#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PER3	8863	ucsc.edu	37	1	7890053	7890053	+	Missense_Mutation	SNP	G	G	A	rs1776342	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr1:7890053G>A	ENST00000361923.2	+	18	3194	c.3019G>A	c.(3019-3021)Gct>Act	p.A1007T	RP3-467L1.4_ENST00000451646.1_RNA|PER3_ENST00000377532.3_Missense_Mutation_p.A1016T	NM_016831.1	NP_058515.1	P56645	PER3_HUMAN	period circadian clock 3	1007	5 X 18 AA tandem repeats of S-[HP]-[AP]- T-[AT]-[GST]-[ATV]-L-S-[MT]-G-[LS]-P-P- [MRS]-[EKR]-[NST]-P.|Ser-rich.		A -> T (in dbSNP:rs1776342).|Missing (associated with eveningness and better cognitive performance during sleep deprivation exepriments; dbSNP:rs57875989).		circadian regulation of gene expression (GO:0032922)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.A1007T(1)		breast(4)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	39	Ovarian(185;0.0634)|all_lung(157;0.178)	all_epithelial(116;9.35e-21)|all_lung(118;7.57e-07)|Lung NSC(185;4.52e-06)|Renal(390;0.000147)|Breast(487;0.00086)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|all cancers(8;8.58e-70)|GBM - Glioblastoma multiforme(8;1.81e-35)|Colorectal(212;2.06e-07)|COAD - Colon adenocarcinoma(227;1.92e-05)|Kidney(185;7.18e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000472)|STAD - Stomach adenocarcinoma(132;0.00118)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|READ - Rectum adenocarcinoma(331;0.0649)		TACTGCCAGCGCTCTGTCCAC	0.587																																					p.A1007T		.											.	PER3-93	1	Substitution - Missense(1)	kidney(1)	c.G3019A						.						87.0	69.0	75.0					1																	7890053		1995	3902	5897	SO:0001583	missense	8863	exon18			GCCAGCGCTCTGT	BC026102	CCDS89.1, CCDS72695.1	1p36.23	2012-12-13	2012-12-13		ENSG00000049246	ENSG00000049246			8847	protein-coding gene	gene with protein product		603427	"""period (Drosophila) homolog 3"", ""period homolog 3 (Drosophila)"""			9427249	Standard	XM_005263520		Approved		uc001aoo.3	P56645	OTTHUMG00000001216	ENST00000361923.2:c.3019G>A	1.37:g.7890053G>A	ENSP00000355031:p.Ala1007Thr	120	2		117	14	NM_016831	0	0	9	9	0	Q5H8X4|Q5H8X5|Q969K6|Q96S77|Q96S78|Q9C0J3|Q9NSP9|Q9UGU8	Missense_Mutation	SNP	ENST00000361923.2	37	CCDS89.1	.	.	.	.	.	.	.	.	.	.	g	0.668	-0.803078	0.02841	.	.	ENSG00000049246	ENST00000377532;ENST00000361923	T;T	0.14391	2.51;2.51	0.119	0.119	0.14685	Period circadian-like, C-terminal (1);	9.368370	0.00166	N	0.000019	T	0.09158	0.0226	N	0.20685	0.6	0.09310	N	1	B;B;B;B;B	0.25048	0.025;0.007;0.066;0.117;0.007	B;B;B;B;B	0.23018	0.002;0.004;0.004;0.043;0.004	T	0.25676	-1.0125	9	0.18710	T	0.47	.	.	.	.	rs1776342	56;1007;1016;1016;1007	B4DR65;A2I2N5;A6H8X0;P56645-2;P56645	.;.;.;.;PER3_HUMAN	T	1016;1007	ENSP00000366755:A1016T;ENSP00000355031:A1007T	ENSP00000355031:A1007T	A	+	1	0	PER3	7812640	0.000000	0.05858	0.068000	0.19968	0.074000	0.17049	-0.849000	0.04322	0.275000	0.22094	0.280000	0.19369	GCT	G|0.998;A|0.002		0.587	PER3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000003607.1	NM_016831	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		20	20	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
FOXD2	2306	hgsc.bcm.edu	37	1	47904909	47904909	+	Missense_Mutation	SNP	G	G	C	rs2405913	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr1:47904909G>C	ENST00000334793.5	+	1	3221	c.1102G>C	c.(1102-1104)Gcg>Ccg	p.A368P		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	368	Ala-rich.|Gly-rich.		A -> P (in dbSNP:rs2405913). {ECO:0000269|PubMed:9403061}.		transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		AGCCTTCTACGCGGCGTCCCT	0.776													C|||	5006	0.999601	0.9985	1.0	5008	,	,		8227	1.0		1.0	False		,,,				2504	1.0				p.A368P		.											.	FOXD2-226	0			c.G1102C						.						2.0	3.0	2.0					1																	47904909		1345	2971	4316	SO:0001583	missense	2306	exon1			TTCTACGCGGCGT	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.1102G>C	1.37:g.47904909G>C	ENSP00000335493:p.Ala368Pro	0	0		6	6	NM_004474	0	0	0	0	0	Q5SVZ3	Missense_Mutation	SNP	ENST00000334793.5	37	CCDS30708.1	2181	0.9986263736263736	489	0.9939024390243902	362	1.0	572	1.0	758	1.0	C	0.800	-0.755720	0.03019	.	.	ENSG00000186564	ENST00000334793	D	0.93547	-3.24	4.4	3.48	0.39840	.	.	.	.	.	T	0.00012	0.0000	N	0.00210	-1.845	0.54753	P	1.7000000000044757E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.42515	-0.9447	8	0.02654	T	1	.	4.1889	0.10411	0.1624:0.5916:0.1573:0.0887	rs2405913;rs2405913	368	O60548	FOXD2_HUMAN	P	368	ENSP00000335493:A368P	ENSP00000335493:A368P	A	+	1	0	FOXD2	47677496	0.000000	0.05858	0.905000	0.35620	0.496000	0.33645	0.098000	0.15189	0.309000	0.22966	-0.978000	0.02582	GCG	G|0.835;C|0.165		0.776	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021831.1	NM_004474	
RBM15	64783	broad.mit.edu	37	1	110882038	110882038	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr1:110882038C>T	ENST00000369784.3	+	1	911	c.11C>T	c.(10-12)gCg>gTg	p.A4V	RBM15_ENST00000602849.1_Missense_Mutation_p.A4V|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Missense_Mutation_p.A4V	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	4					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		ATGAGGACTGCGGGGCGGGAC	0.617			T	MKL1	acute megakaryocytic leukemia																																p.A4V		.		Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	.	RBM15-661	0			c.C11T						.						10.0	13.0	12.0					1																	110882038		2176	4251	6427	SO:0001583	missense	64783	exon1			GGACTGCGGGGCG	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.11C>T	1.37:g.110882038C>T	ENSP00000358799:p.Ala4Val	100	0		114	4	NM_022768	0	0	0	0	0	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	ENST00000369784.3	37	CCDS822.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.931643	0.34096	.	.	ENSG00000162775	ENST00000369784	T	0.19394	2.15	5.46	2.37	0.29283	.	0.687585	0.12587	N	0.455935	T	0.02929	0.0087	N	0.03608	-0.345	0.22185	N	0.999309	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.43163	-0.9408	10	0.48119	T	0.1	-0.2554	7.9627	0.30081	0.1365:0.7029:0.0:0.1607	.	4;4	Q96T37-3;Q96T37	.;RBM15_HUMAN	V	4	ENSP00000358799:A4V	ENSP00000358799:A4V	A	+	2	0	RBM15	110683561	0.006000	0.16342	0.797000	0.32132	0.980000	0.70556	-0.147000	0.10234	0.850000	0.35239	0.655000	0.94253	GCG	.		0.617	RBM15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000031114.2	NM_022768	
CRB1	23418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	197404443	197404443	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr1:197404443T>G	ENST00000367400.3	+	9	3585	c.3450T>G	c.(3448-3450)caT>caG	p.H1150Q	CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367397.1_Missense_Mutation_p.H531Q|CRB1_ENST00000367399.2_Missense_Mutation_p.H1038Q|CRB1_ENST00000535699.1_Missense_Mutation_p.H1126Q|CRB1_ENST00000544212.1_Missense_Mutation_p.H631Q|RP11-75C23.1_ENST00000422250.1_RNA	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1150	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CCTGTTTGCATGGAGGAAACT	0.423																																					p.H1150Q		.											.	CRB1-161	0			c.T3450G						.						125.0	103.0	111.0					1																	197404443		2203	4300	6503	SO:0001583	missense	23418	exon9			TTTGCATGGAGGA		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.3450T>G	1.37:g.197404443T>G	ENSP00000356370:p.His1150Gln	144	0		240	26	NM_201253	0	0	0	0	0	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	37	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	T	9.856	1.195012	0.22037	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	D;D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27;-3.27	5.7	-2.45	0.06481	EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.90456	0.7011	M	0.69358	2.11	0.48762	D	0.999704	B;B;B;B	0.25563	0.064;0.041;0.129;0.093	B;B;B;B	0.27262	0.035;0.022;0.073;0.078	T	0.79771	-0.1663	9	0.72032	D	0.01	.	9.3934	0.38388	0.0:0.437:0.105:0.4579	.	1126;1038;799;1150	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	Q	1126;1150;1038;631;531;799	ENSP00000438786:H1126Q;ENSP00000356370:H1150Q;ENSP00000356369:H1038Q;ENSP00000444556:H631Q;ENSP00000356367:H531Q	ENSP00000356367:H531Q	H	+	3	2	CRB1	195671066	0.991000	0.36638	0.950000	0.38849	0.255000	0.26057	0.193000	0.17116	-0.738000	0.04817	-0.417000	0.06048	CAT	.		0.423	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
LEFTY1	10637	hgsc.bcm.edu	37	1	226075608	226075608	+	Silent	SNP	G	G	A	rs12753531	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr1:226075608G>A	ENST00000272134.5	-	2	454	c.375C>T	c.(373-375)gtC>gtT	p.V125V	RP4-559A3.7_ENST00000432920.2_Missense_Mutation_p.P234S|LEFTY1_ENST00000492457.1_5'UTR	NM_020997.3	NP_066277.1	O75610	LFTY1_HUMAN	left-right determination factor 1	125					cell growth (GO:0016049)|determination of left/right symmetry (GO:0007368)|heart morphogenesis (GO:0003007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)				cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	10	Breast(184;0.197)					CGGCCTTGGGGACCGGCTCCT	0.741													G|||	803	0.160343	0.062	0.2017	5008	,	,		10390	0.1131		0.2674	False		,,,				2504	0.2025				p.V125V		.											.	LEFTY1-90	0			c.C375T						.						2.0	3.0	3.0					1																	226075608		1207	3063	4270	SO:0001819	synonymous_variant	10637	exon2			CTTGGGGACCGGC	AF081507	CCDS1548.1	1q42.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000243709	ENSG00000243709			6552	protein-coding gene	gene with protein product		603037	"""left-right determination, factor B"""	LEFTB		10053005, 10886363	Standard	NM_020997		Approved	LEFTYB	uc001hpo.3	O75610	OTTHUMG00000037443	ENST00000272134.5:c.375C>T	1.37:g.226075608G>A		0	0		7	5	NM_020997	0	0	0	0	0	B2R7U0|Q53H67|Q5TE94	Silent	SNP	ENST00000272134.5	37	CCDS1548.1	377	0.17261904761904762	30	0.06097560975609756	75	0.20718232044198895	75	0.13111888111888112	197	0.2598944591029024	G	8.535	0.871818	0.17322	.	.	ENSG00000255835	ENST00000432920	D	0.82433	-1.61	3.63	1.62	0.23740	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.54753	P	1.3000000000040757E-5	B	0.26935	0.164	B	0.22753	0.041	T	0.03608	-1.1020	7	0.87932	D	0	-3.7816	9.8091	0.40812	0.0:0.4316:0.5684:0.0	rs12753531	234	E7EUD8	.	S	234	ENSP00000414068:P234S	ENSP00000414068:P234S	P	-	1	0	RP4-559A3.7	224142231	0.576000	0.26700	0.314000	0.25224	0.044000	0.14063	0.105000	0.15333	0.142000	0.18901	-0.676000	0.03789	CCC	G|0.827;A|0.173		0.741	LEFTY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091155.1	NM_020997	
LGALS8	3964	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	236700878	236700878	+	Missense_Mutation	SNP	G	G	A	rs372966341		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr1:236700878G>A	ENST00000366584.4	+	3	693	c.127G>A	c.(127-129)Gca>Aca	p.A43T	LGALS8_ENST00000450372.2_Missense_Mutation_p.A43T|LGALS8_ENST00000341872.6_Missense_Mutation_p.A43T|LGALS8_ENST00000527974.1_Missense_Mutation_p.A43T|LGALS8_ENST00000526589.1_Missense_Mutation_p.A43T|LGALS8_ENST00000352231.2_Missense_Mutation_p.A43T|LGALS8_ENST00000416919.2_Missense_Mutation_p.A43T|LGALS8_ENST00000526634.1_Missense_Mutation_p.A43T|LGALS8_ENST00000525042.1_Missense_Mutation_p.A43T|LGALS8_ENST00000323938.6_Missense_Mutation_p.A43T|RP11-385F5.4_ENST00000433131.1_RNA|RP11-385F5.5_ENST00000608547.1_RNA	NM_201544.2	NP_963838.1	O00214	LEG8_HUMAN	lectin, galactoside-binding, soluble, 8	43	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.				plasma cell differentiation (GO:0002317)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(5)	20	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.0253)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TCCTAGTGACGCAGACAGGTA	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		17598	0.0		0.0	False		,,,				2504	0.001				p.A43T		.											.	LGALS8-91	0			c.G127A						.						102.0	84.0	90.0					1																	236700878		2203	4300	6503	SO:0001583	missense	3964	exon4			AGTGACGCAGACA	X91790	CCDS1611.1, CCDS1612.1	1q43	2011-08-04	2008-07-25		ENSG00000116977	ENSG00000116977		"""Lectins, galactoside-binding"""	6569	protein-coding gene	gene with protein product	"""galectin 8"""	606099				7852431, 8692978	Standard	NM_201545		Approved	PCTA-1	uc001hxy.2	O00214	OTTHUMG00000039953	ENST00000366584.4:c.127G>A	1.37:g.236700878G>A	ENSP00000355543:p.Ala43Thr	134	0		185	87	NM_006499	0	0	0	1	1	O15215|Q5T3P5|Q5T3Q4|Q8TEV1|Q96B92|Q9BXC8|Q9H584|Q9H585|Q9UEZ6|Q9UP32|Q9UP33|Q9UP34	Missense_Mutation	SNP	ENST00000366584.4	37	CCDS1612.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.853117	0.51270	.	.	ENSG00000116977	ENST00000481485;ENST00000454943;ENST00000527974;ENST00000430527;ENST00000352231;ENST00000406509;ENST00000526589;ENST00000529489;ENST00000341872;ENST00000450372;ENST00000366584;ENST00000238181;ENST00000356238;ENST00000416919;ENST00000323938;ENST00000526634;ENST00000525042	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.69175	3.3;3.3;3.3;3.3;3.3;3.3;3.3;-0.38;3.3;3.3;3.3;3.3;3.3;2.59;3.3;3.3	5.45	2.23	0.28157	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.474209	0.22320	N	0.061615	T	0.79759	0.4501	M	0.88906	2.99	0.27256	N	0.958766	P;D;P	0.63880	0.875;0.993;0.929	B;P;P	0.54924	0.357;0.764;0.478	T	0.76394	-0.2975	10	0.72032	D	0.01	-0.0539	14.8892	0.70594	0.0:0.0:0.3311:0.6689	.	43;43;43	F6V2D4;O00214;O00214-2	.;LEG8_HUMAN;.	T	43	ENSP00000435632:A43T;ENSP00000405504:A43T;ENSP00000431398:A43T;ENSP00000398630:A43T;ENSP00000309576:A43T;ENSP00000385999:A43T;ENSP00000435460:A43T;ENSP00000437007:A43T;ENSP00000342139:A43T;ENSP00000408657:A43T;ENSP00000355543:A43T;ENSP00000238181:A43T;ENSP00000410843:A43T;ENSP00000434860:A43T;ENSP00000437040:A43T;ENSP00000431884:A43T	ENSP00000238181:A43T	A	+	1	0	LGALS8	234767501	0.998000	0.40836	0.002000	0.10522	0.016000	0.09150	2.417000	0.44653	0.252000	0.21531	0.591000	0.81541	GCA	.		0.423	LGALS8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000096365.2	NM_006499	
WDR37	22884	hgsc.bcm.edu	37	10	1094906	1094906	+	5'Flank	SNP	C	C	T	rs7091756	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:1094906C>T	ENST00000358220.1	+	0	0				IDI1_ENST00000381344.3_Missense_Mutation_p.C13Y|IDI1_ENST00000491735.1_5'UTR			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37											breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		ccgggccgcgcAGCCAATCGC	0.721													C|||	154	0.0307508	0.0038	0.0317	5008	,	,		13577	0.0		0.0368	False		,,,				2504	0.092				p.C13Y		.											.	IDI1-90	0			c.G38A						.	C	TYR/CYS	42,3924		1,40,1942	4.0	6.0	5.0		38	-3.5	0.0	10	dbSNP_116	5	362,7338		7,348,3495	no	missense	IDI1	NM_004508.2	194	8,388,5437	TT,TC,CC		4.7013,1.059,3.4631	benign	13/285	1094906	404,11262	1983	3850	5833	SO:0001631	upstream_gene_variant	3422	exon1			GCCGCGCAGCCAA	AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540		10.37:g.1094906C>T	Exception_encountered	5	0		23	5	NM_004508	0	0	4	4	0	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	ENST00000358220.1	37	CCDS7057.1	45	0.020604395604395604	5	0.01016260162601626	9	0.024861878453038673	0	0.0	31	0.040897097625329816	C	0.031	-1.335823	0.01287	0.01059	0.047013	ENSG00000067064	ENST00000381344	.	.	.	1.77	-3.54	0.04653	.	3.373570	0.01792	U	0.032349	T	0.01940	0.0061	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17715	-1.0360	8	0.02654	T	1	.	4.1354	0.10169	0.0:0.2425:0.3482:0.4093	rs7091756;rs7091756	13	Q13907-2	.	Y	13	.	ENSP00000370748:C13Y	C	-	2	0	IDI1	1084906	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.721000	0.01870	-1.854000	0.01163	-0.350000	0.07774	TGC	C|0.981;T|0.019		0.721	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046418.1	NM_014023	
PITRM1	10531	bcgsc.ca	37	10	3180227	3180227	+	Missense_Mutation	SNP	T	T	C	rs6901	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:3180227T>C	ENST00000224949.4	-	27	3144	c.3110A>G	c.(3109-3111)cAa>cGa	p.Q1037R	PITRM1_ENST00000451104.2_Missense_Mutation_p.Q939R|PITRM1_ENST00000380989.2_Missense_Mutation_p.Q1038R|PITRM1_ENST00000464395.1_5'UTR|PITRM1_ENST00000380994.1_Missense_Mutation_p.Q595R			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	1037			Q -> R (in dbSNP:rs6901). {ECO:0000269|PubMed:10360838, ECO:0000269|PubMed:10470851, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GGCTGCTCATTGGATGATCCA	0.532													C|||	3527	0.704273	0.6861	0.6527	5008	,	,		17679	0.7361		0.7177	False		,,,				2504	0.7188				p.Q1038R		.											.	PITRM1-91	0			c.A3113G						.	C	ARG/GLN,ARG/GLN,ARG/GLN	2947,1129		1086,775,177	45.0	47.0	46.0		3113,2816,3110	0.7	0.0	10	dbSNP_52	46	5936,2422		2087,1762,330	yes	missense,missense,missense	PITRM1	NM_001242307.1,NM_001242309.1,NM_014889.3	43,43,43	3173,2537,507	CC,CT,TT		28.9782,27.6987,28.5588	possibly-damaging,possibly-damaging,possibly-damaging	1038/1039,939/940,1037/1038	3180227	8883,3551	2038	4179	6217	SO:0001583	missense	10531	exon27			GCTCATTGGATGA	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.3110A>G	10.37:g.3180227T>C	ENSP00000224949:p.Gln1037Arg	111	1		60	4	NM_001242307	0	0	75	75	0	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	1591	0.7284798534798534	341	0.693089430894309	261	0.7209944751381215	438	0.7657342657342657	551	0.7269129287598944	N	1.692	-0.503836	0.04261	0.723013	0.710218	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104	T;T;T;T	0.07021	3.88;3.88;3.23;3.78	5.77	0.73	0.18271	.	0.186925	0.56097	N	0.000038	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35968	-0.9767	8	0.02654	T	1	-7.7767	9.6658	0.39983	0.0:0.5963:0.0:0.4037	rs6901;rs1043125;rs3182597;rs17712119;rs17855356;rs17855373;rs6901	939;972	E7ES23;E9PDX7	.;.	R	1037;1030;1038;595;939	ENSP00000224949:Q1037R;ENSP00000370377:Q1038R;ENSP00000370382:Q595R;ENSP00000401201:Q939R	ENSP00000224949:Q1037R	Q	-	2	0	PITRM1	3170227	0.853000	0.29707	0.000000	0.03702	0.000000	0.00434	0.767000	0.26575	-0.351000	0.08249	-0.282000	0.10007	CAA	T|0.276;C|0.724		0.532	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
PTPLA	9200	hgsc.bcm.edu	37	10	17659265	17659265	+	Missense_Mutation	SNP	G	G	C	rs118189437	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:17659265G>C	ENST00000361271.3	-	1	111	c.74C>G	c.(73-75)aCg>aGg	p.T25R	PTPLA_ENST00000326961.6_Missense_Mutation_p.T25R	NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	25					fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						CGGCAGGAGCGTGGGAGGGGA	0.771													G|||	169	0.033746	0.0356	0.0173	5008	,	,		6590	0.0605		0.0258	False		,,,				2504	0.0235				p.T25R		.											.	PTPLA-226	0			c.C74G						.	G	ARG/THR	29,2887		0,29,1429	2.0	3.0	3.0		74	0.8	0.0	10	dbSNP_132	3	89,5607		0,89,2759	no	missense	PTPLA	NM_014241.3	71	0,118,4188	CC,CG,GG		1.5625,0.9945,1.3702	benign	25/289	17659265	118,8494	1458	2848	4306	SO:0001583	missense	9200	exon1			AGGAGCGTGGGAG	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.74C>G	10.37:g.17659265G>C	ENSP00000355308:p.Thr25Arg	4	0		8	6	NM_014241	0	0	0	0	0	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	ENST00000361271.3	37	CCDS7121.1	95	0.043498168498168496	26	0.052845528455284556	12	0.03314917127071823	35	0.06118881118881119	22	0.029023746701846966	G	5.066	0.197875	0.09652	0.009945	0.015625	ENSG00000165996	ENST00000361271;ENST00000326961	T;T	0.19806	2.77;2.12	2.87	0.783	0.18572	.	1.761270	0.03669	U	0.243737	T	0.01905	0.0060	N	0.08118	0	0.09310	N	1	D;P;B	0.60160	0.987;0.858;0.18	P;B;B	0.52514	0.701;0.371;0.026	T	0.17992	-1.0351	10	0.62326	D	0.03	-15.5079	7.1013	0.25338	0.0:0.0:0.5121:0.4879	.	25;25;25	A6NP58;B0YJ81-2;B0YJ81	.;.;HACD1_HUMAN	R	25	ENSP00000355308:T25R;ENSP00000322923:T25R	ENSP00000322923:T25R	T	-	2	0	PTPLA	17699271	0.887000	0.30362	0.005000	0.12908	0.004000	0.04260	0.457000	0.21875	0.204000	0.20548	-0.302000	0.09304	ACG	G|0.955;C|0.045		0.771	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
NPY4R	5540	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	47087602	47087602	+	Silent	SNP	C	C	A			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:47087602C>A	ENST00000395716.1	+	2	904	c.819C>A	c.(817-819)gcC>gcA	p.A273A	NPY4R_ENST00000374312.1_Silent_p.A273A			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	273					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										TGGTGGTGGCCTTTGCTGTGC	0.587																																					p.A273A		.											.	PPYR1-524	0			c.C819A						.						156.0	111.0	126.0					10																	47087602		2203	4300	6503	SO:0001819	synonymous_variant	5540	exon3			GGTGGCCTTTGCT		CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.819C>A	10.37:g.47087602C>A		95	0		135	30	NM_005972	0	0	0	0	0	Q13456|Q5ISU3|Q5T2X9|Q6FH06	Silent	SNP	ENST00000395716.1	37	CCDS31193.1																																																																																			.		0.587	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047837.1		
KIAA1279	26128	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	70748621	70748621	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:70748621G>C	ENST00000361983.4	+	1	135	c.33G>C	c.(31-33)gaG>gaC	p.E11D		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	11					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						AGGTCTGCGAGAAATTCCAGG	0.582											OREG0020215	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E11D		.											.	KIAA1279-91	0			c.G33C						.						49.0	58.0	55.0					10																	70748621		2203	4300	6503	SO:0001583	missense	26128	exon1			CTGCGAGAAATTC	BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.33G>C	10.37:g.70748621G>C	ENSP00000354848:p.Glu11Asp	211	1	1124	234	42	NM_015634	0	0	4	5	1	A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Missense_Mutation	SNP	ENST00000361983.4	37	CCDS7284.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891221	0.52014	.	.	ENSG00000198954	ENST00000361983	T	0.50277	0.75	5.73	4.78	0.61160	.	0.147635	0.64402	D	0.000011	T	0.43656	0.1257	L	0.49350	1.555	0.58432	D	0.999997	B	0.22276	0.067	B	0.15052	0.012	T	0.31752	-0.9932	10	0.39692	T	0.17	-12.8144	16.2343	0.82363	0.0:0.1327:0.8673:0.0	.	11	Q96EK5	KBP_HUMAN	D	11	ENSP00000354848:E11D	ENSP00000354848:E11D	E	+	3	2	KIAA1279	70418627	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	1.078000	0.30754	2.699000	0.92147	0.650000	0.86243	GAG	.		0.582	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048370.1	NM_015634	
PAPSS2	9060	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	89474830	89474831	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:89474830_89474831delCT	ENST00000361175.4	+	6	1097_1098	c.728_729delCT	c.(727-729)actfs	p.T243fs	PAPSS2_ENST00000456849.1_Frame_Shift_Del_p.T243fs|PAPSS2_ENST00000427144.2_Frame_Shift_Del_p.T247fs	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	243					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		GAGGCTGAAACTCTCCCTTCAT	0.356																																					p.243_243del		.											.	PAPSS2-493	0			c.728_729del						.																																			SO:0001589	frameshift_variant	9060	exon6			CTGAAACTCTCCC	AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.728_729delCT	10.37:g.89474832_89474833delCT	ENSP00000354436:p.Thr243fs	102	0		101	39	NM_001015880	0	0	0	0	0	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Frame_Shift_Del	DEL	ENST00000361175.4	37	CCDS7385.1																																																																																			.		0.356	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049229.1		
HECTD2	143279	hgsc.bcm.edu	37	10	93170250	93170250	+	Missense_Mutation	SNP	C	C	G	rs7081569		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:93170250C>G	ENST00000298068.5	+	1	149	c.55C>G	c.(55-57)Ccc>Gcc	p.P19A	HECTD2_ENST00000446394.1_Missense_Mutation_p.P19A|HECTD2_ENST00000371681.4_Missense_Mutation_p.P19A	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	19			P -> A (in dbSNP:rs7081569). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GGTGGCGGCGCCCGCGCCTGA	0.761													G|||	5008	1.0	1.0	1.0	5008	,	,		7483	1.0		1.0	False		,,,				2504	1.0				p.P19A	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2-658	0			c.C55G						.						2.0	2.0	2.0					10																	93170250		1173	2544	3717	SO:0001583	missense	143279	exon1			GCGGCGCCCGCGC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.55C>G	10.37:g.93170250C>G	ENSP00000298068:p.Pro19Ala	0	0		6	6	NM_182765	0	0	0	1	1	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	1998	0.9148351648351648	429	0.8719512195121951	335	0.925414364640884	529	0.9248251748251748	705	0.9300791556728232	g	1.760	-0.486925	0.04352	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.36699	1.5;1.24;1.5	2.37	2.37	0.29283	.	0.964307	0.08409	N	0.950145	T	0.00012	0.0000	N	0.00538	-1.39	0.46241	P	0.001052000000000053	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32534	-0.9903	9	0.02654	T	1	.	7.1033	0.25351	0.0:0.2826:0.7174:0.0	rs7081569	19;19;19	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	A	19	ENSP00000401023:P19A;ENSP00000360746:P19A;ENSP00000298068:P19A	ENSP00000298068:P19A	P	+	1	0	HECTD2	93160230	0.858000	0.29795	0.231000	0.23993	0.735000	0.41995	-0.544000	0.06077	0.556000	0.29098	-0.370000	0.07254	CCC	C|0.154;G|0.846		0.761	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
SLK	9748	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	105779553	105779553	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:105779553C>T	ENST00000369755.3	+	16	3739	c.3194C>T	c.(3193-3195)aCt>aTt	p.T1065I	SLK_ENST00000335753.4_Missense_Mutation_p.T1034I	NM_014720.2	NP_055535.2	Q9H2G2	SLK_HUMAN	STE20-like kinase	1065					apoptotic process (GO:0006915)|protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			kidney(1)|lung(1)|ovary(2)|skin(2)|stomach(2)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		AACAGACAGACTCAAGAAAGA	0.403																																					p.T1065I	NSCLC(111;540 1651 1927 4474 17706)	.											.	SLK-549	0			c.C3194T						.						108.0	109.0	109.0					10																	105779553		2203	4300	6503	SO:0001583	missense	9748	exon16			GACAGACTCAAGA		CCDS7553.1	10q25.1	2010-06-25	2010-06-25		ENSG00000065613	ENSG00000065613			11088	protein-coding gene	gene with protein product			"""SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase (yeast)"", ""STE20-like kinase (yeast)"""			3526554	Standard	NM_014720		Approved	STK2, se20-9, KIAA0204	uc001kxo.1	Q9H2G2	OTTHUMG00000018999	ENST00000369755.3:c.3194C>T	10.37:g.105779553C>T	ENSP00000358770:p.Thr1065Ile	212	0		202	37	NM_014720	0	0	28	33	5	D3DRA0|D3DRA1|O00211|Q6P1Z4|Q86WU7|Q86WW1|Q92603|Q9NQL0|Q9NQL1	Missense_Mutation	SNP	ENST00000369755.3	37	CCDS7553.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.575429	0.86645	.	.	ENSG00000065613	ENST00000335753;ENST00000369755	T;T	0.33438	1.41;1.41	5.2	4.29	0.51040	Protein kinase-like domain (1);	0.054190	0.85682	D	0.000000	T	0.47192	0.1432	L	0.57536	1.79	0.58432	D	0.999999	D;D	0.55800	0.967;0.973	P;P	0.58013	0.676;0.831	T	0.51426	-0.8707	10	0.72032	D	0.01	.	15.2253	0.73345	0.1416:0.8584:0.0:0.0	.	1034;1065	Q9H2G2-2;Q9H2G2	.;SLK_HUMAN	I	1034;1065	ENSP00000336824:T1034I;ENSP00000358770:T1065I	ENSP00000336824:T1034I	T	+	2	0	SLK	105769543	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.792000	0.62467	1.398000	0.46701	0.484000	0.47621	ACT	.		0.403	SLK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050188.1	NM_014720	
SMC3	9126	bcgsc.ca	37	10	112363001	112363001	+	Silent	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:112363001C>T	ENST00000361804.4	+	28	3661	c.3535C>T	c.(3535-3537)Ctg>Ttg	p.L1179L		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	1179					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TAGGCCTGAACTGCTTGAGTC	0.284																																					p.L1179L		.											.	SMC3-92	0			c.C3535T						.						63.0	67.0	66.0					10																	112363001		2203	4292	6495	SO:0001819	synonymous_variant	9126	exon28			CCTGAACTGCTTG	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.3535C>T	10.37:g.112363001C>T		133	0		135	5	NM_005445	0	0	63	63	0	A8K156|O60464|Q5T482	Silent	SNP	ENST00000361804.4	37	CCDS31285.1																																																																																			.		0.284	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
PNPLA2	57104	hgsc.bcm.edu	37	11	824789	824789	+	Missense_Mutation	SNP	T	T	C	rs1138693	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:824789T>C	ENST00000336615.4	+	10	1644	c.1442T>C	c.(1441-1443)cTg>cCg	p.L481P	AP006621.8_ENST00000528982.1_RNA|EFCAB4A_ENST00000528542.2_5'Flank|AP006621.8_ENST00000532946.1_RNA|EFCAB4A_ENST00000450448.1_5'Flank	NM_020376.3	NP_065109.1	Q96AD5	PLPL2_HUMAN	patatin-like phospholipase domain containing 2	481			L -> P (in dbSNP:rs1138693). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:16644682, ECO:0000269|Ref.2}.		acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of sequestering of triglyceride (GO:0010891)|phospholipid metabolic process (GO:0006644)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|lung(4)|prostate(1)|urinary_tract(1)	9		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.63e-25)|Epithelial(43;1.28e-24)|OV - Ovarian serous cystadenocarcinoma(40;7.09e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGCACCAGCTGGCCGGGCCT	0.751													-|||	3277	0.654353	0.7133	0.7709	5008	,	,		10714	0.6002		0.7058	False		,,,				2504	0.4949				p.L481P		.											.	PNPLA2-90	0			c.T1442C						.	-	PRO/LEU	1997,839		756,485,177	2.0	3.0	3.0		1442		0.0	11	dbSNP_86	3	4530,1868		1710,1110,379	no	missense	PNPLA2	NM_020376.3	98	2466,1595,556	CC,CT,TT		29.1966,29.5839,29.3156	possibly-damaging	481/505	824789	6527,2707	1418	3199	4617	SO:0001583	missense	57104	exon10			ACCAGCTGGCCGG	AJ278475	CCDS7718.1	11p15.5	2014-03-14			ENSG00000177666	ENSG00000177666	3.1.1.3	"""Patatin-like phospholipase domain containing"""	30802	protein-coding gene	gene with protein product		609059				8619474, 16799181, 19029121	Standard	NM_020376		Approved	desnutrin, TTS-2.2, ATGL, FP17548, iPLA2zeta	uc001lrt.3	Q96AD5	OTTHUMG00000133309	ENST00000336615.4:c.1442T>C	11.37:g.824789T>C	ENSP00000337701:p.Leu481Pro	0	0		7	7	NM_020376	0	0	0	228	228	O60643|Q5EFF5|Q6XYE5|Q96ET6|Q9NQ61|Q9NQ62	Missense_Mutation	SNP	ENST00000336615.4	37	CCDS7718.1	1526	0.6987179487179487	356	0.7235772357723578	265	0.7320441988950276	378	0.6608391608391608	527	0.6952506596306068	-	10.58	1.389293	0.25118	0.704161	0.708034	ENSG00000177666	ENST00000336615	T	0.32272	1.46	.	.	.	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P	0.51240	0.943	P	0.55011	0.766	T	0.23940	-1.0174	6	0.07175	T	0.84	.	.	.	.	rs1138693;rs3202695;rs17851512;rs57764436	481	Q96AD5	PLPL2_HUMAN	P	481	ENSP00000337701:L481P	ENSP00000337701:L481P	L	+	2	0	PNPLA2	814789	0.003000	0.15002	0.009000	0.14445	0.006000	0.05464	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	CTG	T|0.300;C|0.700		0.751	PNPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257106.1	NM_020376	
OR52E6	390078	bcgsc.ca	37	11	5862845	5862845	+	Missense_Mutation	SNP	A	A	G	rs4592451	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:5862845A>G	ENST00000329322.5	-	1	282	c.283T>C	c.(283-285)Tct>Cct	p.S95P	TRIM5_ENST00000380027.1_Intron|OR52E6_ENST00000379946.2_Missense_Mutation_p.S99P	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	95			S -> P (in dbSNP:rs4592451).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTCCAAAAGATATTTCCTTG	0.468													A|||	1923	0.383986	0.3782	0.3184	5008	,	,		22268	0.4593		0.3728	False		,,,				2504	0.3722				p.S95P		.											.	OR52E6-68	0			c.T283C						.	A	PRO/SER	1619,2783	499.1+/-364.3	294,1031,876	134.0	133.0	133.0		283	-4.4	0.0	11	dbSNP_111	133	3009,5583	464.1+/-366.1	533,1943,1820	yes	missense	OR52E6	NM_001005167.1	74	827,2974,2696	GG,GA,AA		35.0209,36.7787,35.6164	possibly-damaging	95/314	5862845	4628,8366	2201	4296	6497	SO:0001583	missense	390078	exon1			CAAAAGATATTTC	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.283T>C	11.37:g.5862845A>G	ENSP00000328878:p.Ser95Pro	199	1		226	7	NM_001005167	0	0	0	0	0	Q6IFF8	Missense_Mutation	SNP	ENST00000329322.5	37	CCDS53597.1	879	0.4024725274725275	201	0.40853658536585363	120	0.3314917127071823	264	0.46153846153846156	294	0.38786279683377306	A	14.27	2.483961	0.44147	0.367787	0.350209	ENSG00000205409	ENST00000329322;ENST00000379946	T;T	0.41400	1.0;1.0	3.64	-4.43	0.03568	GPCR, rhodopsin-like superfamily (1);	0.410878	0.20792	N	0.085583	T	0.00012	0.0000	M	0.73598	2.24	0.80722	P	0.0	P	0.48016	0.904	P	0.49597	0.616	T	0.27502	-1.0072	9	0.54805	T	0.06	.	5.397	0.16275	0.2086:0.4033:0.0:0.3881	rs4592451;rs52793358;rs4592451	95	Q96RD3	O52E6_HUMAN	P	95;99	ENSP00000328878:S95P;ENSP00000369279:S99P	ENSP00000328878:S95P	S	-	1	0	OR52E6	5819421	0.000000	0.05858	0.000000	0.03702	0.762000	0.43233	-4.844000	0.00179	-0.345000	0.08325	0.450000	0.29827	TCT	A|0.608;G|0.392		0.468	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167	
CREB3L1	90993	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	46321507	46321507	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:46321507C>T	ENST00000529193.1	+	2	575	c.124C>T	c.(124-126)Cac>Tac	p.H42Y	CREB3L1_ENST00000288400.3_Missense_Mutation_p.H42Y			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	42	Required for transcriptional activation.				regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		GCACCTGGACCACTTTACGGA	0.527			T	FUS	myxofibrosarcoma																																p.H42Y	Pancreas(3;159 194 19597 26278 47995)	.		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	.	CREB3L1-92	0			c.C124T						.						102.0	99.0	100.0					11																	46321507		2042	4188	6230	SO:0001583	missense	90993	exon2			CTGGACCACTTTA		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.124C>T	11.37:g.46321507C>T	ENSP00000434939:p.His42Tyr	343	0		310	112	NM_052854	0	0	0	0	0	Q8N2D5|Q96CP0	Missense_Mutation	SNP	ENST00000529193.1	37	CCDS53620.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531744	0.85706	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415	T;T	0.14266	2.52;2.52	5.56	5.56	0.83823	.	0.589852	0.15899	N	0.239164	T	0.36193	0.0958	M	0.64404	1.975	0.39676	D	0.970825	D	0.63880	0.993	D	0.70227	0.968	T	0.01496	-1.1340	10	0.39692	T	0.17	-39.0072	17.7051	0.88306	0.0:1.0:0.0:0.0	.	42	Q96BA8	CR3L1_HUMAN	Y	42	ENSP00000434939:H42Y;ENSP00000288400:H42Y	ENSP00000288400:H42Y	H	+	1	0	CREB3L1	46278083	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.244000	0.72391	2.608000	0.88229	0.655000	0.94253	CAC	.		0.527	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854	
TMEM132A	54972	hgsc.bcm.edu	37	11	60701987	60701987	+	Silent	SNP	G	G	A	rs7715	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:60701987G>A	ENST00000453848.2	+	9	1745	c.1587G>A	c.(1585-1587)tcG>tcA	p.S529S	TMEM132A_ENST00000005286.4_Silent_p.S530S			Q24JP5	T132A_HUMAN	transmembrane protein 132A	529						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CAGAGGCGTCGGATGAGGCCG	0.776													A|||	2111	0.421526	0.4713	0.4467	5008	,	,		10338	0.3165		0.4225	False		,,,				2504	0.4438				p.S530S		.											.	TMEM132A-227	0			c.G1590A						.	A	,	942,1508		213,516,496	2.0	2.0	2.0		1590,1587	-7.2	0.0	11	dbSNP_52	2	2096,3524		468,1160,1182	no	coding-synonymous,coding-synonymous	TMEM132A	NM_017870.3,NM_178031.2	,	681,1676,1678	AA,AG,GG		37.2954,38.449,37.6456	,	530/1025,529/1024	60701987	3038,5032	1225	2810	4035	SO:0001819	synonymous_variant	54972	exon9			GGCGTCGGATGAG	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1587G>A	11.37:g.60701987G>A		0	0		8	4	NM_017870	0	0	16	27	11	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Silent	SNP	ENST00000453848.2	37	CCDS44618.1	914	0.4184981684981685	245	0.49796747967479676	164	0.4530386740331492	185	0.32342657342657344	320	0.42216358839050133	A	4.934	0.173621	0.09391	0.38449	0.372954	ENSG00000006118	ENST00000536409	.	.	.	3.58	-7.16	0.01516	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999658343	.	.	.	.	.	.	T	0.36792	-0.9733	3	.	.	.	.	2.6854	0.05106	0.499:0.0869:0.2045:0.2096	rs7715;rs1054244;rs3168133;rs17341674;rs17349396;rs60745855	.	.	.	R	121	.	.	G	+	1	0	TMEM132A	60458563	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-2.810000	0.00348	-1.376000	0.01182	GGA	G|0.581;A|0.419		0.776	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
SNX15	29907	hgsc.bcm.edu	37	11	64809044	64809044	+	IGR	SNP	C	C	T	rs3741390	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:64809044C>T	ENST00000377244.3	+	0	1939				SAC3D1_ENST00000398846.1_Missense_Mutation_p.R94C|SAC3D1_ENST00000531072.1_Missense_Mutation_p.R94C|SAC3D1_ENST00000530213.1_3'UTR	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15						intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						CGACATCGCCCGCGCCGAGGT	0.741													C|||	1983	0.395966	0.3048	0.2406	5008	,	,		9020	0.7639		0.2952	False		,,,				2504	0.3538				p.R94C	Esophageal Squamous(56;269 1304 3324 8253)	.											.	SAC3D1-90	0			c.C280T						.	C	CYS/ARG	674,2248		69,536,856	2.0	2.0	2.0		280	0.5	0.7	11	dbSNP_107	2	1375,4853		151,1073,1890	yes	missense	SAC3D1	NM_013299.3	180	220,1609,2746	TT,TC,CC		22.0777,23.0664,22.3934	benign	94/359	64809044	2049,7101	1461	3114	4575	SO:0001628	intergenic_variant	29901	exon1			ATCGCCCGCGCCG	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387		11.37:g.64809044C>T		0	0		5	5	NM_013299	0	0	0	0	0	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	CCDS8089.1	911	0.41712454212454214	152	0.3089430894308943	91	0.2513812154696133	436	0.7622377622377622	232	0.30606860158311344	C	11.09	1.536492	0.27475	0.230664	0.220777	ENSG00000168061	ENST00000531072;ENST00000398846;ENST00000301885;ENST00000529996	T;T;T	0.29397	1.57;1.57;1.57	3.79	0.512	0.16994	.	0.982626	0.08258	N	0.973424	T	0.00012	0.0000	N	0.16478	0.41	0.51767	P	6.20000000000065E-5	B	0.10296	0.003	B	0.06405	0.002	T	0.30794	-0.9966	9	0.33940	T	0.23	-5.3095	5.0725	0.14613	0.0:0.5967:0.1758:0.2275	rs3741390	140	A6NKF1	SAC31_HUMAN	C	94;94;139;110	ENSP00000436649:R94C;ENSP00000381824:R94C;ENSP00000436704:R110C	ENSP00000301885:R139C	R	+	1	0	SAC3D1	64565620	0.001000	0.12720	0.713000	0.30519	0.497000	0.33675	0.178000	0.16820	0.372000	0.24591	0.561000	0.74099	CGC	C|0.582;T|0.418		0.741	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
SNX15	29907	hgsc.bcm.edu	37	11	64809090	64809090	+	IGR	SNP	T	T	G	rs12271134	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:64809090T>G	ENST00000377244.3	+	0	1939				SAC3D1_ENST00000398846.1_Missense_Mutation_p.L109R|SAC3D1_ENST00000531072.1_Missense_Mutation_p.L109R|SAC3D1_ENST00000530213.1_3'UTR	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15						intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						CGAGCTGTGCTCCTGGACCTG	0.746													G|||	4995	0.997404	0.9909	0.9986	5008	,	,		9130	1.0		1.0	False		,,,				2504	1.0				p.L109R	Esophageal Squamous(56;269 1304 3324 8253)	.											.	SAC3D1-90	0			c.T326G						.	G	ARG/LEU	2642,10		1316,10,0	2.0	2.0	2.0		326	3.9	0.9	11	dbSNP_120	2	5685,1		2842,1,0	no	missense	SAC3D1	NM_013299.3	102	4158,11,0	GG,GT,TT		0.0176,0.3771,0.1319	benign	109/359	64809090	8327,11	1326	2843	4169	SO:0001628	intergenic_variant	29901	exon1			CTGTGCTCCTGGA	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387		11.37:g.64809090T>G		0	0		7	7	NM_013299	0	0	0	3	3	E5KQS6|Q9NRS5	Missense_Mutation	SNP	ENST00000377244.3	37	CCDS8089.1	2174	0.9954212454212454	489	0.9939024390243902	361	0.9972375690607734	566	0.9895104895104895	758	1.0	G	5.044	0.193816	0.09599	0.996229	0.999824	ENSG00000168061	ENST00000531072;ENST00000398846;ENST00000301885;ENST00000529996	T;T;T	0.20598	2.06;2.06;2.06	3.9	3.9	0.45041	.	0.000000	0.38272	N	0.001754	T	0.00012	0.0000	N	0.00104	-2.125	0.53688	P	2.8999999999945736E-5	B	0.02656	0.0	B	0.01281	0.0	T	0.37798	-0.9690	9	0.02654	T	1	-10.6158	10.9504	0.47325	0.0:0.0:0.811:0.189	rs12271134	155	A6NKF1	SAC31_HUMAN	R	109;109;154;125	ENSP00000436649:L109R;ENSP00000381824:L109R;ENSP00000436704:L125R	ENSP00000301885:L154R	L	+	2	0	SAC3D1	64565666	1.000000	0.71417	0.924000	0.36721	0.504000	0.33889	3.759000	0.55227	1.003000	0.39130	-0.217000	0.12591	CTC	T|0.005;G|0.995		0.746	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
SNX15	29907	hgsc.bcm.edu	37	11	64809133	64809133	+	IGR	SNP	T	T	G	rs10792455	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:64809133T>G	ENST00000377244.3	+	0	1939				SAC3D1_ENST00000398846.1_Silent_p.A123A|SAC3D1_ENST00000531072.1_Silent_p.A123A|SAC3D1_ENST00000530213.1_3'UTR	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15						intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						CCGAGGCAGCTGTGGTGCTGG	0.766													G|||	4208	0.840256	0.7663	0.8847	5008	,	,		9082	0.9435		0.9165	False		,,,				2504	0.7239				p.A123A	Esophageal Squamous(56;269 1304 3324 8253)	.											.	SAC3D1-90	0			c.T369G						.	G		1946,276		838,270,3	1.0	2.0	2.0		369	-0.5	0.0	11	dbSNP_120	2	4412,256		2084,244,6	no	coding-synonymous	SAC3D1	NM_013299.3		2922,514,9	GG,GT,TT		5.4841,12.4212,7.7213		123/359	64809133	6358,532	1111	2334	3445	SO:0001628	intergenic_variant	29901	exon1			GGCAGCTGTGGTG	AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387		11.37:g.64809133T>G		0	0		6	6	NM_013299	0	0	0	3	3	E5KQS6|Q9NRS5	Silent	SNP	ENST00000377244.3	37	CCDS8089.1																																																																																			T|0.119;G|0.881		0.766	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091004.3		
SIPA1	6494	hgsc.bcm.edu	37	11	65415028	65415028	+	Silent	SNP	T	T	G	rs4930157	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:65415028T>G	ENST00000394224.3	+	9	2501	c.2205T>G	c.(2203-2205)acT>acG	p.T735T	SIPA1_ENST00000527525.1_Silent_p.T633T|MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000534313.1_Silent_p.T735T|SIPA1_ENST00000394227.3_Silent_p.T633T	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	735	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						GCGGCCAGACTCTGCCCAGCC	0.761													G|||	4990	0.996406	0.9864	1.0	5008	,	,		5950	1.0		1.0	False		,,,				2504	1.0				p.T735T		.											.	SIPA1-90	0			c.T2205G						.	G	,	2501,29		1236,29,0	2.0	2.0	2.0		2205,2205	-0.2	1.0	11	dbSNP_111	2	5264,4		2630,4,0	no	coding-synonymous,coding-synonymous	SIPA1	NM_006747.3,NM_153253.29	,	3866,33,0	GG,GT,TT		0.0759,1.1462,0.4232	,	735/1043,735/1043	65415028	7765,33	1265	2634	3899	SO:0001819	synonymous_variant	6494	exon9			CCAGACTCTGCCC	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.2205T>G	11.37:g.65415028T>G		0	0		7	7	NM_006747	0	0	0	5	5	O14518|O60484|O60618|Q2YD83	Silent	SNP	ENST00000394224.3	37	CCDS8108.1																																																																																			T|0.010;G|0.990		0.761	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	NM_006747	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		0	0		10	5	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751543	76751604	+	Frame_Shift_Del	DEL	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	-	rs544232471|rs34153015|rs182310862|rs11292200|rs77209527|rs539994853|rs201940118|rs11292199|rs200788398	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	TGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:76751543_76751604delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	ENST00000533140.1	+	2	1086_1147	c.948_1009delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	c.(946-1011)cttggagcgcgccggcctggcgcccagcggccacgagggcatcctggcccttcggcgtgcagcttgfs	p.LGARRPGAQRPRGHPGPSACSL316fs	B3GNT6_ENST00000421061.1_Splice_Site_p.GARRPGAQRPRGHPGP200fs|B3GNT6_ENST00000354301.5_Splice_Site_p.LERAGLAPSGHEGILALRRAA316fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GCATGTGTCTTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCTTGCCTGGCGC	0.71																																					p.316_336del		.											.	.	0			c.947_1006del						.																																			SO:0001589	frameshift_variant	192134	exon3			GTGTCTTGGAGCG	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.948_1009delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	11.37:g.76751543_76751604delTGGAGCGCGCCGGCCTGGCGCCCAGCGGCCACGAGGGCATCCTGGCCCTTCGGCGTGCAGCT	ENSP00000435352:p.Leu316fs	1	0		32	0	NM_138706	0	0	0	0	0	Q4TTN0	In_Frame_Del	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.710	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751585	76751604	+	Frame_Shift_Del	DEL	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	rs200788398|rs34153015|rs11292200|rs201940118|rs11292199	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	TGGCCCTTCGGCGTGCAGCT	TGGCCCTTCGGCGTGCAGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr11:76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENST00000533140.1	+	2	1128_1147	c.990_1009delTGGCCCTTCGGCGTGCAGCT	c.(988-1011)cctggcccttcggcgtgcagcttgfs	p.GPSACSL331fs	B3GNT6_ENST00000421061.1_Splice_Site_p.IGPSACS209fs|B3GNT6_ENST00000354301.5_Splice_Site_p.WPFGVQL330fs			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GAGGGCATCCTGGCCCTTCGGCGTGCAGCTTGCCTGGCGC	0.686																																					p.330_336del		.											.	.	0			c.989_1006del						.																																			SO:0001589	frameshift_variant	192134	exon4			GCATCCTGGCCCT	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.990_1009delTGGCCCTTCGGCGTGCAGCT	11.37:g.76751585_76751604delTGGCCCTTCGGCGTGCAGCT	ENSP00000435352:p.Gly331fs	4	0		41	0	NM_138706	0	0	0	0	0	Q4TTN0	In_Frame_Del	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.686	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		301	12		260	14	NM_032704	0	2	363	557	192		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
KRT7	3855	hgsc.bcm.edu	37	12	52627215	52627215	+	Silent	SNP	A	A	G	rs7308888	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr12:52627215A>G	ENST00000331817.5	+	1	318	c.135A>G	c.(133-135)tcA>tcG	p.S45S		NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	45	Head.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TCGGCGCCTCACGGCCGCGCG	0.771													g|||	4451	0.888778	0.9781	0.8473	5008	,	,		10346	0.9048		0.8191	False		,,,				2504	0.8528				p.S45S		.											.	KRT7-90	0			c.A135G						.			3161,173		1496,169,2	4.0	6.0	5.0		135	-5.3	0.0	12	dbSNP_116	5	5763,1251		2369,1025,113	no	coding-synonymous	KRT7	NM_005556.3		3865,1194,115	GG,GA,AA		17.8358,5.189,13.7611		45/470	52627215	8924,1424	1667	3507	5174	SO:0001819	synonymous_variant	3855	exon1			CGCCTCACGGCCG		CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.135A>G	12.37:g.52627215A>G		0	0		17	17	NM_005556	0	0	0	0	0	Q92676|Q9BUD8|Q9Y3R7	Silent	SNP	ENST00000331817.5	37	CCDS8822.1																																																																																			A|0.133;G|0.867		0.771	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404897.1	NM_005556	
TMCC3	57458	bcgsc.ca	37	12	94972290	94972290	+	Silent	SNP	C	C	T	rs2270893	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr12:94972290C>T	ENST00000261226.4	-	3	1142	c.1011G>A	c.(1009-1011)gaG>gaA	p.E337E	TMCC3_ENST00000551457.1_Silent_p.E306E	NM_020698.2	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	337						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	29						GCAGCTGGTCCTCCAGTCGCT	0.542													C|||	2604	0.519968	0.5234	0.5634	5008	,	,		16768	0.4653		0.5378	False		,,,				2504	0.5225				p.E337E		.											.	TMCC3-92	0			c.G1011A						.	C		2276,2130	598.6+/-389.1	590,1096,517	71.0	57.0	62.0		1011	-1.1	1.0	12	dbSNP_100	62	4626,3974	600.1+/-394.2	1263,2100,937	no	coding-synonymous	TMCC3	NM_020698.2		1853,3196,1454	TT,TC,CC		46.2093,48.3432,46.9322		337/478	94972290	6902,6104	2203	4300	6503	SO:0001819	synonymous_variant	57458	exon3			CTGGTCCTCCAGT	AB032971	CCDS31877.1, CCDS73506.1	12q22	2005-01-21	2005-07-13			ENSG00000057704		"""Transmembrane and coiled-coil domain containing"""	29199	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 3"""			10574461	Standard	XM_005269039		Approved	KIAA1145	uc001tdj.2	Q9ULS5	OTTHUMG00000170225	ENST00000261226.4:c.1011G>A	12.37:g.94972290C>T		69	0		82	5	NM_020698	0	0	3	3	0	Q8IWB2	Silent	SNP	ENST00000261226.4	37	CCDS31877.1																																																																																			C|0.474;T|0.526		0.542	TMCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408113.1	NM_020698	
NTN4	59277	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	96104338	96104338	+	Missense_Mutation	SNP	C	C	T	rs148021049	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr12:96104338C>T	ENST00000343702.4	-	5	1509	c.1061G>A	c.(1060-1062)cGt>cAt	p.R354H	NTN4_ENST00000344911.4_Missense_Mutation_p.R317H|NTN4_ENST00000552603.1_5'Flank|NTN4_ENST00000553059.1_Missense_Mutation_p.R354H|NTN4_ENST00000538383.1_Missense_Mutation_p.R317H	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	354	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						ACCACCACTACGATTCCCTGA	0.507																																					p.R354H		.											.	NTN4-92	0			c.G1061A						.	C	HIS/ARG	0,4406		0,0,2203	195.0	132.0	153.0		1061	4.5	0.8	12	dbSNP_134	153	3,8597	3.0+/-9.4	0,3,4297	no	missense	NTN4	NM_021229.3	29	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	possibly-damaging	354/629	96104338	3,13003	2203	4300	6503	SO:0001583	missense	59277	exon5			CCACTACGATTCC	AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1061G>A	12.37:g.96104338C>T	ENSP00000340998:p.Arg354His	184	0		174	84	NM_021229	0	0	13	19	6	B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Missense_Mutation	SNP	ENST00000343702.4	37	CCDS9054.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242671	0.39598	0.0	3.49E-4	ENSG00000074527	ENST00000343702;ENST00000344911;ENST00000538383;ENST00000553059	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.39	4.49	0.54785	EGF-like, laminin (3);	0.213089	0.50627	D	0.000112	T	0.71871	0.3391	L	0.59967	1.855	0.43308	D	0.995313	D;D	0.76494	0.999;0.998	D;D	0.64595	0.927;0.912	T	0.72060	-0.4404	10	0.45353	T	0.12	.	11.4491	0.50142	0.0:0.8548:0.0:0.1452	.	354;354	Q9HB63-2;Q9HB63	.;NET4_HUMAN	H	354;317;317;354	ENSP00000340998:R354H;ENSP00000339436:R317H;ENSP00000444432:R317H;ENSP00000447292:R354H	ENSP00000340998:R354H	R	-	2	0	NTN4	94628469	0.973000	0.33851	0.811000	0.32455	0.059000	0.15707	2.375000	0.44283	1.422000	0.47177	0.655000	0.94253	CGT	C|0.999;T|0.001		0.507	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408372.1	NM_021229	
FAM109A	144717	hgsc.bcm.edu	37	12	111800827	111800835	+	In_Frame_Del	DEL	GCCACCCCC	GCCACCCCC	-	rs3840795|rs139032867|rs199734407|rs200911236	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	GCCACCCCC	GCCACCCCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr12:111800827_111800835delGCCACCCCC	ENST00000547838.2	-	2	494_502	c.397_405delGGGGGTGGC	c.(397-405)gggggtggcdel	p.GGG133del	FAM109A_ENST00000361483.3_In_Frame_Del_p.GGG146del|FAM109A_ENST00000548163.1_In_Frame_Del_p.GGG133del|FAM109A_ENST00000450786.2_In_Frame_Del_p.113_116AGVA>A|FAM109A_ENST00000392658.5_In_Frame_Del_p.GGG133del			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	133					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G133M(1)|p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						gcagggCCATGCCACCCCCGCCACGTACA	0.732														1710	0.341454	0.233	0.3732	5008	,	,		9526	0.6518		0.2078	False		,,,				2504	0.2832				p.146_148del		.											.	FAM109A-90	3	Deletion - In frame(2)|Substitution - Missense(1)	breast(2)|ovary(1)	c.436_444del						.		,,	674,3090		134,406,1342				http://www.ncbi.nlm.nih.gov/sites/varvu?gene	,,	-4.5	0.0		dbSNP_107	6	1126,6432		186,754,2839	no	coding,coding,coding	FAM109A	NM_144671.4,NM_001177997.1,NM_001177996.1	,,	320,1160,4181	A1A1,A1R,RR		14.8981,17.9065,15.8983	,,	,,		1800,9522				SO:0001651	inframe_deletion	144717	exon4			GGCCATGCCACCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.397_405delGGGGGTGGC	12.37:g.111800827_111800835delGCCACCCCC	ENSP00000447353:p.Gly133_Gly135del	0	0		26	13	NM_001177996	0	0	0	0	0	J3KP50|Q6PJL9|Q96MH8	In_Frame_Del	DEL	ENST00000547838.2	37	CCDS9152.1																																																																																			.		0.732	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
OAS3	4940	bcgsc.ca	37	12	113386779	113386779	+	Missense_Mutation	SNP	C	C	G	rs2285933	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr12:113386779C>G	ENST00000228928.7	+	6	1322	c.1143C>G	c.(1141-1143)agC>agG	p.S381R	RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	381	Linker.		S -> R (in dbSNP:rs2285933). {ECO:0000269|PubMed:15489334}.		cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						GAGCAGGGAGCAAACCTCCCT	0.607													C|||	1405	0.280551	0.4092	0.379	5008	,	,		19978	0.1577		0.2565	False		,,,				2504	0.1881				p.S381R		.											.	OAS3-1	0			c.C1143G						.	C	ARG/SER	1450,2514		249,952,781	37.0	41.0	40.0		1143	0.0	0.0	12	dbSNP_100	40	2178,6156		291,1596,2280	yes	missense	OAS3	NM_006187.2	110	540,2548,3061	GG,GC,CC		26.1339,36.5792,29.5007	benign	381/1088	113386779	3628,8670	1982	4167	6149	SO:0001583	missense	4940	exon6			AGGGAGCAAACCT	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.1143C>G	12.37:g.113386779C>G	ENSP00000228928:p.Ser381Arg	191	0		220	8	NM_006187	0	0	5	5	0	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	ENST00000228928.7	37	CCDS44981.1	621	0.28434065934065933	194	0.3943089430894309	117	0.32320441988950277	105	0.18356643356643357	205	0.2704485488126649	C	2.291	-0.362396	0.05103	0.365792	0.261339	ENSG00000111331	ENST00000228928;ENST00000323881	T	0.06687	3.27	3.0	0.0313	0.14170	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.26002	0.139	B	0.12156	0.007	T	0.47623	-0.9103	8	0.51188	T	0.08	.	3.3881	0.07278	0.0:0.52:0.2178:0.2622	rs2285933;rs2285933	381	Q9Y6K5	OAS3_HUMAN	R	381	ENSP00000228928:S381R	ENSP00000228928:S381R	S	+	3	2	OAS3	111871162	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.993000	0.03720	-0.002000	0.14469	-0.145000	0.13849	AGC	C|0.427;G|0.573		0.607	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405920.1		
DNAH10	196385	broad.mit.edu	37	12	124362430	124362430	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr12:124362430G>T	ENST00000409039.3	+	47	8018	c.7993G>T	c.(7993-7995)Ggt>Tgt	p.G2665C		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2665	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGTTTTTAATGGTCTTGTCCT	0.413																																					p.G2665C		.											.	DNAH10-95	0			c.G7993T						.						172.0	170.0	171.0					12																	124362430		1890	4119	6009	SO:0001583	missense	196385	exon47			TTTAATGGTCTTG	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7993G>T	12.37:g.124362430G>T	ENSP00000386770:p.Gly2665Cys	72	0		70	4	NM_207437	0	0	0	0	0	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992749	0.93167	.	.	ENSG00000197653	ENST00000409039	T	0.56444	0.46	5.46	5.46	0.80206	.	0.000000	0.64402	U	0.000001	D	0.86045	0.5839	H	0.99758	4.755	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92477	0.5990	10	0.87932	D	0	.	18.9035	0.92452	0.0:0.0:1.0:0.0	.	2665	Q8IVF4	DYH10_HUMAN	C	2665	ENSP00000386770:G2665C	ENSP00000386770:G2665C	G	+	1	0	DNAH10	122928383	1.000000	0.71417	0.376000	0.26042	0.954000	0.61252	9.679000	0.98649	2.572000	0.86782	0.555000	0.69702	GGT	.		0.413	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
ATP8A2	51761	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	26436472	26436472	+	Missense_Mutation	SNP	A	A	G	rs138600634	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr13:26436472A>G	ENST00000381655.2	+	33	3251	c.3109A>G	c.(3109-3111)Acc>Gcc	p.T1037A	ATP8A2_ENST00000255283.8_Missense_Mutation_p.T972A|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	997					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		AAGCATGCTGACCTGGCTGGT	0.527																																					p.T1037A		.											.	ATP8A2-138	0			c.A3109G						.						164.0	154.0	157.0					13																	26436472		2021	4178	6199	SO:0001583	missense	51761	exon33			ATGCTGACCTGGC	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3109A>G	13.37:g.26436472A>G	ENSP00000371070:p.Thr1037Ala	125	0		178	54	NM_016529	0	0	0	0	0	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	37	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	A	12.84	2.057092	0.36277	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	D;D	0.88277	-2.36;-2.36	5.52	4.41	0.53225	.	0.394070	0.26045	N	0.026670	T	0.77075	0.4077	N	0.08118	0	0.24162	N	0.995658	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.001	T	0.67546	-0.5643	10	0.46703	T	0.11	.	11.034	0.47789	0.7743:0.2257:0.0:0.0	.	972;817;997	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	A	1037;972;817	ENSP00000371070:T1037A;ENSP00000255283:T972A	ENSP00000255283:T972A	T	+	1	0	ATP8A2	25334472	1.000000	0.71417	1.000000	0.80357	0.517000	0.34286	3.769000	0.55303	2.091000	0.63221	0.533000	0.62120	ACC	A|0.999;T|0.000		0.527	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
PDX1	3651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	28494294	28494294	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr13:28494294T>C	ENST00000381033.4	+	1	138	c.19T>C	c.(19-21)Tac>Cac	p.Y7H	PDX1-AS1_ENST00000499662.2_RNA	NM_000209.3	NP_000200.1	O00330	ODPX_HUMAN	pancreatic and duodenal homeobox 1	0					cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)					all_cancers(110;0.175)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		CGAGGAGCAGTACTACGCGGC	0.711																																					p.Y7H		.											.	PDX1-514	0			c.T19C						.						5.0	4.0	4.0					13																	28494294		1902	3780	5682	SO:0001583	missense	3651	exon1			GAGCAGTACTACG	AF035260	CCDS9327.1	13q12.1	2012-03-09	2006-12-01	2006-12-01	ENSG00000139515	ENSG00000139515		"""Homeoboxes / ANTP class : HOXL subclass"""	6107	protein-coding gene	gene with protein product	"""somatostatin transcription factor 1"""	600733	"""insulin promoter factor 1, homeodomain transcription factor"""	IPF1		7590740	Standard	NM_000209		Approved	IDX-1, STF-1, PDX-1, MODY4	uc001urt.2	P52945	OTTHUMG00000016638	ENST00000381033.4:c.19T>C	13.37:g.28494294T>C	ENSP00000370421:p.Tyr7His	80	0		204	82	NM_000209	0	0	0	0	0	B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	ENST00000381033.4	37	CCDS9327.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.868431	0.91587	.	.	ENSG00000139515	ENST00000381033	D	0.86865	-2.18	5.07	5.07	0.68467	.	0.056928	0.64402	D	0.000001	D	0.88291	0.6397	M	0.76002	2.32	0.53005	D	0.99996	B	0.32968	0.392	B	0.41466	0.358	D	0.88489	0.3074	10	0.87932	D	0	.	9.8472	0.41034	0.0:0.0821:0.0:0.9179	.	7	P52945	PDX1_HUMAN	H	7	ENSP00000370421:Y7H	ENSP00000370421:Y7H	Y	+	1	0	PDX1	27392294	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.509000	0.60448	1.912000	0.55364	0.459000	0.35465	TAC	.		0.711	PDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044310.2	NM_000209	
DLEU7	220107	hgsc.bcm.edu	37	13	51417535	51417535	+	Missense_Mutation	SNP	G	G	A	rs898861	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr13:51417535G>A	ENST00000504404.1	-	1	297	c.248C>T	c.(247-249)gCg>gTg	p.A83V	DLEU7-AS1_ENST00000413510.2_RNA|DLEU7_ENST00000400393.3_Missense_Mutation_p.A83V			Q6UYE1	LEU7_HUMAN	deleted in lymphocytic leukemia, 7	83			A -> V (in dbSNP:rs898861). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.										Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)		TGGGGAGTTCGCCCGCGCCGC	0.811													G|||	885	0.176717	0.0968	0.1888	5008	,	,		8444	0.2917		0.1988	False		,,,				2504	0.135				p.A83V		.											.	.	0			c.C248T						.	G	VAL/ALA	212,2568		7,198,1185	2.0	3.0	3.0		248	1.8	0.0	13	dbSNP_86	3	970,5336		43,884,2226	yes	missense	DLEU7	NM_198989.2	64	50,1082,3411	AA,AG,GG		15.3822,7.6259,13.009	possibly-damaging	83/161	51417535	1182,7904	1390	3153	4543	SO:0001583	missense	220107	exon1			GAGTTCGCCCGCG	AK126830	CCDS53869.1	13q14.3	2005-02-22			ENSG00000186047	ENSG00000186047			17567	protein-coding gene	gene with protein product						14706829	Standard	NM_198989		Approved	FLJ44882	uc001vex.2	Q6UYE1	OTTHUMG00000016936	ENST00000504404.1:c.248C>T	13.37:g.51417535G>A	ENSP00000427177:p.Ala83Val	0	0		15	5	NM_198989	0	0	0	0	0	Q2M2E4|Q6ZT82	Missense_Mutation	SNP	ENST00000504404.1	37		458	0.2097069597069597	57	0.11585365853658537	67	0.1850828729281768	188	0.32867132867132864	146	0.19261213720316622	G	11.22	1.574237	0.28092	0.076259	0.153822	ENSG00000186047	ENST00000400393;ENST00000504404;ENST00000335465	T;T	0.49139	0.79;0.82	2.72	1.81	0.25067	.	0.342483	0.19746	U	0.107012	T	0.00012	0.0000	L	0.34521	1.04	0.80722	P	0.0	B;B	0.28026	0.198;0.198	B;B	0.25506	0.061;0.061	T	0.32587	-0.9901	9	0.07175	T	0.84	.	5.0335	0.14423	0.0:0.2383:0.5179:0.2437	rs898861;rs12869977	83;83	Q6UYE1;Q6UYE1-2	LEU7_HUMAN;.	V	83;83;36	ENSP00000420976:A83V;ENSP00000427177:A83V	ENSP00000439677:A36V	A	-	2	0	DLEU7	50315536	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	0.065000	0.14466	0.650000	0.30769	0.491000	0.48974	GCG	G|0.789;A|0.211		0.811	DLEU7-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045005.2	NM_198989	
PCDH8	5100	hgsc.bcm.edu	37	13	53421432	53421432	+	Silent	SNP	C	C	A	rs3742300	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr13:53421432C>A	ENST00000377942.3	-	1	1343	c.1140G>T	c.(1138-1140)ggG>ggT	p.G380G	PCDH8_ENST00000338862.4_Silent_p.G380G	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	380					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CGTCCGCTCCCCCGAGTGCAG	0.766													C|||	1425	0.284545	0.1876	0.2579	5008	,	,		11677	0.5119		0.2048	False		,,,				2504	0.2822				p.G380G	GBM(36;25 841 9273 49207)	.											.	PCDH8-153	0			c.G1140T						.	C	,	383,2121		30,323,899	3.0	4.0	3.0		1140,1140	-2.3	0.5	13	dbSNP_107	3	791,4555		57,677,1939	no	coding-synonymous,coding-synonymous	PCDH8	NM_002590.3,NM_032949.2	,	87,1000,2838	AA,AC,CC		14.7961,15.2955,14.9554	,	380/1071,380/974	53421432	1174,6676	1252	2673	3925	SO:0001819	synonymous_variant	5100	exon1			CGCTCCCCCGAGT	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.1140G>T	13.37:g.53421432C>A		0	0		9	9	NM_002590	0	0	0	0	0	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Silent	SNP	ENST00000377942.3	37	CCDS9438.1																																																																																			C|0.649;A|0.351		0.766	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
UPF3A	65110	broad.mit.edu	37	13	115047559	115047559	+	Silent	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr13:115047559C>T	ENST00000375299.3	+	2	327	c.271C>T	c.(271-273)Ctg>Ttg	p.L91L	UPF3A_ENST00000351487.5_Silent_p.L91L	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	91	Required for interaction with UPF2.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.L91L(8)		autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		GCTGCGCCCGCTGCCAGCACA	0.731																																					p.L91L		.											.	UPF3A-91	8	Substitution - coding silent(8)	lung(2)|prostate(2)|kidney(2)|central_nervous_system(2)	c.C271T						.						4.0	4.0	4.0					13																	115047559		1902	3804	5706	SO:0001819	synonymous_variant	65110	exon2			CGCCCGCTGCCAG	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.271C>T	13.37:g.115047559C>T		30	0		78	6	NM_080687	0	0	11	11	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Silent	SNP	ENST00000375299.3	37	CCDS9543.1																																																																																			.		0.731	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		0	0		6	6	NM_018139	0	0	0	5	5	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
ASB2	51676	broad.mit.edu	37	14	94405527	94405527	+	Missense_Mutation	SNP	T	T	G	rs199833352		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr14:94405527T>G	ENST00000315988.4	-	6	1888	c.1400A>C	c.(1399-1401)cAc>cCc	p.H467P	ASB2_ENST00000556337.1_5'Flank|ASB2_ENST00000555019.1_Missense_Mutation_p.H515P|RP11-131H24.4_ENST00000557646.1_5'Flank	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	467					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGCCGGCGGGTGCGGGCCGTT	0.692																																					p.H515P		.											.	ASB2-228	0			c.A1544C						.						11.0	13.0	12.0					14																	94405527		2100	4140	6240	SO:0001583	missense	51676	exon8			GGCGGGTGCGGGC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1400A>C	14.37:g.94405527T>G	ENSP00000320675:p.His467Pro	66	3		168	45	NM_001202429	0	0	1	1	0	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.443232	0.63067	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.69685	-0.42;-0.34;-0.32	5.07	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.80847	2.515	0.58432	D	0.999992	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.987;0.994;0.987	T	0.78076	-0.2345	10	0.30854	T	0.27	.	12.1543	0.54068	0.0:0.0:0.1436:0.8564	.	483;515;467	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	P	515;483;467;413;413	ENSP00000451575:H515P;ENSP00000320675:H467P;ENSP00000450940:H413P	ENSP00000320675:H467P	H	-	2	0	ASB2	93475280	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	7.714000	0.84703	0.781000	0.33589	-0.527000	0.04329	CAC	.		0.692	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
PLCB2	5330	hgsc.bcm.edu	37	15	40583560	40583560	+	Silent	SNP	G	G	T	rs62021888	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr15:40583560G>T	ENST00000260402.3	-	26	3025	c.2776C>A	c.(2776-2778)Cgg>Agg	p.R926R	PLCB2_ENST00000557821.1_Silent_p.R922R|PLCB2_ENST00000456256.2_Silent_p.R911R	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	926					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		gccgcgccccgctgcagcagc	0.736													G|||	808	0.161342	0.0121	0.2075	5008	,	,		8373	0.1518		0.337	False		,,,				2504	0.1595				p.R926R		.											.	PLCB2-275	0			c.C2776A						.						2.0	3.0	3.0					15																	40583560		1222	3008	4230	SO:0001819	synonymous_variant	5330	exon26			CGCCCCGCTGCAG		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.2776C>A	15.37:g.40583560G>T		0	0		5	5	NM_004573	0	0	0	0	0	A8K6J2|B9EGH5	Silent	SNP	ENST00000260402.3	37	CCDS42020.1																																																																																			G|0.817;T|0.183		0.736	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418430.1		
CELF6	60677	hgsc.bcm.edu	37	15	72612195	72612195	+	Silent	SNP	C	C	T	rs544676808	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr15:72612195C>T	ENST00000569547.1	-	1	92	c.21G>A	c.(19-21)ggG>ggA	p.G7G	RP11-106M3.2_ENST00000379915.4_RNA|RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000539635.1_5'Flank|CELF6_ENST00000287202.5_Silent_p.G7G|CELF6_ENST00000567083.1_Silent_p.G7G			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	7					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						GCTGCGCTGACCCTCCCGGCG	0.771													c|||	3	0.000599042	0.0	0.0014	5008	,	,		4582	0.0		0.002	False		,,,				2504	0.0				p.G7G		.											.	CELF6-154	0			c.G21A						.						3.0	3.0	3.0					15																	72612195		1835	3409	5244	SO:0001819	synonymous_variant	60677	exon1			CGCTGACCCTCCC	AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.21G>A	15.37:g.72612195C>T		1	0		12	4	NM_001172684	0	0	0	0	0	B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Silent	SNP	ENST00000569547.1	37	CCDS10242.1																																																																																			.		0.771	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000420180.1	NM_052840	
AP3B2	8120	hgsc.bcm.edu	37	15	83378366	83378366	+	Silent	SNP	G	G	A	rs200226421	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr15:83378366G>A	ENST00000261722.3	-	1	300	c.93C>T	c.(91-93)atC>atT	p.I31I	AC105339.1_ENST00000440479.1_lincRNA|AP3B2_ENST00000542200.1_Silent_p.I31I|AP3B2_ENST00000535359.1_Silent_p.I31I|AP3B2_ENST00000535348.1_Silent_p.I31I|AP3B2_ENST00000561455.1_5'Flank	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	31					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			CGGAGGAGAAGATGCCGCCGC	0.761													G|||	25	0.00499201	0.0008	0.0029	5008	,	,		8047	0.0		0.0199	False		,,,				2504	0.002				p.I31I		.											.	AP3B2-94	0			c.C93T						.	G		0,2962		0,0,1481	2.0	3.0	3.0		93	1.7	1.0	15		3	42,6932		0,42,3445	no	coding-synonymous	AP3B2	NM_004644.3		0,42,4926	AA,AG,GG		0.6022,0.0,0.4227		31/1083	83378366	42,9894	1481	3487	4968	SO:0001819	synonymous_variant	8120	exon1			GGAGAAGATGCCG	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.93C>T	15.37:g.83378366G>A		5	0		18	8	NM_004644	0	0	0	1	1	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Silent	SNP	ENST00000261722.3	37	CCDS45331.1																																																																																			.		0.761	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
TICRR	90381	bcgsc.ca	37	15	90168693	90168693	+	Missense_Mutation	SNP	T	T	A	rs1866928	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr15:90168693T>A	ENST00000268138.7	+	20	5257	c.5152T>A	c.(5152-5154)Tca>Aca	p.S1718T	TICRR_ENST00000560985.1_Missense_Mutation_p.S1717T|KIF7_ENST00000558928.1_Intron			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1718			S -> T (in dbSNP:rs1866928). {ECO:0000269|PubMed:14702039}.		cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										ACTGCTTGAGTCAGAGGGCAA	0.652													T|||	1933	0.385982	0.466	0.3285	5008	,	,		16768	0.3968		0.335	False		,,,				2504	0.3599				p.S1718T		.											.	.	0			c.T5152A						.	T	THR/SER	1793,2607	515.5+/-368.9	343,1107,750	47.0	51.0	49.0		5152	0.7	0.0	15	dbSNP_92	49	2896,5702	442.5+/-360.1	484,1928,1887	yes	missense	C15orf42	NM_152259.3	58	827,3035,2637	AA,AT,TT		33.6823,40.75,36.0748	benign	1718/1911	90168693	4689,8309	2200	4299	6499	SO:0001583	missense	90381	exon20			CTTGAGTCAGAGG	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.5152T>A	15.37:g.90168693T>A	ENSP00000268138:p.Ser1718Thr	59	0		67	5	NM_152259	0	0	1	1	0	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	781	0.3576007326007326	214	0.4349593495934959	111	0.30662983425414364	200	0.34965034965034963	256	0.33773087071240104	T	9.772	1.173020	0.21704	0.4075	0.336823	ENSG00000140534	ENST00000268138	T	0.08102	3.13	5.51	0.722	0.18225	.	1.173460	0.06260	N	0.693698	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.18013	0.025	B	0.06405	0.002	T	0.46512	-0.9186	9	0.44086	T	0.13	-0.2223	5.1564	0.15036	0.0:0.3823:0.3545:0.2632	rs1866928;rs3825997;rs1866928	1718	Q7Z2Z1	TICRR_HUMAN	T	1718	ENSP00000268138:S1718T	ENSP00000268138:S1718T	S	+	1	0	C15orf42	87969697	0.007000	0.16637	0.002000	0.10522	0.028000	0.11728	0.220000	0.17660	0.356000	0.24157	-1.055000	0.02315	TCA	T|0.635;A|0.365		0.652	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
MYH11	4629	broad.mit.edu	37	16	15832515	15832515	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr16:15832515C>T	ENST00000300036.5	-	24	3137	c.3028G>A	c.(3028-3030)Gac>Aac	p.D1010N	MYH11_ENST00000396324.3_Missense_Mutation_p.D1017N|MYH11_ENST00000576790.2_Missense_Mutation_p.D1010N|MYH11_ENST00000452625.2_Missense_Mutation_p.D1017N|AF001548.6_ENST00000577048.1_RNA	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	1010					axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GTCGTTAAGTCACTAATCCTC	0.368			T	CBFB	AML																																p.D1017N		.		Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	MYH11-666	0			c.G3049A						.						154.0	143.0	146.0					16																	15832515		2197	4300	6497	SO:0001583	missense	4629	exon25			TTAAGTCACTAAT	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.3028G>A	16.37:g.15832515C>T	ENSP00000300036:p.Asp1010Asn	89	2		59	5	NM_001040114	0	0	0	0	0	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	C	19.31	3.803381	0.70682	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45	4.3	4.3	0.51218	.	0.058700	0.64402	D	0.000002	D	0.88239	0.6383	M	0.64170	1.965	0.80722	D	1	B;B;B;B;B	0.17667	0.001;0.01;0.01;0.01;0.023	B;B;B;B;B	0.25405	0.007;0.06;0.06;0.06;0.06	D	0.87118	0.2189	10	0.87932	D	0	.	16.1203	0.81346	0.0:1.0:0.0:0.0	.	1017;1010;1017;1010;1017	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	N	1010;1010;1017;1017;1017	ENSP00000300036:D1010N;ENSP00000345136:D1010N;ENSP00000379616:D1017N;ENSP00000407821:D1017N	ENSP00000300036:D1010N	D	-	1	0	MYH11	15740016	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.776000	0.85560	2.117000	0.64856	0.555000	0.69702	GAC	.		0.368	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252192.2	NM_001040113	
SPNS1	83985	broad.mit.edu	37	16	28992923	28992923	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr16:28992923G>T	ENST00000311008.11	+	6	1173	c.796G>T	c.(796-798)Gct>Tct	p.A266S	RP11-264B17.4_ENST00000567209.1_RNA|SPNS1_ENST00000334536.8_Missense_Mutation_p.A266S|SPNS1_ENST00000352260.7_Missense_Mutation_p.A244S|SPNS1_ENST00000323081.8_Missense_Mutation_p.A193S|SPNS1_ENST00000565975.1_Missense_Mutation_p.A311S|SPNS1_ENST00000561868.1_3'UTR|RP11-264B17.3_ENST00000569969.1_RNA	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)	266					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)		p.A266S(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						AGATCTGAGGGCTCTGGCAAG	0.602											OREG0023712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A266S		.											.	SPNS1-90	1	Substitution - Missense(1)	lung(1)	c.G796T						.						73.0	77.0	76.0					16																	28992923		2197	4300	6497	SO:0001583	missense	83985	exon6			CTGAGGGCTCTGG	BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.796G>T	16.37:g.28992923G>T	ENSP00000309945:p.Ala266Ser	43	0	806	48	4	NM_001142451	0	0	0	0	0	B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Missense_Mutation	SNP	ENST00000311008.11	37	CCDS10646.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044155	0.55110	.	.	ENSG00000169682	ENST00000311008;ENST00000334536;ENST00000352260;ENST00000323081	T;T;T;T	0.58797	0.31;0.31;0.31;0.31	4.91	4.91	0.64330	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.52725	0.1752	L	0.46670	1.46	0.58432	D	0.999998	B;B;B;B	0.32620	0.014;0.033;0.018;0.378	B;B;B;B	0.36808	0.03;0.049;0.034;0.233	T	0.47522	-0.9111	10	0.20519	T	0.43	.	15.6352	0.76946	0.0:0.0:1.0:0.0	.	193;244;266;266	Q9H2V7-4;Q9H2V7-3;Q9H2V7;Q9H2V7-2	.;.;SPNS1_HUMAN;.	S	266;266;244;193	ENSP00000309945:A266S;ENSP00000335494:A266S;ENSP00000306050:A244S;ENSP00000318228:A193S	ENSP00000309945:A266S	A	+	1	0	SPNS1	28900424	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.227000	0.65305	2.557000	0.86248	0.655000	0.94253	GCT	.		0.602	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254690.2	NM_032038	
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		9	9	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	2	0		20	11	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	1	0		18	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	0	0		13	11	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	0	0		13	11	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZZEF1	23140	hgsc.bcm.edu	37	17	4046101	4046101	+	Missense_Mutation	SNP	A	A	G	rs1454121	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr17:4046101A>G	ENST00000381638.2	-	1	213	c.89T>C	c.(88-90)gTc>gCc	p.V30A	CYB5D2_ENST00000575251.1_5'Flank|CYB5D2_ENST00000573984.1_5'Flank|ZZEF1_ENST00000574474.1_5'UTR|CYB5D2_ENST00000301391.3_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	30			V -> A (in dbSNP:rs1454121). {ECO:0000269|PubMed:14702039}.				calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CGTGCCCGAGACCGCGGCCCA	0.746													A|||	4028	0.804313	0.4781	0.8617	5008	,	,		11055	1.0		0.8529	False		,,,				2504	0.953				p.V30A		.											.	ZZEF1-93	0			c.T89C						.						2.0	2.0	2.0					17																	4046101		1609	3070	4679	SO:0001583	missense	23140	exon1			CCCGAGACCGCGG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.89T>C	17.37:g.4046101A>G	ENSP00000371051:p.Val30Ala	0	0		9	9	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	1773	0.8118131868131868	254	0.516260162601626	308	0.850828729281768	572	1.0	639	0.8430079155672823	A	12.64	1.999923	0.35320	.	.	ENSG00000074755	ENST00000381638	T	0.18810	2.19	4.8	1.17	0.20885	.	0.614467	0.15724	N	0.247743	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20107	-1.0285	9	0.33940	T	0.23	-2.2642	0.9962	0.01467	0.1675:0.1675:0.1581:0.5069	rs1454121	30;30	O43149-3;O43149	.;ZZEF1_HUMAN	A	30	ENSP00000371051:V30A	ENSP00000371051:V30A	V	-	2	0	ZZEF1	3992850	0.343000	0.24818	0.021000	0.16686	0.882000	0.50991	0.278000	0.18753	0.760000	0.33108	-0.527000	0.04329	GTC	A|0.188;G|0.812		0.746	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
TP53	7157	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	7579716	7579716	+	Frame_Shift_Del	DEL	G	G	-	rs397516438		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr17:7579716delG	ENST00000269305.4	-	3	269	c.80delC	c.(79-81)cctfs	p.P27fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.P27fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.P27fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.P27fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.P27fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P27fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	27	Interaction with HRMT1L2.|Transcription activation (acidic).				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.P27fs*17(4)|p.P27fs*50(1)|p.P13fs*18(1)|p.L26fs*11(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTTGTTTTCAGGAAGTCTGAA	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.P27fs	Pancreas(47;798 1329 9957 10801)	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	.	TP53-70225	15	Whole gene deletion(8)|Deletion - Frameshift(7)	large_intestine(5)|bone(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	c.80delC						.						42.0	42.0	42.0					17																	7579716		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon3	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TTTTCAGGAAGTC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.80delC	17.37:g.7579716delG	ENSP00000269305:p.Pro27fs	43	0		28	25	NM_000546	0	0	0	0	0	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	37	CCDS11118.1																																																																																			.		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RNF222	643904	hgsc.bcm.edu	37	17	8296383	8296383	+	Missense_Mutation	SNP	C	C	T	rs12601362	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr17:8296383C>T	ENST00000399398.2	-	3	705	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	RNF222_ENST00000344001.3_Missense_Mutation_p.A133T	NM_001146684.2	NP_001140156.1	A6NCQ9	RN222_HUMAN	ring finger protein 222	133						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)	1						GGGAGCTGGGCGCTctggccc	0.721													C|||	918	0.183307	0.118	0.1657	5008	,	,		14126	0.1954		0.2346	False		,,,				2504	0.2188				p.A133T		.											.	RNF222-68	0			c.G397A						.	C	THR/ALA	123,941		12,99,421	2.0	4.0	3.0		397	-3.4	0.0	17	dbSNP_120	3	556,2088		72,412,838	no	missense	RNF222	NM_001146684.2	58	84,511,1259	TT,TC,CC		21.0287,11.5602,18.3118	benign	133/221	8296383	679,3029	532	1322	1854	SO:0001583	missense	643904	exon3			GCTGGGCGCTCTG		CCDS45608.1	17p13.1	2013-01-09			ENSG00000189051	ENSG00000189051		"""RING-type (C3HC4) zinc fingers"""	34517	protein-coding gene	gene with protein product							Standard	NM_001146684		Approved		uc010vuy.1	A6NCQ9	OTTHUMG00000132049	ENST00000399398.2:c.397G>A	17.37:g.8296383C>T	ENSP00000382330:p.Ala133Thr	0	0		8	7	NM_001146684	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399398.2	37	CCDS45608.1	416	0.19047619047619047	69	0.1402439024390244	68	0.1878453038674033	102	0.17832167832167833	177	0.23350923482849603	C	2.546	-0.305162	0.05495	0.115602	0.210287	ENSG00000189051	ENST00000344001;ENST00000399398	.	.	.	4.22	-3.43	0.04810	.	1.112540	0.06977	N	0.819153	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.34254	-0.9836	8	0.52906	T	0.07	-18.9555	2.2125	0.03951	0.1223:0.447:0.1198:0.3109	rs12601362	133	A6NCQ9	RN222_HUMAN	T	133	.	ENSP00000343799:A133T	A	-	1	0	RNF222	8237108	0.001000	0.12720	0.000000	0.03702	0.224000	0.24922	-0.068000	0.11561	-0.331000	0.08501	0.549000	0.68633	GCC	C|0.808;T|0.192		0.721	RNF222-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255072.2	NM_001146684.2	
CDRT4	284040	bcgsc.ca	37	17	15341183	15341183	+	Missense_Mutation	SNP	A	A	C	rs2954759	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr17:15341183A>C	ENST00000312177.6	-	4	643	c.363T>G	c.(361-363)caT>caG	p.H121Q	CDRT4_ENST00000519354.1_5'UTR|TVP23C-CDRT4_ENST00000522212.2_3'UTR	NM_001204477.1	NP_001191406.1	Q8N9R6	CDRT4_HUMAN	CMT1A duplicated region transcript 4	121			H -> Q (in dbSNP:rs2954759).							endometrium(3)|skin(1)	4				UCEC - Uterine corpus endometrioid carcinoma (92;0.0874)		TGGAATCCGCATGTAAGTGTG	0.488													A|||	1603	0.320088	0.3646	0.2305	5008	,	,		19529	0.4583		0.0984	False		,,,				2504	0.409				p.H122Q		.											.	CDRT4-90	0			c.T366G						.	A	GLN/HIS,	1487,2919	476.8+/-357.7	251,985,967	153.0	136.0	142.0		366,	-9.4	0.0	17	dbSNP_101	142	863,7737	195.8+/-240.9	43,777,3480	yes	missense,utr-3	CDRT4,FAM18B2-CDRT4	NM_001204477.1,NM_001204478.1	24,	294,1762,4447	CC,CA,AA		10.0349,33.7494,18.0686	possibly-damaging,	122/153,	15341183	2350,10656	2203	4300	6503	SO:0001583	missense	284040	exon4			ATCCGCATGTAAG	BC029542	CCDS73995.1	17p12	2011-09-28			ENSG00000239704	ENSG00000239704			14383	protein-coding gene	gene with protein product						11381029	Standard	NM_001204477		Approved	FLJ36674	uc002gop.2	Q8N9R6	OTTHUMG00000059070	ENST00000312177.6:c.363T>G	17.37:g.15341183A>C	ENSP00000310031:p.His121Gln	229	0		141	5	NM_001204477	0	0	3	3	0	A8MSL9|Q8IZ19	Missense_Mutation	SNP	ENST00000312177.6	37		599	0.2742673992673993	190	0.3861788617886179	81	0.22375690607734808	254	0.44405594405594406	74	0.09762532981530343	A	8.850	0.944256	0.18356	0.337494	0.100349	ENSG00000239704	ENST00000520956;ENST00000312177	T	0.30448	1.53	4.67	-9.35	0.00633	.	0.925264	0.09032	N	0.858570	T	0.00012	0.0000	L	0.42245	1.32	0.80722	P	0.0	B	0.06786	0.001	B	0.08055	0.003	T	0.43310	-0.9399	9	0.27785	T	0.31	-3.8928	1.3169	0.02109	0.3108:0.2808:0.2765:0.1319	rs2954759;rs2954759	121	Q8N9R6	CDRT4_HUMAN	Q	122;121	ENSP00000310031:H121Q	ENSP00000310031:H121Q	H	-	3	2	CDRT4	15281908	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.801000	0.01743	-1.745000	0.01337	-1.283000	0.01379	CAT	A|0.767;C|0.233		0.488	CDRT4-001	KNOWN	non_canonical_conserved|non_canonical_other|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000130383.7	NM_173622	
TNFAIP1	7126	bcgsc.ca	37	17	26676135	26676135	+	IGR	SNP	C	C	T	rs13469	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr17:26676135C>T	ENST00000226225.2	+	0	3627				POLDIP2_ENST00000540200.1_Silent_p.S321S|POLDIP2_ENST00000003607.4_5'UTR	NM_021137.4	NP_066960.1	Q13829	BACD2_HUMAN	tumor necrosis factor, alpha-induced protein 1 (endothelial)						apoptotic process (GO:0006915)|cell migration (GO:0016477)|DNA replication (GO:0006260)|embryo development (GO:0009790)|immune response (GO:0006955)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleolus (GO:0005730)	GTP-Rho binding (GO:0017049)			endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)	12	all_lung(13;0.000294)|Lung NSC(42;0.000964)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		AAGCCTGCAGCGAGACGTGGC	0.552													C|||	2530	0.505192	0.3487	0.562	5008	,	,		20316	0.7073		0.499	False		,,,				2504	0.4744				.		.											.	.	0			.						.	C		1532,2702		273,986,858	56.0	63.0	60.0		965	1.0	1.0	17	dbSNP_52	60	4385,4051		1160,2065,993	yes	coding-synonymous	POLDIP2	NM_015584.3		1433,3051,1851	TT,TC,CC		48.0204,36.1833,46.7009		322/369	26676135	5917,6753	2117	4218	6335	SO:0001628	intergenic_variant	26073	.			CTGCAGCGAGACG		CCDS11227.1	17q22-q23	2013-01-09			ENSG00000109079	ENSG00000109079		"""BTB/POZ domain containing"""	11894	protein-coding gene	gene with protein product		191161		EDP1		2406243, 2233719	Standard	NM_021137		Approved	B61, B12, MGC2317, BTBD34	uc002hay.3	Q13829	OTTHUMG00000132501		17.37:g.26676135C>T		125	0		101	7	.	0	0	67	67	0	B7Z6M4|Q5TZQ1	RNA	SNP	ENST00000226225.2	37	CCDS11227.1																																																																																			C|0.491;T|0.509		0.552	TNFAIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255681.2	NM_021137	
MED24	9862	broad.mit.edu	37	17	38189409	38189409	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr17:38189409A>C	ENST00000394128.2	-	8	803	c.722T>G	c.(721-723)tTc>tGc	p.F241C	MED24_ENST00000501516.3_Missense_Mutation_p.F260C|MED24_ENST00000394126.1_Missense_Mutation_p.F266C|MED24_ENST00000394127.2_Missense_Mutation_p.F228C|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000356271.3_Missense_Mutation_p.F228C	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	241					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GACAGTGGGGAAGCCGGTCTT	0.617																																					p.F241C		.											.	MED24-187	0			c.T722G						.						60.0	53.0	55.0					17																	38189409		2203	4300	6503	SO:0001583	missense	9862	exon8			GTGGGGAAGCCGG	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.722T>G	17.37:g.38189409A>C	ENSP00000377686:p.Phe241Cys	73	2		36	3	NM_014815	0	0	4	4	0	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	37	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	A	7.750	0.703182	0.15172	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000543759;ENST00000535508;ENST00000431269;ENST00000428757	T;T;T	0.47528	0.84;0.84;0.84	5.48	4.39	0.52855	Mediator complex, subunit Med24, N-terminal (1);	0.049598	0.85682	D	0.000000	T	0.61060	0.2317	L	0.54323	1.7	0.58432	D	0.999998	D;D;P;D;D;D;D;D;D	0.89917	0.992;0.976;0.946;0.991;1.0;0.992;0.963;0.97;0.992	P;P;P;D;D;P;P;P;P	0.70935	0.882;0.866;0.733;0.933;0.971;0.79;0.575;0.701;0.863	T	0.60880	-0.7175	10	0.54805	T	0.06	-24.1519	11.5859	0.50918	0.8597:0.0:0.0:0.1403	.	215;228;191;170;191;151;228;241;183	B9TX63;B9TX65;B4DV99;B4DDR8;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;.;.;.;MED24_HUMAN;.	C	241;241;241;191;228;183;215;215;151;260	ENSP00000377686:F241C;ENSP00000443344:F191C;ENSP00000377685:F228C	ENSP00000348610:F241C	F	-	2	0	MED24	35442935	1.000000	0.71417	1.000000	0.80357	0.100000	0.18952	6.097000	0.71452	0.888000	0.36160	0.533000	0.62120	TTC	.		0.617	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240791	39240791	+	Silent	SNP	C	C	G	rs553572799	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr17:39240791C>G	ENST00000391417.4	+	1	333	c.333C>G	c.(331-333)cgC>cgG	p.R111R		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	136	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						cctgctgccgccccagctgct	0.662																																					p.R111R		.											.	.	2	Unknown(1)|Deletion - In frame(1)	NS(2)	c.C333G						.																																			SO:0001819	synonymous_variant	100132476	exon1			CTGCCGCCCCAGC	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.333C>G	17.37:g.39240791C>G		68	0		39	7	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	Silent	SNP	ENST00000391417.4	37	CCDS45673.1																																																																																			.		0.662	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
KRTAP4-7	100132476	hgsc.bcm.edu;ucsc.edu	37	17	39240796	39240796	+	Missense_Mutation	SNP	G	G	C	rs553572799|rs199957151	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr17:39240796G>C	ENST00000391417.4	+	1	338	c.338G>C	c.(337-339)aGc>aCc	p.S113T		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	138	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].		Missing. {ECO:0000269|PubMed:15955084}.		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.R111_C115delRPSCC(1)|p.?(1)		NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						tgccgccccagctgctgccgc	0.667																																					p.S113T		.											.	.	2	Unknown(1)|Deletion - In frame(1)	NS(2)	c.G338C						.																																			SO:0001583	missense	100132476	exon1			GCCCCAGCTGCTG	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.338G>C	17.37:g.39240796G>C	ENSP00000375236:p.Ser113Thr	70	0		50	20	NM_033061	0	0	0	0	0	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	37	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	0.047	-1.263726	0.01433	.	.	ENSG00000240871	ENST00000391417	T	0.00627	6.12	2.73	1.66	0.24008	.	2.038930	0.02697	N	0.111300	T	0.00552	0.0018	.	.	.	0.21290	N	0.999731	B	0.13145	0.007	B	0.12837	0.008	T	0.47222	-0.9134	9	0.17832	T	0.49	.	5.1702	0.15107	0.0:0.2319:0.5315:0.2367	.	168	Q9BYR0	KRA47_HUMAN	T	113	ENSP00000375236:S113T	ENSP00000375236:S113T	S	+	2	0	KRTAP4-7	36494322	0.010000	0.17322	0.067000	0.19924	0.024000	0.10985	-0.517000	0.06275	0.191000	0.20236	0.289000	0.19496	AGC	.		0.667	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
PTPN2	5771	broad.mit.edu;ucsc.edu;bcgsc.ca	37	18	12830976	12830976	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr18:12830976A>T	ENST00000309660.5	-	4	419	c.326T>A	c.(325-327)gTt>gAt	p.V109D	PTPN2_ENST00000327283.3_Missense_Mutation_p.V109D|PTPN2_ENST00000591497.1_Missense_Mutation_p.V80D|PTPN2_ENST00000591115.1_Missense_Mutation_p.V109D|PTPN2_ENST00000353319.4_Missense_Mutation_p.V109D	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	109	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				CAGCATGACAACTGCTTTGGT	0.408																																					p.V109D		.											.	PTPN2-652	0			c.T326A						.						72.0	67.0	69.0					18																	12830976		2203	4300	6503	SO:0001583	missense	5771	exon4			ATGACAACTGCTT	M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.326T>A	18.37:g.12830976A>T	ENSP00000311857:p.Val109Asp	286	2		235	45	NM_001207013	0	0	6	7	1	A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	ENST00000309660.5	37	CCDS11865.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.622460	0.87460	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000341361;ENST00000309660	D;D;D	0.86769	-2.17;-2.17;-2.17	5.39	5.39	0.77823	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.137942	0.32578	N	0.005905	D	0.95582	0.8564	H	0.96239	3.79	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.81914	0.992;0.982;0.995;0.995;0.989	D	0.97014	0.9738	10	0.87932	D	0	.	15.4176	0.74983	1.0:0.0:0.0:0.0	.	109;109;86;109;109	P17706;P17706-2;Q59F91;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.;.	D	109;109;86;109	ENSP00000320298:V109D;ENSP00000320546:V109D;ENSP00000311857:V109D	ENSP00000311857:V109D	V	-	2	0	PTPN2	12820976	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	8.840000	0.92125	2.027000	0.59764	0.533000	0.62120	GTT	.		0.408	PTPN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254613.3	NM_002828, NM_080422, NM_080423	
MEX3C	51320	hgsc.bcm.edu	37	18	48723146	48723154	+	Intron	DEL	GCCGCCGCG	GCCGCCGCG	-	rs78074704|rs530394988|rs147438518|rs201868643|rs62092914|rs530602218	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	GCCGCCGCG	GCCGCCGCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr18:48723146_48723154delGCCGCCGCG	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CCccgccgccgccgccgcggccgccgccT	0.78																																					p.179_182del		.											.	MEX3C-659	0			c.537_545del						.			429,1467		144,141,663						-0.2	0.9		dbSNP_131	4	2100,2286		804,492,897	no	coding	MEX3C	NM_016626.4		948,633,1560	A1A1,A1R,RR		47.8796,22.6266,40.2579				2529,3753				SO:0001627	intron_variant	51320	exon1			GCCGCCGCCGCCG	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19200CGCGGCGGC>-	18.37:g.48723146_48723154delGCCGCCGCG		0	0		37	31	NM_016626	0	0	0	0	0	A1L022|Q9NZE3	In_Frame_Del	DEL	ENST00000591040.1	37																																																																																				.		0.780	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	protein_coding	OTTHUMT00000449559.1	NM_016626	
PLPPR3	79948	hgsc.bcm.edu	37	19	813220	813220	+	Missense_Mutation	SNP	T	T	C	rs351994	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:813220T>C	ENST00000520876.3	-	8	1585	c.1507A>G	c.(1507-1509)Acg>Gcg	p.T503A	LPPR3_ENST00000359894.2_Missense_Mutation_p.T531A|MIR3187_ENST00000583431.1_RNA	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		503						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										CCGGCCCCCGTCTGCGCGCCC	0.781													t|||	1480	0.295527	0.6687	0.2378	5008	,	,		6132	0.0456		0.1809	False		,,,				2504	0.2076				p.T531A		.											.	.	0			c.A1591G						.		ALA/THR	929,1563		175,579,492	3.0	4.0	3.0		1591	3.2	0.0	19	dbSNP_79	3	716,5684		57,602,2541	no	missense	LPPR3	NM_024888.1	58	232,1181,3033	CC,CT,TT		11.1875,37.2793,18.4998	benign	531/747	813220	1645,7247	1246	3200	4446	SO:0001583	missense	0	exon7			CCCCCGTCTGCGC																												ENST00000520876.3:c.1507A>G	19.37:g.813220T>C	ENSP00000430297:p.Thr503Ala	0	0		15	8	NM_024888	0	0	0	0	0	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	37	CCDS58636.1	544	0.2490842490842491	314	0.6382113821138211	79	0.21823204419889503	23	0.04020979020979021	128	0.16886543535620052	t	0.011	-1.724891	0.00694	0.372793	0.111875	ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876	T;T	0.21191	2.02;2.02	3.16	3.16	0.36331	.	0.447280	0.20568	N	0.089784	T	0.00012	0.0000	N	0.04959	-0.14	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.42649	-0.9439	9	0.02654	T	1	0.0067	10.0419	0.42164	0.0:0.8946:0.0:0.1054	rs351994	504;503;531	Q6T4P5-2;Q6T4P5;Q6T4P5-3	.;LPPR3_HUMAN;.	A	504;531;503	ENSP00000352962:T531A;ENSP00000430297:T503A	ENSP00000300947:T504A	T	-	1	0	AC006273.1	764220	0.346000	0.24844	0.022000	0.16811	0.404000	0.30871	1.300000	0.33436	0.640000	0.30582	-0.764000	0.03450	ACG	T|0.751;C|0.249		0.781	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000433129.1_Silent_p.G2053G|ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000586866.1_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		0	0		25	16	NM_019112	0	0	3	5	2	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	TCF3_ENST00000453954.2_Silent_p.G352G|TCF3_ENST00000395423.3_Silent_p.G385G|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000344749.5_Silent_p.G436G	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		0	0		27	12	NM_003200	0	0	1	1	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000453954.2_Silent_p.S350S|TCF3_ENST00000395423.3_Silent_p.S383S|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		0	0		27	12	NM_003200	0	0	4	4	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
DOT1L	84444	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	2191208	2191208	+	Silent	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:2191208C>T	ENST00000398665.3	+	5	498	c.462C>T	c.(460-462)acC>acT	p.T154T		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	154	DOT1. {ECO:0000255|PROSITE- ProRule:PRU00902}.				histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCAAGATGACCGACGACGACC	0.622																																					p.T154T		.											.	DOT1L-132	0			c.C462T						.						130.0	140.0	137.0					19																	2191208		2125	4223	6348	SO:0001819	synonymous_variant	84444	exon5			GATGACCGACGAC	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.462C>T	19.37:g.2191208C>T		229	0		239	112	NM_032482	0	0	1	7	6	O60379|Q96JL1	Silent	SNP	ENST00000398665.3	37	CCDS42460.1																																																																																			.		0.622	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318066.1	NM_032482	
NOTCH3	4854	bcgsc.ca	37	19	15303225	15303225	+	Silent	SNP	G	G	A	rs3815188	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:15303225G>A	ENST00000263388.2	-	3	378	c.303C>T	c.(301-303)acC>acT	p.T101T		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	101	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			AGAATCGGGCGGTGCCAGCCA	0.662													G|||	1122	0.224042	0.2496	0.1599	5008	,	,		15642	0.3899		0.1471	False		,,,				2504	0.1431				p.T101T		.											.	NOTCH3-855	0			c.C303T						.	G		1119,3279		144,831,1224	22.0	21.0	21.0		303	-2.4	0.0	19	dbSNP_107	21	1262,7322		103,1056,3133	no	coding-synonymous	NOTCH3	NM_000435.2		247,1887,4357	AA,AG,GG		14.7018,25.4434,18.3408		101/2322	15303225	2381,10601	2199	4292	6491	SO:0001819	synonymous_variant	4854	exon3			TCGGGCGGTGCCA	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.303C>T	19.37:g.15303225G>A		172	0		169	7	NM_000435	0	0	0	0	0	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	37	CCDS12326.1																																																																																			G|0.773;A|0.227		0.662	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465714.1	NM_000435	
CILP2	148113	hgsc.bcm.edu	37	19	19651140	19651140	+	Silent	SNP	A	A	G	rs4808970	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:19651140A>G	ENST00000291495.5	+	3	376	c.291A>G	c.(289-291)gaA>gaG	p.E97E	CILP2_ENST00000586018.1_Silent_p.E103E	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	97						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TGGCGCTGGAAGCGCGCACCA	0.726													A|||	593	0.118411	0.1626	0.1167	5008	,	,		10102	0.0		0.168	False		,,,				2504	0.1309				p.E97E		.											.	CILP2-91	0			c.A291G						.	A		612,3678		42,528,1575	10.0	11.0	11.0		291	3.2	1.0	19	dbSNP_111	11	1223,7149		89,1045,3052	no	coding-synonymous	CILP2	NM_153221.2		131,1573,4627	GG,GA,AA		14.6082,14.2657,14.4922		97/1157	19651140	1835,10827	2145	4186	6331	SO:0001819	synonymous_variant	148113	exon3			GCTGGAAGCGCGC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.291A>G	19.37:g.19651140A>G		2	0		38	16	NM_153221	0	0	0	0	0	Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	37	CCDS12405.1																																																																																			A|0.873;G|0.127		0.726	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
RYR1	6261	broad.mit.edu	37	19	39062721	39062721	+	Silent	SNP	T	T	G			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:39062721T>G	ENST00000359596.3	+	95	13809	c.13809T>G	c.(13807-13809)ggT>ggG	p.G4603G	RYR1_ENST00000360985.3_Silent_p.G4598G|RYR1_ENST00000355481.4_Silent_p.G4598G			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4603					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	ATGTGTCAGGTGCAGGCTCTG	0.597																																					p.G4603G		.											.	RYR1-100	0			c.T13809G						.						82.0	76.0	78.0					19																	39062721		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon95			GTCAGGTGCAGGC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.13809T>G	19.37:g.39062721T>G		100	5		85	6	NM_000540	0	0	0	0	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	37	CCDS33011.1																																																																																			.		0.597	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
BLOC1S3	388552	hgsc.bcm.edu	37	19	45682824	45682824	+	Silent	SNP	G	G	A	rs758506	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:45682824G>A	ENST00000433642.2	+	2	366	c.270G>A	c.(268-270)gcG>gcA	p.A90A	TRAPPC6A_ENST00000006275.4_5'Flank|TRAPPC6A_ENST00000588062.1_5'Flank|BLOC1S3_ENST00000587722.1_Silent_p.A90A|TRAPPC6A_ENST00000592647.1_5'Flank|AC005779.2_ENST00000593083.1_5'Flank|TRAPPC6A_ENST00000585934.1_5'Flank	NM_212550.3	NP_997715.1	Q6QNY0	BL1S3_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 3	90					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|eye development (GO:0001654)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of natural killer cell activation (GO:0032816)|post-Golgi vesicle-mediated transport (GO:0006892)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|transport vesicle (GO:0030133)				ovary(1)|skin(1)	2		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GGGAATCGGCGGAGGAGGCCT	0.771									Hermansky-Pudlak syndrome				G|||	744	0.148562	0.2088	0.0634	5008	,	,		9810	0.2014		0.0944	False		,,,				2504	0.1288				p.A90A		.											.	BLOC1S3-90	0			c.G270A						.	G		211,1469		2,207,631	1.0	2.0	2.0		270	0.0	0.0	19	dbSNP_86	2	272,3378		7,258,1560	no	coding-synonymous	BLOC1S3	NM_212550.3		9,465,2191	AA,AG,GG		7.4521,12.5595,9.0619		90/203	45682824	483,4847	840	1825	2665	SO:0001819	synonymous_variant	388552	exon2	Familial Cancer Database	HPS, HPS1-8	ATCGGCGGAGGAG	AY531266	CCDS12656.1	19q13.32	2012-08-01	2008-08-11			ENSG00000189114		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20914	protein-coding gene	gene with protein product	"""BLOC-1 subunit 3"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 3"", ""Hermansky-Pudlak syndrome 8"""	609762				15102850	Standard	NM_212550		Approved	BLOS3, HPS8	uc002pax.4	Q6QNY0		ENST00000433642.2:c.270G>A	19.37:g.45682824G>A		0	0		5	5	NM_212550	0	0	0	0	0	B2RXB8	Silent	SNP	ENST00000433642.2	37	CCDS12656.1																																																																																			G|0.858;A|0.142		0.771	BLOC1S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457559.1	NM_212550	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48205288	48205288	+	Silent	SNP	G	G	A	rs8100472	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:48205288G>A	ENST00000396720.3	+	15	4493	c.4299G>A	c.(4297-4299)gcG>gcA	p.A1433A	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1433										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCGAGCTGGCGGCCGTGGAGG	0.771													G|||	514	0.102636	0.2519	0.0548	5008	,	,		5835	0.001		0.0577	False		,,,				2504	0.0859				p.A1433A		.											.	GLTSCR1-48	0			c.G4299A						.	G		266,1774		1,264,755	1.0	2.0	2.0		4299	-3.5	1.0	19	dbSNP_116	2	222,4724		0,222,2251	no	coding-synonymous	GLTSCR1	NM_015711.3		1,486,3006	AA,AG,GG		4.4885,13.0392,6.9854		1433/1561	48205288	488,6498	1020	2473	3493	SO:0001819	synonymous_variant	29998	exon15			GCTGGCGGCCGTG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.4299G>A	19.37:g.48205288G>A		2	0		13	11	NM_015711	0	0	1	1	0	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																			G|0.917;A|0.083		0.771	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
PNKP	11284	broad.mit.edu	37	19	50368482	50368482	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:50368482C>T	ENST00000322344.3	-	4	509	c.400G>A	c.(400-402)Gag>Aag	p.E134K	PNKP_ENST00000600573.1_Missense_Mutation_p.E134K|PNKP_ENST00000595792.1_5'Flank|PNKP_ENST00000600910.1_Missense_Mutation_p.E134K|PNKP_ENST00000596014.1_Missense_Mutation_p.E134K	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase	134					dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		TTCGGCAGCTCAGCATCTCTC	0.597								Other BER factors																													p.E134K		.											.	PNKP-253	0			c.G400A						.						62.0	61.0	61.0					19																	50368482		2203	4300	6503	SO:0001583	missense	11284	exon4			GCAGCTCAGCATC	AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60		ENST00000322344.3:c.400G>A	19.37:g.50368482C>T	ENSP00000323511:p.Glu134Lys	76	0		72	3	NM_007254	0	0	80	82	2	Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Missense_Mutation	SNP	ENST00000322344.3	37	CCDS12783.1	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869622	0.33069	.	.	ENSG00000039650	ENST00000322344	T	0.43688	0.94	4.09	-0.431	0.12295	.	0.667620	0.12742	N	0.442967	T	0.21468	0.0517	L	0.29908	0.895	0.09310	N	1	B;B	0.31968	0.349;0.226	B;B	0.22386	0.038;0.039	T	0.18241	-1.0343	10	0.13853	T	0.58	-15.9074	6.0511	0.19787	0.0:0.5257:0.0:0.4743	.	95;134	Q9BUL2;Q96T60	.;PNKP_HUMAN	K	134	ENSP00000323511:E134K	ENSP00000323511:E134K	E	-	1	0	PNKP	55060294	0.002000	0.14202	0.001000	0.08648	0.036000	0.12997	0.298000	0.19120	0.148000	0.19059	0.561000	0.74099	GAG	.		0.597	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465830.1	NM_007254	
LRRC4B	94030	hgsc.bcm.edu	37	19	51021057	51021057	+	Missense_Mutation	SNP	A	A	G	rs61751957	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:51021057A>G	ENST00000599957.1	-	3	2110	c.1913T>C	c.(1912-1914)gTg>gCg	p.V638A	LRRC4B_ENST00000389201.3_Missense_Mutation_p.V638A			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	638	Poly-Ala.			AV -> TA (in Ref. 2; AAH56207). {ECO:0000305}.	positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CCCACTGGCCACGGCGGCCGC	0.726													A|||	1071	0.213858	0.1702	0.2579	5008	,	,		10941	0.125		0.2893	False		,,,				2504	0.2556				p.V638A		.											.	LRRC4B-205	0			c.T1913C						.	A	ALA/VAL	591,3051		57,477,1287	13.0	15.0	14.0		1913	-0.8	0.0	19	dbSNP_129	14	2294,5564		347,1600,1982	no	missense	LRRC4B	NM_001080457.1	64	404,2077,3269	GG,GA,AA		29.1932,16.2273,25.087	benign	638/714	51021057	2885,8615	1821	3929	5750	SO:0001583	missense	94030	exon3			CTGGCCACGGCGG	BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1913T>C	19.37:g.51021057A>G	ENSP00000471502:p.Val638Ala	2	0		44	12	NM_001080457	0	0	0	0	0	Q3ZCQ4|Q58F20	Missense_Mutation	SNP	ENST00000599957.1	37	CCDS42595.1	484	0.2216117216117216	86	0.17479674796747968	89	0.24585635359116023	74	0.12937062937062938	235	0.3100263852242744	A	2.037	-0.421084	0.04734	0.162273	0.291932	ENSG00000131409	ENST00000389201	T	0.27402	1.67	2.86	-0.757	0.11054	.	0.245138	0.17282	U	0.179967	T	0.00012	0.0000	L	0.36672	1.1	0.47183	P	6.540000000000434E-4	B	0.06786	0.001	B	0.04013	0.001	T	0.44982	-0.9292	9	0.12430	T	0.62	.	6.0652	0.19860	0.596:0.0:0.404:0.0	rs61751957	638	Q9NT99	LRC4B_HUMAN	A	638	ENSP00000373853:V638A	ENSP00000373853:V638A	V	-	2	0	LRRC4B	55712869	1.000000	0.71417	0.038000	0.18304	0.337000	0.28794	2.356000	0.44116	-0.425000	0.07371	-1.467000	0.01014	GTG	A|0.777;G|0.223		0.726	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464907.1	NM_001080457	
CTU1	90353	hgsc.bcm.edu	37	19	51602298	51602298	+	Missense_Mutation	SNP	C	C	G	rs12983578	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:51602298C>G	ENST00000421832.2	-	3	651	c.607G>C	c.(607-609)Gag>Cag	p.E203Q		NM_145232.3	NP_660275.2			cytosolic thiouridylase subunit 1											large_intestine(2)|lung(1)|urinary_tract(1)	4						gcgcccccctcgccgggagag	0.726													C|||	357	0.0712859	0.0129	0.0663	5008	,	,		5363	0.0625		0.166	False		,,,				2504	0.0654				p.E203Q		.											.	CTU1-68	0			c.G607C						.	C	GLN/GLU	80,3254		0,80,1587	2.0	3.0	3.0		607	3.7	1.0	19	dbSNP_121	3	703,5807		27,649,2579	no	missense	CTU1	NM_145232.3	29	27,729,4166	GG,GC,CC		10.7988,2.3995,7.9541	probably-damaging	203/349	51602298	783,9061	1667	3255	4922	SO:0001583	missense	90353	exon3			CCCCCTCGCCGGG		CCDS12824.1	19q13.41	2013-05-31	2013-05-31	2009-08-19		ENSG00000142544			29590	protein-coding gene	gene with protein product		612694	"""ATP binding domain 3"", ""cytosolic thiouridylase subunit 1 homolog (S. pombe)"""	ATPBD3		19017811	Standard	NM_145232		Approved	MGC17332, NCS6	uc010eop.3	Q7Z7A3		ENST00000421832.2:c.607G>C	19.37:g.51602298C>G	ENSP00000390011:p.Glu203Gln	0	0		14	7	NM_145232	0	0	1	1	0		Missense_Mutation	SNP	ENST00000421832.2	37	CCDS12824.1	217	0.09935897435897435	20	0.04065040650406504	27	0.07458563535911603	34	0.05944055944055944	136	0.17941952506596306	.	17.62	3.434094	0.62955	0.023995	0.107988	ENSG00000142544	ENST00000421832	T	0.43294	0.95	3.66	3.66	0.41972	Rossmann-like alpha/beta/alpha sandwich fold (1);tRNA(Ile)-lysidine/2-thiocytidine synthase (1);	0.000000	0.85682	D	0.000000	T	0.00178	0.0005	M	0.69523	2.12	0.23991	P	0.99624278	D	0.69078	0.997	D	0.66084	0.941	T	0.09574	-1.0668	9	0.46703	T	0.11	-14.0205	7.3785	0.26841	0.0:0.873:0.0:0.127	rs12983578	203	Q7Z7A3	CTU1_HUMAN	Q	203	ENSP00000390011:E203Q	ENSP00000390011:E203Q	E	-	1	0	CTU1	56294110	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	3.267000	0.51577	1.733000	0.51620	0.505000	0.49811	GAG	C|0.900;G|0.100		0.726	CTU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464292.1	NM_145232	
ZNF761	388561	bcgsc.ca	37	19	53959568	53959568	+	RNA	SNP	G	G	C	rs2617726	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:53959568G>C	ENST00000454407.1	+	0	2260							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		TCATACTGAAGAGAATCCTTA	0.393													g|||	1936	0.386581	0.3964	0.5346	5008	,	,		24330	0.2401		0.3986	False		,,,				2504	0.407				p.E603Q		.											.	ZNF761-91	0			c.G1807C						.	G	GLN/GLU	1775,2631	521.7+/-370.6	392,991,820	116.0	121.0	119.0		1808	1.1	0.2	19	dbSNP_100	119	3494,5102	510.5+/-377.5	706,2082,1510	no	missense	ZNF761	NM_001008401.3	29	1098,3073,2330	CC,CG,GG		40.6468,40.286,40.5245	benign	603/747	53959568	5269,7733	2203	4298	6501			388561	exon7			ACTGAAGAGAATC	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959568G>C		131	0		131	6	NM_001008401	0	0	3	3	0	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37																																																																																				.		0.393	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
CNOT3	4849	broad.mit.edu	37	19	54649663	54649663	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:54649663A>C	ENST00000406403.1	+	8	2324	c.721A>C	c.(721-723)Acc>Ccc	p.T241P	CNOT3_ENST00000221232.5_Missense_Mutation_p.T241P|CNOT3_ENST00000358389.3_Missense_Mutation_p.T60P			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	241					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCTGGTCGCCACCTCCCCTCC	0.642																																					p.T241P		.											.	CNOT3-93	0			c.A721C						.						129.0	102.0	111.0					19																	54649663		2203	4300	6503	SO:0001583	missense	4849	exon9			GTCGCCACCTCCC	AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.721A>C	19.37:g.54649663A>C	ENSP00000383954:p.Thr241Pro	51	5		75	16	NM_014516	0	0	0	0	0	Q9NZN7|Q9UF76	Missense_Mutation	SNP	ENST00000406403.1	37	CCDS12880.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.361697	0.82353	.	.	ENSG00000088038	ENST00000221232;ENST00000358389;ENST00000406403	T;T;T	0.62364	0.87;0.03;0.87	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.60637	0.2284	N	0.08118	0	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.998;0.999	D;D;D	0.83275	0.987;0.987;0.996	T	0.64292	-0.6442	10	0.35671	T	0.21	-35.9662	13.7316	0.62792	1.0:0.0:0.0:0.0	.	241;241;165	B7Z6J7;O75175;Q6ZMJ6	.;CNOT3_HUMAN;.	P	241;60;241	ENSP00000221232:T241P;ENSP00000351159:T60P;ENSP00000383954:T241P	ENSP00000221232:T241P	T	+	1	0	CNOT3	59341475	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.243000	0.89821	2.150000	0.67090	0.533000	0.62120	ACC	.		0.642	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142130.3	NM_014516	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	4	4		32	32	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
CMPK2	129607	hgsc.bcm.edu	37	2	7005369	7005369	+	Silent	SNP	A	A	G	rs11678810	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr2:7005369A>G	ENST00000256722.5	-	1	458	c.459T>C	c.(457-459)tgT>tgC	p.C153C	CMPK2_ENST00000478738.1_Intron|CMPK2_ENST00000404168.1_Silent_p.C153C|CMPK2_ENST00000458098.1_Silent_p.C153C	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial	153					cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GTGCCTCCTGACAGGCGCCCA	0.741													G|||	4998	0.998003	0.9924	1.0	5008	,	,		10694	1.0		1.0	False		,,,				2504	1.0				p.C153C		.											.	CMPK2-68	0			c.T459C						.	G		3605,39		1783,39,0	3.0	4.0	4.0		459	1.6	0.0	2	dbSNP_120	4	7874,0		3937,0,0	no	coding-synonymous	CMPK2	NM_207315.2		5720,39,0	GG,GA,AA		0.0,1.0703,0.3386		153/450	7005369	11479,39	1822	3937	5759	SO:0001819	synonymous_variant	129607	exon1			CTCCTGACAGGCG		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.459T>C	2.37:g.7005369A>G		0	0		13	13	NM_001256478	0	0	0	0	0	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	Silent	SNP	ENST00000256722.5	37	CCDS42648.1																																																																																			A|0.003;G|0.997		0.741	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323339.2	NM_207315	
SIX3	6496	hgsc.bcm.edu	37	2	45171842	45171842	+	Silent	SNP	A	A	G	rs338074	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr2:45171842A>G	ENST00000260653.3	+	2	1284	c.942A>G	c.(940-942)gcA>gcG	p.A314A	SIX3-AS1_ENST00000419364.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	314					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CGGAGCGCGCAGACACCGGCA	0.697													G|||	4695	0.9375	0.9773	0.9323	5008	,	,		10095	0.9901		0.9165	False		,,,				2504	0.8548				p.A314A		.											.	SIX3-90	0			c.A942G						.	G		4039,129		1959,121,4	18.0	19.0	19.0		942	1.0	1.0	2	dbSNP_129	19	7494,648		3453,588,30	yes	coding-synonymous	SIX3	NM_005413.3		5412,709,34	GG,GA,AA		7.9587,3.095,6.3119		314/333	45171842	11533,777	2084	4071	6155	SO:0001819	synonymous_variant	6496	exon2			GCGCGCAGACACC	AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.942A>G	2.37:g.45171842A>G		0	0		7	7	NM_005413	0	0	0	0	0	D6W5A5|Q53T42	Silent	SNP	ENST00000260653.3	37	CCDS1821.1																																																																																			A|0.059;G|0.941		0.697	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326192.1	NM_005413	
EPCAM	4072	bcgsc.ca	37	2	47601106	47601106	+	Missense_Mutation	SNP	T	T	C	rs1126497|rs111849096	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr2:47601106T>C	ENST00000263735.4	+	3	702	c.344T>C	c.(343-345)aTg>aCg	p.M115T	EPCAM_ENST00000405271.1_Missense_Mutation_p.M143T	NM_002354.2	NP_002345.2	P16422	EPCAM_HUMAN	epithelial cell adhesion molecule	115	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.		M -> T (in dbSNP:rs1126497). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2108441, ECO:0000269|PubMed:2463074, ECO:0000269|PubMed:2469722}.		negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|stem cell differentiation (GO:0048863)|ureteric bud development (GO:0001657)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein complex binding (GO:0032403)	p.0?(2)|p.?(1)		endometrium(3)|large_intestine(1)|liver(2)|lung(7)|skin(1)|stomach(1)	15						GGCACCTCCATGTGCTGGTGT	0.532													C|||	3336	0.666134	0.8888	0.5159	5008	,	,		17137	0.8323		0.4692	False		,,,				2504	0.5031				p.M115T		.											.	EPCAM-91	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)	c.T344C						.	C	THR/MET	3649,757	305.5+/-289.0	1530,589,84	74.0	69.0	70.0		344	1.7	0.4	2	dbSNP_86	70	3722,4878	618.5+/-396.8	801,2120,1379	yes	missense	EPCAM	NM_002354.2	81	2331,2709,1463	CC,CT,TT		43.2791,17.1811,43.3262	benign	115/315	47601106	7371,5635	2203	4300	6503	SO:0001583	missense	4072	exon3			CCTCCATGTGCTG	M33011	CCDS1833.1	2p21	2014-09-17	2008-12-16	2008-12-16	ENSG00000119888	ENSG00000119888		"""CD molecules"""	11529	protein-coding gene	gene with protein product		185535	"""antigen identified by monoclonal antibody AUA1"", ""tumor-associated calcium signal transducer 1"""	M4S1, MIC18, TACSTD1		8382772, 11306819	Standard	NM_002354		Approved	Ly74, TROP1, GA733-2, EGP34, EGP40, EGP-2, KSA, CD326, Ep-CAM, HEA125, KS1/4, MK-1, MH99, MOC31, 323/A3, 17-1A, TACST-1, CO-17A, ESA	uc002rvx.3	P16422	OTTHUMG00000128853	ENST00000263735.4:c.344T>C	2.37:g.47601106T>C	ENSP00000263735:p.Met115Thr	156	1		151	6	NM_002354	0	0	14	14	0	P18180|Q6FG26|Q6FG49|Q96C47|Q9UCD0	Missense_Mutation	SNP	ENST00000263735.4	37	CCDS1833.1	1440	0.6593406593406593	437	0.8882113821138211	182	0.5027624309392266	460	0.8041958041958042	361	0.4762532981530343	C	3.317	-0.139650	0.06669	0.828189	0.432791	ENSG00000119888	ENST00000405271;ENST00000263735;ENST00000419334	T;T;T	0.62105	0.05;0.05;0.05	5.93	1.71	0.24356	Thyroglobulin type-1 (6);	0.527053	0.22416	N	0.060350	T	0.00012	0.0000	N	0.01352	-0.895	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44251	-0.9340	9	0.02654	T	1	-4.742	11.8944	0.52648	0.0:0.6732:0.0:0.3268	rs1126497;rs3181550;rs17845436;rs17858308;rs52820371;rs57528354;rs1126497	115;143	P16422;B5MCA4	EPCAM_HUMAN;.	T	143;115;191	ENSP00000385476:M143T;ENSP00000263735:M115T;ENSP00000389028:M191T	ENSP00000263735:M115T	M	+	2	0	EPCAM	47454610	0.325000	0.24660	0.371000	0.25978	0.878000	0.50629	0.040000	0.13905	0.160000	0.19432	-0.119000	0.15052	ATG	T|0.386;C|0.614		0.532	EPCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250792.2		
TEKT4	150483	ucsc.edu	37	2	95542476	95542476	+	Missense_Mutation	SNP	C	C	T	rs1052809		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr2:95542476C>T	ENST00000295201.4	+	6	1407	c.1270C>T	c.(1270-1272)Cgc>Tgc	p.R424C	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	424					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCATCGTACTCGCTACCCCAC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		19845	0.0		0.0	False		,,,				2504	0.001				p.R424C		.											.	TEKT4-155	0			c.C1270T						.						77.0	53.0	61.0					2																	95542476		2203	4300	6503	SO:0001583	missense	150483	exon6			CGTACTCGCTACC	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.1270C>T	2.37:g.95542476C>T	ENSP00000295201:p.Arg424Cys	36	2		54	5	NM_144705	0	0	0	10	10		Missense_Mutation	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	12.76	2.033512	0.35893	.	.	ENSG00000163060	ENST00000295201	T	0.02916	4.11	2.43	2.43	0.29744	.	0.261531	0.37623	N	0.002019	T	0.03651	0.0104	L	0.60455	1.87	0.80722	D	1	P	0.36874	0.572	B	0.32583	0.148	T	0.50792	-0.8786	10	0.44086	T	0.13	-7.0137	10.5484	0.45072	0.0:1.0:0.0:0.0	rs1052809;rs3193279	424	Q8WW24	TEKT4_HUMAN	C	424	ENSP00000295201:R424C	ENSP00000295201:R424C	R	+	1	0	TEKT4	94906203	0.031000	0.19500	0.725000	0.30721	0.755000	0.42902	0.890000	0.28295	1.049000	0.40321	0.281000	0.19383	CGC	C|0.985;T|0.015		0.592	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252777.1	NM_144705	
C2orf40	84417	hgsc.bcm.edu	37	2	106682226	106682226	+	Silent	SNP	T	T	C	rs4271786|rs543094154	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr2:106682226T>C	ENST00000238044.3	+	1	115	c.6T>C	c.(4-6)gcT>gcC	p.A2A	C2orf40_ENST00000409944.1_Intron|C2orf40_ENST00000489174.1_Intron	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	2					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						CCGCCATGGCTGCCTCCCCCG	0.766													C|||	1272	0.253994	0.2753	0.1369	5008	,	,		11771	0.2411		0.2227	False		,,,				2504	0.3538				p.A2A		.											.	C2orf40-90	0			c.T6C						.	C		520,2666		23,474,1096	2.0	3.0	3.0		6	1.0	0.3	2	dbSNP_111	3	871,5647		54,763,2442	no	coding-synonymous	C2orf40	NM_032411.2		77,1237,3538	CC,CT,TT		13.363,16.3214,14.3343		2/149	106682226	1391,8313	1593	3259	4852	SO:0001819	synonymous_variant	84417	exon1			CATGGCTGCCTCC	BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.6T>C	2.37:g.106682226T>C		1	0		21	8	NM_032411	0	0	0	0	0	D3DVK2	Silent	SNP	ENST00000238044.3	37	CCDS2072.1																																																																																			T|0.765;C|0.235		0.766	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253515.2	NM_032411	
C1QL2	165257	hgsc.bcm.edu	37	2	119915509	119915509	+	Silent	SNP	G	G	T	rs1317848	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr2:119915509G>T	ENST00000272520.3	-	1	956	c.337C>A	c.(337-339)Cgg>Agg	p.R113R		NM_182528.3	NP_872334.2	Q7Z5L3	C1QL2_HUMAN	complement component 1, q subcomponent-like 2	113	Collagen-like.				protein oligomerization (GO:0051259)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				NS(1)|endometrium(1)|large_intestine(3)|pancreas(1)|prostate(1)	7						AGCCCGGGCCGCCCCGAGTCG	0.796										HNSCC(49;0.14)			G|||	1430	0.285543	0.0938	0.1859	5008	,	,		8271	0.5982		0.2565	False		,,,				2504	0.3231				p.R113R		.											.	C1QL2-91	0			c.C337A						.	G		209,1941		13,183,879	2.0	2.0	2.0		337	-3.2	0.6	2	dbSNP_88	2	955,4379		99,757,1811	no	coding-synonymous	C1QL2	NM_182528.3		112,940,2690	TT,TG,GG		17.904,9.7209,15.5532		113/288	119915509	1164,6320	1075	2667	3742	SO:0001819	synonymous_variant	165257	exon1			CGGGCCGCCCCGA	AF525315	CCDS42737.1	2q14.2	2009-05-20			ENSG00000144119	ENSG00000144119			24181	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 10"""	614330				18783346	Standard	NM_182528		Approved	CTRP10, C1QTNF10	uc002tlo.2	Q7Z5L3	OTTHUMG00000153271	ENST00000272520.3:c.337C>A	2.37:g.119915509G>T		0	0		15	9	NM_182528	0	0	0	0	0		Silent	SNP	ENST00000272520.3	37	CCDS42737.1																																																																																			G|0.681;T|0.319		0.796	C1QL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330527.2	NM_182528	
KCNJ3	3760	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	155555818	155555818	+	Silent	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr2:155555818C>T	ENST00000295101.2	+	1	1008	c.531C>T	c.(529-531)atC>atT	p.I177I	AC061961.2_ENST00000443901.1_RNA|KCNJ3_ENST00000544049.1_Silent_p.I177I	NM_001260509.1|NM_002239.3	NP_001247438.1|NP_002230.1	P48549	KCNJ3_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 3	177					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to electrical stimulus (GO:0051602)|synaptic transmission (GO:0007268)	external side of plasma membrane (GO:0009897)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			breast(2)|endometrium(2)|kidney(3)|large_intestine(9)|lung(30)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	54					Halothane(DB01159)	CCTTCCTCATCGGCTGCATGT	0.582																																					p.I177I		.											.	KCNJ3-92	0			c.C531T						.						85.0	72.0	76.0					2																	155555818		2203	4300	6503	SO:0001819	synonymous_variant	3760	exon1			CCTCATCGGCTGC	U50964	CCDS2200.1, CCDS58733.1	2q24.1	2011-07-05			ENSG00000162989	ENSG00000162989		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6264	protein-coding gene	gene with protein product		601534				8088798, 16382105	Standard	NM_002239		Approved	Kir3.1, GIRK1, KGA	uc002tyv.2	P48549	OTTHUMG00000131937	ENST00000295101.2:c.531C>T	2.37:g.155555818C>T		103	0		99	6	NM_001260509	0	0	0	0	0	B4DEW7|Q8TBI0	Silent	SNP	ENST00000295101.2	37	CCDS2200.1																																																																																			.		0.582	KCNJ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254890.2	NM_002239	
SCN7A	6332	broad.mit.edu	37	2	167327196	167327196	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr2:167327196G>T	ENST00000409855.1	-	6	719	c.593C>A	c.(592-594)cCt>cAt	p.P198H		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	198					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	GAAGTCCAGAGGTGAGTATCT	0.299																																					p.P198H		.											.	SCN7A-67	0			c.C593A						.						40.0	40.0	40.0					2																	167327196		1799	4046	5845	SO:0001583	missense	6332	exon6			TCCAGAGGTGAGT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.593C>A	2.37:g.167327196G>T	ENSP00000386796:p.Pro198His	89	0		91	3	NM_002976	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	G	10.39	1.335943	0.24253	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98381	-4.9;-4.9;-4.9	4.62	-1.08	0.09936	Ion transport (1);	0.746533	0.11942	N	0.514599	D	0.96645	0.8905	L	0.40543	1.245	0.09310	N	1	D	0.64830	0.994	P	0.60345	0.873	D	0.90516	0.4485	10	0.66056	D	0.02	.	0.4084	0.00437	0.3033:0.1259:0.3:0.2708	.	198	Q01118	SCN7A_HUMAN	H	198	ENSP00000386796:P198H;ENSP00000413699:P198H;ENSP00000403846:P198H	ENSP00000259060:P198H	P	-	2	0	SCN7A	167035442	1.000000	0.71417	0.000000	0.03702	0.031000	0.12232	0.988000	0.29616	-0.016000	0.14127	0.563000	0.77884	CCT	.		0.299	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
ZCCHC3	85364	hgsc.bcm.edu	37	20	278688	278690	+	In_Frame_Del	DEL	CGG	CGG	-	rs11468351|rs5839847|rs6147263	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	CGG	CGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr20:278688_278690delCGG	ENST00000382352.3	+	1	952_954	c.461_463delCGG	c.(460-465)ccggcg>ccg	p.A159del		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	159	Poly-Ala.						poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.A159delA(3)		endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			CAGGATGAgccggcggcggcggc	0.768														4335	0.865615	0.8343	0.9395	5008	,	,		8937	0.8065		0.9423	False		,,,				2504	0.8374				p.154_155del		.											.	ZCCHC3-90	3	Deletion - In frame(3)	prostate(2)|large_intestine(1)	c.461_463del						.																																			SO:0001651	inframe_deletion	85364	exon1			ATGAGCCGGCGGC	AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.461_463delCGG	20.37:g.278697_278699delCGG	ENSP00000371789:p.Ala159del	3	3		11	11	NM_033089	0	0	0	0	0	Q3B7J3|Q6NT79	In_Frame_Del	DEL	ENST00000382352.3	37	CCDS42844.1																																																																																			.		0.768	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077447.1		
DNTTIP1	116092	hgsc.bcm.edu	37	20	44420682	44420682	+	Silent	SNP	T	T	C	rs2664591	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr20:44420682T>C	ENST00000372622.3	+	1	107	c.39T>C	c.(37-39)ccT>ccC	p.P13P	WFDC3_ENST00000481847.1_5'Flank|WFDC3_ENST00000372630.2_5'Flank|WFDC3_ENST00000372632.2_5'Flank|WFDC3_ENST00000243938.4_5'Flank	NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	13						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CGCGGGGACCTAGCGGGGCCG	0.746													C|||	3358	0.670527	0.6952	0.7968	5008	,	,		12080	0.6458		0.7058	False		,,,				2504	0.5368				p.P13P		.											.	DNTTIP1-91	0			c.T39C						.	C		2483,791		949,585,103	4.0	6.0	5.0		39	1.1	0.9	20	dbSNP_100	5	5222,1736		1983,1256,240	no	coding-synonymous	DNTTIP1	NM_052951.2		2932,1841,343	CC,CT,TT		24.9497,24.16,24.697		13/330	44420682	7705,2527	1637	3479	5116	SO:0001819	synonymous_variant	116092	exon1			GGGACCTAGCGGG	AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.39T>C	20.37:g.44420682T>C		0	0		9	5	NM_052951	0	0	1	3	2	B2RA18|Q96DE3|Q9BQP2|Q9H148	Silent	SNP	ENST00000372622.3	37	CCDS13369.1																																																																																			T|0.311;C|0.689		0.746	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079502.1	NM_052951	
SLC13A3	64849	bcgsc.ca	37	20	45242269	45242269	+	Silent	SNP	G	G	C	rs2273024	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr20:45242269G>C	ENST00000279027.4	-	2	225	c.207C>G	c.(205-207)ctC>ctG	p.L69L	SLC13A3_ENST00000417157.2_Silent_p.L22L|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000396360.1_Silent_p.L22L|SLC13A3_ENST00000413164.2_Silent_p.L69L|SLC13A3_ENST00000339636.3_Silent_p.L69L|SLC13A3_ENST00000372121.1_Silent_p.L69L|SLC13A3_ENST00000495082.1_Silent_p.L22L|SLC13A3_ENST00000290317.5_Silent_p.L22L|SLC13A3_ENST00000472148.1_Silent_p.L22L	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	69					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	TGAAGGGGAAGAGGACGATGG	0.612													G|||	1548	0.309105	0.2088	0.3617	5008	,	,		14974	0.2798		0.3539	False		,,,				2504	0.3916				p.L69L		.											.	SLC13A3-91	0			c.C207G						.	G	,,,,	1028,3378	373.4+/-320.8	116,796,1291	74.0	55.0	61.0		66,207,66,,207	-0.3	1.0	20	dbSNP_100	61	2852,5748	440.6+/-359.6	451,1950,1899	no	coding-synonymous,coding-synonymous,coding-synonymous,intron,coding-synonymous	SLC13A3	NM_001011554.2,NM_001193339.1,NM_001193340.1,NM_001193342.1,NM_022829.5	,,,,	567,2746,3190	CC,CG,GG		33.1628,23.3318,29.8324	,,,,	22/556,69/553,22/521,,69/603	45242269	3880,9126	2203	4300	6503	SO:0001819	synonymous_variant	64849	exon2			GGGGAAGAGGACG	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.207C>G	20.37:g.45242269G>C		155	1		219	7	NM_022829	0	0	0	0	0	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Silent	SNP	ENST00000279027.4	37	CCDS13400.1																																																																																			G|0.680;C|0.320		0.612	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080329.2		
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770159	48770159	+	Missense_Mutation	SNP	T	T	C	rs232733		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr20:48770159T>C	ENST00000341698.2	-	1	15	c.16A>G	c.(16-18)Aac>Gac	p.N6D	TMEM189_ENST00000557021.1_Missense_Mutation_p.N6D|TMEM189_ENST00000371650.5_Missense_Mutation_p.N6D|TMEM189_ENST00000371652.4_Missense_Mutation_p.N6D	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CCCGGCCAGTTCTCGGCGCCC	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		6103	1.0		1.0	False		,,,				2504	1.0				p.N6D		.											.	TMEM189-22	0			c.A16G						.						2.0	2.0	2.0					20																	48770159		1101	2248	3349	SO:0001583	missense	387521	exon1			GCCAGTTCTCGGC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.16A>G	20.37:g.48770159T>C	ENSP00000344166:p.Asn6Asp	0	0		9	9	NM_199129	0	0	0	5	5		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	2182	0.9990842490842491	492	1.0	360	0.994475138121547	572	1.0	758	1.0	C	0.054	-1.242740	0.01481	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.46819	0.86;0.86;1.11;1.11	3.81	0.707	0.18139	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40757	-0.9546	8	0.02654	T	1	.	3.4688	0.07559	0.1731:0.5239:0.0:0.303	rs232733;rs674252;rs56654084	6;6;6	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	D	6	ENSP00000344166:N6D;ENSP00000450635:N6D;ENSP00000360713:N6D;ENSP00000360715:N6D	ENSP00000360713:N6D	N	-	1	0	TMEM189-UBE2V1;TMEM189	48203566	1.000000	0.71417	0.503000	0.27626	0.073000	0.16967	0.497000	0.22514	-0.274000	0.09232	-2.268000	0.00277	AAC	C|0.999;T|0.001		0.766	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
RPS21	6227	ucsc.edu	37	20	60962972	60962972	+	Splice_Site	SNP	T	T	G			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr20:60962972T>G	ENST00000343986.4	+	4	225		c.e4+2		RPS21_ENST00000450116.2_Splice_Site|RPS21_ENST00000492356.2_Splice_Site|RPS21_ENST00000370562.1_3'UTR	NM_001024.3	NP_001015.1	P63220	RS21_HUMAN	ribosomal protein S21						cellular protein metabolic process (GO:0044267)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 3'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000461)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)|structural constituent of ribosome (GO:0003735)			endometrium(2)|lung(1)|prostate(1)	4	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CGTAGGATGGTGAGTGTTTCC	0.502																																					.		.											.	RPS21-90	0			c.186+2T>G						.						128.0	122.0	124.0					20																	60962972		2202	4300	6502	SO:0001630	splice_region_variant	6227	exon4			GGATGGTGAGTGT	L04483	CCDS13497.1	20q13.3	2011-04-05			ENSG00000171858	ENSG00000171858		"""S ribosomal proteins"""	10409	protein-coding gene	gene with protein product	"""8.2 kDa differentiation factor"""	180477				8332502, 9582194	Standard	NM_001024		Approved	S21	uc002ycr.3	P63220	OTTHUMG00000032915	ENST00000343986.4:c.186+2T>G	20.37:g.60962972T>G		141	3		171	2	NM_001024	0	0	5	6	1	P35265	Splice_Site	SNP	ENST00000343986.4	37	CCDS13497.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.356105|4.356105	0.82243|0.82243	.|.	.|.	ENSG00000171858|ENSG00000171858	ENST00000317311;ENST00000343986;ENST00000337102;ENST00000450116|ENST00000370592	.|.	.|.	.|.	4.91|4.91	4.91|4.91	0.64330|0.64330	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77177	.|0.4092	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.87578	.|0.998	.|T	.|0.78548	.|-0.2162	.|6	.|.	.|.	.|.	.|.	12.4847|12.4847	0.55866|0.55866	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|63	.|Q9BYK1	.|.	.|G	-1|63	.|.	.|.	.|V	+|+	.|2	.|0	RPS21|RPS21	60396367|60396367	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	5.718000|5.718000	0.68455|0.68455	1.833000|1.833000	0.53350|0.53350	0.455000|0.455000	0.32223|0.32223	.|GTG	.		0.502	RPS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080031.2	NM_001024	Intron
KRTAP11-1	337880	bcgsc.ca	37	21	32253629	32253629	+	Missense_Mutation	SNP	C	C	T	rs71321355	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr21:32253629C>T	ENST00000332378.4	-	1	245	c.215G>A	c.(214-216)cGg>cAg	p.R72Q		NM_175858.2	NP_787054.1	Q8IUC1	KR111_HUMAN	keratin associated protein 11-1	72						keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(12)|pancreas(1)	18						TGAAGTTCGCCGGTAACAGGT	0.567													T|||	723	0.144369	0.0492	0.1455	5008	,	,		20581	0.0526		0.1978	False		,,,				2504	0.3119				p.R72Q		.											.	KRTAP11-1-91	0			c.G215A						.	T	GLN/ARG	354,4052	794.6+/-415.3	16,322,1865	82.0	76.0	78.0		215	2.1	0.3	21	dbSNP_130	78	1862,6738	729.6+/-406.7	212,1438,2650	yes	missense	KRTAP11-1	NM_175858.2	43	228,1760,4515	TT,TC,CC		21.6512,8.0345,17.0383	benign	72/164	32253629	2216,10790	2203	4300	6503	SO:0001583	missense	337880	exon1			GTTCGCCGGTAAC	AJ457065	CCDS13608.1	21q22.1	2003-03-11			ENSG00000182591	ENSG00000182591		"""Keratin associated proteins"""	18922	protein-coding gene	gene with protein product		600064				12359730	Standard	NM_175858		Approved	KAP11.1	uc002yov.3	Q8IUC1	OTTHUMG00000057773	ENST00000332378.4:c.215G>A	21.37:g.32253629C>T	ENSP00000330720:p.Arg72Gln	349	2		170	6	NM_175858	0	0	0	0	0	A1L4I8	Missense_Mutation	SNP	ENST00000332378.4	37	CCDS13608.1	265	0.12133699633699634	20	0.04065040650406504	60	0.16574585635359115	35	0.06118881118881119	150	0.19788918205804748	T	0.788	-0.759997	0.03019	0.080345	0.216512	ENSG00000182591	ENST00000332378	T	0.02812	4.15	4.72	2.11	0.27256	.	0.390240	0.24185	N	0.040779	T	0.00012	0.0000	N	0.00605	-1.335	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44283	-0.9338	9	0.02654	T	1	0.8325	6.5317	0.22330	0.0:0.0884:0.3544:0.5572	.	72	Q8IUC1	KR111_HUMAN	Q	72	ENSP00000330720:R72Q	ENSP00000330720:R72Q	R	-	2	0	KRTAP11-1	31175500	0.982000	0.34865	0.251000	0.24312	0.934000	0.57294	0.755000	0.26405	0.365000	0.24400	-0.260000	0.10688	CGG	C|0.841;T|0.159		0.567	KRTAP11-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128225.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780091	20780091	+	Silent	SNP	C	C	G	rs759610		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr22:20780091C>G	ENST00000266214.5	-	11	2291	c.2187G>C	c.(2185-2187)ccG>ccC	p.P729P	SCARF2_ENST00000405555.3_Silent_p.P724P	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	729	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CGGGCAGCCCCGGGGGGCGCG	0.781																																					p.P729P		.											.	SCARF2-341	0			c.G2187C						.	G	,	3110,60		1525,60,0	4.0	5.0	4.0		2187,2172	-6.8	0.1	22	dbSNP_86	4	5974,118		2928,118,0	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4453,178,0	GG,GC,CC		1.937,1.8927,1.9218	,	729/871,724/866	20780091	9084,178	1585	3046	4631	SO:0001819	synonymous_variant	91179	exon11			CAGCCCCGGGGGG	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2187G>C	22.37:g.20780091C>G		0	0		14	14	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			C|0.138;G|0.862		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		0	0		17	17	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
NEFH	4744	hgsc.bcm.edu;ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		240	0		242	29	NM_021076	0	0	18	18	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TEF	7008	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	41791922	41791922	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr22:41791922G>C	ENST00000266304.4	+	4	986	c.870G>C	c.(868-870)aaG>aaC	p.K290N	TEF_ENST00000406644.3_Missense_Mutation_p.K260N	NM_003216.3	NP_003207.1	Q10587	TEF_HUMAN	thyrotrophic embryonic factor	290	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						GCAAGTGCAAGACCATCGTGT	0.627																																					p.K290N		.											.	TEF-91	0			c.G870C						.						128.0	107.0	114.0					22																	41791922		2203	4300	6503	SO:0001583	missense	7008	exon4			GTGCAAGACCATC		CCDS14014.1, CCDS46716.1	22q13.2	2013-01-10			ENSG00000167074	ENSG00000167074		"""basic leucine zipper proteins"""	11722	protein-coding gene	gene with protein product		188595				7835883, 15665112	Standard	NM_001145398		Approved	KIAA1655	uc003azy.4	Q10587	OTTHUMG00000150968	ENST00000266304.4:c.870G>C	22.37:g.41791922G>C	ENSP00000266304:p.Lys290Asn	192	0		183	12	NM_003216	0	0	8	8	0	B0QYS8|B2RC22|Q15729|Q7Z3J7|Q8IU94|Q96TG4	Missense_Mutation	SNP	ENST00000266304.4	37	CCDS14014.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979198	0.92982	.	.	ENSG00000167074	ENST00000406644;ENST00000433913;ENST00000266304	T;T	0.52526	0.66;0.66	5.69	5.69	0.88448	Basic-leucine zipper (bZIP) transcription factor (2);	0.047315	0.85682	D	0.000000	T	0.69260	0.3091	M	0.78637	2.42	0.80722	D	1	D;D;D	0.60160	0.983;0.986;0.987	P;P;P	0.61477	0.889;0.782;0.875	T	0.71669	-0.4523	10	0.66056	D	0.02	-33.0769	19.8108	0.96545	0.0:0.0:1.0:0.0	.	295;290;260	B4DIH3;Q10587;Q10587-2	.;TEF_HUMAN;.	N	260;260;290	ENSP00000385256:K260N;ENSP00000266304:K290N	ENSP00000266304:K290N	K	+	3	2	TEF	40121868	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.493000	0.81493	2.698000	0.92095	0.563000	0.77884	AAG	.		0.627	TEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320692.1	NM_003216	
CTNNB1	1499	ucsc.edu;bcgsc.ca	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1-24361	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	3.37:g.41266136T>C	ENSP00000344456:p.Ser45Pro	213	3		184	91	NM_001098209	0	0	71	127	56	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
MUC4	4585	bcgsc.ca	37	3	195506459	195506459	+	Missense_Mutation	SNP	C	C	T	rs199910419	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr3:195506459C>T	ENST00000463781.3	-	2	12451	c.11992G>A	c.(11992-11994)Gcc>Acc	p.A3998T	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3998T	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGCGTGACCTGTG	0.602													.|||	38	0.00758786	0.0242	0.0	5008	,	,		9160	0.004		0.002	False		,,,				2504	0.0				p.A3998T		.											.	MUC4-90	0			c.G11992A						.						14.0	10.0	11.0					3																	195506459		668	1475	2143	SO:0001583	missense	4585	exon2			GGGTGGCGTGACC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11992G>A	3.37:g.195506459C>T	ENSP00000417498:p.Ala3998Thr	233	5		71	14	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	N	0.597	-0.830603	0.02734	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.48522	1.25;0.81	0.764	-1.53	0.08611	.	0.000000	0.25514	N	0.030158	T	0.20618	0.0496	N	0.19112	0.55	0.09310	N	1	B	0.33494	0.414	B	0.28232	0.087	T	0.19679	-1.0298	9	.	.	.	.	0.9151	0.01303	0.197:0.2096:0.3846:0.2087	.	3870	E7ESK3	.	T	3998	ENSP00000417498:A3998T;ENSP00000420243:A3998T	.	A	-	1	0	MUC4	196991238	0.000000	0.05858	0.000000	0.03702	0.183000	0.23260	-2.685000	0.00834	-2.003000	0.00962	0.064000	0.15345	GCC	.		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
MUC4	4585	bcgsc.ca	37	3	195506462	195506462	+	Missense_Mutation	SNP	G	G	C	rs547195540	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr3:195506462G>C	ENST00000463781.3	-	2	12448	c.11989C>G	c.(11989-11991)Cac>Gac	p.H3997D	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H3997D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGCGTGACCTGTGGAT	0.602													.|||	35	0.00698882	0.0227	0.0	5008	,	,		9048	0.003		0.002	False		,,,				2504	0.0				p.H3997D		.											.	MUC4-90	0			c.C11989G						.						12.0	9.0	10.0					3																	195506462		664	1461	2125	SO:0001583	missense	4585	exon2			TGGCGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11989C>G	3.37:g.195506462G>C	ENSP00000417498:p.His3997Asp	234	2		61	7	NM_018406	0	0	0	0	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	2.909	-0.225781	0.06022	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.41;1.5	0.764	-0.498	0.12019	.	0.000000	0.25267	N	0.031920	T	0.15003	0.0362	N	0.19112	0.55	0.09310	N	1	B	0.14805	0.011	B	0.21546	0.035	T	0.21827	-1.0234	9	.	.	.	.	5.621	0.17457	0.0:0.0:0.6825:0.3174	.	3869	E7ESK3	.	D	3997	ENSP00000417498:H3997D;ENSP00000420243:H3997D	.	H	-	1	0	MUC4	196991241	0.000000	0.05858	0.001000	0.08648	0.189000	0.23516	-0.901000	0.04093	-0.142000	0.11354	0.064000	0.15345	CAC	.		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
IDUA	3425	hgsc.bcm.edu	37	4	980971	980971	+	Missense_Mutation	SNP	T	T	G	rs10794537	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr4:980971T>G	ENST00000247933.4	+	1	187	c.99T>G	c.(97-99)caT>caG	p.H33Q	IDUA_ENST00000453894.1_Missense_Mutation_p.H33Q|SLC26A1_ENST00000398520.2_Intron	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	33			H -> Q (in dbSNP:rs10794537). {ECO:0000269|PubMed:1362562, ECO:0000269|PubMed:1505961, ECO:0000269|PubMed:1946389, ECO:0000269|PubMed:21394825}.		carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACCTGGTGCATGTGGACGCGG	0.801													G|||	4467	0.891973	0.9826	0.8386	5008	,	,		8604	0.8472		0.8042	False		,,,				2504	0.9438				p.H33Q		.											.	IDUA-91	0			c.T99G						.						1.0	1.0	1.0					4																	980971		552	1375	1927	SO:0001583	missense	3425	exon1			GGTGCATGTGGAC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.99T>G	4.37:g.980971T>G	ENSP00000247933:p.His33Gln	0	0		5	5	NM_000203	0	0	4	7	3	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	1801|1801	0.8246336996336996|0.8246336996336996	464|464	0.943089430894309|0.943089430894309	294|294	0.8121546961325967|0.8121546961325967	448|448	0.7832167832167832|0.7832167832167832	595|595	0.7849604221635884|0.7849604221635884	G|G	3.726|3.726	-0.056533|-0.056533	0.07362|0.07362	.|.	.|.	ENSG00000127415|ENSG00000127415	ENST00000504568|ENST00000247933;ENST00000453894;ENST00000502910	.|D;D;D	.|0.93247	.|-3.18;-3.19;-3.03	3.62|3.62	-0.897|-0.897	0.10553|0.10553	.|.	.|0.728933	.|0.12190	.|N	.|0.491278	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.36817|0.36817	-0.9732|-0.9732	4|9	.|0.10111	.|T	.|0.7	.|.	1.2904|1.2904	0.02059|0.02059	0.1461:0.2669:0.3485:0.2385|0.1461:0.2669:0.3485:0.2385	rs10794537|rs10794537	.|33;33	.|B3KWK6;P35475	.|.;IDUA_HUMAN	G|Q	33|33	.|ENSP00000247933:H33Q;ENSP00000396458:H33Q;ENSP00000422952:H33Q	.|ENSP00000247933:H33Q	C|H	+|+	1|3	0|2	IDUA|IDUA	970971|970971	0.000000|0.000000	0.05858|0.05858	0.992000|0.992000	0.48379|0.48379	0.012000|0.012000	0.07955|0.07955	-2.547000|-2.547000	0.00931|0.00931	-0.253000|-0.253000	0.09514|0.09514	-1.482000|-1.482000	0.00985|0.00985	TGT|CAT	T|0.175;G|0.825		0.801	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
CRIPAK	285464	bcgsc.ca	37	4	1388819	1388819	+	Missense_Mutation	SNP	T	T	C	rs144797159	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr4:1388819T>C	ENST00000324803.4	+	1	3480	c.520T>C	c.(520-522)Tgt>Cgt	p.C174R		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	174					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCCATGTGGAGTGCC	0.677													N|||	940	0.1877	0.3328	0.1398	5008	,	,		17297	0.0992		0.0378	False		,,,				2504	0.271				p.C174R		.											.	CRIPAK-90	0			c.T520C						.						191.0	130.0	151.0					4																	1388819		2194	4196	6390	SO:0001583	missense	285464	exon1			TGCCCATGTGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.520T>C	4.37:g.1388819T>C	ENSP00000323978:p.Cys174Arg	37	2		112	24	NM_175918	0	0	24	24	0	Q8NB03	Missense_Mutation	SNP	ENST00000324803.4	37	CCDS3349.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	2.950|2.950	-0.216975|-0.216975	0.06101|0.06101	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.29142|.	1.58|.	1.25|1.25	-0.146|-0.146	0.13432|0.13432	Post-SET domain (1);|.	.|.	.|.	.|.	.|.	T|T	0.15825|0.15825	0.0381|0.0381	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B|.	0.20052|.	0.041|.	B|.	0.11329|.	0.006|.	T|T	0.24977|0.24977	-1.0145|-1.0145	9|6	0.66056|0.27082	D|T	0.02|0.32	.|.	4.6847|4.6847	0.12752|0.12752	0.0:0.2124:0.0:0.7876|0.0:0.2124:0.0:0.7876	.|.	174|.	Q8N1N5|.	CRPAK_HUMAN|.	R|T	174|157	ENSP00000323978:C174R|.	ENSP00000323978:C174R|ENSP00000372402:M157T	C|M	+|+	1|2	0|0	CRIPAK|CRIPAK	1378819|1378819	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.014000|0.014000	0.08584|0.08584	-0.160000|-0.160000	0.10041|0.10041	-0.013000|-0.013000	0.14199|0.14199	0.102000|0.102000	0.15555|0.15555	TGT|ATG	T|0.950;C|0.050		0.677	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
SOD3	6649	hgsc.bcm.edu	37	4	24801354	24801354	+	Silent	SNP	C	C	T	rs8192291	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr4:24801354C>T	ENST00000382120.3	+	2	416	c.211C>T	c.(211-213)Ctg>Ttg	p.L71L		NM_003102.2	NP_003093.2	P08294	SODE_HUMAN	superoxide dismutase 3, extracellular	71					removal of superoxide radicals (GO:0019430)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	copper ion binding (GO:0005507)|heparin binding (GO:0008201)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)			prostate(1)|urinary_tract(1)	2		Breast(46;0.0503)				GTCGGCCACGCTGGACGCCGC	0.726													C|||	994	0.198482	0.0968	0.1585	5008	,	,		11823	0.3512		0.2028	False		,,,				2504	0.2025				p.L71L		.											.	SOD3-90	0			c.C211T						.	C		341,3293		12,317,1488	4.0	5.0	5.0		211	0.7	0.0	4	dbSNP_117	5	1103,6325		63,977,2674	no	coding-synonymous	SOD3	NM_003102.2		75,1294,4162	TT,TC,CC		14.8492,9.3836,13.0537		71/241	24801354	1444,9618	1817	3714	5531	SO:0001819	synonymous_variant	6649	exon2			GCCACGCTGGACG		CCDS3430.1	4p15.2	2012-09-20			ENSG00000109610	ENSG00000109610	1.15.1.1		11181	protein-coding gene	gene with protein product		185490					Standard	NM_003102		Approved	EC-SOD	uc003gqz.3	P08294	OTTHUMG00000128565	ENST00000382120.3:c.211C>T	4.37:g.24801354C>T		2	0		47	19	NM_003102	0	0	0	0	0	Q5U781|Q6FHA2	Silent	SNP	ENST00000382120.3	37	CCDS3430.1																																																																																			C|0.777;T|0.223		0.726	SOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250416.1		
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000514014.1_Intron|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000381795.6_Silent_p.S19S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		0	0		8	8	NM_001098634	0	0	0	2	2	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
TMEM165	55858	hgsc.bcm.edu	37	4	56262374	56262374	+	Silent	SNP	A	A	G	rs1128141	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr4:56262374A>G	ENST00000381334.5	+	1	251	c.18A>G	c.(16-18)ccA>ccG	p.P6P	SRD5A3-AS1_ENST00000601433.1_RNA|SRD5A3-AS1_ENST00000598819.1_RNA|SRD5A3-AS1_ENST00000599135.1_RNA|TMEM165_ENST00000506198.1_Silent_p.P6P|SRD5A3-AS1_ENST00000592823.1_RNA|TMEM165_ENST00000542052.1_5'UTR	NM_018475.4	NP_060945.2	Q9HC07	TM165_HUMAN	transmembrane protein 165	6					cellular calcium ion homeostasis (GO:0006874)|Golgi calcium ion transport (GO:0032472)|protein N-linked glycosylation (GO:0006487)|regulation of lysosomal lumen pH (GO:0035751)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(1)|kidney(1)|large_intestine(2)	4	Lung NSC(11;0.00545)|Glioma(25;0.08)|all_neural(26;0.101)|all_epithelial(27;0.135)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0103)			CCGCGGCTCCAGGGAACGGCC	0.751													a|||	3782	0.755192	0.8654	0.7176	5008	,	,		8141	0.6776		0.6511	False		,,,				2504	0.82				p.P6P		.											.	TMEM165-514	0			c.A18G						.						1.0	2.0	2.0					4																	56262374		1230	2885	4115	SO:0001819	synonymous_variant	55858	exon1			GGCTCCAGGGAAC	AF183409	CCDS3499.1	4q12	2014-03-13			ENSG00000134851	ENSG00000134851			30760	protein-coding gene	gene with protein product	"""TPA regulated locus"""	614726				3202867, 22683087, 23575229	Standard	NM_018475		Approved	TMPT27, TPARL, GDT1	uc003hax.3	Q9HC07	OTTHUMG00000128735	ENST00000381334.5:c.18A>G	4.37:g.56262374A>G		0	0		6	6	NM_018475	0	0	0	4	4	A8K3P8|B4DHW1|Q9BTN9|Q9NZ34	Silent	SNP	ENST00000381334.5	37	CCDS3499.1																																																																																			T|0.293;G|0.003		0.751	TMEM165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250646.4	NM_018475	
SHROOM3	57619	hgsc.bcm.edu	37	4	77662248	77662248	+	Silent	SNP	G	G	A	rs344142	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr4:77662248G>A	ENST00000296043.6	+	5	3875	c.2922G>A	c.(2920-2922)tcG>tcA	p.S974S		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	974	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCGAGGCGTCGGCCTCCGCCT	0.776													G|||	2165	0.432308	0.4054	0.4827	5008	,	,		9965	0.2669		0.6044	False		,,,				2504	0.4264				p.S974S		.											.	SHROOM3-93	0			c.G2922A						.	G		1740,1410		550,640,385	2.0	3.0	3.0		2922	0.4	0.0	4	dbSNP_129	3	4503,2047		1663,1177,435	no	coding-synonymous	SHROOM3	NM_020859.3		2213,1817,820	AA,AG,GG		31.2519,44.7619,35.6392		974/1997	77662248	6243,3457	1575	3275	4850	SO:0001819	synonymous_variant	57619	exon5			GGCGTCGGCCTCC	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2922G>A	4.37:g.77662248G>A		0	0		8	7	NM_020859	0	0	0	0	0	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	37	CCDS3579.2																																																																																			G|0.531;A|0.469		0.776	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
DSPP	1834	ucsc.edu	37	4	88536457	88536457	+	Silent	SNP	T	T	C	rs141186173|rs111205177|rs199994008	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr4:88536457T>C	ENST00000282478.7	+	4	2676	c.2643T>C	c.(2641-2643)gaT>gaC	p.D881D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.D881D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	881	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.D881_S882insSSD(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcagtgatagcagtgaca	0.498																																					p.D881D		.											.	DSPP-90	1	Insertion - In frame(1)	ovary(1)	c.T2643C						.						73.0	87.0	82.0					4																	88536457		1618	2922	4540	SO:0001819	synonymous_variant	1834	exon5			CAGTGATAGCAGT	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2643T>C	4.37:g.88536457T>C		466	0		439	76	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.498	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
DSPP	1834	mdanderson.org	37	4	88536460	88536460	+	Silent	SNP	C	C	T	rs199691318		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr4:88536460C>T	ENST00000282478.7	+	4	2679	c.2646C>T	c.(2644-2646)agC>agT	p.S882S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Silent_p.S882S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	882	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gcagtgatagcagtgacagca	0.498																																					p.S882S		.											.	DSPP-90	0			c.C2646T						.						73.0	87.0	82.0					4																	88536460		1617	2929	4546	SO:0001819	synonymous_variant	1834	exon5			TGATAGCAGTGAC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2646C>T	4.37:g.88536460C>T		464	2		442	127	NM_014208	0	0	0	0	0	A8MUI0|O95815	Silent	SNP	ENST00000282478.7	37	CCDS43248.1																																																																																			.		0.498	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
SLC9A3	6550	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	475724	475724	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr5:475724C>G	ENST00000264938.3	-	15	2212	c.2203G>C	c.(2203-2205)Gag>Cag	p.E735Q	CTD-2228K2.7_ENST00000606319.1_RNA|CTD-2228K2.5_ENST00000510714.1_5'Flank|CTD-2228K2.7_ENST00000607005.1_RNA|SLC9A3_ENST00000514375.1_Missense_Mutation_p.E726Q|CTD-2228K2.7_ENST00000606288.1_RNA|CTD-2228K2.5_ENST00000510604.1_5'Flank|CTD-2228K2.5_ENST00000342584.3_5'Flank|CTD-2228K2.7_ENST00000607286.1_RNA	NM_004174.2	NP_004165.2	P48764	SL9A3_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3	735					ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|sodium:proton antiporter activity (GO:0015385)			NS(2)|biliary_tract(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(16)|prostate(3)|skin(2)|urinary_tract(1)	37			Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			GCCAGGAACTCGATCCCCCCA	0.632																																					p.E735Q		.											.	SLC9A3-90	0			c.G2203C						.						46.0	39.0	41.0					5																	475724		2158	4205	6363	SO:0001583	missense	6550	exon15			GGAACTCGATCCC		CCDS3855.1, CCDS64116.1	5p15.3	2013-05-22	2012-03-22		ENSG00000066230	ENSG00000066230		"""Solute carriers"""	11073	protein-coding gene	gene with protein product		182307	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3"""	NHE3		8096830	Standard	NM_004174		Approved		uc003jbe.2	P48764	OTTHUMG00000090315	ENST00000264938.3:c.2203G>C	5.37:g.475724C>G	ENSP00000264938:p.Glu735Gln	94	0		100	5	NM_004174	0	0	0	0	0	B7ZKR2|E9PF67|Q3MIW3	Missense_Mutation	SNP	ENST00000264938.3	37	CCDS3855.1	.	.	.	.	.	.	.	.	.	.	C	7.700	0.692927	0.15039	.	.	ENSG00000066230	ENST00000264938;ENST00000514375	T;T	0.76839	-1.05;-1.05	4.64	3.76	0.43208	.	0.445032	0.25601	N	0.029556	T	0.70404	0.3220	M	0.63428	1.95	0.27424	N	0.954212	P;P	0.49307	0.922;0.906	B;B	0.40199	0.164;0.322	T	0.62338	-0.6875	10	0.16896	T	0.51	.	10.9129	0.47118	0.0:0.9097:0.0:0.0903	.	726;735	E9PF67;P48764	.;SL9A3_HUMAN	Q	735;726	ENSP00000264938:E735Q;ENSP00000422983:E726Q	ENSP00000264938:E735Q	E	-	1	0	SLC9A3	528724	0.131000	0.22433	0.910000	0.35882	0.047000	0.14425	1.003000	0.29809	1.071000	0.40834	0.462000	0.41574	GAG	.		0.632	SLC9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206677.2	NM_004174	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5140632	5140632	+	Silent	SNP	T	T	C	rs270208	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr5:5140632T>C	ENST00000274181.7	+	1	190	c.52T>C	c.(52-54)Ttg>Ctg	p.L18L	CTD-2297D10.1_ENST00000514848.1_RNA|CTD-2297D10.2_ENST00000512155.1_RNA|ADAMTS16_ENST00000511368.1_Silent_p.L18L	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	18					branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GTGGATGCTGTTGGCGCAGGT	0.766													C|||	3127	0.624401	0.6747	0.6571	5008	,	,		8861	0.8065		0.501	False		,,,				2504	0.4724				p.L18L		.											.	ADAMTS16-275	0			c.T52C						.	C		2046,874		775,496,189	2.0	5.0	4.0		52	1.2	1.0	5	dbSNP_79	4	3653,3047		1121,1411,818	no	coding-synonymous	ADAMTS16	NM_139056.2		1896,1907,1007	CC,CT,TT		45.4776,29.9315,40.7588		18/1225	5140632	5699,3921	1460	3350	4810	SO:0001819	synonymous_variant	170690	exon1			ATGCTGTTGGCGC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.52T>C	5.37:g.5140632T>C		0	0		13	4	NM_139056	0	0	0	0	0	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	37	CCDS43299.1																																																																																			T|0.352;C|0.648		0.766	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
ISL1	3670	hgsc.bcm.edu;broad.mit.edu	37	5	50685485	50685485	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr5:50685485delC	ENST00000230658.7	+	4	1069	c.484delC	c.(484-486)cccfs	p.P162fs	ISL1_ENST00000505475.2_3'UTR|ISL1_ENST00000511384.1_Frame_Shift_Del_p.P162fs	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	162					atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				CGCAGCGGAGCCCATCTCCGC	0.741																																					p.P162fs		.											.	ISL1-515	0			c.484delC						.						16.0	21.0	19.0					5																	50685485		2192	4293	6485	SO:0001589	frameshift_variant	3670	exon4			GCGGAGCCCATCT	BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.484delC	5.37:g.50685485delC	ENSP00000230658:p.Pro162fs	12	0		49	26	NM_002202	0	0	0	0	0	P20663|P47894	Frame_Shift_Del	DEL	ENST00000230658.7	37	CCDS43314.1																																																																																			.		0.741	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368413.3	NM_002202	
APC	324	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	112103039	112103039	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr5:112103039A>G	ENST00000457016.1	+	4	754	c.374A>G	c.(373-375)aAt>aGt	p.N125S	APC_ENST00000257430.4_Missense_Mutation_p.N125S|APC_ENST00000508376.2_Missense_Mutation_p.N125S			P25054	APC_HUMAN	adenomatous polyposis coli	125	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)			NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GGGTTTGTAAATGGAAGCAGA	0.413		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.N135S	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC-12026	0			c.A404G						.						93.0	91.0	92.0					5																	112103039		2202	4300	6502	SO:0001583	missense	324	exon3	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	TTGTAAATGGAAG	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.374A>G	5.37:g.112103039A>G	ENSP00000413133:p.Asn125Ser	141	0		120	50	NM_001127511	0	0	1	1	0	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	37	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.032335	0.35893	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07	5.57	5.57	0.84162	.	0.155750	0.56097	D	0.000027	T	0.74612	0.3739	N	0.16478	0.41	0.31311	N	0.687151	B;B	0.19445	0.02;0.036	B;B	0.15484	0.013;0.012	T	0.69030	-0.5253	9	.	.	.	-25.4888	15.7301	0.77794	1.0:0.0:0.0:0.0	.	127;125	Q4LE70;P25054	.;APC_HUMAN	S	125;135;125;125;125	ENSP00000413133:N125S;ENSP00000423224:N135S;ENSP00000257430:N125S;ENSP00000427089:N125S;ENSP00000423828:N125S	.	N	+	2	0	APC	112130938	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.587000	0.67510	2.120000	0.65058	0.477000	0.44152	AAT	.		0.413	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
RANBP17	64901	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	170632528	170632528	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr5:170632528C>T	ENST00000523189.1	+	20	2307	c.2143C>T	c.(2143-2145)Cgt>Tgt	p.R715C	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	715					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.R715S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCACTGACAGCGTATGTTGAT	0.428			T	TRD@	ALL																																p.R715C		.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17-524	1	Substitution - Missense(1)	skin(1)	c.C2143T						.						161.0	138.0	146.0					5																	170632528		2203	4300	6503	SO:0001630	splice_region_variant	64901	exon20			TGACAGCGTATGT	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2143-1C>T	5.37:g.170632528C>T		184	0		213	14	NM_022897	0	0	0	0	0	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	C	19.53	3.845396	0.71603	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.68331	-0.32	5.96	5.96	0.96718	Armadillo-type fold (1);	0.000000	0.64402	D	0.000004	T	0.80059	0.4554	M	0.70275	2.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70487	0.932;0.969;0.932	T	0.78986	-0.1987	9	.	.	.	-11.8389	15.1722	0.72884	0.1409:0.8591:0.0:0.0	.	715;40;715	Q546R4;Q96M10;Q9H2T7	.;.;RBP17_HUMAN	C	715;145	ENSP00000427975:R715C	.	R	+	1	0	RANBP17	170565133	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.946000	0.56644	2.832000	0.97577	0.655000	0.94253	CGT	.		0.428	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	Missense_Mutation
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		4	0		16	13	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
BTNL9	153579	hgsc.bcm.edu	37	5	180486404	180486404	+	Missense_Mutation	SNP	C	C	T	rs186444058	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr5:180486404C>T	ENST00000327705.9	+	11	1381	c.1150C>T	c.(1150-1152)Cac>Tac	p.H384Y	BTNL9_ENST00000376842.3_Missense_Mutation_p.H385Y	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9	384	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCCGGCCGCCACTACTGGGA	0.796													C|||	19	0.00379393	0.0	0.0101	5008	,	,		8064	0.0		0.0089	False		,,,				2504	0.0031				p.H384Y		.											.	BTNL9-91	0			c.C1150T						.						1.0	2.0	1.0					5																	180486404		836	1977	2813	SO:0001583	missense	153579	exon11			GGCCGCCACTACT	AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.1150C>T	5.37:g.180486404C>T	ENSP00000330200:p.His384Tyr	1	0		24	12	NM_152547	0	0	0	0	0	A6NL42|Q6P660|Q96DM5	Missense_Mutation	SNP	ENST00000327705.9	37	CCDS4460.2	38	0.0173992673992674	7	0.014227642276422764	5	0.013812154696132596	5	0.008741258741258742	21	0.027704485488126648	c	21.1	4.096472	0.76870	.	.	ENSG00000165810	ENST00000327705;ENST00000376842	T;T	0.68479	-0.33;-0.33	4.71	4.71	0.59529	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.217602	0.23321	U	0.049449	T	0.65575	0.2704	M	0.76938	2.355	0.30133	N	0.804617	B	0.28233	0.204	P	0.55615	0.78	T	0.75714	-0.3221	10	0.48119	T	0.1	.	15.5784	0.76410	0.0:1.0:0.0:0.0	.	384	Q6UXG8	BTNL9_HUMAN	Y	384;385	ENSP00000330200:H384Y;ENSP00000366038:H385Y	ENSP00000330200:H384Y	H	+	1	0	BTNL9	180419010	0.959000	0.32827	1.000000	0.80357	0.530000	0.34684	2.310000	0.43708	2.365000	0.80145	0.298000	0.19748	CAC	C|0.983;T|0.017		0.796	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157342.3	NM_152547	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		0	0		13	13	NM_001145115	0	0	0	2	2		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		0	0		11	11	NM_000287	0	0	0	2	2	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
TMEM63B	55362	bcgsc.ca	37	6	44115169	44115169	+	Missense_Mutation	SNP	G	G	A	rs4714759	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr6:44115169G>A	ENST00000259746.9	+	12	1102	c.919G>A	c.(919-921)Gtg>Atg	p.V307M	TMEM63B_ENST00000323267.6_Missense_Mutation_p.V307M			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	307			V -> M (in dbSNP:rs4714759). {ECO:0000269|PubMed:17974005}.		ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)	p.V307M(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CAAGGAGAACGTGCCTACCAT	0.607													G|||	521	0.104034	0.0068	0.0965	5008	,	,		20519	0.2252		0.0974	False		,,,				2504	0.1227				p.V307M		.											.	TMEM63B-92	1	Substitution - Missense(1)	stomach(1)	c.G919A						.	G	MET/VAL	110,4296	86.8+/-125.4	2,106,2095	147.0	110.0	122.0		919	2.7	0.9	6	dbSNP_111	122	920,7680	204.5+/-247.2	53,814,3433	yes	missense	TMEM63B	NM_018426.1	21	55,920,5528	AA,AG,GG		10.6977,2.4966,7.9194	benign	307/833	44115169	1030,11976	2203	4300	6503	SO:0001583	missense	55362	exon12			GAGAACGTGCCTA	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.919G>A	6.37:g.44115169G>A	ENSP00000259746:p.Val307Met	224	0		129	7	NM_018426	0	0	9	9	0	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	ENST00000259746.9	37	CCDS34461.1	255	0.11675824175824176	3	0.006097560975609756	38	0.10497237569060773	143	0.25	71	0.09366754617414248	G	12.24	1.879303	0.33162	0.024966	0.106977	ENSG00000137216	ENST00000259746;ENST00000323267	T;T	0.44083	0.93;0.93	4.53	2.74	0.32292	.	0.674800	0.15009	N	0.285696	T	0.10423	0.0255	N	0.22421	0.69	0.58432	P	1.0000000000287557E-6	B;B	0.23058	0.007;0.079	B;B	0.15870	0.006;0.014	T	0.07908	-1.0748	9	0.48119	T	0.1	.	3.4756	0.07583	0.266:0.2077:0.5263:0.0	rs4714759;rs52838417;rs58281604;rs4714759	307;307	Q5T3F8;Q5T3F8-2	TM63B_HUMAN;.	M	307	ENSP00000259746:V307M;ENSP00000327154:V307M	ENSP00000259746:V307M	V	+	1	0	TMEM63B	44223147	0.521000	0.26258	0.941000	0.38009	0.977000	0.68977	2.132000	0.42083	1.254000	0.44035	0.650000	0.86243	GTG	G|0.903;A|0.097		0.607	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410	
FAM46A	55603	hgsc.bcm.edu	37	6	82461742	82461742	+	Silent	SNP	G	G	A			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr6:82461742G>A	ENST00000320172.6	-	2	431	c.117C>T	c.(115-117)ggC>ggT	p.G39G	FAM46A_ENST00000369754.3_Silent_p.G58G|FAM46A_ENST00000369756.3_Silent_p.G120G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		cgaagtcgccgccgccgaagt	0.667																																					p.G39G		.											.	FAM46A-90	0			c.C117T						.						7.0	8.0	8.0					6																	82461742		1601	3424	5025	SO:0001819	synonymous_variant	55603	exon2			GTCGCCGCCGCCG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117C>T	6.37:g.82461742G>A		27	0		106	14	NM_017633	0	0	1	1	0	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	37	CCDS34489.1																																																																																			.		0.667	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
TPBG	7162	hgsc.bcm.edu	37	6	83074937	83074937	+	Missense_Mutation	SNP	A	A	G	rs144253219	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr6:83074937A>G	ENST00000369750.3	+	2	876	c.259A>G	c.(259-261)Acg>Gcg	p.T87A	TPBG_ENST00000535040.1_Missense_Mutation_p.T87A|TPBG_ENST00000543496.1_Missense_Mutation_p.T87A			Q13641	TPBG_HUMAN	trophoblast glycoprotein	87	LRRNT.				cell adhesion (GO:0007155)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CGAGGTGCCCACGGACCTGCC	0.726													A|||	43	0.00858626	0.0008	0.0072	5008	,	,		11804	0.0		0.0109	False		,,,				2504	0.0266				p.T87A		.											.	TPBG-514	0			c.A259G						.	A	ALA/THR,ALA/THR	11,4395		0,11,2192	25.0	25.0	25.0		259,259	3.2	0.4	6	dbSNP_134	25	115,8475		3,109,4183	yes	missense,missense	TPBG	NM_001166392.1,NM_006670.4	58,58	3,120,6375	GG,GA,AA		1.3388,0.2497,0.9695	benign,benign	87/421,87/421	83074937	126,12870	2203	4295	6498	SO:0001583	missense	7162	exon2			GTGCCCACGGACC	AJ012159	CCDS4995.1	6q14-q15	2008-07-29			ENSG00000146242	ENSG00000146242			12004	protein-coding gene	gene with protein product		190920				8132670	Standard	NM_006670		Approved	5T4-AG, 5T4	uc003pjo.3	Q13641	OTTHUMG00000015103	ENST00000369750.3:c.259A>G	6.37:g.83074937A>G	ENSP00000358765:p.Thr87Ala	1	0		78	24	NM_001166392	0	0	1	1	0	A8K555	Missense_Mutation	SNP	ENST00000369750.3	37	CCDS4995.1	11	0.005036630036630037	0	0.0	3	0.008287292817679558	0	0.0	8	0.010554089709762533	A	0.079	-1.187227	0.01620	0.002497	0.013388	ENSG00000146242	ENST00000535040;ENST00000369750;ENST00000543496	D;D;D	0.95918	-3.85;-3.85;-3.85	4.11	3.15	0.36227	Leucine-rich repeat-containing N-terminal (2);	1.045480	0.07554	N	0.915940	T	0.65811	0.2727	N	0.00778	-1.195	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.65549	-0.6141	10	0.08381	T	0.77	-3.1433	6.0124	0.19584	0.1321:0.3761:0.4918:0.0	.	87	Q13641	TPBG_HUMAN	A	87	ENSP00000441219:T87A;ENSP00000358765:T87A;ENSP00000440049:T87A	ENSP00000358765:T87A	T	+	1	0	TPBG	83131656	0.000000	0.05858	0.421000	0.26609	0.996000	0.88848	0.161000	0.16481	0.796000	0.33947	0.379000	0.24179	ACG	A|0.990;G|0.010		0.726	TPBG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041340.1		
DOPEY1	23033	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	83830485	83830485	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr6:83830485C>G	ENST00000349129.2	+	10	1334	c.1074C>G	c.(1072-1074)atC>atG	p.I358M	DOPEY1_ENST00000369739.3_Missense_Mutation_p.I349M|DOPEY1_ENST00000536812.1_3'UTR|DOPEY1_ENST00000237163.5_Missense_Mutation_p.I349M	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	358					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		GCATTTTAATCAGTTTACTGG	0.363																																					p.I358M		.											.	DOPEY1-155	0			c.C1074G						.						127.0	119.0	122.0					6																	83830485		2203	4300	6503	SO:0001583	missense	23033	exon10			TTTAATCAGTTTA	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.1074C>G	6.37:g.83830485C>G	ENSP00000195654:p.Ile358Met	72	0		152	32	NM_015018	0	0	0	0	0	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	37	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694848	0.68386	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000369739	T;T;T	0.26810	1.73;1.71;1.71	5.74	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	L	0.55213	1.73	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;D	0.75020	0.985;0.915;0.938	T	0.07271	-1.0781	10	0.44086	T	0.13	-0.1264	9.4189	0.38539	0.143:0.7853:0.0:0.0717	.	255;349;358	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	M	358;349;349	ENSP00000195654:I358M;ENSP00000237163:I349M;ENSP00000358754:I349M	ENSP00000237163:I349M	I	+	3	3	DOPEY1	83887204	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.915000	0.48805	1.429000	0.47314	0.557000	0.71058	ATC	.		0.363	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
ZC3H12D	340152	hgsc.bcm.edu	37	6	149772190	149772190	+	Missense_Mutation	SNP	G	G	A	rs112722576	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr6:149772190G>A	ENST00000409806.3	-	6	1531	c.1213C>T	c.(1213-1215)Cct>Tct	p.P405S	ZC3H12D_ENST00000416573.2_Missense_Mutation_p.A307V|ZC3H12D_ENST00000389942.5_Missense_Mutation_p.P405S|ZC3H12D_ENST00000542614.1_Missense_Mutation_p.A307V|ZC3H12D_ENST00000498662.1_5'Flank			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	405	Pro-rich. {ECO:0000255}.			P -> S (in Ref. 4; AAI57833). {ECO:0000305}.	negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)	p.P405S(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		CCGGGCGGAGGCGGGAGGTCG	0.776													G|||	1682	0.335863	0.1619	0.389	5008	,	,		8771	0.7649		0.1412	False		,,,				2504	0.2914				p.P405S		.											.	.	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1213T						.	G	SER/PRO	516,2856		37,442,1207	3.0	5.0	4.0		1213	-1.9	0.0	6	dbSNP_132	4	945,6567		66,813,2877	no	missense	ZC3H12D	NM_207360.2	74	103,1255,4084	AA,AG,GG		12.5799,15.3025,13.4234	benign	405/528	149772190	1461,9423	1686	3756	5442	SO:0001583	missense	340152	exon6			GCGGAGGCGGGAG			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.1213C>T	6.37:g.149772190G>A	ENSP00000386616:p.Pro405Ser	1	0		37	20	NM_207360	0	0	0	0	0	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Missense_Mutation	SNP	ENST00000409806.3	37		724|724	0.3315018315018315|0.3315018315018315	94|94	0.1910569105691057|0.1910569105691057	123|123	0.3397790055248619|0.3397790055248619	399|399	0.6975524475524476|0.6975524475524476	108|108	0.1424802110817942|0.1424802110817942	G|G	14.21|14.21	2.466986|2.466986	0.43839|0.43839	0.153025|0.153025	0.125799|0.125799	ENSG00000178199|ENSG00000178199	ENST00000416573;ENST00000542614|ENST00000389942;ENST00000409806	T;T|T;T	0.31247|0.25749	1.53;1.5|1.78;1.78	2.45|2.45	-1.9|-1.9	0.07665|0.07665	.|.	.|.	.|.	.|.	.|.	T|T	0.02193|0.02193	0.0068|0.0068	N|N	0.11427|0.11427	0.14|0.14	0.80722|0.80722	P|P	0.0|0.0	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.04013	0.0|0.001	T|T	0.42085|0.42085	-0.9472|-0.9472	8|8	0.27785|0.06365	T|T	0.31|0.9	1.0E-4|1.0E-4	3.5413|3.5413	0.07812|0.07812	0.5478:0.2181:0.2341:0.0|0.5478:0.2181:0.2341:0.0	.|.	307|405	B7WNU7|A2A288	.|ZC12D_HUMAN	V|S	307|405	ENSP00000408686:A307V;ENSP00000440813:A307V|ENSP00000374592:P405S;ENSP00000386616:P405S	ENSP00000408686:A307V|ENSP00000374592:P405S	A|P	-|-	2|1	0|0	ZC3H12D|ZC3H12D	149813883|149813883	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.563000|0.563000	0.35712|0.35712	0.541000|0.541000	0.23207|0.23207	-0.300000|-0.300000	0.08895|0.08895	0.313000|0.313000	0.20887|0.20887	GCC|CCT	G|0.668;A|0.332		0.776	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000286400.2	NM_207360	
TNRC18	84629	hgsc.bcm.edu	37	7	5372406	5372406	+	Silent	SNP	G	G	T	rs13238738	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr7:5372406G>T	ENST00000430969.1	-	19	6342	c.5994C>A	c.(5992-5994)cgC>cgA	p.R1998R	TNRC18_ENST00000399537.4_Silent_p.R1998R	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1998							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGCGCTCGCTGCGGCGCCGCG	0.756													G|||	2646	0.528355	0.3601	0.4352	5008	,	,		9503	0.7063		0.673	False		,,,				2504	0.4898				p.R1998R		.											.	TNRC18-46	0			c.C5994A						.	G		1260,1040		370,520,260	2.0	3.0	3.0		5994	2.1	1.0	7	dbSNP_121	3	3787,1581		1438,911,335	no	coding-synonymous	TNRC18	NM_001080495.2		1808,1431,595	TT,TG,GG		29.4523,45.2174,34.181		1998/2969	5372406	5047,2621	1150	2684	3834	SO:0001819	synonymous_variant	84629	exon19			CTCGCTGCGGCGC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5994C>A	7.37:g.5372406G>T		0	0		25	25	NM_001080495	0	0	0	0	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	1284	0.5879120879120879	197	0.40040650406504064	170	0.4696132596685083	415	0.7255244755244755	502	0.662269129287599	.	11.77	1.738038	0.30774	0.547826	0.705477	ENSG00000182095	ENST00000455076	.	.	.	4.14	2.1	0.27182	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999956	.	.	.	.	.	.	T	0.35425	-0.9789	3	.	.	.	.	12.3787	0.55295	0.0:0.4664:0.5335:0.0	rs13238738	.	.	.	E	35	.	.	A	-	2	0	TNRC18	5338932	0.998000	0.40836	0.997000	0.53966	0.996000	0.88848	0.427000	0.21379	0.648000	0.30732	0.555000	0.69702	GCA	G|0.411;T|0.589		0.756	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ABHD11	83451	bcgsc.ca	37	7	73151644	73151644	+	Silent	SNP	A	A	G	rs112580831|rs6460052|rs386714666	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr7:73151644A>G	ENST00000222800.3	-	4	609	c.540T>C	c.(538-540)taT>taC	p.Y180Y	ABHD11_ENST00000468998.1_5'Flank|ABHD11_ENST00000437775.2_Silent_p.Y173Y|ABHD11_ENST00000458339.1_Intron|ABHD11_ENST00000395147.4_Intron|LINC00035_ENST00000427153.1_RNA	NM_148912.2	NP_683710.1	Q8NFV4	ABHDB_HUMAN	abhydrolase domain containing 11	180						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Lung NSC(55;0.0908)|all_lung(88;0.198)				TGGCTGCCACATAGGTTGCAA	0.562													G|||	3028	0.604633	0.8298	0.5389	5008	,	,		21322	0.5218		0.4891	False		,,,				2504	0.5511				p.Y180Y		.											.	ABHD11-90	0			c.T540C						.	G	,,	3384,1022	367.6+/-318.3	1317,750,136	91.0	74.0	80.0		,540,519	2.6	0.0	7	dbSNP_116	80	4230,4370	582.9+/-391.5	1054,2122,1124	no	intron,coding-synonymous,coding-synonymous	ABHD11	NM_001145364.1,NM_148912.2,NM_148913.2	,,	2371,2872,1260	GG,GA,AA		49.186,23.1956,41.4578	,,	,180/316,173/309	73151644	7614,5392	2203	4300	6503	SO:0001819	synonymous_variant	83451	exon4			TGCCACATAGGTT	AF217971	CCDS5558.1, CCDS47607.1, CCDS47608.1, CCDS75615.1	7q11.23	2010-08-05	2005-01-24	2005-01-27	ENSG00000106077	ENSG00000106077		"""Abhydrolase domain containing"""	16407	protein-coding gene	gene with protein product			"""Williams Beuren syndrome chromosome region 21"""	WBSCR21		12073013	Standard	NR_026910		Approved	PP1226	uc003tzb.3	Q8NFV4	OTTHUMG00000130029	ENST00000222800.3:c.540T>C	7.37:g.73151644A>G		43	1		57	5	NM_148912	0	0	2	2	0	H7BYM8|Q6PJU0|Q8N722|Q8N723|Q8NFV2|Q8NFV3|Q9HBS8	Silent	SNP	ENST00000222800.3	37	CCDS5558.1																																																																																			A|0.410;G|0.590		0.562	ABHD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252306.1		
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	1	0		75	20	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
KLRG2	346689	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	139164980	139164980	+	Silent	SNP	G	G	A			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr7:139164980G>A	ENST00000340940.4	-	2	840	c.771C>T	c.(769-771)taC>taT	p.Y257Y	KLRG2_ENST00000393039.2_Intron	NM_198508.2	NP_940910.1	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G, member 2	257						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|large_intestine(2)|lung(3)	6	Melanoma(164;0.233)					GGGACTTCACGTACATGGGTA	0.567																																					p.Y257Y		.											.	KLRG2-90	0			c.C771T						.						77.0	66.0	70.0					7																	139164980		2202	4300	6502	SO:0001819	synonymous_variant	346689	exon2			CTTCACGTACATG	AK126174	CCDS5854.1	7q34	2011-08-30			ENSG00000188883	ENSG00000188883		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	24778	protein-coding gene	gene with protein product	"""C-type lectin domain family 15, member B"""						Standard	XM_005250311		Approved	FLJ44186, CLEC15B	uc003vvb.3	A4D1S0	OTTHUMG00000157705	ENST00000340940.4:c.771C>T	7.37:g.139164980G>A		72	0		107	34	NM_198508	0	0	0	0	0	Q2NL79|Q6ZTV6	Silent	SNP	ENST00000340940.4	37	CCDS5854.1																																																																																			.		0.567	KLRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349433.1	NM_198508	
CLCN1	1180	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	143042815	143042815	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr7:143042815T>C	ENST00000343257.2	+	17	2219	c.2132T>C	c.(2131-2133)gTg>gCg	p.V711A		NM_000083.2	NP_000074	P35523	CLCN1_HUMAN	chloride channel, voltage-sensitive 1	711					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|neuronal action potential propagation (GO:0019227)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	adenyl nucleotide binding (GO:0030554)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(4)|central_nervous_system(1)|endometrium(1)|large_intestine(11)|lung(26)|ovary(3)|prostate(2)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	58	Melanoma(164;0.205)					TTCGCCTTTGTGGATGAGGAT	0.667											OREG0018402	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V711A		.											.	CLCN1-156	0			c.T2132C						.						6.0	7.0	6.0					7																	143042815		2148	4235	6383	SO:0001583	missense	1180	exon17			CCTTTGTGGATGA	Z25884	CCDS5881.1	7q12	2012-09-26	2012-02-23		ENSG00000188037	ENSG00000188037		"""Ion channels / Chloride channels : Voltage-sensitive"""	2019	protein-coding gene	gene with protein product	"""Thomsen disease, autosomal dominant"""	118425	"""chloride channel 1, skeletal muscle"""			1379744	Standard	NM_000083		Approved	CLC1, ClC-1	uc003wcr.1	P35523	OTTHUMG00000152695	ENST00000343257.2:c.2132T>C	7.37:g.143042815T>C	ENSP00000339867:p.Val711Ala	108	1	1676	195	69	NM_000083	0	0	0	0	0	A4D2H5|Q2M202	Missense_Mutation	SNP	ENST00000343257.2	37	CCDS5881.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.421934	0.83559	.	.	ENSG00000188037	ENST00000343257	D	0.85702	-2.02	4.74	4.74	0.60224	.	0.065483	0.64402	D	0.000012	D	0.89143	0.6631	M	0.70275	2.135	0.47308	D	0.99938	D	0.69078	0.997	D	0.65773	0.938	D	0.86563	0.1842	10	0.09084	T	0.74	.	13.1316	0.59385	0.0:0.0:0.0:1.0	.	711	P35523	CLCN1_HUMAN	A	711	ENSP00000339867:V711A	ENSP00000339867:V711A	V	+	2	0	CLCN1	142752937	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.012000	0.76366	1.893000	0.54813	0.533000	0.62120	GTG	.		0.667	CLCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327420.1	NM_000083	
ZNF282	8427	hgsc.bcm.edu	37	7	148921732	148921732	+	Missense_Mutation	SNP	G	G	A	rs11547158	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr7:148921732G>A	ENST00000262085.3	+	8	2114	c.2009G>A	c.(2008-2010)cGa>cAa	p.R670Q	ZNF282_ENST00000479907.1_3'UTR	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	670					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CCTCCTGAGCGAGACTAGGGC	0.726													G|||	287	0.0573083	0.0129	0.0562	5008	,	,		11344	0.003		0.1203	False		,,,				2504	0.1094				p.R670Q		.											.	ZNF282-90	0			c.G2009A						.	G	GLN/ARG	55,2981		2,51,1465	3.0	3.0	3.0		2009	3.1	0.5	7	dbSNP_120	3	602,5910		10,582,2664	no	missense	ZNF282	NM_003575.2	43	12,633,4129	AA,AG,GG		9.2445,1.8116,6.881	benign	670/672	148921732	657,8891	1518	3256	4774	SO:0001583	missense	8427	exon8			CTGAGCGAGACTA	D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.2009G>A	7.37:g.148921732G>A	ENSP00000262085:p.Arg670Gln	0	0		7	5	NM_003575	0	0	2	5	3	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	ENST00000262085.3	37	CCDS5895.1	124	0.056776556776556776	9	0.018292682926829267	19	0.052486187845303865	5	0.008741258741258742	91	0.12005277044854881	G	11.40	1.628789	0.28978	0.018116	0.092445	ENSG00000170265	ENST00000430197;ENST00000262085	T	0.07114	3.22	4.03	3.11	0.35812	.	0.793468	0.10599	N	0.655855	T	0.00073	0.0002	N	0.12182	0.205	0.58432	P	2.9999999999752447E-6	B	0.13145	0.007	B	0.06405	0.002	T	0.32955	-0.9887	9	0.87932	D	0	0.2436	4.5177	0.11943	0.1229:0.0:0.6627:0.2144	rs11547158	670	Q9UDV7	ZN282_HUMAN	Q	323;670	ENSP00000262085:R670Q	ENSP00000262085:R670Q	R	+	2	0	ZNF282	148552665	0.455000	0.25736	0.496000	0.27539	0.423000	0.31445	0.455000	0.21843	0.989000	0.38761	0.462000	0.41574	CGA	G|0.943;A|0.057		0.726	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352746.1	NM_003575	
PDE7A	5150	ucsc.edu;bcgsc.ca	37	8	66692007	66692007	+	Silent	SNP	A	A	G	rs200299656		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr8:66692007A>G	ENST00000401827.3	-	3	674	c.231T>C	c.(229-231)ttT>ttC	p.F77F	PDE7A_ENST00000396642.3_Silent_p.F77F|PDE7A_ENST00000379419.4_Silent_p.F51F	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	77					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	TTTCTGATTCAAATCCTGCTC	0.378																																					p.F77F		.											.	PDE7A-90	0			c.T231C						.						121.0	125.0	123.0					8																	66692007		2203	4300	6503	SO:0001819	synonymous_variant	5150	exon3			TGATTCAAATCCT	L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.231T>C	8.37:g.66692007A>G		55	0		40	4	NM_001242318	0	0	1	1	0	A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Silent	SNP	ENST00000401827.3	37	CCDS56538.1																																																																																			A|1.000;G|0.000		0.378	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378905.1		
MATN2	4147	bcgsc.ca	37	8	98943545	98943545	+	Silent	SNP	A	A	G	rs2290471	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr8:98943545A>G	ENST00000520016.1	+	2	631	c.507A>G	c.(505-507)acA>acG	p.T169T	MATN2_ENST00000524308.1_Silent_p.T169T|MATN2_ENST00000521689.1_Silent_p.T169T|MATN2_ENST00000254898.5_Silent_p.T169T|MATN2_ENST00000522025.2_Intron			O00339	MATN2_HUMAN	matrilin 2	169	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TGATCGTGACAGATGGGAGAC	0.592													G|||	1390	0.277556	0.5023	0.2565	5008	,	,		21133	0.0804		0.2883	False		,,,				2504	0.181				p.T169T		.											.	MATN2-24	0			c.A507G						.	G	,	1825,2387		422,981,703	38.0	44.0	42.0		507,507	-11.6	0.0	8	dbSNP_100	42	2405,6067		366,1673,2197	no	coding-synonymous,coding-synonymous	MATN2	NM_002380.3,NM_030583.2	,	788,2654,2900	GG,GA,AA		28.3876,43.3286,33.3491	,	169/957,169/938	98943545	4230,8454	2106	4236	6342	SO:0001819	synonymous_variant	4147	exon3			CGTGACAGATGGG	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.507A>G	8.37:g.98943545A>G		129	0		122	5	NM_002380	0	0	1	1	0	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Silent	SNP	ENST00000520016.1	37	CCDS55264.1																																																																																			A|0.787;G|0.213		0.592	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
VPS13B	157680	broad.mit.edu	37	8	100133706	100133706	+	Intron	SNP	T	T	G	rs7460625	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr8:100133706T>G	ENST00000358544.2	+	8	1317				VPS13B_ENST00000355155.1_Intron|VPS13B_ENST00000395996.1_Intron|CTD-2340D6.1_ENST00000523226.1_RNA|VPS13B_ENST00000357162.2_Intron|VPS13B_ENST00000441350.2_Nonsense_Mutation_p.Y413*	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)						protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TATATCTCTATCAACTTTAAT	0.333													G|||	3531	0.705072	0.7088	0.5807	5008	,	,		19997	0.5337		0.7903	False		,,,				2504	0.8773				p.Y413X	Colon(161;2205 2542 7338 31318)	.											.	VPS13B-301	0			c.T1239G						.	G	,,,stop/TYR	3001,1405	454.5+/-350.7	1032,937,234	113.0	117.0	115.0		,,,1239	3.3	0.0	8	dbSNP_116	115	6827,1773	320.0+/-314.4	2702,1423,175	yes	intron,intron,intron,stop-gained	VPS13B	NM_015243.2,NM_017890.3,NM_152564.3,NM_181661.2	,,,	3734,2360,409	GG,GT,TT		20.6163,31.8883,24.4349	,,,	,,,413/416	100133706	9828,3178	2203	4300	6503	SO:0001627	intron_variant	157680	exon8			TCTCTATCAACTT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1206+33T>G	8.37:g.100133706T>G		62	0		77	3	NM_181661	0	0	0	0	0	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Nonsense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	1450	0.6639194139194139	328	0.6666666666666666	232	0.6408839779005525	306	0.534965034965035	584	0.7704485488126649	G	14.97	2.693883	0.48202	0.681117	0.793837	ENSG00000132549	ENST00000441350	.	.	.	5.66	3.32	0.38043	.	.	.	.	.	.	.	.	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.265	0.10759	0.1639:0.0686:0.1109:0.6566	rs7460625;rs60785353;rs7460625	.	.	.	X	413	.	.	Y	+	3	2	VPS13B	100202882	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.041000	0.13927	0.119000	0.18210	-1.113000	0.02065	TAT	T|0.294;G|0.706		0.333	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		25	24	NM_030895	0	0	0	1	1	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	RP11-429J17.8_ENST00000534089.1_RNA|RP11-429J17.8_ENST00000527139.1_RNA|SCRIB_ENST00000546337.1_5'Flank|RP11-429J17.8_ENST00000532625.1_RNA|SCRIB_ENST00000356994.2_Silent_p.P1450P|SCRIB_ENST00000377533.3_Silent_p.P1369P	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		0	0		6	6	NM_015356	0	0	0	35	35	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
PLEC	5339	hgsc.bcm.edu	37	8	144998169	144998169	+	Silent	SNP	C	C	T	rs1140522	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr8:144998169C>T	ENST00000322810.4	-	31	6508	c.6339G>A	c.(6337-6339)gcG>gcA	p.A2113A	PLEC_ENST00000356346.3_Silent_p.A1962A|PLEC_ENST00000354589.3_Silent_p.A1976A|PLEC_ENST00000354958.2_Silent_p.A1954A|PLEC_ENST00000527096.1_Silent_p.A1999A|PLEC_ENST00000398774.2_Silent_p.A1944A|PLEC_ENST00000345136.3_Silent_p.A1976A|PLEC_ENST00000436759.2_Silent_p.A2003A|PLEC_ENST00000357649.2_Silent_p.A1980A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2113	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCTCCTCCGCCGCCAGCTGCC	0.741													C|||	1156	0.230831	0.028	0.2968	5008	,	,		12421	0.1429		0.4274	False		,,,				2504	0.3466				p.A2113A		.											.	PLEC-141	0			c.G6339A						.	C	,,,,,,,	297,3657		19,259,1699	5.0	7.0	6.0		6009,5886,5862,6339,5832,5928,5940,5928	-8.9	0.0	8	dbSNP_86	6	2901,4993		551,1799,1597	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	570,2058,3296	TT,TC,CC		36.7494,7.5114,26.9919	,,,,,,,	2003/4575,1962/4534,1954/4526,2113/4685,1944/4516,1976/4548,1980/4552,1976/4548	144998169	3198,8650	1977	3947	5924	SO:0001819	synonymous_variant	5339	exon31			CTCCGCCGCCAGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6339G>A	8.37:g.144998169C>T		0	0		25	9	NM_201380	0	0	2	3	1	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			C|0.740;T|0.260		0.741	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000527096.1_Silent_p.A1992A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000357649.2_Silent_p.A1973A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		0	0		49	22	NM_201380	0	0	1	1	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000527096.1_Silent_p.L1207L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000357649.2_Silent_p.L1188L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		3	0		52	25	NM_201380	0	0	1	3	2	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		4	0		30	4	NM_024896	0	0	0	0	0	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
FAM205A	259308	bcgsc.ca	37	9	34725047	34725047	+	Silent	SNP	C	C	T	rs78716275		TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr9:34725047C>T	ENST00000378788.3	-	4	2229	c.2190G>A	c.(2188-2190)ccG>ccA	p.P730P		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	730						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						GATGCAGGTCCGGGTCACTTG	0.552																																					p.P730P		.											.	.	0			c.G2190A						.						95.0	56.0	68.0					9																	34725047		692	1591	2283	SO:0001819	synonymous_variant	259308	exon4			CAGGTCCGGGTCA		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.2190G>A	9.37:g.34725047C>T		268	3		136	7	NM_001141917	0	0	0	0	0	A8MVW7	Silent	SNP	ENST00000378788.3	37	CCDS55305.1																																																																																			T|1.000;|0.000		0.552	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	
RP13-60M5.2	0	bcgsc.ca	37	9	91262494	91262494	+	lincRNA	SNP	G	G	T	rs386736063|rs72751474	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr9:91262494G>T	ENST00000418343.2	-	0	257																											CACATTTCCAGGTCTCAGCAG	0.393													G|||	407	0.08127	0.0356	0.121	5008	,	,		22228	0.003		0.1451	False		,,,				2504	0.1299				p.P50H		.											.	.	0			c.C149A						.	G	HIS/PRO	189,3681		1,187,1747	163.0	154.0	157.0		149	0.8	0.0	9	dbSNP_130	157	1142,7124		83,976,3074	yes	missense	LOC286238	NM_001100111.1	77	84,1163,4821	TT,TG,GG		13.8156,4.8837,10.9674		50/113	91262494	1331,10805	1935	4133	6068			0	exon2			TTTCCAGGTCTCA																													9.37:g.91262494G>T		152	1		157	6	NM_001100111	0	0	0	0	0		Missense_Mutation	SNP	ENST00000418343.2	37																																																																																				G|0.919;T|0.081		0.393	RP13-60M5.2-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000052976.2		
REXO4	57109	broad.mit.edu;bcgsc.ca	37	9	136272149	136272151	+	In_Frame_Del	DEL	CTT	CTT	-	rs587743176	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr9:136272149_136272151delCTT	ENST00000371942.3	-	8	1394_1396	c.1195_1197delAAG	c.(1195-1197)aagdel	p.K399del	REXO4_ENST00000371935.2_In_Frame_Del_p.K227del	NM_020385.2	NP_065118.2	Q9GZR2	REXO4_HUMAN	REX4, RNA exonuclease 4 homolog (S. cerevisiae)	399					regulation of transcription, DNA-templated (GO:0006355)	nucleolus (GO:0005730)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.K399delK(1)		kidney(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	15				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		TCTCCCACTCCTTCTTCACCATG	0.621											OREG0019587	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		7	0.00139776	0.0008	0.0014	5008	,	,		20731	0.0		0.005	False		,,,				2504	0.0				p.399_399del		.											.	REXO4-90	1	Deletion - In frame(1)	stomach(1)	c.1195_1197del						.			5,4259		0,5,2127						3.5	1.0			141	38,8216		0,38,4089	no	coding	REXO4	NM_020385.2		0,43,6216	A1A1,A1R,RR		0.4604,0.1173,0.3435				43,12475				SO:0001651	inframe_deletion	57109	exon8			CCACTCCTTCTTC	AF273304	CCDS6969.1, CCDS65179.1	9q34	2008-02-05	2005-08-22	2005-08-22	ENSG00000148300	ENSG00000148300			12820	protein-coding gene	gene with protein product		602930	"""Xenopus prevents mitotic catatrophe 2 homolog"", ""XPMC2 prevents mitotic catastrophe 2 homolog (Xenopus laevis)"""	XPMC2H		9325058	Standard	NM_020385		Approved		uc004cdm.3	Q9GZR2	OTTHUMG00000020870	ENST00000371942.3:c.1195_1197delAAG	9.37:g.136272152_136272154delCTT	ENSP00000361010:p.Lys399del	63	0	1624	85	41	NM_020385	0	0	0	0	0	B2RAT2|Q5T8S4|Q5T8S5|Q5T8S6|Q9GZW3	In_Frame_Del	DEL	ENST00000371942.3	37	CCDS6969.1																																																																																			.		0.621	REXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054899.1		
C9orf172	389813	hgsc.bcm.edu	37	9	139741088	139741089	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	GT	GT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr9:139741088_139741089delGT	ENST00000436881.1	+	1	2222_2223	c.2222_2223delGT	c.(2221-2223)cgtfs	p.R741fs	PHPT1_ENST00000371661.1_5'Flank|PHPT1_ENST00000247665.10_5'Flank|PHPT1_ENST00000545326.1_5'Flank	NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	741										endometrium(2)|large_intestine(1)|lung(6)	9						CGCATCGCGCGTGTCGGCTTCC	0.713																																					p.741_741del		.											.	.	0			c.2222_2223del						.																																			SO:0001589	frameshift_variant	389813	exon1			TCGCGCGTGTCGG		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.2222_2223delGT	9.37:g.139741090_139741091delGT	ENSP00000412388:p.Arg741fs	29	1		56	17	NM_001080482	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000436881.1	37	CCDS48059.1																																																																																			.		0.713	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
CACNA1B	774	hgsc.bcm.edu	37	9	140917779	140917779	+	Missense_Mutation	SNP	G	G	T	rs7873074	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr9:140917779G>T	ENST00000371372.1	+	19	2729	c.2584G>T	c.(2584-2586)Gcg>Tcg	p.A862S	CACNA1B_ENST00000277551.2_Missense_Mutation_p.A862S|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A863S|CACNA1B_ENST00000371363.1_Missense_Mutation_p.A862S|CACNA1B_ENST00000545473.1_5'Flank|CACNA1B_ENST00000277549.5_Missense_Mutation_p.A54S|CACNA1B_ENST00000371367.5_5'Flank|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A863S	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	862			A -> S (in dbSNP:rs7873074).		calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CAAGACCCCCGCGGCGGGGGA	0.771													G|||	2138	0.426917	0.7292	0.1383	5008	,	,		8593	0.6339		0.1541	False		,,,				2504	0.2904				p.A862S		.											.	CACNA1B-138	0			c.G2584T						.						1.0	1.0	1.0					9																	140917779		1024	2272	3296	SO:0001583	missense	774	exon19			ACCCCCGCGGCGG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.2584G>T	9.37:g.140917779G>T	ENSP00000360423:p.Ala862Ser	0	0		12	7	NM_001243812	0	0	0	0	0	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	37	CCDS59522.1	871	0.39880952380952384	351	0.7134146341463414	42	0.11602209944751381	361	0.6311188811188811	117	0.15435356200527706	G	2.404	-0.336886	0.05278	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.96685	-3.87;-3.88;-4.09;-3.88;-3.86;-3.86	2.64	2.64	0.31445	.	607.713000	0.00166	N	0.000000	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	P;P;P	0.41748	0.731;0.761;0.612	B;B;B	0.32149	0.071;0.141;0.081	T	0.48559	-0.9025	9	0.07813	T	0.8	.	8.5047	0.33179	0.0:0.0:1.0:0.0	rs7873074;rs57704776	862;863;862	B1AQK4;B1AQK7;B1AQK6	.;.;.	S	862;862;54;862;863;863	ENSP00000360423:A862S;ENSP00000277551:A862S;ENSP00000277549:A54S;ENSP00000360414:A862S;ENSP00000360408:A863S;ENSP00000360406:A863S	ENSP00000277549:A54S	A	+	1	0	CACNA1B	140037600	0.000000	0.05858	0.012000	0.15200	0.095000	0.18619	-0.158000	0.10070	1.290000	0.44636	0.455000	0.32223	GCG	G|0.601;T|0.399		0.771	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
HDHD1	8226	bcgsc.ca	37	X	6995315	6995315	+	Silent	SNP	C	C	T	rs2379206	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chrX:6995315C>T	ENST00000381077.5	-	3	532	c.456G>A	c.(454-456)ccG>ccA	p.P152P	HDHD1_ENST00000412827.2_Silent_p.P109P|HDHD1_ENST00000424830.2_Silent_p.P175P|HDHD1_ENST00000540122.1_Silent_p.P152P	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1	152					nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						GGAAGATGTCCGGGTCTGGCT	0.557													C|||	2503	0.663046	0.559	0.5187	3775	,	,		15252	0.4524		0.4185	False		,,,				2504	0.5389				p.P175P		.											.	HDHD1-130	0			c.G525A						.	C	,,,	2638,926		837,565,399,95,171	35.0	36.0	36.0		525,456,327,456	-7.8	0.0	X	dbSNP_100	36	3887,2671		870,1118,1029,387,779	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	HDHD1	NM_001135565.1,NM_001178135.1,NM_001178136.1,NM_012080.4	,,,	1707,1683,1428,482,950	TT,TC,T,CC,C		40.7289,25.982,35.5365	,,,	175/252,152/209,109/186,152/229	6995315	6525,3597	2067	4183	6250	SO:0001819	synonymous_variant	8226	exon4			GATGTCCGGGTCT	M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.456G>A	X.37:g.6995315C>T		139	1		141	7	NM_001135565	0	0	8	8	0	B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Silent	SNP	ENST00000381077.5	37	CCDS48075.1																																																																																			C|0.346;T|0.654		0.557	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055683.2	NM_012080	
SHROOM4	57477	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	50345785	50345785	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chrX:50345785A>T	ENST00000289292.7	-	7	4073	c.3790T>A	c.(3790-3792)Tca>Aca	p.S1264T	SHROOM4_ENST00000460112.3_Missense_Mutation_p.S1148T|SHROOM4_ENST00000376020.2_Missense_Mutation_p.S1264T			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1264	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GGGGCCCCTGAAGGAGGCGAA	0.463																																					p.S1264T		.											.	SHROOM4-131	0			c.T3790A						.						65.0	59.0	61.0					X																	50345785		2203	4300	6503	SO:0001583	missense	57477	exon7			CCCCTGAAGGAGG	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3790T>A	X.37:g.50345785A>T	ENSP00000289292:p.Ser1264Thr	78	0		82	14	NM_020717	0	0	0	0	0	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	37	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	G	5.967	0.362384	0.11296	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.13778	2.97;2.97;2.56	5.58	3.73	0.42828	Apx/shroom, ASD2 (2);	1.126700	0.06565	N	0.747483	T	0.09202	0.0227	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43147	-0.9409	10	0.18710	T	0.47	.	5.7074	0.17915	0.1588:0.0:0.5666:0.2746	.	1264	Q9ULL8	SHRM4_HUMAN	T	1264;1264;1148	ENSP00000289292:S1264T;ENSP00000365188:S1264T;ENSP00000421450:S1148T	ENSP00000289292:S1264T	S	-	1	0	SHROOM4	50362525	0.178000	0.23122	0.128000	0.21923	0.639000	0.38242	0.986000	0.29590	0.505000	0.28104	-0.272000	0.10252	TCA	.		0.463	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
ARHGAP36	158763	hgsc.bcm.edu	37	X	130192420	130192420	+	Splice_Site	SNP	T	T	A			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chrX:130192420T>A	ENST00000276211.5	+	1	203		c.e1+2		ARHGAP36_ENST00000370922.1_Splice_Site|RP1-23K20.2_ENST00000412420.1_RNA	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CCCGCCGTGGTGAGTGGGGCC	0.741																																					.		.											.	ARHGAP36-133	0			.						.																																			SO:0001630	splice_region_variant	158763	.			CCGTGGTGAGTGG		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.-143+2T>A	X.37:g.130192420T>A		33	0		77	4	.	0	0	0	0	0	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Splice_Site	SNP	ENST00000276211.5	37	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	T	15.95	2.985358	0.53934	.	.	ENSG00000147256	ENST00000370922	.	.	.	3.76	3.76	0.43208	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.0436	0.30536	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP36	130020101	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.296000	0.51802	1.716000	0.51395	0.486000	0.48141	.	.		0.741	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	Intron
CELSR2	1952	hgsc.bcm.edu	37	1	109792735	109792736	+	In_Frame_Ins	INS	-	-	CGC	rs377757908|rs59201433|rs144034706	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr1:109792735_109792736insCGC	ENST00000271332.3	+	1	95_96	c.34_35insCGC	c.(34-36)acg>aCGCcg	p.16_17insP		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	16					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCCCCTCCCAACgccgccgccg	0.752														2846	0.568291	0.4198	0.6311	5008	,	,		10222	0.5298		0.7276	False		,,,				2504	0.6002				p.T12delinsTP	NSCLC(158;1285 2011 34800 34852 42084)	.											.	CELSR2-526	0			c.34_35insCGC						.			1363,1439		473,417,511						3.0	0.1		dbSNP_130	6	4135,1897		1679,777,560	no	coding	CELSR2	NM_001408.2		2152,1194,1071	A1A1,A1R,RR		31.4489,48.6438,37.7632				5498,3336				SO:0001652	inframe_insertion	1952	exon1			CTCCCAACGCCGC	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.47_49dupCGC	1.37:g.109792742_109792744dupCGC	ENSP00000271332:p.Pro16_Pro16dup	2	2		17	17	NM_001408	0	0	0	0	0	Q5T2Y7|Q92566	In_Frame_Ins	INS	ENST00000271332.3	37	CCDS796.1																																																																																			-|0.389;CGC|0.611		0.752	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
PCGF6	84108	hgsc.bcm.edu	37	10	105110740	105110741	+	In_Frame_Ins	INS	-	-	GGAGGC	rs201702163|rs113359610|rs60968810	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:105110740_105110741insGGAGGC	ENST00000369847.3	-	1	150_151	c.83_84insGCCTCC	c.(82-84)cct>ccGCCTCCt	p.28_28P>PPP	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_In_Frame_Ins_p.28_28P>PPP	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	28	Pro-rich.				negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		gcggggagacaggaggcggagg	0.748														2236	0.446486	0.2269	0.4337	5008	,	,		11043	0.4325		0.5149	False		,,,				2504	0.6963				p.P28delinsPPP		.											.	PCGF6-226	0			c.84_85insGCCTCC						.		,	550,2140		138,274,933					,	1.3	0.0		dbSNP_132	6	1951,3319		581,789,1265	no	coding,coding	PCGF6	NM_032154.3,NM_001011663.1	,	719,1063,2198	A1A1,A1R,RR		37.0209,20.4461,31.4196	,	,		2501,5459				SO:0001652	inframe_insertion	84108	exon1			GGAGACAGGAGGC	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.78_83dupGCCTCC	10.37:g.105110741_105110746dupGGAGGC	ENSP00000358862:p.ProPro28dup	0	0		14	8	NM_032154	0	0	0	0	0	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	In_Frame_Ins	INS	ENST00000369847.3	37	CCDS31275.1																																																																																			-|0.590;GGAGGC|0.410		0.748	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050132.1	NM_032154	
BRCA2	675	bcgsc.ca	37	13	32910689	32910690	+	In_Frame_Ins	INS	-	-	TCTTCTTCT			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr13:32910689_32910690insTCTTCTTCT	ENST00000380152.3	+	11	2430_2431	c.2197_2198insTCTTCTTCT	c.(2197-2199)gtc>gTCTTCTTCTtc	p.733_734insFFF	BRCA2_ENST00000544455.1_In_Frame_Ins_p.733_734insFFF			P51587	BRCA2_HUMAN	breast cancer 2, early onset	733	Interaction with NPM1.				brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AAAAGAAGAGGTCTTGGCTGCA	0.381			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.V733delinsVFFF	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2-3153	0			c.2197_2198insTCTTCTTCT						.																																			SO:0001652	inframe_insertion	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	GAAGAGGTCTTGG	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	Exception_encountered	13.37:g.32910689_32910690insTCTTCTTCT	ENSP00000369497:p.Val733_Leu734insPhePhePhe	169	0		115	4	NM_000059	0	0	0	0	0	O00183|O15008|Q13879|Q5TBJ7	In_Frame_Ins	INS	ENST00000380152.3	37	CCDS9344.1																																																																																			.		0.381	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
ADAMTS9	56999	broad.mit.edu	37	3	64527577	64527578	+	Frame_Shift_Ins	INS	-	-	G			TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr3:64527577_64527578insG	ENST00000498707.1	-	33	5475_5476	c.5133_5134insC	c.(5131-5136)cccagcfs	p.S1712fs	ADAMTS9_ENST00000295903.4_Frame_Shift_Ins_p.S1684fs	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1712	TSP type-1 15. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CATAAGTGGCTGGGTTGGTCCT	0.45																																					p.S1712fs		.											.	ADAMTS9-230	0			c.5134_5135insC						.																																			SO:0001589	frameshift_variant	56999	exon33			AGTGGCTGGGTTG	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.5134dupC	3.37:g.64527580_64527580dupG	ENSP00000418735:p.Ser1712fs	281	0		269	9	NM_182920	0	0	0	0	0	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Frame_Shift_Ins	INS	ENST00000498707.1	37	CCDS2903.1																																																																																			.		0.450	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
MAP3K4	4216	hgsc.bcm.edu	37	6	161413044	161413045	+	In_Frame_Ins	INS	-	-	CCG	rs369151355|rs569609736	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr6:161413044_161413045insCCG	ENST00000392142.4	+	1	229_230	c.81_82insCCG	c.(82-84)ccg>CCGccg	p.28_28P>PP	MAP3K4_ENST00000366920.2_In_Frame_Ins_p.28_28P>PP|RP3-428L16.2_ENST00000608721.1_RNA|MAP3K4_ENST00000348824.7_In_Frame_Ins_p.28_28P>PP|MAP3K4_ENST00000366919.2_In_Frame_Ins_p.28_28P>PP	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	28	Poly-Pro.				activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		Agccgccgccaccgccgccgcc	0.738														185	0.0369409	0.0083	0.0303	5008	,	,		9103	0.0288		0.0487	False		,,,				2504	0.0767				p.P27delinsPP		.											.	MAP3K4-548	0			c.81_82insCCG						.																																			SO:0001652	inframe_insertion	4216	exon1			GCCGCCACCGCCG	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.91_93dupCCG	6.37:g.161413051_161413053dupCCG	ENSP00000375986:p.Pro36dup	0	0		38	18	NM_006724	0	0	0	0	0	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	In_Frame_Ins	INS	ENST00000392142.4	37	CCDS34565.1																																																																																			.		0.738	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
KNDC1	85442	hgsc.bcm.edu	37	10	135012429	135012430	+	Missense_Mutation	DNP	TT	TT	AC	rs386749477|rs3008390|rs3008389	byFrequency	TCGA-OR-A5LE-01A-11D-A29I-10	TCGA-OR-A5LE-10A-01D-A29L-10	TT	TT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	afd8534e-0954-4b91-87c9-66146aa7b4d9	30ce8765-3a46-4a9d-8f9a-4165b14d73f3	g.chr10:135012429_135012430TT>AC	ENST00000304613.3	+	14	2438_2439	c.2417_2418TT>AC	c.(2416-2418)gTT>gAC	p.V806D	KNDC1_ENST00000368572.2_Missense_Mutation_p.V806D|KNDC1_ENST00000368571.2_Missense_Mutation_p.V741D			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CCACCTGGAGTTGCTTCCGGGG	0.748																																					p.V806D		.											.	KNDC1-229	0			c.T2418C						.																																			SO:0001583	missense	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	Exception_encountered	10.37:g.135012429_135012430delinsAC	ENSP00000304437:p.Val806Asp	0	0		11	0	NM_152643	0	0	0	0	0	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	DNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.748	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
