#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CYP4B1	1580	bcgsc.ca	37	1	47279175	47279175	+	Missense_Mutation	SNP	C	C	T	rs4646487	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr1:47279175C>T	ENST00000271153.4	+	5	553	c.517C>T	c.(517-519)Cgg>Tgg	p.R173W	CYP4B1_ENST00000371919.4_Missense_Mutation_p.R158W|CYP4B1_ENST00000452782.2_Missense_Mutation_p.R10W|CYP4B1_ENST00000371923.4_Missense_Mutation_p.R173W			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	173			R -> W (in allele CYP4B1*3 and allele CYP4B1*6; dbSNP:rs4646487). {ECO:0000269|PubMed:12142726, ECO:0000269|Ref.5}.		biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	AGAGAAAGCTCGGGAGGGTAA	0.572													C|||	924	0.184505	0.2027	0.1138	5008	,	,		21766	0.2123		0.1372	False		,,,				2504	0.2301				p.R173W		.											.	CYP4B1-92	0			c.C517T						.	C	TRP/ARG,TRP/ARG	821,3585	328.8+/-300.7	88,645,1470	118.0	111.0	113.0		517,517	0.8	0.2	1	dbSNP_111	113	1111,7489	231.5+/-265.5	82,947,3271	yes	missense,missense	CYP4B1	NM_000779.3,NM_001099772.1	101,101	170,1592,4741	TT,TC,CC		12.9186,18.6337,14.8547	possibly-damaging,possibly-damaging	173/512,173/513	47279175	1932,11074	2203	4300	6503	SO:0001583	missense	1580	exon5			AAAGCTCGGGAGG	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.517C>T	1.37:g.47279175C>T	ENSP00000271153:p.Arg173Trp	80	0		70	4	NM_000779	0	0	0	0	0	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	ENST00000271153.4	37	CCDS542.1	336	0.15384615384615385	94	0.1910569105691057	40	0.11049723756906077	99	0.17307692307692307	103	0.1358839050131926	C	14.12	2.440188	0.43326	0.186337	0.129186	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919;ENST00000526297;ENST00000452782;ENST00000468637	T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.21	0.775	0.18527	.	1.636210	0.03146	N	0.167299	T	0.00241	0.0007	L	0.42245	1.32	0.58432	P	5.000000000032756E-6	D;D;P;P	0.71674	0.991;0.998;0.813;0.844	B;P;P;P	0.56916	0.394;0.809;0.663;0.773	T	0.04065	-1.0980	9	0.72032	D	0.01	.	5.2973	0.15758	0.4946:0.3327:0.0:0.1727	rs4646487;rs57240062;rs4646487	10;158;173;173	E7EME6;Q8IZB0;P13584-2;P13584	.;.;.;CP4B1_HUMAN	W	173;173;158;10;10;10	ENSP00000360991:R173W;ENSP00000271153:R173W;ENSP00000360987:R158W;ENSP00000438995:R10W;ENSP00000400413:R10W;ENSP00000437670:R10W	ENSP00000271153:R173W	R	+	1	2	CYP4B1	47051762	0.081000	0.21417	0.237000	0.24090	0.063000	0.16089	0.723000	0.25939	0.168000	0.19655	0.591000	0.81541	CGG	C|0.839;T|0.161		0.572	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
IL12RB2	3595	bcgsc.ca	37	1	67852335	67852335	+	Silent	SNP	G	G	A	rs2228420	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr1:67852335G>A	ENST00000262345.1	+	14	2569	c.1929G>A	c.(1927-1929)acG>acA	p.T643T	IL12RB2_ENST00000371000.1_Silent_p.T643T|IL12RB2_ENST00000541374.1_Silent_p.T643T|IL12RB2_ENST00000544434.1_Silent_p.T557T|IL12RB2_ENST00000465396.1_3'UTR	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	643					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						TTTTCTCAACGCATTACTTCC	0.428													G|||	2071	0.413538	0.1989	0.4697	5008	,	,		16651	0.3442		0.5845	False		,,,				2504	0.5593				p.T643T		.											.	IL12RB2-92	0			c.G1929A						.	G		1023,3383	377.8+/-322.6	127,769,1307	210.0	178.0	189.0		1929	-3.9	0.0	1	dbSNP_111	189	4908,3692	621.0+/-397.1	1405,2098,797	no	coding-synonymous	IL12RB2	NM_001559.2		1532,2867,2104	AA,AG,GG		42.9302,23.2183,45.602		643/863	67852335	5931,7075	2203	4300	6503	SO:0001819	synonymous_variant	3595	exon14			CTCAACGCATTAC	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.1929G>A	1.37:g.67852335G>A		168	1		174	6	NM_001559	0	0	0	0	0	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Silent	SNP	ENST00000262345.1	37	CCDS638.1																																																																																			A|0.433;G|0.567		0.428	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
CTBS	1486	broad.mit.edu	37	1	85039999	85040007	+	In_Frame_Del	DEL	GCAGCGCCA	GCAGCGCCA	-	rs142534762|rs3217269|rs199701060|rs201060055	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr1:85039999_85040007delGCAGCGCCA	ENST00000370630.5	-	1	140_148	c.92_100delTGGCGCTGC	c.(91-102)ctggcgctgcgg>cgg	p.LAL31del	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	31					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		GCCGCGAGCCgcagcgccagcagcgccag	0.718														1537	0.306909	0.5038	0.2954	5008	,	,		11352	0.0556		0.2624	False		,,,				2504	0.3538				p.31_34del		.											.	CTBS-90	0			c.92_100del						.			865,21,1798		349,2,165,3,13,810						-3.6	0.0		dbSNP_134	4	1279,4,4361		415,1,448,1,1,1956	no	codingComplex	CTBS	NM_004388.2		764,3,613,4,14,2766	A1A1,A1A2,A1R,A2A2,A2R,RR		22.7321,33.0104,26.0447				2144,25,6159				SO:0001651	inframe_deletion	1486	exon1			CGAGCCGCAGCGC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.92_100delTGGCGCTGC	1.37:g.85040008_85040016delGCAGCGCCA	ENSP00000359664:p.Leu31_Leu33del	18	0		56	16	NM_004388	0	0	0	0	0	Q5VX50	In_Frame_Del	DEL	ENST00000370630.5	37	CCDS698.1																																																																																			.		0.718	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027457.2	NM_004388	
SPRR3	6707	broad.mit.edu	37	1	152975659	152975682	+	In_Frame_Del	DEL	GAGCCAGGCTGTACCAAGGTCCCT	GAGCCAGGCTGTACCAAGGTCCCT	-	rs568163793|rs553429466|rs74134624	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr1:152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENST00000295367.4	+	2	205_228	c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	c.(163-186)gagccaggctgtaccaaggtccctdel	p.EPGCTKVP95del	SPRR3_ENST00000542696.1_In_Frame_Del_p.EPGCTKVP87del|SPRR3_ENST00000331860.3_In_Frame_Del_p.EPGCTKVP95del	NM_001097589.1	NP_001091058.1	Q9UBC9	SPRR3_HUMAN	small proline-rich protein 3	95	14 X 8 AA approximate tandem repeats.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	11	Lung NSC(65;1.49e-28)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAAGATTCCAGAGCCAGGCTGTACCAAGGTCCCTGAGCCAGGCT	0.562																																					p.55_62del		.											.	SPRR3-45	0			c.163_186del						.		,	2036,1952		740,556,698					,	-1.4	0.0		dbSNP_130	70	3135,4775		852,1431,1672	no	coding,coding	SPRR3	NM_005416.2,NM_001097589.1	,	1592,1987,2370	A1A1,A1R,RR		39.6334,48.9468,43.4611	,	,		5171,6727				SO:0001651	inframe_deletion	6707	exon2			ATTCCAGAGCCAG	AY118269	CCDS1033.1	1q21-q22	2008-02-05			ENSG00000163209	ENSG00000163209			11268	protein-coding gene	gene with protein product		182271				8325635	Standard	NM_005416		Approved		uc001faz.4	Q9UBC9	OTTHUMG00000013872	ENST00000295367.4:c.163_186delGAGCCAGGCTGTACCAAGGTCCCT	1.37:g.152975659_152975682delGAGCCAGGCTGTACCAAGGTCCCT	ENSP00000295367:p.Glu95_Pro102del	123	0		91	33	NM_001097589	0	0	0	0	0	A5YKK8|B2R4G8|D3DV32|O75597|Q4ZGI7|Q5T525|Q8NET7|Q9UDG3	In_Frame_Del	DEL	ENST00000295367.4	37	CCDS1033.1																																																																																			.		0.562	SPRR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038910.1	NM_005416	
HMCN1	83872	ucsc.edu;bcgsc.ca	37	1	186031041	186031041	+	Silent	SNP	C	C	T	rs7522627	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr1:186031041C>T	ENST00000271588.4	+	47	7600	c.7371C>T	c.(7369-7371)tgC>tgT	p.C2457C	HMCN1_ENST00000367492.2_Silent_p.C2457C	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2457	Ig-like C2-type 22.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AATATACTTGCGTTGTAAGGA	0.378													T|||	3277	0.654353	0.8495	0.647	5008	,	,		16476	0.5903		0.5348	False		,,,				2504	0.5849				p.C2457C		.											.	HMCN1-113	0			c.C7371T						.	T		3571,835	333.6+/-303.0	1454,663,86	124.0	136.0	132.0		7371	1.9	0.9	1	dbSNP_116	132	4602,3998	553.3+/-386.3	1252,2098,950	no	coding-synonymous	HMCN1	NM_031935.2		2706,2761,1036	TT,TC,CC		46.4884,18.9514,37.1598		2457/5636	186031041	8173,4833	2203	4300	6503	SO:0001819	synonymous_variant	83872	exon47			TACTTGCGTTGTA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7371C>T	1.37:g.186031041C>T		53	0		36	4	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	37	CCDS30956.1																																																																																			C|0.372;T|0.628		0.378	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
C1orf106	55765	hgsc.bcm.edu	37	1	200880978	200880978	+	Missense_Mutation	SNP	C	C	T	rs296520	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr1:200880978C>T	ENST00000367342.4	+	9	1812	c.1612C>T	c.(1612-1614)Cgc>Tgc	p.R538C	C1orf106_ENST00000413687.2_Missense_Mutation_p.R453C	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	538			R -> C (in dbSNP:rs296520). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GTGGGAGCTGCGCCGCGCAGC	0.736													T|||	3966	0.791933	0.6089	0.8213	5008	,	,		12017	0.997		0.7256	False		,,,				2504	0.8753				p.R552C		.											.	C1orf106-93	0			c.C1654T						.	T	CYS/ARG,CYS/ARG	2547,1503		890,767,368	5.0	7.0	6.0		1357,1612	0.8	0.0	1	dbSNP_79	6	5587,2355		2124,1339,508	no	missense,missense	C1orf106	NM_001142569.2,NM_018265.3	180,180	3014,2106,876	TT,TC,CC		29.6525,37.1111,32.1714	benign,benign	453/579,538/664	200880978	8134,3858	2025	3971	5996	SO:0001583	missense	55765	exon9			GAGCTGCGCCGCG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1612C>T	1.37:g.200880978C>T	ENSP00000356311:p.Arg538Cys	0	0		9	9	NM_018265	0	0	0	0	0	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	37		1677	0.7678571428571429	261	0.5304878048780488	285	0.787292817679558	569	0.9947552447552448	562	0.741424802110818	T	0.366	-0.936884	0.02340	0.628889	0.703475	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.28454	1.61;1.61	3.39	0.759	0.18438	.	0.912041	0.09365	N	0.812206	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.16188	-1.0411	9	0.29301	T	0.29	-23.0614	3.796	0.08740	0.0:0.2241:0.1856:0.5903	rs296520;rs7519373;rs56757010	538	Q3KP66	CA106_HUMAN	C	538;453	ENSP00000356311:R538C;ENSP00000392105:R453C	ENSP00000356311:R538C	R	+	1	0	C1orf106	199147601	0.004000	0.15560	0.002000	0.10522	0.007000	0.05969	-0.731000	0.04909	-0.124000	0.11724	-0.381000	0.06696	CGC	C|0.242;T|0.758		0.736	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
PROSER2	254427	hgsc.bcm.edu	37	10	11912332	11912332	+	Missense_Mutation	SNP	C	C	T	rs12253554	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr10:11912332C>T	ENST00000277570.5	+	4	1389	c.1235C>T	c.(1234-1236)gCg>gTg	p.A412V	PROSER2-AS1_ENST00000453242.1_RNA|PROSER2_ENST00000379200.1_Missense_Mutation_p.A216V|PROSER2-AS1_ENST00000445498.1_RNA	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	412			A -> V (in dbSNP:rs12253554). {ECO:0000269|PubMed:15489334}.														GTGCAGTTCGCGGGCCGCGGC	0.771													C|||	358	0.0714856	0.0946	0.0476	5008	,	,		9233	0.001		0.0775	False		,,,				2504	0.1237				p.A412V		.											.	.	0			c.C1235T						.	C	VAL/ALA	112,1534		0,112,711	1.0	1.0	1.0		1235	5.3	0.9	10	dbSNP_120	1	187,3499		0,187,1656	no	missense	C10orf47	NM_153256.3	64	0,299,2367	TT,TC,CC		5.0733,6.8044,5.6077	possibly-damaging	412/436	11912332	299,5033	823	1843	2666	SO:0001583	missense	254427	exon4			AGTTCGCGGGCCG	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.1235C>T	10.37:g.11912332C>T	ENSP00000277570:p.Ala412Val	0	0		6	5	NM_153256	0	0	0	0	0	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Missense_Mutation	SNP	ENST00000277570.5	37	CCDS7085.1	143	0.06547619047619048	60	0.12195121951219512	22	0.06077348066298342	1	0.0017482517482517483	60	0.079155672823219	C	22.4	4.285312	0.80803	0.068044	0.050733	ENSG00000148426	ENST00000379208;ENST00000277570;ENST00000379202;ENST00000379200	T;T	0.08984	3.03;3.03	5.3	5.3	0.74995	.	0.302100	0.28895	N	0.013796	T	0.00178	0.0005	L	0.29908	0.895	0.35518	P	0.19877100000000003	D	0.62365	0.991	P	0.47044	0.535	T	0.17531	-1.0366	9	0.87932	D	0	-13.0271	17.9268	0.88986	0.0:1.0:0.0:0.0	rs12253554;rs17851504	412	Q86WR7	CJ047_HUMAN	V	318;412;319;216	ENSP00000277570:A412V;ENSP00000368498:A216V	ENSP00000277570:A412V	A	+	2	0	C10orf47	11952338	0.998000	0.40836	0.879000	0.34478	0.186000	0.23388	4.734000	0.62043	2.476000	0.83614	0.313000	0.20887	GCG	C|0.935;T|0.065		0.771	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
GPRIN2	9721	hgsc.bcm.edu	37	10	47000217	47000217	+	Missense_Mutation	SNP	G	G	A	rs72780221	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr10:47000217G>A	ENST00000374317.1	+	3	1610	c.1337G>A	c.(1336-1338)cGc>cAc	p.R446H	GPRIN2_ENST00000374314.4_Missense_Mutation_p.R446H	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	446								p.R446H(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						TCCCTGCGGCGCCCCAGCTGC	0.716																																					p.R446H		.											.	GPRIN2-90	1	Substitution - Missense(1)	prostate(1)	c.G1337A						.						8.0	9.0	9.0					10																	47000217		2121	4098	6219	SO:0001583	missense	9721	exon3			TGCGGCGCCCCAG	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.1337G>A	10.37:g.47000217G>A	ENSP00000363436:p.Arg446His	2	0		19	9	NM_014696	0	0	0	0	0	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	37	CCDS31192.1	220	0.10073260073260074	86	0.17479674796747968	30	0.08287292817679558	25	0.043706293706293704	79	0.10422163588390501	G	13.52	2.261176	0.39995	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.26223	1.75;1.75	5.11	3.2	0.36748	.	0.744361	0.10758	N	0.637492	T	0.00073	0.0002	L	0.49350	1.555	0.09310	N	1	B	0.24533	0.105	B	0.17433	0.018	T	0.22243	-1.0222	10	0.34782	T	0.22	-0.7153	5.5226	0.16941	0.1777:0.1655:0.6568:0.0	.	446	O60269	GRIN2_HUMAN	H	446	ENSP00000363436:R446H;ENSP00000363433:R446H	ENSP00000363433:R446H	R	+	2	0	GPRIN2	46420223	0.000000	0.05858	0.420000	0.26596	0.986000	0.74619	0.143000	0.16115	0.639000	0.30564	0.561000	0.74099	CGC	G|0.901;A|0.099		0.716	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
AGAP11	119385	broad.mit.edu;bcgsc.ca	37	10	88768599	88768599	+	RNA	SNP	C	C	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr10:88768599C>T	ENST00000444431.1	+	0	3199				RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.5_ENST00000433214.2_RNA|RP11-96C23.10_ENST00000451760.1_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										ATCTCCAGCTCTAAAAGCAAT	0.498																																					p.S197F		.											.	.	0			c.C590T						.						86.0	95.0	92.0					10																	88768599		2203	4300	6503			119385	exon12			CCAGCTCTAAAAG			10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88768599C>T		670	0		586	24	NM_133447	0	0	10	10	0	B9EIP7|D3DWE4	Missense_Mutation	SNP	ENST00000444431.1	37																																																																																				.		0.498	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript	OTTHUMT00000049193.1	NM_133447	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		0	0		7	7	NM_001077494	0	0	0	2	2	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
KNDC1	85442	hgsc.bcm.edu	37	10	135000148	135000148	+	Silent	SNP	T	T	C	rs3810965	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr10:135000148T>C	ENST00000304613.3	+	6	1317	c.1296T>C	c.(1294-1296)gcT>gcC	p.A432A	KNDC1_ENST00000368572.2_Silent_p.A432A|KNDC1_ENST00000368571.2_Silent_p.A367A			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	432					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CAGAAGGAGCTAGGCAGCTGG	0.667													c|||	2087	0.416733	0.118	0.3847	5008	,	,		13870	0.5764		0.4354	False		,,,				2504	0.6595				p.A432A		.											.	KNDC1-229	0			c.T1296C						.			719,3683		63,593,1545	26.0	32.0	30.0		1296	-4.2	0.0	10	dbSNP_107	30	3956,4636		925,2106,1265	no	coding-synonymous	KNDC1	NM_152643.6		988,2699,2810	CC,CT,TT		46.0428,16.3335,35.9781		432/1750	135000148	4675,8319	2201	4296	6497	SO:0001819	synonymous_variant	85442	exon6			AGGAGCTAGGCAG	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1296T>C	10.37:g.135000148T>C		1	0		4	4	NM_152643	0	0	0	1	1	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.607;C|0.393		0.667	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
KNDC1	85442	hgsc.bcm.edu	37	10	135000159	135000159	+	Missense_Mutation	SNP	A	A	G	rs3810964	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr10:135000159A>G	ENST00000304613.3	+	6	1328	c.1307A>G	c.(1306-1308)gAa>gGa	p.E436G	KNDC1_ENST00000368572.2_Missense_Mutation_p.E436G|KNDC1_ENST00000368571.2_Missense_Mutation_p.E371G			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	436			E -> G (in dbSNP:rs3810964). {ECO:0000269|Ref.1}.		cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		AGGCAGCTGGAAAGTGCAGCC	0.652													a|||	2088	0.416933	0.118	0.3847	5008	,	,		14228	0.5774		0.4354	False		,,,				2504	0.6595				p.E436G		.											.	KNDC1-229	0			c.A1307G						.		GLY/GLU	699,3701		65,569,1566	23.0	28.0	26.0		1307	-5.9	0.0	10	dbSNP_107	26	3934,4658		927,2080,1289	yes	missense	KNDC1	NM_152643.6	98	992,2649,2855	GG,GA,AA		45.7868,15.8864,35.6604	benign	436/1750	135000159	4633,8359	2200	4296	6496	SO:0001583	missense	85442	exon6			AGCTGGAAAGTGC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.1307A>G	10.37:g.135000159A>G	ENSP00000304437:p.Glu436Gly	1	0		4	4	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	ENST00000304613.3	37	CCDS7674.1	871	0.39880952380952384	52	0.10569105691056911	135	0.3729281767955801	338	0.5909090909090909	346	0.45646437994722955	A	6.455	0.452036	0.12283	0.158864	0.457868	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.28895	1.59;1.59;1.59	3.02	-5.95	0.02241	.	0.946911	0.08625	N	0.917834	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43893	-0.9363	9	0.09843	T	0.71	-2.0863	2.4481	0.04511	0.2095:0.4457:0.2064:0.1384	rs3810964;rs58651584;rs3810964	371;436	Q76NI1-2;Q76NI1	.;VKIND_HUMAN	G	436;436;371	ENSP00000304437:E436G;ENSP00000357561:E436G;ENSP00000357560:E371G	ENSP00000304437:E436G	E	+	2	0	KNDC1	134850149	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.407000	0.07178	-1.198000	0.02669	-1.676000	0.00740	GAA	A|0.608;G|0.392		0.652	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
MUC6	4588	broad.mit.edu	37	11	1027716	1027716	+	Silent	SNP	G	G	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr11:1027716G>T	ENST00000421673.2	-	16	2000	c.1950C>A	c.(1948-1950)ctC>ctA	p.L650L		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	650					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCCAGCCCCAGAGCAGGACGC	0.667																																					p.L650L		.											.	MUC6-23	0			c.C1950A						.						23.0	28.0	26.0					11																	1027716		2091	4211	6302	SO:0001819	synonymous_variant	4588	exon16			GCCCCAGAGCAGG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.1950C>A	11.37:g.1027716G>T		81	0		78	3	NM_005961	0	0	0	0	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																			.		0.667	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382120.2	XM_290540	
MUC5B	727897	hgsc.bcm.edu	37	11	1253976	1253976	+	Missense_Mutation	SNP	A	A	G	rs76956995		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr11:1253976A>G	ENST00000529681.1	+	17	2099	c.2041A>G	c.(2041-2043)Agc>Ggc	p.S681G	MUC5B_ENST00000447027.1_Missense_Mutation_p.S684G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	681					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGTACAGCTCAGCGACTGGAG	0.687																																					p.S681G		.											.	.	0			c.A2041G						.						22.0	25.0	24.0					11																	1253976		2121	4235	6356	SO:0001583	missense	727897	exon17			CAGCTCAGCGACT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2041A>G	11.37:g.1253976A>G	ENSP00000436812:p.Ser681Gly	49	0		92	6	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	5.230	0.228008	0.09916	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76578	-1.03;-1.03	4.6	-7.0	0.01599	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.70605	0.3243	N	0.25144	0.715	0.09310	N	1	B;D;D	0.59357	0.425;0.985;0.985	B;P;P	0.54499	0.131;0.675;0.754	T	0.69614	-0.5098	9	0.87932	D	0	.	10.9271	0.47197	0.2958:0.5687:0.1355:0.0	.	681;1340;684	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	681;684;682;717	ENSP00000436812:S681G;ENSP00000415793:S684G	ENSP00000343037:S682G	S	+	1	0	MUC5B	1210552	0.000000	0.05858	0.011000	0.14972	0.067000	0.16453	-4.642000	0.00204	-1.098000	0.03038	0.260000	0.18958	AGC	.		0.687	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	45	0		90	7	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR9G4	283189	bcgsc.ca	37	11	56510623	56510623	+	Missense_Mutation	SNP	A	A	G	rs513873	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr11:56510623A>G	ENST00000302957.3	-	1	664	c.665T>C	c.(664-666)gTa>gCa	p.V222A		NM_001005284.1	NP_001005284.1	Q8NGQ1	OR9G4_HUMAN	olfactory receptor, family 9, subfamily G, member 4	222			V -> A (in dbSNP:rs513873).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						GCTGGAGAGTACTGTGAAGCC	0.468													A|||	945	0.188698	0.2163	0.1599	5008	,	,		21139	0.0853		0.2992	False		,,,				2504	0.1646				p.V222A		.											.	OR9G4-71	0			c.T665C						.	A	ALA/VAL	1052,3350	384.7+/-325.4	118,816,1267	101.0	92.0	95.0		665	5.1	1.0	11	dbSNP_83	95	2745,5847	436.3+/-358.3	444,1857,1995	yes	missense	OR9G4	NM_001005284.1	64	562,2673,3262	GG,GA,AA		31.9483,23.8982,29.2212	possibly-damaging	222/328	56510623	3797,9197	2201	4296	6497	SO:0001583	missense	283189	exon1			GAGAGTACTGTGA	BK004400	CCDS31537.1	11q11	2012-08-09			ENSG00000172457	ENSG00000172457		"""GPCR / Class A : Olfactory receptors"""	15322	protein-coding gene	gene with protein product							Standard	NM_001005284		Approved		uc010rjo.2	Q8NGQ1	OTTHUMG00000166932	ENST00000302957.3:c.665T>C	11.37:g.56510623A>G	ENSP00000307515:p.Val222Ala	118	1		118	7	NM_001005284	0	0	0	0	0	Q6IF62|Q96RA9	Missense_Mutation	SNP	ENST00000302957.3	37	CCDS31537.1	445	0.20375457875457875	112	0.22764227642276422	54	0.14917127071823205	46	0.08041958041958042	233	0.3073878627968338	A	14.16	2.452759	0.43531	0.238982	0.319483	ENSG00000172457	ENST00000302957	T	0.38077	1.16	5.07	5.07	0.68467	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35772	N	0.002985	T	0.00012	0.0000	L	0.35542	1.07	0.33213	P	0.44635800000000003	D	0.76494	0.999	D	0.80764	0.994	T	0.32188	-0.9916	9	0.19590	T	0.45	-48.116	13.8217	0.63325	1.0:0.0:0.0:0.0	rs513873;rs52807984;rs60956810;rs513873	222	Q8NGQ1	OR9G4_HUMAN	A	222	ENSP00000307515:V222A	ENSP00000307515:V222A	V	-	2	0	OR9G4	56267199	0.047000	0.20315	0.991000	0.47740	0.912000	0.54170	3.072000	0.50049	2.131000	0.65755	0.523000	0.50628	GTA	A|0.748;G|0.252		0.468	OR9G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391945.1	NM_001005284	
USP35	57558	broad.mit.edu	37	11	77920714	77920714	+	Missense_Mutation	SNP	C	C	T	rs564233462		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr11:77920714C>T	ENST00000529308.1	+	10	2074	c.1813C>T	c.(1813-1815)Cgc>Tgc	p.R605C	USP35_ENST00000530267.1_Missense_Mutation_p.R173C|USP35_ENST00000530535.1_3'UTR|USP35_ENST00000526425.1_Missense_Mutation_p.R336C|USP35_ENST00000441408.2_Missense_Mutation_p.R191C	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	605	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			TCCTCCTGAGCGCTGTCGCCG	0.657													c|||	1	0.000199681	0.0008	0.0	5008	,	,		16164	0.0		0.0	False		,,,				2504	0.0				p.R605C		.											.	USP35-637	0			c.C1813T						.						49.0	55.0	53.0					11																	77920714		2017	4157	6174	SO:0001583	missense	57558	exon10			CCTGAGCGCTGTC	AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.1813C>T	11.37:g.77920714C>T	ENSP00000431876:p.Arg605Cys	97	0		81	4	NM_020798	0	0	0	0	0		Missense_Mutation	SNP	ENST00000529308.1	37	CCDS41693.1	.	.	.	.	.	.	.	.	.	.	c	14.11	2.438578	0.43326	.	.	ENSG00000118369	ENST00000530267;ENST00000529308;ENST00000441408;ENST00000526425	T;T;T;T	0.13307	3.17;3.42;2.6;3.3	4.89	2.83	0.33086	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.427068	0.17866	N	0.159376	T	0.15565	0.0375	M	0.75085	2.285	0.37494	D	0.916499	B;B	0.14805	0.004;0.011	B;B	0.10450	0.005;0.005	T	0.05550	-1.0878	10	0.59425	D	0.04	-17.885	4.7475	0.13045	0.1751:0.624:0.0:0.201	.	605;191	Q9P2H5;E7EWV7	UBP35_HUMAN;.	C	173;605;191;336	ENSP00000435468:R173C;ENSP00000431876:R605C;ENSP00000400825:R191C;ENSP00000434942:R336C	ENSP00000400825:R191C	R	+	1	0	USP35	77598362	0.999000	0.42202	0.799000	0.32177	0.884000	0.51177	0.737000	0.26144	0.508000	0.28173	0.586000	0.80456	CGC	.		0.657	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390026.1	XM_290527	
MMP8	4317	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	102586132	102586132	+	Silent	SNP	G	G	A	rs530920765		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr11:102586132G>A	ENST00000236826.3	-	7	1037	c.939C>T	c.(937-939)gtC>gtT	p.V313V		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	313					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)	p.V313V(1)		autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	AATTCATTTCGACTCTTTGTA	0.398																																					p.V313V		.											.	MMP8-229	1	Substitution - coding silent(1)	large_intestine(1)	c.C939T						.						107.0	96.0	100.0					11																	102586132		2203	4299	6502	SO:0001819	synonymous_variant	4317	exon7			CATTTCGACTCTT	J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.939C>T	11.37:g.102586132G>A		68	0		68	8	NM_002424	0	0	0	0	0	Q45F99	Silent	SNP	ENST00000236826.3	37	CCDS8320.1	.	.	.	.	.	.	.	.	.	.	G	3.447	-0.112775	0.06881	.	.	ENSG00000118113	ENST00000438475	.	.	.	5.47	-10.9	0.00192	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999977	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.1067	0.30890	0.5878:0.2137:0.1393:0.0592	.	.	.	.	X	289	.	.	R	-	1	2	MMP8	102091342	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.508000	0.00447	-3.667000	0.00124	-0.157000	0.13467	CGA	.		0.398	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395223.1	NM_002424	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	TUBA1C_ENST00000541364.1_Silent_p.K234K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		192	18		259	13	NM_032704	0	0	226	324	98		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
UBE3B	89910	broad.mit.edu	37	12	109947450	109947450	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr12:109947450G>T	ENST00000342494.3	+	16	2267	c.1672G>T	c.(1672-1674)Gaa>Taa	p.E558*	UBE3B_ENST00000434735.2_Nonsense_Mutation_p.E558*|UBE3B_ENST00000535900.1_Intron|UBE3B_ENST00000280774.5_Nonsense_Mutation_p.E558*	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	558					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						ATTCAAACTGGAAGAGCTGGT	0.373																																					p.E558X		.											.	UBE3B-660	0			c.G1672T						.						153.0	143.0	146.0					12																	109947450		2203	4300	6503	SO:0001587	stop_gained	89910	exon16			AAACTGGAAGAGC	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.1672G>T	12.37:g.109947450G>T	ENSP00000340596:p.Glu558*	70	0		88	3	NM_130466	0	0	2	2	0	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Nonsense_Mutation	SNP	ENST00000342494.3	37	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	G	45	11.653999	0.99587	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494	.	.	.	5.81	5.81	0.92471	.	0.094804	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-20.5721	18.6424	0.91399	0.0:0.0:1.0:0.0	.	.	.	.	X	558	.	ENSP00000280774:E558X	E	+	1	0	UBE3B	108431833	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.385000	0.97223	2.737000	0.93849	0.650000	0.86243	GAA	.		0.373	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
PPTC7	160760	broad.mit.edu	37	12	111020740	111020742	+	In_Frame_Del	DEL	CGC	CGC	-	rs151075597	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr12:111020740_111020742delCGC	ENST00000354300.3	-	1	383_385	c.95_97delGCG	c.(94-99)ggcgac>gac	p.G32del		NM_139283.1	NP_644812.1	Q8NI37	PPTC7_HUMAN	PTC7 protein phosphatase homolog (S. cerevisiae)	32	Gly-rich.					mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|large_intestine(2)|lung(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	9						AGTCCGTAGTcgccgccgccgcc	0.739														302	0.0603035	0.0719	0.1254	5008	,	,		10517	0.001		0.0924	False		,,,				2504	0.0266				p.32_33del		.											.	PPTC7-90	0			c.95_97del						.			149,1205		60,29,588						4.1	1.0		dbSNP_126	4	388,2704		139,110,1297	no	coding	PPTC7	NM_139283.1		199,139,1885	A1A1,A1R,RR		12.5485,11.0044,12.0783				537,3909				SO:0001651	inframe_deletion	160760	exon1			CGTAGTCGCCGCC	AF385435	CCDS9149.1	12q24.11	2009-11-05				ENSG00000196850			30695	protein-coding gene	gene with protein product	"""T cell activation protein phosphatase 2C"""	609668				15177553	Standard	NM_139283		Approved	TA-PP2C	uc001trh.1	Q8NI37	OTTHUMG00000169529	ENST00000354300.3:c.95_97delGCG	12.37:g.111020749_111020751delCGC	ENSP00000346255:p.Gly32del	11	0		32	10	NM_139283	0	0	0	0	0	B3KWC5|Q68DZ7|Q6UY82	In_Frame_Del	DEL	ENST00000354300.3	37	CCDS9149.1																																																																																			.		0.739	PPTC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404635.1	NM_139283	
FAM109A	144717	hgsc.bcm.edu	37	12	111800836	111800836	+	Silent	SNP	G	G	A	rs375086972		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr12:111800836G>A	ENST00000547838.2	-	2	493	c.396C>T	c.(394-396)ggC>ggT	p.G132G	FAM109A_ENST00000361483.3_Silent_p.G145G|FAM109A_ENST00000392658.5_Silent_p.G132G|FAM109A_ENST00000450786.2_Missense_Mutation_p.A113V|FAM109A_ENST00000548163.1_Silent_p.G132G			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	132					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|lung(1)|ovary(1)	4						TGCCACCCCCGCCACGTACAG	0.721																																					p.G145G		.											.	FAM109A-90	0			c.C435T						.	G	,,	0,4100		0,0,2050	6.0	7.0	7.0		435,396,396	-7.8	0.0	12		7	3,8209		0,3,4103	no	coding-synonymous,coding-synonymous,coding-synonymous	FAM109A	NM_001177996.1,NM_001177997.1,NM_144671.4	,,	0,3,6153	AA,AG,GG		0.0365,0.0,0.0244	,,	145/263,132/250,132/250	111800836	3,12309	2050	4106	6156	SO:0001819	synonymous_variant	144717	exon4			ACCCCCGCCACGT	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.396C>T	12.37:g.111800836G>A		0	0		19	12	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	Silent	SNP	ENST00000547838.2	37	CCDS9152.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608985	0.46527	0.0	3.65E-4	ENSG00000198324	ENST00000450786	.	.	.	3.92	-7.83	0.01201	.	.	.	.	.	T	0.13670	0.0331	.	.	.	0.22424	N	0.99911	P	0.41041	0.736	B	0.28849	0.095	T	0.10683	-1.0619	7	0.87932	D	0	.	4.4899	0.11808	0.096:0.3076:0.4299:0.1665	.	113	G3V0F1	.	V	113	.	ENSP00000390552:A113V	A	-	2	0	FAM109A	110285219	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-7.277000	0.00040	-1.838000	0.01187	-0.258000	0.10820	GCG	.		0.721	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
PITPNM2	57605	bcgsc.ca	37	12	123471094	123471094	+	Silent	SNP	G	G	A	rs12811109	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr12:123471094G>A	ENST00000542749.1	-	23	3678	c.3615C>T	c.(3613-3615)caC>caT	p.H1205H	PITPNM2_ENST00000320201.4_Silent_p.H1205H|PITPNM2_ENST00000280562.5_Silent_p.H1199H|PITPNM2_ENST00000392428.1_Silent_p.H926H			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1205					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CATAGGCCGCGTGCACGCGCA	0.682													G|||	613	0.122404	0.0431	0.1873	5008	,	,		15693	0.002		0.2157	False		,,,				2504	0.2117				p.H1205H		.											.	PITPNM2-228	0			c.C3615T						.	G		308,4096		7,294,1901	25.0	22.0	23.0		3615	0.1	1.0	12	dbSNP_121	23	1667,6931		136,1395,2768	no	coding-synonymous	PITPNM2	NM_020845.2		143,1689,4669	AA,AG,GG		19.3882,6.9936,15.19		1205/1350	123471094	1975,11027	2202	4299	6501	SO:0001819	synonymous_variant	57605	exon24			GGCCGCGTGCACG	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3615C>T	12.37:g.123471094G>A		137	0		206	8	NM_020845	0	0	4	4	0	Q9P271	Silent	SNP	ENST00000542749.1	37	CCDS9242.1																																																																																			G|0.860;A|0.140		0.682	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
NPAP1	23742	hgsc.bcm.edu	37	15	24921115	24921115	+	Missense_Mutation	SNP	C	C	A	rs35022251	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr15:24921115C>A	ENST00000329468.2	+	1	575	c.101C>A	c.(100-102)cCg>cAg	p.P34Q		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	34			P -> Q (in dbSNP:rs35022251).		cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GACGCCTCCCCGCCCGGTCGG	0.711													C|||	130	0.0259585	0.0023	0.0303	5008	,	,		10406	0.0		0.0586	False		,,,				2504	0.0481				p.P34Q		.											.	.	0			c.C101A						.	C	GLN/PRO	32,4026		0,32,1997	7.0	10.0	9.0		101	-4.8	0.0	15	dbSNP_126	9	352,7666		8,336,3665	no	missense	C15orf2	NM_018958.2	76	8,368,5662	AA,AC,CC		4.3901,0.7886,3.1799	benign	34/1157	24921115	384,11692	2029	4009	6038	SO:0001583	missense	23742	exon1			CCTCCCCGCCCGG	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.101C>A	15.37:g.24921115C>A	ENSP00000333735:p.Pro34Gln	0	0		16	6	NM_018958	0	0	0	0	0		Missense_Mutation	SNP	ENST00000329468.2	37	CCDS10015.1	63	0.028846153846153848	2	0.0040650406504065045	10	0.027624309392265192	0	0.0	51	0.06728232189973615	.	2.243	-0.373292	0.05034	0.007886	0.043901	ENSG00000185823	ENST00000329468	T	0.08720	3.06	2.42	-4.83	0.03161	.	.	.	.	.	T	0.00210	0.0006	N	0.01352	-0.895	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.46133	-0.9213	9	0.19147	T	0.46	.	7.4625	0.27304	0.2268:0.4738:0.2994:0.0	rs35022251	34	Q9NZP6	CO002_HUMAN	Q	34	ENSP00000333735:P34Q	ENSP00000333735:P34Q	P	+	2	0	C15orf2	22472208	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.290000	0.08354	-1.979000	0.00992	-1.747000	0.00681	CCG	C|0.970;A|0.030		0.711	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
CAPN15	6650	hgsc.bcm.edu	37	16	597505	597505	+	Missense_Mutation	SNP	G	G	A	rs377678059		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr16:597505G>A	ENST00000219611.2	+	4	1030	c.667G>A	c.(667-669)Gaa>Aaa	p.E223K	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	223					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CCCAGCTGCCGAACCAGAGCC	0.746													g|||	1	0.000199681	0.0008	0.0	5008	,	,		13263	0.0		0.0	False		,,,				2504	0.0				p.E223K		.											.	SOLH-523	0			c.G667A						.	G	LYS/GLU	0,3880		0,0,1940	10.0	17.0	14.0		667	2.7	0.0	16		14	1,7875		0,1,3937	no	missense	SOLH	NM_005632.2	56	0,1,5877	AA,AG,GG		0.0127,0.0,0.0085	benign	223/1087	597505	1,11755	1940	3938	5878	SO:0001583	missense	6650	exon4			GCTGCCGAACCAG	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.667G>A	16.37:g.597505G>A	ENSP00000219611:p.Glu223Lys	0	0		21	11	NM_005632	0	0	0	0	0	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	37	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	g	6.890	0.533771	0.13188	0.0	1.27E-4	ENSG00000103326	ENST00000219611;ENST00000397687	D	0.88586	-2.4	4.69	2.66	0.31614	.	2.559000	0.01516	N	0.018169	D	0.82683	0.5090	N	0.19112	0.55	0.09310	N	1	B	0.24426	0.103	B	0.14578	0.011	T	0.68550	-0.5379	10	0.46703	T	0.11	.	8.9121	0.35559	0.1939:0.0:0.8061:0.0	.	223	O75808	CAN15_HUMAN	K	223	ENSP00000219611:E223K	ENSP00000219611:E223K	E	+	1	0	SOLH	537506	0.999000	0.42202	0.010000	0.14722	0.004000	0.04260	3.352000	0.52239	0.383000	0.24910	0.306000	0.20318	GAA	.		0.746	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
TELO2	9894	ucsc.edu;bcgsc.ca	37	16	1547477	1547477	+	Silent	SNP	T	T	C	rs2745108	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr16:1547477T>C	ENST00000262319.6	+	5	1077	c.798T>C	c.(796-798)gcT>gcC	p.A266A		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	266					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				CCATGGAGGCTGTGCTGACCG	0.697													N|||	1398	0.279153	0.5136	0.268	5008	,	,		17144	0.251		0.1113	False		,,,				2504	0.1718				p.A266A		.											.	TELO2-90	0			c.T798C						.			1949,2381		427,1095,643	11.0	12.0	12.0		798	-10.1	0.0	16	dbSNP_100	12	868,7674		48,772,3451	no	coding-synonymous	TELO2	NM_016111.3		475,1867,4094	CC,CT,TT		10.1616,45.0115,21.8847		266/838	1547477	2817,10055	2165	4271	6436	SO:0001819	synonymous_variant	9894	exon5			GGAGGCTGTGCTG	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.798T>C	16.37:g.1547477T>C		21	0		80	28	NM_016111	0	0	5	9	4	D3DU73|O75168|Q7LDV4|Q9BR21	Silent	SNP	ENST00000262319.6	37	CCDS32363.1																																																																																			T|0.754;C|0.246		0.697	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103602.2	NM_016111	
FUS	2521	broad.mit.edu	37	16	31196405	31196405	+	Silent	SNP	C	C	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr16:31196405C>T	ENST00000254108.7	+	6	774	c.669C>T	c.(667-669)ggC>ggT	p.G223G	RP11-388M20.6_ENST00000564743.1_RNA|FUS_ENST00000568685.1_Silent_p.G223G|FUS_ENST00000380244.3_Silent_p.G222G	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	FUS RNA binding protein	223	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		FUS/ERG(167)|FUS/DDIT3(631)|FUS/FEV(2)|FUS/ATF1(4)|FUS/CREB3L1(6)|FUS/CREB3L2(158)	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		gcagtggtggcggcggcggcg	0.677			T	"""DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1"""	"""liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma"""																																p.G223G		.		Dom	yes		16	16p11.2	2521	"""fusion, derived from t(12;16) malignant liposarcoma"""		"""M, L"""	.	FUS-1719	0			c.C669T						.																																			SO:0001819	synonymous_variant	2521	exon6			TGGTGGCGGCGGC	AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280		"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6		2372777, 7503811, 19251628, 19251627	Standard	NM_004960		Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	ENST00000254108.7:c.669C>T	16.37:g.31196405C>T		15	0		67	5	NM_004960	0	0	10	10	0	Q9H4A8	Silent	SNP	ENST00000254108.7	37	CCDS10707.1																																																																																			.		0.677	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255526.2	NM_004960	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		6	6	NM_033212	0	0	0	1	1	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		12	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ALOX12	239	broad.mit.edu	37	17	6903656	6903656	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr17:6903656A>G	ENST00000251535.6	+	7	862	c.809A>G	c.(808-810)aAt>aGt	p.N270S	AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000574377.1_Intron|RP11-589P10.7_ENST00000572547.1_RNA	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	270	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						TGTCCCCAGAATGGTTCCCTG	0.517																																					p.N270S		.											.	ALOX12-226	0			c.A809G						.						151.0	144.0	146.0					17																	6903656		2203	4300	6503	SO:0001630	splice_region_variant	239	exon7			CCCAGAATGGTTC	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.808-1A>G	17.37:g.6903656A>G		103	0		89	5	NM_000697	0	0	0	0	0	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	ENST00000251535.6	37	CCDS11084.1	.	.	.	.	.	.	.	.	.	.	a	6.526	0.465359	0.12402	.	.	ENSG00000108839	ENST00000251535	T	0.06528	3.29	4.87	3.79	0.43588	Lipoxygenase, C-terminal (3);	1.022680	0.07747	N	0.947942	T	0.06735	0.0172	L	0.31578	0.945	0.23555	N	0.997429	B	0.20368	0.044	B	0.25987	0.065	T	0.44298	-0.9337	10	0.27082	T	0.32	-5.4415	8.9973	0.36061	0.9111:0.0:0.0889:0.0	.	270	P18054	LOX12_HUMAN	S	270	ENSP00000251535:N270S	ENSP00000251535:N270S	N	+	2	0	ALOX12	6844380	1.000000	0.71417	0.737000	0.30932	0.652000	0.38707	5.318000	0.65829	0.985000	0.38656	0.444000	0.29173	AAT	.		0.517	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219922.2		Missense_Mutation
DVL2	1856	ucsc.edu;bcgsc.ca	37	17	7129840	7129840	+	Silent	SNP	T	T	C	rs35594616	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr17:7129840T>C	ENST00000005340.5	-	14	1944	c.1662A>G	c.(1660-1662)caA>caG	p.Q554Q	DVL2_ENST00000574642.1_5'Flank|DVL2_ENST00000575458.1_Silent_p.Q548Q	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	554					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						GGGCAGGGTATTGGTAGGAGA	0.617													T|||	2602	0.519569	0.416	0.4957	5008	,	,		15735	0.4732		0.6233	False		,,,				2504	0.6176				p.Q554Q		.											.	DVL2-659	0			c.A1662G						.	T		1944,2462	545.8+/-376.9	413,1118,672	51.0	55.0	54.0		1662	-2.7	0.9	17	dbSNP_126	54	5380,3220	646.5+/-400.3	1695,1990,615	no	coding-synonymous	DVL2	NM_004422.2		2108,3108,1287	CC,CT,TT		37.4419,44.1217,43.6875		554/737	7129840	7324,5682	2203	4300	6503	SO:0001819	synonymous_variant	1856	exon14			AGGGTATTGGTAG	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1662A>G	17.37:g.7129840T>C		41	0		30	4	NM_004422	0	0	8	8	0	D3DTN3|Q53XM0	Silent	SNP	ENST00000005340.5	37	CCDS11091.1																																																																																			T|0.450;C|0.550		0.617	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
NF1	4763	hgsc.bcm.edu	37	17	29676201	29676202	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr17:29676201_29676202delCT	ENST00000358273.4	+	49	7636_7637	c.7253_7254delCT	c.(7252-7254)actfs	p.T2418fs	NF1_ENST00000417592.2_Frame_Shift_Del_p.T131fs|NF1_ENST00000356175.3_Frame_Shift_Del_p.T2397fs|NF1_ENST00000444181.2_Frame_Shift_Del_p.T211fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2418					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACACTACTAACTCTGGTTAACA	0.342			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																											p.2418_2418del		.	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	.	NF1-3353	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	c.7253_7254del						.																																			SO:0001589	frameshift_variant	4763	exon49	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	TACTAACTCTGGT		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7253_7254delCT	17.37:g.29676203_29676204delCT	ENSP00000351015:p.Thr2418fs	76	2		43	24	NM_001042492	0	0	0	0	0	O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Del	DEL	ENST00000358273.4	37	CCDS42292.1																																																																																			.		0.342	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256351.2	NM_000267	
EPX	8288	broad.mit.edu	37	17	56274588	56274588	+	Missense_Mutation	SNP	C	C	T	rs573827983	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr17:56274588C>T	ENST00000225371.5	+	7	1200	c.1090C>T	c.(1090-1092)Cgc>Tgc	p.R364C		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	364			R -> H (in dbSNP:rs35232062). {ECO:0000269|Ref.2}.		defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.R364C(1)		breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	CCTCACCAACCGCTCGGCGCG	0.632																																					p.R364C		.											.	EPX-92	1	Substitution - Missense(1)	large_intestine(1)	c.C1090T						.						64.0	65.0	65.0					17																	56274588		2203	4300	6503	SO:0001583	missense	8288	exon7			ACCAACCGCTCGG	M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1090C>T	17.37:g.56274588C>T	ENSP00000225371:p.Arg364Cys	49	1		40	3	NM_000502	0	0	0	0	0	Q4TVP3	Missense_Mutation	SNP	ENST00000225371.5	37	CCDS11602.1	.	.	.	.	.	.	.	.	.	.	C	18.10	3.547976	0.65311	.	.	ENSG00000121053	ENST00000225371	T	0.73469	-0.75	4.86	4.86	0.63082	.	0.210370	0.41823	D	0.000814	D	0.83599	0.5289	M	0.78456	2.415	0.45995	D	0.9988	D	0.89917	1.0	D	0.64776	0.929	D	0.85005	0.0902	10	0.62326	D	0.03	-10.3123	11.0265	0.47748	0.186:0.814:0.0:0.0	.	364	P11678	PERE_HUMAN	C	364	ENSP00000225371:R364C	ENSP00000225371:R364C	R	+	1	0	EPX	53629587	0.001000	0.12720	0.980000	0.43619	0.944000	0.59088	0.470000	0.22084	2.408000	0.81797	0.462000	0.41574	CGC	.		0.632	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502	
RAX	30062	hgsc.bcm.edu	37	18	56936395	56936395	+	Silent	SNP	T	T	C	rs7226481	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr18:56936395T>C	ENST00000334889.3	-	3	1068	c.882A>G	c.(880-882)caA>caG	p.Q294Q	RAX_ENST00000256852.7_3'UTR	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	294					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GCGCGAGAGGTTGCAGGCCGG	0.771													C|||	1143	0.228235	0.2421	0.1671	5008	,	,		8659	0.129		0.3032	False		,,,				2504	0.2781				p.Q294Q	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.A882G						.	C		688,3078		75,538,1270	4.0	6.0	5.0		882	2.2	0.3	18	dbSNP_116	5	1688,5834		233,1222,2306	no	coding-synonymous	RAX	NM_013435.2		308,1760,3576	CC,CT,TT		22.4408,18.2687,21.0489		294/347	56936395	2376,8912	1883	3761	5644	SO:0001819	synonymous_variant	30062	exon3			GAGAGGTTGCAGG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.882A>G	18.37:g.56936395T>C		1	0		8	7	NM_013435	0	0	0	0	0	Q86V11	Silent	SNP	ENST00000334889.3	37	CCDS11972.1																																																																																			T|0.767;C|0.233		0.771	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
GRIN3B	116444	hgsc.bcm.edu	37	19	1003292	1003292	+	Missense_Mutation	SNP	G	G	A	rs149087926	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr19:1003292G>A	ENST00000234389.3	+	2	609	c.590G>A	c.(589-591)cGg>cAg	p.R197Q	AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	197					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGGGCTGGCCGGCCCCCACAG	0.746													g|||	7	0.00139776	0.0	0.0	5008	,	,		12044	0.0		0.007	False		,,,				2504	0.0				p.R197Q		.											.	GRIN3B-90	0			c.G590A						.	G	GLN/ARG	7,3903		0,7,1948	4.0	6.0	6.0		590	-0.5	0.6	19	dbSNP_134	6	22,7878		0,22,3928	no	missense	GRIN3B	NM_138690.1	43	0,29,5876	AA,AG,GG		0.2785,0.179,0.2456	benign	197/1044	1003292	29,11781	1955	3950	5905	SO:0001583	missense	116444	exon2			CTGGCCGGCCCCC		CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.590G>A	19.37:g.1003292G>A	ENSP00000234389:p.Arg197Gln	0	0		22	7	NM_138690	0	0	0	0	0	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	ENST00000234389.3	37	CCDS32861.1	6	0.0027472527472527475	0	0.0	2	0.0055248618784530384	0	0.0	4	0.005277044854881266	g	6.773	0.511513	0.12944	0.00179	0.002785	ENSG00000116032	ENST00000234389	T	0.10477	2.87	4.16	-0.518	0.11943	.	3.857410	0.01315	N	0.010758	T	0.04998	0.0134	N	0.19112	0.55	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.31998	-0.9923	10	0.40728	T	0.16	.	3.3735	0.07229	0.3322:0.0:0.3072:0.3607	.	197	O60391	NMD3B_HUMAN	Q	197	ENSP00000234389:R197Q	ENSP00000234389:R197Q	R	+	2	0	GRIN3B	954292	0.629000	0.27146	0.599000	0.28851	0.127000	0.20565	1.991000	0.40727	0.040000	0.15660	-0.274000	0.10170	CGG	G|0.997;A|0.003		0.746	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103923.2		
ZNRF4	148066	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	5456615	5456615	+	Silent	SNP	C	C	T	rs374460618		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr19:5456615C>T	ENST00000222033.4	+	1	1190	c.1113C>T	c.(1111-1113)gaC>gaT	p.D371D		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	371						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)	p.D371D(1)		NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		GCTTCAGGGACGAGGACCCCT	0.682																																					p.D371D		.											.	ZNRF4-135	1	Substitution - coding silent(1)	kidney(1)	c.C1113T						.	C		1,3993		0,1,1996	62.0	71.0	68.0		1113	-8.4	0.0	19		68	0,8334		0,0,4167	no	coding-synonymous	ZNRF4	NM_181710.3		0,1,6163	TT,TC,CC		0.0,0.025,0.0081		371/430	5456615	1,12327	1997	4167	6164	SO:0001819	synonymous_variant	148066	exon1			CAGGGACGAGGAC	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.1113C>T	19.37:g.5456615C>T		53	0		64	4	NM_181710	0	0	0	0	0	A8K886|O75866	Silent	SNP	ENST00000222033.4	37	CCDS42475.1																																																																																			.		0.682	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	NM_181710	
MUC16	94025	bcgsc.ca	37	19	9068397	9068397	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr19:9068397G>T	ENST00000397910.4	-	3	19252	c.19049C>A	c.(19048-19050)tCc>tAc	p.S6350Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6352	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CATCGCAGAGGATCTAGGCAT	0.458																																					p.S6350Y		.											.	MUC16-566	0			c.C19049A						.						98.0	90.0	93.0					19																	9068397		1921	4133	6054	SO:0001583	missense	94025	exon3			GCAGAGGATCTAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.19049C>A	19.37:g.9068397G>T	ENSP00000381008:p.Ser6350Tyr	52	0		54	4	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	3.534	-0.095045	0.07010	.	.	ENSG00000181143	ENST00000397910	T	0.25749	1.78	2.4	-0.15	0.13416	.	.	.	.	.	T	0.29126	0.0724	L	0.36672	1.1	.	.	.	D	0.62365	0.991	P	0.59288	0.855	T	0.35400	-0.9790	8	0.87932	D	0	.	4.3329	0.11073	0.4761:0.0:0.5239:0.0	.	6350	B5ME49	.	Y	6350	ENSP00000381008:S6350Y	ENSP00000381008:S6350Y	S	-	2	0	MUC16	8929397	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.587000	0.05780	0.017000	0.15025	0.187000	0.17357	TCC	.		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	bcgsc.ca	37	19	9075737	9075737	+	Silent	SNP	T	T	C	rs2547071	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr19:9075737T>C	ENST00000397910.4	-	3	11912	c.11709A>G	c.(11707-11709)gtA>gtG	p.V3903V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3904	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGTCCTTAATACACTGGAGG	0.453													T|||	2284	0.45607	0.4652	0.4265	5008	,	,		21982	0.5169		0.4314	False		,,,				2504	0.4274				p.V3903V		.											.	MUC16-566	0			c.A11709G						.	T		1783,2059		422,939,560	87.0	79.0	82.0		11709	1.6	0.0	19	dbSNP_100	82	3400,4868		696,2008,1430	no	coding-synonymous	MUC16	NM_024690.2		1118,2947,1990	CC,CT,TT		41.1224,46.4081,42.7993		3903/14508	9075737	5183,6927	1921	4134	6055	SO:0001819	synonymous_variant	94025	exon3			CCTTAATACACTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11709A>G	19.37:g.9075737T>C		101	0		74	4	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	37	CCDS54212.1																																																																																			T|0.561;C|0.439		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
RGS9BP	388531	hgsc.bcm.edu	37	19	33167455	33167455	+	Missense_Mutation	SNP	G	G	T	rs259290	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr19:33167455G>T	ENST00000334176.3	+	1	1143	c.286G>T	c.(286-288)Gcg>Tcg	p.A96S	ANKRD27_ENST00000587352.1_5'Flank|ANKRD27_ENST00000306065.4_5'Flank	NM_207391.2	NP_997274.2	Q6ZS82	R9BP_HUMAN	regulator of G protein signaling 9 binding protein	96			A -> S (in dbSNP:rs259290). {ECO:0000269|PubMed:14702039}.		detection of light stimulus involved in visual perception (GO:0050908)|negative regulation of signal transduction (GO:0009968)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	integral component of membrane (GO:0016021)				central_nervous_system(1)|lung(2)	3	Esophageal squamous(110;0.137)					CATGCGACGCGCGCTGGAGCT	0.786													G|||	2178	0.434904	0.3805	0.4856	5008	,	,		10415	0.2579		0.6233	False		,,,				2504	0.4611				p.A96S		.											.	RGS9BP-90	0			c.G286T						.	G	SER/ALA	1584,1384		459,666,359	2.0	2.0	2.0		286	3.5	1.0	19	dbSNP_79	2	4397,1763		1670,1057,353	yes	missense	RGS9BP	NM_207391.2	99	2129,1723,712	TT,TG,GG		28.6201,46.6307,34.4763	possibly-damaging	96/236	33167455	5981,3147	1484	3080	4564	SO:0001583	missense	388531	exon1			CGACGCGCGCTGG	AW302149	CCDS12424.1	19q13.11	2008-02-05	2007-08-14			ENSG00000186326			30304	protein-coding gene	gene with protein product		607814	"""regulator of G protein signalling 9 binding protein"""			12119397, 8889548	Standard	NM_207391		Approved	FLJ45744, PERRS, R9AP, RGS9	uc002ntp.1	Q6ZS82		ENST00000334176.3:c.286G>T	19.37:g.33167455G>T	ENSP00000334134:p.Ala96Ser	0	0		4	4	NM_207391	0	0	0	0	0	Q6ZVJ6	Missense_Mutation	SNP	ENST00000334176.3	37	CCDS12424.1	1007	0.4610805860805861	184	0.37398373983739835	188	0.5193370165745856	161	0.28146853146853146	474	0.6253298153034301	G	15.38	2.815844	0.50527	0.533693	0.713799	ENSG00000186326	ENST00000334176	T	0.33654	1.4	4.57	3.5	0.40072	.	0.065802	0.64402	U	0.000009	T	0.00012	0.0000	L	0.28115	0.83	0.20873	P	0.999831543	P	0.52170	0.951	P	0.50352	0.638	T	0.12528	-1.0544	9	0.35671	T	0.21	-21.6697	13.7833	0.63094	0.0:0.0:0.8453:0.1547	rs259290	96	Q6ZS82	R9BP_HUMAN	S	96	ENSP00000334134:A96S	ENSP00000334134:A96S	A	+	1	0	RGS9BP	37859295	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	4.816000	0.62642	1.092000	0.41356	0.313000	0.20887	GCG	G|0.540;T|0.460		0.786	RGS9BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450337.1	NM_207391	
GEMIN7	79760	broad.mit.edu	37	19	45593754	45593754	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr19:45593754A>C	ENST00000270257.4	+	3	629	c.382A>C	c.(382-384)Acc>Ccc	p.T128P	GEMIN7_ENST00000591607.1_Missense_Mutation_p.T128P|GEMIN7_ENST00000591747.1_Missense_Mutation_p.T128P|CTB-179K24.3_ENST00000586556.1_RNA|PPP1R37_ENST00000421905.1_5'Flank|CTB-179K24.3_ENST00000586744.1_RNA|PPP1R37_ENST00000221462.4_5'Flank|GEMIN7_ENST00000391951.2_Missense_Mutation_p.T128P	NM_001007269.1|NM_001007270.1|NM_024707.2	NP_001007270.1|NP_001007271.1|NP_078983.1	Q9H840	GEMI7_HUMAN	gem (nuclear organelle) associated protein 7	128					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				endometrium(1)|kidney(1)|lung(4)|ovary(1)	7		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0131)		TATTTCATATACCTTCAAGCC	0.517																																					p.T128P		.											.	GEMIN7-91	0			c.A382C						.						38.0	42.0	41.0					19																	45593754		2200	4289	6489	SO:0001583	missense	79760	exon3			TCATATACCTTCA	AK024018	CCDS12654.1	19q13.32	2008-02-05				ENSG00000142252			20045	protein-coding gene	gene with protein product		607419				12065586	Standard	NM_024707		Approved	FLJ13956	uc002pap.1	Q9H840		ENST00000270257.4:c.382A>C	19.37:g.45593754A>C	ENSP00000270257:p.Thr128Pro	124	21		122	29	NM_024707	0	0	10	10	0	Q6IA34	Missense_Mutation	SNP	ENST00000270257.4	37	CCDS12654.1	.	.	.	.	.	.	.	.	.	.	A	11.53	1.666389	0.29604	.	.	ENSG00000142252	ENST00000270257;ENST00000391951	.	.	.	4.99	2.74	0.32292	.	0.192590	0.45126	D	0.000387	T	0.50684	0.1630	L	0.38175	1.15	0.80722	D	1	D	0.53151	0.958	P	0.54210	0.745	T	0.50285	-0.8846	9	0.72032	D	0.01	-13.1048	7.7097	0.28671	0.4236:0.0:0.0:0.5764	.	128	Q9H840	GEMI7_HUMAN	P	128	.	ENSP00000270257:T128P	T	+	1	0	GEMIN7	50285594	1.000000	0.71417	0.700000	0.30305	0.315000	0.28087	1.710000	0.37920	0.710000	0.31997	0.454000	0.30748	ACC	.		0.517	GEMIN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457533.1		
RUVBL2	10856	bcgsc.ca	37	19	49513273	49513273	+	Silent	SNP	C	C	T	rs1062708	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr19:49513273C>T	ENST00000595090.1	+	8	1077	c.613C>T	c.(613-615)Ctg>Ttg	p.L205L	RUVBL2_ENST00000413176.2_Silent_p.L160L|RUVBL2_ENST00000601968.1_Silent_p.L160L	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	205					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		GATCTCCAAGCTGGGCCGCTC	0.662													C|||	1950	0.389377	0.2027	0.4798	5008	,	,		18420	0.3899		0.503	False		,,,				2504	0.4601				p.L205L		.											.	RUVBL2-227	0			c.C613T						.	C		910,3158		113,684,1237	60.0	62.0	62.0		613	3.0	1.0	19	dbSNP_86	62	3994,4320		968,2058,1131	no	coding-synonymous	RUVBL2	NM_006666.1		1081,2742,2368	TT,TC,CC		48.0395,22.3697,39.6059		205/464	49513273	4904,7478	2034	4157	6191	SO:0001819	synonymous_variant	10856	exon8			TCCAAGCTGGGCC	AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.613C>T	19.37:g.49513273C>T		145	0		144	7	NM_006666	0	0	35	35	0	B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Silent	SNP	ENST00000595090.1	37	CCDS42588.1																																																																																			C|0.579;T|0.421		0.662	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466235.1		
FEZ2	9637	hgsc.bcm.edu	37	2	36825137	36825137	+	Missense_Mutation	SNP	G	G	A	rs1544655	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr2:36825137G>A	ENST00000405912.3	-	1	148	c.149C>T	c.(148-150)cCg>cTg	p.P50L	FEZ2_ENST00000379245.4_Missense_Mutation_p.P50L	NM_005102.2	NP_005093.2	Q9UHY8	FEZ2_HUMAN	fasciculation and elongation protein zeta 2 (zygin II)	50			P -> L (in dbSNP:rs1544655). {ECO:0000269|PubMed:10931946}.		axon guidance (GO:0007411)|nervous system development (GO:0007399)|signal transduction (GO:0007165)					breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	7		all_hematologic(82;0.21)				GCTGCAGGCCGGGGCCGGGAA	0.761													A|||	4355	0.869609	0.9039	0.8372	5008	,	,		3879	0.9881		0.7435	False		,,,				2504	0.8538				p.P50L		.											.	FEZ2-23	0			c.C149T						.						2.0	3.0	3.0					2																	36825137		1191	2916	4107	SO:0001583	missense	9637	exon1			CAGGCCGGGGCCG	U60061	CCDS46257.1, CCDS46258.1	2p21	2008-05-15			ENSG00000171055	ENSG00000171055			3660	protein-coding gene	gene with protein product		604826				9096408	Standard	NM_005102		Approved		uc002rpg.2	Q9UHY8	OTTHUMG00000152148	ENST00000405912.3:c.149C>T	2.37:g.36825137G>A	ENSP00000385112:p.Pro50Leu	0	0		6	6	NM_001042548	0	0	0	2	2	Q5EBN3|Q76LN0|Q99690	Missense_Mutation	SNP	ENST00000405912.3	37	CCDS46257.1	1789	0.8191391941391941	416	0.8455284552845529	284	0.7845303867403315	557	0.9737762237762237	532	0.7018469656992085	A	9.679	1.148856	0.21288	.	.	ENSG00000171055	ENST00000379245;ENST00000405912	T;T	0.16897	2.31;2.31	3.93	3.93	0.45458	.	0.000000	0.64402	N	0.000005	T	0.00012	0.0000	N	0.00121	-2.07	0.09310	P	0.9999999999999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32025	-0.9922	9	0.02654	T	1	-21.1042	7.5473	0.27775	0.8952:0.0:0.1048:0.0	rs1544655	50;50;50	G3V0F5;Q9UHY8;Q9UHY8-2	.;FEZ2_HUMAN;.	L	50	ENSP00000368547:P50L;ENSP00000385112:P50L	ENSP00000368547:P50L	P	-	2	0	FEZ2	36678641	1.000000	0.71417	0.997000	0.53966	0.540000	0.34992	0.606000	0.24194	0.590000	0.29694	-0.775000	0.03384	CCG	T|0.817;C|0.180		0.761	FEZ2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325432.1		
USP34	9736	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	61463189	61463189	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr2:61463189A>C	ENST00000398571.2	-	56	7014	c.6938T>G	c.(6937-6939)cTa>cGa	p.L2313R		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	2313					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			AAATGTCTCTAGGACAAAGGA	0.244																																					p.L2313R		.											.	USP34-579	0			c.T6938G						.						48.0	45.0	46.0					2																	61463189		1796	4059	5855	SO:0001583	missense	9736	exon56			GTCTCTAGGACAA	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.6938T>G	2.37:g.61463189A>C	ENSP00000381577:p.Leu2313Arg	37	0		58	23	NM_014709	0	0	2	2	0	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.561757	0.65538	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.04809	3.69;3.55	5.96	5.96	0.96718	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.14960	0.0361	L	0.50333	1.59	0.58432	D	0.999998	D	0.60575	0.988	D	0.70935	0.971	T	0.00235	-1.1892	10	0.87932	D	0	.	10.7328	0.46107	0.9296:0.0:0.0704:0.0	.	2313	Q70CQ2	UBP34_HUMAN	R	2161;2161;2313;591	ENSP00000381577:L2313R;ENSP00000410559:L591R	ENSP00000263989:L2161R	L	-	2	0	USP34	61316693	1.000000	0.71417	0.996000	0.52242	0.712000	0.41017	6.361000	0.73070	2.285000	0.76669	0.533000	0.62120	CTA	.		0.244	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
PRR21	643905	hgsc.bcm.edu	37	2	240982362	240982362	+	Missense_Mutation	SNP	G	G	A	rs532390647|rs151246209	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr2:240982362G>A	ENST00000408934.1	-	1	37	c.38C>T	c.(37-39)cCc>cTc	p.P13L		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	13								p.P13L(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGGATGAAGGGCCGTGGATG	0.567																																					p.P13L		.											.	PRR21-70	2	Substitution - Missense(2)	lung(2)	c.C38T						.						88.0	75.0	80.0					2																	240982362		2196	4292	6488	SO:0001583	missense	643905	exon1			ATGAAGGGCCGTG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.38C>T	2.37:g.240982362G>A	ENSP00000386166:p.Pro13Leu	113	0		107	9	NM_001080835	0	0	0	0	0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	22	0.010073260073260074	1	0.0020325203252032522	1	0.0027624309392265192	2	0.0034965034965034965	18	0.023746701846965697	g	0.006	-2.070625	0.00379	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.41065	1.01;1.01	0.483	-0.803	0.10886	.	.	.	.	.	T	0.07052	0.0179	N	0.08118	0	0.09310	N	1	B	0.30068	0.267	B	0.18561	0.022	T	0.18555	-1.0333	9	0.07175	T	0.84	.	4.4839	0.11780	0.3665:0.0:0.6335:0.0	.	13	Q8WXC7	PRR21_HUMAN	L	13	ENSP00000386166:P13L;ENSP00000418240:P13L	ENSP00000386166:P13L	P	-	2	0	PRR21	240631035	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.182000	0.09726	-0.423000	0.07394	-0.438000	0.05819	CCC	G|0.991;A|0.009		0.567	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
PRR21	643905	hgsc.bcm.edu;ucsc.edu	37	2	240982379	240982379	+	Silent	SNP	T	T	C	rs138056768		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr2:240982379T>C	ENST00000408934.1	-	1	20	c.21A>G	c.(19-21)acA>acG	p.T7T		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	7										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GATGAAGAGCTGTGGATGAAC	0.572																																					p.T7T		.											.	PRR21-70	0			c.A21G						.						78.0	66.0	70.0					2																	240982379		2185	4279	6464	SO:0001819	synonymous_variant	643905	exon1			AAGAGCTGTGGAT	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.21A>G	2.37:g.240982379T>C		90	0		92	12	NM_001080835	0	0	0	0	0		Silent	SNP	ENST00000408934.1	37	CCDS33417.1																																																																																			T|0.989;C|0.011		0.572	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
PRR21	643905	hgsc.bcm.edu	37	2	240982389	240982389	+	Missense_Mutation	SNP	C	C	G	rs143417758		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr2:240982389C>G	ENST00000408934.1	-	1	10	c.11G>C	c.(10-12)tGt>tCt	p.C4S		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	4										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						TGTGGATGAACAGGCATGCAT	0.567																																					p.C4S		.											.	PRR21-70	0			c.G11C						.						73.0	62.0	65.0					2																	240982389		2172	4269	6441	SO:0001583	missense	643905	exon1			GATGAACAGGCAT	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.11G>C	2.37:g.240982389C>G	ENSP00000386166:p.Cys4Ser	88	0		86	5	NM_001080835	0	0	0	0	0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	c	5.954	0.359922	0.11296	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.37752	1.18;1.18	0.149	0.149	0.14863	.	.	.	.	.	T	0.18173	0.0436	N	0.08118	0	0.19945	N	0.999941	P	0.37500	0.597	B	0.39119	0.291	T	0.15435	-1.0437	8	0.42905	T	0.14	.	.	.	.	.	4	Q8WXC7	PRR21_HUMAN	S	4	ENSP00000386166:C4S;ENSP00000418240:C4S	ENSP00000386166:C4S	C	-	2	0	PRR21	240631062	0.000000	0.05858	0.009000	0.14445	0.017000	0.09413	-0.776000	0.04674	0.192000	0.20272	0.195000	0.17529	TGT	C|0.998;G|0.002		0.567	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
FRG1B	284802	bcgsc.ca	37	20	29623219	29623219	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr20:29623219A>G	ENST00000278882.3	+	3	411	c.31A>G	c.(31-33)Atg>Gtg	p.M11V	FRG1B_ENST00000439954.2_Missense_Mutation_p.N12S|FRG1B_ENST00000358464.4_Missense_Mutation_p.M11V			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	11										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCACTCGACAATGGTCTTTTT	0.413																																					.		.											.	FRG1B-22	0			.						.																																			SO:0001583	missense	284802	.			TCGACAATGGTCT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.31A>G	20.37:g.29623219A>G	ENSP00000278882:p.Met11Val	549	8		672	18	.	0	0	29	29	0	C4AME5	RNA	SNP	ENST00000278882.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	0.925|0.925	-0.714671|-0.714671	0.03206|0.03206	.|.	.|.	ENSG00000149531|ENSG00000149531	ENST00000278882;ENST00000358464|ENST00000439954	.|T	.|0.53206	.|0.63	1.93|1.93	1.93|1.93	0.25924|0.25924	.|.	0.114289|.	0.56097|.	U|.	0.000024|.	T|T	0.42040|0.42040	0.1185|0.1185	.|.	.|.	.|.	0.18873|0.18873	N|N	0.999983|0.999983	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.36648|0.36648	-0.9739|-0.9739	6|6	0.66056|0.54805	D|T	0.02|0.06	.|.	4.9441|4.9441	0.13980|0.13980	0.6812:0.3188:0.0:0.0|0.6812:0.3188:0.0:0.0	.|.	.|.	.|.	.|.	V|S	11|12	.|ENSP00000408863:N12S	ENSP00000278882:M11V|ENSP00000408863:N12S	M|N	+|+	1|2	0|0	FRG1B|FRG1B	28236880|28236880	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.107000|0.107000	0.19398|0.19398	3.154000|3.154000	0.50693|0.50693	1.147000|1.147000	0.42369|0.42369	0.347000|0.347000	0.21830|0.21830	ATG|AAT	.		0.413	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
BCL2L1	598	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	30309831	30309831	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr20:30309831G>A	ENST00000307677.4	-	2	601	c.191C>T	c.(190-192)gCg>gTg	p.A64V	BCL2L1_ENST00000376062.2_Missense_Mutation_p.A64V|BCL2L1_ENST00000376055.4_Missense_Mutation_p.A64V|BCL2L1_ENST00000420653.1_Missense_Mutation_p.A64V	NM_138578.1	NP_612815.1	Q07817	B2CL1_HUMAN	BCL2-like 1	64					apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|apoptotic process in bone marrow (GO:0071839)|cell proliferation (GO:0008283)|cellular process regulating host cell cycle in response to virus (GO:0060154)|cellular response to alkaloid (GO:0071312)|cellular response to amino acid stimulus (GO:0071230)|cellular response to gamma radiation (GO:0071480)|cytokinesis (GO:0000910)|endocytosis (GO:0006897)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fertilization (GO:0009566)|germ cell development (GO:0007281)|growth (GO:0040007)|hepatocyte apoptotic process (GO:0097284)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male gonad development (GO:0008584)|mitochondrion morphogenesis (GO:0070584)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|release of cytochrome c from mitochondria (GO:0001836)|response to cycloheximide (GO:0046898)|response to cytokine (GO:0034097)|spermatogenesis (GO:0007283)|suppression by virus of host apoptotic process (GO:0019050)	Bcl-2 family protein complex (GO:0097136)|cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synapse (GO:0045202)	BH3 domain binding (GO:0051434)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(4)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_cancers(5;3.47e-06)|all_epithelial(3;1.83e-06)|Lung NSC(7;2.08e-06)|all_lung(7;3.63e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;2.97e-06)|all cancers(5;3.21e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00052)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			TCCATTCACCGCGGGGCTGTC	0.612																																					p.A64V	Colon(51;693 1004 1401 20431 21026)	.											.	BCL2L1-1084	0			c.C191T						.						59.0	60.0	59.0					20																	30309831		2203	4300	6503	SO:0001583	missense	598	exon2			TTCACCGCGGGGC	Z23115	CCDS13188.1, CCDS13189.1	20q11.21	2014-03-07			ENSG00000171552	ENSG00000171552		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	992	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 52"""	600039				8358789	Standard	NM_001191		Approved	BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, PPP1R52	uc002wwl.3	Q07817	OTTHUMG00000032192	ENST00000307677.4:c.191C>T	20.37:g.30309831G>A	ENSP00000302564:p.Ala64Val	70	0		95	38	NM_138578	0	0	1	3	2	E1P5L6|Q5CZ89|Q5TE65|Q92976	Missense_Mutation	SNP	ENST00000307677.4	37	CCDS13189.1	.	.	.	.	.	.	.	.	.	.	G	7.152	0.583867	0.13749	.	.	ENSG00000171552	ENST00000376062;ENST00000376055;ENST00000307677;ENST00000420653;ENST00000450273;ENST00000420488;ENST00000456404;ENST00000422920;ENST00000439267	T;T;T;T;T;T;T;T;T	0.03860	3.78;3.78;3.78;3.78;3.78;3.78;3.78;3.78;3.78	5.64	4.7	0.59300	.	0.591988	0.18962	N	0.126369	T	0.02119	0.0066	N	0.04508	-0.205	0.09310	N	1	B;B	0.28291	0.206;0.001	B;B	0.06405	0.002;0.0	T	0.47275	-0.9130	10	0.20046	T	0.44	-1.8703	8.1047	0.30879	0.1801:0.0:0.8199:0.0	.	64;64	Q5TE63;Q07817	.;B2CL1_HUMAN	V	64	ENSP00000365230:A64V;ENSP00000365223:A64V;ENSP00000302564:A64V;ENSP00000405563:A64V;ENSP00000406203:A64V;ENSP00000390760:A64V;ENSP00000395545:A64V;ENSP00000411252:A64V;ENSP00000389688:A64V	ENSP00000302564:A64V	A	-	2	0	BCL2L1	29773492	0.837000	0.29446	0.045000	0.18777	0.585000	0.36419	4.197000	0.58413	1.629000	0.50426	-0.143000	0.13931	GCG	.		0.612	BCL2L1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078575.1	NM_138578	
BAGE2	85319	bcgsc.ca	37	21	11058322	11058322	+	RNA	SNP	C	C	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr21:11058322C>T	ENST00000470054.1	-	0	325							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAATGCACATCGCTGAAAGGG	0.383																																					p.D40N		.											.	.	0			c.G118A						.						92.0	70.0	77.0					21																	11058322		692	1591	2283			85319	exon3			GCACATCGCTGAA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058322C>T		250	4		235	14	NM_182482	0	0	0	0	0	A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	37																																																																																				C|0.750;T|0.250		0.383	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
TMPRSS2	7113	bcgsc.ca	37	21	42845383	42845383	+	Silent	SNP	A	A	G	rs17854725	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr21:42845383A>G	ENST00000332149.5	-	9	902	c.768T>C	c.(766-768)atT>atC	p.I256I	TMPRSS2_ENST00000398585.3_Silent_p.I293I|TMPRSS2_ENST00000458356.1_Silent_p.I256I	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2	256	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.	Cleavage. {ECO:0000255}.			positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)		TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				CGCCGCCCACAATCCTGCTCT	0.667			T	"""ERG, ETV1, ETV4, ETV5"""	prostate								G|||	1834	0.366214	0.3389	0.4107	5008	,	,		14991	0.121		0.5417	False		,,,				2504	0.4438				p.I293I		.		Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	.	TMPRSS2-5208	0			c.T879C						.	G	,	1714,2650		339,1036,807	21.0	20.0	21.0		879,768	-5.5	0.7	21	dbSNP_123	21	4660,3900		1312,2036,932	no	coding-synonymous,coding-synonymous	TMPRSS2	NM_001135099.1,NM_005656.3	,	1651,3072,1739	GG,GA,AA		45.5607,39.2759,49.3191	,	293/530,256/493	42845383	6374,6550	2182	4280	6462	SO:0001819	synonymous_variant	7113	exon9			GCCCACAATCCTG	U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.768T>C	21.37:g.42845383A>G		107	0		245	8	NM_001135099	0	0	0	0	0	A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Silent	SNP	ENST00000332149.5	37	CCDS33564.1																																																																																			A|0.555;G|0.445		0.667	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195189.1		
KRTAP10-1	386677	bcgsc.ca	37	21	45959559	45959559	+	Missense_Mutation	SNP	C	C	A	rs34549147|rs62218859	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr21:45959559C>A	ENST00000400375.1	-	1	519	c.475G>T	c.(475-477)Gat>Tat	p.D159Y	TSPEAR_ENST00000397916.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198691.2	NP_941964.2	P60331	KR101_HUMAN	keratin associated protein 10-1	159	24 X 5 AA repeats of C-C-X(3).			D -> S (in Ref. 1; BAD01534 and 3; AAI20960/AAI20961). {ECO:0000305}.		keratin filament (GO:0045095)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(3)|prostate(4)|skin(1)	11						GAAGAGGAATCCTCAGAGCAG	0.612													C|||	3015	0.602037	0.6952	0.5908	5008	,	,		18587	0.4921		0.6382	False		,,,				2504	0.5603				p.D159Y		.											.	KRTAP10-1-91	0			c.G475T						.	C	TYR/ASP,	1507,2899		570,367,1266	98.0	106.0	103.0		475,	-1.4	0.0	21	dbSNP_129	103	2707,5893		1014,679,2607	yes	missense,intron	TSPEAR,KRTAP10-1	NM_198691.2,NM_144991.2	160,	1584,1046,3873	AA,AC,CC		31.4767,34.2034,32.4004	possibly-damaging,	159/283,	45959559	4214,8792	2203	4300	6503	SO:0001583	missense	386677	exon1			AGGAATCCTCAGA	AJ566380	CCDS42954.1	21q22.3	2007-10-05			ENSG00000215455	ENSG00000215455		"""Keratin associated proteins"""	22966	protein-coding gene	gene with protein product				KRTAP18-1			Standard	NM_198691		Approved	KAP10.1, KAP18.1	uc002zfh.1	P60331	OTTHUMG00000057627	ENST00000400375.1:c.475G>T	21.37:g.45959559C>A	ENSP00000383226:p.Asp159Tyr	456	5		546	16	NM_198691	0	0	0	0	0	Q0VAR0|Q0VAR1	Missense_Mutation	SNP	ENST00000400375.1	37	CCDS42954.1	1116	0.510989010989011	269	0.5467479674796748	219	0.6049723756906077	248	0.43356643356643354	380	0.5013192612137203	c	0.004	-2.244596	0.00271	0.342034	0.314767	ENSG00000215455	ENST00000400375;ENST00000545982	T	0.00760	5.73	2.19	-1.37	0.09056	.	.	.	.	.	T	0.00012	0.0000	L	0.39898	1.24	0.80722	P	0.0	P	0.40970	0.734	B	0.36567	0.228	T	0.09314	-1.0680	8	0.59425	D	0.04	.	2.5578	0.04764	0.1804:0.5136:0.1743:0.1317	rs62218859	159	P60331	KR101_HUMAN	Y	159	ENSP00000383226:D159Y	ENSP00000383226:D159Y	D	-	1	0	KRTAP10-1	44783987	0.062000	0.20869	0.000000	0.03702	0.012000	0.07955	0.550000	0.23345	-1.167000	0.02779	-2.067000	0.00394	GAT	C|0.434;A|0.566		0.612	KRTAP10-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128030.1		
CCDC157	550631	bcgsc.ca	37	22	30767637	30767637	+	Splice_Site	SNP	A	A	G			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr22:30767637A>G	ENST00000405659.1	+	6	1754		c.e6-1		CCDC157_ENST00000338306.3_Splice_Site			Q569K6	CC157_HUMAN	coiled-coil domain containing 157											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						TGGCTGCCATAGAAACAAGTG	0.607																																					.		.											.	.	0			.						.						65.0	63.0	64.0					22																	30767637		2203	4300	6503	SO:0001630	splice_region_variant	0	.			TGCCATAGAAACA	BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.1046-1A>G	22.37:g.30767637A>G		39	0		46	4	.	0	0	0	0	0	Q0VD76|Q9BYA4	RNA	SNP	ENST00000405659.1	37	CCDS33632.2	.	.	.	.	.	.	.	.	.	.	A	8.080	0.772165	0.16051	.	.	ENSG00000187860	ENST00000405659;ENST00000338306	.	.	.	5.4	3.09	0.35607	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.9489	0.24534	0.7734:0.1485:0.0781:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC157	29097637	0.688000	0.27680	0.912000	0.35992	0.069000	0.16628	1.148000	0.31614	2.051000	0.60960	0.454000	0.30748	.	.		0.607	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320936.1	NM_001017437	Intron
SH3BP1	23616	bcgsc.ca	37	22	38046718	38046718	+	Silent	SNP	A	A	G	rs762987	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr22:38046718A>G	ENST00000357436.4	+	16	1897	c.1584A>G	c.(1582-1584)gcA>gcG	p.A528A	Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000599616.1_Silent_p.A464A	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	528					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					TGGCTTCAGCAGCTACCAAGG	0.642													G|||	778	0.155351	0.3759	0.0735	5008	,	,		15112	0.0149		0.0626	False		,,,				2504	0.1554				p.A528A		.											.	SH3BP1-90	0			c.A1584G						.	G		1518,2888		272,974,957	27.0	31.0	30.0		1584	-0.9	0.0	22	dbSNP_86	30	654,7946		29,596,3675	no	coding-synonymous	SH3BP1	NM_018957.3		301,1570,4632	GG,GA,AA		7.6047,34.453,16.7		528/702	38046718	2172,10834	2203	4300	6503	SO:0001819	synonymous_variant	23616	exon16			TTCAGCAGCTACC		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1584A>G	22.37:g.38046718A>G		98	0		122	5	NM_018957	0	0	0	0	0	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Silent	SNP	ENST00000357436.4	37	CCDS13952.2																																																																																			A|0.859;G|0.141		0.642	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	0	0		12	12	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
CDPF1	150383	ucsc.edu;bcgsc.ca	37	22	46644168	46644168	+	Missense_Mutation	SNP	A	A	G	rs9627281	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr22:46644168A>G	ENST00000314567.3	-	2	437	c.14T>C	c.(13-15)gTa>gCa	p.V5A	CDPF1_ENST00000475605.1_Intron|CDPF1_ENST00000404744.1_Missense_Mutation_p.V5A|CDPF1_ENST00000404583.1_Missense_Mutation_p.V5A	NM_207327.4	NP_997210.3	Q6NVV7	CDPF1_HUMAN	cysteine-rich, DPF motif domain containing 1	5			V -> A (in dbSNP:rs9627281).														ACGGCACTCTACATGGGACGC	0.547													G|||	1398	0.279153	0.7602	0.1686	5008	,	,		19465	0.001		0.1938	False		,,,				2504	0.0818				p.V5A		.											.	.	0			c.T14C						.	G	ALA/VAL	3035,1371	450.4+/-349.3	1051,933,219	73.0	56.0	62.0		14	0.4	0.0	22	dbSNP_119	62	1571,7029	742.3+/-407.2	135,1301,2864	yes	missense	C22orf40	NM_207327.4	64	1186,2234,3083	GG,GA,AA		18.2674,31.1167,35.4144	benign	5/124	46644168	4606,8400	2203	4300	6503	SO:0001583	missense	150383	exon2			CACTCTACATGGG		CCDS33670.1	22q13.31	2012-07-18	2012-07-18	2012-07-18	ENSG00000205643	ENSG00000205643			33710	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 40"""	C22orf40			Standard	NM_207327		Approved	LOC150383	uc003bhe.3	Q6NVV7	OTTHUMG00000030672	ENST00000314567.3:c.14T>C	22.37:g.46644168A>G	ENSP00000325301:p.Val5Ala	49	0		38	4	NM_207327	0	0	0	0	0	A6NCA1|A9IU12|A9IU16|Q3ZCR8	Missense_Mutation	SNP	ENST00000314567.3	37	CCDS33670.1	566	0.2591575091575092	358	0.7276422764227642	69	0.19060773480662985	0	0.0	139	0.18337730870712401	G	0.220	-1.029070	0.02045	0.688833	0.182674	ENSG00000205643	ENST00000404583;ENST00000314567;ENST00000404744	T;T;T	0.28895	1.69;1.72;1.59	5.02	0.371	0.16168	.	1.182090	0.06046	N	0.655683	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.43861	-0.9365	9	0.02654	T	1	.	1.6123	0.02696	0.1825:0.3076:0.3521:0.1578	rs9627281	5;5;5	Q6NVV7;F6RAJ7;F6UL18	CV040_HUMAN;.;.	A	5	ENSP00000384451:V5A;ENSP00000325301:V5A;ENSP00000385460:V5A	ENSP00000325301:V5A	V	-	2	0	C22orf40	45022832	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.533000	0.23082	0.288000	0.22398	-0.119000	0.15052	GTA	A|0.682;G|0.318		0.547	CDPF1-001	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075560.4	NM_207327	
NUP210	23225	bcgsc.ca	37	3	13421150	13421150	+	Missense_Mutation	SNP	C	C	T	rs7628051	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr3:13421150C>T	ENST00000254508.5	-	7	971	c.889G>A	c.(889-891)Gcc>Acc	p.A297T		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	297			A -> T (in dbSNP:rs7628051).		carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					ACCGGCCGGGCTGGGTCTCCT	0.572													C|||	2589	0.516973	0.8215	0.4236	5008	,	,		15632	0.3323		0.5239	False		,,,				2504	0.3548				p.A297T		.											.	NUP210-256	0			c.G889A						.	C	THR/ALA	3338,1068	721.2+/-409.1	1265,808,130	44.0	45.0	45.0		889	3.0	0.1	3	dbSNP_116	45	4672,3928	601.7+/-394.4	1281,2110,909	yes	missense	NUP210	NM_024923.2	58	2546,2918,1039	TT,TC,CC		45.6744,24.2397,38.413	benign	297/1888	13421150	8010,4996	2203	4300	6503	SO:0001583	missense	23225	exon7			GCCGGGCTGGGTC	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.889G>A	3.37:g.13421150C>T	ENSP00000254508:p.Ala297Thr	200	2		134	7	NM_024923	0	0	0	0	0	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	1153	0.5279304029304029	396	0.8048780487804879	161	0.4447513812154696	208	0.36363636363636365	388	0.5118733509234829	C	5.556	0.287518	0.10513	0.757603	0.543256	ENSG00000132182	ENST00000254508	T	0.05382	3.45	5.15	2.96	0.34315	.	0.781060	0.12576	N	0.456838	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.08186	-1.0734	9	0.18276	T	0.48	-21.9636	8.5655	0.33536	0.1293:0.7062:0.0:0.1645	rs7628051;rs17780361;rs56732558;rs7628051	297	Q8TEM1	PO210_HUMAN	T	297	ENSP00000254508:A297T	ENSP00000254508:A297T	A	-	1	0	NUP210	13396150	0.000000	0.05858	0.090000	0.20809	0.099000	0.18886	0.152000	0.16302	1.129000	0.42072	0.655000	0.94253	GCC	C|0.416;T|0.584		0.572	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1	NM_024923	
CCDC71	64925	ucsc.edu;bcgsc.ca	37	3	49200692	49200692	+	Missense_Mutation	SNP	T	T	A	rs4955419	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr3:49200692T>A	ENST00000321895.6	-	2	1056	c.950A>T	c.(949-951)cAg>cTg	p.Q317L		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	317			Q -> L (in dbSNP:rs4955419). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		agccttgacctgtgctgcctt	0.602													t|||	3560	0.710863	0.4501	0.7075	5008	,	,		19948	0.9395		0.6451	False		,,,				2504	0.8978				p.Q317L		.											.	CCDC71-91	0			c.A950T						.	T	LEU/GLN	2062,2344	565.1+/-381.6	493,1076,634	74.0	55.0	61.0		950	-7.5	0.0	3	dbSNP_111	61	5290,3310	643.7+/-400.0	1627,2036,637	yes	missense	CCDC71	NM_022903.3	113	2120,3112,1271	AA,AT,TT		38.4884,46.7998,43.4722	benign	317/468	49200692	7352,5654	2203	4300	6503	SO:0001583	missense	64925	exon2			TTGACCTGTGCTG	AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.950A>T	3.37:g.49200692T>A	ENSP00000319006:p.Gln317Leu	71	0		31	4	NM_022903	0	0	15	15	0	Q6IPE2|Q9H8H4|Q9H9F1	Missense_Mutation	SNP	ENST00000321895.6	37	CCDS2790.1	1499	0.6863553113553114	225	0.4573170731707317	256	0.7071823204419889	531	0.9283216783216783	487	0.6424802110817942	t	0.011	-1.692078	0.00731	0.467998	0.615116	ENSG00000177352	ENST00000321895	T	0.29917	1.55	3.74	-7.48	0.01360	.	.	.	.	.	T	0.00012	0.0000	N	0.22421	0.69	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.07424	-1.0773	8	0.30854	T	0.27	-26.304	8.1181	0.30955	0.2713:0.1197:0.0:0.609	rs4955419;rs17857064;rs52833521;rs57496183;rs4955419	317	Q8IV32	CCD71_HUMAN	L	317	ENSP00000319006:Q317L	ENSP00000319006:Q317L	Q	-	2	0	CCDC71	49175696	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.681000	0.00837	-3.298000	0.00193	-2.851000	0.00103	CAG	T|0.394;A|0.606		0.602	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345980.1	NM_022903	
ROBO1	6091	hgsc.bcm.edu;bcgsc.ca	37	3	78710311	78710311	+	Missense_Mutation	SNP	G	G	T	rs201271022	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr3:78710311G>T	ENST00000464233.1	-	16	2302	c.2189C>A	c.(2188-2190)aCg>aAg	p.T730K	ROBO1_ENST00000467549.1_Missense_Mutation_p.T694K|ROBO1_ENST00000436010.2_Missense_Mutation_p.T691K|ROBO1_ENST00000495273.1_Missense_Mutation_p.T694K	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	730	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TTTGGCTGGCGTCCTCACTTC	0.413																																					p.T730K		.											.	ROBO1-67	0			c.C2189A						.						104.0	101.0	102.0					3																	78710311		1829	4096	5925	SO:0001583	missense	6091	exon16			GCTGGCGTCCTCA	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2189C>A	3.37:g.78710311G>T	ENSP00000420321:p.Thr730Lys	45	0		57	4	NM_002941	0	0	0	0	0	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.732886	0.69189	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.5	5.5	0.81552	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.230857	0.51477	D	0.000082	T	0.60843	0.2300	L	0.36672	1.1	0.43246	D	0.995167	P;P;P;P;P;P	0.52463	0.761;0.909;0.953;0.927;0.909;0.823	B;P;P;P;P;B	0.58077	0.197;0.561;0.832;0.574;0.561;0.425	T	0.55704	-0.8099	9	.	.	.	.	19.3897	0.94576	0.0:0.0:1.0:0.0	.	694;694;730;694;694;691	Q9Y6N7-3;Q1RMC7;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;.;ROBO1_HUMAN;.;.;.	K	691;694;730;694;694;734	ENSP00000406043:T691K;ENSP00000420321:T730K;ENSP00000420637:T694K;ENSP00000417992:T694K	.	T	-	2	0	ROBO1	78793001	1.000000	0.71417	0.969000	0.41365	0.763000	0.43281	6.688000	0.74557	2.576000	0.86940	0.561000	0.74099	ACG	.		0.413	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
OPA1	4976	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	193380667	193380667	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr3:193380667G>T	ENST00000392438.3	+	24	2646	c.2412G>T	c.(2410-2412)gaG>gaT	p.E804D	OPA1_ENST00000361828.2_Missense_Mutation_p.E822D|OPA1_ENST00000361715.2_Missense_Mutation_p.E823D|OPA1_ENST00000361150.2_Missense_Mutation_p.E805D|OPA1_ENST00000361908.3_Missense_Mutation_p.E841D|OPA1_ENST00000361510.2_Missense_Mutation_p.E859D	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	804					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GTAATGAGGAGCACCCAGCTT	0.373																																					p.E859D		.											.	OPA1-68	0			c.G2577T						.						94.0	88.0	90.0					3																	193380667		2203	4300	6503	SO:0001583	missense	4976	exon26			TGAGGAGCACCCA	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2412G>T	3.37:g.193380667G>T	ENSP00000376233:p.Glu804Asp	163	1		162	82	NM_130837	0	0	0	4	4	D3DNW4	Missense_Mutation	SNP	ENST00000392438.3	37	CCDS43186.1	.	.	.	.	.	.	.	.	.	.	G	10.20	1.283477	0.23392	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	D;D;D;D;D;D	0.95103	-3.2;-3.19;-3.21;-3.2;-3.2;-3.61	5.75	-2.79	0.05841	.	0.092678	0.85682	D	0.000000	T	0.81235	0.4780	N	0.03324	-0.35	0.33224	D	0.554999	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.06405	0.001;0.001;0.002;0.002;0.001;0.001;0.001;0.001	T	0.67688	-0.5606	10	0.26408	T	0.33	-20.7859	7.4408	0.27181	0.5707:0.0:0.2444:0.1848	.	768;804;786;805;822;841;823;859	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	D	841;804;859;823;822;805	ENSP00000354681:E841D;ENSP00000376233:E804D;ENSP00000355324:E859D;ENSP00000355311:E823D;ENSP00000354429:E822D;ENSP00000354781:E805D	ENSP00000354781:E805D	E	+	3	2	OPA1	194863361	0.000000	0.05858	0.944000	0.38274	0.978000	0.69477	-1.698000	0.01908	-0.698000	0.05085	-0.150000	0.13652	GAG	.		0.373	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000313812.2	NM_130837	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		19	0		100	8	NM_175918	0	0	10	16	6	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	5	0		56	11	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	1	0		11	11	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
AMBN	258	hgsc.bcm.edu	37	4	71462749	71462749	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr4:71462749G>T	ENST00000322937.6	+	3	221	c.118G>T	c.(118-120)Gct>Tct	p.A40S	AMBN_ENST00000449493.2_Missense_Mutation_p.A40S	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	40					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			ACCGGGTATGGCTAGTTTGAG	0.358																																					p.A40S		.											.	AMBN-94	0			c.G118T						.						111.0	112.0	112.0					4																	71462749		2203	4300	6503	SO:0001583	missense	258	exon3			GGTATGGCTAGTT	AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.118G>T	4.37:g.71462749G>T	ENSP00000313809:p.Ala40Ser	32	0		72	4	NM_016519	0	0	0	0	0	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	ENST00000322937.6	37	CCDS3543.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424521	0.83667	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.41065	1.01;1.01	5.43	5.43	0.79202	.	0.169682	0.40064	N	0.001197	T	0.60301	0.2258	M	0.62723	1.935	0.43874	D	0.996481	D	0.71674	0.998	D	0.65573	0.936	T	0.61987	-0.6949	10	0.72032	D	0.01	-13.0876	15.0885	0.72174	0.0:0.0:1.0:0.0	.	40	Q9NP70	AMBN_HUMAN	S	40	ENSP00000313809:A40S;ENSP00000391234:A40S	ENSP00000313809:A40S	A	+	1	0	AMBN	71497338	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.746000	0.62133	2.699000	0.92147	0.655000	0.94253	GCT	.		0.358	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252165.1	NM_016519	
FAM170A	340069	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	118970068	118970068	+	Missense_Mutation	SNP	G	G	A	rs369994686		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr5:118970068G>A	ENST00000515256.1	+	3	797	c.625G>A	c.(625-627)Gtt>Att	p.V209I				A1A519	F170A_HUMAN	family with sequence similarity 170, member A	209					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	24						CTCACCCACCGTTGAGGACAC	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		20392	0.001		0.0	False		,,,				2504	0.0				p.V209I		.											.	FAM170A-91	0			c.G625A						.	G	ILE/VAL,ILE/VAL	1,4209		0,1,2104	91.0	99.0	96.0		625,484	1.5	0.0	5		96	0,8466		0,0,4233	no	missense,missense	FAM170A	NM_182761.3,NM_001163991.1	29,29	0,1,6337	AA,AG,GG		0.0,0.0238,0.0079	benign,benign	209/330,162/283	118970068	1,12675	2105	4233	6338	SO:0001583	missense	340069	exon3			CCCACCGTTGAGG	AF427126	CCDS43353.1, CCDS54889.1	5q23.1	2008-06-12			ENSG00000164334	ENSG00000164334			27963	protein-coding gene	gene with protein product						12477932	Standard	NM_182761		Approved		uc003ksn.3	A1A519	OTTHUMG00000162946	ENST00000515256.1:c.625G>A	5.37:g.118970068G>A	ENSP00000422684:p.Val209Ile	92	0		115	44	NM_182761	0	0	0	0	0	Q66LM8|Q7Z4V2|Q8IW94	Missense_Mutation	SNP	ENST00000515256.1	37		.	.	.	.	.	.	.	.	.	.	G	1.494	-0.553828	0.03996	2.38E-4	0.0	ENSG00000164334	ENST00000296787;ENST00000515256	T	0.35789	1.29	4.35	1.49	0.22878	.	0.963086	0.08539	N	0.930926	T	0.34513	0.0900	M	0.64997	1.995	0.09310	N	1	B;B	0.25007	0.086;0.116	B;B	0.15484	0.008;0.013	T	0.25710	-1.0124	9	.	.	.	-3.1073	10.1819	0.42972	0.0:0.0:0.4686:0.5314	.	162;209	D6RIE9;A1A519	.;F170A_HUMAN	I	162;209	ENSP00000422684:V209I	.	V	+	1	0	FAM170A	118997967	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.414000	0.21164	0.320000	0.23234	-0.181000	0.13052	GTT	.		0.587	FAM170A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000371126.1	NM_182761	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573844	140573844	+	Silent	SNP	C	C	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr5:140573844C>T	ENST00000239446.4	+	1	1903	c.1719C>T	c.(1717-1719)acC>acT	p.T573T		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	573	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711																																					p.T573T		.											.	PCDHB10-92	0			c.C1719T						.						7.0	10.0	9.0					5																	140573844		1626	3527	5153	SO:0001819	synonymous_variant	56126	exon1			CTGCACCGAGCTG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1719C>T	5.37:g.140573844C>T		2	0		81	27	NM_018930	0	0	10	11	1	Q96T99	Silent	SNP	ENST00000239446.4	37	CCDS4252.1																																																																																			.		0.711	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		0	0		6	6	NM_001145115	0	0	0	0	0		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
BTN2A3P	54718	bcgsc.ca	37	6	26426487	26426487	+	RNA	SNP	G	G	A	rs10946829	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr6:26426487G>A	ENST00000466808.2	+	0	803							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)											CTCTGAGCCCGTCATTGAAAT	0.557													G|||	729	0.145567	0.1641	0.1801	5008	,	,		19293	0.0308		0.166	False		,,,				2504	0.1933				.		.											.	.	0			.						.	G		792,3614		67,658,1478	49.0	43.0	45.0			-5.1	0.0	6	dbSNP_120	45	1446,7154		124,1198,2978	no	intergenic				191,1856,4456	AA,AG,GG		16.814,17.9755,17.2074			26426487	2238,10768	2203	4300	6503			54718	.			GAGCCCGTCATTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26426487G>A		92	0		62	4	.	0	0	0	0	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																				G|0.837;A|0.163		0.557	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000040118.4	NR_027795	
TCTE1	202500	bcgsc.ca	37	6	44268371	44268371	+	5'Flank	SNP	T	T	C	rs325008	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr6:44268371T>C	ENST00000371505.4	-	0	0				AARS2_ENST00000491573.1_5'UTR|AARS2_ENST00000244571.4_Silent_p.S957S|TMEM151B_ENST00000438774.2_Intron|TCTE1_ENST00000371503.3_5'Flank|RP11-444E17.6_ENST00000505802.1_Intron	NM_182539.3	NP_872345.2	Q5JU00	TCTE1_HUMAN	t-complex-associated-testis-expressed 1											breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CCACCACTCGTGAGCCCCACG	0.627													C|||	4354	0.869409	0.5976	0.9496	5008	,	,		19229	0.998		0.9612	False		,,,				2504	0.953				p.S957S		.											.	AARS2-91	0			c.A2871G						.	C		3022,1384	457.1+/-351.5	1045,932,226	83.0	71.0	75.0		2871	-8.7	0.0	6	dbSNP_79	75	8308,292	107.4+/-168.2	4010,288,2	no	coding-synonymous	AARS2	NM_020745.2		5055,1220,228	CC,CT,TT		3.3953,31.4117,12.8864		957/986	44268371	11330,1676	2203	4300	6503	SO:0001631	upstream_gene_variant	57505	exon22			CACTCGTGAGCCC	BC035022	CCDS4910.1	6q21.1	2014-07-18			ENSG00000146221	ENSG00000146221			11693	protein-coding gene	gene with protein product		186975				2568335, 8646886	Standard	NM_182539		Approved	D6S46, MGC33600, FAP155	uc003oxi.2	Q5JU00	OTTHUMG00000014763		6.37:g.44268371T>C	Exception_encountered	83	1		76	4	NM_020745	0	0	2	2	0	B4DX59|Q8IYS6	Silent	SNP	ENST00000371505.4	37	CCDS4910.1																																																																																			T|0.130;C|0.870		0.627	TCTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040736.1	NM_182539	
FAM26F	441168	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	6	116783563	116783563	+	Silent	SNP	G	G	A			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr6:116783563G>A	ENST00000368605.1	+	2	566	c.471G>A	c.(469-471)caG>caA	p.Q157Q	RP1-93H18.6_ENST00000476099.1_RNA|FAM26F_ENST00000368606.3_Intron	NM_001010919.1	NP_001010919.1	Q5R3K3	FA26F_HUMAN	family with sequence similarity 26, member F	157					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)	3				GBM - Glioblastoma multiforme(226;0.0402)|all cancers(137;0.0627)|OV - Ovarian serous cystadenocarcinoma(136;0.0655)|Epithelial(106;0.231)		CGTGCAACCAGGCCAAGGCGT	0.726																																					p.G157G		.											.	FAM26F-68	0			c.A471A						.						3.0	2.0	2.0					6																	116783563		958	1330	2288	SO:0001819	synonymous_variant	441168	exon2			CAACCAGGCCAAG	AF086130	CCDS34519.1, CCDS64506.1	6q22.1	2007-06-20			ENSG00000188820	ENSG00000188820			33391	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 187"""	C6orf187			Standard	NM_001010919		Approved	RP1-93H18.5, OTTHUMP00000017061, OTTHUMP00000017062, dJ93H18.5	uc003pwv.4	Q5R3K3	OTTHUMG00000015438	ENST00000368605.1:c.471G>A	6.37:g.116783563G>A		14	0		24	15	NM_001010919	0	0	1	1	0	B9EJB0|Q5R3K4	Silent	SNP	ENST00000368605.1	37	CCDS34519.1																																																																																			.		0.726	FAM26F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041946.1	NM_001010919	
MAP7	9053	hgsc.bcm.edu	37	6	136682172	136682172	+	Missense_Mutation	SNP	G	G	A	rs2076190	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr6:136682172G>A	ENST00000354570.3	-	12	2082	c.1672C>T	c.(1672-1674)Cgg>Tgg	p.R558W	MAP7_ENST00000438100.2_Missense_Mutation_p.R543W|MAP7_ENST00000432797.2_Missense_Mutation_p.R412W|MAP7_ENST00000454590.1_Missense_Mutation_p.R580W|MAP7_ENST00000544465.1_Missense_Mutation_p.R543W	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	558			R -> W (in dbSNP:rs2076190). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GCCTCCTCCCGCTCGCGCAGC	0.761													G|||	3864	0.771565	0.7156	0.8026	5008	,	,		9294	0.6736		0.8459	False		,,,				2504	0.8497				p.R588W		.											.	MAP7-90	0			c.C1762T						.	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	3211,1131		1187,837,147	7.0	8.0	8.0		1738,1762,1627,1738,1627,1561,1390,1234,1234,1672	2.8	1.0	6	dbSNP_96	8	7130,1264		3035,1060,102	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	MAP7	NM_001198608.1,NM_001198609.1,NM_001198611.1,NM_001198614.1,NM_001198615.1,NM_001198616.1,NM_001198617.1,NM_001198618.1,NM_001198619.1,NM_003980.4	101,101,101,101,101,101,101,101,101,101	4222,1897,249	AA,AG,GG		15.0584,26.0479,18.805	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	580/772,588/780,543/735,580/772,543/735,521/713,464/656,412/604,412/604,558/750	136682172	10341,2395	2171	4197	6368	SO:0001583	missense	9053	exon12			CCTCCCGCTCGCG	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1672C>T	6.37:g.136682172G>A	ENSP00000346581:p.Arg558Trp	0	0		8	8	NM_001198609	0	0	0	0	0	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	ENST00000354570.3	37	CCDS5178.1	1644	0.7527472527472527	337	0.6849593495934959	282	0.7790055248618785	382	0.6678321678321678	643	0.8482849604221636	G	14.45	2.539239	0.45176	0.739521	0.849416	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.26067	1.76;1.76;1.76;1.76;1.76	4.89	2.78	0.32641	.	0.296091	0.22491	N	0.059376	T	0.35189	0.0923	M	0.82517	2.595	0.26264	P	0.9785292	D;D;D;D;D;D	0.76494	0.995;0.994;0.995;0.999;0.998;0.998	P;P;P;P;P;P	0.60886	0.751;0.636;0.751;0.809;0.809;0.88	T	0.38779	-0.9645	9	0.52906	T	0.07	-5.3629	10.9226	0.47174	0.0:0.0:0.3457:0.6543	rs2076190;rs2230172;rs6928528	543;543;580;464;521;558	B7Z290;F5H1E2;E9PCP3;F8W783;Q14244-2;Q14244	.;.;.;.;.;MAP7_HUMAN	W	558;580;543;543;412;464	ENSP00000346581:R558W;ENSP00000414712:R580W;ENSP00000445737:R543W;ENSP00000400790:R543W;ENSP00000414879:R412W	ENSP00000344217:R464W	R	-	1	2	MAP7	136723865	0.441000	0.25626	0.960000	0.40013	0.620000	0.37586	1.543000	0.36147	0.988000	0.38734	0.555000	0.69702	CGG	G|0.243;A|0.757		0.761	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
SYNE1	23345	ucsc.edu	37	6	152469513	152469513	+	Splice_Site	SNP	G	G	A			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr6:152469513G>A	ENST00000367255.5	-	137	25244	c.24643C>T	c.(24643-24645)Ctc>Ttc	p.L8215F	SYNE1_ENST00000423061.1_Splice_Site_p.L8144F|SYNE1_ENST00000356820.4_Splice_Site_p.L2739F|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000448038.1_Splice_Site_p.L8144F|SYNE1_ENST00000354674.4_Splice_Site_p.L370F|SYNE1_ENST00000539504.1_Splice_Site_p.L370F|SYNE1_ENST00000341594.5_Splice_Site_p.L7827F|SYNE1_ENST00000265368.4_Splice_Site_p.L8215F	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8215					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCGTCTGGGAGCTAGAAGGGA	0.547										HNSCC(10;0.0054)																											p.L8215F		.											.	SYNE1-607	0			c.C24643T						.						36.0	37.0	37.0					6																	152469513		2203	4300	6503	SO:0001630	splice_region_variant	23345	exon137			CTGGGAGCTAGAA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24643-1C>T	6.37:g.152469513G>A		43	0		37	4	NM_182961	0	0	0	0	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869636	0.72065	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.59083	0.35;4.49;1.3;0.41;0.29;0.41;0.5;2.37;1.52;4.5	5.4	4.52	0.55395	.	0.151051	0.30011	N	0.010635	T	0.71821	0.3385	M	0.82517	2.595	0.80722	D	1	D;D;D;D;P	0.89917	1.0;1.0;1.0;1.0;0.723	D;D;D;D;B	0.79108	0.983;0.983;0.992;0.983;0.274	T	0.75631	-0.3251	10	0.66056	D	0.02	.	13.517	0.61545	0.075:0.0:0.925:0.0	.	8215;8215;8144;8144;417	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	F	8215;370;861;8144;8215;8144;7827;2739;377;372;1137;370	ENSP00000356224:L8215F;ENSP00000441052:L370F;ENSP00000356226:L861F;ENSP00000396024:L8144F;ENSP00000265368:L8215F;ENSP00000390975:L8144F;ENSP00000341887:L7827F;ENSP00000349276:L2739F;ENSP00000356220:L1137F;ENSP00000346701:L370F	ENSP00000265368:L8215F	L	-	1	0	SYNE1	152511206	1.000000	0.71417	0.991000	0.47740	0.644000	0.38419	5.233000	0.65337	2.530000	0.85305	0.655000	0.94253	CTC	.		0.547	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	Missense_Mutation
GET4	51608	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	930643	930643	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr7:930643A>G	ENST00000265857.3	+	5	639	c.545A>G	c.(544-546)tAt>tGt	p.Y182C	GET4_ENST00000407192.1_Missense_Mutation_p.Y129C	NM_015949.2	NP_057033.2	Q7L5D6	GET4_HUMAN	golgi to ER traffic protein 4 homolog (S. cerevisiae)	182					tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)				breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTGGTGGAGTATTCCACGTCC	0.552																																					p.Y182C		.											.	GET4-90	0			c.A545G						.						133.0	115.0	121.0					7																	930643		2203	4300	6503	SO:0001583	missense	51608	exon5			TGGAGTATTCCAC	AK023560	CCDS5317.1	7p22.3	2010-08-05	2010-03-24	2010-03-24	ENSG00000239857	ENSG00000239857			21690	protein-coding gene	gene with protein product	"""CGI-20 protein"", ""conserved edge protein"", ""transmembrane domain recognition complex, 35kDa"""	612056	"""chromosome 7 open reading frame 20"""	C7orf20		10810093, 20106980, 20676083	Standard	NM_015949		Approved	CGI-20, H_NH1244M04.5, CEE, TRC35	uc003sjl.1	Q7L5D6	OTTHUMG00000112459	ENST00000265857.3:c.545A>G	7.37:g.930643A>G	ENSP00000265857:p.Tyr182Cys	221	0		254	71	NM_015949	0	0	67	116	49	A4D2Q1|B3KNC7|Q9UFC9|Q9Y309	Missense_Mutation	SNP	ENST00000265857.3	37	CCDS5317.1	.	.	.	.	.	.	.	.	.	.	a	21.5	4.157164	0.78114	.	.	ENSG00000239857	ENST00000265857;ENST00000412734;ENST00000407192;ENST00000426056	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.67552	0.2905	L	0.41710	1.295	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.70139	-0.4954	9	0.59425	D	0.04	-37.7166	14.8892	0.70594	1.0:0.0:0.0:0.0	.	182	Q7L5D6	GET4_HUMAN	C	182;136;129;143	.	ENSP00000265857:Y182C	Y	+	2	0	GET4	897169	1.000000	0.71417	0.995000	0.50966	0.554000	0.35429	8.927000	0.92846	1.940000	0.56252	0.398000	0.26397	TAT	.		0.552	GET4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000231930.1	NM_015949	
AP5Z1	9907	broad.mit.edu	37	7	4827402	4827402	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr7:4827402G>T	ENST00000348624.4	+	11	1543	c.1449G>T	c.(1447-1449)caG>caT	p.Q483H	AP5Z1_ENST00000401897.1_Missense_Mutation_p.Q483H|MIR4656_ENST00000579503.1_RNA	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	483					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											TGGACCTGCAGCTCAGGTGGG	0.706																																					p.Q483H		.											.	.	0			c.G1449T						.						14.0	18.0	17.0					7																	4827402		1984	3947	5931	SO:0001583	missense	9907	exon11			CCTGCAGCTCAGG	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.1449G>T	7.37:g.4827402G>T	ENSP00000297562:p.Gln483His	13	0		87	8	NM_014855	0	0	0	0	0	Q8N3X2|Q96H80	Missense_Mutation	SNP	ENST00000348624.4	37	CCDS47528.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854221	0.32791	.	.	ENSG00000242802	ENST00000348624;ENST00000401897	T;T	0.48836	0.81;0.8	4.73	2.77	0.32553	.	0.129357	0.52532	D	0.000063	T	0.45518	0.1346	M	0.82323	2.585	0.48135	D	0.999592	B	0.25609	0.13	B	0.21708	0.036	T	0.49943	-0.8885	10	0.56958	D	0.05	.	4.7521	0.13066	0.0852:0.1506:0.609:0.1552	.	483	O43299	K0415_HUMAN	H	483	ENSP00000297562:Q483H;ENSP00000384980:Q483H	ENSP00000297562:Q483H	Q	+	3	2	KIAA0415	4793928	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	2.161000	0.42358	1.108000	0.41662	0.549000	0.68633	CAG	.		0.706	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323771.1		
TNRC18	84629	hgsc.bcm.edu	37	7	5352665	5352665	+	Silent	SNP	T	T	G			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr7:5352665T>G	ENST00000430969.1	-	27	8205	c.7857A>C	c.(7855-7857)tcA>tcC	p.S2619S	TNRC18_ENST00000399537.4_Silent_p.S2619S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2619	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aggaggaggatgaggaggagg	0.657																																					p.S2619S		.											.	TNRC18-46	0			c.A7857C						.						5.0	8.0	7.0					7																	5352665		1381	3160	4541	SO:0001819	synonymous_variant	84629	exon27			GGAGGATGAGGAG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7857A>C	7.37:g.5352665T>G		7	0		12	7	NM_001080495	2	0	0	7	5	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1																																																																																			.		0.657	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		0	0		6	6	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	0	0		28	12	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	0	0		11	4	NM_194284	0	0	0	0	0	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		0	0		12	12	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		4	4	NM_030895	0	0	0	1	1	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000354958.2_Silent_p.A1947A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		0	0		12	12	NM_201380	0	0	0	4	4	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	0	0		14	14	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000354958.2_Silent_p.L1162L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		0	0		8	8	NM_201380	0	0	0	1	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		11	11	NM_213605	0	0	0	2	2		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
SURF6	6838	hgsc.bcm.edu	37	9	136198859	136198859	+	Missense_Mutation	SNP	G	G	A	rs1800867	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr9:136198859G>A	ENST00000372022.4	-	5	1197	c.932C>T	c.(931-933)aCg>aTg	p.T311M	SURF6_ENST00000468290.1_5'UTR	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6	311			T -> M (in dbSNP:rs1800867).		ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		CACGCCGGCCGTGCGCTTCTC	0.721													G|||	39	0.00778754	0.0023	0.0101	5008	,	,		14630	0.0		0.0199	False		,,,				2504	0.0092				p.T311M		.											.	SURF6-91	0			c.C932T						.	G	MET/THR	11,4393		0,11,2191	20.0	20.0	20.0		932	4.2	1.0	9	dbSNP_89	20	174,8422		0,174,4124	no	missense	SURF6	NM_006753.4	81	0,185,6315	AA,AG,GG		2.0242,0.2498,1.4231	probably-damaging	311/362	136198859	185,12815	2202	4298	6500	SO:0001583	missense	6838	exon5			CCGGCCGTGCGCT	AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.932C>T	9.37:g.136198859G>A	ENSP00000361092:p.Thr311Met	2	0		27	16	NM_006753	0	0	0	10	10	Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	Missense_Mutation	SNP	ENST00000372022.4	37	CCDS6962.1	22	0.010073260073260074	2	0.0040650406504065045	4	0.011049723756906077	0	0.0	16	0.021108179419525065	G	18.74	3.689452	0.68271	0.002498	0.020242	ENSG00000148296	ENST00000372022	T	0.14391	2.51	5.15	4.21	0.49690	.	0.290937	0.35870	N	0.002935	T	0.15349	0.0370	L	0.52573	1.65	0.39677	D	0.970848	D	0.89917	1.0	D	0.65773	0.938	T	0.00719	-1.1595	10	0.46703	T	0.11	-4.2132	14.1324	0.65263	0.0:0.0:0.8497:0.1503	rs1800867	311	O75683	SURF6_HUMAN	M	311	ENSP00000361092:T311M	ENSP00000361092:T311M	T	-	2	0	SURF6	135188680	1.000000	0.71417	0.954000	0.39281	0.706000	0.40770	4.384000	0.59607	2.387000	0.81309	0.467000	0.42956	ACG	G|0.988;A|0.012		0.721	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054905.1	NM_006753	
TLR7	51284	bcgsc.ca	37	X	12903659	12903659	+	Missense_Mutation	SNP	A	A	T	rs179008	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chrX:12903659A>T	ENST00000380659.3	+	3	171	c.32A>T	c.(31-33)cAa>cTa	p.Q11L		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	11			Q -> L (in dbSNP:rs179008). {ECO:0000269|PubMed:19924287}.		cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	CTGAAGAGACAAATTCTTATC	0.358													A|||	446	0.118146	0.0908	0.1599	3775	,	,		14565	0.0		0.1759	False		,,,				2504	0.0389				p.Q11L		.											.	TLR7-564	0			c.A32T	GRCh37	CM084786	TLR7	M	rs179008	.	A	LEU/GLN	521,3314		25,397,74,1210,497	129.0	129.0	129.0		32	-5.4	0.0	X	dbSNP_79	129	1429,5299		98,792,441,1538,1431	yes	missense	TLR7	NM_016562.3	113	123,1189,515,2748,1928	TT,TA,T,AA,A		21.2396,13.5854,18.4607	benign	11/1050	12903659	1950,8613	2203	4300	6503	SO:0001583	missense	51284	exon3			AGAGACAAATTCT	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.32A>T	X.37:g.12903659A>T	ENSP00000370034:p.Gln11Leu	126	0		116	6	NM_016562	0	0	0	0	0	D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	37	CCDS14151.1	253	0.1525015069318867	34	0.0735930735930736	38	0.1165644171779141	0	0.0	110	0.16224188790560473	A	8.200	0.797989	0.16327	0.135854	0.212396	ENSG00000196664	ENST00000380659	T	0.46819	0.86	5.72	-5.42	0.02640	.	0.888102	0.09632	N	0.776072	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.24657	-1.0154	9	0.37606	T	0.19	.	1.4567	0.02387	0.262:0.3564:0.1455:0.2361	rs179008;rs629938;rs17256060;rs179008	11	Q9NYK1	TLR7_HUMAN	L	11	ENSP00000370034:Q11L	ENSP00000370034:Q11L	Q	+	2	0	TLR7	12813580	0.000000	0.05858	0.000000	0.03702	0.519000	0.34347	0.053000	0.14184	-0.637000	0.05516	0.421000	0.28195	CAA	0|0.021;A|0.822;T|0.157		0.358	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562	
MAGT1	84061	hgsc.bcm.edu	37	X	77111010	77111010	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chrX:77111010G>T	ENST00000358075.6	-	6	932	c.846C>A	c.(844-846)caC>caA	p.H282Q		NM_032121.5	NP_115497.4	Q9H0U3	MAGT1_HUMAN	magnesium transporter 1	250					cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	17						CATGTCCCGTGTGGGGATTCT	0.403																																					p.H282Q		.											.	MAGT1-63	0			c.C846A						.						111.0	100.0	104.0					X																	77111010		2203	4296	6499	SO:0001583	missense	84061	exon6			TCCCGTGTGGGGA		CCDS14436.2	Xq21.1	2014-09-17			ENSG00000102158	ENSG00000102158			28880	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog B (S. cerevisiae)"""	300715				15804357	Standard	NM_032121		Approved	DKFZp564K142, IAP, OST3B, MRX95	uc004fof.3	Q9H0U3	OTTHUMG00000021882	ENST00000358075.6:c.846C>A	X.37:g.77111010G>T	ENSP00000354649:p.His282Gln	94	0		72	4	NM_032121	0	0	0	0	0	B2RAR4|D3DTE3|Q53G00|Q6P577|Q8NBN6	Missense_Mutation	SNP	ENST00000358075.6	37	CCDS14436.2	.	.	.	.	.	.	.	.	.	.	g	6.469	0.454638	0.12283	.	.	ENSG00000102158	ENST00000358075;ENST00000453109	T	0.76186	-1.0	5.7	1.37	0.22104	.	0.244803	0.40554	U	0.001075	T	0.40839	0.1133	N	0.01751	-0.74	0.80722	D	1	B	0.10296	0.003	B	0.17098	0.017	T	0.38542	-0.9656	10	0.05525	T	0.97	-7.7381	9.4365	0.38641	0.4588:0.0:0.5412:0.0	.	250	Q9H0U3	MAGT1_HUMAN	Q	282;133	ENSP00000354649:H282Q	ENSP00000354649:H282Q	H	-	3	2	MAGT1	76997666	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	0.760000	0.26475	0.186000	0.20125	0.502000	0.49764	CAC	.		0.403	MAGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057301.2	NM_032121	
PLXNA3	55558	bcgsc.ca	37	X	153694334	153694334	+	Missense_Mutation	SNP	C	C	G	rs5945430	byFrequency	TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chrX:153694334C>G	ENST00000369682.3	+	14	2764	c.2589C>G	c.(2587-2589)gaC>gaG	p.D863E		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	863	IPT/TIG 1.		D -> E (in dbSNP:rs5945430). {ECO:0000269|PubMed:8570614}.		axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCGTGGGTGACAACCTGGGCC	0.642													g|||	1453	0.384901	0.6725	0.0994	3775	,	,		12442	0.128		0.0875	False		,,,				2504	0.2843				p.D863E		.											.	PLXNA3-132	0			c.C2589G						.		GLU/ASP	3042,793		1031,515,465,86,106	64.0	57.0	59.0		2589	4.4	1.0	X	dbSNP_114	59	895,5833		46,535,268,1847,1604	no	missense	PLXNA3	NM_017514.3	45	1077,1050,733,1933,1710	GG,GC,G,CC,C		13.3026,20.678,37.2716	benign	863/1872	153694334	3937,6626	2203	4300	6503	SO:0001583	missense	55558	exon14			GGGTGACAACCTG	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.2589C>G	X.37:g.153694334C>G	ENSP00000358696:p.Asp863Glu	321	2		268	7	NM_017514	0	0	2	2	0	Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	37	CCDS14752.1	482	0.29053646775165765	225	0.7867132867132867	24	0.06857142857142857	38	0.07063197026022305	44	0.062146892655367235	G	0.144	-1.099405	0.01843	0.79322	0.133026	ENSG00000130827	ENST00000369682	T	0.75821	-0.97	5.32	4.45	0.53987	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.129129	0.52532	N	0.000076	T	0.00012	0.0000	N	0.00041	-2.485	0.46499	P	9.219999999999784E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.42865	-0.9426	9	0.06365	T	0.9	.	7.6459	0.28321	0.0881:0.3108:0.6011:0.0	rs5945430;rs58038932	863	P51805	PLXA3_HUMAN	E	863	ENSP00000358696:D863E	ENSP00000358696:D863E	D	+	3	2	PLXNA3	153347528	1.000000	0.71417	0.998000	0.56505	0.197000	0.23852	2.837000	0.48191	1.024000	0.39682	-0.176000	0.13171	GAC	C|0.625;G|0.375		0.642	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	
TMEM2	23670	broad.mit.edu	37	9	74300311	74300312	+	Splice_Site	INS	-	-	AA	rs36080695|rs72019397		TCGA-OR-A5LA-01A-11D-A29I-10	TCGA-OR-A5LA-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	88fcb98e-87f0-400d-a518-d71acd4d4f15	dbf1a7bc-94a6-4ca2-af78-a3649deac3ed	g.chr9:74300311_74300312insAA	ENST00000377044.4	-	24	4495		c.e24-2		TMEM2_ENST00000377066.5_Splice_Site|TMEM2_ENST00000396272.3_Splice_Site	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2						multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TGGTACTCCCTaaaaaaaaaaa	0.371																																					.		.											.	TMEM2-92	0			c.3767-2->TT						.																																			SO:0001630	splice_region_variant	23670	exon24			ACTCCCTAAAAAA		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3956-2->TT	9.37:g.74300320_74300321dupAA		7	0		7	2	NM_001135820	0	0	0	0	0	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Splice_Site	INS	ENST00000377044.4	37	CCDS6638.1																																																																																			A|1.000;|0.000		0.371	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	Intron
