#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ATAD3B	83858	bcgsc.ca	37	1	1431165	1431165	+	Missense_Mutation	SNP	C	C	T	rs9792879		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr1:1431165C>T	ENST00000308647.7	+	16	2031	c.1915C>T	c.(1915-1917)Ccg>Tcg	p.P639S		NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	639						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)	p.P639S(1)		endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGGCGGTCGGCCGTTCTGCCC	0.647																																					p.P639S		.											.	ATAD3B-44	1	Substitution - Missense(1)	skin(1)	c.C1915T						.						33.0	33.0	33.0					1																	1431165		2202	4300	6502	SO:0001583	missense	83858	exon16			GGTCGGCCGTTCT	AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.1915C>T	1.37:g.1431165C>T	ENSP00000311766:p.Pro639Ser	63	0		45	4	NM_031921	0	0	0	0	0	A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Missense_Mutation	SNP	ENST00000308647.7	37	CCDS30.1	476	0.21794871794871795	147	0.29878048780487804	60	0.16574585635359115	170	0.2972027972027972	99	0.13060686015831136	c	11.49	1.652810	0.29336	.	.	ENSG00000160072	ENST00000378737;ENST00000308647	D	0.93811	-3.29	1.39	0.415	0.16411	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	8.000000000008E-6	B;B	0.22604	0.072;0.024	B;B	0.12156	0.007;0.002	T	0.11324	-1.0592	8	0.87932	D	0	.	3.748	0.08555	0.0:0.7411:0.0:0.2589	rs9792879	593;639	Q5T9A4-3;Q5T9A4	.;ATD3B_HUMAN	S	473;639	ENSP00000311766:P639S	ENSP00000311766:P639S	P	+	1	0	ATAD3B	1421028	0.034000	0.19679	0.001000	0.08648	0.022000	0.10575	0.000000	0.12993	0.145000	0.18977	0.194000	0.17425	CCG	C|0.782;T|0.218		0.647	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001369.2	NM_031921	
ARHGEF16	27237	bcgsc.ca	37	1	3395039	3395039	+	Silent	SNP	G	G	A	rs10797395	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr1:3395039G>A	ENST00000378378.4	+	12	2082	c.1677G>A	c.(1675-1677)gtG>gtA	p.V559V	ARHGEF16_ENST00000378371.2_Silent_p.V271V|ARHGEF16_ENST00000413250.2_Silent_p.V263V|ARHGEF16_ENST00000378373.1_Silent_p.V271V	NM_014448.3	NP_055263.2	Q5VV41	ARHGG_HUMAN	Rho guanine nucleotide exchange factor (GEF) 16	559	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Cdc42 GTPase activity (GO:0032864)|activation of Rac GTPase activity (GO:0032863)|apoptotic signaling pathway (GO:0097190)|cell chemotaxis (GO:0060326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	PDZ domain binding (GO:0030165)|receptor tyrosine kinase binding (GO:0030971)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			lung(6)|ovary(1)	7	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		ACATCCAGGTGGAGAAGATAG	0.652													G|||	3436	0.686102	0.3873	0.7637	5008	,	,		17081	0.6766		0.8628	False		,,,				2504	0.863				p.V559V		.											.	ARHGEF16-228	0			c.G1677A						.	G		2073,2325	564.1+/-381.3	495,1083,621	89.0	83.0	85.0		1677	-0.2	0.1	1	dbSNP_120	85	7453,1123	764.3+/-407.6	3231,991,66	no	coding-synonymous	ARHGEF16	NM_014448.3		3726,2074,687	AA,AG,GG		13.0947,47.1351,26.5762		559/710	3395039	9526,3448	2199	4288	6487	SO:0001819	synonymous_variant	27237	exon12			CCAGGTGGAGAAG	D89016	CCDS46.2	1p36.3	2013-01-10	2010-04-13		ENSG00000130762	ENSG00000130762		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15515	protein-coding gene	gene with protein product	"""putative neuroblastoma protein"""						Standard	NM_014448		Approved	NBR, GEF16	uc001akg.4	Q5VV41	OTTHUMG00000000625	ENST00000378378.4:c.1677G>A	1.37:g.3395039G>A		726	5		602	13	NM_014448	0	0	0	0	0	Q86TF0|Q99434	Silent	SNP	ENST00000378378.4	37	CCDS46.2																																																																																			G|0.281;A|0.719		0.652	ARHGEF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001515.1	NM_014448	
AMPD2	271	bcgsc.ca	37	1	110170896	110170896	+	Silent	SNP	T	T	C	rs863978	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr1:110170896T>C	ENST00000256578.3	+	10	1794	c.1434T>C	c.(1432-1434)caT>caC	p.H478H	AMPD2_ENST00000528454.1_Silent_p.H360H|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000393688.3_Silent_p.H359H|AMPD2_ENST00000528667.1_Silent_p.H478H|AMPD2_ENST00000342115.4_Silent_p.H397H|AMPD2_ENST00000358729.4_Silent_p.H403H|AMPD2_ENST00000526301.1_3'UTR	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	478					cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		TGGATGTGCATGCGGTCTGTG	0.622													T|||	4045	0.807708	0.7337	0.7695	5008	,	,		19104	0.9802		0.6769	False		,,,				2504	0.8916				p.H478H		.											.	AMPD2-292	0			c.T1434C						.	T	,,	3331,1075	722.3+/-409.3	1256,819,128	76.0	71.0	73.0		1434,1191,1077	-1.8	1.0	1	dbSNP_86	73	5568,3032	663.0+/-402.0	1798,1972,530	no	coding-synonymous,coding-synonymous,coding-synonymous	AMPD2	NM_004037.6,NM_139156.2,NM_203404.1	,,	3054,2791,658	CC,CT,TT		35.2558,24.3985,31.5777	,,	478/880,397/799,359/761	110170896	8899,4107	2203	4300	6503	SO:0001819	synonymous_variant	271	exon11			TGTGCATGCGGTC	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.1434T>C	1.37:g.110170896T>C		147	1		148	6	NM_001257360	0	0	0	0	0	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Silent	SNP	ENST00000256578.3	37	CCDS805.1	1713	0.7843406593406593	371	0.7540650406504065	270	0.7458563535911602	563	0.9842657342657343	509	0.6715039577836411	T	7.305	0.613917	0.14066	0.756015	0.647442	ENSG00000116337	ENST00000369840	.	.	.	5.04	-1.77	0.07982	.	.	.	.	.	T	0.24084	0.0583	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.20338	-1.0278	3	.	.	.	-42.0812	10.0817	0.42393	0.0:0.3024:0.0:0.6976	rs863978;rs2228425;rs11556215;rs60258788;rs863978	.	.	.	R	449	.	.	C	+	1	0	AMPD2	109972419	0.042000	0.20092	0.994000	0.49952	0.692000	0.40212	-0.772000	0.04694	-0.169000	0.10834	-0.441000	0.05720	TGC	T|0.265;C|0.735		0.622	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
HIST2H2AB	317772	broad.mit.edu	37	1	149859428	149859428	+	Silent	SNP	A	A	G			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr1:149859428A>G	ENST00000331128.3	-	1	38	c.39T>C	c.(37-39)gcT>gcC	p.A13A	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_175065.2	NP_778235.1	Q8IUE6	H2A2B_HUMAN	histone cluster 2, H2ab	13						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.A13A(1)		breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			ACTTGGCCTTAGCGCGGGCCT	0.587																																					p.A13A		.											.	HIST2H2AB-154	1	Substitution - coding silent(1)	kidney(1)	c.T39C						.						56.0	63.0	61.0					1																	149859428		2202	4290	6492	SO:0001819	synonymous_variant	317772	exon1			GGCCTTAGCGCGG	AY131972	CCDS938.1	1q21.2	2011-01-27	2006-10-11		ENSG00000184270	ENSG00000184270		"""Histones / Replication-dependent"""	20508	protein-coding gene	gene with protein product		615014	"""histone 2, H2ab"""			12408966	Standard	NM_175065		Approved		uc001ete.3	Q8IUE6	OTTHUMG00000012085	ENST00000331128.3:c.39T>C	1.37:g.149859428A>G		104	0		117	5	NM_175065	0	0	0	0	0		Silent	SNP	ENST00000331128.3	37	CCDS938.1																																																																																			.		0.587	HIST2H2AB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033440.1	NM_175065	
PGLYRP4	57115	broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	153309754	153309754	+	Silent	SNP	G	G	A	rs184556258	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr1:153309754G>A	ENST00000359650.5	-	8	910	c.846C>T	c.(844-846)ggC>ggT	p.G282G	PGLYRP4_ENST00000368739.3_Silent_p.G278G	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	282					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CATAAATGGCGCCATCCTGGC	0.502													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		20085	0.0		0.0	False		,,,				2504	0.0				p.G282G		.											.	PGLYRP4-94	0			c.C846T						.	G		0,4406		0,0,2203	65.0	55.0	59.0		846	-6.7	0.0	1		59	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	PGLYRP4	NM_020393.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		282/374	153309754	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	57115	exon8			AATGGCGCCATCC	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.846C>T	1.37:g.153309754G>A		66	1		63	56	NM_020393	0	0	0	0	0	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Silent	SNP	ENST00000359650.5	37	CCDS30871.1																																																																																			G|0.999;A|0.000		0.502	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089978.1	NM_020393	
DNAJC12	56521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	69571291	69571291	+	Silent	SNP	T	T	G			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr10:69571291T>G	ENST00000225171.2	-	3	440	c.288A>C	c.(286-288)tcA>tcC	p.S96S	DNAJC12_ENST00000339758.7_Silent_p.S96S|DNAJC12_ENST00000483798.2_Silent_p.S126S|RNU6-1250P_ENST00000391218.1_RNA	NM_021800.2	NP_068572.1	Q9UKB3	DJC12_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 12	96										breast(2)|kidney(2)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	12						CCGTCTTCACTGAGTCATTCA	0.507																																					p.S96S		.											.	DNAJC12-658	0			c.A288C						.						190.0	151.0	164.0					10																	69571291		2203	4300	6503	SO:0001819	synonymous_variant	56521	exon3			CTTCACTGAGTCA	AF176012	CCDS7271.1, CCDS7272.1	10q21.3	2011-09-02			ENSG00000108176	ENSG00000108176		"""Heat shock proteins / DNAJ (HSP40)"""	28908	protein-coding gene	gene with protein product	"""J domain protein 1"""	606060				10760603	Standard	NM_021800		Approved	JDP1	uc001jnb.3	Q9UKB3	OTTHUMG00000018339	ENST00000225171.2:c.288A>C	10.37:g.69571291T>G		170	0		149	49	NM_021800	0	0	0	0	0	Q5JVQ1|Q9UKB2	Silent	SNP	ENST00000225171.2	37	CCDS7271.1																																																																																			.		0.507	DNAJC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048291.1	NM_021800	
TDRD1	56165	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	115982440	115982440	+	Silent	SNP	C	C	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr10:115982440C>T	ENST00000369280.1	+	21	3445	c.2985C>T	c.(2983-2985)gaC>gaT	p.D995D	TDRD1_ENST00000422662.1_Silent_p.D599D|TDRD1_ENST00000251864.2_Silent_p.D995D|TDRD1_ENST00000369281.2_Silent_p.D881D|TDRD1_ENST00000369282.1_Silent_p.D995D			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	995	Tudor 4. {ECO:0000255|PROSITE- ProRule:PRU00211}.				DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GAATTGGAGACGCATGCTGTG	0.373																																					p.D995D		.											.	TDRD1-90	0			c.C2985T						.						89.0	89.0	89.0					10																	115982440		2203	4300	6503	SO:0001819	synonymous_variant	56165	exon21			TGGAGACGCATGC	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.2985C>T	10.37:g.115982440C>T		71	0		47	6	NM_198795	0	0	0	0	0	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Silent	SNP	ENST00000369280.1	37																																																																																				.		0.373	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
USH1C	10083	broad.mit.edu	37	11	17542909	17542909	+	Missense_Mutation	SNP	G	G	A	rs140934960		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr11:17542909G>A	ENST00000318024.4	-	13	1177	c.1069C>T	c.(1069-1071)Cgg>Tgg	p.R357W	USH1C_ENST00000005226.7_Missense_Mutation_p.R357W|USH1C_ENST00000527720.1_Missense_Mutation_p.R326W|USH1C_ENST00000527020.1_Missense_Mutation_p.R338W	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	357					auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						ATCTCCTTCCGGTATCTCTCA	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		19566	0.0		0.0	False		,,,				2504	0.001				p.R357W		.											.	USH1C-91	0			c.C1069T						.						325.0	264.0	285.0					11																	17542909		2200	4293	6493	SO:0001583	missense	10083	exon13			CCTTCCGGTATCT	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1069C>T	11.37:g.17542909G>A	ENSP00000317018:p.Arg357Trp	134	1		125	4	NM_005709	0	0	0	0	0	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	37	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285423	0.80803	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	T;T;T;T	0.39997	1.42;1.47;1.68;1.05	5.72	5.72	0.89469	.	0.117280	0.56097	D	0.000033	T	0.55955	0.1953	L	0.36672	1.1	0.46823	D	0.999213	D;D;D	0.89917	0.999;0.999;1.0	D;P;D	0.72338	0.932;0.893;0.977	T	0.49771	-0.8904	10	0.38643	T	0.18	.	18.651	0.91430	0.0:0.0:1.0:0.0	.	338;357;357	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	W	357;326;338;357	ENSP00000317018:R357W;ENSP00000432944:R326W;ENSP00000436934:R338W;ENSP00000005226:R357W	ENSP00000005226:R357W	R	-	1	2	USH1C	17499485	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.551000	0.53698	2.703000	0.92315	0.650000	0.86243	CGG	G|1.000;A|0.000		0.502	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
TCP11L1	55346	bcgsc.ca	37	11	33065394	33065394	+	Silent	SNP	C	C	T	rs1064005	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr11:33065394C>T	ENST00000334274.4	+	2	475	c.75C>T	c.(73-75)ctC>ctT	p.L25L	TCP11L1_ENST00000432887.1_Silent_p.L25L|TCP11L1_ENST00000530171.1_3'UTR|TCP11L1_ENST00000531632.2_Silent_p.L25L	NM_018393.3	NP_060863.3	Q9NUJ3	T11L1_HUMAN	t-complex 11, testis-specific-like 1	25						microtubule (GO:0005874)				kidney(1)|liver(2)|lung(2)|skin(1)	6						AGGAAGGCCTCGAAGATGCTG	0.408													C|||	1991	0.397564	0.4576	0.4467	5008	,	,		19560	0.4226		0.3986	False		,,,				2504	0.2546				p.L25L		.											.	TCP11L1-90	0			c.C75T						.	C	,	1991,2413	558.9+/-380.1	435,1121,646	199.0	205.0	203.0		75,75	-2.0	1.0	11	dbSNP_86	203	3417,5179	505.6+/-376.4	691,2035,1572	yes	coding-synonymous,coding-synonymous	TCP11L1	NM_001145541.1,NM_018393.3	,	1126,3156,2218	TT,TC,CC		39.751,45.2089,41.6	,	25/510,25/510	33065394	5408,7592	2202	4298	6500	SO:0001819	synonymous_variant	55346	exon2			AGGCCTCGAAGAT	BC041696	CCDS7882.1	11p13	2014-08-12	2012-09-20		ENSG00000176148	ENSG00000176148			25655	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 1"""				Standard	NM_001145541		Approved	FLJ11336	uc010rei.2	Q9NUJ3	OTTHUMG00000165303	ENST00000334274.4:c.75C>T	11.37:g.33065394C>T		106	0		76	5	NM_001145541	0	0	0	0	0	D3DR01|Q8IVX4	Silent	SNP	ENST00000334274.4	37	CCDS7882.1																																																																																			C|0.583;T|0.417		0.408	TCP11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383377.4	NM_018393	
LRP5	4041	bcgsc.ca	37	11	68174122	68174122	+	Silent	SNP	G	G	A	rs2277268	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr11:68174122G>A	ENST00000294304.7	+	9	2038	c.1932G>A	c.(1930-1932)gaG>gaA	p.E644E		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	644	Beta-propeller 3.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TCGTGCCTGAGGCCTTCTTGG	0.622													G|||	280	0.0559105	0.0651	0.0504	5008	,	,		19192	0.0575		0.0716	False		,,,				2504	0.0297				p.E644E		.											.	LRP5-661	0			c.G1932A						.	G		307,4093	166.2+/-197.5	6,295,1899	77.0	62.0	67.0		1932	1.2	1.0	11	dbSNP_100	67	596,7992	158.2+/-211.7	24,548,3722	no	coding-synonymous	LRP5	NM_002335.2		30,843,5621	AA,AG,GG		6.9399,6.9773,6.9526		644/1616	68174122	903,12085	2200	4294	6494	SO:0001819	synonymous_variant	4041	exon9			GCCTGAGGCCTTC	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.1932G>A	11.37:g.68174122G>A		139	2		97	5	NM_002335	0	0	0	0	0	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	ENST00000294304.7	37	CCDS8181.1																																																																																			G|0.935;A|0.065		0.622	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395088.1	NM_002335	
INPPL1	3636	broad.mit.edu	37	11	71949087	71949087	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr11:71949087C>A	ENST00000298229.2	+	27	3758	c.3554C>A	c.(3553-3555)gCt>gAt	p.A1185D	PHOX2A_ENST00000544057.1_5'Flank|INPPL1_ENST00000538751.1_Splice_Site_p.A943D|INPPL1_ENST00000541756.1_Splice_Site_p.A943D	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	1185					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)	p.A1185D(2)		breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						TTTCCTTAGGCTCCGTGCCTG	0.657											OREG0021191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1185D		.											.	INPPL1-660	2	Substitution - Missense(2)	urinary_tract(1)|prostate(1)	c.C3554A						.						15.0	17.0	17.0					11																	71949087		2197	4291	6488	SO:0001630	splice_region_variant	3636	exon27			CTTAGGCTCCGTG	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.3553-1C>A	11.37:g.71949087C>A		26	1	1133	56	9	NM_001567	0	0	0	0	0	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	ENST00000298229.2	37	CCDS8213.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	12.01|12.01	1.810120|1.810120	0.32053|0.32053	.|.	.|.	ENSG00000165458|ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751|ENST00000320683	D;D;D|.	0.96716|.	-2.99;-4.1;-4.1|.	4.69|4.69	2.76|2.76	0.32466|0.32466	.|.	0.083463|.	0.47093|.	D|.	0.000259|.	T|T	0.34600|0.34600	0.0903|0.0903	N|N	0.14661|0.14661	0.345|0.345	0.36357|0.36357	D|D	0.860441|0.860441	P|.	0.44090|.	0.826|.	B|.	0.38655|.	0.278|.	T|T	0.28681|0.28681	-1.0036|-1.0036	10|5	0.44086|.	T|.	0.13|.	.|.	7.041|7.041	0.25021|0.25021	0.0:0.6953:0.1561:0.1486|0.0:0.6953:0.1561:0.1486	.|.	1185|.	O15357|.	SHIP2_HUMAN|.	D|I	1185;943;943|47	ENSP00000298229:A1185D;ENSP00000446360:A943D;ENSP00000444619:A943D|.	ENSP00000298229:A1185D|.	A|L	+|+	2|1	0|0	INPPL1|INPPL1	71626735|71626735	0.671000|0.671000	0.27521|0.27521	1.000000|1.000000	0.80357|0.80357	0.421000|0.421000	0.31385|0.31385	1.197000|1.197000	0.32211|0.32211	1.184000|1.184000	0.42957|0.42957	0.591000|0.591000	0.81541|0.81541	GCT|CTC	.		0.657	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396789.1	NM_001567	Missense_Mutation
KCNA6	3742	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	4919736	4919736	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr12:4919736G>A	ENST00000280684.3	+	1	1395	c.529G>A	c.(529-531)Gcc>Acc	p.A177T	KCNA6_ENST00000433855.1_Missense_Mutation_p.A177T|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	177					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	CAGGGGCATCGCCATCGTCTC	0.597										HNSCC(72;0.22)																											p.A177T		.											.	KCNA6-93	0			c.G529A						.						61.0	55.0	57.0					12																	4919736		2203	4300	6503	SO:0001583	missense	3742	exon1			GGCATCGCCATCG	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.529G>A	12.37:g.4919736G>A	ENSP00000280684:p.Ala177Thr	132	1		244	50	NM_002235	0	0	0	0	0		Missense_Mutation	SNP	ENST00000280684.3	37	CCDS8534.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376688	0.82682	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	T;T	0.70869	-0.52;-0.52	4.99	4.99	0.66335	.	0.108809	0.64402	N	0.000008	T	0.80691	0.4671	M	0.65975	2.015	0.80722	D	1	D	0.61697	0.99	P	0.58391	0.838	T	0.83097	-0.0130	10	0.87932	D	0	.	17.4425	0.87568	0.0:0.0:1.0:0.0	.	177	P17658	KCNA6_HUMAN	T	177	ENSP00000408321:A177T;ENSP00000280684:A177T	ENSP00000280684:A177T	A	+	1	0	KCNA6	4789997	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	9.650000	0.98490	2.595000	0.87683	0.563000	0.77884	GCC	.		0.597	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235	
FAM186A	121006	hgsc.bcm.edu	37	12	50745756	50745863	+	In_Frame_Del	DEL	GCCTGCTGAGGGGTGAGAGGGATCCCCTGAGCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGC	GCCTGCTGAGGGGTGAGAGGGATCCCCTGAGCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGC	-	rs529424307|rs12317429|rs113879003|rs34602257|rs34782671|rs528750865|rs144970699|rs374020295|rs373687267|rs12297653|rs12317332|rs12317337|rs552113332	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	GCCTGCTGAGGGGTGAGAGGGATCCCCTGAGCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGC	GCCTGCTGAGGGGTGAGAGGGATCCCCTGAGCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr12:50745756_50745863delGCCTGCTGAGGGGTGAGAGGGATCCCCTGAGCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGC	ENST00000327337.5	-	4	4751_4858	c.4752_4859delGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGCGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGCGCAGGCTCAGGGGATCCCTCTCACCCCTCAGCAGGC	c.(4750-4860)gcgcaggaactggggatccctctcacccctcagcaggcgcaggaactggggatccctctcacccctcagcaggcgcaggctcaggggatccctctcacccctcagcaggcc>gcc	p.1584_1620AQELGIPLTPQQAQELGIPLTPQQAQAQGIPLTPQQA>A	FAM186A_ENST00000543096.1_5'Flank|FAM186A_ENST00000543111.1_In_Frame_Del_p.1584_1620AQELGIPLTPQQAQELGIPLTPQQAQAQGIPLTPQQA>A	NM_001145475.1	NP_001138947.1	A6NE01	F186A_HUMAN	family with sequence similarity 186, member A	1584								p.G1612G(1)|p.A1608A(1)|p.E1586A(1)|p.A1584A(1)|p.Q1611L(1)|p.A1610A(1)|p.E1598A(1)|p.E1598D(1)									CAGAGCCTGGGCCTGCTGAGGGGTGAGAGGGATCCCCTGAGCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGCGCCTGCTGAG	0.669																																					p.1584_1620del	NSCLC(138;1796 1887 12511 19463 37884)	.											.	FAM186A-68	8	Substitution - Missense(4)|Substitution - coding silent(4)	stomach(6)|endometrium(1)|skin(1)	c.4752_4859del						.																																			SO:0001651	inframe_deletion	121006	exon4			GCCTGGGCCTGCT		CCDS44878.1	12q13.13	2009-04-22			ENSG00000185958	ENSG00000185958			26980	protein-coding gene	gene with protein product							Standard	NM_001145475		Approved	LOC121006	uc001rwl.2	A6NE01	OTTHUMG00000167889	ENST00000327337.5:c.4752_4859delGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGCGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGCGCAGGCTCAGGGGATCCCTCTCACCCCTCAGCAGGC	12.37:g.50745756_50745863delGCCTGCTGAGGGGTGAGAGGGATCCCCTGAGCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGCGCCTGCTGAGGGGTGAGAGGGATCCCCAGTTCCTGC	ENSP00000329995:p.Ala1584_Gln1619del	212	0		294	0	NM_001145475	0	0	0	0	0		In_Frame_Del	DEL	ENST00000327337.5	37	CCDS44878.1																																																																																			.		0.669	FAM186A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396838.1	XM_001718353	
GTSF1	121355	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	54857074	54857074	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr12:54857074G>T	ENST00000552397.1	-	4	1021	c.125C>A	c.(124-126)cCt>cAt	p.P42H	GTSF1_ENST00000305879.5_Missense_Mutation_p.P42H|RP11-753H16.5_ENST00000552785.1_RNA|GTSF1_ENST00000552395.1_5'UTR|RP11-753H16.3_ENST00000550474.1_RNA			Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1	42						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(1001;0.00452)				TGCAACATCAGGATGATTCTG	0.438																																					p.P42H		.											.	GTSF1-90	0			c.C125A						.						122.0	111.0	115.0					12																	54857074		2203	4300	6503	SO:0001583	missense	121355	exon4			ACATCAGGATGAT	AK098819	CCDS8881.1	12q13.2	2008-02-04	2007-11-27	2007-11-27		ENSG00000170627			26565	protein-coding gene	gene with protein product			"""family with sequence similarity 112, member B"""	FAM112B		12477932	Standard	NM_144594		Approved	FLJ32942	uc001sgb.3	Q8WW33		ENST00000552397.1:c.125C>A	12.37:g.54857074G>T	ENSP00000446485:p.Pro42His	103	0		165	86	NM_144594	0	0	0	0	0	B3KQ60|Q0VGM4|Q8N778	Missense_Mutation	SNP	ENST00000552397.1	37	CCDS8881.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287314	0.59867	.	.	ENSG00000170627	ENST00000552397;ENST00000305879	T;T	0.51325	0.71;0.71	6.02	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.65770	0.2723	M	0.80616	2.505	0.40484	D	0.980474	D	0.71674	0.998	D	0.63877	0.919	T	0.71104	-0.4689	10	0.72032	D	0.01	-11.1963	9.9855	0.41839	0.0:0.1506:0.6932:0.1562	.	42	Q8WW33	GTSF1_HUMAN	H	42	ENSP00000446485:P42H;ENSP00000304185:P42H	ENSP00000304185:P42H	P	-	2	0	GTSF1	53143341	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.312000	0.72840	1.521000	0.48983	0.655000	0.94253	CCT	.		0.438	GTSF1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406187.1	NM_144594	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	8	0		35	16	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
F7	2155	bcgsc.ca	37	13	113770068	113770068	+	Silent	SNP	C	C	T	rs6042	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr13:113770068C>T	ENST00000375581.3	+	6	560	c.525C>T	c.(523-525)caC>caT	p.H175H	F7_ENST00000541084.1_Silent_p.H106H|F7_ENST00000346342.3_Silent_p.H153H	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	175	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	GTCGGTGCCACGAGGGGTACT	0.617													C|||	729	0.145567	0.1346	0.1282	5008	,	,		19696	0.0446		0.1213	False		,,,				2504	0.3016				p.H175H		.											.	F7-90	0			c.C525T						.	C	,	590,3816	257.0+/-261.6	43,504,1656	64.0	54.0	57.0		525,459	-3.2	0.4	13	dbSNP_52	57	1008,7592	215.7+/-255.0	62,884,3354	no	coding-synonymous,coding-synonymous	F7	NM_000131.3,NM_019616.2	,	105,1388,5010	TT,TC,CC		11.7209,13.3908,12.2866	,	175/467,153/445	113770068	1598,11408	2203	4300	6503	SO:0001819	synonymous_variant	2155	exon6			GTGCCACGAGGGG		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.525C>T	13.37:g.113770068C>T		185	1		92	5	NM_000131	0	0	0	0	0	B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Silent	SNP	ENST00000375581.3	37	CCDS9528.1																																																																																			C|0.876;T|0.124		0.617	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045838.4	NM_000131	
OR11H12	440153	bcgsc.ca	37	14	19378496	19378496	+	Silent	SNP	T	T	C			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr14:19378496T>C	ENST00000550708.1	+	1	975	c.903T>C	c.(901-903)aaT>aaC	p.N301N		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CACTCTTCAATCCCCTTATCT	0.433																																					p.N301N		.											.	OR11H12-24	0			c.T903C						.						7.0	7.0	7.0					14																	19378496		1103	2704	3807	SO:0001819	synonymous_variant	440153	exon1			CTTCAATCCCCTT		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.903T>C	14.37:g.19378496T>C		419	3		392	61	NM_001013354	0	0	0	0	0		Silent	SNP	ENST00000550708.1	37	CCDS32017.1																																																																																			.		0.433	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354	
KIF26A	26153	bcgsc.ca	37	14	104643409	104643409	+	Silent	SNP	A	A	G	rs2487303	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr14:104643409A>G	ENST00000423312.2	+	12	4284	c.4284A>G	c.(4282-4284)gcA>gcG	p.A1428A	KIF26A_ENST00000315264.7_Silent_p.A1289A	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1428					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		AGGTAGAAGCAGCACACCGTC	0.706													G|||	3872	0.773163	0.826	0.7176	5008	,	,		14740	0.7827		0.7048	False		,,,				2504	0.8016				p.A1428A		.											.	KIF26A-24	0			c.A4284G						.	G		3386,734		1393,600,67	11.0	16.0	14.0		4284	-7.2	0.0	14	dbSNP_100	14	6044,2232		2231,1582,325	no	coding-synonymous	KIF26A	NM_015656.1		3624,2182,392	GG,GA,AA		26.9696,17.8155,23.9271		1428/1883	104643409	9430,2966	2060	4138	6198	SO:0001819	synonymous_variant	26153	exon12			AGAAGCAGCACAC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4284A>G	14.37:g.104643409A>G		8	1		14	14	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			A|0.242;G|0.758		0.706	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
KIF26A	26153	bcgsc.ca	37	14	104643421	104643421	+	Silent	SNP	T	T	C	rs2487302	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr14:104643421T>C	ENST00000423312.2	+	12	4296	c.4296T>C	c.(4294-4296)ctT>ctC	p.L1432L	KIF26A_ENST00000315264.7_Silent_p.L1293L	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1432					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CACACCGTCTTGCCGGACACG	0.701													T|||	2325	0.464257	0.5915	0.3559	5008	,	,		14530	0.4018		0.3767	False		,,,				2504	0.5235				p.L1432L		.											.	KIF26A-24	0			c.T4296C						.	T		2200,1944		632,936,504	12.0	16.0	15.0		4296	-8.2	0.0	14	dbSNP_100	15	3127,5165		644,1839,1663	no	coding-synonymous	KIF26A	NM_015656.1		1276,2775,2167	CC,CT,TT		37.711,46.9112,42.8353		1432/1883	104643421	5327,7109	2072	4146	6218	SO:0001819	synonymous_variant	26153	exon12			CCGTCTTGCCGGA	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.4296T>C	14.37:g.104643421T>C		8	1		13	13	NM_015656	0	0	0	0	0	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	ENST00000423312.2	37	CCDS45171.1																																																																																			T|0.569;C|0.431		0.701	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414356.1		
DNAJA4	55466	bcgsc.ca	37	15	78567960	78567960	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr15:78567960G>T	ENST00000394852.3	+	5	957	c.767G>T	c.(766-768)gGc>gTc	p.G256V	DNAJA4_ENST00000343789.3_Missense_Mutation_p.G256V|DNAJA4_ENST00000394855.3_Missense_Mutation_p.G285V|DNAJA4_ENST00000446172.2_Missense_Mutation_p.G229V	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	256					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						CAGAGACGAGGCCATGACTTG	0.398																																					p.G285V		.											.	DNAJA4-226	0			c.G854T						.						142.0	125.0	131.0					15																	78567960		2196	4293	6489	SO:0001583	missense	55466	exon6			GACGAGGCCATGA	AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.767G>T	15.37:g.78567960G>T	ENSP00000378321:p.Gly256Val	137	1		136	5	NM_018602	0	0	0	0	0	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Missense_Mutation	SNP	ENST00000394852.3	37	CCDS45316.1	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831835	0.71258	.	.	ENSG00000140403	ENST00000394855;ENST00000343789;ENST00000394852;ENST00000446172	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.63	5.63	0.86233	HSP40/DnaJ peptide-binding (1);	0.250874	0.47093	D	0.000259	D	0.82282	0.5003	H	0.99764	4.76	0.80722	D	1	D;D;P	0.52996	0.957;0.957;0.949	P;P;P	0.59643	0.771;0.771;0.861	D	0.88546	0.3113	10	0.72032	D	0.01	-21.7567	12.0541	0.53524	0.0776:0.0:0.9224:0.0	.	229;256;285	E9PDM9;Q8WW22;Q8WW22-2	.;DNJA4_HUMAN;.	V	285;256;256;229	ENSP00000378324:G285V;ENSP00000339581:G256V;ENSP00000378321:G256V;ENSP00000413499:G229V	ENSP00000339581:G256V	G	+	2	0	DNAJA4	76355015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.076000	0.64413	2.652000	0.90054	0.655000	0.94253	GGC	.		0.398	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602	
MSLNL	401827	bcgsc.ca	37	16	820944	820944	+	Missense_Mutation	SNP	T	T	A	rs12599363	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr16:820944T>A	ENST00000442466.1	-	12	1387	c.1388A>T	c.(1387-1389)gAc>gTc	p.D463V	MIR662_ENST00000384847.1_RNA|MSLNL_ENST00000293892.3_Missense_Mutation_p.D814V			Q96KJ4	MSLNL_HUMAN	mesothelin-like	463			D -> V (in dbSNP:rs12599363).		cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GGAGGAGAGGTCCAGGGCCCC	0.687													.|||	1269	0.253395	0.3714	0.2464	5008	,	,		10844	0.2659		0.175	False		,,,				2504	0.1667				.		.											.	.	0			.						.	T	VAL/ASP	1160,2746		190,780,983	11.0	17.0	15.0		2441	4.8	1.0	16	dbSNP_120	15	1645,6627		176,1293,2667	yes	missense	MSLNL	NM_001025190.1	152	366,2073,3650	AA,AT,TT		19.8864,29.6979,23.0333	probably-damaging	814/1054	820944	2805,9373	1953	4136	6089	SO:0001583	missense	724032	.			GAGAGGTCCAGGG			16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.1388A>T	16.37:g.820944T>A	ENSP00000415767:p.Asp463Val	99	0		154	6	.	0	0	0	0	0		Missense_Mutation	SNP	ENST00000442466.1	37		539	0.2467948717948718	180	0.36585365853658536	73	0.20165745856353592	149	0.26048951048951047	137	0.18073878627968337	T	16.77	3.214605	0.58452	0.296979	0.198864	ENSG00000162006	ENST00000543963;ENST00000442466;ENST00000293892	T;T;T	0.19806	2.12;2.12;2.12	4.84	4.84	0.62591	.	0.222920	0.36268	N	0.002689	T	0.00012	0.0000	.	.	.	0.18873	P	0.9999890728	D	0.65815	0.995	P	0.61070	0.883	T	0.41893	-0.9483	8	0.56958	D	0.05	-51.1191	12.0765	0.53647	0.0:0.0:0.0:1.0	rs12599363	463	Q96KJ4	MSLNL_HUMAN	V	513;463;814	ENSP00000441381:D513V;ENSP00000415767:D463V;ENSP00000293892:D814V	ENSP00000293892:D814V	D	-	2	0	MSLNL	760945	0.827000	0.29292	0.985000	0.45067	0.515000	0.34225	2.506000	0.45433	1.930000	0.55929	0.459000	0.35465	GAC	T|0.765;A|0.235		0.687	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_001025190	
MRPS34	65993	hgsc.bcm.edu	37	16	1822947	1822947	+	Silent	SNP	C	C	G	rs1076695	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr16:1822947C>G	ENST00000397375.2	-	1	209	c.174G>C	c.(172-174)gtG>gtC	p.V58V	NME3_ENST00000219302.3_5'Flank|EME2_ENST00000307394.7_5'Flank|NME3_ENST00000563498.1_5'Flank|MRPS34_ENST00000177742.3_Silent_p.V58V|EME2_ENST00000568449.1_5'Flank	NM_023936.1	NP_076425.1	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	58						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|skin(2)	3						TCTCGCGGCGCACGTCGGCCC	0.726													C|||	251	0.0501198	0.0061	0.0965	5008	,	,		10499	0.002		0.1421	False		,,,				2504	0.0317				p.V58V		.											.	MRPS34-92	0			c.G174C						.	C		25,2311		0,25,1143	1.0	2.0	2.0		174	1.7	1.0	16	dbSNP_86	2	405,4871		9,387,2242	no	coding-synonymous	MRPS34	NM_023936.1		9,412,3385	GG,GC,CC		7.6763,1.0702,5.649		58/219	1822947	430,7182	1168	2638	3806	SO:0001819	synonymous_variant	65993	exon1			GCGGCGCACGTCG	BC001182	CCDS10444.1, CCDS73805.1	16p13.3	2012-09-13			ENSG00000074071	ENSG00000074071		"""Mitochondrial ribosomal proteins / small subunits"""	16618	protein-coding gene	gene with protein product		611994					Standard	NM_023936		Approved	MRP-S12, MGC2616	uc002cmo.3	P82930	OTTHUMG00000128636	ENST00000397375.2:c.174G>C	16.37:g.1822947C>G		0	0		9	6	NM_023936	0	0	0	0	0	Q9BVI7	Silent	SNP	ENST00000397375.2	37	CCDS10444.1																																																																																			C|0.923;G|0.077		0.726	MRPS34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250506.1	NM_023936	
EME2	197342	hgsc.bcm.edu	37	16	1823444	1823444	+	Silent	SNP	C	C	G	rs761065	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr16:1823444C>G	ENST00000568449.1	+	1	237	c.216C>G	c.(214-216)gtC>gtG	p.V72V	NME3_ENST00000219302.3_5'Flank|MRPS34_ENST00000397375.2_5'Flank|EME2_ENST00000307394.7_Silent_p.V72V|NME3_ENST00000563498.1_5'Flank|MRPS34_ENST00000177742.3_5'Flank	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	72					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CGGAGCAGGTCCTGAAGCGCC	0.746								Direct reversal of damage;Homologous recombination					C|||	1683	0.336062	0.0915	0.4885	5008	,	,		9781	0.2808		0.5666	False		,,,				2504	0.3783				p.V72V		.											.	EME2-229	0			c.C216G						.	C		457,2833		68,321,1256	4.0	5.0	5.0		216	-5.9	0.0	16	dbSNP_86	5	3986,3362		1200,1586,888	no	coding-synonymous	EME2	NM_001010865.1		1268,1907,2144	GG,GC,CC		45.7539,13.8906,41.7654		72/445	1823444	4443,6195	1645	3674	5319	SO:0001819	synonymous_variant	197342	exon1			GCAGGTCCTGAAG	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.216C>G	16.37:g.1823444C>G		0	0		7	7	NM_001257370	0	0	0	0	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			C|0.615;G|0.385		0.746	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000433185.2	NM_001010865	
KRTAP4-8	728224	ucsc.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	A	T	rs76270529		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:39254054A>T	ENST00000333822.4	-	1	339	c.283T>A	c.(283-285)Tgc>Agc	p.C95S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C95S(4)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgcagcagcTAGGG	0.677																																					p.C95S		.											.	.	4	Substitution - Missense(4)	endometrium(3)|kidney(1)	c.T283A						.						7.0	11.0	10.0					17																	39254054		685	1582	2267	SO:0001583	missense	728224	exon1			AGATGCAGCAGCT	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.283T>A	17.37:g.39254054A>T	ENSP00000328444:p.Cys95Ser	142	4		161	16	NM_031960	0	0	0	0	0	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755714	0.49362	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02280	4.36	3.11	2.01	0.26516	.	0.000000	0.52532	U	0.000067	T	0.04497	0.0123	M	0.83223	2.63	0.25182	N	0.99019	B	0.21606	0.058	B	0.27887	0.084	T	0.21793	-1.0235	10	0.54805	T	0.06	.	6.3859	0.21559	0.8715:0.0:0.1285:0.0	.	95	Q9BYQ9	KRA48_HUMAN	S	95;80	ENSP00000328444:C95S	ENSP00000414561:C80S	C	-	1	0	KRTAP4-8	36507580	0.999000	0.42202	0.393000	0.26258	0.649000	0.38597	3.122000	0.50446	0.404000	0.25506	0.374000	0.22700	TGC	A|0.500;T|0.500		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257684.1	NM_031960	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305769	39305769	+	Missense_Mutation	SNP	G	G	C	rs151111061		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:39305769G>C	ENST00000343246.4	-	1	285	c.251C>G	c.(250-252)aCc>aGc	p.T84S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	84	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cctgcagcaggtggtctggca	0.657																																					p.T84S		.											.	KRTAP4-5-90	0			c.C251G						.						15.0	22.0	20.0					17																	39305769		2110	4225	6335	SO:0001583	missense	85289	exon1			CAGCAGGTGGTCT	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.251C>G	17.37:g.39305769G>C	ENSP00000340546:p.Thr84Ser	83	0		78	24	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	0.045	-1.270621	0.01421	.	.	ENSG00000198271	ENST00000343246	T	0.00529	6.78	2.87	-5.75	0.02384	.	.	.	.	.	T	0.00241	0.0007	N	0.11673	0.155	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41520	-0.9504	9	0.02654	T	1	.	13.221	0.59887	0.1138:0.1674:0.7188:0.0	.	89	Q9BYR2	KRA45_HUMAN	S	84	ENSP00000340546:T84S	ENSP00000340546:T84S	T	-	2	0	KRTAP4-5	36559295	0.000000	0.05858	0.095000	0.20976	0.019000	0.09904	-1.804000	0.01738	-1.404000	0.02050	-1.446000	0.01064	ACC	.		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305774	39305774	+	Missense_Mutation	SNP	C	C	G	rs137947981		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:39305774C>G	ENST00000343246.4	-	1	280	c.246G>C	c.(244-246)caG>caC	p.Q82H		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	82	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcaggtggtctggcagcagc	0.652																																					p.Q82H		.											.	KRTAP4-5-90	1	Substitution - Missense(1)	lung(1)	c.G246C						.						14.0	21.0	19.0					17																	39305774		2102	4215	6317	SO:0001583	missense	85289	exon1			GGTGGTCTGGCAG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.246G>C	17.37:g.39305774C>G	ENSP00000340546:p.Gln82His	77	0		79	24	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	6.243	0.412973	0.11812	.	.	ENSG00000198271	ENST00000343246	T	0.00594	6.33	2.03	-0.354	0.12591	.	.	.	.	.	T	0.01320	0.0043	M	0.79693	2.465	0.09310	N	1	B	0.21147	0.052	B	0.35182	0.197	T	0.25950	-1.0117	9	0.45353	T	0.12	.	12.081	0.53671	0.0:0.7361:0.2639:0.0	.	87	Q9BYR2	KRA45_HUMAN	H	82	ENSP00000340546:Q82H	ENSP00000340546:Q82H	Q	-	3	2	KRTAP4-5	36559300	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-3.389000	0.00488	-0.371000	0.08004	-1.872000	0.00552	CAG	.		0.652	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
KRTAP4-5	85289	ucsc.edu	37	17	39305785	39305785	+	Missense_Mutation	SNP	A	A	T	rs411367		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:39305785A>T	ENST00000343246.4	-	1	269	c.235T>A	c.(235-237)Tgc>Agc	p.C79S		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	79	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			tggcagcagcaggggcggcag	0.657																																					p.C79S		.											.	KRTAP4-5-90	0			c.T235A						.						12.0	18.0	16.0					17																	39305785		2089	4172	6261	SO:0001583	missense	85289	exon1			AGCAGCAGGGGCG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.235T>A	17.37:g.39305785A>T	ENSP00000340546:p.Cys79Ser	61	2		85	36	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	773	0.35393772893772896	210	0.4268292682926829	126	0.34806629834254144	175	0.30594405594405594	262	0.34564643799472294	.	0.010	-1.763522	0.00651	.	.	ENSG00000198271	ENST00000343246	T	0.00534	6.74	2.78	-5.56	0.02529	.	0.768893	0.10092	N	0.717076	T	0.00012	0.0000	N	0.01431	-0.87	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.23297	-1.0192	9	0.02654	T	1	.	5.4481	0.16548	0.6146:0.0:0.1542:0.2312	rs411367;rs6503604	79	Q9BYR2	KRA45_HUMAN	S	79	ENSP00000340546:C79S	ENSP00000340546:C79S	C	-	1	0	KRTAP4-5	36559311	0.977000	0.34250	0.000000	0.03702	0.000000	0.00434	-0.260000	0.08708	-1.272000	0.02427	-2.057000	0.00402	TGC	A|0.354;T|0.646		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305800	39305800	+	Missense_Mutation	SNP	T	T	A	rs141998775		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:39305800T>A	ENST00000343246.4	-	1	254	c.220A>T	c.(220-222)Agc>Tgc	p.S74C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	74	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cggcagcagctggattcacag	0.657																																					p.S74C		.											.	KRTAP4-5-90	0			c.A220T						.						12.0	18.0	16.0					17																	39305800		2056	4148	6204	SO:0001583	missense	85289	exon1			AGCAGCTGGATTC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.220A>T	17.37:g.39305800T>A	ENSP00000340546:p.Ser74Cys	63	0		88	9	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	12.46	1.946118	0.34377	.	.	ENSG00000198271	ENST00000343246	T	0.00633	6.08	3.65	2.55	0.30701	.	.	.	.	.	T	0.01287	0.0042	N	0.25957	0.775	0.22412	N	0.999125	D	0.76494	0.999	D	0.63703	0.917	T	0.57015	-0.7883	9	0.59425	D	0.04	.	7.2679	0.26239	0.0:0.1123:0.0:0.8877	.	74	Q9BYR2	KRA45_HUMAN	C	74	ENSP00000340546:S74C	ENSP00000340546:S74C	S	-	1	0	KRTAP4-5	36559326	0.004000	0.15560	0.084000	0.20598	0.021000	0.10359	-0.223000	0.09177	0.555000	0.29079	0.358000	0.22013	AGC	.		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
ASB16	92591	hgsc.bcm.edu	37	17	42254281	42254281	+	Missense_Mutation	SNP	A	A	G	rs7212573	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:42254281A>G	ENST00000293414.1	+	3	829	c.745A>G	c.(745-747)Acg>Gcg	p.T249A	ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000592897.1_RNA|ASB16-AS1_ENST00000591166.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	249				T -> A (in Ref. 1; BAB70800/BAG37167, 3; AAH75088 and 4; AAL57353). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TGCGCTGAACACGGCGTGCGC	0.756													G|||	2594	0.517971	0.702	0.4424	5008	,	,		11135	0.752		0.2932	False		,,,				2504	0.3129				p.T249A		.											.	ASB16-227	0			c.A745G						.	G	ALA/THR,ARG/CYS	2530,1736		801,928,404	7.0	8.0	7.0		745,340	3.1	0.7	17	dbSNP_116	7	2387,5811		422,1543,2134	no	missense,missense	ASB16,C17orf65	NM_080863.4,NM_178542.3	58,180	1223,2471,2538	GG,GA,AA		29.1169,40.6939,39.4496	benign,benign	249/454,114/194	42254281	4917,7547	2133	4099	6232	SO:0001583	missense	92591	exon3			CTGAACACGGCGT	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.745A>G	17.37:g.42254281A>G	ENSP00000293414:p.Thr249Ala	2	0		5	5	NM_080863	0	0	0	0	0	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	1144|1144	0.5238095238095238|0.5238095238095238	349|349	0.709349593495935|0.709349593495935	142|142	0.39226519337016574|0.39226519337016574	420|420	0.7342657342657343|0.7342657342657343	233|233	0.3073878627968338|0.3073878627968338	G|G	5.919|5.919	0.353578|0.353578	0.11182|0.11182	0.593061|0.593061	0.291169|0.291169	ENSG00000168597|ENSG00000161664	ENST00000303061|ENST00000293414	.|T	.|0.51817	.|0.69	5.22|5.22	3.08|3.08	0.35506|0.35506	.|Ankyrin repeat-containing domain (4);	.|0.157781	.|0.56097	.|N	.|0.000038	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.04148|0.04148	-0.265|-0.265	0.58432|0.58432	P|P	8.000000000008E-6|8.000000000008E-6	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.01281	0.0|0.0	T|T	0.41502|0.41502	-0.9505|-0.9505	7|9	0.87932|0.05833	D|T	0|0.94	-9.3151|-9.3151	9.5645|9.5645	0.39389|0.39389	0.0761:0.0:0.6662:0.2577|0.0761:0.0:0.6662:0.2577	rs7212573|rs7212573	114|249	Q495Z4|Q96NS5	CQ065_HUMAN|ASB16_HUMAN	R|A	114|249	.|ENSP00000293414:T249A	ENSP00000366342:C114R|ENSP00000293414:T249A	C|T	-|+	1|1	0|0	C17orf65|ASB16	39609807|39609807	0.002000|0.002000	0.14202|0.14202	0.723000|0.723000	0.30687|0.30687	0.056000|0.056000	0.15407|0.15407	1.059000|1.059000	0.30517|0.30517	0.777000|0.777000	0.33496|0.33496	-0.227000|-0.227000	0.12334|0.12334	TGT|ACG	A|0.476;G|0.524		0.756	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
PLEKHM1	9842	bcgsc.ca	37	17	43552921	43552921	+	Silent	SNP	C	C	T	rs12452273	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:43552921C>T	ENST00000430334.3	-	4	601	c.468G>A	c.(466-468)cgG>cgA	p.R156R	PLEKHM1_ENST00000421073.2_Silent_p.R67R	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	156	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					CCTCAGCATCCCGGAGCAGGG	0.602													C|||	412	0.0822684	0.0378	0.1556	5008	,	,		19188	0.001		0.1958	False		,,,				2504	0.0573				p.R156R		.											.	PLEKHM1-90	0			c.G468A						.	C		276,4128	141.9+/-177.2	10,256,1936	43.0	42.0	42.0		468	-4.5	0.2	17	dbSNP_120	42	1606,6992	272.0+/-289.9	155,1296,2848	no	coding-synonymous	PLEKHM1	NM_014798.2		165,1552,4784	TT,TC,CC		18.6788,6.267,14.4747		156/1057	43552921	1882,11120	2202	4299	6501	SO:0001819	synonymous_variant	9842	exon4			AGCATCCCGGAGC	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.468G>A	17.37:g.43552921C>T		323	4		260	9	NM_014798	0	0	0	0	0	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Silent	SNP	ENST00000430334.3	37	CCDS32671.1																																																																																			C|0.865;T|0.135		0.602	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
ABCA6	23460	bcgsc.ca	37	17	67081276	67081276	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:67081276G>T	ENST00000284425.2	-	32	4251	c.4077C>A	c.(4075-4077)tgC>tgA	p.C1359*	ABCA6_ENST00000446604.2_5'UTR	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	1359	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TCTCTTGAGGGCAGTACCCCA	0.532																																					p.C1359X		.											.	ABCA6-159	0			c.C4077A						.						48.0	38.0	41.0					17																	67081276		2203	4300	6503	SO:0001587	stop_gained	23460	exon32			TTGAGGGCAGTAC	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.4077C>A	17.37:g.67081276G>T	ENSP00000284425:p.Cys1359*	53	0		64	4	NM_080284	0	0	0	0	0	Q6NSH9|Q8N856|Q8WWZ6	Nonsense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	G	43	9.851422	0.99280	.	.	ENSG00000154262	ENST00000284425;ENST00000446604	.	.	.	4.76	-2.84	0.05751	.	0.000000	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.0707	0.59059	0.4633:0.0:0.5367:0.0	.	.	.	.	X	1359;219	.	ENSP00000284425:C1359X	C	-	3	2	ABCA6	64592871	0.562000	0.26586	0.973000	0.42090	0.946000	0.59487	-0.246000	0.08878	-0.698000	0.05085	-0.312000	0.09012	TGC	.		0.532	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450463.1	NM_080284	
FAM104A	84923	broad.mit.edu	37	17	71205699	71205699	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:71205699C>A	ENST00000403627.3	-	3	590	c.530G>T	c.(529-531)aGc>aTc	p.S177I	FAM104A_ENST00000583178.1_5'UTR|FAM104A_ENST00000405159.3_Missense_Mutation_p.S198I|FAM104A_ENST00000580032.1_Missense_Mutation_p.S87I	NM_032837.2	NP_116226.2	Q969W3	F104A_HUMAN	family with sequence similarity 104, member A	177										endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			LUSC - Lung squamous cell carcinoma(166;0.197)			GTGCTGTAGGCTGTGGAAGTG	0.582																																					p.S198I		.											.	.	0			c.G593T						.						30.0	26.0	27.0					17																	71205699		2202	4300	6502	SO:0001583	missense	84923	exon4			TGTAGGCTGTGGA	AK027681	CCDS11693.2, CCDS45766.1, CCDS74143.1, CCDS74144.1	17q25.1	2005-12-16			ENSG00000133193	ENSG00000133193			25918	protein-coding gene	gene with protein product							Standard	NM_032837		Approved	FLJ14775	uc002jjj.4	Q969W3	OTTHUMG00000150564	ENST00000403627.3:c.530G>T	17.37:g.71205699C>A	ENSP00000384648:p.Ser177Ile	74	2		72	8	NM_001098832	0	0	0	0	0	B4E339	Missense_Mutation	SNP	ENST00000403627.3	37	CCDS11693.2	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872973	0.91664	.	.	ENSG00000133193	ENST00000403627;ENST00000405159	T;T	0.61274	0.12;0.12	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	T	0.76666	0.4019	M	0.69823	2.125	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.69654	0.965;0.952	T	0.77112	-0.2708	10	0.87932	D	0	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	198;177	Q969W3-2;Q969W3	.;F104A_HUMAN	I	177;198	ENSP00000384648:S177I;ENSP00000384832:S198I	ENSP00000384648:S177I	S	-	2	0	FAM104A	68717294	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.676000	0.74498	2.840000	0.97914	0.655000	0.94253	AGC	.		0.582	FAM104A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318935.1	NM_032837	
AATK	9625	hgsc.bcm.edu	37	17	79096115	79096115	+	Missense_Mutation	SNP	C	C	T	rs61738821	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:79096115C>T	ENST00000326724.4	-	11	1645	c.1621G>A	c.(1621-1623)Gcc>Acc	p.A541T	AATK_ENST00000417379.1_Missense_Mutation_p.A438T|AATK_ENST00000572339.1_5'Flank|MIR657_ENST00000385003.1_RNA	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	541				A -> T (in Ref. 1; BAD18544). {ECO:0000305}.	brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TCGTGGCCGGCGGCGGGTGCG	0.756													C|||	710	0.141773	0.2451	0.0836	5008	,	,		7975	0.0337		0.1342	False		,,,				2504	0.1626				p.A541T		.											.	AATK-933	0			c.G1621A						.						2.0	2.0	2.0					17																	79096115		1391	2783	4174	SO:0001583	missense	9625	exon11			GGCCGGCGGCGGG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1621G>A	17.37:g.79096115C>T	ENSP00000324196:p.Ala541Thr	1	0		28	25	NM_001080395	0	0	0	0	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	322	0.14743589743589744	149	0.30284552845528456	49	0.13535911602209943	11	0.019230769230769232	113	0.14907651715039577	C	10.34	1.324257	0.24080	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.77489	-1.1;-1.09	4.26	3.26	0.37387	.	0.388682	0.24547	N	0.037589	T	0.00012	0.0000	L	0.48642	1.525	0.80722	P	0.0	P	0.45986	0.87	B	0.27608	0.081	T	0.05716	-1.0868	9	0.29301	T	0.29	.	11.2582	0.49067	0.1833:0.8167:0.0:0.0	rs61738821	541	Q6ZMQ8	LMTK1_HUMAN	T	541;505	ENSP00000324196:A541T;ENSP00000363924:A505T	ENSP00000324196:A541T	A	-	1	0	AATK	76710710	0.009000	0.17119	0.030000	0.17652	0.032000	0.12392	0.876000	0.28092	0.731000	0.32448	0.561000	0.74099	GCC	C|0.850;T|0.150		0.756	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
B3GNTL1	146712	hgsc.bcm.edu	37	17	81009622	81009622	+	Silent	SNP	C	C	T	rs59686903	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:81009622C>T	ENST00000320865.3	-	1	64	c.51G>A	c.(49-51)caG>caA	p.Q17Q	B3GNTL1_ENST00000571954.1_5'Flank|B3GNTL1_ENST00000576599.1_5'Flank	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	17							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			CCACGTGGGCCTGCATGGCCT	0.766													C|||	728	0.145367	0.0809	0.0605	5008	,	,		10471	0.1915		0.1163	False		,,,				2504	0.2751				p.Q17Q		.											.	B3GNTL1-92	0			c.G51A						.	C		198,2642		10,178,1232	6.0	6.0	6.0		51	0.5	0.0	17	dbSNP_129	6	518,4562		23,472,2045	no	coding-synonymous	B3GNTL1	NM_001009905.1		33,650,3277	TT,TC,CC		10.1969,6.9718,9.0404		17/362	81009622	716,7204	1420	2540	3960	SO:0001819	synonymous_variant	146712	exon1			GTGGGCCTGCATG	AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.51G>A	17.37:g.81009622C>T		8	0		5	5	NM_001009905	0	0	0	0	0	Q6GV30|Q8WUT3	Silent	SNP	ENST00000320865.3	37	CCDS32778.1																																																																																			C|0.880;T|0.120		0.766	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438949.1	NM_001009905	
B3GNTL1	146712	hgsc.bcm.edu	37	17	81009636	81009636	+	Missense_Mutation	SNP	T	T	G	rs57923322	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:81009636T>G	ENST00000320865.3	-	1	50	c.37A>C	c.(37-39)Agc>Cgc	p.S13R	B3GNTL1_ENST00000571954.1_5'Flank|B3GNTL1_ENST00000576599.1_5'Flank	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	13				S -> R (in Ref. 1; AAQ74775). {ECO:0000305}.			transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			ATGGCCTGGCTCTCCTCGGAC	0.761													G|||	1187	0.237021	0.146	0.1383	5008	,	,		10101	0.3393		0.2296	False		,,,				2504	0.3323				p.S13R		.											.	B3GNTL1-92	0			c.A37C						.	G	ARG/SER	332,2470		24,284,1093	6.0	5.0	5.0		37	0.6	0.0	17	dbSNP_129	5	802,4208		58,686,1761	no	missense	B3GNTL1	NM_001009905.1	110	82,970,2854	GG,GT,TT		16.008,11.8487,14.5161	benign	13/362	81009636	1134,6678	1401	2505	3906	SO:0001583	missense	146712	exon1			CCTGGCTCTCCTC	AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.37A>C	17.37:g.81009636T>G	ENSP00000319979:p.Ser13Arg	8	0		5	5	NM_001009905	0	0	0	0	0	Q6GV30|Q8WUT3	Missense_Mutation	SNP	ENST00000320865.3	37	CCDS32778.1	474	0.21703296703296704	73	0.1483739837398374	55	0.15193370165745856	171	0.29895104895104896	175	0.23087071240105542	G	5.126	0.208889	0.09757	0.118487	0.16008	ENSG00000175711	ENST00000320865	T	0.43688	0.94	1.58	0.586	0.17434	.	13.166200	0.00687	N	0.000717	T	0.00012	0.0000	L	0.28740	0.885	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.24119	-1.0169	8	.	.	.	.	2.1956	0.03910	0.1979:0.0:0.4977:0.3044	rs57923322;rs61743210	13	Q67FW5	B3GNL_HUMAN	R	13	ENSP00000319979:S13R	.	S	-	1	0	B3GNTL1	78602925	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	-0.011000	0.12721	-0.113000	0.11958	-0.478000	0.04885	AGC	T|0.786;G|0.214		0.761	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438949.1	NM_001009905	
MTCL1	23255	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	8826196	8826196	+	Missense_Mutation	SNP	C	C	T	rs543844504	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr18:8826196C>T	ENST00000306329.11	+	13	5645	c.5645C>T	c.(5644-5646)tCg>tTg	p.S1882L	SOGA2_ENST00000400050.3_Missense_Mutation_p.S1522L|SOGA2_ENST00000517570.1_Missense_Mutation_p.S1522L|SOGA2_ENST00000359865.3_Missense_Mutation_p.S1563L|SOGA2_ENST00000306285.7_Missense_Mutation_p.S888L|SOGA2_ENST00000518815.1_Missense_Mutation_p.S888L																							GACAGCCACTCGCTGGGGGAC	0.632													C|||	2	0.000399361	0.0	0.0	5008	,	,		15535	0.0		0.0	False		,,,				2504	0.002				p.S1563L		.											.	.	0			c.C4688T						.						18.0	20.0	20.0					18																	8826196		2173	4228	6401	SO:0001583	missense	23255	exon15			GCCACTCGCTGGG																												ENST00000306329.11:c.5645C>T	18.37:g.8826196C>T	ENSP00000305027:p.Ser1882Leu	95	1		110	98	NM_015210	0	0	0	0	0		Missense_Mutation	SNP	ENST00000306329.11	37		.	.	.	.	.	.	.	.	.	.	C	14.08	2.427218	0.43122	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	T;T;T;T	0.32023	2.48;2.48;2.48;1.47	5.41	-3.37	0.04898	.	7.839910	0.00166	N	0.000000	T	0.20820	0.0501	N	0.22421	0.69	0.09310	N	1	B;B	0.17852	0.011;0.024	B;B	0.09377	0.001;0.004	T	0.24799	-1.0150	10	0.41790	T	0.15	3.5122	7.5929	0.28031	0.0:0.406:0.1128:0.4812	.	1873;1563	Q9Y4B5;Q9Y4B5-3	CC165_HUMAN;.	L	1584;1522;1563;1522;888	ENSP00000429556:S1522L;ENSP00000352927:S1563L;ENSP00000382924:S1522L;ENSP00000303670:S888L	ENSP00000303670:S888L	S	+	2	0	CCDC165	8816196	0.000000	0.05858	0.000000	0.03702	0.975000	0.68041	-0.126000	0.10563	-0.483000	0.06772	0.462000	0.41574	TCG	.		0.632	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
ANKRD20A5P	440482	bcgsc.ca	37	18	14183680	14183680	+	RNA	SNP	G	G	A	rs75090388	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr18:14183680G>A	ENST00000581935.1	+	0	531							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGTGCCAGTGGCCATGTGAAA	0.388																																					.		.											.	ANKRD20A5P-90	0			.						.																																					440482	.			CCAGTGGCCATGT	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14183680G>A		148	8		195	42	.	0	0	0	0	0	Q4G1B6	RNA	SNP	ENST00000581935.1	37																																																																																				G|0.300;A|0.700		0.388	ANKRD20A5P-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000442833.1		
CBLN2	147381	hgsc.bcm.edu	37	18	70209321	70209321	+	Silent	SNP	C	C	A	rs7237888	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr18:70209321C>A	ENST00000269503.4	-	3	848	c.75G>T	c.(73-75)ccG>ccT	p.P25P	CBLN2_ENST00000583651.1_Intron|CBLN2_ENST00000585159.1_Silent_p.P25P|CBLN2_ENST00000584764.1_Intron|CBLN2_ENST00000581073.1_Intron	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	25					positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				CGCAgccgcccggctcgcgca	0.786													C|||	2820	0.563099	0.1868	0.8573	5008	,	,		7947	0.381		0.9304	False		,,,				2504	0.6728				p.P25P		.											.	CBLN2-90	0			c.G75T						.	C		1660,2420		328,1004,708	5.0	7.0	6.0		75	-0.8	1.0	18	dbSNP_116	6	7475,487		3530,415,36	no	coding-synonymous	CBLN2	NM_182511.3		3858,1419,744	AA,AC,CC		6.1166,40.6863,24.1405		25/225	70209321	9135,2907	2040	3981	6021	SO:0001819	synonymous_variant	147381	exon3			GCCGCCCGGCTCG	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.75G>T	18.37:g.70209321C>A		0	0		10	10	NM_182511	0	0	0	0	0	Q53Z56	Silent	SNP	ENST00000269503.4	37	CCDS11999.1																																																																																			C|0.390;A|0.610		0.786	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
SALL3	27164	hgsc.bcm.edu	37	18	76753768	76753768	+	Missense_Mutation	SNP	C	C	G	rs2447437	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr18:76753768C>G	ENST00000537592.2	+	2	1777	c.1777C>G	c.(1777-1779)Ctc>Gtc	p.L593V	SALL3_ENST00000536229.3_Missense_Mutation_p.L460V|SALL3_ENST00000575389.2_Missense_Mutation_p.L593V	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	593			L -> V (in dbSNP:rs2447437). {ECO:0000269|Ref.1}.		forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.L593V(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CGGGCCGCCCCTCACTAAAGC	0.731													C|||	3973	0.793331	0.5825	0.8444	5008	,	,		9900	0.9226		0.8648	False		,,,				2504	0.8354				p.L593V		.											.	SALL3-155	1	Substitution - Missense(1)	prostate(1)	c.C1777G						.	C	VAL/LEU	2422,1000		875,672,164	3.0	4.0	4.0		1777	5.2	0.2	18	dbSNP_100	4	6372,926		2808,756,85	yes	missense	SALL3	NM_171999.2	32	3683,1428,249	GG,GC,CC		12.6884,29.2227,17.9664	benign	593/1301	76753768	8794,1926	1711	3649	5360	SO:0001583	missense	27164	exon2			CCGCCCCTCACTA	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1777C>G	18.37:g.76753768C>G	ENSP00000441823:p.Leu593Val	0	0		5	5	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	1724	0.7893772893772893	287	0.5833333333333334	299	0.8259668508287292	511	0.8933566433566433	627	0.8271767810026385	C	0.073	-1.197989	0.01594	0.707773	0.873116	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.08984	3.03	5.2	5.2	0.72013	.	0.464067	0.17974	N	0.155779	T	0.00012	0.0000	L	0.35288	1.05	0.80722	P	0.0	B;B	0.15473	0.013;0.006	B;B	0.18561	0.022;0.002	T	0.36237	-0.9756	9	0.14656	T	0.56	-21.7235	10.231	0.43256	0.2471:0.6277:0.1252:0.0	rs2447437	325;593	F5GXY4;Q9BXA9	.;SALL3_HUMAN	V	593;593;325	ENSP00000441823:L593V	ENSP00000299466:L593V	L	+	1	0	SALL3	74854756	0.002000	0.14202	0.157000	0.22605	0.006000	0.05464	0.292000	0.19011	2.584000	0.87258	0.563000	0.77884	CTC	C|0.780;G|0.220		0.731	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
NWD1	284434	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	16861150	16861150	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr19:16861150T>A	ENST00000552788.1	+	4	1697	c.1697T>A	c.(1696-1698)cTc>cAc	p.L566H	NWD1_ENST00000549814.1_Missense_Mutation_p.L566H|NWD1_ENST00000523826.1_Missense_Mutation_p.L360H|NWD1_ENST00000379808.3_Missense_Mutation_p.L566H|NWD1_ENST00000339803.6_Missense_Mutation_p.L431H|NWD1_ENST00000524140.2_Missense_Mutation_p.L566H			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	566	NACHT.						ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ACGCACCAACTCTGCACCCGC	0.617																																					p.L566H		.											.	NWD1-7	0			c.T1697A						.						23.0	25.0	24.0					19																	16861150		2203	4300	6503	SO:0001583	missense	284434	exon6			ACCAACTCTGCAC	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.1697T>A	19.37:g.16861150T>A	ENSP00000447224:p.Leu566His	63	0		82	34	NM_001007525	0	0	0	0	0	C9J021|Q68CT3	Missense_Mutation	SNP	ENST00000552788.1	37		.	.	.	.	.	.	.	.	.	.	T	15.11	2.736874	0.49045	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.64803	-0.12;-0.06;-0.12;-0.09;-0.08;-0.05	5.04	5.04	0.67666	.	0.235814	0.34603	N	0.003824	T	0.78780	0.4337	M	0.80183	2.485	0.46279	D	0.998963	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.78314	0.98;0.991;0.915	T	0.81810	-0.0762	10	0.72032	D	0.01	-22.4071	12.6949	0.56997	0.0:0.0:0.0:1.0	.	566;566;431	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	H	431;566;566;566;360;566;431	ENSP00000428579:L566H;ENSP00000447548:L566H;ENSP00000369136:L566H;ENSP00000428955:L360H;ENSP00000447224:L566H;ENSP00000340159:L431H	ENSP00000340159:L431H	L	+	2	0	NWD1	16722150	1.000000	0.71417	0.962000	0.40283	0.041000	0.13682	6.026000	0.70873	1.894000	0.54839	0.448000	0.29417	CTC	.		0.617	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000403569.1	NM_001007525	
TBCB	1155	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36611666	36611666	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr19:36611666G>A	ENST00000221855.3	+	3	888	c.313G>A	c.(313-315)Gag>Aag	p.E105K	TBCB_ENST00000589996.1_Missense_Mutation_p.E105K|TBCB_ENST00000585746.1_Missense_Mutation_p.E54K|TBCB_ENST00000392178.4_3'UTR|TBCB_ENST00000586868.1_Intron	NM_001281.2	NP_001272.2	Q99426	TBCB_HUMAN	tubulin folding cofactor B	105					'de novo' posttranslational protein folding (GO:0051084)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GTCCCGGGTGGAGAAGTACAC	0.632																																					p.E105K		.											.	TBCB-90	0			c.G313A						.						91.0	72.0	79.0					19																	36611666		2203	4300	6503	SO:0001583	missense	1155	exon3			CGGGTGGAGAAGT	AF013488	CCDS12488.1, CCDS74344.1	19q13.11-q13.12	2008-02-05	2006-11-22	2006-11-22	ENSG00000105254	ENSG00000105254			1989	protein-coding gene	gene with protein product		601303	"""cytoskeleton-associated protein 1"", ""cytoskeleton associated protein 1"""	CKAP1		8978778	Standard	NM_001281		Approved	CG22, CKAPI	uc002odg.1	Q99426	OTTHUMG00000048143	ENST00000221855.3:c.313G>A	19.37:g.36611666G>A	ENSP00000221855:p.Glu105Lys	106	0		173	67	NM_001281	0	0	0	0	0	O00111|O00674|O14728|Q6FGY5	Missense_Mutation	SNP	ENST00000221855.3	37	CCDS12488.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987144	0.35036	.	.	ENSG00000105254	ENST00000221855;ENST00000392178	D	0.92397	-3.03	5.22	3.07	0.35406	Cytoskeleton-associated protein, Gly-rich domain (1);	0.159958	0.53938	N	0.000059	D	0.88247	0.6385	L	0.58925	1.835	0.80722	D	1	B;B	0.20671	0.047;0.003	B;B	0.19148	0.024;0.021	T	0.82621	-0.0367	10	0.49607	T	0.09	-20.9552	7.3682	0.26785	0.0916:0.1688:0.7396:0.0	.	54;105	Q6FGY5;Q99426	.;TBCB_HUMAN	K	105	ENSP00000221855:E105K	ENSP00000221855:E105K	E	+	1	0	TBCB	41303506	1.000000	0.71417	0.997000	0.53966	0.145000	0.21501	3.001000	0.49488	0.596000	0.29794	0.448000	0.29417	GAG	.		0.632	TBCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156291.2	NM_001281	
NUMBL	9253	hgsc.bcm.edu	37	19	41173886	41173886	+	Silent	SNP	C	C	T	rs62640392		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr19:41173886C>T	ENST00000252891.4	-	10	1484	c.1317G>A	c.(1315-1317)caG>caA	p.Q439Q	NUMBL_ENST00000598779.1_Silent_p.Q398Q|NUMBL_ENST00000540131.1_Silent_p.Q398Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	439	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgctgctgctgctgctgct	0.657																																					p.Q439Q		.											.	NUMBL-637	0			c.G1317A						.						9.0	8.0	8.0					19																	41173886		2013	3879	5892	SO:0001819	synonymous_variant	9253	exon10			CTGCTGCTGCTGC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1317G>A	19.37:g.41173886C>T		74	0		99	12	NM_004756	0	0	0	0	0	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																			C|0.984;T|0.016		0.657	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
NUMBL	9253	hgsc.bcm.edu	37	19	41173898	41173898	+	Silent	SNP	T	T	C	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr19:41173898T>C	ENST00000252891.4	-	10	1472	c.1305A>G	c.(1303-1305)caA>caG	p.Q435Q	NUMBL_ENST00000598779.1_Silent_p.Q394Q|NUMBL_ENST00000540131.1_Silent_p.Q394Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgctgctgttgctgttgct	0.667																																					p.Q435Q		.											.	NUMBL-637	0			c.A1305G						.						5.0	6.0	6.0					19																	41173898		1943	3908	5851	SO:0001819	synonymous_variant	9253	exon10			CTGCTGTTGCTGT	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305A>G	19.37:g.41173898T>C		61	0		92	23	NM_004756	0	0	0	0	0	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																			.		0.667	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
NUMBL	9253	mdanderson.org	37	19	41173904	41173904	+	Silent	SNP	T	T	C	rs79658769		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr19:41173904T>C	ENST00000252891.4	-	10	1466	c.1299A>G	c.(1297-1299)caA>caG	p.Q433Q	NUMBL_ENST00000598779.1_Silent_p.Q392Q|NUMBL_ENST00000540131.1_Silent_p.Q392Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	433	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			gctgttgctgttgctgctgct	0.662																																					p.Q433Q		.											.	NUMBL-637	0			c.A1299G						.						8.0	8.0	8.0					19																	41173904		2119	4125	6244	SO:0001819	synonymous_variant	9253	exon10			TTGCTGTTGCTGC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1299A>G	19.37:g.41173904T>C		65	1		89	24	NM_004756	0	0	0	0	0	Q7Z4J9	Silent	SNP	ENST00000252891.4	37	CCDS12561.1																																																																																			C|1.000;|0.000		0.662	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462749.2	NM_004756	
MARK4	57787	broad.mit.edu	37	19	45783864	45783864	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr19:45783864C>A	ENST00000262891.4	+	12	1479	c.1148C>A	c.(1147-1149)gCc>gAc	p.A383D	MARK4_ENST00000300843.4_Missense_Mutation_p.A383D	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	383					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CCAGGGCTGGCCCTGGCACGG	0.667																																					p.A383D		.											.	MARK4-782	0			c.C1148A						.						32.0	35.0	34.0					19																	45783864		2202	4298	6500	SO:0001583	missense	57787	exon12			GGCTGGCCCTGGC	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1148C>A	19.37:g.45783864C>A	ENSP00000262891:p.Ala383Asp	112	4		237	21	NM_001199867	0	0	0	0	0	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	CCDS56097.1	.	.	.	.	.	.	.	.	.	.	C	18.37	3.608146	0.66558	.	.	ENSG00000007047	ENST00000262891;ENST00000300843	T;T	0.70749	-0.51;-0.51	5.64	5.64	0.86602	.	0.226096	0.36519	N	0.002546	T	0.60856	0.2301	L	0.29908	0.895	0.42701	D	0.993614	P;P;P	0.38922	0.566;0.651;0.557	B;B;B	0.35114	0.196;0.165;0.128	T	0.65602	-0.6128	10	0.54805	T	0.06	.	17.2054	0.86916	0.0:1.0:0.0:0.0	.	249;383;383	Q8N2N5;Q96L34;Q96L34-2	.;MARK4_HUMAN;.	D	383	ENSP00000262891:A383D;ENSP00000300843:A383D	ENSP00000262891:A383D	A	+	2	0	MARK4	50475704	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.844000	0.55873	2.675000	0.91044	0.462000	0.41574	GCC	.		0.667	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417	
NTN5	126147	hgsc.bcm.edu	37	19	49164952	49164952	+	Silent	SNP	A	A	G	rs281392	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr19:49164952A>G	ENST00000270235.4	-	7	1547	c.1452T>C	c.(1450-1452)agT>agC	p.S484S	SEC1P_ENST00000430145.2_RNA	NM_145807.1	NP_665806.1	Q8WTR8	NET5_HUMAN	netrin 5	484						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	10						CCGGCCTGGGACTGGGTGTGG	0.687													G|||	2669	0.532947	0.351	0.4669	5008	,	,		9559	0.5625		0.6421	False		,,,				2504	0.683				p.S484S		.											.	NTN5-136	0			c.T1452C						.	G		1663,2349		390,883,733	9.0	9.0	9.0		1452	2.2	0.0	19	dbSNP_79	9	5217,2785		1816,1585,600	no	coding-synonymous	NTN5	NM_145807.1		2206,2468,1333	GG,GA,AA		34.8038,41.4506,42.7335		484/490	49164952	6880,5134	2006	4001	6007	SO:0001819	synonymous_variant	126147	exon7			CCTGGGACTGGGT		CCDS33068.1	19q13.33	2013-03-01			ENSG00000142233	ENSG00000142233		"""Netrins"""	25208	protein-coding gene	gene with protein product	"""Netrin-5"""					12477932	Standard	NM_145807		Approved		uc002pkb.3	Q8WTR8		ENST00000270235.4:c.1452T>C	19.37:g.49164952A>G		9	0		12	10	NM_145807	0	0	0	0	0	Q8N4X9|Q8WU63	Silent	SNP	ENST00000270235.4	37	CCDS33068.1																																																																																			A|0.464;G|0.536		0.687	NTN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466176.1	NM_145807	
ZNF628	89887	hgsc.bcm.edu	37	19	55993260	55993260	+	Missense_Mutation	SNP	A	A	G	rs34864744	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr19:55993260A>G	ENST00000598519.1	+	3	1253	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	ZNF628_ENST00000391718.2_Missense_Mutation_p.T230A			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	234	Pro-rich.			T -> A (in Ref. 2; AAH89449). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		cgccccgggtaccgcctccgc	0.766													N|||	3815	0.761781	0.9387	0.732	5008	,	,		4719	0.4395		0.837	False		,,,				2504	0.7986				p.T234A		.											.	ZNF628-22	0			c.A700G						.						3.0	4.0	4.0					19																	55993260		1771	3509	5280	SO:0001583	missense	89887	exon3			CCGGGTACCGCCT	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.700A>G	19.37:g.55993260A>G	ENSP00000469591:p.Thr234Ala	0	0		8	8	NM_033113	0	0	0	0	0	Q86X34	Missense_Mutation	SNP	ENST00000598519.1	37	CCDS33116.3	1594	0.7298534798534798	448	0.9105691056910569	272	0.7513812154696132	259	0.4527972027972028	615	0.8113456464379947	.	0.001	-2.964343	0.00049	.	.	ENSG00000197483	ENST00000391718	T	0.08193	3.12	3.0	-0.723	0.11181	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.05852	-1.0860	8	0.25106	T	0.35	0.0335	6.0751	0.19911	0.3452:0.3167:0.3381:0.0	rs34864744	230	Q5EBL2	ZN628_HUMAN	A	230	ENSP00000375598:T230A	ENSP00000375598:T230A	T	+	1	0	ZNF628	60685072	0.324000	0.24652	0.001000	0.08648	0.007000	0.05969	-0.265000	0.08644	-0.261000	0.09405	-2.335000	0.00248	ACC	A|0.270;G|0.730		0.766	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
EFR3B	22979	broad.mit.edu	37	2	25359422	25359422	+	Silent	SNP	G	G	A	rs3731631	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr2:25359422G>A	ENST00000403714.3	+	14	1698	c.1515G>A	c.(1513-1515)ctG>ctA	p.L505L	EFR3B_ENST00000405108.1_Silent_p.L357L|EFR3B_ENST00000401432.3_Silent_p.L505L|EFR3B_ENST00000402191.1_Silent_p.L470L	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	505										endometrium(1)	1						TCCTGAAGCTGAAAGTGGACA	0.572													G|||	1476	0.294728	0.3169	0.2954	5008	,	,		20989	0.3948		0.3022	False		,,,				2504	0.1534				p.L505L		.											.	.	0			c.G1515A						.	G		412,972		66,280,346	119.0	95.0	102.0		1515	1.1	1.0	2	dbSNP_107	102	965,2217		141,683,767	yes	coding-synonymous	EFR3B	NM_014971.1		207,963,1113	AA,AG,GG		30.3268,29.7688,30.1577		505/818	25359422	1377,3189	692	1591	2283	SO:0001819	synonymous_variant	22979	exon14			GAAGCTGAAAGTG	AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.1515G>A	2.37:g.25359422G>A		92	0		76	4	NM_014971	0	0	0	0	0	B7WPL8|Q86XU6	Silent	SNP	ENST00000403714.3	37	CCDS46231.1																																																																																			G|0.664;A|0.335		0.572	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324808.1	NM_014971	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000437928.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000545389.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		0	0		6	6	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
WDR33	55339	broad.mit.edu	37	2	128471416	128471416	+	Missense_Mutation	SNP	C	C	G	rs145331578	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr2:128471416C>G	ENST00000322313.4	-	18	3207	c.3049G>C	c.(3049-3051)Gat>Cat	p.D1017H		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	1017					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		TGGAAGTCATCTGGTCTGCTG	0.637																																					p.D1017H		.											.	WDR33-90	0			c.G3049C						.	C	HIS/ASP	1,4405	2.1+/-5.4	0,1,2202	148.0	153.0	152.0		3049	5.8	1.0	2	dbSNP_134	152	3,8597	3.0+/-9.4	0,3,4297	yes	missense	WDR33	NM_018383.4	81	0,4,6499	GG,GC,CC		0.0349,0.0227,0.0308	probably-damaging	1017/1337	128471416	4,13002	2203	4300	6503	SO:0001583	missense	55339	exon18			AGTCATCTGGTCT		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.3049G>C	2.37:g.128471416C>G	ENSP00000325377:p.Asp1017His	111	2		96	3	NM_018383	0	0	0	0	0	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Missense_Mutation	SNP	ENST00000322313.4	37	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235509	0.79800	2.27E-4	3.49E-4	ENSG00000136709	ENST00000322313	D	0.90385	-2.66	5.81	5.81	0.92471	.	0.081930	0.51477	D	0.000083	D	0.85261	0.5656	N	0.14661	0.345	0.80722	D	1	B	0.26258	0.145	B	0.31191	0.125	T	0.80160	-0.1498	10	0.32370	T	0.25	-5.3868	20.0726	0.97729	0.0:1.0:0.0:0.0	.	1017	Q9C0J8	WDR33_HUMAN	H	1017	ENSP00000325377:D1017H	ENSP00000325377:D1017H	D	-	1	0	WDR33	128187886	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	6.018000	0.70811	2.738000	0.93877	0.655000	0.94253	GAT	C|1.000;G|0.000		0.637	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
TLK1	9874	bcgsc.ca	37	2	171850329	171850329	+	Silent	SNP	T	T	G	rs3731993	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr2:171850329T>G	ENST00000431350.2	-	21	2666	c.2262A>C	c.(2260-2262)gcA>gcC	p.A754A	TLK1_ENST00000360843.3_Silent_p.A775A|TLK1_ENST00000434911.2_Silent_p.A658A|TLK1_ENST00000442919.2_Silent_p.A706A|TLK1_ENST00000521943.1_Silent_p.A706A			Q9UKI8	TLK1_HUMAN	tousled-like kinase 1	754					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|liver(3)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						GTGTAGGGGATGCTGTCAGCC	0.438													T|||	566	0.113019	0.0083	0.1037	5008	,	,		17307	0.2917		0.0209	False		,,,				2504	0.1718				p.A754A		.											.	TLK1-439	0			c.A2262C						.	T	,,	72,4334	64.1+/-101.4	0,72,2131	156.0	144.0	148.0		2118,1974,2262	4.9	1.0	2	dbSNP_107	148	147,8453	72.6+/-135.2	2,143,4155	no	coding-synonymous,coding-synonymous,coding-synonymous	TLK1	NM_001136554.1,NM_001136555.1,NM_012290.4	,,	2,215,6286	GG,GT,TT		1.7093,1.6341,1.6838	,,	706/719,658/671,754/767	171850329	219,12787	2203	4300	6503	SO:0001819	synonymous_variant	9874	exon21			AGGGGATGCTGTC	AB004885	CCDS2241.1, CCDS46447.1, CCDS46448.1	2q31.1	2010-04-19			ENSG00000198586	ENSG00000198586			11841	protein-coding gene	gene with protein product		608438				9427565, 12660173	Standard	NM_012290		Approved	KIAA0137, PKU-BETA	uc002ugp.2	Q9UKI8	OTTHUMG00000132243	ENST00000431350.2:c.2262A>C	2.37:g.171850329T>G		208	0		181	6	NM_012290	0	0	0	0	0	B3KR15|B4DX87|Q14150|Q8N591|Q9NYH2|Q9Y4F6	Silent	SNP	ENST00000431350.2	37	CCDS2241.1																																																																																			T|0.951;G|0.049		0.438	TLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255314.1	NM_012290	
SLC4A11	83959	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	20	3210295	3210318	+	In_Frame_Del	DEL	GCTGGCGTTGAGGGCAGTGTGGAG	GCTGGCGTTGAGGGCAGTGTGGAG	-	rs200422150|rs41281860|rs141743086	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	GCTGGCGTTGAGGGCAGTGTGGAG	GCTGGCGTTGAGGGCAGTGTGGAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr20:3210295_3210318delGCTGGCGTTGAGGGCAGTGTGGAG	ENST00000380056.3	-	13	1689_1712	c.1642_1665delCTCCACACTGCCCTCAACGCCAGC	c.(1642-1665)ctccacactgccctcaacgccagcdel	p.LHTALNAS548del	SLC4A11_ENST00000539553.2_In_Frame_Del_p.LHTALNAS532del|SLC4A11_ENST00000488544.1_5'UTR|SLC4A11_ENST00000380059.3_In_Frame_Del_p.LHTALNAS575del	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	548	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						TGGCGAGGAAGCTGGCGTTGAGGGCAGTGTGGAGGCTGGCGTTG	0.625																																					p.575_582del	NSCLC(190;922 2139 10266 10292 38692)	.											.	SLC4A11-91	0			c.1723_1746del						.																																			SO:0001651	inframe_deletion	83959	exon14			GAGGAAGCTGGCG	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1642_1665delCTCCACACTGCCCTCAACGCCAGC	20.37:g.3210295_3210318delGCTGGCGTTGAGGGCAGTGTGGAG	ENSP00000369396:p.Leu548_Ser555del	74	0		148	45	NM_001174090	0	0	0	0	0	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	In_Frame_Del	DEL	ENST00000380056.3	37	CCDS13052.1																																																																																			.		0.625	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1		
LAMP5	24141	bcgsc.ca	37	20	9496716	9496716	+	Missense_Mutation	SNP	C	C	G	rs2232264	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr20:9496716C>G	ENST00000246070.2	+	3	799	c.307C>G	c.(307-309)Cag>Gag	p.Q103E	RP5-1119D9.4_ENST00000443469.1_RNA|LAMP5_ENST00000427562.2_Intron	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	103			Q -> E (in dbSNP:rs2232264).			cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											TGGCCACAGCCAGTCGGAGCT	0.622													G|||	1234	0.246406	0.562	0.2003	5008	,	,		15813	0.131		0.1382	False		,,,				2504	0.0828				p.Q103E		.											.	.	0			c.C307G						.	G	,GLU/GLN	2290,2116	566.0+/-381.8	590,1110,503	35.0	35.0	35.0		,307	6.0	1.0	20	dbSNP_98	35	1424,7176	742.0+/-407.2	111,1202,2987	yes	intron,missense	C20orf103	NM_001199897.1,NM_012261.3	,29	701,2312,3490	GG,GC,CC		16.5581,48.0254,28.5561	,benign	,103/281	9496716	3714,9292	2203	4300	6503	SO:0001583	missense	24141	exon3			CACAGCCAGTCGG	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.307C>G	20.37:g.9496716C>G	ENSP00000246070:p.Gln103Glu	196	3		325	9	NM_012261	0	0	0	0	0	B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	37	CCDS13106.1	513	0.2348901098901099	249	0.5060975609756098	74	0.20441988950276244	86	0.15034965034965034	104	0.13720316622691292	G	5.673	0.308768	0.10733	0.519746	0.165581	ENSG00000125869	ENST00000246070	T	0.30981	1.51	6.01	6.01	0.97437	.	0.000000	0.85682	N	0.000000	T	0.00012	0.0000	N	0.01352	-0.895	0.09310	P	1.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44314	-0.9336	8	.	.	.	-20.3116	17.5415	0.87849	0.0:0.1238:0.8762:0.0	rs2232264;rs52813663;rs56575354;rs2232264	103	Q9UJQ1	CT103_HUMAN	E	103	ENSP00000246070:Q103E	.	Q	+	1	0	C20orf103	9444716	1.000000	0.71417	0.999000	0.59377	0.934000	0.57294	6.363000	0.73082	1.573000	0.49748	-0.120000	0.15030	CAG	C|0.731;G|0.269		0.622	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261	
SON	6651	hgsc.bcm.edu	37	21	34948684	34948684	+	Missense_Mutation	SNP	G	G	A	rs397829693|rs34377180		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr21:34948684G>A	ENST00000356577.4	+	12	7710	c.7235G>A	c.(7234-7236)gGa>gAa	p.G2412E	SON_ENST00000290239.6_3'UTR|AP000304.1_ENST00000595468.1_5'Flank|SON_ENST00000470533.1_Intron|SON_ENST00000381692.2_Missense_Mutation_p.G440E|DONSON_ENST00000303113.6_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	2412	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						TTGAGAAATGGAGCCCTTACC	0.338																																					p.G2412E		.											.	SON-97	0			c.G7235A						.						55.0	55.0	55.0					21																	34948684		2201	4295	6496	SO:0001583	missense	6651	exon12			GAAATGGAGCCCT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.7235G>A	21.37:g.34948684G>A	ENSP00000348984:p.Gly2412Glu	33	0		67	2	NM_138927	0	0	0	0	0	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.434360	0.43224	.	.	ENSG00000159140	ENST00000356577;ENST00000381692	T;T	0.69306	-0.39;-0.39	5.42	5.42	0.78866	Double-stranded RNA-binding-like (1);	0.000000	0.51477	D	0.000097	T	0.71134	0.3304	M	0.69823	2.125	0.80722	D	1	D;P	0.59767	0.986;0.799	P;B	0.50970	0.655;0.435	T	0.75127	-0.3427	10	0.87932	D	0	.	9.3335	0.38036	0.0788:0.1457:0.7755:0.0	.	440;2412	Q6ZRV7;P18583	.;SON_HUMAN	E	2412;440	ENSP00000348984:G2412E;ENSP00000371111:G440E	ENSP00000348984:G2412E	G	+	2	0	SON	33870554	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.898000	0.48672	2.560000	0.86352	0.555000	0.69702	GGA	.		0.338	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
PCNT	5116	bcgsc.ca	37	21	47851796	47851796	+	Silent	SNP	G	G	A	rs9983522	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr21:47851796G>A	ENST00000359568.5	+	38	8525	c.8418G>A	c.(8416-8418)gcG>gcA	p.A2806A	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2806					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					ACTTGCAAGCGATGCTTGAAA	0.582													G|||	734	0.146565	0.0666	0.1801	5008	,	,		20552	0.1984		0.1252	False		,,,				2504	0.1994				p.A2806A		.											.	PCNT-141	0			c.G8418A						.	G		279,4127	155.2+/-188.4	11,257,1935	59.0	58.0	58.0		8418	-10.6	0.0	21	dbSNP_119	58	1054,7546	221.6+/-259.0	63,928,3309	no	coding-synonymous	PCNT	NM_006031.5		74,1185,5244	AA,AG,GG		12.2558,6.3323,10.2491		2806/3337	47851796	1333,11673	2203	4300	6503	SO:0001819	synonymous_variant	5116	exon38			GCAAGCGATGCTT	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8418G>A	21.37:g.47851796G>A		70	0		130	6	NM_006031	0	0	0	0	0	O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	CCDS33592.1																																																																																			G|0.887;A|0.113		0.582	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
MYH9	4627	broad.mit.edu	37	22	36702092	36702092	+	Silent	SNP	G	G	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr22:36702092G>T	ENST00000216181.5	-	17	2273	c.2043C>A	c.(2041-2043)ggC>ggA	p.G681G		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	681	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.G681G(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GGTCCAGCTTGCCGGCCTGGA	0.597			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												p.G681G		.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9-292	1	Substitution - coding silent(1)	kidney(1)	c.C2043A						.						61.0	58.0	59.0					22																	36702092		2203	4300	6503	SO:0001819	synonymous_variant	4627	exon17	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	CAGCTTGCCGGCC		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2043C>A	22.37:g.36702092G>T		101	4		79	7	NM_002473	0	0	0	0	0	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	ENST00000216181.5	37	CCDS13927.1																																																																																			.		0.597	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	
SH3BP1	23616	hgsc.bcm.edu	37	22	38051355	38051355	+	Silent	SNP	G	G	A	rs762989	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr22:38051355G>A	ENST00000357436.4	+	18	2083	c.1770G>A	c.(1768-1770)ccG>ccA	p.P590P	Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000599616.1_Intron	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	590					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CTCCAGCCCCGCCCTTGCCCC	0.741													G|||	975	0.194688	0.2867	0.3055	5008	,	,		4753	0.0833		0.1799	False		,,,				2504	0.1217				p.P590P		.											.	SH3BP1-90	0			c.G1770A						.	G		606,2448		46,514,967	3.0	4.0	4.0		1770	-1.0	0.0	22	dbSNP_86	4	739,5643		39,661,2491	no	coding-synonymous	SH3BP1	NM_018957.3		85,1175,3458	AA,AG,GG		11.5794,19.8428,14.2539		590/702	38051355	1345,8091	1527	3191	4718	SO:0001819	synonymous_variant	23616	exon18			AGCCCCGCCCTTG		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1770G>A	22.37:g.38051355G>A		3	0		16	14	NM_018957	0	0	0	0	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Silent	SNP	ENST00000357436.4	37	CCDS13952.2																																																																																			G|0.825;A|0.175		0.741	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
TTLL12	23170	bcgsc.ca	37	22	43579049	43579049	+	Missense_Mutation	SNP	T	T	C	rs13058467	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr22:43579049T>C	ENST00000216129.6	-	2	347	c.284A>G	c.(283-285)aAc>aGc	p.N95S		NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	95			N -> S (in dbSNP:rs13058467).		cellular protein modification process (GO:0006464)					central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				GCACAGCTCGTTCCCCGGGTT	0.632													C|||	249	0.0497204	0.0522	0.0692	5008	,	,		18526	0.001		0.0974	False		,,,				2504	0.0337				p.N95S		.											.	TTLL12-90	0			c.A284G						.	C	SER/ASN	320,4086	797.0+/-415.4	12,296,1895	132.0	122.0	126.0		284	0.1	0.0	22	dbSNP_121	126	930,7670	776.5+/-407.7	55,820,3425	yes	missense	TTLL12	NM_015140.3	46	67,1116,5320	CC,CT,TT		10.814,7.2628,9.6109	benign	95/645	43579049	1250,11756	2203	4300	6503	SO:0001583	missense	23170	exon2			AGCTCGTTCCCCG	D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.284A>G	22.37:g.43579049T>C	ENSP00000216129:p.Asn95Ser	133	1		116	7	NM_015140	0	0	0	0	0	Q20WK5|Q9UGU3	Missense_Mutation	SNP	ENST00000216129.6	37	CCDS14047.1	132	0.06043956043956044	33	0.06707317073170732	29	0.08011049723756906	0	0.0	70	0.09234828496042216	C	0.107	-1.143970	0.01728	0.072628	0.10814	ENSG00000100304	ENST00000216129;ENST00000357017;ENST00000423379	T	0.06608	3.28	5.08	0.0633	0.14348	.	0.876012	0.09812	N	0.752737	T	0.00073	0.0002	N	0.14661	0.345	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.47381	-0.9122	9	0.10111	T	0.7	-9.0748	0.8509	0.01172	0.1548:0.2013:0.3024:0.3415	rs13058467;rs58544459;rs13058467	95;95	B1AH89;Q14166	.;TTL12_HUMAN	S	95	ENSP00000216129:N95S	ENSP00000216129:N95S	N	-	2	0	TTLL12	41908993	0.000000	0.05858	0.001000	0.08648	0.450000	0.32258	0.178000	0.16820	0.177000	0.19895	-0.119000	0.15052	AAC	T|0.917;C|0.083		0.632	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140	
CTNNB1	1499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	3.37:g.41266136T>C	ENSP00000344456:p.Ser45Pro	160	0		137	45	NM_001098209	0	0	0	0	0	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
FBXW12	285231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	48420011	48420011	+	Silent	SNP	C	C	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr3:48420011C>T	ENST00000296438.5	+	6	796	c.610C>T	c.(610-612)Ctg>Ttg	p.L204L	FBXW12_ENST00000436231.1_Silent_p.L47L|FBXW12_ENST00000415155.1_Intron|RN7SL321P_ENST00000581742.1_RNA|FBXW12_ENST00000445170.1_Silent_p.L185L	NM_207102.2	NP_996985.2	Q6X9E4	FBW12_HUMAN	F-box and WD repeat domain containing 12	204										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGCCCATTCCTGATGGTAAG	0.478																																					p.L204L		.											.	FBXW12-226	0			c.C610T						.						51.0	45.0	47.0					3																	48420011		2203	4300	6503	SO:0001819	synonymous_variant	285231	exon6			CCATTCCTGATGG	AK097594, AY247969	CCDS2764.1, CCDS54577.1, CCDS54578.1	3p21.31	2011-07-01	2007-02-08	2004-07-21	ENSG00000164049	ENSG00000164049		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	20729	protein-coding gene	gene with protein product		609075	"""F-box only protein 35"", ""F-box and WD-40 domain protein 12"""	FBXO35		15040455	Standard	NM_207102		Approved	Fbw12	uc010hjv.3	Q6X9E4	OTTHUMG00000133530	ENST00000296438.5:c.610C>T	3.37:g.48420011C>T		97	0		83	29	NM_207102	0	0	0	0	0	E9PG36|Q494Y9|Q494Z0	Silent	SNP	ENST00000296438.5	37	CCDS2764.1																																																																																			.		0.478	FBXW12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257505.1	NM_207102	
WDR6	11180	broad.mit.edu	37	3	49050036	49050036	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr3:49050036G>T	ENST00000608424.1	+	2	1108	c.1069G>T	c.(1069-1071)Gct>Tct	p.A357S	WDR6_ENST00000448293.1_Missense_Mutation_p.A306S|WDR6_ENST00000415265.2_Intron|WDR6_ENST00000489684.1_3'UTR|WDR6_ENST00000395474.3_Missense_Mutation_p.A387S			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	357					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		TGTGACTCTGGCTGGCTCTTG	0.577																																					p.A387S		.											.	WDR6-90	0			c.G1159T						.						48.0	50.0	50.0					3																	49050036		2203	4300	6503	SO:0001583	missense	11180	exon2			ACTCTGGCTGGCT	AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.1069G>T	3.37:g.49050036G>T	ENSP00000477389:p.Ala357Ser	88	0		99	4	NM_018031	0	0	0	0	0	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	ENST00000608424.1	37		.	.	.	.	.	.	.	.	.	.	G	15.04	2.715681	0.48622	.	.	ENSG00000178252	ENST00000395474;ENST00000448293	T;T	0.58940	0.3;0.31	5.28	4.4	0.53042	WD40 repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);	0.126994	0.51477	D	0.000093	T	0.38558	0.1045	N	0.08118	0	0.27808	N	0.942243	D;P;D	0.59357	0.985;0.924;0.985	P;B;B	0.50537	0.643;0.258;0.444	T	0.32079	-0.9920	10	0.05620	T	0.96	-14.9498	10.6719	0.45764	0.1518:0.0:0.8482:0.0	.	228;357;306	B4DK45;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	S	387;306	ENSP00000378857:A387S;ENSP00000413432:A306S	ENSP00000378857:A387S	A	+	1	0	WDR6	49025040	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.742000	0.62103	2.478000	0.83669	0.561000	0.74099	GCT	.		0.577	WDR6-024	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471652.1		
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D|SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	0	0		6	6	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
MUC4	4585	bcgsc.ca	37	3	195511911	195511911	+	Silent	SNP	G	G	A	rs200732241		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr3:195511911G>A	ENST00000463781.3	-	2	6999	c.6540C>T	c.(6538-6540)acC>acT	p.T2180T	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.T2180T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.T2180T(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGAAGTGTCGGTGACAGGAA	0.587																																					p.T2180T		.											.	MUC4-90	2	Substitution - coding silent(2)	endometrium(2)	c.C6540T						.						8.0	14.0	12.0					3																	195511911		633	1518	2151	SO:0001819	synonymous_variant	4585	exon2			AGTGTCGGTGACA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6540C>T	3.37:g.195511911G>A		429	27		355	24	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			G|0.998;A|0.002		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388726	1388726	+	Missense_Mutation	SNP	T	T	C	rs199689156	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr4:1388726T>C	ENST00000324803.4	+	1	3387	c.427T>C	c.(427-429)Tgc>Cgc	p.C143R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	143					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGCGGAGTGCC	0.697																																					p.C143R		.											.	CRIPAK-90	0			c.T427C						.						38.0	37.0	37.0					4																	1388726		1908	3685	5593	SO:0001583	missense	285464	exon1			TGCCCATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.427T>C	4.37:g.1388726T>C	ENSP00000323978:p.Cys143Arg	20	0		116	7	NM_175918	0	0	0	0	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	8.608|8.608	0.888529|0.888529	0.17540|0.17540	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	0.948|0.948	-0.668|-0.668	0.11392|0.11392	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.12860|0.12860	0.0312|0.0312	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.27594|.	0.182|.	B|.	0.13407|.	0.009|.	T|T	0.30621|0.30621	-0.9972|-0.9972	9|6	0.51188|0.06365	T|T	0.08|0.9	.|.	4.4755|4.4755	0.11733|0.11733	0.0:0.2357:0.0:0.7643|0.0:0.2357:0.0:0.7643	.|.	143|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	143|126	ENSP00000323978:C143R|.	ENSP00000323978:C143R|ENSP00000372402:M126T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378726|1378726	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.008000|0.008000	0.06430|0.06430	-0.703000|-0.703000	0.05063|0.05063	-0.155000|-0.155000	0.11098|0.11098	0.102000|0.102000	0.15555|0.15555	TGC|ATG	T|0.980;C|0.020		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
ANTXR2	118429	bcgsc.ca	37	4	80898808	80898808	+	Silent	SNP	C	C	T	rs35798108	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr4:80898808C>T	ENST00000307333.7	-	16	1397	c.1395G>A	c.(1393-1395)cgG>cgA	p.R465R	ANTXR2_ENST00000403729.2_Silent_p.R465R|ANTXR2_ENST00000346652.6_Silent_p.R362R|ANTXR2_ENST00000404191.1_Silent_p.R388R	NM_001145794.1	NP_001139266.1	P58335	ANTR2_HUMAN	anthrax toxin receptor 2	465					reproductive process (GO:0022414)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	13						TCAAAGAAACCCGGTCATACT	0.443									Juvenile Hyaline Fibromatosis				C|||	223	0.0445288	0.0189	0.0519	5008	,	,		15728	0.0109		0.0915	False		,,,				2504	0.0603				p.R465R		.											.	ANTXR2-23	0			c.G1395A						.	C	,	84,3628		2,80,1774	65.0	58.0	60.0		1395,1395	0.3	1.0	4	dbSNP_126	60	812,7396		36,740,3328	no	coding-synonymous,coding-synonymous	ANTXR2	NM_001145794.1,NM_058172.5	,	38,820,5102	TT,TC,CC		9.8928,2.2629,7.5168	,	465/490,465/489	80898808	896,11024	1856	4104	5960	SO:0001819	synonymous_variant	118429	exon16	Familial Cancer Database	incl. Infantile Systemic Hyalinosis	AGAAACCCGGTCA	AY040326	CCDS47085.1, CCDS47086.1, CCDS68733.1	4q21.3	2004-01-15			ENSG00000163297	ENSG00000163297			21732	protein-coding gene	gene with protein product	"""capillary morphogenesis protein 2"""	608041				11683410, 12700348	Standard	NM_058172		Approved	CMG2, CMG-2, FLJ31074	uc003hlz.4	P58335	OTTHUMG00000151982	ENST00000307333.7:c.1395G>A	4.37:g.80898808C>T		85	0		159	7	NM_001145794	0	0	0	0	0	Q4W5H6|Q59E98|Q5JPE9|Q86UI1|Q8N4J8|Q8NB13|Q96NC7	Silent	SNP	ENST00000307333.7	37	CCDS47086.1																																																																																			C|0.936;T|0.064		0.443	ANTXR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324663.1	NM_058172	
KLHL8	57563	broad.mit.edu	37	4	88106900	88106900	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr4:88106900G>A	ENST00000273963.5	-	3	609	c.268C>T	c.(268-270)Ccc>Tcc	p.P90S	KLHL8_ENST00000498875.2_Intron|KLHL8_ENST00000512111.1_Missense_Mutation_p.P90S|KLHL8_ENST00000425278.2_Intron|KLHL8_ENST00000545252.1_Intron	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	90	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CTAAAGTAGGGAATAACACAA	0.373																																					p.P90S		.											.	KLHL8-90	0			c.C268T						.						29.0	29.0	29.0					4																	88106900		2203	4297	6500	SO:0001583	missense	57563	exon3			AGTAGGGAATAAC	AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.268C>T	4.37:g.88106900G>A	ENSP00000273963:p.Pro90Ser	84	1		166	18	NM_020803	0	0	0	0	0	Q53XA3|Q6N018	Missense_Mutation	SNP	ENST00000273963.5	37	CCDS3617.1	.	.	.	.	.	.	.	.	.	.	G	19.27	3.795615	0.70452	.	.	ENSG00000145332	ENST00000273963;ENST00000512111	T;T	0.71934	-0.61;-0.61	5.89	5.89	0.94794	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.78509	0.4294	L	0.55481	1.735	0.80722	D	1	P	0.51791	0.948	P	0.54499	0.754	T	0.76586	-0.2905	10	0.45353	T	0.12	.	20.2572	0.98426	0.0:0.0:1.0:0.0	.	90	Q9P2G9	KLHL8_HUMAN	S	90	ENSP00000273963:P90S;ENSP00000424131:P90S	ENSP00000273963:P90S	P	-	1	0	KLHL8	88325924	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.178000	0.65037	2.793000	0.96121	0.650000	0.86243	CCC	.		0.373	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253040.1		
RGMB	285704	hgsc.bcm.edu	37	5	98109838	98109838	+	Missense_Mutation	SNP	A	A	C	rs2662263	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr5:98109838A>C	ENST00000513185.1	+	1	500	c.64A>C	c.(64-66)Agc>Cgc	p.S22R	RGMB-AS1_ENST00000501938.2_RNA|RGMB-AS1_ENST00000505677.1_RNA|RGMB-AS1_ENST00000498871.2_RNA|RGMB_ENST00000308234.7_Missense_Mutation_p.S63R|RGMB-AS1_ENST00000505362.1_RNA|RGMB_ENST00000504776.1_3'UTR|RGMB-AS1_ENST00000515003.1_RNA			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	22				S -> R (in Ref. 3; AAH67736). {ECO:0000305}.	axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		gcagcgccgcagccccgggct	0.741													C|||	4970	0.992412	1.0	0.9885	5008	,	,		8183	1.0		0.9791	False		,,,				2504	0.9908				p.S63R		.											.	.	0			c.A187C						.						1.0	1.0	1.0					5																	98109838		379	926	1305	SO:0001583	missense	285704	exon3			CGCCGCAGCCCCG	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.64A>C	5.37:g.98109838A>C	ENSP00000423256:p.Ser22Arg	0	0		5	5	NM_001012761	0	0	0	0	0	D6R9A0|Q8NC92	Missense_Mutation	SNP	ENST00000513185.1	37		2084	0.9542124542124543	469	0.9532520325203252	342	0.9447513812154696	557	0.9737762237762237	716	0.9445910290237467	C	10.21	1.287484	0.23478	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.93019	-3.14;-3.15	4.16	2.33	0.28932	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.58432	P	6.999999999979245E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.34976	-0.9807	8	0.11794	T	0.64	-0.2125	4.3815	0.11297	0.1608:0.5981:0.1551:0.0861	rs2662263;rs61109719	22	Q6NW40	RGMB_HUMAN	R	63;22	ENSP00000308219:S63R;ENSP00000423256:S22R	ENSP00000308219:S63R	S	+	1	0	RGMB	98137738	0.902000	0.30710	0.372000	0.25991	0.345000	0.29048	0.380000	0.20602	0.144000	0.18951	-0.371000	0.07208	AGC	T|0.046;G|0.950		0.741	RGMB-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370308.1	NM_173670	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	0	0		12	12	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
PCDHA9	9752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140230462	140230462	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr5:140230462T>G	ENST00000532602.1	+	1	3415	c.2382T>G	c.(2380-2382)gaT>gaG	p.D794E	PCDHA9_ENST00000378122.3_Missense_Mutation_p.D794E|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	794	5 X 4 AA repeats of P-X-X-P.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCCTCAGATTCAACTGGGA	0.448																																					p.D794E	Melanoma(55;1800 1972 14909)	.											.	PCDHA9-138	0			c.T2382G						.						50.0	55.0	53.0					5																	140230462		2196	4266	6462	SO:0001583	missense	9752	exon1			CTCAGATTCAACT	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2382T>G	5.37:g.140230462T>G	ENSP00000436042:p.Asp794Glu	182	0		334	154	NM_031857	0	0	0	0	0	O15053|Q2M3S5	Missense_Mutation	SNP	ENST00000532602.1	37	CCDS54920.1	.	.	.	.	.	.	.	.	.	.	T	9.601	1.128645	0.21041	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.11063	2.81;2.81	4.42	-5.97	0.02227	.	.	.	.	.	T	0.03477	0.0100	N	0.08118	0	0.09310	N	1	B;B	0.30937	0.001;0.301	B;B	0.31495	0.001;0.131	T	0.42378	-0.9455	9	0.18710	T	0.47	.	1.9318	0.03328	0.1102:0.2666:0.2179:0.4053	.	794;794	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	E	794	ENSP00000436042:D794E;ENSP00000367362:D794E	ENSP00000367362:D794E	D	+	3	2	PCDHA9	140210646	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.018000	0.01444	-0.900000	0.03896	-0.415000	0.06103	GAT	.		0.448	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372896.2	NM_031857	
ATXN1	6310	mdanderson.org	37	6	16327912	16327912	+	Missense_Mutation	SNP	C	C	A	rs369629396|rs368218879		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr6:16327912C>A	ENST00000244769.4	-	8	1566	c.630G>T	c.(628-630)caG>caT	p.Q210H	ATXN1_ENST00000436367.1_Missense_Mutation_p.Q210H	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	210	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)	p.H209_H211delHQH(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gctgctgatgctgatgctgct	0.667																																					p.Q210H		.											.	ATXN1-93	1	Deletion - In frame(1)	prostate(1)	c.G630T						.						5.0	8.0	7.0					6																	16327912		1576	3508	5084	SO:0001583	missense	6310	exon7			CTGATGCTGATGC	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.630G>T	6.37:g.16327912C>A	ENSP00000244769:p.Gln210His	53	1		35	12	NM_001128164	0	0	0	0	0	Q17S02|Q9UJG2|Q9Y4J1	Missense_Mutation	SNP	ENST00000244769.4	37	CCDS34342.1	.	.	.	.	.	.	.	.	.	.	C	4.990	0.183769	0.09495	.	.	ENSG00000124788	ENST00000244769;ENST00000450222;ENST00000436367	T;T	0.50001	0.76;0.76	.	.	.	.	.	.	.	.	T	0.07413	0.0187	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.37709	-0.9694	5	0.15952	T	0.53	.	.	.	.	.	210	P54253	ATX1_HUMAN	H	210	ENSP00000244769:Q210H;ENSP00000416360:Q210H	ENSP00000244769:Q210H	Q	-	3	2	ATXN1	16435891	0.501000	0.26099	0.020000	0.16555	0.059000	0.15707	0.066000	0.14489	0.000000	0.14550	0.000000	0.15137	CAG	.		0.667	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
ITPR3	3710	bcgsc.ca	37	6	33653486	33653486	+	Missense_Mutation	SNP	G	G	A	rs12528378	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr6:33653486G>A	ENST00000374316.5	+	42	6609	c.5549G>A	c.(5548-5550)cGg>cAg	p.R1850Q	ITPR3_ENST00000605930.1_Missense_Mutation_p.R1850Q			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1850			R -> Q (in dbSNP:rs12528378).		activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	AGCCTGCGCCGGGGGCACGAG	0.657													g|||	167	0.0333466	0.0023	0.062	5008	,	,		20882	0.005		0.0984	False		,,,				2504	0.0174				p.R1850Q		.											.	ITPR3-1085	0			c.G5549A						.		GLN/ARG	87,4319	70.9+/-108.8	0,87,2116	66.0	62.0	63.0		5549	3.8	1.0	6	dbSNP_120	63	854,7746	189.6+/-236.3	50,754,3496	yes	missense	ITPR3	NM_002224.3	43	50,841,5612	AA,AG,GG		9.9302,1.9746,7.2351	benign	1850/2672	33653486	941,12065	2203	4300	6503	SO:0001583	missense	3710	exon41			TGCGCCGGGGGCA	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.5549G>A	6.37:g.33653486G>A	ENSP00000363435:p.Arg1850Gln	250	3		228	11	NM_002224	0	0	0	0	0	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	111	0.050824175824175824	3	0.006097560975609756	25	0.06906077348066299	4	0.006993006993006993	79	0.10422163588390501	G	10.28	1.306279	0.23736	0.019746	0.099302	ENSG00000096433	ENST00000374316	D	0.91843	-2.92	4.69	3.81	0.43845	.	0.392432	0.23809	N	0.044353	T	0.69637	0.3133	L	0.28400	0.85	0.19775	N	0.999952	B	0.31009	0.303	B	0.27380	0.079	T	0.58962	-0.7543	10	0.13853	T	0.58	-21.4683	5.0338	0.14423	0.1979:0.1733:0.6288:0.0	rs12528378	1850	Q14573	ITPR3_HUMAN	Q	1850	ENSP00000363435:R1850Q	ENSP00000363435:R1850Q	R	+	2	0	ITPR3	33761464	0.800000	0.28916	1.000000	0.80357	0.906000	0.53458	1.127000	0.31357	0.960000	0.38005	0.313000	0.20887	CGG	G|0.935;A|0.065		0.657	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
TAAR5	9038	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	132910157	132910157	+	Silent	SNP	A	A	G			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr6:132910157A>G	ENST00000258034.2	-	1	720	c.669T>C	c.(667-669)ttT>ttC	p.F223F		NM_003967.2	NP_003958.2	O14804	TAAR5_HUMAN	trace amine associated receptor 5	223					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|trimethylamine receptor activity (GO:1990081)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	32	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.00604)|GBM - Glioblastoma multiforme(226;0.015)		TAGCAACCACAAAGATCTTCA	0.493																																					p.F223F		.											.	TAAR5-91	0			c.T669C						.						45.0	45.0	45.0					6																	132910157		2203	4300	6503	SO:0001819	synonymous_variant	9038	exon1			AACCACAAAGATC	AF021818	CCDS5156.1	6q23.2	2012-08-08			ENSG00000135569	ENSG00000135569		"""GPCR / Class A : Trace amine associated receptors"""	30236	protein-coding gene	gene with protein product		607405				9464258, 15718104	Standard	NM_003967		Approved	PNR	uc003qdk.2	O14804	OTTHUMG00000015581	ENST00000258034.2:c.669T>C	6.37:g.132910157A>G		99	0		75	27	NM_003967	0	0	0	0	0	D8KZS1|Q2M1V1|Q4VBL1|Q5VUQ3|Q6NTA8	Silent	SNP	ENST00000258034.2	37	CCDS5156.1																																																																																			.		0.493	TAAR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042257.1	NM_003967	
GRM1	2911	broad.mit.edu	37	6	146755630	146755632	+	In_Frame_Del	DEL	GAC	GAC	-	rs568155311		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr6:146755630_146755632delGAC	ENST00000282753.1	+	8	3518_3520	c.3283_3285delGAC	c.(3283-3285)gacdel	p.D1099del	GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000392299.2_3'UTR|GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000361719.2_In_Frame_Del_p.D1099del			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	1099	Asp/Glu-rich (acidic).				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CCCGCCCGCGGACGACGACGACG	0.65																																					p.1095_1095del		.											.	GRM1-1080	0			c.3283_3285del						.																																			SO:0001651	inframe_deletion	2911	exon9			CCCGCGGACGACG	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.3283_3285delGAC	6.37:g.146755639_146755641delGAC	ENSP00000282753:p.Asp1099del	146	0		195	7	NM_000838	0	0	0	0	0	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	In_Frame_Del	DEL	ENST00000282753.1	37	CCDS5209.1																																																																																			.		0.650	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042574.1	NM_000838	
ADGB	79747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	147054299	147054299	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr6:147054299T>C	ENST00000397944.3	+	21	2640	c.2564T>C	c.(2563-2565)aTa>aCa	p.I855T	ADGB_ENST00000367493.3_Missense_Mutation_p.I274T	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	855					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AAAGTTCAAATAACAAAACCT	0.363																																					p.I855T		.											.	.	0			c.T2564C						.						86.0	75.0	78.0					6																	147054299		692	1591	2283	SO:0001583	missense	79747	exon21			TTCAAATAACAAA	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.2564T>C	6.37:g.147054299T>C	ENSP00000381036:p.Ile855Thr	52	0		35	12	NM_024694	0	0	0	0	0	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	ENST00000397944.3	37		.	.	.	.	.	.	.	.	.	.	T	10.50	1.368839	0.24771	.	.	ENSG00000118492	ENST00000397944;ENST00000367493	T	0.29142	1.58	5.0	-0.287	0.12858	.	.	.	.	.	T	0.06917	0.0176	L	0.51422	1.61	0.09310	N	1	B	0.19445	0.036	B	0.09377	0.004	T	0.35201	-0.9798	9	0.13853	T	0.58	.	2.3312	0.04236	0.1247:0.1613:0.1275:0.5865	.	855	Q8N7X0	CAN7L_HUMAN	T	855;274	ENSP00000381036:I855T	ENSP00000356463:I274T	I	+	2	0	C6orf103	147095992	0.000000	0.05858	0.001000	0.08648	0.913000	0.54294	-0.026000	0.12392	0.355000	0.24131	0.254000	0.18369	ATA	.		0.363	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
LRP11	84918	hgsc.bcm.edu	37	6	150184882	150184882	+	Missense_Mutation	SNP	G	G	C	rs9322225	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr6:150184882G>C	ENST00000239367.2	-	1	280	c.275C>G	c.(274-276)cCg>cGg	p.P92R	LRP11_ENST00000546019.1_Intron|RP11-244K5.8_ENST00000596229.1_RNA|LRP11_ENST00000367368.2_Missense_Mutation_p.P92R|RP11-244K5.8_ENST00000606915.1_RNA	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	92			P -> R (in dbSNP:rs9322225). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCCGCTGCCCGGGCCCGGGCA	0.756													g|||	2394	0.478035	0.3071	0.5101	5008	,	,		7691	0.8224		0.4165	False		,,,				2504	0.3947				p.P92R		.											.	LRP11-90	0			c.C275G						.	G	ARG/PRO	799,1991		151,497,747	2.0	2.0	2.0		275	3.0	0.3	6	dbSNP_119	2	2072,3740		444,1184,1278	yes	missense	LRP11	NM_032832.5	103	595,1681,2025	CC,CG,GG		35.6504,28.638,33.376	possibly-damaging	92/501	150184882	2871,5731	1395	2906	4301	SO:0001583	missense	84918	exon1			CTGCCCGGGCCCG	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.275C>G	6.37:g.150184882G>C	ENSP00000239367:p.Pro92Arg	0	0		4	4	NM_032832	0	0	0	0	0	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	1110	0.5082417582417582	147	0.29878048780487804	188	0.5193370165745856	465	0.8129370629370629	310	0.40897097625329815	G	12.02	1.812850	0.32053	0.28638	0.356504	ENSG00000120256	ENST00000239367;ENST00000367368	T;T	0.20463	2.07;2.07	3.91	2.96	0.34315	Seven cysteines, N-terminal (2);	1.059560	0.07539	N	0.913589	T	0.07279	0.0184	L	0.36672	1.1	0.51767	P	7.00000000000145E-5	B;B	0.25743	0.133;0.012	B;B	0.23150	0.044;0.025	T	0.19484	-1.0304	9	0.19590	T	0.45	-4.154	11.8365	0.52327	0.0:0.1787:0.8213:0.0	rs9322225;rs17846346;rs17859381	92;92	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	R	92	ENSP00000239367:P92R;ENSP00000356338:P92R	ENSP00000239367:P92R	P	-	2	0	LRP11	150226575	0.132000	0.22450	0.342000	0.25602	0.428000	0.31595	0.489000	0.22387	1.900000	0.55004	0.484000	0.47621	CCG	G|0.492;C|0.508		0.756	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	NM_032832	
BCL7B	9275	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	72952314	72952314	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr7:72952314C>A	ENST00000223368.2	-	5	889	c.466G>T	c.(466-468)Gat>Tat	p.D156Y	BCL7B_ENST00000411832.1_Missense_Mutation_p.D99Y|BCL7B_ENST00000482231.1_5'UTR	NM_001707.3	NP_001698.2	Q9BQE9	BCL7B_HUMAN	B-cell CLL/lymphoma 7B	156							actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	9		Lung NSC(55;0.0659)|all_lung(88;0.152)				GGAGGTTCATCAGCAACTTCC	0.532																																					p.D156Y		.											.	BCL7B-228	0			c.G466T						.						126.0	114.0	118.0					7																	72952314		2203	4300	6503	SO:0001583	missense	9275	exon5			GTTCATCAGCAAC	X89985	CCDS5550.1, CCDS56489.1, CCDS75613.1	7q11.23	2008-07-18			ENSG00000106635	ENSG00000106635			1005	protein-coding gene	gene with protein product		605846				8605326, 9806765	Standard	NM_001707		Approved		uc003tyf.2	Q9BQE9	OTTHUMG00000023412	ENST00000223368.2:c.466G>T	7.37:g.72952314C>A	ENSP00000223368:p.Asp156Tyr	187	1		197	62	NM_001707	0	0	0	0	0	A8K226|C9JWD3|D3DXF0|O43769|Q13845|Q6ZW75	Missense_Mutation	SNP	ENST00000223368.2	37	CCDS5550.1	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669119	0.67814	.	.	ENSG00000106635	ENST00000223368;ENST00000411832	T	0.56941	0.43	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.71660	0.3366	M	0.69358	2.11	0.58432	D	0.999997	P;D	0.76494	0.94;0.999	P;D	0.79784	0.564;0.993	T	0.73541	-0.3950	10	0.87932	D	0	.	17.3513	0.87324	0.0:1.0:0.0:0.0	.	99;156	C9JWD3;Q9BQE9	.;BCL7B_HUMAN	Y	156;99	ENSP00000223368:D156Y	ENSP00000223368:D156Y	D	-	1	0	BCL7B	72590250	1.000000	0.71417	0.997000	0.53966	0.358000	0.29455	6.985000	0.76193	2.704000	0.92352	0.555000	0.69702	GAT	.		0.532	BCL7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252194.1	NM_001707	
MKLN1	4289	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	131084167	131084167	+	Silent	SNP	A	A	G			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr7:131084167A>G	ENST00000352689.6	+	6	718	c.678A>G	c.(676-678)gaA>gaG	p.E226E	MKLN1_ENST00000421797.2_Silent_p.E134E	NM_013255.4	NP_037387.2	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing kelch motifs	226	CTLH. {ECO:0000255|PROSITE- ProRule:PRU00058}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	28	Melanoma(18;0.162)					ATGCTTGCGAAGAGTTGATTG	0.358																																					p.E226E		.											.	MKLN1-135	0			c.A678G						.						181.0	178.0	179.0					7																	131084167		2203	4300	6503	SO:0001819	synonymous_variant	4289	exon6			TTGCGAAGAGTTG	AF047489	CCDS34754.1	7q32	2008-07-18			ENSG00000128585	ENSG00000128585			7109	protein-coding gene	gene with protein product		605623				10640805	Standard	NM_001145354		Approved	TWA2	uc011kpm.2	Q9UL63	OTTHUMG00000154880	ENST00000352689.6:c.678A>G	7.37:g.131084167A>G		140	2		154	47	NM_013255	0	0	0	0	0	A4D1M8|A6NG43|Q9NSK4|Q9NUS8	Silent	SNP	ENST00000352689.6	37	CCDS34754.1																																																																																			.		0.358	MKLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000337473.4	NM_013255	
CPNE3	8895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	87560662	87560662	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr8:87560662C>T	ENST00000521271.1	+	12	1175	c.1013C>T	c.(1012-1014)gCt>gTt	p.A338V	CPNE3_ENST00000198765.4_Splice_Site_p.A338V	NM_003909.3	NP_003900.1	O75131	CPNE3_HUMAN	copine III	338	VWFA.				lipid metabolic process (GO:0006629)|protein phosphorylation (GO:0006468)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|transporter activity (GO:0005215)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	23						GATTATGATGCGTGAGTATGA	0.433																																					p.A338V		.											.	CPNE3-117	0			c.C1013T						.						168.0	141.0	150.0					8																	87560662		2203	4300	6503	SO:0001630	splice_region_variant	8895	exon12			ATGATGCGTGAGT	AB014536	CCDS6243.1	8q21	2008-07-03				ENSG00000085719			2316	protein-coding gene	gene with protein product		604207				9430674	Standard	NM_003909		Approved		uc003ydv.2	O75131		ENST00000521271.1:c.1013+1C>T	8.37:g.87560662C>T		119	0		117	28	NM_003909	0	0	0	0	0	A8KA47|Q8IYA1	Missense_Mutation	SNP	ENST00000521271.1	37	CCDS6243.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.802264	0.70682	.	.	ENSG00000085719	ENST00000198765;ENST00000521271	T;T	0.22539	1.95;1.95	5.32	4.39	0.52855	von Willebrand factor, type A (1);Copine (1);	0.370928	0.32488	N	0.006036	T	0.17746	0.0426	L	0.33245	0.995	0.80722	D	1	P	0.40250	0.709	B	0.37239	0.244	T	0.04400	-1.0954	10	0.87932	D	0	-21.3127	14.7563	0.69567	0.1451:0.8549:0.0:0.0	.	338	O75131	CPNE3_HUMAN	V	338	ENSP00000198765:A338V;ENSP00000430934:A338V	ENSP00000198765:A338V	A	+	2	0	CPNE3	87629778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.029000	0.57253	2.506000	0.84524	0.563000	0.77884	GCT	.		0.433	CPNE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374994.1		Missense_Mutation
ESRP1	54845	hgsc.bcm.edu;bcgsc.ca	37	8	95690599	95690599	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr8:95690599G>T	ENST00000433389.2	+	13	2010	c.1820G>T	c.(1819-1821)aGc>aTc	p.S607I	ESRP1_ENST00000423620.2_Splice_Site_p.S603I|ESRP1_ENST00000454170.2_Splice_Site_p.S607I|ESRP1_ENST00000358397.5_Splice_Site_p.S603I	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	607					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TACTATCCCAGGTAAGGCTCT	0.498																																					p.S607I		.											.	ESRP1-94	0			c.G1820T						.						68.0	66.0	66.0					8																	95690599		2036	4199	6235	SO:0001630	splice_region_variant	54845	exon13			ATCCCAGGTAAGG	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.1820+1G>T	8.37:g.95690599G>T		57	0		62	4	NM_017697	0	0	0	0	0	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	37	CCDS47897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.2|28.2	4.899318|4.899318	0.91962|0.91962	.|.	.|.	ENSG00000104413|ENSG00000104413	ENST00000519505|ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000517610	.|T;T;T;T;T	.|0.16073	.|2.69;2.68;2.67;2.37;2.46	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	.|0.073025	.|0.85682	.|D	.|0.000000	T|T	0.41373|0.41373	0.1156|0.1156	M|M	0.68593|0.68593	2.085|2.085	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.65815	.|0.995;0.995;0.992;0.995;0.992	.|D;D;D;D;P	.|0.66979	.|0.945;0.948;0.917;0.945;0.883	T|T	0.15150|0.15150	-1.0447|-1.0447	5|10	.|0.51188	.|T	.|0.08	-11.1506|-11.1506	18.9933|18.9933	0.92803|0.92803	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|607;607;603;603;607	.|Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.|.;.;.;.;ESRP1_HUMAN	H|I	472|603;607;603;607;466	.|ENSP00000407349:S603I;ENSP00000405738:S607I;ENSP00000351168:S603I;ENSP00000402766:S607I;ENSP00000429125:S466I	.|ENSP00000351168:S603I	Q|S	+|+	3|2	2|0	ESRP1|ESRP1	95759775|95759775	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.675000|9.675000	0.98638|0.98638	2.549000|2.549000	0.85964|0.85964	0.591000|0.591000	0.81541|0.81541	CAG|AGC;AGC;AGC;AGT;AGC	.		0.498	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	Missense_Mutation
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		5	0		22	8	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
MROH6	642475	hgsc.bcm.edu	37	8	144649601	144649601	+	Silent	SNP	A	A	G	rs13268196	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr8:144649601A>G	ENST00000398882.3	-	14	2224	c.1968T>C	c.(1966-1968)gcT>gcC	p.A656A	MROH6_ENST00000534459.1_5'UTR|MROH6_ENST00000533679.1_5'UTR|MROH6_ENST00000524906.1_5'UTR|MROH6_ENST00000532704.1_Intron	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6	656																	CCGCGGCCACAGCCGGCTTGG	0.776													G|||	4732	0.944888	0.8018	0.9827	5008	,	,		8608	1.0		0.998	False		,,,				2504	1.0				p.A656A		.											.	.	0			c.T1968C						.						1.0	2.0	2.0					8																	144649601		1007	2126	3133	SO:0001819	synonymous_variant	642475	exon14			GGCCACAGCCGGC	AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164	ENST00000398882.3:c.1968T>C	8.37:g.144649601A>G		0	0		5	5	NM_001100878	0	0	0	0	0	A8MWB1	Silent	SNP	ENST00000398882.3	37	CCDS47928.1																																																																																			A|0.057;G|0.943		0.776	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382330.3	NM_001100878	
SHARPIN	81858	hgsc.bcm.edu	37	8	145158503	145158503	+	Silent	SNP	G	G	T	rs11136254	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr8:145158503G>T	ENST00000398712.2	-	1	590	c.154C>A	c.(154-156)Cgg>Agg	p.R52R	MAF1_ENST00000532522.1_5'Flank|MAF1_ENST00000322428.5_5'Flank|MAF1_ENST00000534585.1_5'Flank|SHARPIN_ENST00000533948.1_Intron	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	52	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CGCCCAGGCCGCTCAGGGTCC	0.771													G|||	4431	0.884784	0.6884	0.9366	5008	,	,		10154	0.999		0.9115	False		,,,				2504	0.9683				p.R52R		.											.	SHARPIN-523	0			c.C154A						.	G		1990,374		815,360,7	2.0	2.0	2.0		154	2.7	0.6	8	dbSNP_120	2	5503,323		2593,317,3	no	coding-synonymous	SHARPIN	NM_030974.3		3408,677,10	TT,TG,GG		5.5441,15.8206,8.5104		52/388	145158503	7493,697	1182	2913	4095	SO:0001819	synonymous_variant	81858	exon1			CAGGCCGCTCAGG	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.154C>A	8.37:g.145158503G>T		0	0		5	5	NM_030974	0	0	0	0	0	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Silent	SNP	ENST00000398712.2	37	CCDS43777.1																																																																																			G|0.108;T|0.892		0.771	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382901.1	NM_030974	
SPATA31E1	286234	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	90500470	90500470	+	Missense_Mutation	SNP	C	C	A	rs62578207		TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr9:90500470C>A	ENST00000325643.5	+	4	1134	c.1068C>A	c.(1066-1068)ttC>ttA	p.F356L		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	356					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCTGCACATTCATCCACCCTG	0.582																																					p.F356L		.											.	.	0			c.C1068A						.						65.0	65.0	65.0					9																	90500470		2203	4300	6503	SO:0001583	missense	286234	exon4			CACATTCATCCAC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.1068C>A	9.37:g.90500470C>A	ENSP00000322640:p.Phe356Leu	84	1		82	29	NM_178828	0	0	0	0	0	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	37	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	.	7.814	0.716346	0.15306	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.04454	3.62	2.32	-2.7	0.06004	.	0.329814	0.22929	N	0.053925	T	0.04907	0.0132	L	0.34521	1.04	0.09310	N	1	D;P	0.52996	0.957;0.873	P;B	0.52758	0.708;0.388	T	0.33317	-0.9873	10	0.25751	T	0.34	.	3.5459	0.07828	0.0:0.2948:0.2115:0.4937	.	356;8	Q6ZUB1;Q8NA33	CI079_HUMAN;.	L	356;8	ENSP00000322640:F356L	ENSP00000322640:F356L	F	+	3	2	C9orf79	89690290	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	0.219000	0.17641	-0.714000	0.04975	-0.145000	0.13849	TTC	.		0.582	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
PBX3	5090	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	128724400	128724400	+	Silent	SNP	C	C	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr9:128724400C>T	ENST00000373489.5	+	7	1045	c.1029C>T	c.(1027-1029)aaC>aaT	p.N343N	PBX3_ENST00000373483.2_Silent_p.N162N|PBX3_ENST00000538998.1_Intron|PBX3_ENST00000447726.2_Silent_p.N268N|PBX3_ENST00000342287.5_Intron|PBX3_ENST00000373487.4_Silent_p.N364N	NM_006195.5	NP_006186.1	P40426	PBX3_HUMAN	pre-B-cell leukemia homeobox 3	343					adult locomotory behavior (GO:0008344)|anterior compartment pattern formation (GO:0007387)|dorsal spinal cord development (GO:0021516)|neuron development (GO:0048666)|posterior compartment specification (GO:0007388)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)	24						GTTCTTTTAACCTCCCAAATT	0.458																																					p.N343N		.											.	PBX3-91	0			c.C1029T						.						102.0	88.0	93.0					9																	128724400		2203	4300	6503	SO:0001819	synonymous_variant	5090	exon7			TTTTAACCTCCCA		CCDS6865.1, CCDS48021.1	9q33.3	2011-06-20	2007-01-30		ENSG00000167081	ENSG00000167081		"""Homeoboxes / TALE class"""	8634	protein-coding gene	gene with protein product		176312	"""pre-B-cell leukemia transcription factor 3"""			1682799	Standard	NM_006195		Approved		uc004bqb.3	P40426	OTTHUMG00000020684	ENST00000373489.5:c.1029C>T	9.37:g.128724400C>T		62	0		63	11	NM_006195	0	0	0	0	0	E9PB27|Q5JSA0|Q5JSA1|Q5VXL3|Q96PF9|Q96PG0	Silent	SNP	ENST00000373489.5	37	CCDS6865.1																																																																																			.		0.458	PBX3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417765.1		
CD99	4267	bcgsc.ca	37	X	2644302	2644302	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chrX:2644302C>T	ENST00000381192.3	+	8	545	c.363C>T	c.(361-363)gcC>gcT	p.A121A	CD99_ENST00000381184.1_Splice_Site_p.A121A|CD99_ENST00000381187.3_Splice_Site_p.A105A|CD99_ENST00000482405.2_3'UTR	NM_001277710.1|NM_002414.3	NP_001264639.1|NP_002405.1	P14209	CD99_HUMAN	CD99 molecule	121					cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11						CTCCTGCAGCCGACGCCCCAG	0.597													.|||	594	0.11861	0.0741	0.2075	5008	,	,		18276	0.0804		0.1362	False		,,,				2504	0.137				p.A121A		.											.	CD99-40	0			c.C363T						.	C	,	405,4001		22,361,1820	72.0	72.0	72.0		315,363	-5.0	0.0	X	dbSNP_134	72	1289,7303		91,1107,3098	no	coding-synonymous-near-splice,coding-synonymous-near-splice	CD99	NM_001122898.1,NM_002414.3	,	113,1468,4918	TT,TC,CC		15.0023,9.192,13.0328	,	105/170,121/186	2644302	1694,11304	2203	4296	6499	SO:0001630	splice_region_variant	4267	exon8			TGCAGCCGACGCC	M16279	CCDS14119.1, CCDS48071.1, CCDS75947.1	Xp22.32 and Yp11.3	2012-10-02	2006-03-28	2003-02-14	ENSG00000002586	ENSG00000002586		"""Pseudoautosomal regions / PAR1"", ""CD molecules"""	7082	protein-coding gene	gene with protein product		313470, 450000	"""antigen identified by monoclonal antibodies 12E7, F21 and O13"", ""CD99 antigen"""	MIC2			Standard	NM_001122898		Approved		uc004cqm.3	P14209	OTTHUMG00000021073	ENST00000381192.3:c.362-1C>T	X.37:g.2644302C>T		211	0		162	7	NM_002414	0	0	0	0	0	A6NIW1|O00518|Q6ICV7	Silent	SNP	ENST00000381192.3	37	CCDS14119.1																																																																																			.		0.597	CD99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055624.1	NM_001122898	Silent
MAGEC1	9947	bcgsc.ca	37	X	140994913	140994913	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chrX:140994913C>A	ENST00000285879.4	+	4	2009	c.1723C>A	c.(1723-1725)Ctg>Atg	p.L575M	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	575										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GGAGGACTCCCTGTCTCCTCA	0.597										HNSCC(15;0.026)																											p.L575M		.											.	MAGEC1-133	0			c.C1723A						.						239.0	258.0	251.0					X																	140994913		2203	4300	6503	SO:0001583	missense	9947	exon4			GACTCCCTGTCTC	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1723C>A	X.37:g.140994913C>A	ENSP00000285879:p.Leu575Met	98	4		47	33	NM_005462	0	0	0	0	0	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	c	12.49	1.952705	0.34471	.	.	ENSG00000155495	ENST00000285879	T	0.02236	4.38	0.92	0.92	0.19397	.	.	.	.	.	T	0.02888	0.0086	N	0.08118	0	0.80722	D	1	D	0.54964	0.969	P	0.61397	0.888	T	0.62530	-0.6835	9	0.46703	T	0.11	.	7.6329	0.28249	0.0:0.9999:0.0:1.0E-4	.	575	O60732	MAGC1_HUMAN	M	575	ENSP00000285879:L575M	ENSP00000285879:L575M	L	+	1	2	MAGEC1	140822579	0.000000	0.05858	0.012000	0.15200	0.012000	0.07955	-0.593000	0.05740	0.179000	0.19938	0.181000	0.17075	CTG	.		0.597	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MAGEC1	9947	ucsc.edu;bcgsc.ca	37	X	140994923	140994923	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chrX:140994923A>T	ENST00000285879.4	+	4	2019	c.1733A>T	c.(1732-1734)cAc>cTc	p.H578L	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	578										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CTGTCTCCTCACTACTTTCCT	0.582										HNSCC(15;0.026)																											p.H578L		.											.	MAGEC1-133	0			c.A1733T						.						241.0	259.0	253.0					X																	140994923		2203	4300	6503	SO:0001583	missense	9947	exon4			CTCCTCACTACTT	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1733A>T	X.37:g.140994923A>T	ENSP00000285879:p.His578Leu	104	1		34	18	NM_005462	0	0	0	0	0	A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	ENST00000285879.4	37	CCDS35417.1	.	.	.	.	.	.	.	.	.	.	a	0.012	-1.674894	0.00758	.	.	ENSG00000155495	ENST00000285879	T	0.02050	4.48	0.92	-1.84	0.07809	.	.	.	.	.	T	0.01124	0.0037	N	0.08118	0	0.24667	N	0.993435	B	0.06786	0.001	B	0.04013	0.001	T	0.46735	-0.9170	9	0.27082	T	0.32	.	2.0331	0.03534	0.496:0.0:0.2423:0.2617	.	578	O60732	MAGC1_HUMAN	L	578	ENSP00000285879:H578L	ENSP00000285879:H578L	H	+	2	0	MAGEC1	140822589	0.000000	0.05858	0.007000	0.13788	0.007000	0.05969	-2.200000	0.01237	-1.408000	0.02040	-1.471000	0.01009	CAC	.		0.582	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
MAGEC1	9947	bcgsc.ca	37	X	140994939	140994939	+	Silent	SNP	C	C	T			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chrX:140994939C>T	ENST00000285879.4	+	4	2035	c.1749C>T	c.(1747-1749)agC>agT	p.S583S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	583										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					TTCCTCAGAGCCCTCAGGGGG	0.587										HNSCC(15;0.026)																											p.S583S		.											.	MAGEC1-133	0			c.C1749T						.						235.0	253.0	247.0					X																	140994939		2203	4300	6503	SO:0001819	synonymous_variant	9947	exon4			TCAGAGCCCTCAG	AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.1749C>T	X.37:g.140994939C>T		122	0		26	5	NM_005462	0	0	0	0	0	A0PK03|O75451|Q8TCV4	Silent	SNP	ENST00000285879.4	37	CCDS35417.1																																																																																			.		0.587	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058604.1	NM_005462	
IRAK1	3654	bcgsc.ca	37	X	153284192	153284192	+	Missense_Mutation	SNP	A	A	G	rs1059702	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chrX:153284192A>G	ENST00000369980.3	-	5	754	c.587T>C	c.(586-588)tTt>tCt	p.F196S	IRAK1_ENST00000429936.2_Missense_Mutation_p.F222S|MIR718_ENST00000390190.2_RNA|IRAK1_ENST00000369974.2_Missense_Mutation_p.F196S|IRAK1_ENST00000393687.2_Missense_Mutation_p.F196S|IRAK1_ENST00000477274.1_5'Flank|IRAK1_ENST00000393682.1_Missense_Mutation_p.F222S	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	196	ProST region.		F -> S (in dbSNP:rs1059702). {ECO:0000269|PubMed:8599092}.		activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCAAAACGGAAAGGGGCGGGC	0.642													G|||	2374	0.628874	0.7337	0.4337	3775	,	,		12789	0.1667		0.6491	False		,,,				2504	0.2883				p.F196S		.											.	IRAK1-1074	0			c.T587C						.	G	SER/PHE,SER/PHE,SER/PHE	3663,172		1491,139,542,2,29	40.0	39.0	39.0		587,587,587	3.7	0.0	X	dbSNP_86	39	5783,945		1800,578,1605,50,267	yes	missense,missense,missense	IRAK1	NM_001025242.1,NM_001025243.1,NM_001569.3	155,155,155	3291,717,2147,52,296	GG,GA,G,AA,A		14.0458,4.485,10.5746	benign,benign,benign	196/683,196/634,196/713	153284192	9446,1117	2203	4300	6503	SO:0001583	missense	3654	exon5			AACGGAAAGGGGC	L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.587T>C	X.37:g.153284192A>G	ENSP00000358997:p.Phe196Ser	427	5		389	9	NM_001569	0	0	0	0	0	D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Missense_Mutation	SNP	ENST00000369980.3	37	CCDS14740.1	1126	0.6787221217600965	256	0.9552238805970149	116	0.48333333333333334	53	0.10474308300395258	339	0.7635135135135135	.	8.005	0.756226	0.15846	0.95515	0.859542	ENSG00000184216	ENST00000369980;ENST00000369974;ENST00000393682;ENST00000393687;ENST00000429936	T;D;D;T;T	0.92858	1.44;-3.12;-3.12;1.44;1.44	4.57	3.68	0.42216	Protein kinase-like domain (1);	0.475758	0.17848	N	0.159961	T	0.00012	0.0000	N	0.00116	-2.08	0.80722	P	0.0	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.44034	-0.9354	9	0.20046	T	0.44	-1.92	6.4293	0.21788	0.1022:0.3457:0.5521:0.0	rs1059702;rs17856471;rs58363670;rs1059702	196;196;196	P51617-4;P51617;P51617-2	.;IRAK1_HUMAN;.	S	196;196;222;196;222	ENSP00000358997:F196S;ENSP00000358991:F196S;ENSP00000377287:F222S;ENSP00000377291:F196S;ENSP00000392662:F222S	ENSP00000358990:F222S	F	-	2	0	IRAK1	152937386	0.053000	0.20554	0.002000	0.10522	0.090000	0.18270	0.487000	0.22356	0.235000	0.21160	-0.252000	0.11476	TTT	0|0.003;T|0.067		0.642	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061143.3		
CTBP2	1488	hgsc.bcm.edu	37	10	126715159	126715160	+	Intron	INS	-	-	GCCGCAGGCTGGGGCTGCAGG	rs529129641|rs372118432	byFrequency	TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr10:126715159_126715160insGCCGCAGGCTGGGGCTGCAGG	ENST00000337195.5	-	3	458				CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000309035.6_In_Frame_Ins_p.390_390A>ALQPQPAA	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TCTGCAGAGGAGCCGCAGCGCC	0.698														537	0.107228	0.1006	0.2478	5008	,	,		14420	0.0417		0.1093	False		,,,				2504	0.0818				p.A390delinsALQPQPAA		.											.	CTBP2-90	0			c.1170_1171insCCTGCAGCCCCAGCCTGCGGC						.		,,	295,3727		33,229,1749					,,	-1.1	0.0			8	694,7122		93,508,3307	no	coding,intron,intron	CTBP2	NM_022802.2,NM_001329.2,NM_001083914.1	,,	126,737,5056	A1A1,A1R,RR		8.8792,7.3347,8.3545	,,	,,		989,10849				SO:0001627	intron_variant	1488	exon1			CAGAGGAGCCGCA	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12405->CCTGCAGCCCCAGCCTGCGGC	10.37:g.126715159_126715160insGCCGCAGGCTGGGGCTGCAGG		51	2		55	6	NM_022802	0	0	0	0	0	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	In_Frame_Ins	INS	ENST00000337195.5	37	CCDS7643.1																																																																																			.		0.698	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
KRTAP9-1	728318	hgsc.bcm.edu	37	17	39346616	39346617	+	In_Frame_Ins	INS	-	-	AGCCTAGCTGTGGGTCCAGCTGCTGCC			TCGA-OR-A5L1-01A-11D-A30A-10	TCGA-OR-A5L1-10A-01D-A30A-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	ec61f9a9-1d55-4395-975b-9dae30944df4	b0f55c34-a9e1-49b6-9835-fa1825bfe350	g.chr17:39346616_39346617insAGCCTAGCTGTGGGTCCAGCTGCTGCC	ENST00000398470.1	+	1	478_479	c.478_479insAGCCTAGCTGTGGGTCCAGCTGCTGCC	c.(478-480)cag>cAGCCTAGCTGTGGGTCCAGCTGCTGCCag	p.160_160Q>QPSCGSSCCQ	KRTAP9-1_ENST00000318329.5_In_Frame_Ins_p.77_77Q>QPSCGSSCCQ|KRTAP9-1_ENST00000377723.3_Intron	NM_001190460.1	NP_001177389.1	A8MXZ3	KRA91_HUMAN	keratin associated protein 9-1	160	30 X 5 AA repeats of C-C-[CGSVRQH]- [SQTNP]-[PTSI].					keratin filament (GO:0045095)				breast(1)|lung(3)	4						CAGCTGCTGCCAGCCTTGCTGC	0.599																																					p.Q160delinsQPSCGSSCCQ		.											.	.	0			c.478_479insAGCCTAGCTGTGGGTCCAGCTGCTGCC						.																																			SO:0001652	inframe_insertion	728318	exon1			TGCTGCCAGCCTT	AC006070	CCDS56029.1	17q21.2	2010-06-03			ENSG00000240542	ENSG00000240542		"""Keratin associated proteins"""	18912	protein-coding gene	gene with protein product			"""keratin associated protein 9-like 3"""	KRTAP9L3			Standard	NM_001190460		Approved	KAP9.1	uc021txf.1	A8MXZ3	OTTHUMG00000133636	Exception_encountered	17.37:g.39346616_39346617insAGCCTAGCTGTGGGTCCAGCTGCTGCC	Exception_encountered	154	0		113	0	NM_001190460	0	0	0	0	0		In_Frame_Ins	INS	ENST00000398470.1	37	CCDS56029.1																																																																																			.		0.599	KRTAP9-1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257781.1		
