#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SRM	6723	hgsc.bcm.edu	37	1	11119899	11119899	+	Silent	SNP	T	T	C	rs7545802		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr1:11119899T>C	ENST00000376957.2	-	1	182	c.102A>G	c.(100-102)tcA>tcG	p.S34S		NM_003132.2	NP_003123.2	P19623	SPEE_HUMAN	spermidine synthase	34	PABS.				cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)|spermidine synthase activity (GO:0004766)			large_intestine(1)|lung(1)|urinary_tract(1)	3	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.228)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)|STAD - Stomach adenocarcinoma(313;0.192)	S-Adenosylmethionine(DB00118)	CCACCTGCAGTGACAGGGCCT	0.761													C|||	5008	1.0	1.0	1.0	5008	,	,		7294	1.0		1.0	False		,,,				2504	1.0				p.S34S		.											.	SRM-90	0			c.A102G						.						8.0	10.0	10.0					1																	11119899		1613	3461	5074	SO:0001819	synonymous_variant	6723	exon1			CTGCAGTGACAGG	BC033106	CCDS125.1	1p36-p22	2010-11-08			ENSG00000116649	ENSG00000116649	2.5.1.16		11296	protein-coding gene	gene with protein product		182891		SRML1		2344393	Standard	NM_003132		Approved	SPS1	uc001arz.1	P19623	OTTHUMG00000002119	ENST00000376957.2:c.102A>G	1.37:g.11119899T>C		0	0		7	7	NM_003132	0	0	0	31	31	B1AKP9|Q15511	Silent	SNP	ENST00000376957.2	37	CCDS125.1																																																																																			T|0.001;C|0.999		0.761	SRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006056.1	NM_003132	
XKR8	55113	hgsc.bcm.edu	37	1	28286666	28286666	+	Missense_Mutation	SNP	C	C	T	rs201643190		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr1:28286666C>T	ENST00000373884.5	+	1	694	c.86C>T	c.(85-87)aCc>aTc	p.T29I	RP11-460I13.2_ENST00000448015.1_RNA	NM_018053.2	NP_060523.2	Q9H6D3	XKR8_HUMAN	XK, Kell blood group complex subunit-related family, member 8	29					engulfment of apoptotic cell (GO:0043652)|phosphatidylserine exposure on apoptotic cell surface (GO:0070782)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(1)	4		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;4.72e-24)|Colorectal(126;1.52e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00572)|READ - Rectum adenocarcinoma(331;0.0526)		GACCTGGGCACCGACCTGTGG	0.766													C|||	1	0.000199681	0.0	0.0	5008	,	,		12236	0.0		0.001	False		,,,				2504	0.0				p.T29I		.											.	XKR8-90	0			c.C86T						.	C	ILE/THR	1,3561		0,1,1780	3.0	3.0	3.0		86	4.4	0.2	1		3	12,7300		0,12,3644	no	missense	XKR8	NM_018053.2	89	0,13,5424	TT,TC,CC		0.1641,0.0281,0.1196	benign	29/396	28286666	13,10861	1781	3656	5437	SO:0001583	missense	55113	exon1			TGGGCACCGACCT	AK091615	CCDS315.1	1p35.3	2008-02-05	2006-01-12		ENSG00000158156	ENSG00000158156			25508	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 8"""			12477932	Standard	NM_018053		Approved	FLJ10307	uc001bph.1	Q9H6D3	OTTHUMG00000003912	ENST00000373884.5:c.86C>T	1.37:g.28286666C>T	ENSP00000362991:p.Thr29Ile	0	0		5	5	NM_018053	0	0	0	1	1		Missense_Mutation	SNP	ENST00000373884.5	37	CCDS315.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.922685	0.52653	2.81E-4	0.001641	ENSG00000158156	ENST00000373884	T	0.63417	-0.04	4.37	4.37	0.52481	.	0.573872	0.17575	N	0.169335	T	0.52980	0.1768	L	0.43923	1.385	0.30799	N	0.740021	B	0.12013	0.005	B	0.06405	0.002	T	0.50882	-0.8775	10	0.20519	T	0.43	.	14.4545	0.67407	0.0:1.0:0.0:0.0	.	29	Q9H6D3	XKR8_HUMAN	I	29	ENSP00000362991:T29I	ENSP00000362991:T29I	T	+	2	0	XKR8	28159253	0.481000	0.25941	0.233000	0.24025	0.224000	0.24922	3.171000	0.50824	2.258000	0.74832	0.557000	0.71058	ACC	.		0.766	XKR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011175.1	NM_018053	
ZZZ3	26009	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	78098574	78098574	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr1:78098574C>A	ENST00000370801.3	-	5	941	c.466G>T	c.(466-468)Gat>Tat	p.D156Y	ZZZ3_ENST00000476275.1_5'Flank|ZZZ3_ENST00000370798.1_Intron	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	156					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						CCTTGAAAATCTGCATCATTG	0.398																																					p.D156Y		.											.	ZZZ3-157	0			c.G466T						.						163.0	163.0	163.0					1																	78098574		2203	4300	6503	SO:0001583	missense	26009	exon5			GAAAATCTGCATC	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.466G>T	1.37:g.78098574C>A	ENSP00000359837:p.Asp156Tyr	120	0		159	14	NM_015534	0	0	4	4	0	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	ENST00000370801.3	37	CCDS677.1	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822561	0.32237	.	.	ENSG00000036549	ENST00000370801	.	.	.	5.34	5.34	0.76211	.	0.313359	0.34088	N	0.004270	T	0.55497	0.1924	L	0.43152	1.355	0.80722	D	1	P;P;P	0.50528	0.936;0.838;0.899	P;B;P	0.53809	0.735;0.372;0.576	T	0.50224	-0.8853	8	.	.	.	.	19.4381	0.94806	0.0:1.0:0.0:0.0	.	156;156;156	Q8IYH5-4;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	Y	156	.	.	D	-	1	0	ZZZ3	77871162	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.580000	0.53907	2.649000	0.89929	0.650000	0.86243	GAT	.		0.398	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026615.1	NM_015534	
LOR	4014	hgsc.bcm.edu	37	1	153233701	153233701	+	Silent	SNP	A	A	C	rs1143390	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr1:153233701A>C	ENST00000368742.3	+	2	333	c.276A>C	c.(274-276)ggA>ggC	p.G92G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	92					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGTACTCcggaggcggcggct	0.786													a|||	1994	0.398163	0.416	0.3703	5008	,	,		4732	0.3562		0.3797	False		,,,				2504	0.456				p.G92G		.											.	LOR-90	0			c.A276C						.						1.0	1.0	1.0					1																	153233701		392	1110	1502	SO:0001819	synonymous_variant	4014	exon2			CTCCGGAGGCGGC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.276A>C	1.37:g.153233701A>C		0	0		4	4	NM_000427	0	0	0	0	0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																			A|0.594;C|0.406		0.786	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
KLHDC8A	55220	bcgsc.ca	37	1	205306590	205306590	+	Silent	SNP	G	G	A	rs3210952	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr1:205306590G>A	ENST00000367156.3	-	9	1806	c.990C>T	c.(988-990)gcC>gcT	p.A330A	KLHDC8A_ENST00000539253.1_Silent_p.A330A|KLHDC8A_ENST00000460687.1_Silent_p.A196A|KLHDC8A_ENST00000537168.1_Silent_p.A217A|KLHDC8A_ENST00000367155.3_Silent_p.A330A	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	330										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			CACCTCCCACGGCGAGGAGGC	0.587													g|||	894	0.178514	0.0219	0.17	5008	,	,		19856	0.3383		0.2127	False		,,,				2504	0.1963				p.A330A		.											.	KLHDC8A-91	0			c.C990T						.	A		203,4203	126.6+/-163.6	1,201,2001	198.0	177.0	184.0		990	-10.9	0.2	1	dbSNP_105	184	1604,6996	299.3+/-304.4	151,1302,2847	no	coding-synonymous	KLHDC8A	NM_018203.1		152,1503,4848	AA,AG,GG		18.6512,4.6074,13.8936		330/351	205306590	1807,11199	2203	4300	6503	SO:0001819	synonymous_variant	55220	exon7			TCCCACGGCGAGG		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.990C>T	1.37:g.205306590G>A		98	1		117	5	NM_001271864	0	0	23	23	0	B3KU70|Q9NVG5	Silent	SNP	ENST00000367156.3	37	CCDS30985.1																																																																																			G|0.841;A|0.159		0.587	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	NM_018203	
PLXNA2	5362	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	208202216	208202216	+	Silent	SNP	G	G	C			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr1:208202216G>C	ENST00000367033.3	-	30	6154	c.5397C>G	c.(5395-5397)ctC>ctG	p.L1799L	PLXNA2_ENST00000483048.1_5'UTR	NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1799					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CCTTGGCATAGAGCAGCTTGT	0.607																																					p.L1799L		.											.	PLXNA2-92	0			c.C5397G						.						106.0	103.0	104.0					1																	208202216		2203	4300	6503	SO:0001819	synonymous_variant	5362	exon30			GGCATAGAGCAGC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.5397C>G	1.37:g.208202216G>C		136	0		171	152	NM_025179	0	0	1	1	0	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	ENST00000367033.3	37	CCDS31013.1																																																																																			.		0.607	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
GPR158	57512	bcgsc.ca	37	10	25701341	25701341	+	Missense_Mutation	SNP	C	C	G	rs2480345	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr10:25701341C>G	ENST00000376351.3	+	4	1633	c.1274C>G	c.(1273-1275)gCc>gGc	p.A425G		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	425			A -> G (in dbSNP:rs2480345). {ECO:0000269|Ref.1}.		protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TCCTTCCAAGCCCTGTGTATG	0.507													C|||	2457	0.490615	0.4561	0.5029	5008	,	,		20107	0.1587		0.6948	False		,,,				2504	0.6605				p.A425G		.											.	GPR158-141	0			c.C1274G						.	C	GLY/ALA	2112,2294	575.0+/-383.9	505,1102,596	235.0	202.0	213.0		1274	4.0	1.0	10	dbSNP_100	213	6264,2336	703.6+/-405.4	2284,1696,320	yes	missense	GPR158	NM_020752.2	60	2789,2798,916	GG,GC,CC		27.1628,47.9346,35.599	benign	425/1216	25701341	8376,4630	2203	4300	6503	SO:0001583	missense	57512	exon4			TCCAAGCCCTGTG	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1274C>G	10.37:g.25701341C>G	ENSP00000365529:p.Ala425Gly	141	0		151	6	NM_020752	0	0	0	0	0	Q6QR81|Q9ULT3	Missense_Mutation	SNP	ENST00000376351.3	37	CCDS31166.1	1019	0.4665750915750916	218	0.44308943089430897	195	0.5386740331491713	78	0.13636363636363635	528	0.6965699208443272	C	13.99	2.401024	0.42613	0.479346	0.728372	ENSG00000151025	ENST00000376351	T	0.60040	0.22	6.16	4.01	0.46588	GPCR, family 3, C-terminal (1);	0.289069	0.29376	N	0.012330	T	0.00012	0.0000	N	0.10874	0.06	0.38124	P	0.062031999999999976	B	0.11235	0.004	B	0.16722	0.016	T	0.34428	-0.9829	9	0.27785	T	0.31	.	14.0138	0.64513	0.0:0.8586:0.0:0.1414	rs2480345;rs16925746;rs17556198;rs52825413;rs2480345	425	Q5T848	GP158_HUMAN	G	425	ENSP00000365529:A425G	ENSP00000365529:A425G	A	+	2	0	GPR158	25741347	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.212000	0.51145	1.612000	0.50221	0.650000	0.86243	GCC	C|0.433;G|0.567		0.507	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
RASGEF1A	221002	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	43698838	43698838	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr10:43698838A>T	ENST00000395809.1	-	3	2735	c.229T>A	c.(229-231)Tcc>Acc	p.S77T	RASGEF1A_ENST00000374459.1_Missense_Mutation_p.S85T|RASGEF1A_ENST00000472864.1_5'UTR|RASGEF1A_ENST00000395810.1_Missense_Mutation_p.S77T			Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	77	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				cell migration (GO:0016477)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(2)	11						AAGACCCGGGAGCTCAGGAGA	0.657																																					p.S77T		.											.	RASGEF1A-227	0			c.T229A						.						20.0	17.0	18.0					10																	43698838		2179	4291	6470	SO:0001583	missense	221002	exon3			CCCGGGAGCTCAG	AK095136	CCDS7202.2, CCDS60517.1	10q11.21	2006-01-11			ENSG00000198915	ENSG00000198915			24246	protein-coding gene	gene with protein product		614531				12477932	Standard	XM_005271808		Approved	CG4853, FLJ37817	uc001jap.1	Q8N9B8	OTTHUMG00000018025	ENST00000395809.1:c.229T>A	10.37:g.43698838A>T	ENSP00000379154:p.Ser77Thr	195	0		285	35	NM_145313	0	0	0	0	0	Q8TBF1	Missense_Mutation	SNP	ENST00000395809.1	37	CCDS7202.2	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165187	0.78339	.	.	ENSG00000198915	ENST00000374459;ENST00000395810;ENST00000395809	T;T;T	0.31247	1.5;1.5;1.5	5.33	5.33	0.75918	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	0.083628	0.52532	D	0.000080	T	0.38719	0.1051	M	0.64997	1.995	0.43403	D	0.99553	B;B	0.30709	0.291;0.243	B;B	0.41917	0.37;0.253	T	0.21827	-1.0234	10	0.33141	T	0.24	.	11.3071	0.49342	0.8477:0.1523:0.0:0.0	.	77;85	Q8N9B8;Q8N9B8-2	RGF1A_HUMAN;.	T	85;77;77	ENSP00000363583:S85T;ENSP00000379155:S77T;ENSP00000379154:S77T	ENSP00000363583:S85T	S	-	1	0	RASGEF1A	43018844	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.719000	0.54926	2.017000	0.59298	0.402000	0.26972	TCC	.		0.657	RASGEF1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313989.1	NM_145313	
MUC5B	727897	bcgsc.ca	37	11	1266696	1266696	+	Silent	SNP	A	A	C	rs532138150	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr11:1266696A>C	ENST00000529681.1	+	31	8644	c.8586A>C	c.(8584-8586)ccA>ccC	p.P2862P	MUC5B_ENST00000447027.1_Silent_p.P2865P|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2862	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CATCGGCCCCAATAACCACGG	0.692													-|||	1610	0.321486	0.236	0.3386	5008	,	,		9611	0.497		0.2575	False		,,,				2504	0.3098				p.P2862P		.											.	.	0			c.A8586C						.						54.0	65.0	61.0					11																	1266696		1727	3813	5540	SO:0001819	synonymous_variant	727897	exon31			GGCCCCAATAACC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8586A>C	11.37:g.1266696A>C		180	7		113	82	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			A|0.500;C|0.500		0.692	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1266716	1266716	+	Missense_Mutation	SNP	T	T	C	rs200243273	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr11:1266716T>C	ENST00000529681.1	+	31	8664	c.8606T>C	c.(8605-8607)aTg>aCg	p.M2869T	MUC5B_ENST00000447027.1_Missense_Mutation_p.M2872T|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2869	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GTGGTGACCATGGGCTGTGAG	0.657													-|||	1477	0.294928	0.2284	0.2752	5008	,	,		10473	0.4812		0.2266	False		,,,				2504	0.2771				p.M2869T		.											.	.	0			c.T8606C						.						43.0	51.0	49.0					11																	1266716		1683	3765	5448	SO:0001583	missense	727897	exon31			TGACCATGGGCTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8606T>C	11.37:g.1266716T>C	ENSP00000436812:p.Met2869Thr	222	4		96	45	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	1.479	-0.557829	0.03967	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.15718	2.4;2.59	1.67	-1.74	0.08056	.	.	.	.	.	T	0.05686	0.0149	N	0.02539	-0.55	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29882	-0.9997	8	0.87932	D	0	.	3.4419	0.07466	0.1749:0.468:0.0:0.3571	rs2860626;rs2943499;rs2943524;rs3965637	3452;2872	A7Y9J9;E9PBJ0	.;.	T	2869;2872;2841;2829	ENSP00000436812:M2869T;ENSP00000415793:M2872T	ENSP00000343037:M2841T	M	+	2	0	MUC5B	1223292	0.003000	0.15002	0.000000	0.03702	0.007000	0.05969	0.117000	0.15583	-1.035000	0.03291	-0.471000	0.05019	ATG	C|1.000;|0.000		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
INPPL1	3636	broad.mit.edu	37	11	71949087	71949087	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr11:71949087C>A	ENST00000298229.2	+	27	3758	c.3554C>A	c.(3553-3555)gCt>gAt	p.A1185D	INPPL1_ENST00000538751.1_Splice_Site_p.A943D|INPPL1_ENST00000541756.1_Splice_Site_p.A943D|PHOX2A_ENST00000544057.1_5'Flank	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1185					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)	p.A1185D(2)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TTTCCTTAGGCTCCGTGCCTG	0.657											OREG0021191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1185D		.											.	INPPL1-660	2	Substitution - Missense(2)	urinary_tract(1)|prostate(1)	c.C3554A						.						15.0	17.0	17.0					11																	71949087		2197	4291	6488	SO:0001630	splice_region_variant	3636	exon27			CTTAGGCTCCGTG	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.3553-1C>A	11.37:g.71949087C>A		10	0	1133	48	6	NM_001567	0	0	1	1	0	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	ENST00000298229.2	37	CCDS8213.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	12.01|12.01	1.810120|1.810120	0.32053|0.32053	.|.	.|.	ENSG00000165458|ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751|ENST00000320683	D;D;D|.	0.96716|.	-2.99;-4.1;-4.1|.	4.69|4.69	2.76|2.76	0.32466|0.32466	.|.	0.083463|.	0.47093|.	D|.	0.000259|.	T|T	0.34600|0.34600	0.0903|0.0903	N|N	0.14661|0.14661	0.345|0.345	0.36357|0.36357	D|D	0.860441|0.860441	P|.	0.44090|.	0.826|.	B|.	0.38655|.	0.278|.	T|T	0.28681|0.28681	-1.0036|-1.0036	10|5	0.44086|.	T|.	0.13|.	.|.	7.041|7.041	0.25021|0.25021	0.0:0.6953:0.1561:0.1486|0.0:0.6953:0.1561:0.1486	.|.	1185|.	O15357|.	SHIP2_HUMAN|.	D|I	1185;943;943|47	ENSP00000298229:A1185D;ENSP00000446360:A943D;ENSP00000444619:A943D|.	ENSP00000298229:A1185D|.	A|L	+|+	2|1	0|0	INPPL1|INPPL1	71626735|71626735	0.671000|0.671000	0.27521|0.27521	1.000000|1.000000	0.80357|0.80357	0.421000|0.421000	0.31385|0.31385	1.197000|1.197000	0.32211|0.32211	1.184000|1.184000	0.42957|0.42957	0.591000|0.591000	0.81541|0.81541	GCT|CTC	.		0.657	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	Missense_Mutation
B3GNT6	192134	hgsc.bcm.edu	37	11	76751585	76751604	+	Frame_Shift_Del	DEL	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	rs200788398|rs34153015|rs11292200|rs201940118|rs11292199	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr11:76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENST00000533140.1	+	2	1128_1147	c.990_1009delTGGCCCTTCGGCGTGCAGCT	c.(988-1011)cctggcccttcggcgtgcagcttgfs	p.GPSACSL331fs	B3GNT6_ENST00000421061.1_Splice_Site_p.IGPSACS209fs|B3GNT6_ENST00000354301.5_Splice_Site_p.WPFGVQL330fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GAGGGCATCCTGGCCCTTCGGCGTGCAGCTTGCCTGGCGC	0.686																																					p.330_336del		.											.	.	0			c.989_1006del						.																																			SO:0001589	frameshift_variant	192134	exon4			GCATCCTGGCCCT	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.990_1009delTGGCCCTTCGGCGTGCAGCT	11.37:g.76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENSP00000435352:p.Gly331fs	5	0		18	0	NM_138706	0	0	0	0	0	Q4TTN0	In_Frame_Del	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.686	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
MAML2	84441	broad.mit.edu	37	11	95825374	95825374	+	Silent	SNP	T	T	C	rs60727839|rs543548810|rs112603485|rs141671766	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr11:95825374T>C	ENST00000524717.1	-	2	3105	c.1821A>G	c.(1819-1821)caA>caG	p.Q607Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	607					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q607Q(1)	CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgttgctgctgct	0.532			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																p.Q607Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	1	Substitution - coding silent(1)	endometrium(1)	c.A1821G						.						27.0	35.0	33.0					11																	95825374		2008	3974	5982	SO:0001819	synonymous_variant	84441	exon2			CTGCTGTTGCTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1821A>G	11.37:g.95825374T>C		134	0		151	6	NM_032427	2	5	48	5076	5021	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			C|1.000;|0.000		0.532	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ATN1	1822	hgsc.bcm.edu	37	12	7045924	7045924	+	Missense_Mutation	SNP	G	G	T	rs199988271		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr12:7045924G>T	ENST00000356654.4	+	5	1731	c.1494G>T	c.(1492-1494)caG>caT	p.Q498H	ATN1_ENST00000396684.2_Missense_Mutation_p.Q498H	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	498	Poly-Gln.				cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						agcagcagcagcagcagcagc	0.637																																					p.Q498H		.											.	ATN1-139	0			c.G1494T						.						43.0	53.0	49.0					12																	7045924		2201	4297	6498	SO:0001583	missense	1822	exon5			GCAGCAGCAGCAG	U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1494G>T	12.37:g.7045924G>T	ENSP00000349076:p.Gln498His	99	0		182	12	NM_001007026	0	0	134	134	0	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	ENST00000356654.4	37	CCDS31734.1	.	.	.	.	.	.	.	.	.	.	g	0.004	-2.273578	0.00257	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.56776	0.44;0.44;0.44	1.44	-2.88	0.05682	.	.	.	.	.	T	0.24392	0.0591	N	0.22421	0.69	0.09310	N	1	P	0.40970	0.734	B	0.30401	0.115	T	0.19353	-1.0308	9	0.17832	T	0.49	.	3.3676	0.07208	0.2981:0.2446:0.4573:0.0	.	498	P54259	ATN1_HUMAN	H	498;498;498;83	ENSP00000349076:Q498H;ENSP00000379915:Q498H;ENSP00000441744:Q498H	ENSP00000229279:Q83H	Q	+	3	2	ATN1	6916185	0.175000	0.23083	0.269000	0.24586	0.334000	0.28698	-0.489000	0.06490	-0.760000	0.04677	0.109000	0.15622	CAG	G|0.999;A|0.001		0.637	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401948.2	NM_001940	
C1QL4	338761	hgsc.bcm.edu	37	12	49730135	49730135	+	Silent	SNP	G	G	C	rs146137821	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr12:49730135G>C	ENST00000334221.3	-	1	836	c.126C>G	c.(124-126)ccC>ccG	p.P42P		NM_001008223.1	NP_001008224.1	Q86Z23	C1QL4_HUMAN	complement component 1, q subcomponent-like 4	42						collagen trimer (GO:0005581)|extracellular region (GO:0005576)				large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						GCGCGCCGTCGGGACCAGGGC	0.756													G|||	454	0.090655	0.0991	0.0836	5008	,	,		11826	0.0248		0.1332	False		,,,				2504	0.1084				p.P42P		.											.	C1QL4-90	0			c.C126G						.	G		278,3274		16,246,1514	4.0	4.0	4.0		126	3.4	0.9	12	dbSNP_134	4	773,6267		42,689,2789	no	coding-synonymous	C1QL4	NM_001008223.1		58,935,4303	CC,CG,GG		10.9801,7.8266,9.9226		42/239	49730135	1051,9541	1776	3520	5296	SO:0001819	synonymous_variant	338761	exon1			GCCGTCGGGACCA		CCDS31793.1	12q13.12	2012-04-12				ENSG00000186897			31416	protein-coding gene	gene with protein product		615229					Standard	NM_001008223		Approved	C1QTNF11, CTRP11	uc001rtz.1	Q86Z23	OTTHUMG00000169515	ENST00000334221.3:c.126C>G	12.37:g.49730135G>C		0	0		6	4	NM_001008223	0	0	0	0	0		Silent	SNP	ENST00000334221.3	37	CCDS31793.1																																																																																			G|0.904;C|0.096		0.756	C1QL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404561.1	NM_001008223	
HOXC9	3225	hgsc.bcm.edu	37	12	54394284	54394284	+	Silent	SNP	C	C	T	rs34079606	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr12:54394284C>T	ENST00000303450.4	+	1	382	c.312C>T	c.(310-312)gtC>gtT	p.V104V	HOXC9_ENST00000508190.1_Silent_p.V104V|HOXC-AS1_ENST00000505700.1_RNA|HOXC9_ENST00000504557.1_Intron|HOXC-AS1_ENST00000512427.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	104					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						CCGGCGCCGTCTCCTTCCCCA	0.741													C|||	79	0.0157748	0.0	0.0058	5008	,	,		10961	0.0258		0.0219	False		,,,				2504	0.0276				p.V104V		.											.	HOXC9-155	0			c.C312T						.	C		16,4106		0,16,2045	7.0	9.0	8.0		312	2.1	1.0	12	dbSNP_126	8	147,8059		0,147,3956	no	coding-synonymous	HOXC9	NM_006897.1		0,163,6001	TT,TC,CC		1.7914,0.3882,1.3222		104/261	54394284	163,12165	2061	4103	6164	SO:0001819	synonymous_variant	3225	exon1			CGCCGTCTCCTTC		CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.312C>T	12.37:g.54394284C>T		0	0		11	9	NM_006897	0	0	0	0	0	B2RCN7|Q9H1I0	Silent	SNP	ENST00000303450.4	37	CCDS8869.1																																																																																			C|0.982;T|0.018		0.741	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358958.1		
HSP90B1	7184	broad.mit.edu	37	12	104332202	104332204	+	In_Frame_Del	DEL	GAA	GAA	-	rs546630977		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr12:104332202_104332204delGAA	ENST00000299767.5	+	7	1122_1124	c.940_942delGAA	c.(940-942)gaadel	p.E318del		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	318					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	tgcagtagaggaagaagaagaag	0.379																																					p.314_314del		.											.	HSP90B1-93	0			c.940_942del						.			45,4219		0,45,2087						-0.2	1.0			44	116,8138		0,116,4011	no	coding	HSP90B1	NM_003299.1		0,161,6098	A1A1,A1R,RR		1.4054,1.0553,1.2861				161,12357				SO:0001651	inframe_deletion	7184	exon7			GTAGAGGAAGAAG	AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.940_942delGAA	12.37:g.104332211_104332213delGAA	ENSP00000299767:p.Glu318del	135	0		228	8	NM_003299	0	0	0	0	0	Q96A97	In_Frame_Del	DEL	ENST00000299767.5	37	CCDS9094.1																																																																																			.		0.379	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1	NM_003299	
ATXN2	6311	hgsc.bcm.edu	37	12	112036797	112036797	+	Silent	SNP	C	C	T	rs4098854	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr12:112036797C>T	ENST00000377617.3	-	1	683	c.522G>A	c.(520-522)caG>caA	p.Q174Q	ATXN2_ENST00000550104.1_Silent_p.Q174Q|RP11-686G8.2_ENST00000547021.1_RNA|ATXN2_ENST00000549455.1_5'UTR|ATXN2_ENST00000535949.1_Intron|ATXN2_ENST00000608853.1_Silent_p.Q14Q|ATXN2_ENST00000389153.4_5'Flank|ATXN2_ENST00000542287.2_Intron	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	174	Poly-Gln.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						gctgctgctgctgctgctgct	0.731													C|||	3289	0.656749	0.5734	0.6787	5008	,	,		4944	0.622		0.7167	False		,,,				2504	0.728				p.Q174Q		.											.	ATXN2-136	0			c.G522A						.						1.0	1.0	1.0					12																	112036797		720	1770	2490	SO:0001819	synonymous_variant	6311	exon1			CTGCTGCTGCTGC	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.522G>A	12.37:g.112036797C>T		0	0		6	6	NM_002973	0	0	131	141	10	A6NLD4|Q6ZQZ7|Q99493	Silent	SNP	ENST00000377617.3	37	CCDS31902.1																																																																																			C|0.429;T|0.571		0.731	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	ING1_ENST00000464141.1_Intron|ING1_ENST00000375775.3_Intron|ING1_ENST00000338450.7_Intron|ING1_ENST00000333219.7_Intron|CARS2_ENST00000535398.1_5'Flank	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		0	0		11	11	NM_005537	0	0	0	1	1	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
DAAM1	23002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	14	59798591	59798591	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr14:59798591G>T	ENST00000395125.1	+	14	1944	c.1921G>T	c.(1921-1923)Gat>Tat	p.D641Y	DAAM1_ENST00000351081.1_Missense_Mutation_p.D641Y|DAAM1_ENST00000360909.3_Missense_Mutation_p.D641Y	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	641	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		CAAAATTCTAGATCTTGAAGA	0.368																																					p.D641Y		.											.	DAAM1-227	0			c.G1921T						.						144.0	153.0	150.0					14																	59798591		2203	4300	6503	SO:0001583	missense	23002	exon15			ATTCTAGATCTTG	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.1921G>T	14.37:g.59798591G>T	ENSP00000378557:p.Asp641Tyr	82	0		100	16	NM_001270520	0	0	3	3	0	Q86U34|Q8N1Z8|Q8TB39	Missense_Mutation	SNP	ENST00000395125.1	37	CCDS9737.1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.565696	0.86439	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	T;T;T	0.21191	2.02;2.02;2.02	5.85	5.85	0.93711	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.042539	0.85682	D	0.000000	T	0.60573	0.2279	H	0.95004	3.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.66340	-0.5948	10	0.36615	T	0.2	.	20.1649	0.98147	0.0:0.0:1.0:0.0	.	641;641	Q9Y4D1-2;Q9Y4D1	.;DAAM1_HUMAN	Y	641	ENSP00000354162:D641Y;ENSP00000247170:D641Y;ENSP00000378557:D641Y	ENSP00000247170:D641Y	D	+	1	0	DAAM1	58868344	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.837000	0.99465	2.753000	0.94483	0.655000	0.94253	GAT	.		0.368	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276942.2	NM_014992	
SERPINA10	51156	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	94752476	94752476	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr14:94752476G>T	ENST00000393096.1	-	4	1577	c.1112C>A	c.(1111-1113)tCa>tAa	p.S371*	SERPINA10_ENST00000261994.4_Nonsense_Mutation_p.S371*|SERPINA10_ENST00000554723.1_Nonsense_Mutation_p.S411*|SERPINA10_ENST00000554173.1_Nonsense_Mutation_p.S371*	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	371					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		TCCAGTAGCTGAGAGTTCACT	0.433																																					p.S371X		.											.	SERPINA10-228	0			c.C1112A						.						106.0	94.0	98.0					14																	94752476		2203	4300	6503	SO:0001587	stop_gained	51156	exon4			GTAGCTGAGAGTT	AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.1112C>A	14.37:g.94752476G>T	ENSP00000376809:p.Ser371*	108	0		114	37	NM_001100607	0	0	0	0	0	A5Z2A5|Q6UWX9|Q86U20	Nonsense_Mutation	SNP	ENST00000393096.1	37	CCDS9923.1	.	.	.	.	.	.	.	.	.	.	G	40	8.247121	0.98724	.	.	ENSG00000140093	ENST00000554723;ENST00000393096;ENST00000261994;ENST00000554173	.	.	.	5.34	3.51	0.40186	.	0.600583	0.14022	N	0.346720	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	8.5851	0.33653	0.0779:0.0:0.771:0.1511	.	.	.	.	X	411;371;371;371	.	ENSP00000261994:S371X	S	-	2	0	SERPINA10	93822229	0.742000	0.28228	0.002000	0.10522	0.513000	0.34164	4.115000	0.57865	0.635000	0.30488	0.563000	0.77884	TCA	.		0.433	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413061.1	NM_016186	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	0	0		7	4	NM_001127258	0	0	1	1	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
LACTB	114294	hgsc.bcm.edu	37	15	63414083	63414083	+	Missense_Mutation	SNP	A	A	C	rs34317102	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr15:63414083A>C	ENST00000261893.4	+	1	85	c.13A>C	c.(13-15)Atg>Ctg	p.M5L	LACTB_ENST00000413507.2_Missense_Mutation_p.M5L	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	5				M -> L (in Ref. 1 and 2). {ECO:0000305}.		cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						GTACCGGCTCATGTCAGCAGT	0.751													C|||	3981	0.794928	0.6725	0.8256	5008	,	,		8367	0.997		0.7316	False		,,,				2504	0.7955				p.M5L	Melanoma(85;443 1381 6215 27308 35583)	.											.	LACTB-90	0			c.A13C						.	C	LEU/MET,LEU/MET	1936,668		733,470,99	4.0	4.0	4.0		13,13	3.1	1.0	15	dbSNP_126	4	4375,1183		1737,901,141	yes	missense,missense	LACTB	NM_032857.3,NM_171846.2	15,15	2470,1371,240	CC,CA,AA		21.2846,25.6528,22.6783	benign,benign	5/548,5/374	63414083	6311,1851	1302	2779	4081	SO:0001583	missense	114294	exon1			CGGCTCATGTCAG	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.13A>C	15.37:g.63414083A>C	ENSP00000261893:p.Met5Leu	0	0		8	8	NM_171846	0	0	0	0	0	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	1713	0.7843406593406593	304	0.6178861788617886	287	0.7928176795580111	568	0.993006993006993	554	0.7308707124010554	C	0.674	-0.800779	0.02841	0.743472	0.787154	ENSG00000103642	ENST00000261893;ENST00000413507	T	0.33216	1.42	3.1	3.1	0.35709	.	0.592824	0.14749	N	0.300689	T	0.00012	0.0000	N	0.02539	-0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.37842	-0.9688	9	0.02654	T	1	0.0321	7.626	0.28212	0.2541:0.7459:0.0:0.0	rs34317102	5	P83111	LACTB_HUMAN	L	5	ENSP00000261893:M5L	ENSP00000261893:M5L	M	+	1	0	LACTB	61201136	0.994000	0.37717	0.956000	0.39512	0.117000	0.20001	0.346000	0.19997	0.640000	0.30582	-0.677000	0.03784	ATG	A|0.226;C|0.774		0.751	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256224.1	NM_032857	
IFT140	9742	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	1642210	1642210	+	Nonsense_Mutation	SNP	C	C	A	rs367721062		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr16:1642210C>A	ENST00000426508.2	-	6	964	c.601G>T	c.(601-603)Gag>Tag	p.E201*	LA16c-395F10.2_ENST00000563162.1_RNA|IFT140_ENST00000439987.2_5'UTR	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	201					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				AACAGCCCCTCGTGAGACCCC	0.488																																					p.E201X		.											.	IFT140-95	0			c.G601T						.						160.0	142.0	148.0					16																	1642210		2199	4300	6499	SO:0001587	stop_gained	9742	exon6			GCCCCTCGTGAGA	AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.601G>T	16.37:g.1642210C>A	ENSP00000406012:p.Glu201*	135	1		162	53	NM_014714	0	0	1	2	1	A2A2A8|D3DU75|O60332|Q9UG52	Nonsense_Mutation	SNP	ENST00000426508.2	37	CCDS10439.1	.	.	.	.	.	.	.	.	.	.	C	36	5.673410	0.96754	.	.	ENSG00000187535	ENST00000397417;ENST00000426508;ENST00000439987	.	.	.	5.55	4.6	0.57074	.	0.104806	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	13.8936	0.63755	0.0:0.7088:0.2912:0.0	.	.	.	.	X	201	.	ENSP00000380562:E201X	E	-	1	0	IFT140	1582211	0.998000	0.40836	0.660000	0.29694	0.018000	0.09664	3.697000	0.54764	1.360000	0.45960	-0.188000	0.12872	GAG	.		0.488	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250438.2	NM_014714	
ZNF598	90850	hgsc.bcm.edu	37	16	2049849	2049849	+	Silent	SNP	T	T	C	rs12149722	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr16:2049849T>C	ENST00000563630.1	-	9	1778	c.1536A>G	c.(1534-1536)acA>acG	p.T512T	ZNF598_ENST00000562103.1_Silent_p.T512T|ZNF598_ENST00000431526.1_Silent_p.T567T|AC005606.15_ENST00000567515.1_lincRNA			Q86UK7	ZN598_HUMAN	zinc finger protein 598	567							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CCGTGGGGCGTGTGCTCAGAA	0.672													T|||	631	0.125998	0.0061	0.2147	5008	,	,		14610	0.0456		0.1829	False		,,,				2504	0.2495				p.T567T		.											.	ZNF598-432	0			c.A1701G						.	T		125,3761		6,113,1824	11.0	14.0	13.0		1703	-5.3	0.0	16	dbSNP_120	13	1390,6838		115,1160,2839	no	coding-synonymous	ZNF598	NM_178167.2		121,1273,4663	CC,CT,TT		16.8935,3.2167,12.5062		567/905	2049849	1515,10599	1943	4114	6057	SO:0001819	synonymous_variant	90850	exon11			GGGGCGTGTGCTC	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.1536A>G	16.37:g.2049849T>C		1	0		12	8	NM_178167	0	0	7	20	13	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Silent	SNP	ENST00000563630.1	37																																																																																				T|0.897;C|0.103		0.672	ZNF598-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000434439.1	NM_178167	
MEFV	4210	hgsc.bcm.edu	37	16	3304573	3304573	+	Silent	SNP	G	G	T	rs224223	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr16:3304573G>T	ENST00000219596.1	-	2	534	c.495C>A	c.(493-495)gcC>gcA	p.A165A	MEFV_ENST00000339854.4_Intron|MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	165					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)	p.A165A(2)		NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GGCCCTCCGAGGCCTTCTCTC	0.766													G|||	1935	0.386382	0.528	0.5965	5008	,	,		10896	0.1667		0.4732	False		,,,				2504	0.183				p.A165A		.											.	MEFV-228	2	Substitution - coding silent(2)	prostate(2)	c.C495A						.	G	,	2112,2188		580,952,618	7.0	7.0	7.0		495,	2.9	0.0	16	dbSNP_79	7	3826,4590		964,1898,1346	no	coding-synonymous,intron	MEFV	NM_000243.2,NM_001198536.1	,	1544,2850,1964	TT,TG,GG		45.461,49.1163,46.6971	,	165/782,	3304573	5938,6778	2150	4208	6358	SO:0001819	synonymous_variant	4210	exon2			CTCCGAGGCCTTC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.495C>A	16.37:g.3304573G>T		0	0		18	15	NM_000243	0	0	0	0	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	37	CCDS10498.1																																																																																			G|0.570;T|0.430		0.766	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
DNAH3	55567	broad.mit.edu	37	16	21011788	21011790	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr16:21011788_21011790delAAG	ENST00000261383.3	-	43	6176_6178	c.6177_6179delCTT	c.(6175-6180)ttcttg>ttg	p.F2059del	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2059	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GTAGGTTTTCAAGAAGAAGGACT	0.527																																					p.2059_2060del		.											.	DNAH3-167	0			c.6177_6179del						.			0,4264		0,0,2132						3.6	1.0			151	2,8252		0,2,4125	no	coding	DNAH3	NM_017539.1		0,2,6257	A1A1,A1R,RR		0.0242,0.0,0.016				2,12516				SO:0001651	inframe_deletion	55567	exon43			GTTTTCAAGAAGA	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.6177_6179delCTT	16.37:g.21011794_21011796delAAG	ENSP00000261383:p.Phe2059del	205	0		256	12	NM_017539	0	0	0	0	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	In_Frame_Del	DEL	ENST00000261383.3	37	CCDS10594.1																																																																																			.		0.527	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207361.1	NM_017539	
IL4R	3566	broad.mit.edu	37	16	27370278	27370278	+	Missense_Mutation	SNP	G	G	T	rs55988941	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr16:27370278G>T	ENST00000395762.2	+	9	1071	c.812G>T	c.(811-813)cGc>cTc	p.R271L	IL4R_ENST00000170630.2_Missense_Mutation_p.R271L|IL4R_ENST00000565915.1_3'UTR|IL4R_ENST00000380922.3_Missense_Mutation_p.R256L|IL4R_ENST00000543915.2_Missense_Mutation_p.R271L	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	271					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						AACCCAGCCCGCAGCCGCCTC	0.478																																					p.R271L		.											.	IL4R-227	0			c.G812T						.						80.0	77.0	78.0					16																	27370278		2197	4300	6497	SO:0001583	missense	3566	exon9			CAGCCCGCAGCCG	X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.812G>T	16.37:g.27370278G>T	ENSP00000379111:p.Arg271Leu	79	0		92	4	NM_000418	0	0	5	5	0	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Missense_Mutation	SNP	ENST00000395762.2	37	CCDS10629.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.339592	0.24339	.	.	ENSG00000077238	ENST00000395762;ENST00000543915;ENST00000380922;ENST00000170630	T;T;T;T	0.11063	2.81;2.81;2.81;2.81	5.56	-0.673	0.11373	.	2.019430	0.01676	N	0.025872	T	0.10937	0.0267	L	0.44542	1.39	0.30265	N	0.792805	P;P;B	0.38827	0.649;0.649;0.451	B;B;B	0.32090	0.14;0.14;0.066	T	0.37526	-0.9702	10	0.52906	T	0.07	-17.7949	9.7321	0.40368	0.4166:0.0:0.5834:0.0	.	256;271;271	B4E076;B9EGC0;P24394	.;.;IL4RA_HUMAN	L	271;271;256;271	ENSP00000379111:R271L;ENSP00000441667:R271L;ENSP00000370309:R256L;ENSP00000170630:R271L	ENSP00000170630:R271L	R	+	2	0	IL4R	27277779	0.921000	0.31238	0.136000	0.22124	0.078000	0.17371	0.845000	0.27668	-0.387000	0.07809	-0.302000	0.09304	CGC	G|0.999;A|0.001		0.478	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214104.4		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		15	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000599026.1_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L|AC108004.3_ENST00000466740.2_RNA			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		0	0		17	17	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
C17orf97	400566	broad.mit.edu	37	17	263687	263687	+	Silent	SNP	C	C	T	rs112578606		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:263687C>T	ENST00000360127.6	+	2	1069	c.1053C>T	c.(1051-1053)gcC>gcT	p.A351A	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	381	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						ACCCCGAGGCCCTCAAGGGCT	0.682																																					p.A351A		.											.	C17orf97-91	0			c.C1053T						.						15.0	22.0	19.0					17																	263687		2141	4188	6329	SO:0001819	synonymous_variant	400566	exon2			CGAGGCCCTCAAG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1053C>T	17.37:g.263687C>T		105	0		135	8	NM_001013672	0	0	40	46	6	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000360127.6	37	CCDS32519.2																																																																																			C|0.500;T|0.500		0.682	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255648.4	NM_001013672	
GPS2	2874	bcgsc.ca	37	17	7217463	7217463	+	Silent	SNP	T	T	C	rs2292064	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:7217463T>C	ENST00000380728.2	-	5	633	c.333A>G	c.(331-333)ctA>ctG	p.L111L	GPS2_ENST00000391950.3_Silent_p.L111L|RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000389167.5_Silent_p.L111L			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	111					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				CAGCTGATGTTAGGGTGGTCA	0.493													C|||	2879	0.57488	0.4592	0.6484	5008	,	,		23632	0.6796		0.5179	False		,,,				2504	0.6299				p.L111L		.											.	GPS2-93	0			c.A333G						.	C		2073,2333	606.4+/-390.7	487,1099,617	175.0	162.0	166.0		333	1.3	1.0	17	dbSNP_100	166	4552,4048	558.3+/-387.2	1227,2098,975	yes	coding-synonymous	GPS2	NM_004489.4		1714,3197,1592	CC,CT,TT		47.0698,47.0495,49.062		111/328	7217463	6625,6381	2203	4300	6503	SO:0001819	synonymous_variant	2874	exon5			TGATGTTAGGGTG	U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.333A>G	17.37:g.7217463T>C		156	1		146	8	NM_004489	0	0	77	77	0	B4DXA1|Q6FHM8	Silent	SNP	ENST00000380728.2	37	CCDS11100.1																																																																																			T|0.476;C|0.524		0.493	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220048.4	NM_004489	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7578378	7578392	+	In_Frame_Del	DEL	ATCTGAGCAGCGCTC	ATCTGAGCAGCGCTC	-	rs587782596|rs72661117|rs397514495		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	ATCTGAGCAGCGCTC	ATCTGAGCAGCGCTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:7578378_7578392delATCTGAGCAGCGCTC	ENST00000269305.4	-	5	727_741	c.538_552delGAGCGCTGCTCAGAT	c.(538-552)gagcgctgctcagatdel	p.ERCSD180del	TP53_ENST00000359597.4_In_Frame_Del_p.ERCSD180del|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_In_Frame_Del_p.ERCSD180del|TP53_ENST00000413465.2_In_Frame_Del_p.ERCSD180del|TP53_ENST00000445888.2_In_Frame_Del_p.ERCSD180del|TP53_ENST00000420246.2_In_Frame_Del_p.ERCSD180del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	180	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in a sporadic cancer; somatic mutation).|E -> K (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S183*(29)|p.R181H(21)|p.R181C(19)|p.R181P(14)|p.E180*(14)|p.D184N(14)|p.C182S(8)|p.0?(8)|p.D184H(8)|p.P177_C182delPHHERC(8)|p.E180D(6)|p.E180K(5)|p.C182*(5)|p.D184Y(4)|p.R181L(3)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.H178_S183delHHERCS(3)|p.S183P(3)|p.S90*(2)|p.R88C(2)|p.R49C(2)|p.C182C(2)|p.V173fs*59(2)|p.?(2)|p.S183L(2)|p.P177fs*3(2)|p.C182R(2)|p.C182Y(2)|p.S51*(2)|p.R181R(2)|p.D184D(2)|p.R49P(1)|p.C182fs*4(1)|p.R181G(1)|p.E180fs*67(1)|p.D52H(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.H46_S51delHHERCS(1)|p.C176fs*65(1)|p.D91H(1)|p.E180G(1)|p.R174fs*3(1)|p.R181>XXXXXXX(1)|p.E180Q(1)|p.R42fs*24(1)|p.D184fs*24(1)|p.D184fs*63(1)|p.D184fs*62(1)|p.R81fs*24(1)|p.E180>DGRCPHQ(1)|p.R174_E180>K(1)|p.D184fs*4(1)|p.D184fs*2(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.S185fs*63(1)|p.C182fs*65(1)|p.E87D(1)|p.E48D(1)|p.H85_S90delHHERCS(1)|p.E180_S183del(1)|p.R88P(1)|p.S185_D186delSD(1)|p.E180fs*6(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACCATCGCTATCTGAGCAGCGCTCATGGTGGGGG	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.180_184del	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	242	Substitution - Missense(124)|Substitution - Nonsense(52)|Deletion - In frame(23)|Deletion - Frameshift(19)|Whole gene deletion(8)|Substitution - coding silent(6)|Insertion - Frameshift(4)|Complex - insertion inframe(2)|Unknown(2)|Insertion - In frame(1)|Complex - deletion inframe(1)	large_intestine(39)|lung(38)|upper_aerodigestive_tract(26)|breast(22)|urinary_tract(20)|oesophagus(14)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(11)|ovary(10)|liver(9)|stomach(7)|prostate(7)|biliary_tract(5)|bone(5)|soft_tissue(4)|pancreas(4)|cervix(3)|salivary_gland(3)|endometrium(2)|kidney(1)|skin(1)	c.538_552del	GRCh37	CD031545|CM056067|CM920671|CM920672|CM941328|CM942120	TP53	D|M		.																																			SO:0001651	inframe_deletion	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATCGCTATCTGAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.538_552delGAGCGCTGCTCAGAT	17.37:g.7578378_7578392delATCTGAGCAGCGCTC	ENSP00000269305:p.Glu180_Asp184del	143	0		134	93	NM_000546	0	0	0	0	0	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
NF1	4763	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	29554308	29554317	+	Splice_Site	DEL	AGGTATGCCC	AGGTATGCCC	-			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	AGGTATGCCC	AGGTATGCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:29554308_29554317delAGGTATGCCC	ENST00000358273.4	+	19	2707_2708	c.2324_2325delAGGTATGCCC	c.(2323-2325)gag>g	p.E775fs	NF1_ENST00000356175.3_Splice_Site_p.E775fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	775					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)|p.E775A(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GGAAACACTGAGGTATGCCCTTAGCAACAG	0.462			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.775_775del		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	15	Whole gene deletion(8)|Unknown(5)|Substitution - Missense(2)	soft_tissue(7)|autonomic_ganglia(3)|urinary_tract(2)|central_nervous_system(2)|lung(1)	c.2324_2325del	GRCh37	CS030991|CS086412	NF1	S		.																																			SO:0001630	splice_region_variant	4763	exon19	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	ACACTGAGGTATG		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.2325+1AGGTATGCCC>-	17.37:g.29554308_29554317delAGGTATGCCC		86	0		66	38	NM_000267	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.462	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	Frame_Shift_Del
KRTAP4-8	728224	ucsc.edu	37	17	39254149	39254149	+	Missense_Mutation	SNP	G	G	C	rs201246375		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:39254149G>C	ENST00000333822.4	-	1	244	c.188C>G	c.(187-189)aCc>aGc	p.T63S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	63	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						GCGACAGCAGGTGGGCTGGCA	0.652																																					p.T63S		.											.	.	0			c.C188G						.						7.0	10.0	9.0					17																	39254149		651	1515	2166	SO:0001583	missense	728224	exon1			CAGCAGGTGGGCT	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.188C>G	17.37:g.39254149G>C	ENSP00000328444:p.Thr63Ser	62	2		70	14	NM_031960	0	0	0	0	0	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	3.249	-0.153662	0.06585	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.01215	5.16	3.11	-1.04	0.10068	.	1.573260	0.03861	N	0.273912	T	0.00724	0.0024	N	0.10809	0.05	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.43637	-0.9379	10	0.05721	T	0.95	.	4.7356	0.12986	0.2319:0.434:0.3341:0.0	.	63	Q9BYQ9	KRA48_HUMAN	S	63	ENSP00000328444:T63S	ENSP00000414561:T63S	T	-	2	0	KRTAP4-8	36507675	0.000000	0.05858	0.109000	0.21407	0.234000	0.25298	-2.396000	0.01052	-0.528000	0.06366	0.449000	0.29647	ACC	.		0.652	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
MAP3K3	4215	bcgsc.ca	37	17	61771099	61771099	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:61771099G>C	ENST00000361733.3	+	16	2163	c.1843G>C	c.(1843-1845)Gag>Cag	p.E615Q	MAP3K3_ENST00000579585.1_Missense_Mutation_p.E646Q|MAP3K3_ENST00000361357.3_Missense_Mutation_p.E646Q|MAP3K3_ENST00000584573.1_Missense_Mutation_p.E642Q|MAP3K3_ENST00000577395.1_Missense_Mutation_p.E611Q	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	615	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)			breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						TTCAGCTGAGGAGCTGCTCAC	0.617																																					p.E646Q		.											.	MAP3K3-979	0			c.G1936C						.						72.0	69.0	70.0					17																	61771099		2203	4300	6503	SO:0001583	missense	4215	exon17			GCTGAGGAGCTGC	U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1843G>C	17.37:g.61771099G>C	ENSP00000354485:p.Glu615Gln	80	1		102	5	NM_203351	0	0	4	4	0	B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	ENST00000361733.3	37	CCDS32702.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.067068	0.55539	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.27104	1.69;1.69	4.69	4.69	0.59074	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.23210	0.0561	N	0.20357	0.565	0.80722	D	1	P;P;B;P	0.38250	0.624;0.624;0.418;0.559	B;B;B;B	0.43445	0.42;0.292;0.326;0.295	T	0.04522	-1.0945	10	0.23891	T	0.37	.	17.6147	0.88064	0.0:0.0:1.0:0.0	.	611;583;615;646	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	Q	646;615	ENSP00000354927:E646Q;ENSP00000354485:E615Q	ENSP00000354927:E646Q	E	+	1	0	MAP3K3	59124831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.879000	0.87236	2.148000	0.66965	0.561000	0.74099	GAG	.		0.617	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443867.1	NM_002401	
QRICH2	84074	bcgsc.ca	37	17	74288631	74288631	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:74288631A>T	ENST00000262765.5	-	4	1858	c.1679T>A	c.(1678-1680)gTt>gAt	p.V560D		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	560	Gln-rich.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						ACCATGCTGAACTGCACCAGG	0.527																																					p.V560D		.											.	QRICH2-94	0			c.T1679A						.						200.0	158.0	172.0					17																	74288631		2203	4300	6503	SO:0001583	missense	84074	exon4			TGCTGAACTGCAC	AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.1679T>A	17.37:g.74288631A>T	ENSP00000262765:p.Val560Asp	410	0		416	22	NM_032134	0	0	0	0	0	A2RRE1|Q96LM3	Missense_Mutation	SNP	ENST00000262765.5	37	CCDS32741.1	.	.	.	.	.	.	.	.	.	.	a	6.387	0.439484	0.12104	.	.	ENSG00000129646	ENST00000262765;ENST00000301613	T	0.07567	3.18	4.93	-9.85	0.00476	.	.	.	.	.	T	0.02688	0.0081	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.39961	-0.9588	9	0.11182	T	0.66	2.2727	1.5765	0.02626	0.38:0.2524:0.2497:0.1179	.	560;560	B5MD94;Q9H0J4	.;QRIC2_HUMAN	D	560	ENSP00000262765:V560D	ENSP00000262765:V560D	V	-	2	0	QRICH2	71800226	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-13.576000	0.00001	-2.255000	0.00696	-3.142000	0.00059	GTT	.		0.527	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395140.1	NM_032134	
GAA	2548	bcgsc.ca	37	17	78083791	78083791	+	Silent	SNP	C	C	T	rs1800305	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:78083791C>T	ENST00000302262.3	+	9	1593	c.1374C>T	c.(1372-1374)taC>taT	p.Y458Y	GAA_ENST00000390015.3_Silent_p.Y458Y	NM_000152.3	NP_000143.2	P10253	LYAG_HUMAN	glucosidase, alpha; acid	458			Y -> C. {ECO:0000269|PubMed:22644586}.		cardiac muscle contraction (GO:0060048)|diaphragm contraction (GO:0002086)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|heart morphogenesis (GO:0003007)|locomotory behavior (GO:0007626)|lysosome organization (GO:0007040)|maltose metabolic process (GO:0000023)|muscle cell cellular homeostasis (GO:0046716)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|regulation of the force of heart contraction (GO:0002026)|sucrose metabolic process (GO:0005985)|tissue development (GO:0009888)|vacuolar sequestering (GO:0043181)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)		Acarbose(DB00284)|Miglitol(DB00491)	ACAGGCCCTACGACGAGGGTC	0.657													C|||	492	0.0982428	0.2284	0.0533	5008	,	,		15097	0.0		0.0736	False		,,,				2504	0.0808				p.Y458Y		.											.	GAA-91	0			c.C1374T						.	C	,,	809,3597	304.9+/-288.7	73,663,1467	40.0	46.0	44.0		1374,1374,1374	-8.6	0.6	17	dbSNP_89	44	615,7985	158.0+/-211.6	28,559,3713	no	coding-synonymous,coding-synonymous,coding-synonymous	GAA	NM_000152.3,NM_001079803.1,NM_001079804.1	,,	101,1222,5180	TT,TC,CC		7.1512,18.3613,10.9488	,,	458/953,458/953,458/953	78083791	1424,11582	2203	4300	6503	SO:0001819	synonymous_variant	2548	exon10			GCCCTACGACGAG		CCDS32760.1	17q25.2-q25.3	2014-09-17	2008-08-01				3.2.1.20		4065	protein-coding gene	gene with protein product	"""Pompe disease"", ""glycogen storage disease type II"""	606800					Standard	NM_000152		Approved		uc002jxq.3	P10253		ENST00000302262.3:c.1374C>T	17.37:g.78083791C>T		147	1		153	9	NM_001079803	0	0	29	29	0	Q09GN4|Q14351|Q16302|Q8IWE7	Silent	SNP	ENST00000302262.3	37	CCDS32760.1																																																																																			C|0.902;T|0.098		0.657	GAA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437441.1		
UTS2R	2837	broad.mit.edu	37	17	80333066	80333066	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr17:80333066C>A	ENST00000313135.2	+	1	914	c.866C>A	c.(865-867)gCg>gAg	p.A289E		NM_018949.1	NP_061822.1	Q9UKP6	UR2R_HUMAN	urotensin 2 receptor	289					blood circulation (GO:0008015)|negative regulation of blood pressure (GO:0045776)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cell growth (GO:0030307)|positive regulation of circadian sleep/wake cycle, REM sleep (GO:0046005)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of vasoconstriction (GO:0045907)|regulation of vasodilation (GO:0042312)|response to drug (GO:0042493)|signal transduction (GO:0007165)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|urotensin II receptor activity (GO:0001604)			breast(1)|endometrium(4)|kidney(1)|lung(2)	8	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			GCCCCGCTGGCGCCGCGGACG	0.672																																					p.A289E		.											.	UTS2R-153	0			c.C866A						.																																			SO:0001583	missense	2837	exon1			CGCTGGCGCCGCG	AF140631	CCDS11810.1	17q25.3	2013-04-30	2004-07-13	2004-07-13		ENSG00000181408			4468	protein-coding gene	gene with protein product		600896	"""G protein-coupled receptor 14"""	GPR14		8666380, 10499587	Standard	NM_018949		Approved		uc010wvl.2	Q9UKP6		ENST00000313135.2:c.866C>A	17.37:g.80333066C>A	ENSP00000323516:p.Ala289Glu	47	2		149	14	NM_018949	0	0	0	0	0	B2RMV8	Missense_Mutation	SNP	ENST00000313135.2	37	CCDS11810.1	.	.	.	.	.	.	.	.	.	.	C	13.69	2.313287	0.40996	.	.	ENSG00000181408	ENST00000313135	T	0.72051	-0.62	4.95	1.39	0.22231	GPCR, rhodopsin-like superfamily (1);	0.338048	0.28257	U	0.016009	T	0.61375	0.2342	N	0.17723	0.515	0.09310	N	1	P	0.42973	0.796	P	0.50791	0.65	T	0.55711	-0.8098	10	0.07644	T	0.81	.	14.9821	0.71319	0.0:0.5448:0.4552:0.0	.	289	Q9UKP6	UR2R_HUMAN	E	289	ENSP00000323516:A289E	ENSP00000323516:A289E	A	+	2	0	UTS2R	77926355	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	0.380000	0.20602	0.518000	0.28383	0.637000	0.83480	GCG	.		0.672	UTS2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443506.1	NM_018949	
C18orf25	147339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	43796373	43796373	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr18:43796373G>A	ENST00000282059.6	+	2	901	c.527G>A	c.(526-528)aGc>aAc	p.S176N	C18orf25_ENST00000321319.6_Missense_Mutation_p.S176N	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	176										central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						GGTCATCGGAGCCAAAAGCAC	0.493																																					p.S176N		.											.	C18orf25-515	0			c.G527A						.						63.0	66.0	65.0					18																	43796373		2055	4184	6239	SO:0001583	missense	147339	exon2			ATCGGAGCCAAAA	AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.527G>A	18.37:g.43796373G>A	ENSP00000282059:p.Ser176Asn	161	1		168	154	NM_145055	0	0	1	5	4	A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Missense_Mutation	SNP	ENST00000282059.6	37	CCDS42430.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.016165	0.75161	.	.	ENSG00000152242	ENST00000282059;ENST00000321319	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.76912	0.4054	L	0.55481	1.735	0.80722	D	1	D;D	0.67145	0.989;0.996	D;D	0.75484	0.979;0.986	T	0.78445	-0.2201	9	0.87932	D	0	-7.0207	19.3124	0.94195	0.0:0.0:1.0:0.0	.	176;176	Q96B23-2;Q96B23	.;CR025_HUMAN	N	176	.	ENSP00000282059:S176N	S	+	2	0	C18orf25	42050371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.412000	0.97347	2.585000	0.87301	0.561000	0.74099	AGC	.		0.493	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445242.1	NM_145055	
KIAA1468	57614	broad.mit.edu	37	18	59919898	59919898	+	Splice_Site	SNP	C	C	A	rs386352321		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr18:59919898C>A	ENST00000398130.2	+	12	1967	c.1735C>A	c.(1735-1737)Caa>Aaa	p.Q579K	KIAA1468_ENST00000256858.6_Splice_Site_p.Q579K	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	579								p.Q579K(3)		autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				ATTTTTCAGGCAAATGATACT	0.383																																					p.Q579K		.											.	KIAA1468-158	3	Substitution - Missense(3)	lung(1)|endometrium(1)|kidney(1)	c.C1735A						.						101.0	94.0	96.0					18																	59919898		2203	4300	6503	SO:0001630	splice_region_variant	57614	exon12			TTCAGGCAAATGA	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.1734-1C>A	18.37:g.59919898C>A		39	0		62	5	NM_020854	0	0	0	0	0		Missense_Mutation	SNP	ENST00000398130.2	37	CCDS11979.2	.	.	.	.	.	.	.	.	.	.	C	15.86	2.958076	0.53400	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.40476	1.03;1.03	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.57388	0.2050	L	0.41710	1.295	0.80722	D	1	B;D;D	0.76494	0.007;0.999;0.998	B;D;D	0.71184	0.059;0.972;0.969	T	0.49143	-0.8970	9	.	.	.	-11.5654	20.0621	0.97678	0.0:1.0:0.0:0.0	.	579;579;223	Q9P260-2;Q9P260;B2RD46	.;K1468_HUMAN;.	K	579	ENSP00000381198:Q579K;ENSP00000256858:Q579K	.	Q	+	1	0	KIAA1468	58070878	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	5.830000	0.69324	2.750000	0.94351	0.655000	0.94253	CAA	.		0.383	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256187.1	NM_020854	Missense_Mutation
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000575389.2_Missense_Mutation_p.L593V|SALL3_ENST00000536229.3_Missense_Mutation_p.L460V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	0	0		7	7	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000453954.2_Silent_p.S350S|TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000588136.1_Silent_p.S434S|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		0	0		14	4	NM_003200	0	0	18	18	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
PTPRS	5802	hgsc.bcm.edu	37	19	5222831	5222831	+	Missense_Mutation	SNP	G	G	A	rs2230610	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:5222831G>A	ENST00000587303.1	-	17	3071	c.2972C>T	c.(2971-2973)gCg>gTg	p.A991V	PTPRS_ENST00000348075.2_Missense_Mutation_p.A969V|PTPRS_ENST00000262963.6_Missense_Mutation_p.A987V|PTPRS_ENST00000592099.1_Intron|PTPRS_ENST00000353284.2_Intron|PTPRS_ENST00000357368.4_Missense_Mutation_p.A991V|PTPRS_ENST00000588012.1_Missense_Mutation_p.A969V|PTPRS_ENST00000372412.4_Missense_Mutation_p.A992V|PTPRS_ENST00000588552.1_Intron			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	991	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CGCGTTCTCCGCGCCCGGCTC	0.736													G|||	35	0.00698882	0.0	0.0058	5008	,	,		8299	0.0		0.0298	False		,,,				2504	0.001				p.A991V		.											.	PTPRS-357	0			c.C2972T						.	G	VAL/ALA,,VAL/ALA,	18,4126		0,18,2054	10.0	14.0	13.0		2972,,2906,	3.5	1.0	19	dbSNP_98	13	223,7773		3,217,3778	yes	missense,intron,missense,intron	PTPRS	NM_002850.3,NM_130853.2,NM_130854.2,NM_130855.2	64,,64,	3,235,5832	AA,AG,GG		2.7889,0.4344,1.9852	benign,,benign,	991/1949,,969/1911,	5222831	241,11899	2072	3998	6070	SO:0001583	missense	5802	exon18			TTCTCCGCGCCCG	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.2972C>T	19.37:g.5222831G>A	ENSP00000467537:p.Ala991Val	0	0		15	9	NM_002850	0	0	4	6	2	O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	ENST00000587303.1	37	CCDS45930.1	33	0.01510989010989011	0	0.0	6	0.016574585635359115	0	0.0	27	0.03562005277044855	G	13.79	2.342295	0.41498	0.004344	0.027889	ENSG00000105426	ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075	T;T;T;T	0.56776	0.44;0.44;0.44;0.44	3.47	3.47	0.39725	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.085994	0.47093	U	0.000244	T	0.35856	0.0946	M	0.65498	2.005	0.80722	D	1	D;P	0.76494	0.999;0.663	D;B	0.71184	0.972;0.196	T	0.55585	-0.8118	10	0.25751	T	0.34	.	16.2373	0.82384	0.0:0.0:1.0:0.0	rs2230610	969;991	Q13332-6;Q13332	.;PTPRS_HUMAN	V	992;991;991;982;987;969	ENSP00000361489:A992V;ENSP00000349932:A991V;ENSP00000262963:A987V;ENSP00000269907:A969V	ENSP00000262963:A987V	A	-	2	0	PTPRS	5173831	0.995000	0.38212	1.000000	0.80357	0.237000	0.25408	2.558000	0.45879	2.257000	0.74773	0.557000	0.71058	GCG	G|0.979;A|0.021		0.736	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
LPHN1	22859	broad.mit.edu	37	19	14262129	14262129	+	Silent	SNP	A	A	C			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:14262129A>C	ENST00000340736.6	-	24	4278	c.3981T>G	c.(3979-3981)ggT>ggG	p.G1327G	CTB-55O6.12_ENST00000588658.1_RNA|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000361434.3_Silent_p.G1322G	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	1327					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						CCCGGTCAGCACCCCCGGGCC	0.716																																					p.G1327G		.											.	LPHN1-523	0			c.T3981G						.						5.0	6.0	6.0					19																	14262129		2111	4119	6230	SO:0001819	synonymous_variant	22859	exon24			GTCAGCACCCCCG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.3981T>G	19.37:g.14262129A>C		22	6		79	28	NM_001008701	0	0	0	0	0	Q96IE7|Q9BU07|Q9HAR3	Silent	SNP	ENST00000340736.6	37	CCDS32928.1																																																																																			.		0.716	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
MAP1S	55201	hgsc.bcm.edu	37	19	17837425	17837425	+	Missense_Mutation	SNP	C	C	G	rs17710707	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:17837425C>G	ENST00000324096.4	+	5	1383	c.1232C>G	c.(1231-1233)tCt>tGt	p.S411C	MAP1S_ENST00000544059.2_Missense_Mutation_p.S385C|MAP1S_ENST00000597681.1_Intron|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	411	Necessary for the microtubule-organizing center localization.		S -> C (in dbSNP:rs17710707). {ECO:0000269|PubMed:15489334}.		apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						ACGCTGGCCTCTGTGTGCGCC	0.731													C|||	574	0.114617	0.0832	0.1772	5008	,	,		12607	0.0169		0.2068	False		,,,				2504	0.1186				p.S411C		.											.	MAP1S-90	0			c.C1232G						.	C	CYS/SER	344,3714		17,310,1702	5.0	5.0	5.0		1232	2.6	0.2	19	dbSNP_123	5	1234,6710		91,1052,2829	no	missense	MAP1S	NM_018174.4	112	108,1362,4531	GG,GC,CC		15.5337,8.4771,13.1478	probably-damaging	411/1060	17837425	1578,10424	2029	3972	6001	SO:0001583	missense	55201	exon5			TGGCCTCTGTGTG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1232C>G	19.37:g.17837425C>G	ENSP00000325313:p.Ser411Cys	0	0		16	10	NM_018174	0	0	2	7	5	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	257	0.11767399267399267	34	0.06910569105691057	66	0.18232044198895028	7	0.012237762237762238	150	0.19788918205804748	C	15.12	2.738952	0.49045	0.084771	0.155337	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.03801	3.8;3.8	3.67	2.61	0.31194	.	0.155772	0.30277	N	0.009981	T	0.00012	0.0000	M	0.79614	2.46	0.09310	P	0.99999454915	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.06006	-1.0851	9	0.87932	D	0	-16.5051	8.9574	0.35827	0.0:0.8847:0.0:0.1153	rs17710707	385;411	B4DH53;Q66K74	.;MAP1S_HUMAN	C	411;385	ENSP00000325313:S411C;ENSP00000439243:S385C	ENSP00000325313:S411C	S	+	2	0	MAP1S	17698425	0.998000	0.40836	0.209000	0.23619	0.382000	0.30200	7.628000	0.83189	0.516000	0.28340	-0.291000	0.09656	TCT	C|0.883;G|0.117		0.731	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	FBXO17_ENST00000595329.1_Silent_p.P14P|SARS2_ENST00000448145.2_5'Flank|CTC-360G5.8_ENST00000599996.1_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		0	0		9	8	NM_148169	0	0	0	12	12	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
PPM1N	147699	hgsc.bcm.edu	37	19	46002368	46002368	+	Missense_Mutation	SNP	C	C	T	rs371865410		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:46002368C>T	ENST00000451287.2	+	1	638	c.638C>T	c.(637-639)gCc>gTc	p.A213V	PPM1N_ENST00000396736.2_5'Flank|PPM1N_ENST00000456399.2_Intron|RTN2_ENST00000590526.1_5'Flank|RTN2_ENST00000344680.4_5'Flank|PPM1N_ENST00000324688.4_Missense_Mutation_p.A135V|RTN2_ENST00000245923.4_5'Flank|PPM1N_ENST00000401705.1_Intron|PPM1N_ENST00000396735.2_5'Flank|PPM1N_ENST00000396737.2_Intron|PPM1N_ENST00000401593.1_5'Flank|RTN2_ENST00000589384.1_5'Flank	NM_001080401.1	NP_001073870.1	Q8N819	PPM1N_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative)	213	PP2C-like.						magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)	9						CGCATCCACGCCGCTGGCGGC	0.741																																					p.A213V		.											.	.	0			c.C638T						.		VAL/ALA	0,3628		0,0,1814	7.0	9.0	8.0		638	0.6	0.6	19		8	1,7935		0,1,3967	no	missense	PPM1N	NM_001080401.1	64	0,1,5781	TT,TC,CC		0.0126,0.0,0.0086	possibly-damaging	213/431	46002368	1,11563	1814	3968	5782	SO:0001583	missense	147699	exon1			TCCACGCCGCTGG	AK097444	CCDS46115.1	19q13.32	2012-04-17			ENSG00000213889	ENSG00000213889		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26845	protein-coding gene	gene with protein product							Standard	NM_001080401		Approved	FLJ40125	uc002pce.3	Q8N819	OTTHUMG00000140397	ENST00000451287.2:c.638C>T	19.37:g.46002368C>T	ENSP00000397050:p.Ala213Val	0	0		8	6	NM_001080401	0	0	0	0	0	Q6P662	Missense_Mutation	SNP	ENST00000451287.2	37	CCDS46115.1	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087330	0.55968	0.0	1.26E-4	ENSG00000213889	ENST00000451287;ENST00000396734;ENST00000324688	T;T	0.18810	2.19;2.19	3.95	0.621	0.17643	Protein phosphatase 2C-like (5);	0.329086	0.26103	U	0.026327	T	0.25005	0.0607	M	0.82923	2.615	0.22096	N	0.999366	P	0.37158	0.585	B	0.38921	0.285	T	0.13818	-1.0495	10	0.56958	D	0.05	.	5.8092	0.18457	0.565:0.34:0.095:0.0	.	213	Q8N819	PPM1N_HUMAN	V	213;213;135	ENSP00000397050:A213V;ENSP00000321761:A135V	ENSP00000321761:A135V	A	+	2	0	PPM1N	50694208	0.963000	0.33076	0.567000	0.28434	0.733000	0.41908	1.909000	0.39917	0.035000	0.15519	0.313000	0.20887	GCC	.		0.741	PPM1N-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326517.2	NM_001080401	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48184474	48184474	+	Missense_Mutation	SNP	C	C	T	rs3745762	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:48184474C>T	ENST00000396720.3	+	6	2241	c.2047C>T	c.(2047-2049)Ccc>Tcc	p.P683S	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	683			P -> S (in dbSNP:rs3745762).							breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GGGGCAGCCGCCCTCTGCCAC	0.731													C|||	1734	0.346246	0.4781	0.317	5008	,	,		10675	0.3214		0.2545	False		,,,				2504	0.3088				p.P683S		.											.	GLTSCR1-48	0			c.C2047T						.	C	SER/PRO	777,1685		98,581,552	2.0	2.0	2.0		2047	1.8	0.6	19	dbSNP_107	2	1019,4295		102,815,1740	yes	missense	GLTSCR1	NM_015711.3	74	200,1396,2292	TT,TC,CC		19.1758,31.5597,23.0967	probably-damaging	683/1561	48184474	1796,5980	1231	2657	3888	SO:0001583	missense	29998	exon6			CAGCCGCCCTCTG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.2047C>T	19.37:g.48184474C>T	ENSP00000379946:p.Pro683Ser	0	0		10	10	NM_015711	0	0	0	2	2	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	37	CCDS46134.1	690	0.3159340659340659	237	0.4817073170731707	97	0.26795580110497236	164	0.2867132867132867	192	0.2532981530343008	C	0.504	-0.869519	0.02570	0.315597	0.191758	ENSG00000063169	ENST00000396720	T	0.29142	1.58	3.98	1.84	0.25277	.	.	.	.	.	T	0.00012	0.0000	L	0.27053	0.805	0.80722	P	0.0	B	0.13594	0.008	B	0.12156	0.007	T	0.46898	-0.9158	8	0.36615	T	0.2	.	1.1554	0.01795	0.1785:0.4436:0.1729:0.205	rs3745762	683	Q9NZM4	GSCR1_HUMAN	S	683	ENSP00000379946:P683S	ENSP00000379946:P683S	P	+	1	0	GLTSCR1	52876286	0.017000	0.18338	0.560000	0.28344	0.253000	0.25986	0.274000	0.18680	1.012000	0.39366	0.561000	0.74099	CCC	C|0.684;T|0.316		0.731	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
MIR520F	574464	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	54185480	54185480	+	RNA	SNP	T	T	C			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:54185480T>C	ENST00000384824.1	+	0	68				MIR519E_ENST00000385075.1_RNA|MIR515-2_ENST00000384883.1_RNA	NR_030186.1				microRNA 520f																		TGCTTCCTTTTAGAGGGTTAC	0.458																																					.		.											.	.	0			.						.						69.0	63.0	65.0					19																	54185480		1568	3582	5150			574464	.			TCCTTTTAGAGGG			19q13.42	2011-09-12		2008-12-18	ENSG00000207555	ENSG00000207555		"""ncRNAs / Micro RNAs"""	32096	non-coding RNA	RNA, micro				MIRN520F			Standard	NR_030186		Approved	hsa-mir-520f	uc021uzp.1				19.37:g.54185480T>C		98	1		219	138	.	0	0	0	0	0		RNA	SNP	ENST00000384824.1	37																																																																																				.		0.458	MIR520F-201	KNOWN	basic	miRNA	miRNA		NR_030186	
RFPL4A	342931	broad.mit.edu	37	19	56274284	56274284	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:56274284delC	ENST00000434937.2	+	3	778	c.607delC	c.(607-609)cctfs	p.P203fs		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	203	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CAGCACTGTGCCTATGACTCC	0.502																																					p.P203fs		.											.	RFPL4A-68	0			c.607delC						.						93.0	76.0	81.0					19																	56274284		692	1589	2281	SO:0001589	frameshift_variant	342931	exon3			ACTGTGCCTATGA		CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.607delC	19.37:g.56274284delC	ENSP00000392936:p.Pro203fs	286	0		483	51	NM_001145014	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000434937.2	37	CCDS46201.1																																																																																			.		0.502	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384184.1	XM_292796	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	0	0		14	13	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF837	116412	hgsc.bcm.edu	37	19	58879118	58879118	+	Missense_Mutation	SNP	G	G	A	rs202005567	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr19:58879118G>A	ENST00000427624.2	-	3	1904	c.1582C>T	c.(1582-1584)Cgc>Tgc	p.R528C	ZNF837_ENST00000597582.1_Missense_Mutation_p.R528C|CTD-2619J13.3_ENST00000599889.1_RNA			Q96EG3	ZN837_HUMAN	zinc finger protein 837	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						GGCGCGGCGCGGCCCCCGTGC	0.701													G|||	7	0.00139776	0.0	0.0	5008	,	,		14240	0.0		0.007	False		,,,				2504	0.0				p.R528C		.											.	ZNF837-68	0			c.C1582T						.						3.0	4.0	4.0					19																	58879118		620	1452	2072	SO:0001583	missense	116412	exon3			CGGCGCGGCCCCC	BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.1582C>T	19.37:g.58879118G>A	ENSP00000405699:p.Arg528Cys	0	0		34	22	NM_138466	0	0	2	3	1		Missense_Mutation	SNP	ENST00000427624.2	37	CCDS46216.1	.	.	.	.	.	.	.	.	.	.	G	9.346	1.064256	0.20067	.	.	ENSG00000152475	ENST00000427624	T	0.07216	3.21	0.854	-0.29	0.12847	Zinc finger, C2H2 (1);	.	.	.	.	T	0.04588	0.0125	L	0.41710	1.295	0.26705	N	0.971096	D	0.71674	0.998	B	0.32211	0.142	T	0.38394	-0.9663	9	0.87932	D	0	.	3.1397	0.06451	0.3375:0.0:0.6625:0.0	.	528	Q96EG3	ZN837_HUMAN	C	528	ENSP00000405699:R528C	ENSP00000405699:R528C	R	-	1	0	ZNF837	63570930	.	.	0.011000	0.14972	0.077000	0.17291	.	.	-0.072000	0.12864	0.462000	0.41574	CGC	.		0.701	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000458098.1_Silent_p.C153C|CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000478738.1_Intron	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		0	0		5	5	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
NT5C1B	93034	hgsc.bcm.edu	37	2	18766156	18766156	+	Nonsense_Mutation	SNP	G	G	T	rs61742596	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:18766156G>T	ENST00000359846.2	-	5	604	c.527C>A	c.(526-528)tCg>tAg	p.S176*	NT5C1B_ENST00000600945.1_Nonsense_Mutation_p.S176*|NT5C1B_ENST00000304081.4_Nonsense_Mutation_p.S116*|NT5C1B_ENST00000460052.1_5'Flank|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B-RDH14_ENST00000532967.1_Nonsense_Mutation_p.S176*	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	176	Pro-rich.|Ser-rich.				nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TGGCTGGAGCGAGGGCTGCCC	0.721													G|||	205	0.0409345	0.0023	0.1225	5008	,	,		12349	0.0625		0.0447	False		,,,				2504	0.0092				p.S193X		.											.	NT5C1B-47	0			c.C578A						.	G	stop/SER,stop/SER,stop/SER,stop/SER,stop/SER,stop/SER,stop/SER	28,4122		1,26,2048	10.0	17.0	15.0		527,476,578,533,353,527,347	3.3	0.3	2	dbSNP_129	15	368,7750		13,342,3704	no	stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained,stop-gained	NT5C1B,NT5C1B-RDH14	NM_001002006.2,NM_001199086.1,NM_001199087.1,NM_001199088.1,NM_001199103.1,NM_001199104.1,NM_033253.3	,,,,,,	14,368,5752	TT,TG,GG		4.5331,0.6747,3.2279	,,,,,,	176/611,159/594,193/628,178/613,118/651,176/603,116/551	18766156	396,11872	2075	4059	6134	SO:0001587	stop_gained	93034	exon5			TGGAGCGAGGGCT	AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.527C>A	2.37:g.18766156G>T	ENSP00000352904:p.Ser176*	0	0		14	13	NM_001199087	0	0	0	0	0	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Nonsense_Mutation	SNP	ENST00000359846.2	37	CCDS33150.1	111	0.050824175824175824	4	0.008130081300813009	30	0.08287292817679558	38	0.06643356643356643	39	0.051451187335092345	G	18.93	3.728402	0.69074	0.006747	0.045331	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846;ENST00000416783	.	.	.	4.15	3.26	0.37387	.	3.553780	0.01074	N	0.004867	.	.	.	.	.	.	0.09310	P	0.9999999999999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.3183	6.8928	0.24238	0.1236:0.0:0.8764:0.0	.	.	.	.	X	176;118;116;176;193	.	ENSP00000305979:S116X	S	-	2	0	NT5C1B-RDH14;NT5C1B	18629637	0.438000	0.25602	0.345000	0.25642	0.048000	0.14542	2.099000	0.41767	2.246000	0.74042	0.563000	0.77884	TCG	G|0.950;T|0.050		0.721	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000323822.1		
FAM179A	165186	bcgsc.ca	37	2	29226498	29226498	+	Silent	SNP	G	G	A	rs12613325	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:29226498G>A	ENST00000379558.4	+	6	1131	c.780G>A	c.(778-780)ccG>ccA	p.P260P	FAM179A_ENST00000403861.2_Silent_p.P260P	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	260										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TTCCCAGCCCGTTACCTCCAG	0.642													A|||	2971	0.593251	0.3056	0.7089	5008	,	,		18152	0.6677		0.7584	False		,,,				2504	0.6534				p.P260P		.											.	FAM179A-26	0			c.G780A						.	A		1513,2439		294,925,757	28.0	31.0	30.0		780	2.0	0.0	2	dbSNP_120	30	6585,1697		2629,1327,185	no	coding-synonymous	FAM179A	NM_199280.2		2923,2252,942	AA,AG,GG		20.4902,38.2844,33.8074		260/1020	29226498	8098,4136	1976	4141	6117	SO:0001819	synonymous_variant	165186	exon6			CAGCCCGTTACCT	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.780G>A	2.37:g.29226498G>A		243	2		255	9	NM_199280	0	0	0	0	0	Q6ZUF5	Silent	SNP	ENST00000379558.4	37	CCDS1769.2																																																																																			G|0.369;A|0.631		0.642	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
PAIP2B	400961	bcgsc.ca	37	2	71417065	71417065	+	Silent	SNP	G	G	T	rs357777	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:71417065G>T	ENST00000244221.8	-	3	391	c.225C>A	c.(223-225)ccC>ccA	p.P75P		NM_020459.1	NP_065192.1	Q9ULR5	PAI2B_HUMAN	poly(A) binding protein interacting protein 2B	75					negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)	translation repressor activity, nucleic acid binding (GO:0000900)			large_intestine(1)|lung(1)	2						GGTCTCGTGAGGGAATAAACC	0.493													T|||	4796	0.957668	0.9622	0.9438	5008	,	,		19061	0.997		0.9076	False		,,,				2504	0.9724				p.P75P		.											.	PAIP2B-46	0			c.C225A						.	T		3738,216		1767,204,6	64.0	62.0	62.0		225	-1.2	0.9	2	dbSNP_79	62	7617,721		3480,657,32	no	coding-synonymous	PAIP2B	NM_020459.1		5247,861,38	TT,TG,GG		8.6472,5.4628,7.6228		75/124	71417065	11355,937	1977	4169	6146	SO:0001819	synonymous_variant	400961	exon3			TCGTGAGGGAATA		CCDS46322.1	2p13.3	2007-07-16			ENSG00000124374	ENSG00000124374			29200	protein-coding gene	gene with protein product		611018				16804161	Standard	NM_020459		Approved	KIAA1155	uc002shu.2	Q9ULR5	OTTHUMG00000153284	ENST00000244221.8:c.225C>A	2.37:g.71417065G>T		121	0		115	6	NM_020459	0	0	5	5	0		Silent	SNP	ENST00000244221.8	37	CCDS46322.1																																																																																			G|0.052;T|0.948		0.493	PAIP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330547.2	XM_376062	
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	47	5		136	36	NM_001145054	0	0	0	0	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
EPB41L5	57669	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	120834600	120834601	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:120834600_120834601delTT	ENST00000263713.5	+	8	773_774	c.559_560delTT	c.(559-561)ttcfs	p.F187fs	EPB41L5_ENST00000452780.1_Frame_Shift_Del_p.F187fs|EPB41L5_ENST00000443124.1_Frame_Shift_Del_p.F187fs|EPB41L5_ENST00000331393.4_Frame_Shift_Del_p.F187fs|EPB41L5_ENST00000443902.2_Frame_Shift_Del_p.F187fs	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	187	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TGTCTCAGAGTTCAGATTCGTG	0.371																																					p.187_187del		.											.	EPB41L5-91	0			c.559_560del						.																																			SO:0001589	frameshift_variant	57669	exon8			TCAGAGTTCAGAT	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.559_560delTT	2.37:g.120834600_120834601delTT	ENSP00000263713:p.Phe187fs	77	0		58	56	NM_020909	0	0	0	0	0	Q7Z5S1|Q8IZ12|Q9H975	Frame_Shift_Del	DEL	ENST00000263713.5	37	CCDS2130.1																																																																																			.		0.371	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
AMER3	205147	bcgsc.ca	37	2	131520598	131520598	+	Missense_Mutation	SNP	G	G	A	rs200015684		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:131520598G>A	ENST00000423981.1	+	2	1063	c.953G>A	c.(952-954)cGt>cAt	p.R318H	AMER3_ENST00000321420.4_Missense_Mutation_p.R318H	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	318					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										CGCTCAGTGCGTCAGCAGCAG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		17745	0.001		0.0	False		,,,				2504	0.0				p.R318H		.											.	.	0			c.G953A						.	G	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	36.0	42.0	40.0		953,953,953,953	1.0	0.2	2		40	1,8597	1.2+/-3.3	0,1,4298	yes	missense,missense,missense,missense	FAM123C	NM_001105193.1,NM_001105194.1,NM_001105195.1,NM_152698.2	29,29,29,29	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	318/862,318/862,318/862,318/862	131520598	1,13003	2203	4299	6502	SO:0001583	missense	205147	exon2			CAGTGCGTCAGCA	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.953G>A	2.37:g.131520598G>A	ENSP00000392700:p.Arg318His	121	4		172	157	NM_152698	0	0	0	0	0	B7ZLH6	Missense_Mutation	SNP	ENST00000423981.1	37	CCDS2164.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	14.40	2.523111	0.44866	0.0	1.16E-4	ENSG00000178171	ENST00000321420;ENST00000423981	T;T	0.17854	2.25;2.25	4.97	0.997	0.19851	.	0.614690	0.14376	N	0.323482	T	0.23410	0.0566	L	0.47716	1.5	0.24021	N	0.99615	D	0.58970	0.984	P	0.58077	0.832	T	0.09037	-1.0693	10	0.56958	D	0.05	.	4.4413	0.11575	0.3623:0.1586:0.4791:0.0	.	318	Q8N944	F123C_HUMAN	H	318	ENSP00000314914:R318H;ENSP00000392700:R318H	ENSP00000314914:R318H	R	+	2	0	FAM123C	131237068	0.001000	0.12720	0.236000	0.24074	0.431000	0.31685	-0.382000	0.07408	-0.025000	0.13918	0.561000	0.74099	CGT	G|0.999;A|0.000		0.662	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
GALNT5	11227	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	158115239	158115239	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:158115239C>G	ENST00000259056.4	+	1	1130	c.645C>G	c.(643-645)gaC>gaG	p.D215E		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	215					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						CTGAAAGGGACTTGAATGTGA	0.493																																					p.D215E		.											.	GALNT5-290	0			c.C645G						.						52.0	54.0	53.0					2																	158115239		2203	4300	6503	SO:0001583	missense	11227	exon1			AAGGGACTTGAAT	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.645C>G	2.37:g.158115239C>G	ENSP00000259056:p.Asp215Glu	56	0		87	40	NM_014568	0	0	0	0	0	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	ENST00000259056.4	37	CCDS2203.1	.	.	.	.	.	.	.	.	.	.	C	13.31	2.198846	0.38806	.	.	ENSG00000136542	ENST00000259056	T	0.56776	0.44	5.66	3.85	0.44370	.	3.265900	0.00695	N	0.000743	T	0.39627	0.1085	N	0.14661	0.345	0.09310	N	1	B	0.19817	0.039	B	0.19946	0.027	T	0.31447	-0.9943	10	0.62326	D	0.03	.	5.6404	0.17561	0.0:0.666:0.1633:0.1707	.	215	Q7Z7M9	GALT5_HUMAN	E	215	ENSP00000259056:D215E	ENSP00000259056:D215E	D	+	3	2	GALNT5	157823485	0.000000	0.05858	0.008000	0.14137	0.005000	0.04900	-0.771000	0.04699	1.534000	0.49203	-0.136000	0.14681	GAC	.		0.493	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568	
CATIP	375307	bcgsc.ca	37	2	219221846	219221846	+	Silent	SNP	G	G	A	rs4324314	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:219221846G>A	ENST00000289388.3	+	2	83	c.54G>A	c.(52-54)tcG>tcA	p.S18S	AC021016.8_ENST00000411433.1_RNA	NM_198559.1	NP_940961.1	Q7Z7H3	CATIP_HUMAN		18					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	16		Renal(207;0.0915)		Epithelial(149;8.08e-07)|all cancers(144;0.000146)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACCAGCCCTCGGGTCCGGAGT	0.637													G|||	594	0.11861	0.0408	0.2421	5008	,	,		15900	0.1032		0.2117	False		,,,				2504	0.0562				p.S18S		.											.	C2orf62-68	0			c.G54A						.	G		316,4090	167.6+/-198.6	9,298,1896	55.0	55.0	55.0		54	-3.9	0.0	2	dbSNP_111	55	1929,6671	338.5+/-322.8	219,1491,2590	no	coding-synonymous	C2orf62	NM_198559.1		228,1789,4486	AA,AG,GG		22.4302,7.172,17.2613		18/388	219221846	2245,10761	2203	4300	6503	SO:0001819	synonymous_variant	375307	exon2			GCCCTCGGGTCCG																												ENST00000289388.3:c.54G>A	2.37:g.219221846G>A		95	1		113	6	NM_198559	0	0	0	0	0		Silent	SNP	ENST00000289388.3	37	CCDS2414.1																																																																																			G|0.844;A|0.156		0.637	C2orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256771.1		
ALPPL2	251	hgsc.bcm.edu	37	2	233274475	233274475	+	Missense_Mutation	SNP	C	C	A	rs56080708	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr2:233274475C>A	ENST00000295453.3	+	11	1544	c.1492C>A	c.(1492-1494)Cgc>Agc	p.R498S		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	498				R -> P (in Ref. 1; AAA98616 and 4; CAA39425). {ECO:0000305}.|R -> S (in Ref. 3; CAA37374). {ECO:0000305}.	dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CCTGGCGCCCCGCGCCGGCAC	0.731													c|||	477	0.0952476	0.0514	0.062	5008	,	,		10169	0.2133		0.0785	False		,,,				2504	0.0736				p.R498S		.											.	ALPPL2-91	0			c.C1492A						.	C	SER/ARG	328,4022		17,294,1864	12.0	16.0	15.0		1492	1.2	0.0	2	dbSNP_129	15	716,7764		55,606,3579	no	missense	ALPPL2	NM_031313.2	110	72,900,5443	AA,AC,CC		8.4434,7.5402,8.1372	benign	498/533	233274475	1044,11786	2175	4240	6415	SO:0001583	missense	251	exon11			GCGCCCCGCGCCG	J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.1492C>A	2.37:g.233274475C>A	ENSP00000295453:p.Arg498Ser	0	0		13	10	NM_031313	0	0	0	0	0	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	ENST00000295453.3	37	CCDS2491.1	231	0.10576923076923077	28	0.056910569105691054	21	0.058011049723756904	120	0.2097902097902098	62	0.08179419525065963	c	0.762	-0.768825	0.02974	0.075402	0.084434	ENSG00000163286	ENST00000295453	D	0.95412	-3.7	2.17	1.24	0.21308	Alkaline-phosphatase-like, core domain (1);	0.504996	0.18426	N	0.141584	T	0.00271	0.0008	N	0.08118	0	0.80722	P	0.0	B	0.06786	0.001	B	0.06405	0.002	T	0.42327	-0.9458	9	0.06236	T	0.91	.	4.2075	0.10495	0.3616:0.5075:0.0:0.1308	rs56080708;rs61730276	498	P10696	PPBN_HUMAN	S	498	ENSP00000295453:R498S	ENSP00000295453:R498S	R	+	1	0	ALPPL2	232982719	0.000000	0.05858	0.020000	0.16555	0.076000	0.17211	-0.511000	0.06321	0.233000	0.21120	0.205000	0.17691	CGC	C|0.901;A|0.099		0.731	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257034.2	NM_031313	
ZCCHC3	85364	hgsc.bcm.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	CGG	-	rs11468351|rs5839847|rs6147263	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	CGG	CGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr20:278688_278690delCGG	ENST00000382352.3	+	1	952_954	c.461_463delCGG	c.(460-465)ccggcg>ccg	p.A159del		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	159	Poly-Ala.						poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A159delA(3)		endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.768														4335	0.865615	0.8343	0.9395	5008	,	,		8937	0.8065		0.9423	False		,,,				2504	0.8374				p.154_155del		.											.	ZCCHC3-90	3	Deletion - In frame(3)	prostate(2)|large_intestine(1)	c.461_463del						.																																			SO:0001651	inframe_deletion	85364	exon1			ATGAGCCGGCGGC	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.461_463delCGG	20.37:g.278697_278699delCGG	ENSP00000371789:p.Ala159del	0	0		18	17	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	In_Frame_Del	DEL	ENST00000382352.3	37	CCDS42844.1																																																																																			.		0.768	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		8	8	NM_153638	0	0	0	2	2	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
SLC23A2	9962	hgsc.bcm.edu	37	20	4850569	4850569	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr20:4850569delG	ENST00000379333.1	-	12	1625	c.1233delC	c.(1231-1233)cccfs	p.P411fs	SNORA31_ENST00000516287.1_RNA|SLC23A2_ENST00000468355.1_5'UTR|SLC23A2_ENST00000338244.1_Frame_Shift_Del_p.P411fs|SLC23A2_ENST00000424750.2_Frame_Shift_Del_p.P297fs	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	411					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.I412fs*4(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TTGCGTGGATGGGGGGGGGTG	0.527																																					p.P411fs		.											.	SLC23A2-92	1	Deletion - Frameshift(1)	ovary(1)	c.1233delC						.						65.0	70.0	68.0					20																	4850569		2203	4300	6503	SO:0001589	frameshift_variant	9962	exon12			GTGGATGGGGGGG	AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1233delC	20.37:g.4850569delG	ENSP00000368637:p.Pro411fs	196	0		358	0	NM_203327	0	0	0	0	0	B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Frame_Shift_Del	DEL	ENST00000379333.1	37	CCDS13085.1																																																																																			.		0.527	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077832.1		
L3MBTL1	26013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	42157986	42157986	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr20:42157986A>G	ENST00000427442.2	+	9	1127	c.968A>G	c.(967-969)tAc>tGc	p.Y323C	L3MBTL1_ENST00000418998.1_Missense_Mutation_p.Y323C|L3MBTL1_ENST00000373134.1_Missense_Mutation_p.Y255C|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.Y255C|L3MBTL1_ENST00000444063.1_Missense_Mutation_p.Y255C			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	255					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CCGTCCATGTACTTCATCCTC	0.522																																					p.Y323C		.											.	L3MBTL1-227	0			c.A968G						.						200.0	126.0	151.0					20																	42157986		2203	4300	6503	SO:0001583	missense	26013	exon9			CCATGTACTTCAT	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.968A>G	20.37:g.42157986A>G	ENSP00000402107:p.Tyr323Cys	177	0		446	107	NM_032107	0	0	1	1	0	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	ENST00000427442.2	37	CCDS46602.2	.	.	.	.	.	.	.	.	.	.	A	20.7	4.026146	0.75390	.	.	ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861	D;D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02;-2.02	5.45	4.34	0.51931	.	0.000000	0.85682	D	0.000000	D	0.91848	0.7420	M	0.82193	2.58	0.52501	D	0.999955	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.91823	0.5469	10	0.87932	D	0	.	10.9604	0.47383	0.8598:0.0:0.0:0.1402	.	323;255;255	Q9Y468-5;Q9Y468-2;Q9Y468-1	.;.;.	C	323;323;255;255;255;41	ENSP00000402107:Y323C;ENSP00000398516:Y323C;ENSP00000362227:Y255C;ENSP00000403316:Y255C;ENSP00000362226:Y255C;ENSP00000410139:Y41C	ENSP00000362226:Y255C	Y	+	2	0	L3MBTL1	41591400	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.020000	0.64066	0.894000	0.36317	0.379000	0.24179	TAC	.		0.522	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079300.3	NM_032107	
CEBPB	1051	hgsc.bcm.edu;broad.mit.edu	37	20	48807902	48807902	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr20:48807902delC	ENST00000303004.3	+	1	527	c.332delC	c.(331-333)tccfs	p.S111fs		NM_005194.3	NP_005185.2	P17676	CEBPB_HUMAN	CCAAT/enhancer binding protein (C/EBP), beta	111					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cellular response to amino acid stimulus (GO:0071230)|embryonic placenta development (GO:0001892)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mammary gland epithelial cell differentiation (GO:0060644)|mammary gland epithelial cell proliferation (GO:0033598)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|response to lipopolysaccharide (GO:0032496)|transcription from RNA polymerase II promoter (GO:0006366)	condensed chromosome, centromeric region (GO:0000779)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|lung(1)	2			BRCA - Breast invasive adenocarcinoma(9;5.72e-08)|STAD - Stomach adenocarcinoma(23;0.19)			cccgccTCCTCCGGGCAGCAC	0.751																																					p.S111fs		.											.	CEBPB-226	0			c.332delC						.						2.0	3.0	3.0					20																	48807902		1764	3596	5360	SO:0001589	frameshift_variant	1051	exon1			CCTCCTCCGGGCA	AY193834	CCDS13429.1	20q13.1	2013-01-10			ENSG00000172216	ENSG00000172216		"""basic leucine zipper proteins"""	1834	protein-coding gene	gene with protein product	"""liver-enriched transcriptional activator protein"", ""nuclear factor of interleukin 6"", ""interleukin 6-dependent DNA-binding protein"""	189965		TCF5		1535333, 1840554	Standard	NM_005194		Approved	LAP, CRP2, NFIL6, IL6DBP, C/EBP-beta	uc002xvi.2	P17676	OTTHUMG00000032715	ENST00000303004.3:c.332delC	20.37:g.48807902delC	ENSP00000305422:p.Ser111fs	15	0		53	18	NM_005194	0	0	0	0	0	A8K671|Q96IH2|Q9H4Z5	Frame_Shift_Del	DEL	ENST00000303004.3	37	CCDS13429.1																																																																																			.		0.751	CEBPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079672.1	NM_005194	
OGFR	11054	hgsc.bcm.edu	37	20	61444637	61444637	+	Missense_Mutation	SNP	G	G	C	rs78981100		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr20:61444637G>C	ENST00000290291.6	+	7	1695	c.1670G>C	c.(1669-1671)aGc>aCc	p.S557T	OGFR_ENST00000370461.1_Missense_Mutation_p.S505T	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	557	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.S557T(3)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCAGCCGAGAGCCCATCGGAG	0.746																																					p.S557T		.											.	OGFR-68	3	Substitution - Missense(3)	upper_aerodigestive_tract(1)|prostate(1)|skin(1)	c.G1670C						.						5.0	10.0	8.0					20																	61444637		1884	3696	5580	SO:0001583	missense	11054	exon7			CCGAGAGCCCATC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1670G>C	20.37:g.61444637G>C	ENSP00000290291:p.Ser557Thr	4	0		77	14	NM_007346	1	0	164	191	26	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	7.631	0.678796	0.14841	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.40225	1.04;1.04	0.773	0.773	0.18516	.	.	.	.	.	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	P;B;P	0.45594	0.862;0.386;0.862	B;B;B	0.38655	0.278;0.099;0.278	T	0.08868	-1.0701	9	0.09338	T	0.73	3.6159	4.5226	0.11966	0.2481:0.0:0.7519:0.0	.	557;540;557	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	T	557;537;392;505	ENSP00000290291:S557T;ENSP00000359491:S505T	ENSP00000290291:S557T	S	+	2	0	OGFR	60915082	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-1.934000	0.01552	0.687000	0.31509	0.185000	0.17295	AGC	.		0.746	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
HSPA13	6782	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	15750609	15750609	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr21:15750609C>T	ENST00000285667.3	-	3	558	c.491G>A	c.(490-492)gGa>gAa	p.G164E	HSPA13_ENST00000544452.1_Intron|HSPA13_ENST00000478035.1_5'Flank	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	164						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						AACTGGCATTCCAAGATATGC	0.413																																					p.G164E		.											.	HSPA13-226	0			c.G491A						.						115.0	102.0	107.0					21																	15750609		2203	4300	6503	SO:0001583	missense	6782	exon3			GGCATTCCAAGAT		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.491G>A	21.37:g.15750609C>T	ENSP00000285667:p.Gly164Glu	55	0		73	44	NM_006948	0	0	8	15	7	B2R616|Q8NE40	Missense_Mutation	SNP	ENST00000285667.3	37	CCDS13567.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327584	0.81690	.	.	ENSG00000155304	ENST00000285667	T	0.01185	5.21	5.61	5.61	0.85477	.	0.152878	0.56097	D	0.000022	T	0.08223	0.0205	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00785	-1.1567	10	0.87932	D	0	-17.8883	19.6378	0.95744	0.0:1.0:0.0:0.0	.	164	P48723	HSP13_HUMAN	E	164	ENSP00000285667:G164E	ENSP00000285667:G164E	G	-	2	0	HSPA13	14672480	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	5.698000	0.68302	2.631000	0.89168	0.655000	0.94253	GGA	.		0.413	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157815.1		
SPECC1L	23384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	24717579	24717579	+	Missense_Mutation	SNP	G	G	T	rs113473482		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr22:24717579G>T	ENST00000314328.9	+	5	916	c.631G>T	c.(631-633)Gcc>Tcc	p.A211S	SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.A211S|SPECC1L_ENST00000416735.1_Intron|SPECC1L_ENST00000437398.1_Missense_Mutation_p.A211S|SPECC1L_ENST00000541492.1_Missense_Mutation_p.A211S	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	211					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						AGACATGCGTGCCCAGCTGGG	0.448																																					p.A211S		.											.	SPECC1L-92	0			c.G631T						.						85.0	88.0	87.0					22																	24717579		2203	4300	6503	SO:0001583	missense	23384	exon4			ATGCGTGCCCAGC	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.631G>T	22.37:g.24717579G>T	ENSP00000325785:p.Ala211Ser	56	0		57	14	NM_001145468	0	0	5	6	1	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	37	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249291	0.39797	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492;ENST00000440893	T;T;T;T;T	0.59502	0.26;2.74;0.26;3.26;0.9	5.64	4.59	0.56863	.	0.287055	0.37906	N	0.001898	T	0.34919	0.0914	N	0.12182	0.205	0.32380	N	0.554613	B;B	0.17465	0.022;0.01	B;B	0.16289	0.015;0.005	T	0.33979	-0.9847	10	0.14252	T	0.57	-15.3708	10.7678	0.46303	0.0:0.1412:0.7122:0.1465	.	211;211	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	S	239;211;211;211;211;150	ENSP00000393363:A211S;ENSP00000405671:A211S;ENSP00000325785:A211S;ENSP00000439633:A211S;ENSP00000414354:A150S	ENSP00000325785:A211S	A	+	1	0	SPECC1L	23047579	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.339000	0.72969	2.675000	0.91044	0.591000	0.81541	GCC	G|0.500;A|0.500		0.448	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
EIF4ENIF1	56478	bcgsc.ca	37	22	31838085	31838085	+	Silent	SNP	G	G	A	rs5997988	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr22:31838085G>A	ENST00000397525.1	-	17	2449	c.2226C>T	c.(2224-2226)agC>agT	p.S742S	EIF4ENIF1_ENST00000397523.1_Silent_p.S718S|EIF4ENIF1_ENST00000441289.1_5'Flank|EIF4ENIF1_ENST00000382180.2_Silent_p.S397S|EIF4ENIF1_ENST00000344710.5_Silent_p.S568S|EIF4ENIF1_ENST00000330125.5_Silent_p.S742S	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	742						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TGGGTACAGAGCTGGATGACA	0.478													G|||	1621	0.323682	0.4039	0.3026	5008	,	,		18314	0.0377		0.4583	False		,,,				2504	0.3865				p.S742S		.											.	EIF4ENIF1-91	0			c.C2226T						.	G	,,	1863,2543	539.4+/-375.3	388,1087,728	104.0	109.0	107.0		2226,1704,2226	-0.7	0.3	22	dbSNP_114	107	3953,4647	550.0+/-385.6	907,2139,1254	no	coding-synonymous,coding-synonymous,coding-synonymous	EIF4ENIF1	NM_001164501.1,NM_001164502.1,NM_019843.3	,,	1295,3226,1982	AA,AG,GG		45.9651,42.2833,44.7178	,,	742/986,568/812,742/986	31838085	5816,7190	2203	4300	6503	SO:0001819	synonymous_variant	56478	exon17			TACAGAGCTGGAT	AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.2226C>T	22.37:g.31838085G>A		109	0		137	7	NM_019843	0	0	8	8	0	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Silent	SNP	ENST00000397525.1	37	CCDS13898.1																																																																																			G|0.611;A|0.389		0.478	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	NM_019843	
ACO2	50	bcgsc.ca	37	22	41903813	41903813	+	Silent	SNP	A	A	C	rs137831	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr22:41903813A>C	ENST00000216254.4	+	3	214	c.192A>C	c.(190-192)acA>acC	p.T64T	ACO2_ENST00000396512.3_Silent_p.T64T	NM_001098.2	NP_001089.1	Q99798	ACON_HUMAN	aconitase 2, mitochondrial	64					cell death (GO:0008219)|cellular metabolic process (GO:0044237)|citrate metabolic process (GO:0006101)|generation of precursor metabolites and energy (GO:0006091)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron ion binding (GO:0005506)			breast(3)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	23						GGCCGCTGACACTCTCGGAGA	0.637													C|||	2095	0.418331	0.3714	0.5418	5008	,	,		18535	0.5734		0.2306	False		,,,				2504	0.4274				p.T64T		.											.	ACO2-290	0			c.A192C						.	C		1536,2870	638.6+/-397.0	276,984,943	25.0	26.0	25.0		192	1.3	1.0	22	dbSNP_78	25	1819,6781	698.8+/-405.0	213,1393,2694	no	coding-synonymous	ACO2	NM_001098.2		489,2377,3637	CC,CA,AA		21.1512,34.8616,25.7958		64/781	41903813	3355,9651	2203	4300	6503	SO:0001819	synonymous_variant	50	exon3			GCTGACACTCTCG	AH006514	CCDS14017.1	22q13.2	2013-05-21			ENSG00000100412	ENSG00000100412	4.2.1.3		118	protein-coding gene	gene with protein product	"""aconitate hydratase, mitochondrial"""	100850				10591208	Standard	NM_001098		Approved	ACONM	uc003bac.3	Q99798	OTTHUMG00000030544	ENST00000216254.4:c.192A>C	22.37:g.41903813A>C		262	11		287	16	NM_001098	0	0	20	20	0	O75809|Q5JZ41|Q6FHX0|Q8TAQ6	Silent	SNP	ENST00000216254.4	37	CCDS14017.1																																																																																			A|0.669;C|0.331		0.637	ACO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259151.1	NM_001098	
PRR34	55267	hgsc.bcm.edu	37	22	46449891	46449891	+	Missense_Mutation	SNP	G	G	A	rs12159707	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr22:46449891G>A	ENST00000396008.2	-	1	133	c.83C>T	c.(82-84)cCc>cTc	p.P28L	FLJ27365_ENST00000381051.2_Intron|RP6-109B7.5_ENST00000608644.1_RNA|RP6-109B7.2_ENST00000439423.1_lincRNA|RP6-109B7.3_ENST00000416202.1_RNA|RP6-109B7.3_ENST00000451166.1_RNA|RP6-109B7.3_ENST00000445441.1_RNA|C22orf26_ENST00000333761.1_Missense_Mutation_p.P28L			Q9NV39	PRR34_HUMAN		28	Pro-rich.		P -> L (in dbSNP:rs12159707).										Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.0784)|LUAD - Lung adenocarcinoma(64;0.247)		TGCGGGGTTGGGGGGGGAGGT	0.746													G|||	1079	0.215455	0.2723	0.2723	5008	,	,		6433	0.0278		0.33	False		,,,				2504	0.1738				p.P28L		.											.	C22orf26-90	0			c.C83T						.	G	LEU/PRO	1414,2432		349,716,858	5.0	5.0	5.0		83	0.7	0.0	22	dbSNP_120	5	2591,5181		546,1499,1841	no	missense	C22orf26	NM_018280.2	98	895,2215,2699	AA,AG,GG		33.3376,36.7655,34.4724	probably-damaging	28/139	46449891	4005,7613	1923	3886	5809	SO:0001583	missense	55267	exon1			GGGTTGGGGGGGG																												ENST00000396008.2:c.83C>T	22.37:g.46449891G>A	ENSP00000379329:p.Pro28Leu	0	0		7	7	NM_018280	0	0	0	0	0	B0QZ24	Missense_Mutation	SNP	ENST00000396008.2	37	CCDS14071.1	542	0.24816849816849818	155	0.3150406504065041	117	0.32320441988950277	22	0.038461538461538464	248	0.32717678100263853	G	5.153	0.213778	0.09810	0.367655	0.333376	ENSG00000182257	ENST00000396008;ENST00000333761	T;T	0.41400	1.0;1.0	0.666	0.666	0.17901	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	D	0.69078	0.997	D	0.68483	0.958	T	0.42189	-0.9466	7	0.87932	D	0	.	.	.	.	rs12159707;rs59880898	28	Q9NV39	CV026_HUMAN	L	28	ENSP00000379329:P28L;ENSP00000327764:P28L	ENSP00000327764:P28L	P	-	2	0	C22orf26	44828555	0.742000	0.28228	0.008000	0.14137	0.010000	0.07245	0.672000	0.25187	0.636000	0.30508	0.645000	0.84053	CCC	A|0.248;C|0.000;G|0.752		0.746	C22orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317994.1		
CAND2	23066	bcgsc.ca	37	3	12856856	12856856	+	Missense_Mutation	SNP	A	A	G	rs2305398	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:12856856A>G	ENST00000456430.2	+	8	1264	c.1223A>G	c.(1222-1224)cAg>cGg	p.Q408R	CAND2_ENST00000295989.5_Missense_Mutation_p.Q315R	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	408			Q -> R (in dbSNP:rs2305398). {ECO:0000269|PubMed:9734811}.		positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CGGCAAACACAGCCCCCGAAG	0.617													G|||	2887	0.576478	0.972	0.4986	5008	,	,		20497	0.2907		0.6551	False		,,,				2504	0.3108				p.Q408R	GBM(43;676 868 1633 6395 37496)	.											.	CAND2-72	0			c.A1223G						.	G	ARG/GLN,ARG/GLN	3844,376		1752,340,18	46.0	54.0	51.0		1223,944	3.8	1.0	3	dbSNP_100	51	5225,3213		1621,1983,615	yes	missense,missense	CAND2	NM_001162499.1,NM_012298.2	43,43	3373,2323,633	GG,GA,AA		38.0777,8.91,28.3536	benign,benign	408/1237,315/1120	12856856	9069,3589	2110	4219	6329	SO:0001583	missense	23066	exon8			AAACACAGCCCCC		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1223A>G	3.37:g.12856856A>G	ENSP00000387641:p.Gln408Arg	673	8		717	17	NM_001162499	0	0	0	0	0	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	37	CCDS54554.1	1283	0.5874542124542125	469	0.9532520325203252	180	0.4972375690607735	150	0.26223776223776224	484	0.6385224274406333	G	0.066	-1.213618	0.01555	0.9109	0.619223	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.64991	-0.13;-0.13	4.86	3.85	0.44370	Armadillo-like helical (1);Armadillo-type fold (1);	0.296572	0.26016	N	0.026849	T	0.00012	0.0000	N	0.00399	-1.545	0.09310	P	0.999996978	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36504	-0.9745	9	0.07482	T	0.82	-22.8675	7.173	0.25728	0.2702:0.0:0.7298:0.0	rs2305398;rs17824975;rs59611646;rs2305398	408;315	O75155;O75155-2	CAND2_HUMAN;.	R	315;408	ENSP00000295989:Q315R;ENSP00000387641:Q408R	ENSP00000295989:Q315R	Q	+	2	0	CAND2	12831856	0.994000	0.37717	0.955000	0.39395	0.098000	0.18820	0.601000	0.24119	1.046000	0.40249	-0.215000	0.12644	CAG	G|0.597;N|0.001		0.617	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
FAM198A	729085	broad.mit.edu;bcgsc.ca	37	3	43095101	43095101	+	Missense_Mutation	SNP	A	A	G	rs536119	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:43095101A>G	ENST00000430121.2	+	3	1474	c.1379A>G	c.(1378-1380)cAg>cGg	p.Q460R	KRBOX1_ENST00000443313.1_3'UTR	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	460			Q -> R (in dbSNP:rs536119). {ECO:0000269|PubMed:14702039}.			extracellular region (GO:0005576)				endometrium(1)	1						GAGAAATGCCAGAACCCAGCC	0.597													G|||	2710	0.541134	0.4644	0.6686	5008	,	,		16542	0.6696		0.5954	False		,,,				2504	0.3661				p.Q460R		.											.	FAM198A-68	0			c.A1379G						.	G	ARG/GLN	625,759		142,341,209	32.0	43.0	40.0		1379	0.7	1.0	3	dbSNP_83	40	1929,1253		582,765,244	yes	missense	FAM198A	NM_001129908.2	43	724,1106,453	GG,GA,AA		39.3777,45.159,44.0648	benign	460/576	43095101	2554,2012	692	1591	2283	SO:0001583	missense	729085	exon3			AATGCCAGAACCC	AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.1379A>G	3.37:g.43095101A>G	ENSP00000407301:p.Gln460Arg	139	0		194	7	NM_001129908	0	0	0	0	0	B3KR48	Missense_Mutation	SNP	ENST00000430121.2	37	CCDS46808.1	1315	0.6021062271062271	252	0.5121951219512195	253	0.6988950276243094	373	0.6520979020979021	437	0.5765171503957783	G	3.612	-0.079297	0.07141	0.45159	0.606223	ENSG00000144649	ENST00000488863;ENST00000430121	T;T	0.27104	1.69;1.69	5.62	0.681	0.17986	.	0.564021	0.18201	N	0.148503	T	0.00012	0.0000	N	0.00054	-2.38	0.58432	P	9.99999999995449E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36237	-0.9756	9	0.02654	T	1	-20.7108	6.9169	0.24365	0.322:0.1098:0.5682:0.0	rs536119;rs17469537;rs58673217;rs536119	31;460	F5H4W4;Q9UFP1	.;F198A_HUMAN	R	31;460	ENSP00000439905:Q31R;ENSP00000407301:Q460R	ENSP00000273146:Q460R	Q	+	2	0	FAM198A	43070105	0.469000	0.25846	0.965000	0.40720	0.817000	0.46193	0.166000	0.16583	-0.417000	0.07461	-0.974000	0.02594	CAG	T|0.179;G|0.318		0.597	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344240.3	NM_001129908	
TOPAZ1	375337	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	44308516	44308516	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:44308516G>A	ENST00000309765.4	+	6	3216	c.3048G>A	c.(3046-3048)atG>atA	p.M1016I		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	1016						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										CAGACTTTATGGTCGGCGAAT	0.343																																					p.M1016I		.											.	.	0			c.G3048A						.						111.0	98.0	102.0					3																	44308516		692	1591	2283	SO:0001583	missense	375337	exon6			CTTTATGGTCGGC	AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.3048G>A	3.37:g.44308516G>A	ENSP00000310303:p.Met1016Ile	68	0		61	5	NM_001145030	0	0	0	0	0		Missense_Mutation	SNP	ENST00000309765.4	37	CCDS46809.1	.	.	.	.	.	.	.	.	.	.	G	0.361	-0.939366	0.02322	.	.	ENSG00000173769	ENST00000309765	T	0.08896	3.04	5.06	1.98	0.26296	.	.	.	.	.	T	0.04092	0.0114	N	0.14661	0.345	0.09310	N	1	B	0.18610	0.029	B	0.11329	0.006	T	0.46484	-0.9188	9	0.15952	T	0.53	0.0041	4.3568	0.11183	0.0912:0.153:0.5989:0.157	.	1016	Q8N9V7	CC077_HUMAN	I	1016	ENSP00000310303:M1016I	ENSP00000310303:M1016I	M	+	3	0	C3orf77	44283520	0.002000	0.14202	0.000000	0.03702	0.004000	0.04260	0.791000	0.26915	0.582000	0.29556	0.585000	0.79938	ATG	.		0.343	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343247.1	NM_001145030	
APEH	327	broad.mit.edu	37	3	49723596	49723596	+	IGR	SNP	G	G	A	rs200900272		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:49723596G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000449682.2_Missense_Mutation_p.P349L|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'Flank|MST1_ENST00000383728.3_3'UTR	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.P335L(5)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGAGCCGTCGGGGTTCCGGCA	0.667																																					p.P349L		.											.	MST1-278	5	Substitution - Missense(5)	endometrium(3)|skin(2)	c.C1046T						.						12.0	16.0	15.0					3																	49723596		2189	4280	6469	SO:0001628	intergenic_variant	4485	exon9			CCGTCGGGGTTCC	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723596G>A		66	1		116	5	NM_020998	0	0	7	7	0	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	.	.	.	.	.	.	.	.	.	.	G	35	5.499226	0.96355	.	.	ENSG00000173531	ENST00000449682	D	0.83250	-1.7	5.47	5.47	0.80525	.	0.000000	0.42053	D	0.000771	D	0.90256	0.6953	M	0.88450	2.955	0.80722	D	1	P	0.35793	0.521	P	0.46419	0.516	D	0.90879	0.4752	10	0.62326	D	0.03	.	18.9304	0.92563	0.0:0.0:1.0:0.0	.	349	G3XAK1	.	L	349	ENSP00000414287:P349L	ENSP00000414287:P349L	P	-	2	0	MST1	49698600	1.000000	0.71417	0.996000	0.52242	0.942000	0.58702	9.855000	0.99526	2.561000	0.86390	0.655000	0.94253	CCC	.		0.667	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
RBM6	10180	bcgsc.ca	37	3	50097113	50097113	+	Missense_Mutation	SNP	A	A	G	rs34707170	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:50097113A>G	ENST00000266022.4	+	11	2421	c.2162A>G	c.(2161-2163)aAc>aGc	p.N721S	RBM6_ENST00000442092.1_Missense_Mutation_p.N199S|RBM6_ENST00000539992.1_Missense_Mutation_p.N63S|RBM6_ENST00000443081.1_Missense_Mutation_p.N589S|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000422955.1_Missense_Mutation_p.N199S	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	721			N -> T (in dbSNP:rs34707170).		RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		ATCTTACAGAACCTTGATCCG	0.468													A|||	17	0.00339457	0.0	0.0216	5008	,	,		17692	0.0		0.001	False		,,,				2504	0.001				p.N721S		.											.	RBM6-280	0			c.A2162G						.	A	SER/ASN,SER/ASN	1,4405	2.1+/-5.4	0,1,2202	124.0	119.0	120.0		596,2162	5.6	1.0	3	dbSNP_126	120	13,8587	10.5+/-38.8	0,13,4287	yes	missense,missense	RBM6	NM_001167582.1,NM_005777.2	46,46	0,14,6489	GG,GA,AA		0.1512,0.0227,0.1076	probably-damaging,probably-damaging	199/602,721/1124	50097113	14,12992	2203	4300	6503	SO:0001583	missense	10180	exon11			TACAGAACCTTGA	AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.2162A>G	3.37:g.50097113A>G	ENSP00000266022:p.Asn721Ser	119	0		174	6	NM_005777	0	0	18	18	0	O60549|O75524|Q86SS3	Missense_Mutation	SNP	ENST00000266022.4	37	CCDS2809.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	A	10.62	1.400290	0.25291	2.27E-4	0.001512	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000539992;ENST00000422955	T;T;T;T;T	0.41758	1.19;1.19;1.19;0.99;1.19	5.56	5.56	0.83823	Nucleotide-binding, alpha-beta plait (1);	0.423695	0.25481	N	0.030379	T	0.25195	0.0612	N	0.19112	0.55	0.26786	N	0.96951	B;P	0.38617	0.27;0.64	B;B	0.40602	0.136;0.334	T	0.13229	-1.0517	9	.	.	.	-7.8717	15.7691	0.78149	1.0:0.0:0.0:0.0	.	589;721	E9PGM9;P78332	.;RBM6_HUMAN	S	199;721;589;63;199	ENSP00000393530:N199S;ENSP00000266022:N721S;ENSP00000396466:N589S;ENSP00000443165:N63S;ENSP00000392939:N199S	.	N	+	2	0	RBM6	50072117	0.986000	0.35501	1.000000	0.80357	0.832000	0.47134	2.642000	0.46596	2.126000	0.65437	0.529000	0.55759	AAC	A|0.998;C|0.000;G|0.001		0.468	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345528.4	NM_005777	
DENND6A	201627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	57616477	57616477	+	Silent	SNP	G	G	C			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:57616477G>C	ENST00000311128.5	-	17	1552	c.1482C>G	c.(1480-1482)acC>acG	p.T494T	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	494					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										TTATTCTAGAGGTTAGCTGAG	0.353																																					p.T494T		.											.	.	0			c.C1482G						.						92.0	90.0	91.0					3																	57616477		2203	4300	6503	SO:0001819	synonymous_variant	201627	exon17			TCTAGAGGTTAGC	AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.1482C>G	3.37:g.57616477G>C		61	0		36	21	NM_152678	0	0	4	6	2	Q7Z5T4|Q8N235|Q8TEG8	Silent	SNP	ENST00000311128.5	37	CCDS33773.1	.	.	.	.	.	.	.	.	.	.	G	8.830	0.939581	0.18281	.	.	ENSG00000174839	ENST00000471531	.	.	.	5.94	-1.89	0.07689	.	.	.	.	.	T	0.41119	0.1145	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.26189	-1.0110	4	.	.	.	-26.25	2.0351	0.03538	0.2418:0.3084:0.3319:0.118	.	.	.	.	V	66	.	.	L	-	1	0	FAM116A	57591517	0.618000	0.27051	0.945000	0.38365	0.997000	0.91878	-0.328000	0.07945	-0.742000	0.04790	0.557000	0.71058	CTC	.		0.353	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351594.1	NM_152678	
CNTN3	5067	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	74385793	74385793	+	Missense_Mutation	SNP	C	C	T	rs187262258		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:74385793C>T	ENST00000263665.6	-	11	1408	c.1381G>A	c.(1381-1383)Gat>Aat	p.D461N		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	461	Ig-like C2-type 5.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AGTCCTCCATCGTTTAACAAA	0.318													C|||	1	0.000199681	0.0	0.0	5008	,	,		16472	0.001		0.0	False		,,,				2504	0.0				p.D461N		.											.	CNTN3-137	0			c.G1381A						.						82.0	73.0	76.0					3																	74385793		2203	4299	6502	SO:0001583	missense	5067	exon11			CTCCATCGTTTAA	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.1381G>A	3.37:g.74385793C>T	ENSP00000263665:p.Asp461Asn	81	0		78	69	NM_020872	0	0	0	0	0	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	37	CCDS33790.1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.91	1.484010	0.26598	.	.	ENSG00000113805	ENST00000263665	T	0.28454	1.61	4.8	4.8	0.61643	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.181162	0.48767	D	0.000173	T	0.17619	0.0423	N	0.10916	0.065	0.42964	D	0.994414	B	0.06786	0.001	B	0.13407	0.009	T	0.07731	-1.0757	10	0.07813	T	0.8	.	18.2607	0.90034	0.0:1.0:0.0:0.0	.	461	Q9P232	CNTN3_HUMAN	N	461	ENSP00000263665:D461N	ENSP00000263665:D461N	D	-	1	0	CNTN3	74468483	0.989000	0.36119	0.578000	0.28575	0.347000	0.29111	2.701000	0.47094	2.382000	0.81193	0.557000	0.71058	GAT	C|0.999;T|0.000		0.318	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
VGLL3	389136	broad.mit.edu;bcgsc.ca	37	3	87027942	87027942	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:87027942G>A	ENST00000398399.2	-	2	500	c.137C>T	c.(136-138)gCg>gTg	p.A46V	VGLL3_ENST00000383698.3_Missense_Mutation_p.A46V	NM_016206.2	NP_057290.2			vestigial-like family member 3											NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		GCTGAATACCGCTAACTTCTT	0.428																																					p.A46V		.											.	VGLL3-90	0			c.C137T						.						57.0	54.0	55.0					3																	87027942		1942	4165	6107	SO:0001583	missense	389136	exon2			AATACCGCTAACT	AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.137C>T	3.37:g.87027942G>A	ENSP00000381436:p.Ala46Val	50	2		38	32	NM_016206	0	0	0	0	0		Missense_Mutation	SNP	ENST00000398399.2	37	CCDS43110.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471695	0.43942	.	.	ENSG00000206538	ENST00000398399;ENST00000383698	T;T	0.55234	0.57;0.53	5.14	5.14	0.70334	.	0.353082	0.30193	N	0.010196	T	0.35653	0.0939	L	0.32530	0.975	0.34741	D	0.730782	P	0.49961	0.93	B	0.30943	0.122	T	0.58521	-0.7622	10	0.66056	D	0.02	-7.3039	12.9789	0.58552	0.0777:0.0:0.9223:0.0	.	46	A8MV65	VGLL3_HUMAN	V	46	ENSP00000381436:A46V;ENSP00000373199:A46V	ENSP00000373199:A46V	A	-	2	0	VGLL3	87110632	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.733000	0.38156	2.391000	0.81399	0.655000	0.94253	GCG	.		0.428	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352805.1	NM_016206	
ALG1L	200810	hgsc.bcm.edu	37	3	125648356	125648356	+	Missense_Mutation	SNP	T	T	C	rs3828357	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:125648356T>C	ENST00000340333.3	-	6	566	c.403A>G	c.(403-405)Aac>Gac	p.N135D	FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like	135			N -> D (in dbSNP:rs3828357). {ECO:0000269|PubMed:15489334}.				transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						TCCCGCAGGTTCTTCCAAAAC	0.507													.|||	1388	0.277157	0.2262	0.2738	5008	,	,		18320	0.245		0.3738	False		,,,				2504	0.2822				p.N155D		.											.	ALG1L-90	0			c.A463G						.	T	ASP/ASN,ASP/ASN	737,2003		84,569,717	41.0	52.0	48.0		403,463	2.3	0.4	3	dbSNP_107	48	1670,2956		300,1070,943	no	missense,missense	ALG1L	NM_001015050.2,NM_001195223.1	23,23	384,1639,1660	CC,CT,TT		36.1003,26.8978,32.6772	possibly-damaging,possibly-damaging	135/188,155/208	125648356	2407,4959	1370	2313	3683	SO:0001583	missense	200810	exon7			GCAGGTTCTTCCA	BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.403A>G	3.37:g.125648356T>C	ENSP00000340009:p.Asn135Asp	0	0		8	8	NM_001195223	0	0	0	5	5	D3DNA5	Missense_Mutation	SNP	ENST00000340333.3	37	CCDS33840.1	643	0.2944139194139194	118	0.23983739837398374	97	0.26795580110497236	151	0.263986013986014	277	0.3654353562005277	.	12.49	1.952222	0.34471	0.268978	0.361003	ENSG00000189366	ENST00000340333	T	0.70399	-0.48	2.3	2.3	0.28687	.	0.292589	0.40908	D	0.000982	T	0.00012	0.0000	L	0.33339	1.005	0.19775	P	0.9999521818	P	0.37423	0.594	B	0.33454	0.164	T	0.30387	-0.9980	9	0.37606	T	0.19	-8.7393	8.1541	0.31158	0.0:0.0:0.0:1.0	rs3828357;rs4082673;rs16834984;rs3828357	135	Q6GMV1	ALG1L_HUMAN	D	135	ENSP00000340009:N135D	ENSP00000340009:N135D	N	-	1	0	ALG1L	127131046	1.000000	0.71417	0.429000	0.26710	0.033000	0.12548	4.720000	0.61944	1.057000	0.40506	0.155000	0.16302	AAC	T|0.677;C|0.323		0.507	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356347.1	NM_001015050	
IGSF10	285313	broad.mit.edu	37	3	151155638	151155638	+	Silent	SNP	G	G	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:151155638G>T	ENST00000282466.3	-	6	6710	c.6711C>A	c.(6709-6711)atC>atA	p.I2237I	IGSF10_ENST00000495443.1_5'UTR	NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	2237	Ig-like C2-type 9.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACAGACCATTGATTAATGGAG	0.438																																					p.I2237I		.											.	IGSF10-102	0			c.C6711A						.						111.0	100.0	104.0					3																	151155638		2203	4300	6503	SO:0001819	synonymous_variant	285313	exon6			ACCATTGATTAAT	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.6711C>A	3.37:g.151155638G>T		37	0		83	3	NM_178822	0	0	0	0	0	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	37	CCDS3160.1																																																																																			.		0.438	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
ABCC5	10057	broad.mit.edu	37	3	183665257	183665257	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:183665257delA	ENST00000334444.6	-	23	3509	c.3269delT	c.(3268-3270)ttgfs	p.L1090fs	ABCC5_ENST00000265586.6_Frame_Shift_Del_p.L1047fs	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1090	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	ACACGTAAACAAAAAAAAAGG	0.532																																					p.L1090fs		.											.	ABCC5-137	0			c.3269delT						.						49.0	58.0	55.0					3																	183665257		1969	4159	6128	SO:0001589	frameshift_variant	10057	exon23			GTAAACAAAAAAA	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3269delT	3.37:g.183665257delA	ENSP00000333926:p.Leu1090fs	105	0		148	7	NM_005688	0	0	0	0	0	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Frame_Shift_Del	DEL	ENST00000334444.6	37	CCDS43176.1																																																																																			.		0.532	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
FAM157A	728262	bcgsc.ca	37	3	197880129	197880129	+	lincRNA	SNP	T	T	C	rs28554473	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:197880129T>C	ENST00000437428.2	+	0	9							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						TTACAAGAACTGgcagcagca	0.542													N|||	596	0.11901	0.3275	0.0865	5008	,	,		17811	0.0149		0.0408	False		,,,				2504	0.0481				p.W70R		.											.	.	0			c.T208C						.						25.0	20.0	22.0					3																	197880129		692	1591	2283			728262	exon2			AAGAACTGGCAGC			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880129T>C		390	7		299	19	NM_001145248	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	0.026	-1.367330	0.01225	.	.	ENSG00000236438	ENST00000431569	.	.	.	.	.	.	.	.	.	.	.	T	0.12689	0.0308	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19582	-1.0301	5	.	.	.	.	.	.	.	.	70	C9JC47	F157A_HUMAN	R	70	.	.	W	+	1	0	FAM157A	199364526	0.009000	0.17119	0.102000	0.21198	0.103000	0.19146	-0.853000	0.04303	-1.749000	0.01330	-1.762000	0.00668	TGG	.		0.542	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
FAM157A	728262	bcgsc.ca	37	3	197880136	197880136	+	lincRNA	SNP	A	A	G	rs56683636		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr3:197880136A>G	ENST00000437428.2	+	0	16							C9JC47	F157A_HUMAN	family with sequence similarity 157, member A											NS(1)|skin(1)	2						AACTGgcagcagcagcagcag	0.532																																					p.Q72R		.											.	.	0			c.A215G						.						20.0	17.0	18.0					3																	197880136		692	1591	2283			728262	exon2			GGCAGCAGCAGCA			3q29	2013-01-30			ENSG00000236438	ENSG00000236438			34079	other	unknown							Standard	NM_001145248		Approved		uc011bup.1	C9JC47			3.37:g.197880136A>G		398	7		281	25	NM_001145248	0	0	0	0	0		Missense_Mutation	SNP	ENST00000437428.2	37		.	.	.	.	.	.	.	.	.	.	.	0.645	-0.811867	0.02798	.	.	ENSG00000236438	ENST00000431569	.	.	.	.	.	.	.	.	.	.	.	T	0.16727	0.0402	N	0.08118	0	0.09310	N	1	B	0.28667	0.219	B	0.32393	0.145	T	0.32052	-0.9921	5	.	.	.	.	.	.	.	.	72	C9JC47	F157A_HUMAN	R	72	.	.	Q	+	2	0	FAM157A	199364533	0.007000	0.16637	0.114000	0.21550	0.115000	0.19883	0.370000	0.20433	0.103000	0.17682	0.102000	0.15555	CAG	.		0.532	FAM157A-001	KNOWN	not_best_in_genome_evidence|mRNA_end_NF|basic	lincRNA	lincRNA	OTTHUMT00000340078.2	NM_001145248	
ZNF732	654254	hgsc.bcm.edu	37	4	289888	289888	+	Silent	SNP	G	G	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr4:289888G>A	ENST00000419098.1	-	2	70	c.60C>T	c.(58-60)tgC>tgT	p.C20C		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	20	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						CAGGGTCCAGGCATTTCCACT	0.403																																					p.C19C		.											.	ZNF732-22	0			c.C57T						.						35.0	33.0	34.0					4																	289888		692	1590	2282	SO:0001819	synonymous_variant	654254	exon1			GTCCAGGCATTTC	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.60C>T	4.37:g.289888G>A		95	0		110	6	NM_001137608	0	0	25	25	0		Silent	SNP	ENST00000419098.1	37	CCDS46990.1																																																																																			.		0.403	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		4	0		59	13	NM_175918	0	0	1	3	2	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	ucsc.edu	37	4	1388850	1388850	+	Missense_Mutation	SNP	C	C	T	rs78729943	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr4:1388850C>T	ENST00000324803.4	+	1	3511	c.551C>T	c.(550-552)aCg>aTg	p.T184M		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	184					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCAACGTGGAGTGCC	0.667													N|||	112	0.0223642	0.0234	0.0288	5008	,	,		13476	0.001		0.0378	False		,,,				2504	0.0225				p.T184M		.											.	CRIPAK-90	0			c.C551T						.						219.0	152.0	176.0					4																	1388850		2180	3938	6118	SO:0001583	missense	285464	exon1			TGCCAACGTGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.551C>T	4.37:g.1388850C>T	ENSP00000323978:p.Thr184Met	33	0		157	36	NM_175918	0	0	0	0	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	2.068	-0.413800	0.04799	.	.	ENSG00000179979	ENST00000324803	T	0.19532	2.14	1.41	-2.82	0.05787	Post-SET domain (1);	.	.	.	.	T	0.08447	0.0210	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.22277	-1.0221	9	0.29301	T	0.29	.	4.7529	0.13070	0.0:0.3841:0.1667:0.4492	.	184	Q8N1N5	CRPAK_HUMAN	M	184	ENSP00000323978:T184M	ENSP00000323978:T184M	T	+	2	0	CRIPAK	1378850	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.507000	0.06352	-2.573000	0.00466	-2.139000	0.00339	ACG	C|0.500;T|0.500		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
CRIPAK	285464	hgsc.bcm.edu;ucsc.edu	37	4	1388867	1388867	+	Missense_Mutation	SNP	A	A	C	rs76058011	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr4:1388867A>C	ENST00000324803.4	+	1	3528	c.568A>C	c.(568-570)Atc>Ctc	p.I190L		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	190					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			TGCCCGCCTGATCACACGTGC	0.662													N|||	145	0.0289537	0.0174	0.0447	5008	,	,		14453	0.0099		0.0586	False		,,,				2504	0.0225				p.I190L		.											.	CRIPAK-90	0			c.A568C						.						246.0	170.0	197.0					4																	1388867		2172	3827	5999	SO:0001583	missense	285464	exon1			CGCCTGATCACAC	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.568A>C	4.37:g.1388867A>C	ENSP00000323978:p.Ile190Leu	37	0		145	30	NM_175918	0	0	1	12	11	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	4.910	0.169067	0.09339	.	.	ENSG00000179979	ENST00000324803	T	0.19394	2.15	1.25	-1.56	0.08532	.	.	.	.	.	T	0.06917	0.0176	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34004	-0.9846	9	0.10636	T	0.68	.	0.5937	0.00732	0.3976:0.2382:0.1983:0.1659	.	190	Q8N1N5	CRPAK_HUMAN	L	190	ENSP00000323978:I190L	ENSP00000323978:I190L	I	+	1	0	CRIPAK	1378867	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.558000	0.00923	-1.849000	0.01171	-2.030000	0.00424	ATC	A|0.994;C|0.006		0.662	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
SOWAHB	345079	hgsc.bcm.edu	37	4	77818202	77818202	+	Silent	SNP	T	T	C	rs2645674	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr4:77818202T>C	ENST00000334306.2	-	1	800	c.801A>G	c.(799-801)acA>acG	p.T267T		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	267	Ala-rich.																AAGCCCTGCTTGTCGCAGCCT	0.726													C|||	1670	0.333466	0.4887	0.2392	5008	,	,		13358	0.2292		0.332	False		,,,				2504	0.2996				p.T267T		.											.	.	0			c.A801G						.	C		1258,2610		207,844,883	3.0	5.0	4.0		801	-3.8	0.0	4	dbSNP_100	4	1803,5973		226,1351,2311	no	coding-synonymous	ANKRD56	NM_001029870.1		433,2195,3194	CC,CT,TT		23.1867,32.5233,26.2882		267/794	77818202	3061,8583	1934	3888	5822	SO:0001819	synonymous_variant	345079	exon1			CCTGCTTGTCGCA		CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.801A>G	4.37:g.77818202T>C		0	0		9	9	NM_001029870	0	0	0	0	0	B2RP29	Silent	SNP	ENST00000334306.2	37	CCDS34017.1																																																																																			T|0.691;C|0.309		0.726	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362762.1	NM_001029870	
TRIO	7204	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	14387852	14387852	+	Silent	SNP	C	C	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr5:14387852C>T	ENST00000344204.4	+	23	3801	c.3777C>T	c.(3775-3777)ctC>ctT	p.L1259L	TRIO_ENST00000509967.2_Silent_p.L1210L|TRIO_ENST00000537187.1_Silent_p.L1259L	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1259					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L1259L(1)		NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GTAAAAGTCTCCAGCTAGATA	0.433																																					p.L1259L		.											.	TRIO-562	1	Substitution - coding silent(1)	prostate(1)	c.C3777T						.						67.0	71.0	69.0					5																	14387852		2203	4300	6503	SO:0001819	synonymous_variant	7204	exon23			AAGTCTCCAGCTA	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.3777C>T	5.37:g.14387852C>T		119	0		126	48	NM_007118	0	0	0	0	0	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	ENST00000344204.4	37	CCDS3883.1																																																																																			.		0.433	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
SNCAIP	9627	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	121758644	121758644	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr5:121758644G>T	ENST00000261368.8	+	4	474	c.212G>T	c.(211-213)aGt>aTt	p.S71I	SNCAIP_ENST00000504884.2_Intron|SNCAIP_ENST00000379533.2_Missense_Mutation_p.S118I|SNCAIP_ENST00000261367.7_Missense_Mutation_p.S118I|SNCAIP_ENST00000503116.2_Missense_Mutation_p.S118I|SNCAIP_ENST00000414317.2_Intron|SNCAIP_ENST00000379536.2_Missense_Mutation_p.S71I|SNCAIP_ENST00000542191.1_Intron|SNCAIP_ENST00000379538.3_Intron	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	71					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		GATGTGTACAGTAAGTTCCGC	0.428																																					p.S71I		.											.	SNCAIP-92	0			c.G212T						.						64.0	65.0	65.0					5																	121758644		2203	4300	6503	SO:0001583	missense	9627	exon4			TGTACAGTAAGTT	AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.212G>T	5.37:g.121758644G>T	ENSP00000261368:p.Ser71Ile	255	0		259	117	NM_005460	0	0	0	0	0	D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	ENST00000261368.8	37	CCDS4131.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.239690	0.79800	.	.	ENSG00000064692	ENST00000514467;ENST00000506272;ENST00000508681;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000261367;ENST00000503116	T;T;T;T;T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54;1.54	5.66	5.66	0.87406	.	0.040353	0.85682	D	0.000000	T	0.43322	0.1242	L	0.34521	1.04	0.80722	D	1	P;D;P;D	0.71674	0.811;0.998;0.874;0.993	P;D;P;P	0.68943	0.506;0.961;0.447;0.844	T	0.31052	-0.9957	10	0.87932	D	0	-18.1219	13.4387	0.61099	0.0808:0.0:0.9192:0.0	.	71;118;118;71	D6R9G8;Q9Y6H5-6;Q9Y6H5-3;Q9Y6H5	.;.;.;SNCAP_HUMAN	I	71;118;71;71;71;118;71;118;118	ENSP00000427090:S71I;ENSP00000426551:S118I;ENSP00000422610:S71I;ENSP00000422106:S71I;ENSP00000261368:S71I;ENSP00000368848:S118I;ENSP00000368851:S71I;ENSP00000261367:S118I;ENSP00000423199:S118I	ENSP00000261367:S118I	S	+	2	0	SNCAIP	121786543	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.759000	0.74934	2.690000	0.91761	0.655000	0.94253	AGT	.		0.428	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250888.1		
GNPDA1	10007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	141382735	141382735	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr5:141382735G>C	ENST00000508177.1	-	5	1445	c.687C>G	c.(685-687)ttC>ttG	p.F229L	GNPDA1_ENST00000542860.1_Missense_Mutation_p.F152L|GNPDA1_ENST00000503794.1_Missense_Mutation_p.F229L|GNPDA1_ENST00000458112.2_Missense_Mutation_p.F195L|GNPDA1_ENST00000311337.6_Missense_Mutation_p.F229L|GNPDA1_ENST00000500692.2_Missense_Mutation_p.F229L|GNPDA1_ENST00000513454.1_Missense_Mutation_p.F229L			P46926	GNPI1_HUMAN	glucosamine-6-phosphate deaminase 1	229					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucosamine catabolic process (GO:0006043)|N-acetylglucosamine metabolic process (GO:0006044)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)			central_nervous_system(1)|lung(1)|skin(3)|stomach(1)	6		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GATGCTGCTGGAAGGCAGACA	0.537																																					p.F229L		.											.	GNPDA1-90	0			c.C687G						.						160.0	136.0	144.0					5																	141382735		2203	4300	6503	SO:0001583	missense	10007	exon6			CTGCTGGAAGGCA	AF048826	CCDS4272.1	5q21	2008-02-05	2003-10-17	2003-10-22	ENSG00000113552	ENSG00000113552	3.5.99.6		4417	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate deaminase"", ""oscillin"""	601798	"""glucosamine-6-phosphate isomerase"""	GNPI		9714720, 9438414	Standard	NM_005471		Approved	GNPDA, HLN, GPI, KIAA0060	uc010jgh.3	P46926	OTTHUMG00000129657	ENST00000508177.1:c.687C>G	5.37:g.141382735G>C	ENSP00000423674:p.Phe229Leu	176	0		184	92	NM_005471	0	0	4	13	9	B7Z3X4|D3DQE7	Missense_Mutation	SNP	ENST00000508177.1	37	CCDS4272.1	.	.	.	.	.	.	.	.	.	.	G	7.760	0.705200	0.15172	.	.	ENSG00000113552	ENST00000513454;ENST00000311337;ENST00000458112;ENST00000500692;ENST00000508177;ENST00000503794;ENST00000542860;ENST00000504139;ENST00000505689	T;T;T;T;T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02;2.02;2.03;2.02;2.02	5.26	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.08044	0.0201	N	0.05050	-0.12	0.80722	D	1	B;B	0.11235	0.001;0.004	B;B	0.12156	0.003;0.007	T	0.15578	-1.0432	10	0.02654	T	1	-21.7282	8.559	0.33498	0.2286:0.0:0.7714:0.0	.	195;229	E7EVU7;P46926	.;GNPI1_HUMAN	L	229;229;195;229;229;229;152;195;250	ENSP00000423494:F229L;ENSP00000311876:F229L;ENSP00000387718:F195L;ENSP00000424275:F229L;ENSP00000423674:F229L;ENSP00000423485:F229L;ENSP00000445143:F152L;ENSP00000424625:F195L;ENSP00000421524:F250L	ENSP00000311876:F229L	F	-	3	2	GNPDA1	141362919	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.480000	0.53172	1.580000	0.49851	0.655000	0.94253	TTC	.		0.537	GNPDA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370631.1	NM_005471	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		0	0		6	6	NM_001145115	0	0	0	3	3		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
HLA-B	3106	hgsc.bcm.edu	37	6	31324595	31324604	+	Frame_Shift_Del	DEL	CGGCTCCTCT	CGGCTCCTCT	-	rs41541416|rs200186034|rs1050543|rs41540514|rs9266179|rs9266178|rs1050538|rs281864598|rs41545612|rs72558108|rs41562914|rs9281379	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	CGGCTCCTCT	CGGCTCCTCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr6:31324595_31324604delCGGCTCCTCT	ENST00000412585.2	-	2	232_241	c.204_213delAGAGGAGCCG	c.(202-213)agagaggagccgfs	p.REEP68fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	68	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.E69fs*30(2)|p.E69fs*8(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						ACGGCGCCCGCGGCTCCTCTCTCGGACTCG	0.676									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.68_71del		.											.	HLA-B-90	3	Insertion - Frameshift(2)|Deletion - Frameshift(1)	large_intestine(3)	c.204_213del						.																																			SO:0001589	frameshift_variant	3106	exon2	Familial Cancer Database	;Lichen Sclerosis, Familial	CGCCCGCGGCTCC	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.204_213delAGAGGAGCCG	6.37:g.31324595_31324604delCGGCTCCTCT	ENSP00000399168:p.Arg68fs	22	0		97	0	NM_005514	0	0	0	0	0	Q29764	Frame_Shift_Del	DEL	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.676	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000579174.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		10	10	NM_002047	0	0	0	25	25	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
EGFR	1956	broad.mit.edu;bcgsc.ca	37	7	55214349	55214349	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr7:55214349G>A	ENST00000275493.2	+	4	652	c.475G>A	c.(475-477)Gtg>Atg	p.V159M	EGFR_ENST00000344576.2_Missense_Mutation_p.V159M|EGFR_ENST00000420316.2_Missense_Mutation_p.V159M|EGFR_ENST00000455089.1_Intron|EGFR_ENST00000442591.1_Missense_Mutation_p.V159M|EGFR_ENST00000342916.3_Missense_Mutation_p.V159M|EGFR_ENST00000454757.2_Missense_Mutation_p.V106M	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	159			Missing (variant EGFR vIII; found in a lung cancer sample; somatic mutation; induces lung cancer when exogenously expressed). {ECO:0000269|PubMed:16672372}.		activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CCTGTGCAACGTGGAGAGCAT	0.542		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.V159M		.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR-44910	0			c.G475A						.						115.0	96.0	102.0					7																	55214349		2203	4300	6503	SO:0001583	missense	1956	exon4	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	TGCAACGTGGAGA		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.475G>A	7.37:g.55214349G>A	ENSP00000275493:p.Val159Met	116	0		222	16	NM_005228	0	0	1	1	0	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	37	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	G	9.133	1.011971	0.19277	.	.	ENSG00000146648	ENST00000342916;ENST00000395504;ENST00000344576;ENST00000420316;ENST00000275493;ENST00000442591;ENST00000450046;ENST00000454757	D;D;D;D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69;-1.69;-1.69;-1.69	5.6	-0.531	0.11894	EGF receptor, L domain (1);	0.445298	0.26272	N	0.025337	T	0.61311	0.2337	L	0.31578	0.945	0.27950	N	0.937188	B;P;B;B	0.39044	0.019;0.656;0.06;0.093	B;B;B;B	0.29176	0.011;0.099;0.042;0.021	T	0.58335	-0.7654	10	0.11794	T	0.64	.	5.8866	0.18884	0.5329:0.0:0.3322:0.1349	.	159;159;159;159	P00533;P00533-3;P00533-4;P00533-2	EGFR_HUMAN;.;.;.	M	159;29;159;159;159;159;106;106	ENSP00000342376:V159M;ENSP00000345973:V159M;ENSP00000413843:V159M;ENSP00000275493:V159M;ENSP00000410031:V159M;ENSP00000413354:V106M;ENSP00000395243:V106M	ENSP00000275493:V159M	V	+	1	0	EGFR	55181843	0.220000	0.23631	0.980000	0.43619	0.657000	0.38888	-0.395000	0.07287	-0.168000	0.10853	0.655000	0.94253	GTG	.		0.542	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
SGCE	8910	hgsc.bcm.edu	37	7	94227276	94227276	+	Intron	SNP	T	T	G	rs10247562	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr7:94227276T>G	ENST00000265735.7	-	9	1364				SGCE_ENST00000428696.2_Intron|SGCE_ENST00000445866.2_Missense_Mutation_p.S432R|SGCE_ENST00000415788.2_Intron|SGCE_ENST00000437425.2_Intron|SGCE_ENST00000447873.1_Intron	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon						cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ccaagatcgctccattgcact	0.483													G|||	3818	0.76238	0.9576	0.7032	5008	,	,		14879	0.7083		0.7147	False		,,,				2504	0.6452				p.S432R		.											.	SGCE-91	0			c.A1294C						.						1.0	1.0	1.0					7																	94227276		142	139	281	SO:0001627	intron_variant	8910	exon10			GATCGCTCCATTG	AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.1253+810A>C	7.37:g.94227276T>G		0	0		5	5	NM_001099401	117	0	16	380	247	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Missense_Mutation	SNP	ENST00000265735.7	37	CCDS5637.1	1627	0.74496336996337	436	0.8861788617886179	243	0.6712707182320442	416	0.7272727272727273	532	0.7018469656992085	G	0.003	-2.528823	0.00147	.	.	ENSG00000127990	ENST00000445866	T	0.38077	1.16	0.113	0.113	0.14631	.	.	.	.	.	T	0.00012	0.0000	N	0.00427	-1.505	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28933	-1.0028	7	0.48119	T	0.1	.	.	.	.	rs10247562;rs56677001	432	G5E9K6	.	R	432	ENSP00000398930:S432R	ENSP00000398930:S432R	S	-	1	0	SGCE	94065212	0.002000	0.14202	0.004000	0.12327	0.002000	0.02628	-0.857000	0.04286	-1.124000	0.02936	-1.117000	0.02048	AGC	T|0.255;G|0.745		0.483	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2		
NOM1	64434	hgsc.bcm.edu	37	7	156742501	156742501	+	Missense_Mutation	SNP	C	C	G	rs6969990	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr7:156742501C>G	ENST00000275820.3	+	1	85	c.70C>G	c.(70-72)Cgc>Ggc	p.R24G		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	24	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.		R -> G (in dbSNP:rs6969990).			nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CCGCATGAAGCGCAGAggcgg	0.721													.|||	1013	0.202276	0.2042	0.2392	5008	,	,		7202	0.2778		0.1511	False		,,,				2504	0.1483				p.R24G		.											.	NOM1-90	0			c.C70G						.	C	GLY/ARG	460,2914		22,416,1249	3.0	4.0	3.0		70	4.4	0.0	7	dbSNP_116	3	715,6171		26,663,2754	no	missense	NOM1	NM_138400.1	125	48,1079,4003	GG,GC,CC		10.3834,13.6337,11.4522	probably-damaging	24/861	156742501	1175,9085	1687	3443	5130	SO:0001583	missense	64434	exon1			ATGAAGCGCAGAG	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.70C>G	7.37:g.156742501C>G	ENSP00000275820:p.Arg24Gly	2	0		15	12	NM_138400	0	0	0	0	0	Q96I08	Missense_Mutation	SNP	ENST00000275820.3	37	CCDS34787.1	459	0.21016483516483517	100	0.2032520325203252	69	0.19060773480662985	164	0.2867132867132867	126	0.1662269129287599	C	17.33	3.362797	0.61403	0.136337	0.103834	ENSG00000146909	ENST00000275820	T	0.13307	2.6	4.36	4.36	0.52297	.	1.850510	0.03172	N	0.170899	T	0.00012	0.0000	L	0.27053	0.805	0.58432	P	9.99999999995449E-6	D	0.64830	0.994	P	0.54924	0.764	T	0.39603	-0.9606	9	0.87932	D	0	-1.3828	15.9395	0.79743	0.0:1.0:0.0:0.0	rs6969990;rs6969990	24	Q5C9Z4	NOM1_HUMAN	G	24	ENSP00000275820:R24G	ENSP00000275820:R24G	R	+	1	0	NOM1	156435262	0.939000	0.31865	0.023000	0.16930	0.179000	0.23085	3.589000	0.53972	1.979000	0.57680	0.306000	0.20318	CGC	C|0.663;G|0.337		0.721	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
NKX3-1	4824	hgsc.bcm.edu	37	8	23540249	23540249	+	Missense_Mutation	SNP	G	G	A	rs2228013	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr8:23540249G>A	ENST00000380871.4	-	1	191	c.154C>T	c.(154-156)Cgc>Tgc	p.R52C	NKX3-1_ENST00000523261.1_Intron	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	52			R -> C (in dbSNP:rs2228013). {ECO:0000269|PubMed:9377551}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		TCCGGGTCGCGCTGTCTCTGG	0.756													G|||	111	0.0221645	0.0008	0.0519	5008	,	,		11150	0.001		0.0467	False		,,,				2504	0.0266				p.R52C		.											.	NKX3-1-90	0			c.C154T						.	G	CYS/ARG	33,3943		0,33,1955	8.0	9.0	9.0		154	2.4	0.0	8	dbSNP_98	9	337,7623		5,327,3648	no	missense	NKX3-1	NM_006167.3	180	5,360,5603	AA,AG,GG		4.2337,0.83,3.0999	possibly-damaging	52/235	23540249	370,11566	1988	3980	5968	SO:0001583	missense	4824	exon1			GGTCGCGCTGTCT		CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.154C>T	8.37:g.23540249G>A	ENSP00000370253:p.Arg52Cys	0	0		12	8	NM_006167	0	0	1	1	0	O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Missense_Mutation	SNP	ENST00000380871.4	37	CCDS6042.1	49	0.022435897435897436	1	0.0020325203252032522	16	0.04419889502762431	0	0.0	32	0.04221635883905013	G	13.18	2.161019	0.38119	0.0083	0.042337	ENSG00000167034	ENST00000380871	D	0.91011	-2.77	4.28	2.43	0.29744	.	7739.210000	0.00166	N	0.000000	T	0.50820	0.1638	N	0.08118	0	0.18873	N	0.999983	D	0.53151	0.958	B	0.35182	0.197	T	0.70066	-0.4974	10	0.56958	D	0.05	.	4.8592	0.13575	0.1031:0.0:0.5205:0.3765	rs2228013	52	Q99801	NKX31_HUMAN	C	52	ENSP00000370253:R52C	ENSP00000370253:R52C	R	-	1	0	NKX3-1	23596194	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.180000	0.16860	0.410000	0.25675	0.484000	0.47621	CGC	G|0.977;A|0.023		0.756	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215141.2		
ST18	9705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	53044607	53044607	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr8:53044607C>G	ENST00000276480.7	-	22	3260	c.2577G>C	c.(2575-2577)tgG>tgC	p.W859C		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	859					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				TGTTCAGTTTCCAGGAGAGGG	0.493																																					p.W859C		.											.	ST18-95	0			c.G2577C						.						151.0	133.0	139.0					8																	53044607		2203	4300	6503	SO:0001583	missense	9705	exon22			CAGTTTCCAGGAG	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2577G>C	8.37:g.53044607C>G	ENSP00000276480:p.Trp859Cys	179	0		330	170	NM_014682	0	0	0	0	0	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	37	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382219	0.82792	.	.	ENSG00000147488	ENST00000276480	T	0.51574	0.7	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.68165	0.2971	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70252	-0.4923	10	0.72032	D	0.01	-8.9451	19.2617	0.93970	0.0:1.0:0.0:0.0	.	859	O60284	ST18_HUMAN	C	859	ENSP00000276480:W859C	ENSP00000276480:W859C	W	-	3	0	ST18	53207160	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.602000	0.87976	0.591000	0.81541	TGG	.		0.493	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		2	0	1096	27	5	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
STAU2	27067	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	74464276	74464276	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr8:74464276C>G	ENST00000521451.1	-	8	1217	c.841G>C	c.(841-843)Gaa>Caa	p.E281Q	STAU2_ENST00000521727.1_Missense_Mutation_p.E481Q|STAU2_ENST00000524300.1_Missense_Mutation_p.E501Q|STAU2_ENST00000517542.1_Missense_Mutation_p.E463Q|STAU2_ENST00000522509.1_Missense_Mutation_p.E469Q|STAU2_ENST00000522695.1_Missense_Mutation_p.E469Q|STAU2_ENST00000355780.5_Missense_Mutation_p.E469Q|STAU2_ENST00000521210.1_Missense_Mutation_p.E397Q|STAU2_ENST00000523558.1_Missense_Mutation_p.E329Q|STAU2_ENST00000519961.1_Missense_Mutation_p.E501Q			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	501					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			GCTAAATATTCCAGTTGTTTT	0.363																																					p.E501Q		.											.	STAU2-90	0			c.G1501C						.						60.0	64.0	63.0					8																	74464276		2203	4297	6500	SO:0001583	missense	27067	exon13			AATATTCCAGTTG	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521451.1:c.841G>C	8.37:g.74464276C>G	ENSP00000428476:p.Glu281Gln	160	1		257	48	NM_001164380	0	0	16	18	2	B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Missense_Mutation	SNP	ENST00000521451.1	37		.	.	.	.	.	.	.	.	.	.	C	17.76	3.467667	0.63625	.	.	ENSG00000040341	ENST00000522695;ENST00000524300;ENST00000523558;ENST00000521210;ENST00000523533;ENST00000355780;ENST00000519961;ENST00000521727;ENST00000521451;ENST00000522509;ENST00000517542	T;T;T;T;T;T;T;T;T;T;T	0.79653	0.39;0.39;0.39;-1.29;0.39;0.39;0.39;0.39;0.39;0.39;0.39	4.6	4.6	0.57074	.	0.048930	0.85682	D	0.000000	D	0.85191	0.5640	L	0.53249	1.67	0.80722	D	1	P;D;D;D;P;P;P;P	0.61080	0.759;0.957;0.989;0.957;0.844;0.759;0.849;0.729	B;P;P;P;P;B;P;B	0.58660	0.328;0.608;0.843;0.608;0.528;0.188;0.478;0.315	D	0.84204	0.0452	10	0.36615	T	0.2	-12.4942	17.9748	0.89123	0.0:1.0:0.0:0.0	.	481;397;329;397;469;501;469;501	E7EPX0;E9PEI3;E7ER74;B7Z8B4;F8VPI7;E7EVJ4;E9PH62;E9PF26	.;.;.;.;.;.;.;.	Q	469;501;329;397;114;469;501;481;281;469;463	ENSP00000428456:E469Q;ENSP00000428756:E501Q;ENSP00000428741:E329Q;ENSP00000429173:E397Q;ENSP00000430511:E114Q;ENSP00000348026:E469Q;ENSP00000430907:E501Q;ENSP00000429973:E481Q;ENSP00000428476:E281Q;ENSP00000427977:E469Q;ENSP00000431111:E463Q	ENSP00000344030:E329Q	E	-	1	0	STAU2	74626830	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.883000	0.75595	2.538000	0.85594	0.650000	0.86243	GAA	.		0.363	STAU2-006	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000379006.4	NM_001164380	
EPPK1	83481	broad.mit.edu;bcgsc.ca	37	8	144940435	144940435	+	Silent	SNP	G	G	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr8:144940435G>A	ENST00000525985.1	-	2	7058	c.6987C>T	c.(6985-6987)ctC>ctT	p.L2329L				P58107	EPIPL_HUMAN	epiplakin 1	2329						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCCGGACGATGAGGTCCTTCT	0.697																																					p.L2329L		.											.	EPPK1-25	0			c.C6987T						.						187.0	185.0	186.0					8																	144940435		2175	4255	6430	SO:0001819	synonymous_variant	83481	exon1			GACGATGAGGTCC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6987C>T	8.37:g.144940435G>A		204	1		977	64	NM_031308	0	0	1	1	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				.		0.697	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
EPPK1	83481	hgsc.bcm.edu	37	8	144940706	144940706	+	Missense_Mutation	SNP	C	C	T	rs112377501	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr8:144940706C>T	ENST00000525985.1	-	2	6787	c.6716G>A	c.(6715-6717)cGc>cAc	p.R2239H				P58107	EPIPL_HUMAN	epiplakin 1	2239						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)	p.R2239H(2)		NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CTTCTCCTGGCGGCCGGGCTG	0.701																																					p.R2239H		.											.	EPPK1-25	2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)	c.G6716A						.						61.0	61.0	61.0					8																	144940706		2173	4243	6416	SO:0001583	missense	83481	exon1			TCCTGGCGGCCGG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6716G>A	8.37:g.144940706C>T	ENSP00000436337:p.Arg2239His	6	0		121	8	NM_031308	0	0	2	2	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	16.79	3.221029	0.58560	.	.	ENSG00000227184	ENST00000525985	T	0.73047	-0.71	4.67	3.7	0.42460	.	.	.	.	.	T	0.50854	0.1640	L	0.38175	1.15	0.25587	N	0.986731	P	0.43938	0.822	B	0.30179	0.112	T	0.49093	-0.8975	9	0.45353	T	0.12	.	5.4805	0.16721	0.0:0.7826:0.0:0.2174	.	2239	E9PPU0	.	H	2239	ENSP00000436337:R2239H	ENSP00000436337:R2239H	R	-	2	0	EPPK1	145012694	.	.	0.959000	0.39883	0.982000	0.71751	.	.	2.420000	0.82092	0.591000	0.81541	CGC	C|0.993;T|0.007		0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
AKAP2	11217	bcgsc.ca	37	9	112898576	112898576	+	Missense_Mutation	SNP	C	C	T	rs151065500	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr9:112898576C>T	ENST00000259318.7	+	2	266	c.59C>T	c.(58-60)cCa>cTa	p.P20L	AKAP2_ENST00000510514.5_Missense_Mutation_p.P251L|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.P251L|AKAP2_ENST00000374525.1_Missense_Mutation_p.P109L|AKAP2_ENST00000555236.1_Missense_Mutation_p.P251L|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.P251L|AKAP2_ENST00000434623.2_Missense_Mutation_p.P109L	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	20										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						ACCTCTACCCCACATCCCATG	0.498													C|||	44	0.00878594	0.0023	0.0043	5008	,	,		20072	0.0		0.0129	False		,,,				2504	0.0256				p.P251L		.											.	PALM2-AKAP2-475	0			c.C752T						.	C	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	25,4381	31.7+/-61.6	0,25,2178	186.0	171.0	176.0		326,59,326,752,752	4.4	0.1	9	dbSNP_134	176	82,8518	47.2+/-106.3	2,78,4220	yes	missense,missense,missense,missense,missense	AKAP2,PALM2-AKAP2	NM_001004065.4,NM_001136562.2,NM_001198656.1,NM_007203.4,NM_147150.2	98,98,98,98,98	2,103,6398	TT,TC,CC		0.9535,0.5674,0.8227	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	109/949,20/860,109/962,251/1104,251/1091	112898576	107,12899	2203	4300	6503	SO:0001583	missense	445815	exon8			CTACCCCACATCC	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.59C>T	9.37:g.112898576C>T	ENSP00000259318:p.Pro20Leu	152	2		209	7	NM_007203	0	0	1	1	0	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000259318.7	37	CCDS48003.1	12	0.005494505494505495	2	0.0040650406504065045	1	0.0027624309392265192	0	0.0	9	0.011873350923482849	C	13.48	2.249854	0.39797	0.005674	0.009535	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.48836	2.14;2.14;2.14;2.14;1.39;0.8;0.81;1.49	6.17	4.36	0.52297	.	0.256481	0.31809	N	0.007037	T	0.28962	0.0719	L	0.33485	1.01	0.32786	N	0.501856	B;B;B;B;B;B;B;B	0.13145	0.0;0.004;0.007;0.004;0.002;0.003;0.001;0.004	B;B;B;B;B;B;B;B	0.12156	0.002;0.006;0.007;0.006;0.003;0.005;0.005;0.002	T	0.42716	-0.9435	10	0.72032	D	0.01	-4.1394	10.6145	0.45443	0.0:0.8539:0.0:0.1461	.	20;109;103;109;110;251;251;69	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	L	251;251;251;251;109;109;69;20	ENSP00000363654:P251L;ENSP00000305861:P251L;ENSP00000451476:P251L;ENSP00000421522:P251L;ENSP00000404782:P109L;ENSP00000363649:P109L;ENSP00000419268:P69L;ENSP00000259318:P20L	ENSP00000259318:P20L	P	+	2	0	PALM2-AKAP2;AKAP2	111938397	0.879000	0.30193	0.112000	0.21494	0.687000	0.40016	3.012000	0.49575	0.952000	0.37798	0.655000	0.94253	CCA	C|0.993;T|0.007		0.498	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	113173641	113173641	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr9:113173641A>T	ENST00000401783.2	-	37	6686	c.6350T>A	c.(6349-6351)gTa>gAa	p.V2117E	SVEP1_ENST00000297826.5_Missense_Mutation_p.V43E|SVEP1_ENST00000374469.1_Missense_Mutation_p.V2094E	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2117	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GGTGTTCAGTACAAAGCCTTC	0.488																																					p.V2117E		.											.	SVEP1-75	0			c.T6350A						.						56.0	59.0	58.0					9																	113173641		1912	4134	6046	SO:0001583	missense	79987	exon37			TTCAGTACAAAGC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6350T>A	9.37:g.113173641A>T	ENSP00000384917:p.Val2117Glu	66	0		101	34	NM_153366	0	0	1	2	1	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.707829	0.48412	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.63913	-0.07;-0.07;-0.07	5.98	5.98	0.97165	Complement control module (2);Sushi/SCR/CCP (3);	0.052369	0.85682	D	0.000000	T	0.74283	0.3696	M	0.70275	2.135	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.71331	-0.4625	10	0.02654	T	1	.	16.4728	0.84119	1.0:0.0:0.0:0.0	.	2117	Q4LDE5	SVEP1_HUMAN	E	2117;2094;43	ENSP00000384917:V2117E;ENSP00000363593:V2094E;ENSP00000297826:V43E	ENSP00000297826:V43E	V	-	2	0	SVEP1	112213462	1.000000	0.71417	0.980000	0.43619	0.254000	0.26022	7.105000	0.77031	2.296000	0.77279	0.482000	0.46254	GTA	.		0.488	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ALAD	210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	116154411	116154411	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr9:116154411G>A	ENST00000409155.3	-	3	348	c.152C>T	c.(151-153)cCa>cTa	p.P51L	ALAD_ENST00000277315.5_Intron|ALAD_ENST00000482001.1_5'UTR	NM_000031.5	NP_000022.3	P13716	HEM2_HUMAN	aminolevulinate dehydratase	51					cellular response to interleukin-4 (GO:0071353)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protein homooligomerization (GO:0051260)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|identical protein binding (GO:0042802)|lead ion binding (GO:0032791)|porphobilinogen synthase activity (GO:0004655)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|stomach(1)	9					Aminolevulinic acid(DB00855)	GGCCACTCCTGGGAGGCTGGT	0.622																																					p.P51L		.											.	ALAD-90	0			c.C152T						.						46.0	44.0	44.0					9																	116154411		2203	4300	6503	SO:0001583	missense	210	exon3			ACTCCTGGGAGGC	M13928	CCDS6794.2	9q32	2010-04-29	2010-04-29		ENSG00000148218	ENSG00000148218	4.2.1.24		395	protein-coding gene	gene with protein product	"""porphobilinogen synthase"""	125270	"""aminolevulinate, delta-, dehydratase"""			6839527, 6378062	Standard	NM_000031		Approved	ALADH, PBGS	uc011lxf.2	P13716	OTTHUMG00000020522	ENST00000409155.3:c.152C>T	9.37:g.116154411G>A	ENSP00000386284:p.Pro51Leu	82	0		94	12	NM_000031	0	0	16	23	7	A8K375|B2R6F2|Q16870|Q16871|Q9BVQ9	Missense_Mutation	SNP	ENST00000409155.3	37	CCDS6794.2	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013130	0.93346	.	.	ENSG00000148218	ENST00000409155;ENST00000448137	D;D	0.94687	-3.49;-3.49	5.7	5.7	0.88788	Aldolase-type TIM barrel (1);	0.051310	0.85682	D	0.000000	D	0.98629	0.9541	H	0.99104	4.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.99541	1.0963	10	0.87932	D	0	-5.6957	17.0031	0.86385	0.0:0.0:1.0:0.0	.	51;80	P13716;P13716-2	HEM2_HUMAN;.	L	51;60	ENSP00000386284:P51L;ENSP00000392748:P60L	ENSP00000386284:P51L	P	-	2	0	ALAD	115194232	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.638000	0.91019	2.688000	0.91661	0.655000	0.94253	CCA	.		0.622	ALAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053724.3	NM_001003945	
ABCA2	20	ucsc.edu;bcgsc.ca	37	9	139918597	139918597	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr9:139918597T>C	ENST00000371605.3	-	2	305	c.158A>G	c.(157-159)gAa>gGa	p.E53G	ABCA2_ENST00000341511.6_Missense_Mutation_p.E53G|ABCA2_ENST00000265662.5_Missense_Mutation_p.E53G|ABCA2_ENST00000492260.1_5'UTR			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	53					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GCACTCACCTTCCTTCACGGA	0.647																																					p.E83G		.											.	ABCA2-90	0			c.A248G						.						28.0	33.0	31.0					9																	139918597		2055	4197	6252	SO:0001583	missense	20	exon2			TCACCTTCCTTCA	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.158A>G	9.37:g.139918597T>C	ENSP00000360666:p.Glu53Gly	196	3		357	329	NM_212533	0	0	0	0	0	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	37		.	.	.	.	.	.	.	.	.	.	T	26.9	4.777706	0.90195	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.98437	-4.55;-4.93;-4.93	4.59	4.59	0.56863	.	4.222010	0.01850	U	0.035848	D	0.98289	0.9433	M	0.77616	2.38	0.41219	D	0.98649	B;P	0.46987	0.01;0.888	B;P	0.47102	0.003;0.537	D	0.92489	0.5999	10	0.49607	T	0.09	.	11.47	0.50264	0.0:0.0:0.0:1.0	.	53;83	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	G	53;53;83;53	ENSP00000265662:E53G;ENSP00000360666:E53G;ENSP00000344155:E53G	ENSP00000265662:E53G	E	-	2	0	ABCA2	139038418	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.728000	0.54991	1.713000	0.51359	0.459000	0.35465	GAA	.		0.647	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
MAGEB16	139604	bcgsc.ca	37	X	35821127	35821127	+	Nonsense_Mutation	SNP	C	C	T	rs4829392	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chrX:35821127C>T	ENST00000399989.1	+	2	1093	c.814C>T	c.(814-816)Cga>Tga	p.R272*	MAGEB16_ENST00000399988.1_Nonsense_Mutation_p.R272*|MAGEB16_ENST00000399987.1_Nonsense_Mutation_p.R272*|MAGEB16_ENST00000399985.1_Nonsense_Mutation_p.R272*|MAGEB16_ENST00000399992.1_Nonsense_Mutation_p.R304*	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	272	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						TGATCCTGCACGATATGAATT	0.483													C|||	2342	0.620397	0.4478	0.4121	3775	,	,		15380	0.5694		0.4195	False		,,,				2504	0.4785				p.R272X		.											.	MAGEB16-66	0			c.C814T						.	C	stop/ARG	2170,1655		540,782,308,305,263	38.0	38.0	38.0		814	-1.3	0.0	X	dbSNP_111	38	3581,3147		694,1206,987,528,885	yes	stop-gained	MAGEB16	NM_001099921.1		1234,1988,1295,833,1148	TT,TC,T,CC,C		46.7747,43.268,45.5036		272/325	35821127	5751,4802	2198	4300	6498	SO:0001587	stop_gained	139604	exon2			CCTGCACGATATG		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.814C>T	X.37:g.35821127C>T	ENSP00000382871:p.Arg272*	175	2		210	7	NM_001099921	0	0	0	0	0	A8MU30	Nonsense_Mutation	SNP	ENST00000399989.1	37	CCDS43927.1	1014	0.6112115732368897	151	0.4415204678362573	102	0.4146341463414634	212	0.5792349726775956	230	0.3885135135135135	C	16.21	3.060037	0.55325	0.56732	0.532253	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	.	.	.	3.13	-1.27	0.09347	.	0.391845	0.25596	N	0.029598	.	.	.	.	.	.	0.09310	P	0.99999629397	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.9248	0.19104	0.5383:0.2869:0.1748:0.0	rs4829392;rs52830693;rs4829392	.	.	.	X	272;304;272;272;272	.	ENSP00000382867:R272X	R	+	1	2	MAGEB16	35731048	0.000000	0.05858	0.000000	0.03702	0.404000	0.30871	0.056000	0.14256	-0.423000	0.07394	-0.340000	0.08031	CGA	C|0.355;0|0.042		0.483	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251034.1		
CT45A5	441521	bcgsc.ca	37	X	134948034	134948034	+	Silent	SNP	A	A	G	rs2034920	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chrX:134948034A>G	ENST00000463085.2	-	3	380	c.291T>C	c.(289-291)aaT>aaC	p.N97N	CT45A4_ENST00000420087.2_Intron|CT45A5_ENST00000491480.1_Silent_p.N97N|CT45A5_ENST00000370724.3_Silent_p.N97N			Q6NSH3	CT455_HUMAN	cancer/testis antigen family 45, member A5	97										endometrium(1)|large_intestine(2)|lung(6)	9						TGCTGGTAACATTTCCTCCCA	0.433													.|||	3151	0.834702	0.6876	0.5937	3775	,	,		15275	0.6577		0.5487	False		,,,				2504	0.6288				p.N97N		.											.	CT45A5-44	0			c.T291C						.	G	,	3268,552		1196,387,489,49,67	207.0	192.0	197.0		291,291	0.5	0.0	X	dbSNP_94	197	4926,1768		1325,883,1393,217,451	no	coding-synonymous,coding-synonymous	CT45A5	NM_001007551.3,NM_001172288.1	,	2521,1270,1882,266,518	GG,GA,G,AA,A		26.4117,14.4503,22.0658	,	97/190,97/190	134948034	8194,2320	2188	4269	6457	SO:0001819	synonymous_variant	441521	exon3			GGTAACATTTCCT	AY743713	CCDS35406.1	Xq26.3	2009-03-12				ENSG00000269586			33270	protein-coding gene	gene with protein product	"""cancer/testis antigen CT45-5"""	300796				15905330	Standard	XM_006724759		Approved	CT45-5, CT45.5	uc022ces.1	Q6NSH3		ENST00000463085.2:c.291T>C	X.37:g.134948034A>G		99	0		105	8	NM_001007551	0	0	0	0	0	A8K842|B7ZMC5	Silent	SNP	ENST00000463085.2	37	CCDS35406.1																																																																																			0|0.004;T|0.049		0.433	CT45A5-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472589.1	NM_001007551	
ARHGAP4	393	bcgsc.ca	37	X	153176254	153176254	+	Silent	SNP	A	A	G	rs2070097	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chrX:153176254A>G	ENST00000350060.5	-	15	1757	c.1716T>C	c.(1714-1716)caT>caC	p.H572H	ARHGAP4_ENST00000370016.1_Silent_p.H551H|ARHGAP4_ENST00000467421.1_5'UTR|ARHGAP4_ENST00000370028.3_Silent_p.H612H|ARHGAP4_ENST00000393721.1_Silent_p.H394H|ARHGAP4_ENST00000537206.1_Silent_p.H549H	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	572	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGTCCAGGTCATGGGCAGTGC	0.682											OREG0003617	type=REGULATORY REGION|Gene=ARHGAP4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	G|||	2661	0.704901	0.6914	0.4928	3775	,	,		6158	0.5437		0.3062	False		,,,				2504	0.5613				p.H612H		.											.	ARHGAP4-227	0			c.T1836C						.	G	,	3240,563		1191,370,488,60,73	13.0	15.0	15.0		1836,1716	-6.9	0.0	X	dbSNP_96	15	2616,4076		384,1102,746,931,1112	no	coding-synonymous,coding-synonymous	ARHGAP4	NM_001164741.1,NM_001666.4	,	1575,1472,1234,991,1185	GG,GA,G,AA,A		39.0915,14.8041,44.202	,	612/987,572/947	153176254	5856,4639	2182	4275	6457	SO:0001819	synonymous_variant	393	exon16			CAGGTCATGGGCA	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.1716T>C	X.37:g.153176254A>G		40	0	1753	36	4	NM_001164741	0	0	16	16	0	Q14144|Q86UY3	Silent	SNP	ENST00000350060.5	37	CCDS14736.1	1043	0.6286919831223629	234	0.7959183673469388	118	0.44696969696969696	218	0.5828877005347594	163	0.26547231270358307	a	0.105	-1.146679	0.01714	0.851959	0.390915	ENSG00000089820	ENST00000454164;ENST00000442172	.	.	.	4.61	-6.94	0.01633	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.24137	P	0.99574145	.	.	.	.	.	.	T	0.07009	-1.0795	3	.	.	.	.	7.0917	0.25287	0.6809:0.0919:0.1343:0.0929	rs2070097;rs17846493;rs17859557;rs61248836;rs2070097	.	.	.	T	72;61	.	.	M	-	2	0	ARHGAP4	152829448	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.160000	0.03147	-2.323000	0.00639	-2.187000	0.00313	ATG	A|0.354;G|0.646		0.682	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666	
PLXNA3	55558	bcgsc.ca	37	X	153694334	153694334	+	Missense_Mutation	SNP	C	C	G	rs5945430	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chrX:153694334C>G	ENST00000369682.3	+	14	2764	c.2589C>G	c.(2587-2589)gaC>gaG	p.D863E		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	863	IPT/TIG 1.		D -> E (in dbSNP:rs5945430). {ECO:0000269|PubMed:8570614}.		axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCGTGGGTGACAACCTGGGCC	0.642													g|||	1453	0.384901	0.6725	0.0994	3775	,	,		12442	0.128		0.0875	False		,,,				2504	0.2843				p.D863E		.											.	PLXNA3-132	0			c.C2589G						.		GLU/ASP	3042,793		1031,515,465,86,106	64.0	57.0	59.0		2589	4.4	1.0	X	dbSNP_114	59	895,5833		46,535,268,1847,1604	no	missense	PLXNA3	NM_017514.3	45	1077,1050,733,1933,1710	GG,GC,G,CC,C		13.3026,20.678,37.2716	benign	863/1872	153694334	3937,6626	2203	4300	6503	SO:0001583	missense	55558	exon14			GGGTGACAACCTG	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.2589C>G	X.37:g.153694334C>G	ENSP00000358696:p.Asp863Glu	164	0		196	6	NM_017514	0	0	8	8	0	Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	482	0.29053646775165765	225	0.7867132867132867	24	0.06857142857142857	38	0.07063197026022305	44	0.062146892655367235	G	0.144	-1.099405	0.01843	0.79322	0.133026	ENSG00000130827	ENST00000369682	T	0.75821	-0.97	5.32	4.45	0.53987	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.129129	0.52532	N	0.000076	T	0.00012	0.0000	N	0.00041	-2.485	0.46499	P	9.219999999999784E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.42865	-0.9426	9	0.06365	T	0.9	.	7.6459	0.28321	0.0881:0.3108:0.6011:0.0	rs5945430;rs58038932	863	P51805	PLXA3_HUMAN	E	863	ENSP00000358696:D863E	ENSP00000358696:D863E	D	+	3	2	PLXNA3	153347528	1.000000	0.71417	0.998000	0.56505	0.197000	0.23852	2.837000	0.48191	1.024000	0.39682	-0.176000	0.13171	GAC	C|0.625;G|0.375		0.642	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
KRTAP10-6	386674	broad.mit.edu	37	21	46012219	46012220	+	In_Frame_Ins	INS	-	-	GGGGCGCAGCAGCTG	rs374776064|rs587611810|rs71199613	byFrequency	TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr21:46012219_46012220insGGGGCGCAGCAGCTG	ENST00000400368.1	-	1	166_167	c.146_147insCAGCTGCTGCGCCCC	c.(145-147)ccg>ccCAGCTGCTGCGCCCCg	p.49_49P>PSCCAP	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	49	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGCAGGGGGCCGGGGCGCAGCA	0.688														1042	0.208067	0.1188	0.2522	5008	,	,		15055	0.1379		0.3231	False		,,,				2504	0.2515				p.P49delinsPSCCAP		.											.	KRTAP10-6-90	0			c.147_148insCAGCTGCTGCGCCCC						.																																			SO:0001652	inframe_insertion	386674	exon1			GGGGGCCGGGGCG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.146_147insCAGCTGCTGCGCCCC	21.37:g.46012219_46012220insGGGGCGCAGCAGCTG	Exception_encountered	30	0		106	10	NM_198688	0	0	0	0	0		In_Frame_Ins	INS	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.688	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
NKD2	85409	hgsc.bcm.edu	37	5	1033568	1033569	+	Frame_Shift_Ins	INS	-	-	CCGCGAGGGC			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chr5:1033568_1033569insCCGCGAGGGC	ENST00000296849.5	+	5	513_514	c.284_285insCCGCGAGGGC	c.(283-288)aaccgcfs	p.-99fs	NKD2_ENST00000274150.4_Frame_Shift_Ins_p.-99fs|NKD2_ENST00000537972.1_Frame_Shift_Ins_p.-99fs	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)						exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			AGGGCAGCAAACCGCGAGGGCC	0.688																																					p.N95fs		.											.	NKD2-226	0			c.284_285insCCGCGAGGGC						.																																			SO:0001589	frameshift_variant	85409	exon5			CAGCAAACCGCGA	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.285_294dupCCGCGAGGGC	5.37:g.1033569_1033578dupCCGCGAGGGC	ENSP00000296849:p.Pro99fs	65	0		287	16	NM_001271082	0	0	0	0	0	Q96EK8|Q9BSN0	Frame_Shift_Ins	INS	ENST00000296849.5	37	CCDS3859.1																																																																																			.		0.688	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120	
TCEAL6	158931	broad.mit.edu	37	X	101396073	101396074	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5KZ-01A-11D-A29I-10	TCGA-OR-A5KZ-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	d5d4c41b-6ff9-4b93-aea8-e6caef2209e1	4d364400-c9b7-492f-a193-1beeeb2b1d82	g.chrX:101396073_101396074insT	ENST00000372774.3	-	3	479_480	c.230_231insA	c.(229-231)aagfs	p.K77fs	TCEAL6_ENST00000372773.1_Frame_Shift_Ins_p.K77fs	NM_001006938.2	NP_001006939.2	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	77					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	14						CGCCTTGTGGCTTGCCCTCACC	0.624																																					p.K77fs		.											.	TCEAL6-91	0			c.231_232insA						.																																			SO:0001589	frameshift_variant	158931	exon3			TTGTGGCTTGCCC	BC071675	CCDS43978.1	Xq22.1	2014-03-21			ENSG00000204071	ENSG00000204071			24553	protein-coding gene	gene with protein product						16221301	Standard	NM_001006938		Approved	WEX2	uc004eiq.3	Q6IPX3	OTTHUMG00000022050	ENST00000372774.3:c.231dupA	X.37:g.101396075_101396075dupT	ENSP00000361860:p.Lys77fs	87	0		143	8	NM_001006938	0	0	0	0	0	Q5H9J8	Frame_Shift_Ins	INS	ENST00000372774.3	37	CCDS43978.1																																																																																			.		0.624	TCEAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057609.1	NM_001006938	
