.											.	TMEM2-92	0			c.A1472G						.						123.0	110.0	114.0					9																	74347358		2203	4300	6503	SO:0001583	missense	23670	exon7			ACAATATTCCGGG		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.1472A>G	9.37:g.74347358T>C	ENSP00000366243:p.Asn491Ser	88	0		100	28	NM_013390	0	0	8	8	0	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	37	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689163	0.88735	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	D;T	0.93133	-3.17;-1.47	5.54	5.54	0.83059	Pectin lyase fold/virulence factor (1);	0.000000	0.85682	D	0.000000	D	0.96694	0.8921	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.80764	0.966;0.994	D	0.96926	0.9677	10	0.54805	T	0.06	.	15.6891	0.77436	0.0:0.0:0.0:1.0	.	491;428	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	S	491;428	ENSP00000366243:N491S;ENSP00000366266:N428S	ENSP00000366243:N491S	N	-	2	0	TMEM2	73537178	1.000000	0.71417	0.984000	0.44739	0.987000	0.75469	8.004000	0.88535	2.116000	0.64780	0.528000	0.53228	AAT	.		0.443	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
C9orf57	138240	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	74674243	74674243	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:74674243C>T	ENST00000377024.3	-	2	166	c.71G>A	c.(70-72)aGa>aAa	p.R24K	C9orf57_ENST00000424431.2_Intron	NM_001128618.1	NP_001122090.1	Q5W0N0	CI057_HUMAN	chromosome 9 open reading frame 57	24						integral component of membrane (GO:0016021)				endometrium(1)	1						AACAATCCTTCTCATTCTGAT	0.398																																					p.R24K		.											.	.	0			c.G71A						.						117.0	97.0	103.0					9																	74674243		692	1591	2283	SO:0001583	missense	138240	exon2			ATCCTTCTCATTC	BC036255	CCDS47980.1	9q21.2	2012-03-15			ENSG00000204669	ENSG00000204669			27037	protein-coding gene	gene with protein product						12477932	Standard	NM_001128618		Approved		uc004aip.3	Q5W0N0	OTTHUMG00000020003	ENST00000377024.3:c.71G>A	9.37:g.74674243C>T	ENSP00000366223:p.Arg24Lys	82	0		91	18	NM_001128618	0	0	0	0	0	A1L456	Missense_Mutation	SNP	ENST00000377024.3	37	CCDS47980.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.956783	0.34565	.	.	ENSG00000204669	ENST00000377024	.	.	.	3.61	-0.557	0.11800	.	.	.	.	.	T	0.28234	0.0697	N	0.19112	0.55	0.36762	D	0.883326	B	0.32573	0.376	B	0.34301	0.179	T	0.16719	-1.0393	8	0.87932	D	0	.	4.3246	0.11034	0.0:0.4128:0.3678:0.2194	.	24	Q5W0N0	CI057_HUMAN	K	24	.	ENSP00000366223:R24K	R	-	2	0	C9orf57	73864063	0.501000	0.26099	0.303000	0.25071	0.039000	0.13416	-0.123000	0.10611	-0.096000	0.12329	-0.810000	0.03169	AGA	.		0.398	C9orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052631.1	NM_001128618	
KIF27	55582	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	86518378	86518378	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:86518378T>G	ENST00000297814.2	-	4	1198	c.1055A>C	c.(1054-1056)gAg>gCg	p.E352A	KIF27_ENST00000334204.2_Missense_Mutation_p.E352A|KIF27_ENST00000413982.1_Missense_Mutation_p.E352A	NM_017576.1	NP_060046.1	Q86VH2	KIF27_HUMAN	kinesin family member 27	352					ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(7)|lung(17)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	43						ACGGTCTGACTCGGGGCTGAA	0.443																																					p.E352A		.											.	KIF27-523	0			c.A1055C						.						114.0	113.0	113.0					9																	86518378		2203	4300	6503	SO:0001583	missense	55582	exon4			TCTGACTCGGGGC	AY237536	CCDS6665.1, CCDS65071.1, CCDS65072.1	9q21.32	2008-03-03			ENSG00000165115	ENSG00000165115		"""Kinesins"""	18632	protein-coding gene	gene with protein product		611253					Standard	NM_017576		Approved	DKFZp434D0917	uc004ana.4	Q86VH2	OTTHUMG00000020109	ENST00000297814.2:c.1055A>C	9.37:g.86518378T>G	ENSP00000297814:p.Glu352Ala	35	0		32	6	NM_017576	0	0	0	0	0	B2RTR8|Q5T6W0|Q86VH0|Q86VH1|Q9UF54	Missense_Mutation	SNP	ENST00000297814.2	37	CCDS6665.1	.	.	.	.	.	.	.	.	.	.	T	13.08	2.129930	0.37630	.	.	ENSG00000165115	ENST00000297814;ENST00000413982;ENST00000334204	T;T;T	0.72282	-0.64;-0.64;-0.64	5.56	5.56	0.83823	Kinesin, motor domain (1);	0.207933	0.30869	N	0.008702	T	0.54351	0.1853	N	0.24115	0.695	0.24368	N	0.994841	B;P;P	0.38922	0.053;0.629;0.651	B;B;B	0.33960	0.015;0.173;0.039	T	0.47736	-0.9094	10	0.16896	T	0.51	.	15.7317	0.77810	0.0:0.0:0.0:1.0	.	352;352;352	Q86VH2-3;Q86VH2-2;Q86VH2	.;.;KIF27_HUMAN	A	352	ENSP00000297814:E352A;ENSP00000401688:E352A;ENSP00000333928:E352A	ENSP00000297814:E352A	E	-	2	0	KIF27	85708198	0.889000	0.30405	0.948000	0.38648	0.933000	0.57130	4.089000	0.57685	2.125000	0.65367	0.533000	0.62120	GAG	.		0.443	KIF27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052861.1	NM_017576	
PTPDC1	138639	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	96859984	96859984	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:96859984C>T	ENST00000375360.3	+	7	1314	c.974C>T	c.(973-975)tCt>tTt	p.S325F	PTPDC1_ENST00000288976.3_Missense_Mutation_p.S377F	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	325					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						AAGACAATGTCTGAGATGGTC	0.488																																					p.S379F		.											.	PTPDC1-227	0			c.C1136T						.						87.0	80.0	83.0					9																	96859984		2203	4300	6503	SO:0001583	missense	138639	exon6			CAATGTCTGAGAT	BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.974C>T	9.37:g.96859984C>T	ENSP00000364509:p.Ser325Phe	124	0		132	38	NM_001253829	0	0	0	0	0	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	37	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	.	21.0	4.082710	0.76528	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.20332	2.13;2.08	5.97	5.08	0.68730	.	0.092505	0.85682	D	0.000000	T	0.48150	0.1484	M	0.78916	2.43	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.986;0.996;0.991;0.991	T	0.53114	-0.8484	10	0.72032	D	0.01	-11.9369	14.4927	0.67663	0.0:0.9299:0.0:0.0701	.	379;377;379;325	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	F	325;377	ENSP00000364509:S325F;ENSP00000288976:S377F	ENSP00000288976:S377F	S	+	2	0	PTPDC1	95899805	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	6.631000	0.74277	1.536000	0.49237	0.655000	0.94253	TCT	.		0.488	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	
DFNB31	25861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	117169063	117169063	+	Missense_Mutation	SNP	C	C	G	rs368141295		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:117169063C>G	ENST00000362057.3	-	9	1976	c.1808G>C	c.(1807-1809)gGg>gCg	p.G603A	DFNB31_ENST00000374059.3_Missense_Mutation_p.G252A|DFNB31_ENST00000265134.6_Missense_Mutation_p.G220A	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	603	Pro-rich.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GTCCTCTCTCCCCAGCTTCCT	0.662																																					p.G603A		.											.	DFNB31-95	0			c.G1808C						.						42.0	37.0	38.0					9																	117169063		2202	4297	6499	SO:0001583	missense	25861	exon9			TCTCTCCCCAGCT	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1808G>C	9.37:g.117169063C>G	ENSP00000354623:p.Gly603Ala	105	0		151	30	NM_001173425	0	0	8	10	2	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	37	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.248187	0.22880	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.08193	4.04;4.01;3.12	4.78	2.89	0.33648	.	0.434161	0.19258	N	0.118755	T	0.06645	0.0170	L	0.41824	1.3	0.38587	D	0.950328	B;B;B	0.19935	0.018;0.006;0.04	B;B;B	0.22386	0.015;0.014;0.039	T	0.21793	-1.0235	10	0.08179	T	0.78	-10.8335	8.8695	0.35307	0.3002:0.5546:0.1452:0.0	.	603;603;252	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	A	220;252;603	ENSP00000265134:G220A;ENSP00000363172:G252A;ENSP00000354623:G603A	ENSP00000265134:G220A	G	-	2	0	DFNB31	116208884	0.000000	0.05858	0.437000	0.26809	0.613000	0.37349	0.113000	0.15499	0.407000	0.25591	0.491000	0.48974	GGG	.		0.662	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
TNC	3371	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	117792645	117792645	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:117792645G>A	ENST00000350763.4	-	24	6371	c.5960C>T	c.(5959-5961)gCa>gTa	p.A1987V	TNC_ENST00000346706.3_Missense_Mutation_p.A1441V|TNC_ENST00000542877.1_Missense_Mutation_p.A1624V|TNC_ENST00000423613.2_Missense_Mutation_p.A1714V|TNC_ENST00000535648.1_Missense_Mutation_p.A1532V|TNC_ENST00000537320.1_Missense_Mutation_p.A1350V|TNC_ENST00000345230.3_Missense_Mutation_p.A1350V|TNC_ENST00000341037.4_Missense_Mutation_p.A1805V|TNC_ENST00000340094.3_Missense_Mutation_p.A1623V	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1987	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						ATTCAGCATTGCTTGGGAGCA	0.512																																					p.A1987V		.											.	TNC-517	0			c.C5960T						.						122.0	101.0	108.0					9																	117792645		2203	4300	6503	SO:0001583	missense	3371	exon24			AGCATTGCTTGGG		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5960C>T	9.37:g.117792645G>A	ENSP00000265131:p.Ala1987Val	113	0		169	46	NM_002160	0	0	1	1	0	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	ENST00000350763.4	37	CCDS6811.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566476	0.86439	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17;2.17;2.17;2.17;2.17	5.35	5.35	0.76521	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.343864	0.34853	N	0.003631	T	0.11067	0.0270	N	0.02225	-0.63	0.25597	N	0.98663	P;B	0.41597	0.756;0.349	B;B	0.42882	0.401;0.17	T	0.27640	-1.0068	10	0.07482	T	0.82	.	19.4228	0.94729	0.0:0.0:1.0:0.0	.	1714;1987	E9PC84;P24821	.;TENA_HUMAN	V	1623;1532;1441;1350;1987;1805;1714;1350;1624	ENSP00000344400:A1623V;ENSP00000438152:A1532V;ENSP00000344555:A1441V;ENSP00000345861:A1350V;ENSP00000265131:A1987V;ENSP00000339553:A1805V;ENSP00000411406:A1714V;ENSP00000443478:A1350V;ENSP00000442242:A1624V	ENSP00000344400:A1623V	A	-	2	0	TNC	116832466	1.000000	0.71417	0.973000	0.42090	0.995000	0.86356	6.155000	0.71833	2.663000	0.90544	0.655000	0.94253	GCA	.		0.512	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055418.2	NM_002160	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000373225.3_5'Flank	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	0	0		8	8	NM_004957	0	0	0	2	2	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
GLE1	2733	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131271255	131271255	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:131271255C>G	ENST00000309971.4	+	2	306	c.200C>G	c.(199-201)tCt>tGt	p.S67C	GLE1_ENST00000372770.4_Missense_Mutation_p.S67C|GLE1_ENST00000539582.1_5'UTR	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	67					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						CAACCTCTGTCTGAGACTTCG	0.498																																					p.S67C		.											.	GLE1-22	0			c.C200G						.						209.0	172.0	184.0					9																	131271255		2203	4300	6503	SO:0001583	missense	2733	exon2			CTCTGTCTGAGAC	AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.200C>G	9.37:g.131271255C>G	ENSP00000308622:p.Ser67Cys	215	1		331	58	NM_001499	1	0	8	9	0	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Missense_Mutation	SNP	ENST00000309971.4	37	CCDS35154.1	.	.	.	.	.	.	.	.	.	.	C	17.97	3.517627	0.64634	.	.	ENSG00000119392	ENST00000309971;ENST00000372770	T;T	0.66638	-0.22;0.19	5.48	4.58	0.56647	.	0.418418	0.27682	N	0.018297	T	0.73528	0.3598	M	0.66939	2.045	0.80722	D	1	P;D	0.59357	0.89;0.985	B;P	0.55161	0.41;0.77	T	0.75091	-0.3440	10	0.54805	T	0.06	-3.4603	11.0773	0.48038	0.0:0.9139:0.0:0.0861	.	67;67	Q53GS7;Q53GS7-2	GLE1_HUMAN;.	C	67	ENSP00000308622:S67C;ENSP00000361856:S67C	ENSP00000308622:S67C	S	+	2	0	GLE1	130311076	0.451000	0.25705	0.165000	0.22776	0.011000	0.07611	2.982000	0.49337	1.318000	0.45170	0.462000	0.41574	TCT	.		0.498	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054456.1	NM_001003722	
GLE1	2733	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	131271329	131271329	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr9:131271329A>G	ENST00000309971.4	+	2	380	c.274A>G	c.(274-276)Agc>Ggc	p.S92G	GLE1_ENST00000372770.4_Missense_Mutation_p.S92G|GLE1_ENST00000539582.1_5'UTR	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	92					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						TCCTGACGCAAGCTCTGCCTT	0.493																																					p.S92G		.											.	GLE1-22	0			c.A274G						.						180.0	147.0	158.0					9																	131271329		2203	4300	6503	SO:0001583	missense	2733	exon2			GACGCAAGCTCTG	AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.274A>G	9.37:g.131271329A>G	ENSP00000308622:p.Ser92Gly	202	0		335	53	NM_001499	0	0	7	7	0	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Missense_Mutation	SNP	ENST00000309971.4	37	CCDS35154.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.504613	0.26949	.	.	ENSG00000119392	ENST00000309971;ENST00000372770	T;T	0.65732	-0.17;0.25	5.29	0.153	0.14897	.	1.531570	0.03022	N	0.150864	T	0.53546	0.1803	L	0.47716	1.5	0.18873	N	0.999988	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	T	0.19484	-1.0304	10	0.29301	T	0.29	-0.6179	5.6917	0.17833	0.3756:0.4342:0.1902:0.0	.	92;92	Q53GS7;Q53GS7-2	GLE1_HUMAN;.	G	92	ENSP00000308622:S92G;ENSP00000361856:S92G	ENSP00000308622:S92G	S	+	1	0	GLE1	130311150	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.036000	0.12185	0.027000	0.15297	-0.648000	0.03929	AGC	.		0.493	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054456.1	NM_001003722	
SAT1	6303	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	23803871	23803873	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	CTT	CTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:23803871_23803873delCTT	ENST00000379270.4	+	6	593_595	c.414_416delCTT	c.(412-417)aacttc>aac	p.F139del	SAT1_ENST00000379254.1_In_Frame_Del_p.F111del|SAT1_ENST00000489394.1_3'UTR|RP13-314C10.5_ENST00000366134.2_RNA	NM_002970.2	NP_002961.1	Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1	0					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			breast(1)|endometrium(3)|kidney(3)|lung(3)	10						CATCCATCAACTTCTATAAAAGA	0.443																																					p.138_139del		.											.	SAT1-554	0			c.414_416del						.																																			SO:0001651	inframe_deletion	6303	exon6			CATCAACTTCTAT	M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379270.4:c.414_416delCTT	X.37:g.23803871_23803873delCTT	ENSP00000368572:p.Phe139del	254	0		220	55	NM_002970	0	0	0	0	0	A8K9N2|Q7Z5R3|Q96BK0	In_Frame_Del	DEL	ENST00000379270.4	37	CCDS14207.1																																																																																			.		0.443	SAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056056.1	NM_002970	
PCYT1B	9468	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	24593415	24593415	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:24593415C>G	ENST00000379144.2	-	7	859	c.729G>C	c.(727-729)caG>caC	p.Q243H	PCYT1B_ENST00000356768.4_Missense_Mutation_p.Q243H|PCYT1B_ENST00000379145.1_Missense_Mutation_p.Q225H	NM_004845.4	NP_004836.2	Q9Y5K3	PCY1B_HUMAN	phosphate cytidylyltransferase 1, choline, beta	243					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|ovarian follicle development (GO:0001541)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)	choline-phosphate cytidylyltransferase activity (GO:0004105)			breast(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	17					Choline(DB00122)	CCACTTGGTTCTGGAAACGGT	0.363																																					p.Q243H		.											.	PCYT1B-130	0			c.G729C						.						137.0	113.0	121.0					X																	24593415		2203	4300	6503	SO:0001583	missense	9468	exon7			TTGGTTCTGGAAA	AF052510	CCDS14213.1, CCDS55391.1, CCDS55392.1	Xp22	2008-02-05	2005-09-05		ENSG00000102230	ENSG00000102230	2.7.7.15		8755	protein-coding gene	gene with protein product		604926	"""phosphate cytidylyltransferase 1, choline, beta isoform"""			9593753	Standard	NM_004845		Approved	CCT-beta, CTB	uc004dbi.3	Q9Y5K3	OTTHUMG00000021270	ENST00000379144.2:c.729G>C	X.37:g.24593415C>G	ENSP00000368439:p.Gln243His	103	0		97	22	NM_004845	0	0	0	0	0	A8IX00|B2RCX8|B4DK10|E9PD84|O60621|Q86XC9	Missense_Mutation	SNP	ENST00000379144.2	37	CCDS14213.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.134903	0.37728	.	.	ENSG00000102230	ENST00000379145;ENST00000379144;ENST00000356768	.	.	.	4.56	3.6	0.41247	.	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	M	0.79614	2.46	0.80722	D	1	P;P;P	0.42785	0.525;0.79;0.79	B;B;B	0.42245	0.381;0.179;0.179	T	0.58736	-0.7584	9	0.87932	D	0	-21.0804	5.4981	0.16813	0.0:0.5157:0.0:0.4843	.	243;225;243	Q9Y5K3-2;E9PD84;Q9Y5K3	.;.;PCY1B_HUMAN	H	225;243;243	.	ENSP00000349211:Q243H	Q	-	3	2	PCYT1B	24503336	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.040000	0.49799	0.774000	0.33427	0.513000	0.50165	CAG	.		0.363	PCYT1B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056103.1	NM_004845	
MAGEB6	158809	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	X	26212978	26212978	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:26212978G>C	ENST00000379034.1	+	2	1164	c.1015G>C	c.(1015-1017)Gat>Cat	p.D339H		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	339	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						TTTGGTGCAAGATAAGTACGT	0.498																																					p.D339H		.											.	MAGEB6-133	0			c.G1015C						.						121.0	118.0	119.0					X																	26212978		2201	4281	6482	SO:0001583	missense	158809	exon2			GTGCAAGATAAGT	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.1015G>C	X.37:g.26212978G>C	ENSP00000368320:p.Asp339His	367	0		456	102	NM_173523	0	0	0	0	0	Q6GS19|Q9H219	Missense_Mutation	SNP	ENST00000379034.1	37	CCDS14217.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625774	0.28889	.	.	ENSG00000176746	ENST00000379034	T	0.04758	3.56	3.29	-4.83	0.03161	.	0.283163	0.34002	U	0.004349	T	0.07143	0.0181	N	0.19112	0.55	0.09310	N	1	D	0.62365	0.991	D	0.65443	0.935	T	0.05022	-1.0911	10	0.66056	D	0.02	.	11.0202	0.47713	0.0962:0.6822:0.2216:0.0	.	339	Q8N7X4	MAGB6_HUMAN	H	339	ENSP00000368320:D339H	ENSP00000368320:D339H	D	+	1	0	MAGEB6	26122899	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.767000	0.04720	-1.427000	0.01992	-0.237000	0.12165	GAT	.		0.498	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056123.1	NM_173523	
GPR82	27197	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	41587121	41587121	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:41587121G>T	ENST00000302548.4	+	3	1082	c.842G>T	c.(841-843)tGt>tTt	p.C281F	CASK_ENST00000378154.1_Intron|CASK_ENST00000361962.4_Intron|CASK_ENST00000378166.4_Intron|CASK_ENST00000442742.2_Intron|CASK_ENST00000318588.9_Intron|CASK_ENST00000421587.2_Intron|CASK_ENST00000378158.1_Intron|CASK_ENST00000378163.1_Intron	NM_080817.4	NP_543007.1	Q96P67	GPR82_HUMAN	G protein-coupled receptor 82	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	10						AGAGATAACTGTCAGCAATTG	0.313																																					p.C281F		.											.	GPR82-110	0			c.G842T						.						52.0	51.0	51.0					X																	41587121		2203	4294	6497	SO:0001583	missense	27197	exon3			ATAACTGTCAGCA	AF411111	CCDS14259.1	Xp11.4	2012-08-21			ENSG00000171657	ENSG00000171657		"""GPCR / Class A : Orphans"""	4533	protein-coding gene	gene with protein product		300748				11574155	Standard	NM_080817		Approved		uc004dft.3	Q96P67	OTTHUMG00000021373	ENST00000302548.4:c.842G>T	X.37:g.41587121G>T	ENSP00000303549:p.Cys281Phe	164	0		164	31	NM_080817	0	0	0	0	0	Q5VT13	Missense_Mutation	SNP	ENST00000302548.4	37	CCDS14259.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.609248	0.46527	.	.	ENSG00000171657	ENST00000302548	T	0.38077	1.16	5.29	5.29	0.74685	GPCR, rhodopsin-like superfamily (1);	0.075071	0.51477	D	0.000087	T	0.50120	0.1597	L	0.36672	1.1	0.37324	D	0.909691	D	0.63046	0.992	D	0.66847	0.947	T	0.57195	-0.7853	10	0.62326	D	0.03	-9.6693	16.6629	0.85245	0.0:0.0:1.0:0.0	.	281	Q96P67	GPR82_HUMAN	F	281	ENSP00000303549:C281F	ENSP00000303549:C281F	C	+	2	0	GPR82	41472065	1.000000	0.71417	0.522000	0.27862	0.783000	0.44284	6.481000	0.73608	2.330000	0.79161	0.594000	0.82650	TGT	.		0.313	GPR82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056261.1	NM_080817	
DGKK	139189	broad.mit.edu	37	X	50213274	50213274	+	RNA	SNP	G	G	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:50213274G>A	ENST00000376025.2	-	0	463							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					ggccggctctgggaccgactc	0.672																																					.		.											.	DGKK-227	0			.						.						36.0	42.0	40.0					X																	50213274		1858	4078	5936			139189	.			GGCTCTGGGACCG	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50213274G>A		19	0		15	4	.	0	0	0	0	0	B2RP91	RNA	SNP	ENST00000376025.2	37																																																																																				.		0.672	DGKK-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000368187.1	NM_001013742	
SMC1A	8243	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	53410124	53410124	+	Silent	SNP	C	C	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:53410124C>T	ENST00000322213.4	-	20	3151	c.3024G>A	c.(3022-3024)caG>caA	p.Q1008Q	SMC1A_ENST00000469129.1_5'Flank	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	1008					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						CATTCAGCTTCTGCTGCAGTG	0.557																																					p.Q1008Q		.											.	SMC1A-232	0			c.G3024A						.						102.0	69.0	80.0					X																	53410124		2202	4298	6500	SO:0001819	synonymous_variant	8243	exon20			CAGCTTCTGCTGC	S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.3024G>A	X.37:g.53410124C>T		95	0		113	33	NM_006306	0	0	6	7	1	O14995|Q16351|Q2M228	Silent	SNP	ENST00000322213.4	37	CCDS14352.1																																																																																			.		0.557	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056756.2	NM_006306	
HUWE1	10075	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	53591626	53591626	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:53591626A>C	ENST00000342160.3	-	50	7395	c.6938T>G	c.(6937-6939)gTg>gGg	p.V2313G	HUWE1_ENST00000262854.6_Missense_Mutation_p.V2313G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2313	Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CCCATCTGCCACCTCTGTCTG	0.527																																					p.V2313G		.											.	HUWE1-280	0			c.T6938G						.						193.0	123.0	146.0					X																	53591626		2203	4300	6503	SO:0001583	missense	10075	exon51			TCTGCCACCTCTG	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6938T>G	X.37:g.53591626A>C	ENSP00000340648:p.Val2313Gly	132	2		128	21	NM_031407	0	0	0	0	0	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	37	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	A	8.250	0.808736	0.16467	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.36878	1.23;1.23	5.44	5.44	0.79542	.	0.000000	0.47852	D	0.000209	T	0.22166	0.0534	N	0.14661	0.345	0.51767	D	0.999937	B;B	0.09022	0.001;0.002	B;B	0.04013	0.0;0.001	T	0.06789	-1.0807	10	0.23891	T	0.37	.	12.321	0.54985	1.0:0.0:0.0:0.0	.	2313;2313	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	G	2313	ENSP00000340648:V2313G;ENSP00000262854:V2313G	ENSP00000262854:V2313G	V	-	2	0	HUWE1	53608351	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.905000	0.56333	1.813000	0.52934	0.417000	0.27973	GTG	.		0.527	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
SATL1	340562	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	84362926	84362926	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:84362926C>A	ENST00000395409.3	-	1	1048	c.488G>T	c.(487-489)gGt>gTt	p.G163V	SATL1_ENST00000332921.5_Missense_Mutation_p.G163V|SATL1_ENST00000509231.1_Missense_Mutation_p.G350V			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	163	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						TTGCGGTGGACCTGGTTGGCT	0.537																																					p.G350V		.											.	SATL1-175	0			c.G1049T						.						219.0	140.0	166.0					X																	84362926		2203	4300	6503	SO:0001583	missense	340562	exon1			GGTGGACCTGGTT	BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.488G>T	X.37:g.84362926C>A	ENSP00000378804:p.Gly163Val	312	1		363	84	NM_001012980	0	0	0	0	0	A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	ENST00000395409.3	37		.	.	.	.	.	.	.	.	.	.	C	6.664	0.490976	0.12702	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.41758	0.99;0.99;0.99	1.92	0.23	0.15372	.	.	.	.	.	T	0.47395	0.1443	L	0.43152	1.355	0.09310	N	1	B;D	0.59357	0.328;0.985	B;D	0.63877	0.112;0.919	T	0.30592	-0.9973	9	0.49607	T	0.09	.	5.4149	0.16368	0.0:0.667:0.0:0.333	.	163;350	Q86VE3;E9PB72	SATL1_HUMAN;.	V	163;163;350	ENSP00000378804:G163V;ENSP00000329115:G163V;ENSP00000425421:G350V	ENSP00000329115:G163V	G	-	2	0	SATL1	84249582	0.020000	0.18652	0.000000	0.03702	0.013000	0.08279	1.368000	0.34216	-0.040000	0.13580	0.190000	0.17370	GGT	.		0.537	SATL1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_291339	
DACH2	117154	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	85950071	85950071	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:85950071G>T	ENST00000373125.4	+	5	820	c.820G>T	c.(820-822)Gct>Tct	p.A274S	DACH2_ENST00000373131.1_Missense_Mutation_p.A261S|DACH2_ENST00000510272.1_Missense_Mutation_p.A55S|DACH2_ENST00000508860.1_Missense_Mutation_p.A107S	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	274					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GTCTCCATTTGCTGCACCTGG	0.473																																					p.A274S		.											.	DACH2-136	0			c.G820T						.						68.0	56.0	60.0					X																	85950071		2203	4300	6503	SO:0001583	missense	117154	exon5			CCATTTGCTGCAC	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.820G>T	X.37:g.85950071G>T	ENSP00000362217:p.Ala274Ser	341	0		328	79	NM_053281	0	0	0	0	0	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	ENST00000373125.4	37	CCDS14455.1	.	.	.	.	.	.	.	.	.	.	g	1.941	-0.443550	0.04604	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297	D;D	0.82984	-1.67;-1.66	4.99	1.7	0.24286	.	0.492910	0.18818	N	0.130327	T	0.50274	0.1606	N	0.01352	-0.895	0.09310	N	0.999996	B;B;B	0.25772	0.035;0.134;0.083	B;B;B	0.19946	0.027;0.027;0.012	T	0.43180	-0.9407	10	0.20046	T	0.44	.	2.2764	0.04103	0.4957:0.0:0.2574:0.2469	.	140;261;274	Q1RMF5;Q96NX9-2;Q96NX9	.;.;DACH2_HUMAN	S	274;261;274;107;55;107	ENSP00000362223:A261S;ENSP00000362217:A274S	ENSP00000345134:A274S	A	+	1	0	DACH2	85836727	1.000000	0.71417	0.588000	0.28705	0.060000	0.15804	2.764000	0.47613	0.345000	0.23873	-0.371000	0.07208	GCT	.		0.473	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359266.1	NM_053281	
IRS4	8471	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	107979446	107979446	+	Silent	SNP	G	G	T			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chrX:107979446G>T	ENST00000372129.2	-	1	205	c.129C>A	c.(127-129)ctC>ctA	p.L43L	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	43					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CGGTCCCAATGAGTGCGGTCG	0.657																																					p.L43L		.											.	IRS4-623	0			c.C129A						.						25.0	27.0	26.0					X																	107979446		2197	4280	6477	SO:0001819	synonymous_variant	8471	exon1			CCCAATGAGTGCG	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.129C>A	X.37:g.107979446G>T		115	0		111	23	NM_003604	0	0	0	0	0		Silent	SNP	ENST00000372129.2	37	CCDS14544.1																																																																																			.		0.657	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
PAQR4	124222	broad.mit.edu	37	16	3019781	3019782	+	Frame_Shift_Ins	INS	-	-	C	rs144682481		TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr16:3019781_3019782insC	ENST00000318782.8	+	1	536_537	c.106_107insC	c.(106-108)tcgfs	p.S36fs	PAQR4_ENST00000576565.1_Intron|PAQR4_ENST00000572687.1_Frame_Shift_Ins_p.S36fs|PAQR4_ENST00000574988.1_5'Flank|PKMYT1_ENST00000431515.2_Intron|PAQR4_ENST00000293978.8_Frame_Shift_Ins_p.S36fs|PKMYT1_ENST00000571102.1_Intron	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	36						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						CAGCAGCGGCTCGGGCTGCCTG	0.698																																					p.S36fs		.											.	PAQR4-68	0			c.106_107insC						.																																			SO:0001589	frameshift_variant	124222	exon1			AGCGGCTCGGGCT		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.107dupC	16.37:g.3019782_3019782dupC	ENSP00000321804:p.Ser36fs	65	0		204	7	NM_152341	0	0	0	0	0	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Frame_Shift_Ins	INS	ENST00000318782.8	37	CCDS10485.1																																																																																			.		0.698	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250966.1	NM_152341	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346616	39346617	+	In_Frame_Ins	INS	-	-	AGCCTAGCTGTGGGTCCAGCTGCTGCC			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:39346616_39346617insAGCCTAGCTGTGGGTCCAGCTGCTGCC	ENST00000398470.1	+	1	478_479	c.478_479insAGCCTAGCTGTGGGTCCAGCTGCTGCC	c.(478-480)cag>cAGCCTAGCTGTGGGTCCAGCTGCTGCCag	p.160_160Q>QPSCGSSCCQ	KRTAP9-1_ENST00000318329.5_In_Frame_Ins_p.77_77Q>QPSCGSSCCQ|KRTAP9-1_ENST00000377723.3_Intron	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	160	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CAGCTGCTGCCAGCCTTGCTGC	0.599																																					p.Q160delinsQPSCGSSCCQ		.											.	.	0			c.478_479insAGCCTAGCTGTGGGTCCAGCTGCTGCC						.																																			SO:0001652	inframe_insertion	728318	exon1			TGCTGCCAGCCTT	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	Exception_encountered	17.37:g.39346616_39346617insAGCCTAGCTGTGGGTCCAGCTGCTGCC	Exception_encountered	134	0		136	0	NM_001190460	0	0	0	0	0		In_Frame_Ins	INS	ENST00000398470.1	37	CCDS56029.1																																																																																			.		0.599	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
FLJ45079	400624	hgsc.bcm.edu;bcgsc.ca	37	17	75879202	75879203	+	5'Flank	INS	-	-	CCCA			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr17:75879202_75879203insCCCA	ENST00000374983.2	-	0	0																								BRCA - Breast invasive adenocarcinoma(99;0.00524)|Lung(188;0.154)			GAGCGAGAGACCCCACAGTACC	0.574																																					.		.											.	.	0			.						.																																			SO:0001631	upstream_gene_variant	0	.			GAGAGACCCCACA																													17.37:g.75879203_75879206dupCCCA	Exception_encountered	57	0		62	13	.	0	0	0	0	0		RNA	INS	ENST00000374983.2	37																																																																																				.		0.574	FLJ45079-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
ME2	4200	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	48434497	48434498	+	Frame_Shift_Ins	INS	-	-	AGAG			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr18:48434497_48434498insAGAG	ENST00000321341.5	+	3	445_446	c.173_174insAGAG	c.(172-177)atagagfs	p.-59fs	ME2_ENST00000382927.3_Frame_Shift_Ins_p.-59fs	NM_002396.4	NP_002387.1	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial						malate metabolic process (GO:0006108)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(3)	23		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)		CCTCCCAAAATAGAGACACAAG	0.327																																					p.I58fs		.											.	ME2-90	0			c.173_174insAGAG						.																																			SO:0001589	frameshift_variant	4200	exon3			CCAAAATAGAGAC	M55905	CCDS11948.1, CCDS54187.1	18q21	2012-10-02			ENSG00000082212	ENSG00000082212	1.1.1.40		6984	protein-coding gene	gene with protein product		154270				1993674	Standard	NM_002396		Approved		uc002ley.3	P23368	OTTHUMG00000132694	ENST00000321341.5:c.174_177dupAGAG	18.37:g.48434498_48434501dupAGAG	ENSP00000321070:p.Glu59fs	96	0		118	25	NM_001168335	0	0	0	0	0	B2R8J2|Q9BWL6|Q9BYG1|Q9H4B2	Frame_Shift_Ins	INS	ENST00000321341.5	37	CCDS11948.1																																																																																			.		0.327	ME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255991.1	NM_002396	
DCAF15	90379	broad.mit.edu	37	19	14071333	14071334	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr19:14071333_14071334insG	ENST00000254337.6	+	12	1709_1710	c.1688_1689insG	c.(1687-1692)ctggtgfs	p.V564fs		NM_138353.2	NP_612362.2	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	564					protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)	11						ATGAAGTGGCTGGTGCCGGAGA	0.658											OREG0025301	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L563fs		.											.	DCAF15-90	0			c.1688_1689insG						.																																			SO:0001589	frameshift_variant	90379	exon12			AGTGGCTGGTGCC	BC002926	CCDS32926.1	19p13.12	2009-07-17	2009-07-17	2009-07-17	ENSG00000132017	ENSG00000132017		"""DDB1 and CUL4 associated factors"""	25095	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 72"""	C19orf72			Standard	NM_138353		Approved	MGC99481	uc002mxt.3	Q66K64		ENST00000254337.6:c.1690dupG	19.37:g.14071335_14071335dupG	ENSP00000254337:p.Val564fs	222	0	692	542	7	NM_138353	0	0	0	0	0	B3KS86|Q96DW0|Q9BU31	Frame_Shift_Ins	INS	ENST00000254337.6	37	CCDS32926.1																																																																																			.		0.658	DCAF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458099.1	NM_138353	
KIF1A	547	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	241715297	241715298	+	Frame_Shift_Ins	INS	-	-	CGGAATCT			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr2:241715297_241715298insCGGAATCT	ENST00000320389.7	-	11	1086_1087	c.928_929insAGATTCCG	c.(928-930)gtgfs	p.V310fs	KIF1A_ENST00000498729.2_Frame_Shift_Ins_p.V310fs	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	310	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CCAGGTCAACACGGAATCTCGG	0.554																																					p.V310fs		.											.	KIF1A-91	0			c.929_930insAGATTCCG						.																																			SO:0001589	frameshift_variant	547	exon11			GTCAACACGGAAT	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.921_928dupAGATTCCG	2.37:g.241715298_241715305dupCGGAATCT	ENSP00000322791:p.Val310fs	90	0		105	8	NM_001244008	0	0	0	0	0	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Frame_Shift_Ins	INS	ENST00000320389.7	37	CCDS46561.1																																																																																			.		0.554	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324536.3	NM_138483	
MCF2L2	23101	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	183035998	183035999	+	Frame_Shift_Ins	INS	-	-	C			TCGA-OR-A5K5-01A-11D-A29I-10	TCGA-OR-A5K5-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	a7ec1b86-9c36-455f-a4f9-f8e82a163b67	eca69aee-715b-48c7-be08-bc78e8190f99	g.chr3:183035998_183035999insC	ENST00000328913.3	-	7	907_908	c.610_611insG	c.(610-612)gaafs	p.E204fs	MCF2L2_ENST00000414362.2_Frame_Shift_Ins_p.E204fs|MCF2L2_ENST00000447025.2_Frame_Shift_Ins_p.E204fs|MCF2L2_ENST00000473233.1_Frame_Shift_Ins_p.E204fs	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	204							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			GGCAAAGTTTTCGATGGCCTGG	0.46																																					p.E204fs		.											.	MCF2L2-293	0			c.611_612insG						.																																			SO:0001589	frameshift_variant	23101	exon7			AAGTTTTCGATGG	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.611dupG	3.37:g.183035999_183035999dupC	ENSP00000328118:p.Glu204fs	142	0		199	36	NM_015078	0	0	0	0	0	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Frame_Shift_Ins	INS	ENST00000328913.3	37	CCDS3243.1																																																																																			.		0.460	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
