#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NOL9	79707	broad.mit.edu;bcgsc.ca	37	1	6610521	6610521	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:6610521G>T	ENST00000377705.5	-	2	583	c.551C>A	c.(550-552)cCt>cAt	p.P184H		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	184					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		GCTTTTCTCAGGCTGTGAGTA	0.448																																					p.P184H		.											.	NOL9-515	0			c.C551A						.						141.0	140.0	140.0					1																	6610521		2203	4300	6503	SO:0001583	missense	79707	exon2			TTCTCAGGCTGTG	AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.551C>A	1.37:g.6610521G>T	ENSP00000366934:p.Pro184His	128	1		84	6	NM_024654	0	0	1	1	0	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	ENST00000377705.5	37	CCDS80.1	.	.	.	.	.	.	.	.	.	.	G	8.596	0.885766	0.17540	.	.	ENSG00000162408	ENST00000377705	T	0.47528	0.84	5.23	3.32	0.38043	.	0.271433	0.28016	N	0.016925	T	0.29423	0.0733	N	0.22421	0.69	0.34871	D	0.743553	B	0.18741	0.03	B	0.14578	0.011	T	0.26985	-1.0087	10	0.13470	T	0.59	-11.8073	10.1226	0.42630	0.0:0.1419:0.6947:0.1634	.	184	Q5SY16	NOL9_HUMAN	H	184	ENSP00000366934:P184H	ENSP00000366934:P184H	P	-	2	0	NOL9	6533108	0.713000	0.27926	0.949000	0.38748	0.048000	0.14542	3.024000	0.49674	0.731000	0.32448	0.555000	0.69702	CCT	.		0.448	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002625.1	NM_024654	
HNRNPCL1	343069	bcgsc.ca	37	1	12907358	12907358	+	Missense_Mutation	SNP	T	T	C	rs74587302|rs559905244	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:12907358T>C	ENST00000317869.6	-	2	1010	c.785A>G	c.(784-786)cAg>cGg	p.Q262R		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	262						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						GTCATCCCCCTGATCTTCATT	0.498																																					p.Q262R		.											.	HNRNPCL1-68	0			c.A785G						.						143.0	157.0	152.0					1																	12907358		2203	4300	6503	SO:0001583	missense	343069	exon2			TCCCCCTGATCTT	BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.785A>G	1.37:g.12907358T>C	ENSP00000365370:p.Gln262Arg	91	1		86	9	NM_001013631	0	0	0	0	0	B2RP44	Missense_Mutation	SNP	ENST00000317869.6	37	CCDS30591.1	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.089806	0.00367	.	.	ENSG00000179172	ENST00000317869	T	0.09445	2.98	0.343	-0.686	0.11324	.	2.239460	0.02976	N	0.145045	T	0.04724	0.0128	N	0.02830	-0.485	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33650	-0.9860	10	0.33940	T	0.23	.	3.9448	0.09344	0.0:0.3889:0.0:0.6111	.	262	O60812	HNRCL_HUMAN	R	262	ENSP00000365370:Q262R	ENSP00000365370:Q262R	Q	-	2	0	HNRNPCL1	12829945	0.213000	0.23551	0.005000	0.12908	0.003000	0.03518	0.096000	0.15147	-0.605000	0.05753	-0.620000	0.04034	CAG	.		0.498	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005462.1	NM_001013631	
ARHGEF19	128272	bcgsc.ca	37	1	16534646	16534646	+	Missense_Mutation	SNP	C	C	G	rs221058	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:16534646C>G	ENST00000270747.3	-	3	623	c.487G>C	c.(487-489)Ggc>Cgc	p.G163R	ARHGEF19_ENST00000478117.1_5'Flank	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19	163			G -> R (in dbSNP:rs221058). {ECO:0000269|PubMed:14702039}.		regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		ACTACCTGGCCAGGCTCTAGG	0.657													C|||	1222	0.24401	0.0862	0.3948	5008	,	,		16480	0.1528		0.2654	False		,,,				2504	0.4223				p.G163R		.											.	ARHGEF19-229	0			c.G487C						.	C	ARG/GLY	453,3953	209.2+/-230.0	35,383,1785	56.0	61.0	59.0		487	2.1	1.0	1	dbSNP_79	59	2233,6367	370.2+/-335.8	295,1643,2362	yes	missense	ARHGEF19	NM_153213.3	125	330,2026,4147	GG,GC,CC		25.9651,10.2814,20.652	benign	163/803	16534646	2686,10320	2203	4300	6503	SO:0001583	missense	128272	exon3			CCTGGCCAGGCTC	BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.487G>C	1.37:g.16534646C>G	ENSP00000270747:p.Gly163Arg	164	0		148	5	NM_153213	0	0	0	0	0	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Missense_Mutation	SNP	ENST00000270747.3	37	CCDS170.1	450	0.20604395604395603	47	0.09552845528455285	118	0.3259668508287293	74	0.12937062937062938	211	0.2783641160949868	C	10.83	1.459937	0.26248	0.102814	0.259651	ENSG00000142632	ENST00000270747;ENST00000421561;ENST00000375607	T;T	0.50001	0.76;0.76	5.21	2.13	0.27403	.	1.238380	0.05817	N	0.615075	T	0.00012	0.0000	L	0.32530	0.975	0.45390	P	0.001623000000000041	B	0.15719	0.014	B	0.14578	0.011	T	0.31138	-0.9954	9	0.30078	T	0.28	.	6.6718	0.23072	0.0:0.6669:0.0:0.3331	rs221058;rs221058	163	Q8IW93	ARHGJ_HUMAN	R	163	ENSP00000270747:G163R;ENSP00000396001:G163R	ENSP00000270747:G163R	G	-	1	0	ARHGEF19	16407233	0.296000	0.24398	0.967000	0.41034	0.118000	0.20060	0.673000	0.25203	0.220000	0.20860	0.561000	0.74099	GGC	C|0.794;G|0.206		0.657	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006289.1	NM_153213	
PLA2G2C	391013	bcgsc.ca	37	1	20501582	20501582	+	Nonsense_Mutation	SNP	G	G	A	rs12139100	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:20501582G>A	ENST00000429261.2	-	2	157	c.97C>T	c.(97-99)Cga>Tga	p.R33*	PLA2G2C_ENST00000247992.5_Nonsense_Mutation_p.R36*|PLA2G2C_ENST00000495760.2_5'UTR			Q5R387	PA2GC_HUMAN	phospholipase A2, group IIC	33					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(1)	7		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.14e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.000528)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AAGGCACTTCGCCCCGTGATG	0.532													G|||	1203	0.240216	0.2829	0.121	5008	,	,		18086	0.1766		0.1839	False		,,,				2504	0.3906				p.R36X		.											.	PLA2G2C-68	0			c.C106T						.	G	stop/ARG	979,2931		124,731,1100	99.0	103.0	101.0		106	-0.9	0.1	1	dbSNP_120	101	1469,6879		122,1225,2827	yes	stop-gained	PLA2G2C	NM_001105572.1		246,1956,3927	AA,AG,GG		17.597,25.0384,19.9706		36/151	20501582	2448,9810	1955	4174	6129	SO:0001587	stop_gained	391013	exon1			CACTTCGCCCCGT			1p36.12	2010-06-04	2003-10-13		ENSG00000187980	ENSG00000187980			9032	protein-coding gene	gene with protein product			"""phospholipase A2, group IIC (possible pseudogene)"""			8838795	Standard	NM_001105572		Approved		uc009vpq.1	Q5R387	OTTHUMG00000002705	ENST00000429261.2:c.97C>T	1.37:g.20501582G>A	ENSP00000389335:p.Arg33*	242	2		188	9	NM_001105572	0	0	0	0	0	Q7M4M6	Nonsense_Mutation	SNP	ENST00000429261.2	37		403	0.18452380952380953	119	0.241869918699187	45	0.12430939226519337	94	0.16433566433566432	145	0.19129287598944592	G	18.40	3.615689	0.66672	0.250384	0.17597	ENSG00000187980	ENST00000429261;ENST00000247992	.	.	.	5.13	-0.89	0.10577	.	0.311359	0.23189	N	0.050933	.	.	.	.	.	.	0.09310	P	0.999999999909794	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	4.7511	0.13061	0.1801:0.0:0.3081:0.5118	rs12139100;rs57362211;rs12139100	.	.	.	X	33;36	.	ENSP00000247992:R36X	R	-	1	2	PLA2G2C	20374169	0.033000	0.19621	0.057000	0.19452	0.256000	0.26092	0.198000	0.17217	-0.055000	0.13244	-0.751000	0.03497	CGA	G|0.802;A|0.198		0.532	PLA2G2C-001	PUTATIVE	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000007689.3	NM_001105572	
VWA5B1	127731	broad.mit.edu	37	1	20669623	20669623	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:20669623A>C	ENST00000375079.2	+	16	2559	c.2363A>C	c.(2362-2364)gAc>gCc	p.D788A	VWA5B1_ENST00000289815.8_Missense_Mutation_p.D788A|VWA5B1_ENST00000375083.4_Missense_Mutation_p.D788A|VWA5B1_ENST00000525343.1_3'UTR	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	788						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TCGGACTGGGACCCCCCAGCC	0.701																																					p.D788A		.											.	.	0			c.A2363C						.						7.0	11.0	10.0					1																	20669623		683	1575	2258	SO:0001583	missense	127731	exon16			ACTGGGACCCCCC	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2363A>C	1.37:g.20669623A>C	ENSP00000364220:p.Asp788Ala	66	2		111	25	NM_001039500	0	0	0	0	0	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	37		.	.	.	.	.	.	.	.	.	.	a	13.40	2.227098	0.39399	.	.	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000375079	T;T;T	0.13420	2.59;2.59;2.59	3.89	3.89	0.44902	.	1.579240	0.03851	U	0.272332	T	0.12646	0.0307	N	0.19112	0.55	0.80722	D	1	B;B;B	0.14012	0.0;0.009;0.004	B;B;B	0.14023	0.001;0.01;0.01	T	0.08806	-1.0704	10	0.72032	D	0.01	0.5451	10.1452	0.42760	1.0:0.0:0.0:0.0	.	788;788;788	Q5TIE3;Q5TIE3-5;Q5TIE3-2	VW5B1_HUMAN;.;.	A	788	ENSP00000289815:D788A;ENSP00000364224:D788A;ENSP00000364220:D788A	ENSP00000289815:D788A	D	+	2	0	VWA5B1	20542210	1.000000	0.71417	0.914000	0.36105	0.097000	0.18754	4.551000	0.60740	1.398000	0.46701	0.139000	0.15985	GAC	.		0.701	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
MUL1	79594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	20828581	20828581	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:20828581T>C	ENST00000264198.3	-	3	446	c.310A>G	c.(310-312)Aat>Gat	p.N104D		NM_024544.2	NP_078820.2	Q969V5	MUL1_HUMAN	mitochondrial E3 ubiquitin protein ligase 1	104					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|cellular response to exogenous dsRNA (GO:0071360)|mitochondrial fission (GO:0000266)|mitochondrion localization (GO:0051646)|negative regulation of cell growth (GO:0030308)|negative regulation of chemokine (C-C motif) ligand 5 production (GO:0071650)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of innate immune response (GO:0045824)|negative regulation of mitochondrial fusion (GO:0010637)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein sumoylation (GO:0033235)|protein stabilization (GO:0050821)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)	cytoplasm (GO:0005737)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(5)	11		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		GTGGTTCGATTCCACACCATC	0.507																																					p.N104D		.											.	MUL1-90	0			c.A310G						.						153.0	146.0	149.0					1																	20828581		2203	4300	6503	SO:0001583	missense	79594	exon3			TTCGATTCCACAC	BC014010	CCDS208.1	1p36.12	2013-01-11	2010-09-17	2008-03-26	ENSG00000090432	ENSG00000090432		"""RING-type (C3HC4) zinc fingers"""	25762	protein-coding gene	gene with protein product	"""ring finger protein 218"", ""mitochondria-anchored protein ligase"", ""growth inhibition and death E3 ligase"", ""mitochondrial ubiquitin ligase activator of NFKB 1"""	612037	"""chromosome 1 open reading frame 166"""	C1orf166		18591963, 12761501, 18213395, 18207745	Standard	NM_024544		Approved	FLJ12875, MULAN, RNF218, MAPL, GIDE	uc001bdi.4	Q969V5	OTTHUMG00000002838	ENST00000264198.3:c.310A>G	1.37:g.20828581T>C	ENSP00000264198:p.Asn104Asp	168	0		130	26	NM_024544	0	0	1	2	1	B5M497|Q7Z431|Q9H9B5	Missense_Mutation	SNP	ENST00000264198.3	37	CCDS208.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.754767	0.89843	.	.	ENSG00000090432	ENST00000264198	T	0.30182	1.54	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.55449	0.1921	M	0.69823	2.125	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.56559	-0.7959	10	0.56958	D	0.05	-31.0143	14.7743	0.69713	0.0:0.0:0.0:1.0	.	104	Q969V5	MUL1_HUMAN	D	104	ENSP00000264198:N104D	ENSP00000264198:N104D	N	-	1	0	MUL1	20701168	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.598000	0.82745	2.371000	0.80710	0.533000	0.62120	AAT	.		0.507	MUL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007951.1	NM_024544	
HSPG2	3339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22182300	22182300	+	Missense_Mutation	SNP	G	G	A	rs151035968		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:22182300G>A	ENST00000374695.3	-	45	5760	c.5681C>T	c.(5680-5682)aCg>aTg	p.T1894M	HSPG2_ENST00000430507.1_5'Flank	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1894	Ig-like C2-type 4.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GAGGGTGGGCGTGGGGCTCCC	0.667																																					p.T1894M		.											.	HSPG2-141	0			c.C5681T						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	37.0	37.0	37.0		5681	2.3	0.8	1	dbSNP_134	37	1,8599	1.2+/-3.3	0,1,4299	no	missense	HSPG2	NM_005529.5	81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	1894/4392	22182300	2,13004	2203	4300	6503	SO:0001583	missense	3339	exon45			GTGGGCGTGGGGC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5681C>T	1.37:g.22182300G>A	ENSP00000363827:p.Thr1894Met	30	0		61	42	NM_005529	0	0	0	0	0	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	37	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	g	13.36	2.215071	0.39102	2.27E-4	1.16E-4	ENSG00000142798	ENST00000374695	T	0.68624	-0.34	5.24	2.32	0.28847	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.574006	0.14494	N	0.316190	T	0.59432	0.2193	L	0.53671	1.685	0.31361	N	0.681397	B	0.24043	0.096	B	0.26864	0.074	T	0.57207	-0.7851	10	0.34782	T	0.22	.	9.198	0.37240	0.2455:0.0:0.7545:0.0	.	1894	P98160	PGBM_HUMAN	M	1894	ENSP00000363827:T1894M	ENSP00000363827:T1894M	T	-	2	0	HSPG2	22054887	0.571000	0.26659	0.847000	0.33407	0.762000	0.43233	1.150000	0.31639	0.219000	0.20840	0.558000	0.71614	ACG	G|1.000;T|0.000		0.667	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
SEPN1	57190	bcgsc.ca	37	1	26138262	26138262	+	Silent	SNP	T	T	C	rs760597	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:26138262T>C	ENST00000374315.1	+	8	1109	c.1071T>C	c.(1069-1071)ccT>ccC	p.P357P	RP1-317E23.6_ENST00000527604.1_5'Flank|SEPN1_ENST00000354177.4_Silent_p.P357P|SEPN1_ENST00000361547.2_Silent_p.P391P	NM_206926.1	NP_996809.1	Q9NZV5	SELN_HUMAN	selenoprotein N, 1	391						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.P391P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0421)|OV - Ovarian serous cystadenocarcinoma(117;1.26e-25)|Colorectal(126;3.01e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0143)|READ - Rectum adenocarcinoma(331;0.0649)		GCCACCTGCCTTCAGGGGAGC	0.642													C|||	3966	0.791933	0.5575	0.8516	5008	,	,		18488	0.9683		0.7753	False		,,,				2504	0.9018				.		.											.	SEPN1-92	1	Substitution - coding silent(1)	prostate(1)	.						.	C	,	2631,1521		845,941,290	25.0	27.0	26.0		1173,1071	4.1	1.0	1	dbSNP_86	26	6650,1788		2621,1408,190	no	coding-synonymous,coding-synonymous	SEPN1	NM_020451.2,NM_206926.1	,	3466,2349,480	CC,CT,TT		21.1899,36.6329,26.2828	,	391/591,357/557	26138262	9281,3309	2076	4219	6295	SO:0001819	synonymous_variant	57190	.			CCTGCCTTCAGGG	AF166125	CCDS41282.1, CCDS41283.1	1p36.13	2014-09-17	2004-02-13		ENSG00000162430	ENSG00000162430		"""EF-hand domain containing"""	15999	protein-coding gene	gene with protein product		606210	"""rigid spine muscular dystrophy 1"""	RSMD1, MDRS1		10608886	Standard	NM_020451		Approved	selN, RSS	uc021ojl.1	Q9NZV5	OTTHUMG00000007375	ENST00000374315.1:c.1071T>C	1.37:g.26138262T>C		366	3		338	12	.	0	0	5	5	0	A6NJG8|A8MQ64|Q6PI70|Q969F6|Q9NUI6	Silent	SNP	ENST00000374315.1	37	CCDS41283.1																																																																																			T|0.001;G|0.786;C|0.007;A|0.206		0.642	SEPN1-002	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000019315.2	NM_020451	
GSTM1	2944	bcgsc.ca	37	1	110233147	110233147	+	Silent	SNP	C	C	T	rs1056806	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:110233147C>T	ENST00000309851.5	+	7	582	c.528C>T	c.(526-528)gaC>gaT	p.D176D	GSTM1_ENST00000369823.2_Silent_p.D195D|GSTM2_ENST00000369831.2_Intron|GSTM1_ENST00000369819.2_Intron|GSTM2_ENST00000460717.3_Intron|GSTM1_ENST00000490021.2_Intron|GSTM1_ENST00000483399.2_Intron|GSTM1_ENST00000349334.3_Intron|AC000032.2_ENST00000562538.1_RNA	NM_000561.3	NP_000552.2	P09488	GSTM1_HUMAN	glutathione S-transferase mu 1	176	GST C-terminal.				cellular detoxification of nitrogen compound (GO:0070458)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|nitrobenzene metabolic process (GO:0018916)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|protein homodimerization activity (GO:0042803)			endometrium(1)|lung(1)|ovary(1)	3		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		all cancers(265;0.0122)|Colorectal(144;0.0129)|Epithelial(280;0.0146)|Lung(183;0.0422)|COAD - Colon adenocarcinoma(174;0.047)|LUSC - Lung squamous cell carcinoma(189;0.227)	Azathioprine(DB00993)|Busulfan(DB01008)|Carboplatin(DB00958)|Cisplatin(DB00515)|Glutathione(DB00143)|Oxaliplatin(DB00526)	AGTGCTTGGACGCCTTCCCAA	0.488									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				C|||	1143	0.228235	0.2413	0.2219	5008	,	,		7904	0.2034		0.1581	False		,,,				2504	0.3129				p.D176D		.											.	GSTM1-44	0			c.C528T						.	C	,	1047,3255		379,289,1483	259.0	142.0	182.0		528,	-7.1	0.0	1	dbSNP_86	182	952,7310		377,198,3556	yes	coding-synonymous,intron	GSTM1	NM_000561.3,NM_146421.2	,	756,487,5039	TT,TC,CC		11.5226,24.3375,15.9105	,	176/219,	110233147	1999,10565	2151	4131	6282	SO:0001819	synonymous_variant	2944	exon7	Familial Cancer Database	incl.: Familial Head and Neck Cancer; ;AIMAH, Cushing disease, Adrenal, Familial	CTTGGACGCCTTC	BC036805	CCDS809.1, CCDS810.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134184	ENSG00000134184	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4632	protein-coding gene	gene with protein product		138350	"""glutathione S-transferase M1"""	GST1			Standard	NM_000561		Approved	MU, H-B	uc001dyk.3	P09488	OTTHUMG00000011635	ENST00000309851.5:c.528C>T	1.37:g.110233147C>T		503	5		196	6	NM_000561	0	0	6	6	0	Q5GHG0|Q6FH88|Q8TC98|Q9UC96	Silent	SNP	ENST00000309851.5	37	CCDS809.1																																																																																			C|0.862;T|0.138		0.488	GSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032151.2	NM_000561	
CSF1	1435	bcgsc.ca	37	1	110466338	110466338	+	Silent	SNP	C	C	A	rs333970	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:110466338C>A	ENST00000329608.6	+	6	1486	c.1095C>A	c.(1093-1095)acC>acA	p.T365T	CSF1_ENST00000344188.5_Intron|CSF1_ENST00000369801.1_Intron|CSF1_ENST00000369802.3_Silent_p.T365T|CSF1_ENST00000420111.2_Intron	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	365					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		TAACTGGTACCGCCTTGCCCA	0.632											OREG0013645	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2154	0.430112	0.1067	0.5749	5008	,	,		17431	0.4018		0.6213	False		,,,				2504	0.5971				p.T365T		.											.	CSF1-91	0			c.C1095A						.	C	,,,	843,3563	328.8+/-300.7	89,665,1449	55.0	56.0	56.0		1095,,,1095	-3.9	0.0	1	dbSNP_79	56	5200,3400	632.1+/-398.6	1572,2056,672	no	coding-synonymous,intron,intron,coding-synonymous	CSF1	NM_000757.5,NM_172210.2,NM_172211.2,NM_172212.2	,,,	1661,2721,2121	AA,AC,CC		39.5349,19.133,46.4632	,,,	365/555,,,365/555	110466338	6043,6963	2203	4300	6503	SO:0001819	synonymous_variant	1435	exon6			TGGTACCGCCTTG	BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.1095C>A	1.37:g.110466338C>A		160	0	1427	126	5	NM_000757	0	0	4	4	0	A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Silent	SNP	ENST00000329608.6	37	CCDS816.1																																																																																			C|0.554;A|0.446		0.632	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032208.1	NM_000757	
PDE4DIP	9659	broad.mit.edu	37	1	144917828	144917828	+	Frame_Shift_Del	DEL	A	A	-	rs375854543|rs11295415	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:144917828delA	ENST00000369354.3	-	11	1647	c.1458delT	c.(1456-1458)gttfs	p.V486fs	PDE4DIP_ENST00000369349.3_Frame_Shift_Del_p.V486fs|PDE4DIP_ENST00000369356.4_Frame_Shift_Del_p.V486fs|PDE4DIP_ENST00000369351.3_Frame_Shift_Del_p.V486fs|PDE4DIP_ENST00000313382.9_Frame_Shift_Del_p.V552fs|PDE4DIP_ENST00000529945.1_Frame_Shift_Del_p.V649fs|PDE4DIP_ENST00000479408.2_Frame_Shift_Del_p.V273fs|PDE4DIP_ENST00000369359.4_Frame_Shift_Del_p.V623fs|PDE4DIP_ENST00000530740.1_Frame_Shift_Del_p.V623fs|PDE4DIP_ENST00000313431.9_Frame_Shift_Del_p.V649fs			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	486					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCTCCAGAGCAACAGCTTTAT	0.383			T	PDGFRB	MPD								AA|AA|A|deletion	1281	0.255791	0.3994	0.2406	5008	,	,		35225	0.0397		0.3499	False		,,,				2504	0.1984				p.V649fs		.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP-663	0			c.1947delT						.		,,,,	1671,2595		0,1671,462	123.0	135.0	131.0		,,,,	5.8	1.0	1	dbSNP_120	166	2886,5360		0,2886,1237	no	frameshift,frameshift,frameshift,frameshift,frameshift	PDE4DIP	NM_014644.4,NM_001198834.2,NM_001198832.1,NM_001002812.1,NM_001002811.1	,,,,	0,4557,1699	A1A1,A1R,RR		34.9988,39.1702,36.421	,,,,	,,,,	144917828	4557,7955	2203	4294	6497	SO:0001589	frameshift_variant	9659	exon7			CAGAGCAACAGCT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1458delT	1.37:g.144917828delA	ENSP00000358360:p.Val486fs	447	0		344	7	NM_001002811	0	0	0	0	0	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Frame_Shift_Del	DEL	ENST00000369354.3	37	CCDS30824.1																																																																																			.		0.383	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
HSPA6	3310	bcgsc.ca	37	1	161495885	161495885	+	Silent	SNP	T	T	C	rs404508	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:161495885T>C	ENST00000309758.4	+	1	1850	c.1437T>C	c.(1435-1437)acT>acC	p.T479T	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	479					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TAGAGGTGACTTTTGACATTG	0.552													C|||	4012	0.801118	0.7791	0.7233	5008	,	,		20105	0.9117		0.7883	False		,,,				2504	0.7853				p.T479T		.											.	HSPA6-226	0			c.T1437C						.	C		3495,911		1377,741,85	69.0	64.0	66.0		1437	1.6	0.9	1	dbSNP_80	66	6462,2138		2425,1612,263	no	coding-synonymous	HSPA6	NM_002155.3		3802,2353,348	CC,CT,TT		24.8605,20.6764,23.443		479/644	161495885	9957,3049	2203	4300	6503	SO:0001819	synonymous_variant	3310	exon1			GGTGACTTTTGAC		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.1437T>C	1.37:g.161495885T>C		452	2		331	9	NM_002155	0	14	2	16	0	Q1HBA8|Q8IYK7|Q9BT95	Silent	SNP	ENST00000309758.4	37	CCDS1231.1																																																																																			T|0.179;G|0.216;C|0.555;A|0.050		0.552	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083308.1	NM_002155	
TNR	7143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	175365862	175365862	+	Missense_Mutation	SNP	G	G	A	rs138654492		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:175365862G>A	ENST00000367674.2	-	5	1766	c.1058C>T	c.(1057-1059)aCg>aTg	p.T353M	TNR_ENST00000263525.2_Missense_Mutation_p.T353M			Q92752	TENR_HUMAN	tenascin R	353	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CACATATTCCGTCACTGCCAT	0.617																																					p.T353M		.											.	TNR-324	0			c.C1058T						.	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	83.0	83.0	83.0		1058	6.0	1.0	1	dbSNP_134	83	0,8600		0,0,4300	no	missense	TNR	NM_003285.2	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	353/1359	175365862	1,13005	2203	4300	6503	SO:0001583	missense	7143	exon5			TATTCCGTCACTG	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1058C>T	1.37:g.175365862G>A	ENSP00000356646:p.Thr353Met	110	0		100	13	NM_003285	0	0	0	0	0	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	ENST00000367674.2	37	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905250	0.92035	2.27E-4	0.0	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.60171	0.21;0.21	5.96	5.96	0.96718	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.055941	0.64402	D	0.000001	T	0.77805	0.4185	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.76277	-0.3018	10	0.46703	T	0.11	.	19.9958	0.97383	0.0:0.0:1.0:0.0	.	353	Q92752	TENR_HUMAN	M	353	ENSP00000356646:T353M;ENSP00000263525:T353M	ENSP00000263525:T353M	T	-	2	0	TNR	173632485	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.328000	0.96403	2.826000	0.97356	0.655000	0.94253	ACG	G|1.000;A|0.000		0.617	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
RGSL1	353299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	182499457	182499457	+	Missense_Mutation	SNP	C	C	T	rs202037903		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:182499457C>T	ENST00000294854.8	+	12	2224	c.2204C>T	c.(2203-2205)aCg>aTg	p.T735M	RGSL1_ENST00000542961.1_Missense_Mutation_p.T770M|RGSL1_ENST00000456971.2_3'UTR	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	735	RGS.				termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						ACACTGTTAACGCTCCAGGGA	0.418													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17738	0.0		0.0	False		,,,				2504	0.0				p.T735M	Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)	.											.	RGSL1-226	0			c.C2204T						.	C	MET/THR	1,1383		0,1,691	120.0	98.0	105.0		2204	-4.3	0.0	1		105	0,3182		0,0,1591	yes	missense	RGSL1	NM_001137669.1	81	0,1,2282	TT,TC,CC		0.0,0.0723,0.0219	benign	735/1077	182499457	1,4565	692	1591	2283	SO:0001583	missense	353299	exon12			TGTTAACGCTCCA	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.2204C>T	1.37:g.182499457C>T	ENSP00000457748:p.Thr735Met	118	0		74	38	NM_001137669	0	0	0	0	0	A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	ENST00000294854.8	37	CCDS58049.1																																																																																			.		0.418	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320710.3	NM_181572	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186092228	186092228	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:186092228G>C	ENST00000271588.4	+	81	12604	c.12375G>C	c.(12373-12375)caG>caC	p.Q4125H	HMCN1_ENST00000367492.2_Missense_Mutation_p.Q4125H	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4125	Ig-like C2-type 40.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTATCCGCCAGCGCGTCCTCA	0.537																																					p.Q4125H		.											.	HMCN1-113	0			c.G12375C						.						101.0	78.0	86.0					1																	186092228		2203	4300	6503	SO:0001583	missense	83872	exon81			CCGCCAGCGCGTC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12375G>C	1.37:g.186092228G>C	ENSP00000271588:p.Gln4125His	153	0		103	33	NM_031935	0	0	0	0	0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.538323	0.65085	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.65549	-0.16;-0.16	5.85	5.85	0.93711	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.178723	0.49916	D	0.000128	T	0.55609	0.1931	N	0.04746	-0.17	0.47994	D	0.999567	D	0.67145	0.996	P	0.60789	0.879	T	0.54166	-0.8334	10	0.15499	T	0.54	.	15.3266	0.74168	0.0686:0.0:0.9314:0.0	.	4125	Q96RW7	HMCN1_HUMAN	H	4125	ENSP00000271588:Q4125H;ENSP00000356462:Q4125H	ENSP00000271588:Q4125H	Q	+	3	2	HMCN1	184358851	1.000000	0.71417	1.000000	0.80357	0.475000	0.33008	2.821000	0.48065	2.768000	0.95171	0.655000	0.94253	CAG	.		0.537	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
OR2T12	127064	bcgsc.ca	37	1	248457979	248457979	+	Missense_Mutation	SNP	C	C	A	rs6667171	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:248457979C>A	ENST00000317996.1	-	1	901	c.902G>T	c.(901-903)cGg>cTg	p.R301L		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	301			R -> L (in dbSNP:rs6667171).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			CCCCAGCCACCGTTTCAGGGC	0.453													N|||	3980	0.794728	0.7496	0.7608	5008	,	,		19195	0.8591		0.7177	False		,,,				2504	0.8926				p.R301L		.											.	OR2T12-71	0			c.G902T						.	T	LEU/ARG	3382,1024	728.5+/-409.9	1274,834,95	165.0	160.0	162.0		902	-1.1	0.0	1	dbSNP_116	162	6434,2166	713.1+/-405.9	2427,1580,293	no	missense	OR2T12	NM_001004692.1	102	3701,2414,388	AA,AC,CC		25.186,23.241,24.5271	benign	301/321	248457979	9816,3190	2203	4300	6503	SO:0001583	missense	127064	exon1			AGCCACCGTTTCA	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.902G>T	1.37:g.248457979C>A	ENSP00000324583:p.Arg301Leu	270	3		252	7	NM_001004692	0	0	0	0	0		Missense_Mutation	SNP	ENST00000317996.1	37	CCDS31110.1	1674	0.7664835164835165	364	0.7398373983739838	256	0.7071823204419889	490	0.8566433566433567	564	0.7440633245382586	c	9.029	0.986776	0.18889	0.76759	0.74814	ENSG00000177201	ENST00000317996	T	0.40225	1.04	1.25	-1.12	0.09808	.	1.589820	0.05228	U	0.509856	T	0.00012	0.0000	M	0.63208	1.945	0.80722	P	0.0	B	0.14438	0.01	B	0.15870	0.014	T	0.46693	-0.9173	9	0.87932	D	0	.	5.2518	0.15527	0.0:0.5861:0.0:0.4139	rs6667171	301	Q8NG77	O2T12_HUMAN	L	301	ENSP00000324583:R301L	ENSP00000324583:R301L	R	-	2	0	OR2T12	246524602	0.000000	0.05858	0.002000	0.10522	0.175000	0.22909	-1.839000	0.01686	-0.207000	0.10187	0.175000	0.17021	CGG	C|0.242;A|0.758		0.453	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
OR2M7	391196	bcgsc.ca	37	1	248487638	248487638	+	Missense_Mutation	SNP	A	A	G	rs7555310	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:248487638A>G	ENST00000317965.2	-	1	261	c.233T>C	c.(232-234)gTa>gCa	p.V78A		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	78			V -> A (in dbSNP:rs7555310).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CATCTTGGGTACAGTGGTGCA	0.498													a|||	4009	0.800519	0.77	0.7651	5008	,	,		21843	0.8601		0.7117	False		,,,				2504	0.8967				p.V78A		.											.	OR2M7-70	0			c.T233C						.	A	ALA/VAL	3420,986	732.6+/-410.4	1321,778,104	281.0	269.0	274.0		233	-0.0	0.9	1	dbSNP_116	274	6420,2180	712.3+/-405.9	2414,1592,294	no	missense	OR2M7	NM_001004691.1	64	3735,2370,398	GG,GA,AA		25.3488,22.3786,24.3426	possibly-damaging	78/313	248487638	9840,3166	2203	4300	6503	SO:0001583	missense	391196	exon1			TTGGGTACAGTGG	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.233T>C	1.37:g.248487638A>G	ENSP00000324557:p.Val78Ala	290	1		216	9	NM_001004691	0	0	0	0	0	B2RNL0|Q6IEX6	Missense_Mutation	SNP	ENST00000317965.2	37	CCDS31111.1	1672	0.7655677655677655	364	0.7398373983739838	260	0.7182320441988951	490	0.8566433566433567	558	0.7361477572559367	A	12.09	1.833168	0.32421	0.776214	0.746512	ENSG00000177186	ENST00000317965	T	0.04917	3.53	1.54	-0.0112	0.13993	GPCR, rhodopsin-like superfamily (1);	0.303544	0.17742	U	0.163532	T	0.00012	0.0000	M	0.62088	1.915	0.80722	P	0.0	D	0.54964	0.969	P	0.52514	0.701	T	0.07578	-1.0765	9	0.72032	D	0.01	.	7.0716	0.25181	0.7737:0.2263:0.0:0.0	rs7555310;rs52824261;rs59109346;rs7555310	78	Q8NG81	OR2M7_HUMAN	A	78	ENSP00000324557:V78A	ENSP00000324557:V78A	V	-	2	0	OR2M7	246554261	0.000000	0.05858	0.903000	0.35520	0.318000	0.28184	0.285000	0.18883	0.703000	0.31848	0.155000	0.16302	GTA	A|0.247;G|0.753		0.498	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691	
OR2T2	401992	bcgsc.ca	37	1	248616705	248616711	+	Frame_Shift_Del	DEL	TGCTGCG	TGCTGCG	-	rs199823862|rs372931983		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	TGCTGCG	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:248616705_248616711delTGCTGCG	ENST00000342927.3	+	1	629_635	c.607_613delTGCTGCG	c.(607-615)tgctgcgtgfs	p.CCV203fs		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GATGTATGCCTGCTGCGTGCTGATGCT	0.527																																					p.203_205del		.											.	OR2T2-23	0			c.607_613del						.			51,3755		2,47,1854						-2.5	0.6			76	261,7371		12,237,3567	no	frameshift	OR2T2	NM_001004136.1		14,284,5421	A1A1,A1R,RR		3.4198,1.34,2.7277				312,11126				SO:0001589	frameshift_variant	401992	exon1			TATGCCTGCTGCG	BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.607_613delTGCTGCG	1.37:g.248616705_248616711delTGCTGCG	ENSP00000343062:p.Cys203fs	493	3		452	6	NM_001004136	0	0	0	0	0	B2RNM1|B9EH01	Frame_Shift_Del	DEL	ENST00000342927.3	37	CCDS31116.1																																																																																			.		0.527	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097421.1	NM_001004136	
PITRM1	10531	hgsc.bcm.edu	37	10	3214937	3214937	+	Silent	SNP	G	G	A	rs572092794		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr10:3214937G>A	ENST00000224949.4	-	1	62	c.28C>T	c.(28-30)Ctg>Ttg	p.L10L	PITRM1_ENST00000380989.2_Silent_p.L10L|PITRM1_ENST00000451104.2_Missense_Mutation_p.P12L			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	10					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						AGCACACACAGGCCCTGCCGC	0.756													G|||	1	0.000199681	0.0	0.0	5008	,	,		8769	0.0		0.001	False		,,,				2504	0.0				p.P12L		.											.	PITRM1-91	0			c.C35T						.						4.0	7.0	6.0					10																	3214937		1873	3764	5637	SO:0001819	synonymous_variant	10531	exon1			CACACAGGCCCTG	AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.28C>T	10.37:g.3214937G>A		2	0		63	50	NM_001242309	0	0	0	0	0	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	ENST00000224949.4	37	CCDS59208.1	.	.	.	.	.	.	.	.	.	.	G	8.131	0.783106	0.16189	.	.	ENSG00000107959	ENST00000380980;ENST00000451104	T	0.04049	3.72	3.31	-1.02	0.10135	.	.	.	.	.	T	0.02230	0.0069	.	.	.	0.09310	N	0.999993	B	0.06786	0.001	B	0.01281	0.0	T	0.48186	-0.9057	7	.	.	.	.	0.5482	0.00657	0.2427:0.1955:0.3619:0.1999	.	12	E7ES23	.	L	12	ENSP00000401201:P12L	.	P	-	2	0	PITRM1	3204937	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.084000	0.11268	-0.082000	0.12640	-1.943000	0.00494	CCT	.		0.756	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046469.2		
MYPN	84665	bcgsc.ca	37	10	69926334	69926334	+	Missense_Mutation	SNP	C	C	G	rs10823148	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr10:69926334C>G	ENST00000358913.5	+	10	2372	c.1884C>G	c.(1882-1884)ttC>ttG	p.F628L	MYPN_ENST00000354393.2_Missense_Mutation_p.F353L|MYPN_ENST00000540630.1_Missense_Mutation_p.F628L	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	628			F -> L (in dbSNP:rs10823148). {ECO:0000269|PubMed:22286171, ECO:0000269|PubMed:22892539}.		sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						CCGATTCTTTCCAGGAGAGGT	0.537													C|||	1585	0.316494	0.1104	0.4049	5008	,	,		16523	0.2163		0.5099	False		,,,				2504	0.4366				p.F628L		.											.	MYPN-95	0			c.C1884G						.	C	LEU/PHE	768,3638	311.9+/-292.3	73,622,1508	71.0	66.0	68.0		1884	4.3	1.0	10	dbSNP_120	68	4382,4218	582.8+/-391.5	1167,2048,1085	yes	missense	MYPN	NM_032578.2	22	1240,2670,2593	GG,GC,CC		49.0465,17.4308,39.5971	benign	628/1321	69926334	5150,7856	2203	4300	6503	SO:0001583	missense	84665	exon10			TTCTTTCCAGGAG	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1884C>G	10.37:g.69926334C>G	ENSP00000351790:p.Phe628Leu	113	1		95	7	NM_032578	0	0	0	0	0	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	37	CCDS7275.1	736	0.336996336996337	64	0.13008130081300814	157	0.43370165745856354	128	0.22377622377622378	387	0.5105540897097626	C	0.738	-0.777515	0.02929	0.174308	0.509535	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.55588	0.51;0.57;0.55	5.29	4.3	0.51218	.	0.087877	0.49305	D	0.000149	T	0.00012	0.0000	N	0.22421	0.69	0.29149	P	0.878514	B;B;B	0.12013	0.005;0.002;0.001	B;B;B	0.13407	0.009;0.006;0.003	T	0.45071	-0.9286	8	.	.	.	.	7.6139	0.28145	0.129:0.6838:0.1132:0.0741	rs10823148;rs17457985;rs52812887;rs10823148	628;353;628	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	L	353;353;628;628	ENSP00000346369:F353L;ENSP00000351790:F628L;ENSP00000441668:F628L	.	F	+	3	2	MYPN	69596340	1.000000	0.71417	0.994000	0.49952	0.087000	0.18053	2.051000	0.41307	2.455000	0.83008	0.655000	0.94253	TTC	C|0.625;G|0.374		0.537	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
SEC31B	25956	bcgsc.ca	37	10	102265847	102265847	+	Missense_Mutation	SNP	A	A	C	rs2295774	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr10:102265847A>C	ENST00000370345.3	-	9	1091	c.994T>G	c.(994-996)Tct>Gct	p.S332A	SEC31B_ENST00000535773.1_Missense_Mutation_p.S175A|SEC31B_ENST00000451524.1_Missense_Mutation_p.S332A|SEC31B_ENST00000370329.5_Missense_Mutation_p.S335A	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	332			S -> A (in dbSNP:rs2295774). {ECO:0000269|PubMed:15489334}.		protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CCCATCACAGAGTACAAACTG	0.542													A|||	751	0.14996	0.0719	0.1744	5008	,	,		19627	0.1319		0.1909	False		,,,				2504	0.2147				p.S332A		.											.	SEC31B-91	0			c.T994G						.	A	ALA/SER	340,4066	181.5+/-209.5	13,314,1876	158.0	156.0	157.0		994	5.9	1.0	10	dbSNP_100	157	1888,6712	335.8+/-321.6	216,1456,2628	yes	missense	SEC31B	NM_015490.3	99	229,1770,4504	CC,CA,AA		21.9535,7.7167,17.1306	probably-damaging	332/1180	102265847	2228,10778	2203	4300	6503	SO:0001583	missense	25956	exon9			TCACAGAGTACAA	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.994T>G	10.37:g.102265847A>C	ENSP00000359370:p.Ser332Ala	152	0		146	5	NM_015490	0	0	1	1	0	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	338	0.15476190476190477	19	0.03861788617886179	66	0.18232044198895028	94	0.16433566433566432	159	0.20976253298153033	A	32	5.124589	0.94429	0.077167	0.219535	ENSG00000075826	ENST00000370345;ENST00000451524;ENST00000535773;ENST00000370329	T;T;T;T	0.71817	1.47;1.47;-0.6;1.47	5.94	5.94	0.96194	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.050373	0.85682	D	0.000000	T	0.00300	0.0009	M	0.92169	3.28	0.09310	P	0.9999999837421	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.999;0.979;0.994;0.979;0.987	T	0.01566	-1.1323	9	0.72032	D	0.01	-11.7028	15.579	0.76418	1.0:0.0:0.0:0.0	rs2295774;rs2295774	332;335;331;332;332	A8KAL6;B4DGE3;Q9NQW1-5;E9PKR7;Q9NQW1	.;.;.;.;SC31B_HUMAN	A	332;332;175;335	ENSP00000359370:S332A;ENSP00000391178:S332A;ENSP00000442621:S175A;ENSP00000359354:S335A	ENSP00000359354:S335A	S	-	1	0	SEC31B	102255837	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.334000	0.79224	2.279000	0.76181	0.459000	0.35465	TCT	A|0.836;C|0.164		0.542	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
ATRNL1	26033	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	116853707	116853707	+	Silent	SNP	C	C	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr10:116853707C>A	ENST00000355044.3	+	1	324	c.198C>A	c.(196-198)acC>acA	p.T66T	ATRNL1_ENST00000529665.1_3'UTR|ATRNL1_ENST00000527407.1_Silent_p.T66T	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	66	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GCGAGAGGACCGGCTCCTGCT	0.662																																					p.T66T		.											.	ATRNL1-96	0			c.C198A						.						20.0	19.0	19.0					10																	116853707		2189	4275	6464	SO:0001819	synonymous_variant	26033	exon1			GAGGACCGGCTCC	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.198C>A	10.37:g.116853707C>A		30	0		75	30	NM_207303	0	0	0	0	0	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Silent	SNP	ENST00000355044.3	37	CCDS7592.1																																																																																			.		0.662	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
LHPP	64077	hgsc.bcm.edu	37	10	126150523	126150523	+	Missense_Mutation	SNP	C	C	A	rs75426652	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr10:126150523C>A	ENST00000368842.5	+	1	120	c.92C>A	c.(91-93)aCg>aAg	p.T31K	LHPP_ENST00000392757.4_Missense_Mutation_p.T31K|LHPP_ENST00000368839.1_Missense_Mutation_p.T31K	NM_022126.3	NP_071409.3	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic pyrophosphate phosphatase	31					phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|phosphohistidine phosphatase activity (GO:0008969)|protein homodimerization activity (GO:0042803)			large_intestine(2)|lung(2)	4		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		GGCGGCGGCACGGCCATCGCC	0.771													C|||	497	0.0992412	0.3427	0.0288	5008	,	,		7758	0.0109		0.0119	False		,,,				2504	0.001				p.T31K	GBM(165;1980 2715 15999 18454)	.											.	LHPP-90	0			c.C92A						.	C	LYS/THR,LYS/THR	756,2764		49,658,1053	5.0	5.0	5.0		92,92	-8.6	0.0	10	dbSNP_131	5	60,6906		1,58,3424	no	missense,missense	LHPP	NM_001167880.1,NM_022126.3	78,78	50,716,4477	AA,AC,CC		0.8613,21.4773,7.7818	benign,benign	31/211,31/271	126150523	816,9670	1760	3483	5243	SO:0001583	missense	64077	exon1			GCGGCACGGCCAT	AB049629	CCDS7640.1, CCDS53587.1	10q26.2	2010-02-17			ENSG00000107902	ENSG00000107902	3.6.1.1		30042	protein-coding gene	gene with protein product						12801912, 16430861	Standard	NM_022126		Approved	HDHD2B	uc001lhs.2	Q9H008	OTTHUMG00000019214	ENST00000368842.5:c.92C>A	10.37:g.126150523C>A	ENSP00000357835:p.Thr31Lys	0	0		7	6	NM_022126	0	0	0	1	1	B3KP20|Q2TBE9|Q5VUV9|Q5VUW0	Missense_Mutation	SNP	ENST00000368842.5	37	CCDS7640.1	176	0.08058608058608059	156	0.3170731707317073	10	0.027624309392265192	3	0.005244755244755245	7	0.009234828496042216	C	4.235	0.042626	0.08196	0.214773	0.008613	ENSG00000107902	ENST00000392757;ENST00000368842;ENST00000368839	T;T;T	0.26810	1.71;1.71;1.71	4.3	-8.6	0.00889	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	2.588180	0.01329	N	0.011196	T	0.00012	0.0000	N	0.17838	0.53	0.80722	P	0.0	B;B;B	0.15719	0.014;0.01;0.001	B;B;B	0.09377	0.002;0.004;0.004	T	0.26849	-1.0091	9	0.07813	T	0.8	0.4261	4.7267	0.12945	0.0882:0.123:0.2632:0.5256	.	31;31;31	Q5T1Z0;Q9H008-2;Q9H008	.;.;LHPP_HUMAN	K	31	ENSP00000376512:T31K;ENSP00000357835:T31K;ENSP00000357832:T31K	ENSP00000357832:T31K	T	+	2	0	LHPP	126140513	0.000000	0.05858	0.000000	0.03702	0.859000	0.49053	-1.087000	0.03383	-2.575000	0.00465	-0.300000	0.09419	ACG	C|0.919;A|0.081		0.771	LHPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050870.1	NM_022126	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219066	134219066	+	Silent	SNP	G	G	C	rs76595411	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr10:134219066G>C	ENST00000305233.5	+	2	1121	c.1062G>C	c.(1060-1062)gtG>gtC	p.V354V	PWWP2B_ENST00000368609.4_Silent_p.V354V	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	354										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		CCGAGCTGGTGGGGGAGCTGA	0.726													G|||	150	0.0299521	0.0083	0.0504	5008	,	,		14238	0.002		0.0636	False		,,,				2504	0.0389				p.V354V		.											.	PWWP2B-90	0			c.G1062C						.	G	,	58,4234		0,58,2088	21.0	26.0	24.0		1062,1062	-1.9	0.8	10	dbSNP_132	24	487,7941		17,453,3744	no	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	17,511,5832	CC,CG,GG		5.7784,1.3514,4.2846	,	354/500,354/591	134219066	545,12175	2146	4214	6360	SO:0001819	synonymous_variant	170394	exon2			GCTGGTGGGGGAG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1062G>C	10.37:g.134219066G>C		0	0		10	6	NM_001098637	0	0	0	10	10	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			G|0.955;C|0.045		0.726	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
MUC2	4583	broad.mit.edu	37	11	1092971	1092971	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr11:1092971C>T	ENST00000441003.2	+	30	4817	c.4790C>T	c.(4789-4791)aCa>aTa	p.T1597I	MUC2_ENST00000359061.5_Intron|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaaccccaacacccaccggc	0.632																																					p.T1597I		.											.	MUC2-90	0			c.C4790T						.						47.0	82.0	70.0					11																	1092971		1782	3233	5015	SO:0001583	missense	4583	exon30			CCCCAACACCCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4790C>T	11.37:g.1092971C>T	ENSP00000415183:p.Thr1597Ile	102	1		93	7	NM_002457	0	0	0	0	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.395	-0.338980	0.05243	.	.	ENSG00000198788	ENST00000441003	T	0.14640	2.49	1.75	0.762	0.18454	.	.	.	.	.	T	0.07143	0.0181	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.41520	-0.9504	8	0.22109	T	0.4	.	4.3366	0.11089	0.0:0.6142:0.0:0.3858	.	1597	E7EUV1	.	I	1597	ENSP00000415183:T1597I	ENSP00000415183:T1597I	T	+	2	0	MUC2	1082971	0.029000	0.19370	0.001000	0.08648	0.134000	0.20937	1.107000	0.31110	0.104000	0.17725	0.121000	0.15741	ACA	.		0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
KRTAP5-5	439915	broad.mit.edu	37	11	1651191	1651199	+	In_Frame_Del	DEL	GGCTGTGGA	GGCTGTGGA	-	rs71025763|rs144216147	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr11:1651191_1651199delGGCTGTGGA	ENST00000399676.2	+	1	159_167	c.121_129delGGCTGTGGA	c.(121-129)ggctgtggadel	p.GCG47del		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggctccggctgtggaggctgtgggg	0.713																																					p.41_43del		.											.	KRTAP5-5-23	0			c.121_129del						.			727,2515		74,579,968						1.8	0.6		dbSNP_130	24	1587,5219		143,1301,1959	no	coding	KRTAP5-5	NM_001001480.2		217,1880,2927	A1A1,A1R,RR		23.3177,22.4244,23.0295				2314,7734				SO:0001651	inframe_deletion	439915	exon1			GGCTCCGGCTGTG	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.121_129delGGCTGTGGA	11.37:g.1651191_1651199delGGCTGTGGA	ENSP00000382584:p.Gly47_Gly49del	5	0		84	7	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Del	DEL	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.713	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
SCUBE2	57758	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	9101018	9101018	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr11:9101018C>A	ENST00000309263.3	-	3	367	c.295G>T	c.(295-297)Gtc>Ttc	p.V99F	SCUBE2_ENST00000450649.2_Missense_Mutation_p.V99F|SCUBE2_ENST00000520467.1_Missense_Mutation_p.V99F|SCUBE2_ENST00000457346.2_Missense_Mutation_p.V99F|SCUBE2_ENST00000534295.1_5'UTR			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	99	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		CAGTCATGGACACAGCCTCCA	0.403																																					p.V99F		.											.	SCUBE2-92	0			c.G295T						.						242.0	198.0	213.0					11																	9101018		2201	4296	6497	SO:0001583	missense	57758	exon3			CATGGACACAGCC	AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.295G>T	11.37:g.9101018C>A	ENSP00000310658:p.Val99Phe	158	0		105	9	NM_001170690	0	0	1	1	0	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37		.	.	.	.	.	.	.	.	.	.	C	34	5.361610	0.95877	.	.	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25	5.37	5.37	0.77165	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.89287	0.6672	N	0.19112	0.55	0.80722	D	1	D;D;D	0.69078	0.997;0.996;0.993	D;D;D	0.75484	0.986;0.978;0.935	D	0.90724	0.4637	10	0.66056	D	0.02	.	19.4788	0.95000	0.0:1.0:0.0:0.0	.	99;99;99	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	F	99	ENSP00000390481:V99F;ENSP00000310658:V99F;ENSP00000415187:V99F;ENSP00000429969:V99F	ENSP00000310658:V99F	V	-	1	0	SCUBE2	9057594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.684000	0.84104	2.676000	0.91093	0.655000	0.94253	GTC	.		0.403	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974	
ATG2A	23130	hgsc.bcm.edu	37	11	64673875	64673880	+	In_Frame_Del	DEL	GCCCTT	GCCCTT	-	rs369499174		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	GCCCTT	GCCCTT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr11:64673875_64673880delGCCCTT	ENST00000377264.3	-	21	3221_3226	c.3109_3114delAAGGGC	c.(3109-3114)aagggcdel	p.KG1037del	ATG2A_ENST00000421419.2_In_Frame_Del_p.KG1037del	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1037					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CCCGGCCCTGGCCCTTGCGGCCCGAG	0.655																																					p.1037_1038del		.											.	ATG2A-69	0			c.3109_3114del						.																																			SO:0001651	inframe_deletion	23130	exon21			GCCCTGGCCCTTG		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.3109_3114delAAGGGC	11.37:g.64673875_64673880delGCCCTT	ENSP00000366475:p.Lys1037_Gly1038del	5	1		33	21	NM_015104	0	0	0	0	0	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	In_Frame_Del	DEL	ENST00000377264.3	37	CCDS31602.1																																																																																			.		0.655	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000143224.1	NM_015104	
CNTN5	53942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	99942451	99942451	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr11:99942451G>T	ENST00000524871.1	+	12	1604	c.1314G>T	c.(1312-1314)atG>atT	p.M438I	CNTN5_ENST00000528682.1_Missense_Mutation_p.M438I|CNTN5_ENST00000527185.1_Missense_Mutation_p.M438I|CNTN5_ENST00000418526.2_Missense_Mutation_p.M364I|CNTN5_ENST00000279463.3_Missense_Mutation_p.M438I	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	438	Ig-like C2-type 4.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		GGGTTGAGATGGTTAATGGAG	0.343																																					p.M438I		.											.	CNTN5-366	0			c.G1314T						.						115.0	105.0	108.0					11																	99942451		1853	4110	5963	SO:0001583	missense	53942	exon11			TGAGATGGTTAAT	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1314G>T	11.37:g.99942451G>T	ENSP00000435637:p.Met438Ile	85	0		84	12	NM_001243270	0	0	0	0	0	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	G	3.035	-0.198697	0.06219	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1	5.48	4.38	0.52667	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.080619	0.85682	D	0.000000	T	0.25005	0.0607	N	0.00602	-1.34	0.39898	D	0.973869	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.12156	0.005;0.004;0.007	T	0.33650	-0.9860	10	0.02654	T	1	.	10.5911	0.45310	0.1182:0.0:0.8818:0.0	.	438;364;438	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	I	438;438;438;364;438	ENSP00000433575:M438I;ENSP00000436185:M438I;ENSP00000435637:M438I;ENSP00000393229:M364I;ENSP00000279463:M438I	ENSP00000279463:M438I	M	+	3	0	CNTN5	99447661	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.897000	0.48664	1.018000	0.39521	0.655000	0.94253	ATG	.		0.343	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
SORL1	6653	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	121490527	121490527	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr11:121490527C>G	ENST00000260197.7	+	43	5919	c.5790C>G	c.(5788-5790)gaC>gaG	p.D1930E	SORL1_ENST00000527934.1_Missense_Mutation_p.D545E|SORL1_ENST00000534286.1_Missense_Mutation_p.D840E|SORL1_ENST00000532694.1_Missense_Mutation_p.D776E|SORL1_ENST00000525532.1_Missense_Mutation_p.D874E	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1930					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TGATCCCGGACAGCAGGCTTC	0.537																																					p.D1930E		.											.	SORL1-228	0			c.C5790G						.						219.0	187.0	198.0					11																	121490527		2202	4299	6501	SO:0001583	missense	6653	exon43			CCCGGACAGCAGG	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.5790C>G	11.37:g.121490527C>G	ENSP00000260197:p.Asp1930Glu	201	0		147	40	NM_003105	0	0	0	0	0	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	37	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.650688	0.47362	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	D;D;T;D;D	0.91631	-2.88;-2.62;0.59;-2.3;-2.15	5.77	4.81	0.61882	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.055720	0.64402	D	0.000001	D	0.90981	0.7164	L	0.34521	1.04	0.48288	D	0.99962	D;D	0.67145	0.996;0.982	P;B	0.55923	0.787;0.446	D	0.90963	0.4814	10	0.72032	D	0.01	.	9.8541	0.41075	0.0:0.7776:0.0:0.2224	.	545;1930	E9PKB0;Q92673	.;SORL_HUMAN	E	1930;874;776;840;545	ENSP00000260197:D1930E;ENSP00000434634:D874E;ENSP00000432131:D776E;ENSP00000436447:D840E;ENSP00000435405:D545E	ENSP00000260197:D1930E	D	+	3	2	SORL1	120995737	1.000000	0.71417	1.000000	0.80357	0.034000	0.12701	1.382000	0.34374	1.331000	0.45412	0.561000	0.74099	GAC	.		0.537	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
OR10S1	219873	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	123848074	123848074	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr11:123848074C>G	ENST00000531945.1	-	1	414	c.325G>C	c.(325-327)Gag>Cag	p.E109Q		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	109						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GCACAGCCCTCAAAGGAGATC	0.547																																					p.E109Q		.											.	OR10S1-70	0			c.G325C						.						90.0	70.0	77.0					11																	123848074		2202	4299	6501	SO:0001583	missense	219873	exon1			AGCCCTCAAAGGA	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.325G>C	11.37:g.123848074C>G	ENSP00000431914:p.Glu109Gln	140	0		103	12	NM_001004474	0	0	0	0	0	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	37	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	C	1.115	-0.657117	0.03480	.	.	ENSG00000196248	ENST00000531945	T	0.00402	7.56	4.53	0.263	0.15602	GPCR, rhodopsin-like superfamily (1);	1.503160	0.04716	N	0.418539	T	0.00241	0.0007	N	0.16708	0.43	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.36187	-0.9758	10	0.10377	T	0.69	-2.4621	7.4888	0.27449	0.0:0.3423:0.4905:0.1672	.	109	Q8NGN2	O10S1_HUMAN	Q	109	ENSP00000431914:E109Q	ENSP00000431914:E109Q	E	-	1	0	OR10S1	123353284	0.000000	0.05858	0.040000	0.18447	0.923000	0.55619	-3.059000	0.00624	-0.091000	0.12440	0.573000	0.79308	GAG	.		0.547	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474	
ABCD2	225	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	40012643	40012643	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr12:40012643G>T	ENST00000308666.3	-	1	910	c.775C>A	c.(775-777)Cta>Ata	p.L259I		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	259	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						AGTCCTGCTAGTAGGGTGGGC	0.448																																					p.L259I		.											.	ABCD2-95	0			c.C775A						.						117.0	115.0	115.0					12																	40012643		2203	4300	6503	SO:0001583	missense	225	exon1			CTGCTAGTAGGGT	U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.775C>A	12.37:g.40012643G>T	ENSP00000310688:p.Leu259Ile	192	1		259	85	NM_005164	0	0	0	0	0	B2RAM3|Q13210|Q2M3H9	Missense_Mutation	SNP	ENST00000308666.3	37	CCDS8734.1	.	.	.	.	.	.	.	.	.	.	G	0.570	-0.841375	0.02692	.	.	ENSG00000173208	ENST00000308666	D	0.91237	-2.81	5.51	-2.96	0.05547	ABC transporter, N-terminal (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.64402	D	0.000002	T	0.79986	0.4541	N	0.05414	-0.055	0.24864	N	0.992321	B	0.30526	0.283	B	0.38225	0.268	T	0.68682	-0.5344	9	.	.	.	-24.6613	14.1325	0.65263	0.2339:0.0:0.7661:0.0	.	259	Q9UBJ2	ABCD2_HUMAN	I	259	ENSP00000310688:L259I	.	L	-	1	2	ABCD2	38298910	0.531000	0.26338	0.259000	0.24435	0.880000	0.50808	0.773000	0.26661	-0.430000	0.07318	-1.193000	0.01689	CTA	.		0.448	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403591.1	NM_005164	
NDUFA12	55967	bcgsc.ca	37	12	95387985	95387985	+	Missense_Mutation	SNP	G	G	T	rs199506466		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr12:95387985G>T	ENST00000327772.2	-	3	307	c.218C>A	c.(217-219)aCa>aAa	p.T73K	NDUFA12_ENST00000547157.1_Intron|NDUFA12_ENST00000547986.1_Intron|NDUFA12_ENST00000550187.1_5'UTR	NM_018838.4	NP_061326.1	Q9UI09	NDUAC_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12	73					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|large_intestine(2)|lung(3)	6						ATCCCAGAATGTGTTTTTGCC	0.368																																					p.T73K		.											.	NDUFA12-90	0			c.C218A						.						126.0	112.0	117.0					12																	95387985		2203	4300	6503	SO:0001583	missense	55967	exon3			CAGAATGTGTTTT	BC005936	CCDS9050.1, CCDS58263.1	12q22	2011-07-04			ENSG00000184752	ENSG00000184752		"""Mitochondrial respiratory chain complex / Complex I"""	23987	protein-coding gene	gene with protein product	"""complex I B17.2 subunit"""	614530				10830904, 9827566	Standard	NM_018838		Approved	DAP13, B17.2	uc001tdl.4	Q9UI09		ENST00000327772.2:c.218C>A	12.37:g.95387985G>T	ENSP00000330737:p.Thr73Lys	65	0		79	5	NM_018838	0	0	160	160	0	F8VQS7|Q53XX0|Q9BRV6	Missense_Mutation	SNP	ENST00000327772.2	37	CCDS9050.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274570	0.40194	.	.	ENSG00000184752	ENST00000327772	T	0.42131	0.98	5.37	4.47	0.54385	.	0.089324	0.85682	D	0.000000	T	0.60508	0.2274	M	0.71581	2.175	0.80722	D	1	D	0.64830	0.994	D	0.64595	0.927	T	0.60115	-0.7326	10	0.30854	T	0.27	-11.7968	15.3884	0.74723	0.0:0.1402:0.8598:0.0	.	73	Q9UI09	NDUAC_HUMAN	K	73	ENSP00000330737:T73K	ENSP00000330737:T73K	T	-	2	0	NDUFA12	93912116	1.000000	0.71417	0.998000	0.56505	0.007000	0.05969	8.350000	0.90069	1.379000	0.46325	-0.314000	0.08810	ACA	G|1.000;A|0.000		0.368	NDUFA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407245.2	NM_018838	
FAM109A	144717	hgsc.bcm.edu	37	12	111800603	111800603	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr12:111800603C>T	ENST00000547838.2	-	2	726	c.629G>A	c.(628-630)cGc>cAc	p.R210H	FAM109A_ENST00000392658.5_Missense_Mutation_p.R210H|FAM109A_ENST00000548163.1_Missense_Mutation_p.R210H|FAM109A_ENST00000450786.2_Missense_Mutation_p.A191T|FAM109A_ENST00000361483.3_Missense_Mutation_p.R223H			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	210	Pro-rich.				endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|lung(1)|ovary(1)	4						CGAGGCCCGGCGGCGAGGCGG	0.736																																					p.R223H		.											.	FAM109A-90	0			c.G668A						.						5.0	3.0	4.0					12																	111800603		1529	2980	4509	SO:0001583	missense	144717	exon4			GCCCGGCGGCGAG	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.629G>A	12.37:g.111800603C>T	ENSP00000447353:p.Arg210His	0	0		21	13	NM_001177996	0	0	2	2	0	J3KP50|Q6PJL9|Q96MH8	Missense_Mutation	SNP	ENST00000547838.2	37	CCDS9152.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.109703|4.109703	0.77096|0.77096	.|.	.|.	ENSG00000198324|ENSG00000198324	ENST00000450786|ENST00000547838;ENST00000361483;ENST00000392658;ENST00000548163	.|T;T;T;T	.|0.40225	.|1.07;1.04;1.07;1.07	4.14|4.14	3.23|3.23	0.37069|0.37069	.|.	.|.	.|.	.|.	.|.	T|T	0.42787|0.42787	0.1218|0.1218	L|L	0.46157|0.46157	1.445|1.445	0.34173|0.34173	D|D	0.670073|0.670073	D|D;D	0.56521|0.67145	0.976|0.996;0.996	B|P;P	0.40477|0.50192	0.33|0.634;0.634	T|T	0.54768|0.54768	-0.8244|-0.8244	8|9	0.87932|0.39692	D|T	0|0.17	.|.	10.4944|10.4944	0.44768|0.44768	0.0:0.9065:0.0:0.0935|0.0:0.9065:0.0:0.0935	.|.	191|210;207	G3V0F1|Q8N4B1;B4DRN3	.|SESQ1_HUMAN;.	T|H	191|210;223;210;210	.|ENSP00000447353:R210H;ENSP00000354461:R223H;ENSP00000376426:R210H;ENSP00000449994:R210H	ENSP00000390552:A191T|ENSP00000354461:R223H	A|R	-|-	1|2	0|0	FAM109A|FAM109A	110284986|110284986	0.000000|0.000000	0.05858|0.05858	0.767000|0.767000	0.31495|0.31495	0.285000|0.285000	0.27093|0.27093	0.730000|0.730000	0.26043|0.26043	0.709000|0.709000	0.31976|0.31976	0.561000|0.561000	0.74099|0.74099	GCC|CGC	.		0.736	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404768.2	NM_144671	
TRAFD1	10906	bcgsc.ca	37	12	112590550	112590550	+	Silent	SNP	C	C	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr12:112590550C>G	ENST00000257604.5	+	12	2321	c.1704C>G	c.(1702-1704)tcC>tcG	p.S568S	TRAFD1_ENST00000412615.2_Silent_p.S568S	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	568					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						CAAAGCCTTCCAAGCAACAGG	0.493																																					p.S568S		.											.	TRAFD1-90	0			c.C1704G						.						145.0	135.0	138.0					12																	112590550		2203	4300	6503	SO:0001819	synonymous_variant	10906	exon12			GCCTTCCAAGCAA	AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.1704C>G	12.37:g.112590550C>G		84	0		109	5	NM_001143906	0	0	0	0	0	A8K5L6|B4DI89	Silent	SNP	ENST00000257604.5	37	CCDS9160.1																																																																																			.		0.493	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405214.1	NM_006700	
TMEM132C	92293	bcgsc.ca	37	12	129190266	129190266	+	Missense_Mutation	SNP	G	G	A	rs112818862	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr12:129190266G>A	ENST00000435159.2	+	9	2753	c.2753G>A	c.(2752-2754)cGg>cAg	p.R918Q	TMEM132C_ENST00000537538.1_Missense_Mutation_p.R303Q|TMEM132C_ENST00000315208.8_Missense_Mutation_p.R534Q	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	918						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CAGACTCCGCGGGGCCTGAGT	0.612													G|||	90	0.0179712	0.0	0.0029	5008	,	,		18120	0.0347		0.0149	False		,,,				2504	0.0389				p.R918Q		.											.	TMEM132C-68	0			c.G2753A						.	G	GLN/ARG	1,1383		0,1,691	18.0	26.0	23.0		2753	1.7	0.0	12	dbSNP_132	23	25,3157		0,25,1566	yes	missense	TMEM132C	NM_001136103.2	43	0,26,2257	AA,AG,GG		0.7857,0.0723,0.5694	probably-damaging	918/1109	129190266	26,4540	692	1591	2283	SO:0001583	missense	92293	exon9			CTCCGCGGGGCCT	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2753G>A	12.37:g.129190266G>A	ENSP00000410852:p.Arg918Gln	93	1		97	4	NM_001136103	0	0	2	2	0	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	37		27	0.012362637362637362	0	0.0	2	0.0055248618784530384	16	0.027972027972027972	9	0.011873350923482849	G	13.70	2.316102	0.40996	7.23E-4	0.007857	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.25085	1.82;1.82;1.82	4.62	1.73	0.24493	.	0.338213	0.22633	N	0.057558	T	0.09069	0.0224	L	0.48935	1.535	0.09310	N	1	D	0.54397	0.966	P	0.48815	0.591	T	0.04621	-1.0938	10	0.30854	T	0.27	.	7.3314	0.26584	0.3464:0.0:0.6536:0.0	.	918	Q8N3T6	T132C_HUMAN	Q	918;534;303	ENSP00000410852:R918Q;ENSP00000324458:R534Q;ENSP00000438477:R303Q	ENSP00000324458:R534Q	R	+	2	0	TMEM132C	127756219	0.033000	0.19621	0.004000	0.12327	0.298000	0.27526	2.211000	0.42825	0.372000	0.24591	0.655000	0.94253	CGG	A|0.013;C|0.000;G|0.987		0.612	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
RIMBP2	23504	hgsc.bcm.edu	37	12	130921471	130921471	+	Silent	SNP	T	T	C	rs2292663	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr12:130921471T>C	ENST00000261655.4	-	10	2134	c.1971A>G	c.(1969-1971)ccA>ccG	p.P657P	RIMBP2_ENST00000536002.1_Silent_p.P565P|RIMBP2_ENST00000535703.1_Silent_p.P565P	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	657	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CCTGTGGCTGTGGCAGGATGC	0.736													C|||	734	0.146565	0.1657	0.1599	5008	,	,		11830	0.256		0.1054	False		,,,				2504	0.0409				p.P657P		.											.	RIMBP2-142	0			c.A1971G						.	C		577,3799		41,495,1652	12.0	18.0	16.0		1971	-0.1	1.0	12	dbSNP_100	16	861,7691		48,765,3463	no	coding-synonymous	RIMBP2	NM_015347.4		89,1260,5115	CC,CT,TT		10.0678,13.1856,11.1231		657/1053	130921471	1438,11490	2188	4276	6464	SO:0001819	synonymous_variant	23504	exon10			TGGCTGTGGCAGG	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1971A>G	12.37:g.130921471T>C		0	0		34	14	NM_015347	0	0	1	1	0	Q96ID2	Silent	SNP	ENST00000261655.4	37	CCDS31925.1																																																																																			T|0.868;C|0.132		0.736	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399520.1	NM_015347	
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr13:50235160G>C	ENST00000242827.6	-	4	615	c.565C>G	c.(565-567)Cta>Gta	p.L189V	EBPL_ENST00000378284.2_3'UTR|EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000378270.5_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	189					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.L189V(9)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418																																					p.L189V	NSCLC(39;857 1083 36109 42364 51411)	.											.	EBPL-90	9	Substitution - Missense(9)	endometrium(6)|kidney(3)	c.C565G						.						67.0	67.0	67.0					13																	50235160		2203	4300	6503	SO:0001583	missense	84650	exon4			GTTCTAGCCATGA	AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.565C>G	13.37:g.50235160G>C	ENSP00000242827:p.Leu189Val	110	1		88	6	NM_032565	0	0	13	13	0	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	37	CCDS9420.1	.	.	.	.	.	.	.	.	.	.	C	3.076	-0.189988	0.06299	.	.	ENSG00000123179	ENST00000242827	D	0.97850	-4.57	5.61	2.84	0.33178	.	0.689671	0.14945	N	0.289287	D	0.88179	0.6367	N	0.00621	-1.32	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.79482	-0.1785	10	0.25751	T	0.34	-0.2032	8.3049	0.32036	0.0:0.4998:0.3595:0.1406	.	189	Q9BY08	EBPL_HUMAN	V	189	ENSP00000242827:L189V	ENSP00000242827:L189V	L	-	1	2	EBPL	49133161	0.000000	0.05858	0.303000	0.25071	0.899000	0.52679	-1.071000	0.03437	0.397000	0.25310	-0.127000	0.14921	CTA	.		0.418	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044932.2	NM_032565	
TMCO3	55002	bcgsc.ca	37	13	114156093	114156093	+	Silent	SNP	C	C	T	rs2260080	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr13:114156093C>T	ENST00000434316.2	+	5	1202	c.843C>T	c.(841-843)tcC>tcT	p.S281S	TMCO3_ENST00000474393.1_3'UTR|TMCO3_ENST00000375391.1_Silent_p.S281S	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	281						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)	p.S281S(1)		NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			GAATGCTGTCCTTGCCTTGTG	0.408													.|||	1207	0.241014	0.4107	0.147	5008	,	,		22189	0.2708		0.1581	False		,,,				2504	0.1329				p.S281S		.											.	TMCO3-90	1	Substitution - coding silent(1)	stomach(1)	c.C843T						.	C		1535,2871	486.2+/-360.5	264,1007,932	167.0	164.0	165.0		843	-3.1	0.1	13	dbSNP_100	165	1275,7325	252.3+/-278.5	90,1095,3115	no	coding-synonymous	TMCO3	NM_017905.4		354,2102,4047	TT,TC,CC		14.8256,34.8389,21.6054		281/678	114156093	2810,10196	2203	4300	6503	SO:0001819	synonymous_variant	55002	exon5			GCTGTCCTTGCCT	BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.843C>T	13.37:g.114156093C>T		106	0		74	5	NM_017905	0	0	1	1	0	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Silent	SNP	ENST00000434316.2	37	CCDS9537.1																																																																																			C|0.772;T|0.228		0.408	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045931.3	NM_017905	
ACIN1	22985	hgsc.bcm.edu	37	14	23548793	23548793	+	Missense_Mutation	SNP	C	C	T	rs80007670	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr14:23548793C>T	ENST00000262710.1	-	6	2252	c.1925G>A	c.(1924-1926)cGt>cAt	p.R642H	ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000555053.1_Missense_Mutation_p.R642H|ACIN1_ENST00000457657.1_Missense_Mutation_p.R602H|ACIN1_ENST00000605057.1_Missense_Mutation_p.R584H	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	642	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		AGAACGTGAACGTGACCTTGA	0.478																																					p.R642H		.											.	ACIN1-156	0			c.G1925A						.	C	HIS/ARG,HIS/ARG,HIS/ARG	6,4400	6.2+/-15.9	0,6,2197	258.0	226.0	237.0		1925,1805,1925	3.2	0.8	14	dbSNP_131	237	24,8576	11.9+/-42.8	0,24,4276	yes	missense,missense,missense	ACIN1	NM_001164814.1,NM_001164815.1,NM_014977.3	29,29,29	0,30,6473	TT,TC,CC		0.2791,0.1362,0.2307	probably-damaging,probably-damaging,probably-damaging	642/1329,602/1302,642/1342	23548793	30,12976	2203	4300	6503	SO:0001583	missense	22985	exon6			CGTGAACGTGACC	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1925G>A	14.37:g.23548793C>T	ENSP00000262710:p.Arg642His	202	0		148	8	NM_001164814	0	0	0	0	0	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	37	CCDS9587.1	9	0.004120879120879121	1	0.0020325203252032522	4	0.011049723756906077	0	0.0	4	0.005277044854881266	C	14.59	2.580077	0.46006	0.001362	0.002791	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.29917	2.39;1.55;2.39	5.05	3.18	0.36537	.	0.000000	0.40144	N	0.001165	T	0.20170	0.0485	L	0.27053	0.805	0.26413	N	0.976231	D;D;D	0.67145	0.992;0.986;0.996	P;P;P	0.51582	0.674;0.475;0.572	T	0.04440	-1.0951	10	0.59425	D	0.04	-4.3727	7.238	0.26079	0.0:0.7908:0.0:0.2092	.	642;642;602	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	H	642;602;642	ENSP00000262710:R642H;ENSP00000405677:R602H;ENSP00000451328:R642H	ENSP00000262710:R642H	R	-	2	0	ACIN1	22618633	0.984000	0.35163	0.847000	0.33407	0.542000	0.35054	0.703000	0.25646	0.669000	0.31146	-0.216000	0.12614	CGT	C|0.994;T|0.006		0.478	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
C14orf23	387978	broad.mit.edu	37	14	29261305	29261305	+	Frame_Shift_Del	DEL	A	A	-	rs202195469|rs200251419		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr14:29261305delA	ENST00000399387.4	+	3	446	c.342delA	c.(340-342)ctafs	p.L114fs	C14orf23_ENST00000548213.1_Intron|C14orf23_ENST00000550266.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						CTTCAGCACTAAAAAAAACAA	0.378																																					.		.											.	C14orf23-23	0			.						.																																			SO:0001589	frameshift_variant	387978	.			AGCACTAAAAAAA			14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	ENST00000399387.4:c.342delA	14.37:g.29261305delA	ENSP00000382318:p.Leu114fs	115	3		102	27	.	0	0	0	0	0		RNA	DEL	ENST00000399387.4	37																																																																																				-|0.667;AAC|0.333		0.378	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000134019.2	NR_026731	
DTD2	112487	broad.mit.edu	37	14	31926599	31926599	+	Start_Codon_SNP	SNP	T	T	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr14:31926599T>C	ENST00000310850.4	-	1	117	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	RP11-176H8.1_ENST00000547378.1_Start_Codon_SNP_p.M1V|DTD2_ENST00000356180.4_Start_Codon_SNP_p.M1V	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	1					D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)										CCCTCAGCCATGGCTTAAGCC	0.706																																					p.M1V		.											.	.	0			c.A1G						.						10.0	10.0	10.0					14																	31926599		2175	4263	6438	SO:0001582	initiator_codon_variant	112487	exon1			CAGCCATGGCTTA	BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.1A>G	14.37:g.31926599T>C	ENSP00000312224:p.Met1Val	22	0		171	11	NM_080664	0	0	1	1	0	D3DS87	Missense_Mutation	SNP	ENST00000310850.4	37	CCDS9643.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.175378	0.78564	.	.	ENSG00000203546;ENSG00000129480;ENSG00000129480	ENST00000547378;ENST00000310850;ENST00000356180	T;T;T	0.53206	0.63;0.96;0.96	4.7	3.53	0.40419	.	0.156761	0.53938	D	0.000060	T	0.65933	0.2739	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.68507	-0.5390	9	0.87932	D	0	-5.3285	10.8952	0.47019	0.0:0.0:0.1578:0.8422	.	1	Q96FN9	DTD2_HUMAN	V	1	ENSP00000447056:M1V;ENSP00000312224:M1V;ENSP00000348503:M1V	ENSP00000312224:M1V	M	-	1	0	C14orf126;RP11-176H8.1	30996350	1.000000	0.71417	0.954000	0.39281	0.079000	0.17450	4.522000	0.60539	0.802000	0.34089	0.459000	0.35465	ATG	.		0.706	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276614.2	NM_080664	Missense_Mutation
FMN1	342184	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	33149251	33149251	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr15:33149251G>T	ENST00000559047.1	-	14	3892	c.3893C>A	c.(3892-3894)cCt>cAt	p.P1298H	FMN1_ENST00000334528.9_Missense_Mutation_p.P1075H|FMN1_ENST00000561249.1_Missense_Mutation_p.P1200H			Q68DA7	FMN1_HUMAN	formin 1	1298	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GTCCTTGAAAGGCTGGAGATA	0.443																																					p.P1075H		.											.	FMN1-23	0			c.C3224A						.						125.0	127.0	126.0					15																	33149251		1943	4131	6074	SO:0001583	missense	342184	exon13			TTGAAAGGCTGGA	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.3893C>A	15.37:g.33149251G>T	ENSP00000454047:p.Pro1298His	126	0		79	15	NM_001103184	0	0	0	0	0	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	ENST00000559047.1	37		.	.	.	.	.	.	.	.	.	.	G	18.85	3.712299	0.68730	.	.	ENSG00000248905	ENST00000334528	T	0.17691	2.26	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.47600	0.1454	M	0.87547	2.89	0.19775	N	0.999955	D	0.89917	1.0	D	0.91635	0.999	T	0.60347	-0.7281	9	0.87932	D	0	.	15.2718	0.73708	0.0:0.0:1.0:0.0	.	1075	Q68DA7-5	.	H	1075	ENSP00000333950:P1075H	ENSP00000333950:P1075H	P	-	2	0	FMN1	30936543	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.038000	0.70964	2.664000	0.90586	0.650000	0.86243	CCT	.		0.443	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
PATL2	197135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	44964347	44964347	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr15:44964347C>A	ENST00000560775.1	-	6	582	c.523G>T	c.(523-525)Gcc>Tcc	p.A175S	PATL2_ENST00000560780.1_5'UTR|PATL2_ENST00000434130.1_Missense_Mutation_p.A175S|PATL2_ENST00000558573.1_5'Flank			C9JE40	PATL2_HUMAN	protein associated with topoisomerase II homolog 2 (yeast)	175					negative regulation of cytoplasmic mRNA processing body assembly (GO:0010607)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	RNA binding (GO:0003723)			kidney(2)|stomach(1)	3						GGCTTCTTGGCTGGGGGACTT	0.537																																					p.A175S		.											.	.	0			c.G523T						.						66.0	62.0	63.0					15																	44964347		687	1589	2276	SO:0001583	missense	197135	exon7			TCTTGGCTGGGGG	BC036924	CCDS45253.1	15q21.1	2010-06-04			ENSG00000229474	ENSG00000229474			33630	protein-coding gene	gene with protein product		614661				17936923	Standard	NM_001145112		Approved		uc010uej.2	C9JE40		ENST00000560775.1:c.523G>T	15.37:g.44964347C>A	ENSP00000453915:p.Ala175Ser	69	0		51	7	NM_001145112	0	0	0	0	0		Missense_Mutation	SNP	ENST00000560775.1	37	CCDS45253.1	.	.	.	.	.	.	.	.	.	.	C	10.50	1.367649	0.24771	.	.	ENSG00000229474	ENST00000434130	T	0.12984	2.63	5.66	4.69	0.59074	.	.	.	.	.	T	0.08223	0.0205	L	0.28115	0.83	0.09310	N	1	B	0.25850	0.136	B	0.24701	0.055	T	0.36768	-0.9734	9	0.07325	T	0.83	-17.4801	7.2656	0.26227	0.0:0.7398:0.172:0.0882	.	175	C9JE40	PATL2_HUMAN	S	175	ENSP00000416673:A175S	ENSP00000416673:A175S	A	-	1	0	PATL2	42751639	0.003000	0.15002	1.000000	0.80357	0.973000	0.67179	0.574000	0.23714	2.665000	0.90641	0.655000	0.94253	GCC	.		0.537	PATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415947.1	NM_001145112	
ADAMTS7	11173	ucsc.edu	37	15	79089111	79089111	+	Missense_Mutation	SNP	A	A	G	rs3825807	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr15:79089111A>G	ENST00000388820.4	-	4	850	c.640T>C	c.(640-642)Tct>Cct	p.S214P	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	214			S -> P (in dbSNP:rs3825807).		cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						tcccgtcgAGACTCCAGCTCT	0.657													G|||	1253	0.2502	0.1112	0.2968	5008	,	,		14046	0.1518		0.4274	False		,,,				2504	0.3241				p.S214P		.											.	ADAMTS7-226	0			c.T640C						.	G	PRO/SER	678,3714		57,564,1575	22.0	21.0	22.0	http://www.ncbi.nlm.nih.gov/pubmed?term	640	-9.0	0.0	15	dbSNP_107	22	3816,4762		878,2060,1351	yes	missense	ADAMTS7	NM_014272.3	74	935,2624,2926	GG,GA,AA	http://www.ncbi.nlm.nih.gov/pubmed?term	44.4859,15.4372,34.6492	benign	214/1687	79089111	4494,8476	2196	4289	6485	SO:0001583	missense	11173	exon4			GTCGAGACTCCAG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.640T>C	15.37:g.79089111A>G	ENSP00000373472:p.Ser214Pro	10	0		34	8	NM_014272	0	0	0	0	0	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	37	CCDS32303.1	584	0.2673992673992674	63	0.12804878048780488	123	0.3397790055248619	77	0.1346153846153846	321	0.4234828496042216	G	12.54	1.968180	0.34754	0.154372	0.444859	ENSG00000136378	ENST00000388820;ENST00000456326	T	0.60920	0.15	5.11	-8.98	0.00754	.	0.967066	0.08499	N	0.936716	T	0.00012	0.0000	N	0.00436	-1.5	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.40384	-0.9566	9	0.30078	T	0.28	.	2.7518	0.05283	0.5523:0.0989:0.1616:0.1872	rs3825807;rs57075956;rs3825807	214;214;214	E7EP58;A8MQ00;Q9UKP4	.;.;ATS7_HUMAN	P	214	ENSP00000373472:S214P	ENSP00000373472:S214P	S	-	1	0	ADAMTS7	76876166	0.000000	0.05858	0.000000	0.03702	0.354000	0.29330	-1.471000	0.02344	-1.596000	0.01611	-1.382000	0.01172	TCT	A|0.704;G|0.296		0.657	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
SLC28A1	9154	bcgsc.ca	37	15	85432030	85432030	+	Silent	SNP	T	T	C	rs17222302	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr15:85432030T>C	ENST00000286749.3	+	3	214	c.124T>C	c.(124-126)Ttg>Ctg	p.L42L	SLC28A1_ENST00000537624.1_Silent_p.L42L|SLC28A1_ENST00000537703.1_5'UTR|SLC28A1_ENST00000538177.1_Silent_p.L42L|SLC28A1_ENST00000537216.1_Silent_p.L42L|SLC28A1_ENST00000338602.2_Silent_p.L42L|SLC28A1_ENST00000394573.1_Silent_p.L42L			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	42					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	TAGGAGTGACTTGAGCCCCGC	0.667													T|||	37	0.00738818	0.0045	0.0115	5008	,	,		16707	0.0079		0.0149	False		,,,				2504	0.0				p.L42L		.											.	SLC28A1-93	0			c.T124C						.	T	,	17,4293		0,17,2138	20.0	19.0	19.0		124,124	-0.2	0.0	15	dbSNP_126	19	81,8365		0,81,4142	no	coding-synonymous,coding-synonymous	SLC28A1	NM_004213.3,NM_201651.1	,	0,98,6280	CC,CT,TT		0.959,0.3944,0.7683	,	42/650,42/176	85432030	98,12658	2155	4223	6378	SO:0001819	synonymous_variant	9154	exon4			AGTGACTTGAGCC	U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.124T>C	15.37:g.85432030T>C		62	0		75	4	NM_201651	0	0	0	0	0	A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Silent	SNP	ENST00000286749.3	37	CCDS10334.1																																																																																			T|0.991;C|0.009		0.667	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000308998.2		
ZNF598	90850	hgsc.bcm.edu	37	16	2059674	2059674	+	Missense_Mutation	SNP	T	T	C	rs71384660		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr16:2059674T>C	ENST00000431526.1	-	2	88	c.74A>G	c.(73-75)gAa>gGa	p.E25G	ZNF598_ENST00000563630.1_5'UTR|ZNF598_ENST00000562103.1_5'UTR	NM_178167.2	NP_835461.2	Q86UK7	ZN598_HUMAN	zinc finger protein 598	25							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						GCTCCCGCCTTCCCGCTCAGG	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		5162	1.0		1.0	False		,,,				2504	1.0				p.E25G		.											.	ZNF598-432	0			c.A74G						.						1.0	2.0	2.0					16																	2059674		1089	2314	3403	SO:0001583	missense	90850	exon2			CCGCCTTCCCGCT	BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000431526.1:c.74A>G	16.37:g.2059674T>C	ENSP00000411409:p.Glu25Gly	0	0		5	5	NM_178167	0	0	0	0	0	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	ENST00000431526.1	37		2168	0.9926739926739927	487	0.9898373983739838	361	0.9972375690607734	568	0.993006993006993	752	0.9920844327176781	N	1.560	-0.537056	0.04082	.	.	ENSG00000167962	ENST00000431526	T	0.77098	-1.07	3.3	3.3	0.37823	.	0.415485	0.23105	N	0.051871	T	0.00012	0.0000	.	.	.	0.48696	P	3.1000000000003247E-4	.	.	.	.	.	.	T	0.34650	-0.9820	6	0.22706	T	0.39	-7.8624	8.393	0.32540	0.0:0.8796:0.0:0.1204	.	.	.	.	G	25	ENSP00000411409:E25G	ENSP00000411409:E25G	E	-	2	0	ZNF598	1999675	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	0.911000	0.28584	0.691000	0.31592	-0.642000	0.03964	GAA	T|0.007;C|0.993		0.766	ZNF598-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178167	
MYLK3	91807	broad.mit.edu	37	16	46744683	46744683	+	Silent	SNP	T	T	G	rs200273306		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr16:46744683T>G	ENST00000394809.4	-	11	2248	c.2133A>C	c.(2131-2133)ccA>ccC	p.P711P	MYLK3_ENST00000562104.1_5'UTR|MYLK3_ENST00000536476.1_Silent_p.P370P	NM_182493.2	NP_872299.2	Q32MK0	MYLK3_HUMAN	myosin light chain kinase 3	711	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac myofibril assembly (GO:0055003)|cellular response to interleukin-1 (GO:0071347)|positive regulation of sarcomere organization (GO:0060298)|protein phosphorylation (GO:0006468)|regulation of vascular permeability involved in acute inflammatory response (GO:0002528)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(5)|stomach(3)	37		all_cancers(37;0.00023)|all_epithelial(9;0.000543)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				CCCCTAGAAATGGGGACAAGC	0.473																																					p.P711P		.											.	MYLK3-374	0			c.A2133C						.						81.0	90.0	87.0					16																	46744683		2203	4300	6503	SO:0001819	synonymous_variant	91807	exon11			TAGAAATGGGGAC	AJ247087	CCDS10723.2	16q11.2	2008-10-23			ENSG00000140795	ENSG00000140795			29826	protein-coding gene	gene with protein product	"""MLC kinase"""	612147				17885681	Standard	NM_182493		Approved	caMLCK, MLCK	uc002eei.4	Q32MK0	OTTHUMG00000132543	ENST00000394809.4:c.2133A>C	16.37:g.46744683T>G		73	8		58	9	NM_182493	0	0	0	0	0	B5BUL9|B7Z5U8|Q32MK1|Q96DV1	Silent	SNP	ENST00000394809.4	37	CCDS10723.2																																																																																			T|0.996;G|0.004		0.473	MYLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255743.2	NM_182493	
WWP2	11060	bcgsc.ca	37	16	69963355	69963355	+	Silent	SNP	G	G	A	rs1566452	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr16:69963355G>A	ENST00000359154.2	+	12	1340	c.1239G>A	c.(1237-1239)aaG>aaA	p.K413K	WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000448661.1_Silent_p.K413K|WWP2_ENST00000356003.2_Silent_p.K413K|WWP2_ENST00000542271.1_Silent_p.K297K|WWP2_ENST00000568684.1_5'UTR	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	413	WW 3. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						TGGCAGAGAAGAGACAGGACA	0.557													G|||	4282	0.855032	0.9455	0.7493	5008	,	,		17978	0.9683		0.7535	False		,,,				2504	0.7955				p.K413K		.											.	WWP2-658	0			c.G1239A						.	G	,	3933,463	777.5+/-414.2	1759,415,24	51.0	47.0	49.0		1239,	4.3	1.0	16	dbSNP_88	49	6376,2224	703.7+/-405.4	2379,1618,303	no	coding-synonymous,utr-5	WWP2	NM_007014.3,NM_199424.1	,	4138,2033,327	AA,AG,GG		25.8605,10.5323,20.6756	,	413/871,	69963355	10309,2687	2198	4300	6498	SO:0001819	synonymous_variant	11060	exon12			AGAGAAGAGACAG	BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.1239G>A	16.37:g.69963355G>A		265	1		224	8	NM_001270454	0	0	1	1	0	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Silent	SNP	ENST00000359154.2	37	CCDS10885.1																																																																																			A|0.812;C|0.000		0.557	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268954.1	NM_007014	
MTSS1L	92154	hgsc.bcm.edu	37	16	70698094	70698094	+	Missense_Mutation	SNP	G	G	A	rs77173170	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr16:70698094G>A	ENST00000338779.6	-	15	2004	c.1730C>T	c.(1729-1731)gCc>gTc	p.A577V	FLJ00418_ENST00000597002.1_5'UTR	NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	577					filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						GCTGGACAGGGCGCGGCGCAC	0.766													G|||	25	0.00499201	0.0	0.0029	5008	,	,		10718	0.0		0.0099	False		,,,				2504	0.0133				p.A577V		.											.	MTSS1L-68	0			c.C1730T						.	G	VAL/ALA	16,4360		0,16,2172	16.0	17.0	17.0		1730	4.4	1.0	16	dbSNP_131	17	89,8459		1,87,4186	no	missense	MTSS1L	NM_138383.2	64	1,103,6358	AA,AG,GG		1.0412,0.3656,0.8124	benign	577/748	70698094	105,12819	2188	4274	6462	SO:0001583	missense	92154	exon15			GACAGGGCGCGGC		CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.1730C>T	16.37:g.70698094G>A	ENSP00000341171:p.Ala577Val	1	0		9	9	NM_138383	0	0	0	7	7	A6NJI7|Q9BUA8	Missense_Mutation	SNP	ENST00000338779.6	37	CCDS32476.1	8	0.003663003663003663	0	0.0	1	0.0027624309392265192	0	0.0	7	0.009234828496042216	G	21.1	4.104706	0.77096	0.003656	0.010412	ENSG00000132613	ENST00000338779	T	0.31247	1.5	4.38	4.38	0.52667	.	0.173169	0.50627	D	0.000114	T	0.21468	0.0517	L	0.36672	1.1	0.43531	D	0.99581	B	0.22683	0.073	B	0.26094	0.066	T	0.07712	-1.0758	10	0.51188	T	0.08	-14.3388	16.5688	0.84606	0.0:0.0:1.0:0.0	.	577	Q765P7	MTSSL_HUMAN	V	577	ENSP00000341171:A577V	ENSP00000341171:A577V	A	-	2	0	MTSS1L	69255595	0.769000	0.28531	0.961000	0.40146	0.985000	0.73830	3.986000	0.56937	1.964000	0.57103	0.462000	0.41574	GCC	G|0.995;A|0.005		0.766	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434927.3	NM_138383	
PLCG2	5336	bcgsc.ca	37	16	81929527	81929527	+	Silent	SNP	C	C	G	rs13333716	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr16:81929527C>G	ENST00000359376.3	+	13	1402	c.1188C>G	c.(1186-1188)acC>acG	p.T396T		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	396	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						CCTTTGTTACCTCGAGGTCAG	0.547													C|||	224	0.0447284	0.0749	0.0403	5008	,	,		19718	0.002		0.0696	False		,,,				2504	0.0256				p.T396T		.											.	PLCG2-892	0			c.C1188G						.	C		300,3886		11,278,1804	170.0	180.0	177.0		1188	3.0	1.0	16	dbSNP_121	177	619,7837		19,581,3628	no	coding-synonymous	PLCG2	NM_002661.3		30,859,5432	GG,GC,CC		7.3202,7.1667,7.2694		396/1266	81929527	919,11723	2093	4228	6321	SO:0001819	synonymous_variant	5336	exon13			TGTTACCTCGAGG		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.1188C>G	16.37:g.81929527C>G		135	0		137	5	NM_002661	0	0	0	0	0	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Silent	SNP	ENST00000359376.3	37	CCDS42204.1																																																																																			C|0.936;G|0.064		0.547	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
DNAAF1	123872	bcgsc.ca	37	16	84203612	84203612	+	Missense_Mutation	SNP	A	A	G	rs17856705	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr16:84203612A>G	ENST00000378553.5	+	8	1302	c.1178A>G	c.(1177-1179)aAg>aGg	p.K393R	DNAAF1_ENST00000334315.5_Missense_Mutation_p.K393R|DNAAF1_ENST00000563818.1_3'UTR	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	393	Pro-rich.		K -> R (in dbSNP:rs17856705). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17974005}.		axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)	p.K393R(1)		NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						TGCCCGGAAAAGCCAAGTGGA	0.577													A|||	1608	0.321086	0.1853	0.4063	5008	,	,		18118	0.3403		0.4473	False		,,,				2504	0.2945				p.K393R		.											.	DNAAF1-73	1	Substitution - Missense(1)	stomach(1)	c.A1178G						.	A	ARG/LYS	991,3409	369.1+/-318.9	105,781,1314	61.0	67.0	65.0		1178	0.1	0.0	16	dbSNP_123	65	3932,4666	546.9+/-385.1	897,2138,1264	yes	missense	DNAAF1	NM_178452.4	26	1002,2919,2578	GG,GA,AA		45.7316,22.5227,37.8751	benign	393/726	84203612	4923,8075	2200	4299	6499	SO:0001583	missense	123872	exon8			CGGAAAAGCCAAG	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1178A>G	16.37:g.84203612A>G	ENSP00000367815:p.Lys393Arg	149	0		113	5	NM_178452	0	0	0	0	0	B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Missense_Mutation	SNP	ENST00000378553.5	37	CCDS10943.2	795	0.364010989010989	99	0.20121951219512196	145	0.4005524861878453	209	0.36538461538461536	342	0.45118733509234826	A	9.460	1.092818	0.20471	0.225227	0.457316	ENSG00000154099	ENST00000334315;ENST00000378553	T;T	0.34472	1.36;1.78	5.18	0.133	0.14766	.	1.732920	0.03435	N	0.208365	T	0.00012	0.0000	L	0.51422	1.61	0.80722	P	0.0	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.003	T	0.44682	-0.9312	9	0.18710	T	0.47	-2.2671	1.0174	0.01510	0.5219:0.1476:0.1697:0.1609	rs17856705;rs17856705	157;393	Q8NEP3-2;Q8NEP3	.;DAAF1_HUMAN	R	393	ENSP00000334593:K393R;ENSP00000367815:K393R	ENSP00000334593:K393R	K	+	2	0	DNAAF1	82761113	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.630000	0.24553	-0.189000	0.10482	-1.652000	0.00757	AAG	A|0.639;G|0.361		0.577	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250328.3	NM_178452	
JPH3	57338	hgsc.bcm.edu	37	16	87678021	87678021	+	Silent	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr16:87678021C>T	ENST00000284262.2	+	2	782	c.540C>T	c.(538-540)gaC>gaT	p.D180D		NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	180					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		TGCATCCCGACGCCTCTCCGG	0.697																																					p.D180D		.											.	JPH3-92	0			c.C540T						.						39.0	42.0	41.0					16																	87678021		2194	4296	6490	SO:0001819	synonymous_variant	57338	exon2			TCCCGACGCCTCT	AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	ENST00000284262.2:c.540C>T	16.37:g.87678021C>T		4	0		46	10	NM_020655	0	0	0	0	0	D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Silent	SNP	ENST00000284262.2	37	CCDS10962.1																																																																																			.		0.697	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269108.2		
MPRIP	23164	hgsc.bcm.edu	37	17	17062002	17062002	+	Missense_Mutation	SNP	C	C	T	rs190974068	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr17:17062002C>T	ENST00000341712.4	+	14	1732	c.1732C>T	c.(1732-1734)Cct>Tct	p.P578S	MPRIP_ENST00000444976.1_Missense_Mutation_p.P540S|MPRIP_ENST00000395804.3_Missense_Mutation_p.P578S|MPRIP_ENST00000395811.5_Missense_Mutation_p.P578S			Q6WCQ1	MPRIP_HUMAN	myosin phosphatase Rho interacting protein	578	Interaction with RHOA.			P -> S (in Ref. 1; AAQ63176). {ECO:0000305}.		actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	31						TGAGGCGGAGCCTGGGGAGCT	0.731													C|||	2	0.000399361	0.0	0.0	5008	,	,		14407	0.0		0.0	False		,,,				2504	0.002				p.P578S		.											.	MPRIP-90	0			c.C1732T						.	C	SER/PRO,SER/PRO	1,4337		0,1,2168	10.0	12.0	12.0		1732,1732	0.7	0.0	17		12	15,8431		0,15,4208	no	missense,missense	MPRIP	NM_015134.3,NM_201274.3	74,74	0,16,6376	TT,TC,CC		0.1776,0.0231,0.1252	,	578/1039,578/1026	17062002	16,12768	2169	4223	6392	SO:0001583	missense	23164	exon14			GCGGAGCCTGGGG	BC014102	CCDS32578.1, CCDS42268.1	17p11.2	2013-01-10			ENSG00000133030	ENSG00000133030		"""Pleckstrin homology (PH) domain containing"""	30321	protein-coding gene	gene with protein product	"""Rho interacting protein 3"""	612935				10048485	Standard	NM_201274		Approved	RHOIP3, M-RIP, p116Rip	uc002gqy.2	Q6WCQ1	OTTHUMG00000059276	ENST00000341712.4:c.1732C>T	17.37:g.17062002C>T	ENSP00000342379:p.Pro578Ser	0	0		18	6	NM_015134	0	0	4	4	0	Q3KQZ5|Q5FB94|Q6DHW2|Q7Z5Y2|Q8N390|Q96G40	Missense_Mutation	SNP	ENST00000341712.4	37	CCDS32578.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	1.418	-0.573734	0.03882	2.31E-4	0.001776	ENSG00000133030	ENST00000444976;ENST00000395811;ENST00000395804;ENST00000341712	T;T;T;T	0.22945	1.93;2.25;2.26;2.26	5.45	0.739	0.18324	.	.	.	.	.	T	0.17152	0.0412	L	0.40543	1.245	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.0	T	0.33292	-0.9874	9	0.19590	T	0.45	.	5.8487	0.18681	0.0:0.5417:0.1339:0.3244	.	578;578	Q6WCQ1-2;Q6WCQ1	.;MPRIP_HUMAN	S	540;578;578;578	ENSP00000400189:P540S;ENSP00000379156:P578S;ENSP00000379149:P578S;ENSP00000342379:P578S	ENSP00000342379:P578S	P	+	1	0	MPRIP	17002727	0.000000	0.05858	0.007000	0.13788	0.552000	0.35366	-0.642000	0.05427	-0.068000	0.12953	0.456000	0.33151	CCT	C|0.999;T|0.000		0.731	MPRIP-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131587.1	NM_015134	
SLC47A2	146802	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	19582079	19582079	+	Missense_Mutation	SNP	G	G	A	rs201004962		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr17:19582079G>A	ENST00000325411.5	-	17	1779	c.1729C>T	c.(1729-1731)Cgc>Tgc	p.R577C	SLC47A2_ENST00000463318.1_5'UTR|SLC47A2_ENST00000350657.5_Missense_Mutation_p.R555C	NM_152908.3	NP_690872.2	Q86VL8	S47A2_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 2	577					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antiporter activity (GO:0015297)|drug transmembrane transporter activity (GO:0015238)			endometrium(2)|kidney(3)|large_intestine(2)|lung(1)|ovary(1)	9	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)				Aciclovir(DB00787)	GCCCCACGGCGGATGACCAGC	0.587																																					p.R577C		.											.	SLC47A2-90	0			c.C1729T						.	G	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	54.0	51.0	52.0		1621,1729	2.0	0.0	17		52	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	SLC47A2	NM_001099646.1,NM_152908.3	180,180	0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308	probably-damaging,probably-damaging	541/567,577/603	19582079	4,13002	2203	4300	6503	SO:0001583	missense	146802	exon17			CACGGCGGATGAC	AB250364	CCDS11211.1, CCDS58530.1	17p11.2	2013-07-17	2013-07-17		ENSG00000180638	ENSG00000180638		"""Solute carriers"""	26439	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 2"""	609833				16996621, 16807400	Standard	NM_152908		Approved	FLJ31196, MATE2, MATE2-K	uc002gwf.4	Q86VL8	OTTHUMG00000059464	ENST00000325411.5:c.1729C>T	17.37:g.19582079G>A	ENSP00000326671:p.Arg577Cys	139	0		132	8	NM_152908	0	0	0	0	0	A0JBX9|A0P8Z7|Q63HJ9|Q8IV44|Q96NA1	Missense_Mutation	SNP	ENST00000325411.5	37	CCDS11211.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872148	0.51695	2.27E-4	3.49E-4	ENSG00000180638	ENST00000350657;ENST00000325411	T;T	0.37058	1.27;1.22	5.16	2.01	0.26516	.	0.064473	0.64402	N	0.000008	T	0.46288	0.1385	L	0.52126	1.63	0.22034	N	0.999407	D;D;D	0.89917	0.974;0.994;1.0	P;P;D	0.83275	0.89;0.724;0.996	T	0.28004	-1.0057	10	0.87932	D	0	-12.9926	4.1946	0.10437	0.2551:0.0:0.583:0.162	.	541;555;577	Q86VL8-3;Q86VL8-4;Q86VL8	.;.;S47A2_HUMAN	C	555;577	ENSP00000338084:R555C;ENSP00000326671:R577C	ENSP00000326671:R577C	R	-	1	0	SLC47A2	19522671	1.000000	0.71417	0.004000	0.12327	0.648000	0.38561	4.047000	0.57383	0.177000	0.19895	-0.471000	0.05019	CGC	.		0.587	SLC47A2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000132242.2	NM_152908	
ENPP7	339221	bcgsc.ca	37	17	77709339	77709339	+	Silent	SNP	C	C	G	rs11657217	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr17:77709339C>G	ENST00000328313.5	+	3	1118	c.897C>G	c.(895-897)gcC>gcG	p.A299A		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TGTACGATGCCCTCAAGGACG	0.592													G|||	1599	0.319289	0.4864	0.2435	5008	,	,		5034	0.1101		0.2942	False		,,,				2504	0.3885				p.A299A		.											.	ENPP7-92	0			c.C897G						.	G		2062,2344	607.3+/-390.9	479,1104,620	94.0	76.0	82.0		897	-0.9	0.0	17	dbSNP_120	82	2625,5975	686.6+/-404.1	414,1797,2089	no	coding-synonymous	ENPP7	NM_178543.3		893,2901,2709	GG,GC,CC		30.5233,46.7998,36.0372		299/459	77709339	4687,8319	2203	4300	6503	SO:0001819	synonymous_variant	339221	exon3			CGATGCCCTCAAG	AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.897C>G	17.37:g.77709339C>G		169	0		128	5	NM_178543	0	0	0	0	0		Silent	SNP	ENST00000328313.5	37	CCDS11763.1																																																																																			C|0.673;G|0.327		0.592	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437038.1	NM_178543	
OGFOD3	79701	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	80361861	80361861	+	Silent	SNP	C	C	T	rs200973304		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr17:80361861C>T	ENST00000313056.5	-	7	802	c.651G>A	c.(649-651)acG>acA	p.T217T	RP13-20L14.4_ENST00000579188.1_RNA|OGFOD3_ENST00000329197.5_Silent_p.T217T	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	217	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										TCCGCGCTTCCGTGCTGTTTA	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		18921	0.0		0.001	False		,,,				2504	0.0				p.T217T		.											.	.	0			c.G651A						.						98.0	74.0	82.0					17																	80361861		2203	4299	6502	SO:0001819	synonymous_variant	79701	exon7			CGCTTCCGTGCTG	BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.651G>A	17.37:g.80361861C>T		62	0		105	8	NM_175902	0	0	32	42	10	C9JDC8|Q8IZ37|Q9H6J2	Silent	SNP	ENST00000313056.5	37	CCDS11811.1																																																																																			C|0.999;T|0.000		0.637	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442895.1	NM_175902	
LAMA1	284217	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	18	7013829	7013829	+	Silent	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr18:7013829C>T	ENST00000389658.3	-	23	3441	c.3348G>A	c.(3346-3348)ggG>ggA	p.G1116G		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1116	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AAGGGCAGGCCCCGGTTTCCT	0.577																																					p.G1116G		.											.	LAMA1-149	0			c.G3348A						.						63.0	66.0	65.0					18																	7013829		2203	4300	6503	SO:0001819	synonymous_variant	284217	exon23			GCAGGCCCCGGTT	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3348G>A	18.37:g.7013829C>T		214	0		174	13	NM_005559	0	0	0	0	0		Silent	SNP	ENST00000389658.3	37	CCDS32787.1																																																																																			.		0.577	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
RAX	30062	hgsc.bcm.edu	37	18	56940307	56940307	+	Missense_Mutation	SNP	G	G	T	rs2271733	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr18:56940307G>T	ENST00000334889.3	-	1	318	c.132C>A	c.(130-132)gaC>gaA	p.D44E	RAX_ENST00000256852.7_Missense_Mutation_p.D44E	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	44			D -> E (in dbSNP:rs2271733). {ECO:0000269|PubMed:14662654}.		camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		GGATCCCGTCGTCCTTGGTAA	0.746													G|||	980	0.195687	0.1452	0.1571	5008	,	,		10556	0.128		0.3002	False		,,,				2504	0.2536				p.D44E	GBM(150;770 1898 17679 24325 37807)	.											.	RAX-90	0			c.C132A						.	G	GLU/ASP	490,2640		39,412,1114	11.0	9.0	10.0		132	0.1	1.0	18	dbSNP_100	10	1484,4096		212,1060,1518	yes	missense	RAX	NM_013435.2	45	251,1472,2632	TT,TG,GG		26.595,15.655,22.6636	benign	44/347	56940307	1974,6736	1565	2790	4355	SO:0001583	missense	30062	exon1			CCCGTCGTCCTTG	AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.132C>A	18.37:g.56940307G>T	ENSP00000334813:p.Asp44Glu	0	0		4	4	NM_013435	0	0	0	0	0	Q86V11	Missense_Mutation	SNP	ENST00000334889.3	37	CCDS11972.1	453	0.20741758241758243	75	0.1524390243902439	69	0.19060773480662985	76	0.13286713286713286	233	0.3073878627968338	G	12.43	1.936984	0.34189	0.15655	0.26595	ENSG00000134438	ENST00000256852;ENST00000334889;ENST00000555288	T;D;T	0.87966	0.09;-2.32;0.09	5.56	0.117	0.14652	.	0.213892	0.50627	N	0.000107	T	0.00012	0.0000	N	0.12182	0.205	0.42455	P	0.0072349999999999914	B;B	0.22800	0.075;0.004	B;B	0.23574	0.047;0.009	T	0.06481	-1.0824	9	0.06365	T	0.9	.	0.4639	0.00520	0.2353:0.2064:0.3162:0.2421	rs2271733;rs58469971;rs2271733	44;44	Q86V11;Q9Y2V3	.;RX_HUMAN	E	44	ENSP00000256852:D44E;ENSP00000334813:D44E;ENSP00000450583:D44E	ENSP00000256852:D44E	D	-	3	2	RAX	55091287	0.002000	0.14202	0.999000	0.59377	0.992000	0.81027	-0.819000	0.04462	0.271000	0.22005	0.561000	0.74099	GAC	G|0.801;T|0.199		0.746	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256128.2		
CNDP2	55748	bcgsc.ca	37	18	72178161	72178161	+	Silent	SNP	T	T	C	rs2278159	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr18:72178161T>C	ENST00000324262.4	+	6	886	c.570T>C	c.(568-570)taT>taC	p.Y190Y	CNDP2_ENST00000579847.1_Silent_p.Y190Y|CNDP2_ENST00000324301.8_Silent_p.Y106Y	NM_018235.2	NP_060705.2	Q96KP4	CNDP2_HUMAN	CNDP dipeptidase 2 (metallopeptidase M20 family)	190					cellular nitrogen compound metabolic process (GO:0034641)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)	p.Y190Y(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(5)|ovary(2)|skin(2)|stomach(3)	24		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.22)		ATGTGGACTATGTCTGCATTT	0.507													T|||	1013	0.202276	0.0779	0.3026	5008	,	,		23053	0.2986		0.162	False		,,,				2504	0.2413				p.Y190Y		.											.	CNDP2-93	1	Substitution - coding silent(1)	stomach(1)	c.T570C						.	T	,	493,3913	230.4+/-244.6	34,425,1744	146.0	127.0	134.0		318,570	1.8	0.9	18	dbSNP_100	134	1634,6966	303.4+/-306.4	133,1368,2799	no	coding-synonymous,coding-synonymous	CNDP2	NM_001168499.1,NM_018235.2	,	167,1793,4543	CC,CT,TT		19.0,11.1893,16.354	,	106/392,190/476	72178161	2127,10879	2203	4300	6503	SO:0001819	synonymous_variant	55748	exon6			GGACTATGTCTGC	AK001692	CCDS12006.1, CCDS54190.1	18q22.3	2014-07-14	2004-07-12		ENSG00000133313	ENSG00000133313	3.4.13.18		24437	protein-coding gene	gene with protein product	"""cytosolic nonspecific dipeptidase"""	169800	"""peptidase A"""	PEPA		12473676	Standard	NM_018235		Approved	FLJ10830, CN2, HsT2298, CPGL	uc002llm.2	Q96KP4	OTTHUMG00000132853	ENST00000324262.4:c.570T>C	18.37:g.72178161T>C		225	1		195	8	NM_018235	0	0	6	6	0	B3KUG4|Q8WY59|Q9BQ94|Q9NVB4	Silent	SNP	ENST00000324262.4	37	CCDS12006.1																																																																																			T|0.825;C|0.175		0.507	CNDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256327.1	NM_018235	
CNDP1	84735	bcgsc.ca	37	18	72234635	72234635	+	Silent	SNP	C	C	T	rs12960862	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr18:72234635C>T	ENST00000358821.3	+	6	951	c.723C>T	c.(721-723)taC>taT	p.Y241Y	CNDP1_ENST00000582365.1_Silent_p.Y198Y	NM_032649.5	NP_116038	Q96KN2	CNDP1_HUMAN	carnosine dipeptidase 1 (metallopeptidase M20 family)	241						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|tripeptidase activity (GO:0034701)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27		Esophageal squamous(42;0.129)|Prostate(75;0.157)|Melanoma(33;0.211)		BRCA - Breast invasive adenocarcinoma(31;0.109)		CAATCACTTACGGAACCCGGG	0.493													C|||	2276	0.454473	0.2852	0.4856	5008	,	,		17870	0.4008		0.671	False		,,,				2504	0.4939				p.Y241Y	Melanoma(32;1029 1042 25286 38395 44237)	.											.	CNDP1-90	0			c.C723T						.	C		1625,2781	499.3+/-364.4	307,1011,885	95.0	93.0	94.0		723	-5.6	0.0	18	dbSNP_121	94	5730,2870	672.9+/-403.0	1907,1916,477	no	coding-synonymous	CNDP1	NM_032649.5		2214,2927,1362	TT,TC,CC		33.3721,36.8815,43.4492		241/508	72234635	7355,5651	2203	4300	6503	SO:0001819	synonymous_variant	84735	exon6			CACTTACGGAACC		CCDS12007.1	18q22.3	2014-07-14			ENSG00000150656	ENSG00000150656	3.4.13.20		20675	protein-coding gene	gene with protein product	"""carnosinase 1"", ""glutamate carboxypeptidase-like protein 2"""	609064				12473676	Standard	NM_032649		Approved	MGC10825, CN1, CPGL2, HsT2308	uc002llq.3	Q96KN2	OTTHUMG00000132852	ENST00000358821.3:c.723C>T	18.37:g.72234635C>T		165	0		177	8	NM_032649	0	0	0	0	0	Q14D40|Q17S05|Q2TBG0|Q6UWK2|Q9BT98	Silent	SNP	ENST00000358821.3	37	CCDS12007.1																																																																																			C|0.481;T|0.519		0.493	CNDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256326.1	NM_032649	
SALL3	27164	hgsc.bcm.edu	37	18	76753067	76753067	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr18:76753067C>G	ENST00000537592.2	+	2	1076	c.1076C>G	c.(1075-1077)cCa>cGa	p.P359R	SALL3_ENST00000536229.3_Missense_Mutation_p.P226R|SALL3_ENST00000575389.2_Missense_Mutation_p.P359R	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	359					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCCGGCCTGCCAAGTCCGCTT	0.741																																					p.P359R		.											.	SALL3-155	0			c.C1076G						.						11.0	12.0	12.0					18																	76753067		2164	4257	6421	SO:0001583	missense	27164	exon2			GCCTGCCAAGTCC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1076C>G	18.37:g.76753067C>G	ENSP00000441823:p.Pro359Arg	2	0		40	10	NM_171999	0	0	0	0	0	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	37	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	C	9.151	1.016350	0.19355	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T;T	0.10860	2.87;2.83	4.37	4.37	0.52481	.	0.000000	0.56097	D	0.000035	T	0.35624	0.0938	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	T	0.33033	-0.9884	10	0.56958	D	0.05	-13.1988	17.1219	0.86704	0.0:1.0:0.0:0.0	.	359	Q9BXA9	SALL3_HUMAN	R	359;359;91	ENSP00000441823:P359R;ENSP00000439975:P359R	ENSP00000299466:P359R	P	+	2	0	SALL3	74854055	1.000000	0.71417	0.990000	0.47175	0.029000	0.11900	3.668000	0.54554	2.269000	0.75478	0.460000	0.39030	CCA	.		0.741	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
MADCAM1	8174	ucsc.edu;bcgsc.ca	37	19	501762	501762	+	Missense_Mutation	SNP	A	A	C	rs200007467		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:501762A>C	ENST00000215637.3	+	4	807	c.761A>C	c.(760-762)cAg>cCg	p.Q254P	MADCAM1_ENST00000587541.1_Missense_Mutation_p.Q35P|AC005775.2_ENST00000592413.1_RNA|MADCAM1_ENST00000346144.4_Intron|MADCAM1_ENST00000382683.4_Intron	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	254	5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|Mucin-like.			Q -> P (in Ref. 1; AAC13661). {ECO:0000305}.	aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)	p.Q254P(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCACCTCCCAGGAGCCTCCC	0.721																																					p.Q254P		.											.	MADCAM1-90	1	Substitution - Missense(1)	kidney(1)	c.A761C						.						31.0	36.0	34.0					19																	501762		2194	4290	6484	SO:0001583	missense	8174	exon4			CCTCCCAGGAGCC	U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.761A>C	19.37:g.501762A>C	ENSP00000215637:p.Gln254Pro	58	0		160	24	NM_130760	0	0	0	0	0	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	ENST00000215637.3	37	CCDS12028.1	.	.	.	.	.	.	.	.	.	.	N	5.739	0.320845	0.10845	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637	T	0.09073	3.02	2.86	-5.72	0.02406	.	.	.	.	.	T	0.01940	0.0061	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40869	-0.9540	9	0.02654	T	1	.	3.6031	0.08032	0.3032:0.5048:0.0:0.192	.	254	Q13477	MADCA_HUMAN	P	278;270;262;254	ENSP00000215637:Q254P	ENSP00000215637:Q254P	Q	+	2	0	MADCAM1	452762	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.356000	0.00247	-1.159000	0.02807	-1.988000	0.00451	CAG	.		0.721	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451884.1	NM_130760	
POLRMT	5442	hgsc.bcm.edu	37	19	621561	621561	+	Missense_Mutation	SNP	C	C	A	rs10421235	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:621561C>A	ENST00000588649.2	-	10	2221	c.2137G>T	c.(2137-2139)Gtg>Ttg	p.V713L	LLNLR-299G3.1_ENST00000607288.1_RNA	NM_005035.3	NP_005026.3	O00411	RPOM_HUMAN	polymerase (RNA) mitochondrial (DNA directed)	713					gene expression (GO:0010467)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)|prostate(1)|stomach(1)	20		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTCCAGCACGCGCCCGTTG	0.741													C|||	677	0.135184	0.2254	0.0461	5008	,	,		10089	0.0764		0.0258	False		,,,				2504	0.2495				p.V713L		.											.	POLRMT-92	0			c.G2137T						.	C	LEU/VAL	447,3185		14,419,1383	4.0	3.0	3.0		2137	2.1	0.5	19	dbSNP_119	3	143,6993		2,139,3427	no	missense	POLRMT	NM_005035.3	32	16,558,4810	AA,AC,CC		2.0039,12.3073,5.4792	benign	713/1231	621561	590,10178	1816	3568	5384	SO:0001583	missense	5442	exon10			CCAGCACGCGCCC		CCDS12036.1	19p13.3	2010-10-22			ENSG00000099821	ENSG00000099821	2.7.7.6		9200	protein-coding gene	gene with protein product		601778				9097968	Standard	NM_005035		Approved	h-mtRPOL, APOLMT, MTRNAP, MTRPOL	uc002lpf.1	O00411		ENST00000588649.2:c.2137G>T	19.37:g.621561C>A	ENSP00000465759:p.Val713Leu	0	0		20	12	NM_005035	0	0	2	2	0	O60370	Missense_Mutation	SNP	ENST00000588649.2	37	CCDS12036.1	179	0.08195970695970696	98	0.1991869918699187	23	0.06353591160220995	41	0.07167832167832168	17	0.022427440633245383	.	1.831	-0.469877	0.04445	0.123073	0.020039	ENSG00000099821	ENST00000215591	T	0.41400	1.0	4.38	2.07	0.26955	DNA-directed RNA polymerase, helix hairpin domain (1);	0.337088	0.28971	N	0.013545	T	0.00039	0.0001	L	0.28274	0.84	0.40284	P	0.021571000000000007	B	0.21520	0.057	B	0.21708	0.036	T	0.23226	-1.0194	9	0.10636	T	0.68	-21.1616	7.9361	0.29931	0.0:0.4845:0.4232:0.0923	rs10421235	713	O00411	RPOM_HUMAN	L	713	ENSP00000215591:V713L	ENSP00000215591:V713L	V	-	1	0	POLRMT	572561	0.015000	0.18098	0.490000	0.27465	0.466000	0.32739	0.069000	0.14552	0.409000	0.25649	0.455000	0.32223	GTG	C|0.918;A|0.082		0.741	POLRMT-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452172.3	NM_005035	
XAB2	56949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7689283	7689283	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:7689283C>T	ENST00000358368.4	-	7	908	c.871G>A	c.(871-873)Gac>Aac	p.D291N	XAB2_ENST00000534844.1_Missense_Mutation_p.D288N	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	291					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						TGTGTGAAGTCCCGCACGGTC	0.637								Direct reversal of damage;Nucleotide excision repair (NER)																													p.D291N		.											.	XAB2-272	0			c.G871A						.						140.0	110.0	120.0					19																	7689283		2203	4300	6503	SO:0001583	missense	56949	exon7			TGAAGTCCCGCAC	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.871G>A	19.37:g.7689283C>T	ENSP00000351137:p.Asp291Asn	109	0		141	9	NM_020196	0	0	9	11	2	Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	ENST00000358368.4	37	CCDS32892.1	.	.	.	.	.	.	.	.	.	.	C	35	5.464791	0.96257	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.33438	1.41;1.41	4.1	4.1	0.47936	.	0.067844	0.56097	D	0.000021	T	0.63402	0.2508	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.74281	-0.3716	10	0.87932	D	0	-39.1188	15.2759	0.73742	0.0:1.0:0.0:0.0	.	291	Q9HCS7	SYF1_HUMAN	N	291;288	ENSP00000351137:D291N;ENSP00000438225:D288N	ENSP00000351137:D291N	D	-	1	0	XAB2	7595283	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.580000	0.67464	2.128000	0.65567	0.491000	0.48974	GAC	.		0.637	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461021.1	NM_020196	
KLF1	10661	hgsc.bcm.edu;broad.mit.edu;ucsc.edu	37	19	12996235	12996235	+	Missense_Mutation	SNP	G	G	A	rs558942739		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:12996235G>A	ENST00000264834.4	-	2	849	c.809C>T	c.(808-810)tCg>tTg	p.S270L	CTD-2265O21.7_ENST00000592400.1_RNA	NM_006563.3	NP_006554.1	Q13351	KLF1_HUMAN	Kruppel-like factor 1 (erythroid)	270					cellular response to peptide (GO:1901653)|chromatin remodeling (GO:0006338)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|large_intestine(1)|skin(1)	5		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCGCCCACGAACGTCGGCC	0.672																																					p.S270L		.											.	KLF1-90	0			c.C809T						.						14.0	13.0	14.0					19																	12996235		2200	4296	6496	SO:0001583	missense	10661	exon2			GCCCACGAACGTC	U37106	CCDS12285.1	19p13.2	2014-07-18			ENSG00000105610	ENSG00000105610		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6345	protein-coding gene	gene with protein product	"""erythroid Kruppel-like factor"""	600599				8924208, 9119377	Standard	NM_006563		Approved	EKLF	uc002mvo.3	Q13351	OTTHUMG00000180536	ENST00000264834.4:c.809C>T	19.37:g.12996235G>A	ENSP00000264834:p.Ser270Leu	10	0		142	21	NM_006563	0	0	0	0	0	Q6PIJ5|Q92899	Missense_Mutation	SNP	ENST00000264834.4	37	CCDS12285.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.431753	0.83776	.	.	ENSG00000105610	ENST00000264834	T	0.12672	2.66	4.25	4.25	0.50352	.	0.207319	0.24504	N	0.037945	T	0.13329	0.0323	L	0.59436	1.845	0.26639	N	0.972326	P	0.42757	0.789	B	0.36092	0.217	T	0.19582	-1.0301	10	0.66056	D	0.02	.	9.4263	0.38581	0.0:0.0:0.788:0.212	.	270	Q13351	KLF1_HUMAN	L	270	ENSP00000264834:S270L	ENSP00000264834:S270L	S	-	2	0	KLF1	12857235	0.766000	0.28496	0.960000	0.40013	0.832000	0.47134	4.250000	0.58772	2.199000	0.70637	0.561000	0.74099	TCG	.		0.672	KLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451794.1	NM_006563	
OCEL1	79629	hgsc.bcm.edu	37	19	17337557	17337557	+	Missense_Mutation	SNP	G	G	T	rs10425488	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:17337557G>T	ENST00000215061.4	+	2	169	c.125G>T	c.(124-126)cGc>cTc	p.R42L	OCEL1_ENST00000597836.1_5'UTR|OCEL1_ENST00000601529.1_Missense_Mutation_p.R42L|OCEL1_ENST00000601576.1_3'UTR	NM_024578.1	NP_078854.1	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	42	Pro-rich.		R -> L (in dbSNP:rs10425488).							central_nervous_system(2)|endometrium(2)|kidney(1)|lung(2)	7						CGCAGGACCCGCCCATCAGCC	0.746													G|||	385	0.076877	0.115	0.0836	5008	,	,		10155	0.001		0.0755	False		,,,				2504	0.1002				p.R42L		.											.	OCEL1-68	0			c.G125T						.	G	LEU/ARG	300,3398		14,272,1563	4.0	6.0	6.0		125	3.0	0.1	19	dbSNP_119	6	480,6968		14,452,3258	no	missense	OCEL1	NM_024578.1	102	28,724,4821	TT,TG,GG		6.4447,8.1125,6.998	possibly-damaging	42/265	17337557	780,10366	1849	3724	5573	SO:0001583	missense	79629	exon2			GGACCCGCCCATC	BC029361	CCDS12351.1	19p13.11	2008-02-05				ENSG00000099330			26221	protein-coding gene	gene with protein product						12477932	Standard	NM_024578		Approved	FLJ22709	uc002nfp.3	Q9H607		ENST00000215061.4:c.125G>T	19.37:g.17337557G>T	ENSP00000215061:p.Arg42Leu	0	0		13	9	NM_024578	0	0	3	5	2		Missense_Mutation	SNP	ENST00000215061.4	37	CCDS12351.1	142	0.06501831501831502	54	0.10975609756097561	30	0.08287292817679558	0	0.0	58	0.07651715039577836	G	16.23	3.063736	0.55432	0.081125	0.064447	ENSG00000099330	ENST00000215061	T	0.32988	1.43	3.01	3.01	0.34805	.	0.596543	0.14714	N	0.302724	T	0.00666	0.0022	N	0.19112	0.55	0.80722	P	0.0	D	0.76494	0.999	D	0.79108	0.992	T	0.04855	-1.0922	9	0.39692	T	0.17	-18.151	6.1073	0.20081	0.1412:0.0:0.8588:0.0	rs10425488	42	Q9H607	OCEL1_HUMAN	L	42	ENSP00000215061:R42L	ENSP00000215061:R42L	R	+	2	0	OCEL1	17198557	0.003000	0.15002	0.067000	0.19924	0.403000	0.30841	0.226000	0.17776	2.001000	0.58596	0.491000	0.48974	CGC	G|0.934;T|0.066		0.746	OCEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463307.1	NM_024578	
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		0	0		9	9	NM_012088	0	0	0	12	12		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
MAP1S	55201	hgsc.bcm.edu	37	19	17837425	17837425	+	Missense_Mutation	SNP	C	C	G	rs17710707	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:17837425C>G	ENST00000324096.4	+	5	1383	c.1232C>G	c.(1231-1233)tCt>tGt	p.S411C	CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Missense_Mutation_p.S385C|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	411	Necessary for the microtubule-organizing center localization.		S -> C (in dbSNP:rs17710707). {ECO:0000269|PubMed:15489334}.		apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						ACGCTGGCCTCTGTGTGCGCC	0.731													C|||	574	0.114617	0.0832	0.1772	5008	,	,		12607	0.0169		0.2068	False		,,,				2504	0.1186				p.S411C		.											.	MAP1S-90	0			c.C1232G						.	C	CYS/SER	344,3714		17,310,1702	5.0	5.0	5.0		1232	2.6	0.2	19	dbSNP_123	5	1234,6710		91,1052,2829	no	missense	MAP1S	NM_018174.4	112	108,1362,4531	GG,GC,CC		15.5337,8.4771,13.1478	probably-damaging	411/1060	17837425	1578,10424	2029	3972	6001	SO:0001583	missense	55201	exon5			TGGCCTCTGTGTG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1232C>G	19.37:g.17837425C>G	ENSP00000325313:p.Ser411Cys	0	0		12	6	NM_018174	0	0	1	3	2	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	257	0.11767399267399267	34	0.06910569105691057	66	0.18232044198895028	7	0.012237762237762238	150	0.19788918205804748	C	15.12	2.738952	0.49045	0.084771	0.155337	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.03801	3.8;3.8	3.67	2.61	0.31194	.	0.155772	0.30277	N	0.009981	T	0.00012	0.0000	M	0.79614	2.46	0.09310	P	0.99999454915	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.06006	-1.0851	9	0.87932	D	0	-16.5051	8.9574	0.35827	0.0:0.8847:0.0:0.1153	rs17710707	385;411	B4DH53;Q66K74	.;MAP1S_HUMAN	C	411;385	ENSP00000325313:S411C;ENSP00000439243:S385C	ENSP00000325313:S411C	S	+	2	0	MAP1S	17698425	0.998000	0.40836	0.209000	0.23619	0.382000	0.30200	7.628000	0.83189	0.516000	0.28340	-0.291000	0.09656	TCT	C|0.883;G|0.117		0.731	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
LGI4	163175	hgsc.bcm.edu	37	19	35622449	35622449	+	Missense_Mutation	SNP	C	C	A	rs556580869		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:35622449C>A	ENST00000310123.3	-	6	988	c.469G>T	c.(469-471)Ggg>Tgg	p.G157W	LGI4_ENST00000493050.1_5'UTR|LGI4_ENST00000392225.3_Missense_Mutation_p.G157W|LGI4_ENST00000591633.1_Missense_Mutation_p.G157W	NM_139284.2	NP_644813.1	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	157					adult locomotory behavior (GO:0008344)|glial cell proliferation (GO:0014009)|myelination in peripheral nervous system (GO:0022011)|neuron maturation (GO:0042551)	extracellular space (GO:0005615)				endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			AACGGGTTCCCGCGGAGGTCC	0.721																																					p.G157W		.											.	LGI4-91	0			c.G469T						.						11.0	10.0	10.0					19																	35622449		1942	3711	5653	SO:0001583	missense	163175	exon6			GGTTCCCGCGGAG	AJ487519	CCDS12444.1	19q13.13	2008-07-03			ENSG00000153902	ENSG00000153902			18712	protein-coding gene	gene with protein product		608303				12023020	Standard	NM_139284		Approved		uc002nxx.2	Q8N135	OTTHUMG00000044558	ENST00000310123.3:c.469G>T	19.37:g.35622449C>A	ENSP00000312273:p.Gly157Trp	7	0		93	15	NM_139284	0	0	0	0	0	B2RN53|B9EGS7|Q5M8T1	Missense_Mutation	SNP	ENST00000310123.3	37	CCDS12444.1	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069835	0.55539	.	.	ENSG00000153902	ENST00000310123;ENST00000392225;ENST00000437421	T;T	0.61040	0.14;0.14	3.74	3.74	0.42951	.	0.000000	0.64402	D	0.000016	T	0.76183	0.3952	M	0.83774	2.66	0.50313	D	0.999862	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.80714	-0.1259	10	0.87932	D	0	.	13.0908	0.59166	0.0:1.0:0.0:0.0	.	157;157	Q8N135-2;Q8N135	.;LGI4_HUMAN	W	157	ENSP00000312273:G157W;ENSP00000376059:G157W	ENSP00000312273:G157W	G	-	1	0	LGI4	40314289	1.000000	0.71417	0.992000	0.48379	0.321000	0.28281	7.017000	0.76399	1.653000	0.50694	0.306000	0.20318	GGG	.		0.721	LGI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103963.1		
CLASRP	11129	hgsc.bcm.edu	37	19	45567668	45567668	+	Missense_Mutation	SNP	C	C	A	rs71352251	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:45567668C>A	ENST00000221455.3	+	13	1287	c.1189C>A	c.(1189-1191)Cgc>Agc	p.R397S	CLASRP_ENST00000391953.4_Missense_Mutation_p.R335S|CLASRP_ENST00000544944.2_Missense_Mutation_p.R397S	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	397	Arg-rich.|Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						ctccagctctcgctccagctc	0.751													C|||	9	0.00179712	0.0	0.0014	5008	,	,		8999	0.0		0.008	False		,,,				2504	0.0				p.R397S		.											.	CLASRP-154	0			c.C1189A						.	C	SER/ARG	15,3921		0,15,1953	7.0	8.0	8.0		1189	2.2	0.9	19	dbSNP_130	8	110,7628		0,110,3759	yes	missense	CLASRP	NM_007056.2	110	0,125,5712	AA,AC,CC		1.4216,0.3811,1.0708	benign	397/675	45567668	125,11549	1968	3869	5837	SO:0001583	missense	11129	exon13			AGCTCTCGCTCCA	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1189C>A	19.37:g.45567668C>A	ENSP00000221455:p.Arg397Ser	0	0		36	20	NM_007056	0	0	2	5	3	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	ENST00000221455.3	37	CCDS12652.2	8	0.003663003663003663	0	0.0	1	0.0027624309392265192	0	0.0	7	0.009234828496042216	C	9.225	1.034325	0.19590	0.003811	0.014216	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.10960	2.82;2.83;2.82;2.82	4.39	2.19	0.27852	.	0.442461	0.16641	N	0.205652	T	0.03695	0.0105	N	0.19112	0.55	0.47698	D	0.999495	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.0	T	0.29305	-1.0016	10	0.02654	T	1	-2.0521	9.152	0.36969	0.4644:0.5356:0.0:0.0	.	335;397;397	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	S	397;397;335;397	ENSP00000221455:R397S;ENSP00000375814:R397S;ENSP00000375815:R335S;ENSP00000438702:R397S	ENSP00000221455:R397S	R	+	1	0	CLASRP	50259508	0.075000	0.21258	0.922000	0.36590	0.800000	0.45204	0.653000	0.24902	0.414000	0.25790	0.563000	0.77884	CGC	C|0.996;A|0.004		0.751	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
CKM	1158	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	45815122	45815122	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:45815122T>C	ENST00000221476.3	-	5	712	c.538A>G	c.(538-540)Acg>Gcg	p.T180A		NM_001824.4	NP_001815.2	P06732	KCRM_HUMAN	creatine kinase, muscle	180	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|phosphocreatine biosynthetic process (GO:0046314)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			cervix(1)|endometrium(1)|large_intestine(8)|lung(3)|prostate(2)|skin(2)	17		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	TCCTTCTCCGTCATGCTCTTC	0.617																																					p.T180A		.											.	CKM-91	0			c.A538G						.						88.0	65.0	73.0					19																	45815122		2203	4300	6503	SO:0001583	missense	1158	exon5			TCTCCGTCATGCT	M14780	CCDS12659.1	19q13.32	2012-10-02			ENSG00000104879	ENSG00000104879	2.7.3.2		1994	protein-coding gene	gene with protein product		123310		CKMM			Standard	NM_001824		Approved		uc002pbd.4	P06732		ENST00000221476.3:c.538A>G	19.37:g.45815122T>C	ENSP00000221476:p.Thr180Ala	94	0		119	19	NM_001824	0	0	0	0	0	Q96QL9	Missense_Mutation	SNP	ENST00000221476.3	37	CCDS12659.1	.	.	.	.	.	.	.	.	.	.	T	15.92	2.974073	0.53720	.	.	ENSG00000104879	ENST00000221476	T	0.23950	1.88	5.18	4.15	0.48705	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.110120	0.64402	D	0.000009	T	0.41673	0.1169	H	0.95645	3.7	0.51012	D	0.999901	B	0.25272	0.122	B	0.31442	0.13	T	0.42982	-0.9419	10	0.72032	D	0.01	-23.8165	5.9795	0.19399	0.1649:0.0:0.1719:0.6632	.	180	P06732	KCRM_HUMAN	A	180	ENSP00000221476:T180A	ENSP00000221476:T180A	T	-	1	0	CKM	50506962	1.000000	0.71417	0.983000	0.44433	0.964000	0.63967	3.743000	0.55104	0.799000	0.34018	0.459000	0.35465	ACG	.		0.617	CKM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457569.1		
PPP1R13L	10848	hgsc.bcm.edu	37	19	45900158	45900158	+	Silent	SNP	C	C	G	rs367747237		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:45900158C>G	ENST00000418234.2	-	4	435	c.357G>C	c.(355-357)tcG>tcC	p.S119S	PPP1R13L_ENST00000360957.5_Silent_p.S119S	NM_001142502.1	NP_001135974.1	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13 like	119	Pro-rich.				apoptotic process (GO:0006915)|cardiac muscle contraction (GO:0060048)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic camera-type eye development (GO:0031076)|hair cycle (GO:0042633)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|ventricular cardiac muscle tissue development (GO:0003229)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		TGCGCGGCGACGACGGCCGTC	0.741																																					p.S119S	Pancreas(61;1447 1663 31419 50578)	.											.	PPP1R13L-91	0			c.G357C						.	C	,	1,4343		0,1,2171	14.0	19.0	17.0		357,357	-2.2	0.1	19		17	0,8490		0,0,4245	no	coding-synonymous,coding-synonymous	PPP1R13L	NM_001142502.1,NM_006663.3	,	0,1,6416	GG,GC,CC		0.0,0.023,0.0078	,	119/829,119/829	45900158	1,12833	2172	4245	6417	SO:0001819	synonymous_variant	10848	exon4			CGGCGACGACGGC	AF078036	CCDS33050.1	19q13.32	2013-01-10	2011-10-04		ENSG00000104881	ENSG00000104881		"""Ankyrin repeat domain containing"""	18838	protein-coding gene	gene with protein product		607463	"""protein phosphatase 1, regulatory (inhibitor) subunit 13 like"""			10336463	Standard	NM_006663		Approved	RAI, IASPP	uc002pbo.3	Q8WUF5		ENST00000418234.2:c.357G>C	19.37:g.45900158C>G		0	0		6	4	NM_001142502	0	0	0	1	1	Q2PNZ9|Q5DU71|Q5I1X4|Q6P1R7|Q6PKF8|Q9Y290	Silent	SNP	ENST00000418234.2	37	CCDS33050.1																																																																																			.		0.741	PPP1R13L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457586.1	NM_006663	
ARHGAP35	2909	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	47492807	47492807	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:47492807A>G	ENST00000404338.3	+	4	3911	c.3911A>G	c.(3910-3912)aAc>aGc	p.N1304S		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1304	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										TCAGACCACAACCTGGACCTG	0.527																																					p.N1304S		.											.	.	0			c.A3911G						.						79.0	80.0	80.0					19																	47492807		1976	4171	6147	SO:0001583	missense	2909	exon4			ACCACAACCTGGA	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3911A>G	19.37:g.47492807A>G	ENSP00000385720:p.Asn1304Ser	138	1		154	21	NM_004491	0	0	0	0	0	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	37	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	A	14.27	2.484783	0.44147	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.18174	2.23	5.62	3.54	0.40534	.	0.151012	0.56097	D	0.000029	T	0.12902	0.0313	L	0.37507	1.11	0.43246	D	0.995166	B	0.06786	0.001	B	0.01281	0.0	T	0.06356	-1.0831	10	0.34782	T	0.22	-43.0572	9.6935	0.40143	0.8719:0.0:0.1281:0.0	.	1304	Q9NRY4-2	.	S	1304	ENSP00000385720:N1304S	ENSP00000324820:N1304S	N	+	2	0	ARHGAP35	52184647	0.621000	0.27077	1.000000	0.80357	0.983000	0.72400	0.885000	0.28227	2.150000	0.67090	0.533000	0.62120	AAC	.		0.527	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
INAFM1	255783	hgsc.bcm.edu	37	19	47778221	47778221	+	Silent	SNP	A	A	C	rs10407367	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:47778221A>C	ENST00000552360.2	+	1	80	c.45A>C	c.(43-45)ggA>ggC	p.G15G		NM_178511.5	NP_848606.3														skin(1)	1						AGAGCCCCGGAGGCGCGGGGC	0.781													C|||	3184	0.635783	0.7837	0.6254	5008	,	,		4462	0.6845		0.4324	False		,,,				2504	0.6022				p.G15G		.											.	.	0			c.A45C						.						5.0	6.0	6.0					19																	47778221		647	1520	2167	SO:0001819	synonymous_variant	255783	exon1			CCCCGGAGGCGCG																												ENST00000552360.2:c.45A>C	19.37:g.47778221A>C		0	0		4	4	NM_178511	0	0	0	2	2		Silent	SNP	ENST00000552360.2	37	CCDS46131.1																																																																																			A|0.415;C|0.585		0.781	PRR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407505.2		
HRC	3270	hgsc.bcm.edu	37	19	49657751	49657751	+	Silent	SNP	A	A	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:49657751A>G	ENST00000252825.4	-	1	930	c.744T>C	c.(742-744)gaT>gaC	p.D248D	HRC_ENST00000595625.1_Silent_p.D248D	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	248	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Asp-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)	p.D248D(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		catcatcatcatcgtcatctt	0.507																																					p.D248D	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	1	Substitution - coding silent(1)	large_intestine(1)	c.T744C						.						132.0	95.0	107.0					19																	49657751		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			ATCATCATCGTCA		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.744T>C	19.37:g.49657751A>G		80	0		96	12	NM_002152	0	0	0	0	0	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																			A|0.998;G|0.002		0.507	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
NR1H2	7376	hgsc.bcm.edu;ucsc.edu	37	19	50881825	50881825	+	Silent	SNP	G	G	A	rs55817866	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:50881825G>A	ENST00000253727.5	+	6	754	c.519G>A	c.(517-519)caG>caA	p.Q173Q	NR1H2_ENST00000599105.1_Silent_p.Q173Q|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000411902.2_Silent_p.Q76Q|NR1H2_ENST00000593926.1_Silent_p.Q173Q|NR1H2_ENST00000598168.1_Silent_p.Q173Q	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	173					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TTCGGAAACAGCAGCAGGAGT	0.637																																					p.Q173Q		.											.	NR1H2-186	0			c.G519A						.						38.0	47.0	44.0					19																	50881825		2140	4249	6389	SO:0001819	synonymous_variant	7376	exon6			GAAACAGCAGCAG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.519G>A	19.37:g.50881825G>A		64	0		125	7	NM_007121	0	0	0	0	0	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	37	CCDS42593.1																																																																																			G|0.903;A|0.097		0.637	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
ZNF761	388561	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	53959137	53959137	+	RNA	SNP	G	G	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:53959137G>A	ENST00000454407.1	+	0	1829							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		CATCGTAGACGTCATACTGGA	0.393																																					p.R459H		.											.	ZNF761-91	0			c.G1376A						.						101.0	105.0	104.0					19																	53959137		2203	4300	6503			388561	exon7			GTAGACGTCATAC	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53959137G>A		72	0		131	24	NM_001008401	0	0	2	2	0	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	37																																																																																				.		0.393	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
PPP1R12C	54776	hgsc.bcm.edu	37	19	55628609	55628609	+	Silent	SNP	A	A	G	rs66707428	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:55628609A>G	ENST00000263433.3	-	1	318	c.303T>C	c.(301-303)ggT>ggC	p.G101G	PPP1R12C_ENST00000376393.2_Silent_p.G101G	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		GGGCGCTGATACCGTCGGCGT	0.781													N|||	1009	0.201478	0.2806	0.0965	5008	,	,		7556	0.2738		0.1093	False		,,,				2504	0.1892				p.G101G		.											.	PPP1R12C-227	0			c.T303C						.						1.0	2.0	1.0					19																	55628609		1184	2666	3850	SO:0001819	synonymous_variant	54776	exon1			GCTGATACCGTCG	AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.303T>C	19.37:g.55628609A>G		0	0		8	4	NM_017607	0	0	1	2	1		Silent	SNP	ENST00000263433.3	37	CCDS12916.1																																																																																			A|0.808;G|0.192		0.781	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451814.2	NM_017607	
ZNF628	89887	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55995158	55995158	+	Silent	SNP	G	G	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr19:55995158G>A	ENST00000598519.1	+	3	3151	c.2598G>A	c.(2596-2598)caG>caA	p.Q866Q	NAT14_ENST00000587400.1_5'Flank|NAT14_ENST00000205194.4_5'Flank|NAT14_ENST00000591590.1_5'Flank|ZNF628_ENST00000391718.2_Silent_p.Q862Q			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	866					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		CCACGGTCCAGCTCCAGCCCG	0.647																																					p.Q866Q		.											.	ZNF628-22	0			c.G2598A						.						37.0	42.0	41.0					19																	55995158		2202	4300	6502	SO:0001819	synonymous_variant	89887	exon3			GGTCCAGCTCCAG	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.2598G>A	19.37:g.55995158G>A		114	0		202	68	NM_033113	0	0	3	8	5	Q86X34	Silent	SNP	ENST00000598519.1	37	CCDS33116.3																																																																																			.		0.647	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2	XM_058964	
EFR3B	22979	broad.mit.edu;bcgsc.ca	37	2	25372574	25372574	+	Silent	SNP	C	C	T	rs189511251	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr2:25372574C>T	ENST00000403714.3	+	20	2337	c.2154C>T	c.(2152-2154)gcC>gcT	p.A718A	EFR3B_ENST00000402191.1_Silent_p.A683A|EFR3B_ENST00000405108.1_Silent_p.A570A	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	718										endometrium(1)	1						GAGTGCCTGCCGAGGAGATCA	0.587													C|||	14	0.00279553	0.0061	0.0	5008	,	,		19536	0.0		0.004	False		,,,				2504	0.002				p.A718A		.											.	.	0			c.C2154T						.	C		15,1369		0,15,677	72.0	69.0	70.0		2154	-5.7	0.9	2		70	22,3160		1,20,1570	no	coding-synonymous	EFR3B	NM_014971.1		1,35,2247	TT,TC,CC		0.6914,1.0838,0.8103		718/818	25372574	37,4529	692	1591	2283	SO:0001819	synonymous_variant	22979	exon20			GCCTGCCGAGGAG	AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.2154C>T	2.37:g.25372574C>T		158	0		118	5	NM_014971	0	0	0	0	0	B7WPL8|Q86XU6	Silent	SNP	ENST00000403714.3	37	CCDS46231.1																																																																																			C|0.996;T|0.004		0.587	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324808.1	NM_014971	
PLB1	151056	bcgsc.ca	37	2	28827533	28827533	+	Silent	SNP	C	C	T	rs146023795	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr2:28827533C>T	ENST00000327757.5	+	41	2912	c.2868C>T	c.(2866-2868)cgC>cgT	p.R956R	PLB1_ENST00000422425.2_Silent_p.R945R|PLB1_ENST00000541605.1_Intron	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	956	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GCAGCATGCGCGAGCTGGTGG	0.637													C|||	35	0.00698882	0.0023	0.0043	5008	,	,		18259	0.0		0.0209	False		,,,				2504	0.0082				p.R956R		.											.	PLB1-141	0			c.C2868T						.	C	,	10,4396	17.9+/-39.9	0,10,2193	104.0	86.0	92.0		2835,2868	-10.8	0.0	2	dbSNP_134	92	72,8528	42.2+/-99.7	0,72,4228	no	coding-synonymous,coding-synonymous	PLB1	NM_001170585.1,NM_153021.4	,	0,82,6421	TT,TC,CC		0.8372,0.227,0.6305	,	945/1448,956/1459	28827533	82,12924	2203	4300	6503	SO:0001819	synonymous_variant	151056	exon41			CATGCGCGAGCTG		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.2868C>T	2.37:g.28827533C>T		171	0		119	6	NM_153021	0	0	0	0	0	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Silent	SNP	ENST00000327757.5	37	CCDS33168.1	17	0.007783882783882784	0	0.0	2	0.0055248618784530384	0	0.0	15	0.01978891820580475	C	3.123	-0.180047	0.06380	0.00227	0.008372	ENSG00000163803	ENST00000404858	.	.	.	5.41	-10.8	0.00216	.	.	.	.	.	T	0.12390	0.0301	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.15607	-1.0431	4	.	.	.	-3.2672	8.7579	0.34656	0.0794:0.3128:0.4975:0.1102	.	.	.	.	V	944	.	.	A	+	2	0	PLB1	28681037	0.000000	0.05858	0.027000	0.17364	0.556000	0.35491	-8.051000	0.00025	-3.188000	0.00220	-3.030000	0.00073	GCG	C|0.993;T|0.007		0.637	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
ADD2	119	broad.mit.edu	37	2	70918047	70918047	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr2:70918047C>A	ENST00000264436.4	-	8	1164	c.720G>T	c.(718-720)aaG>aaT	p.K240N	ADD2_ENST00000355733.3_Missense_Mutation_p.K240N|ADD2_ENST00000407644.2_Missense_Mutation_p.K240N|ADD2_ENST00000413157.2_Missense_Mutation_p.K240N|AC007395.3_ENST00000457851.1_RNA|ADD2_ENST00000430656.1_Missense_Mutation_p.K256N	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	240					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						GGAGGCCCCACTTCATGGCCG	0.587																																					p.K256N		.											.	ADD2-93	0			c.G768T						.						73.0	62.0	65.0					2																	70918047		2203	4300	6503	SO:0001583	missense	119	exon7			GCCCCACTTCATG	X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.720G>T	2.37:g.70918047C>A	ENSP00000264436:p.Lys240Asn	109	0		109	4	NM_001185055	0	0	0	0	0	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	ENST00000264436.4	37	CCDS1906.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.052866	0.75960	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.13	5.13	0.70059	Class II aldolase/adducin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.41259	0.1151	M	0.67953	2.075	0.54753	D	0.999987	D;D;D;D	0.76494	0.999;0.994;0.986;0.998	D;P;D;D	0.74348	0.983;0.88;0.93;0.959	T	0.18681	-1.0329	10	0.87932	D	0	-39.3853	9.7751	0.40614	0.0:0.9083:0.0:0.0917	.	256;240;240;240	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	N	240;240;240;240;240;240;256	ENSP00000264436:K240N;ENSP00000384677:K240N;ENSP00000347972:K240N;ENSP00000388072:K240N;ENSP00000398112:K256N	ENSP00000264436:K240N	K	-	3	2	ADD2	70771555	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.968000	0.40500	2.823000	0.97156	0.650000	0.86243	AAG	.		0.587	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251918.4	NM_001617	
SLC4A10	57282	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	162820668	162820668	+	Silent	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr2:162820668C>T	ENST00000446997.1	+	22	2979	c.2886C>T	c.(2884-2886)ttC>ttT	p.F962F	SLC4A10_ENST00000375514.5_Silent_p.F943F|SLC4A10_ENST00000421911.1_Silent_p.F962F|SLC4A10_ENST00000415876.2_Silent_p.F932F|SLC4A10_ENST00000272716.5_Silent_p.F932F	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	962					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	TAAAGCTCTTCTGGATGCCGG	0.363																																					p.F962F		.											.	SLC4A10-229	0			c.C2886T						.						64.0	57.0	59.0					2																	162820668		1835	4088	5923	SO:0001819	synonymous_variant	57282	exon22			GCTCTTCTGGATG		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.2886C>T	2.37:g.162820668C>T		42	0		33	7	NM_001178015	0	0	0	0	0	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Silent	SNP	ENST00000446997.1	37	CCDS54411.1																																																																																			.		0.363	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
TMC2	117532	broad.mit.edu;bcgsc.ca	37	20	2582894	2582894	+	Nonsense_Mutation	SNP	C	C	T	rs202171256		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr20:2582894C>T	ENST00000358864.1	+	11	1375	c.1360C>T	c.(1360-1362)Cga>Tga	p.R454*	TMC2_ENST00000496948.1_3'UTR	NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	454					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGTGGTTAAGCGATCTCAGCA	0.408																																					p.R454X		.											.	TMC2-93	0			c.C1360T						.						169.0	146.0	154.0					20																	2582894		2203	4300	6503	SO:0001587	stop_gained	117532	exon11			GTTAAGCGATCTC	AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.1360C>T	20.37:g.2582894C>T	ENSP00000351732:p.Arg454*	215	0		261	10	NM_080751	0	0	0	0	0	Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Nonsense_Mutation	SNP	ENST00000358864.1	37	CCDS13029.2	.	.	.	.	.	.	.	.	.	.	C	39	7.678704	0.98428	.	.	ENSG00000149488	ENST00000358864	.	.	.	5.58	4.62	0.57501	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.0622	13.7421	0.62853	0.1551:0.8449:0.0:0.0	.	.	.	.	X	454	.	ENSP00000351732:R454X	R	+	1	2	TMC2	2530894	0.998000	0.40836	0.998000	0.56505	0.983000	0.72400	0.837000	0.27558	1.457000	0.47850	0.655000	0.94253	CGA	C|0.999;T|0.001		0.408	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077601.2		
MYLK2	85366	broad.mit.edu;bcgsc.ca	37	20	30418931	30418931	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr20:30418931A>C	ENST00000375994.2	+	9	1684	c.1411A>C	c.(1411-1413)Atc>Ctc	p.I471L	MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_Missense_Mutation_p.I471L			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	471	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TATGGGGGTGATCACCTACAT	0.562																																					p.I471L		.											.	MYLK2-760	0			c.A1411C						.						99.0	100.0	100.0					20																	30418931		2203	4300	6503	SO:0001583	missense	85366	exon10			GGGGTGATCACCT	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1411A>C	20.37:g.30418931A>C	ENSP00000365162:p.Ile471Leu	134	0		198	8	NM_033118	0	0	0	0	0	Q569L1|Q96I84	Missense_Mutation	SNP	ENST00000375994.2	37	CCDS13191.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.971184	0.74246	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.68903	-0.36;-0.36	3.94	3.94	0.45596	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.69495	0.3117	L	0.28458	0.855	0.40402	D	0.979656	P	0.47191	0.891	P	0.62382	0.901	T	0.71623	-0.4537	9	0.51188	T	0.08	.	12.0531	0.53518	1.0:0.0:0.0:0.0	.	471	Q9H1R3	MYLK2_HUMAN	L	471	ENSP00000365162:I471L;ENSP00000365152:I471L	ENSP00000365152:I471L	I	+	1	0	MYLK2	29882592	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.871000	0.75531	1.756000	0.51951	0.448000	0.29417	ATC	.		0.562	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078583.2	NM_033118	
HELZ2	85441	hgsc.bcm.edu	37	20	62194713	62194713	+	Missense_Mutation	SNP	A	A	C	rs3810486	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr20:62194713A>C	ENST00000467148.1	-	8	5531	c.5462T>G	c.(5461-5463)cTg>cGg	p.L1821R	HELZ2_ENST00000427522.2_Missense_Mutation_p.L1252R	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1821			L -> R (in dbSNP:rs3810486).		cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCCACGGCCAGGGTGTGTGG	0.726													C|||	1226	0.244808	0.0575	0.1023	5008	,	,		15371	0.5923		0.1948	False		,,,				2504	0.2924				p.L1821R		.											.	.	0			c.T5462G						.	C	ARG/LEU,ARG/LEU	196,3498		4,188,1655	3.0	3.0	3.0		5462,3755	-2.5	0.0	20	dbSNP_107	3	895,6669		51,793,2938	no	missense,missense	PRIC285	NM_001037335.2,NM_033405.3	102,102	55,981,4593	CC,CA,AA		11.8324,5.3059,9.6909	benign,benign	1821/2650,1252/2081	62194713	1091,10167	1847	3782	5629	SO:0001583	missense	85441	exon9			ACGGCCAGGGTGT	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.5462T>G	20.37:g.62194713A>C	ENSP00000417401:p.Leu1821Arg	0	0		15	6	NM_001037335	0	0	3	4	1	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	ENST00000467148.1	37	CCDS33508.1	575	0.2632783882783883	23	0.046747967479674794	44	0.12154696132596685	352	0.6153846153846154	156	0.20580474934036938	C	7.173	0.588046	0.13812	0.053059	0.118324	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.79033	-1.23;-1.15	4.54	-2.49	0.06403	.	2.710140	0.01204	N	0.007649	T	0.00012	0.0000	N	0.00347	-1.61	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36261	-0.9755	9	0.18710	T	0.47	0.0741	1.1162	0.01714	0.3228:0.32:0.1009:0.2562	rs3810486	1821;1252	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	R	1252;1821	ENSP00000393257:L1252R;ENSP00000417401:L1821R	ENSP00000393257:L1252R	L	-	2	0	RP4-697K14.7	61665157	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.101000	0.15251	-0.351000	0.08249	-0.323000	0.08544	CTG	A|0.739;C|0.261		0.726	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354127.1	NM_001037335	
KRTAP10-7	386675	broad.mit.edu	37	21	46020656	46020670	+	In_Frame_Del	DEL	CTGCTGCGCCCCCAG	CTGCTGCGCCCCCAG	-	rs36208679|rs60739860|rs373191083		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr21:46020656_46020670delCTGCTGCGCCCCCAG	ENST00000380102.2	+	1	160_174	c.135_149delCTGCTGCGCCCCCAG	c.(133-150)ccctgctgcgcccccagc>ccc	p.CCAPS46del	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	46	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)		p.S50_P54delSCCAP(1)		breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						GCGAGCCCCCCTGCTGCGCCCCCAGCTGCTGCGCC	0.698																																					.		.											.	.	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	.						.		,	2258,1042		849,560,241					,	-0.7	1.0		dbSNP_126	22	6001,1123		2605,791,166	no	coding,intron	TSPEAR,KRTAP10-7	NM_198689.2,NM_144991.2	,	3454,1351,407	A1A1,A1R,RR		15.7636,31.5758,20.7694	,	,		8259,2165				SO:0001651	inframe_deletion	386675	.			GCCCCCCTGCTGC	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.135_149delCTGCTGCGCCCCCAG	21.37:g.46020656_46020670delCTGCTGCGCCCCCAG	ENSP00000369445:p.Cys46_Ser50del	24	0		78	9	.	0	0	0	0	0	Q0VDJ8|Q70LJ2	Splice_Site	DEL	ENST00000380102.2	37																																																																																				.		0.698	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
RSPH14	27156	bcgsc.ca	37	22	23482460	23482460	+	Silent	SNP	A	A	G	rs4822360	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr22:23482460A>G	ENST00000216036.4	-	2	344	c.148T>C	c.(148-150)Ttg>Ctg	p.L50L	RTDR1_ENST00000406876.1_Silent_p.L50L	NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		50								p.L50L(1)		breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		AGGTCACACAAGGCCATGAGG	0.577													G|||	2628	0.52476	0.6354	0.5706	5008	,	,		18083	0.4038		0.5547	False		,,,				2504	0.4366				p.L50L		.											.	RTDR1-516	1	Substitution - coding silent(1)	stomach(1)	c.T148C						.	G		2827,1579	493.4+/-362.7	899,1029,275	151.0	114.0	126.0		148	3.9	1.0	22	dbSNP_111	126	4819,3781	536.0+/-382.9	1365,2089,846	no	coding-synonymous	RTDR1	NM_014433.2		2264,3118,1121	GG,GA,AA		43.9651,35.8375,41.2117		50/349	23482460	7646,5360	2203	4300	6503	SO:0001819	synonymous_variant	27156	exon2			CACACAAGGCCAT																												ENST00000216036.4:c.148T>C	22.37:g.23482460A>G		121	0		95	4	NM_014433	0	0	0	0	0		Silent	SNP	ENST00000216036.4	37	CCDS13803.1																																																																																			A|0.436;G|0.564		0.577	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319049.1		
CRYBB3	1417	broad.mit.edu;bcgsc.ca	37	22	25597401	25597401	+	Missense_Mutation	SNP	C	C	G	rs147831812	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr22:25597401C>G	ENST00000215855.2	+	2	118	c.38C>G	c.(37-39)gCt>gGt	p.A13G	CRYBB3_ENST00000404334.1_Missense_Mutation_p.A13G	NM_004076.3	NP_004067.1	P26998	CRBB3_HUMAN	crystallin, beta B3	13	N-terminal arm.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(2)|lung(2)|prostate(1)	5						CAGGCTGCAGCTGGCAAGAGC	0.607													C|||	7	0.00139776	0.0	0.0014	5008	,	,		17324	0.0		0.003	False		,,,				2504	0.0031				p.E13G		.											.	CRYBB3-90	0			c.A38G						.	C	GLY/ALA	7,4399	11.4+/-27.6	0,7,2196	76.0	78.0	78.0		38	4.8	1.0	22	dbSNP_134	78	60,8540	37.8+/-93.5	0,60,4240	yes	missense	CRYBB3	NM_004076.3	60	0,67,6436	GG,GC,CC		0.6977,0.1589,0.5151	benign	13/212	25597401	67,12939	2203	4300	6503	SO:0001583	missense	1417	exon2			CTGCAGCTGGCAA		CCDS13830.1	22q11.23	2008-06-10			ENSG00000100053	ENSG00000100053			2400	protein-coding gene	gene with protein product		123630		CRYB3		8999933	Standard	NM_004076		Approved		uc003abo.2	P26998	OTTHUMG00000150869	ENST00000215855.2:c.38C>G	22.37:g.25597401C>G	ENSP00000215855:p.Ala13Gly	202	0		119	6	NM_004076	0	0	0	0	0	Q3B7S9|Q3T1B7|Q6ISK6|Q92965|Q9UH09	Missense_Mutation	SNP	ENST00000215855.2	37	CCDS13830.1	4	0.0018315018315018315	1	0.0020325203252032522	0	0.0	0	0.0	3	0.00395778364116095	C	16.18	3.049798	0.55218	0.001589	0.006977	ENSG00000100053	ENST00000215855;ENST00000404334	T;T	0.79749	-0.97;-1.3	4.81	4.81	0.61882	.	1.241440	0.05694	N	0.592805	T	0.76076	0.3937	L	0.53249	1.67	0.49130	D	0.999751	B	0.34241	0.444	B	0.35607	0.206	T	0.66388	-0.5936	10	0.45353	T	0.12	.	15.3457	0.74334	0.0:1.0:0.0:0.0	.	13	P26998	CRBB3_HUMAN	G	13	ENSP00000215855:A13G;ENSP00000386123:A13G	ENSP00000215855:A13G	A	+	2	0	CRYBB3	23927401	1.000000	0.71417	0.974000	0.42286	0.879000	0.50718	4.709000	0.61867	2.201000	0.70794	0.655000	0.94253	GCT	C|0.997;G|0.003		0.607	CRYBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320352.1	NM_004076	
LIMK2	3985	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	22	31667154	31667154	+	Silent	SNP	G	G	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr22:31667154G>A	ENST00000331728.4	+	12	1464	c.1350G>A	c.(1348-1350)cgG>cgA	p.R450R	LIMK2_ENST00000333611.4_Silent_p.R429R|LIMK2_ENST00000406516.1_Silent_p.R372R|LIMK2_ENST00000444929.2_Silent_p.R204R|LIMK2_ENST00000340552.4_Silent_p.R429R	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	450	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						TCATCCACCGGGATCTGAACT	0.532																																					p.R450R		.											.	LIMK2-548	0			c.G1350A						.						187.0	142.0	157.0					22																	31667154		2203	4300	6503	SO:0001819	synonymous_variant	3985	exon12			CCACCGGGATCTG	D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1350G>A	22.37:g.31667154G>A		152	0		131	10	NM_005569	0	0	1	1	0	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Silent	SNP	ENST00000331728.4	37	CCDS13891.1																																																																																			.		0.532	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
XIRP1	165904	bcgsc.ca	37	3	39230386	39230386	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:39230386G>T	ENST00000340369.3	-	2	779	c.551C>A	c.(550-552)gCc>gAc	p.A184D	XIRP1_ENST00000421646.1_Intron|XIRP1_ENST00000396251.1_Missense_Mutation_p.A184D	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	184					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		ATCTCCGCTGGCTGCAGGCTC	0.647																																					p.A184D		.											.	XIRP1-158	0			c.C551A						.						49.0	48.0	48.0					3																	39230386		2203	4300	6503	SO:0001583	missense	165904	exon2			CCGCTGGCTGCAG	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.551C>A	3.37:g.39230386G>T	ENSP00000343140:p.Ala184Asp	53	0		73	4	NM_001198621	0	0	0	0	0	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	37	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	G	5.222	0.226542	0.09916	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.04970	3.52;3.91	4.61	3.72	0.42706	.	0.642918	0.13814	U	0.360934	T	0.07098	0.0180	L	0.46157	1.445	0.80722	D	1	P;P	0.45902	0.868;0.804	B;B	0.41571	0.273;0.36	T	0.32955	-0.9887	10	0.45353	T	0.12	.	6.4548	0.21924	0.0958:0.0:0.7263:0.1779	.	184;184	Q702N8;Q702N8-2	XIRP1_HUMAN;.	D	184	ENSP00000379550:A184D;ENSP00000343140:A184D	ENSP00000343140:A184D	A	-	2	0	XIRP1	39205390	1.000000	0.71417	0.299000	0.25016	0.117000	0.20001	3.776000	0.55356	1.036000	0.39998	0.655000	0.94253	GCC	.		0.647	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
TOPAZ1	375337	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	44285176	44285176	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:44285176A>C	ENST00000309765.4	+	2	1346	c.1178A>C	c.(1177-1179)gAt>gCt	p.D393A		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	393						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										TCTTTGATGGATCATTTATTA	0.323																																					p.D393A		.											.	.	0			c.A1178C						.						44.0	43.0	43.0					3																	44285176		692	1591	2283	SO:0001583	missense	375337	exon2			TGATGGATCATTT	AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.1178A>C	3.37:g.44285176A>C	ENSP00000310303:p.Asp393Ala	15	0		26	8	NM_001145030	0	0	0	0	0		Missense_Mutation	SNP	ENST00000309765.4	37	CCDS46809.1	.	.	.	.	.	.	.	.	.	.	A	13.47	2.246827	0.39697	.	.	ENSG00000173769	ENST00000309765	T	0.11821	2.74	5.55	4.4	0.53042	.	0.282341	0.34046	N	0.004317	T	0.14313	0.0346	L	0.29908	0.895	0.31273	N	0.691533	D	0.63046	0.992	P	0.52066	0.689	T	0.07558	-1.0766	10	0.46703	T	0.11	-13.3505	5.967	0.19330	0.7774:0.0:0.0775:0.1451	.	393	Q8N9V7	CC077_HUMAN	A	393	ENSP00000310303:D393A	ENSP00000310303:D393A	D	+	2	0	C3orf77	44260180	0.984000	0.35163	0.999000	0.59377	0.614000	0.37383	1.942000	0.40243	0.944000	0.37579	0.528000	0.53228	GAT	.		0.323	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343247.1	NM_001145030	
RHOA	387	broad.mit.edu;bcgsc.ca	37	3	49395482	49395482	+	IGR	SNP	G	G	C	rs201944086	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:49395482G>C	ENST00000418115.1	-	0	2031				GPX1_ENST00000496791.1_5'UTR|GPX1_ENST00000419349.1_Missense_Mutation_p.P77R|GPX1_ENST00000419783.1_Missense_Mutation_p.P77R	NM_001664.2	NP_001655.1	P61586	RHOA_HUMAN	ras homolog family member A						actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|apical junction assembly (GO:0043297)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cerebral cortex cell migration (GO:0021795)|cleavage furrow formation (GO:0036089)|forebrain radial glial cell differentiation (GO:0021861)|negative chemotaxis (GO:0050919)|negative regulation of axonogenesis (GO:0050771)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification involved in bone maturation (GO:0043931)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytokinesis (GO:0032467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of podosome assembly (GO:0071803)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of translation (GO:0045727)|positive regulation of vasoconstriction (GO:0045907)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion transport (GO:0051924)|regulation of cell migration (GO:0030334)|regulation of dendrite development (GO:0050773)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of osteoblast proliferation (GO:0033688)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|Rho protein signal transduction (GO:0007266)|skeletal muscle tissue development (GO:0007519)|small GTPase mediated signal transduction (GO:0007264)|spindle assembly involved in mitosis (GO:0090307)|stress fiber assembly (GO:0043149)|stress-activated protein kinase signaling cascade (GO:0031098)|substantia nigra development (GO:0021762)|trabecula morphogenesis (GO:0061383)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	apical junction complex (GO:0043296)|axon (GO:0030424)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin binding (GO:0017022)			cervix(1)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.58e-05)|Kidney(197;0.0023)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CTGGTTGCACGGGAAGCCGAG	0.726																																					.		.											.	GPX1-68	0			.						.						11.0	14.0	13.0					3																	49395482		1848	4061	5909	SO:0001628	intergenic_variant	2876	.			TTGCACGGGAAGC	BC001360	CCDS2795.1	3p21.3	2012-02-27	2012-02-27	2004-03-23	ENSG00000067560	ENSG00000067560			667	protein-coding gene	gene with protein product		165390	"""ras homolog gene family, member A"""	ARH12, ARHA		9605859	Standard	NM_001664		Approved	RhoA, Rho12, RHOH12	uc003cwu.3	P61586	OTTHUMG00000156838		3.37:g.49395482G>C		39	0		167	11	.	0	0	291	291	0	P06749|Q53HM4|Q5U024|Q9UDJ0|Q9UEJ4	Missense_Mutation	SNP	ENST00000418115.1	37	CCDS2795.1	.	.	.	.	.	.	.	.	.	.	G	36	5.745728	0.96882	.	.	ENSG00000233276	ENST00000419783;ENST00000419349	T;T	0.25085	1.82;1.82	5.88	5.88	0.94601	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.63070	0.2480	M	0.93150	3.385	0.80722	D	1	D;D	0.71674	0.998;0.988	D;P	0.68483	0.958;0.891	T	0.72279	-0.4340	10	0.87932	D	0	.	18.8152	0.92075	0.0:0.0:1.0:0.0	.	77;77	E9PAS1;P07203	.;GPX1_HUMAN	R	77	ENSP00000407375:P77R;ENSP00000391316:P77R	ENSP00000391316:P77R	P	-	2	0	GPX1	49370486	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.875000	0.87205	2.788000	0.95919	0.555000	0.69702	CCG	G|0.333;C|0.667		0.726	RHOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346157.3	NM_001664	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		6	6	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
OR5H14	403273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	97869140	97869140	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:97869140T>C	ENST00000437310.1	+	1	971	c.911T>C	c.(910-912)aTg>aCg	p.M304T	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TTCACAAAAATGTTCAAAAGA	0.308																																					p.M304T		.											.	OR5H14-91	0			c.T911C						.						31.0	31.0	31.0					3																	97869140		2193	4295	6488	SO:0001583	missense	403273	exon1			CAAAAATGTTCAA		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.911T>C	3.37:g.97869140T>C	ENSP00000401706:p.Met304Thr	154	0		214	19	NM_001005514	0	0	0	0	0	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	37	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	T	3.394	-0.123756	0.06795	.	.	ENSG00000236032	ENST00000437310	T	0.37235	1.21	2.49	1.29	0.21616	.	1.921520	0.02567	N	0.097382	T	0.24236	0.0587	L	0.31207	0.915	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13575	-1.0504	10	0.06891	T	0.86	.	5.353	0.16045	0.0:0.1585:0.0:0.8415	.	304	A6NHG9	O5H14_HUMAN	T	304	ENSP00000401706:M304T	ENSP00000401706:M304T	M	+	2	0	OR5H14	99351830	0.000000	0.05858	0.001000	0.08648	0.072000	0.16883	0.822000	0.27352	0.212000	0.20703	0.164000	0.16699	ATG	.		0.308	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D|SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	0	0		6	5	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
TRIM42	287015	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	140401765	140401765	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:140401765C>T	ENST00000286349.3	+	2	994	c.803C>T	c.(802-804)tCg>tTg	p.S268L		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	268						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S268L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCCTTCCACTCGGATGTGGCC	0.597																																					p.S268L		.											.	TRIM42-227	1	Substitution - Missense(1)	large_intestine(1)	c.C803T						.						117.0	104.0	108.0					3																	140401765		2203	4300	6503	SO:0001583	missense	287015	exon2			TCCACTCGGATGT	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.803C>T	3.37:g.140401765C>T	ENSP00000286349:p.Ser268Leu	157	0		244	16	NM_152616	0	0	0	0	0	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	37	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.986617	0.53934	.	.	ENSG00000155890	ENST00000286349	T	0.38887	1.11	5.41	4.52	0.55395	.	0.588445	0.15101	N	0.280534	T	0.27278	0.0669	L	0.39898	1.24	0.32689	N	0.514476	P	0.45011	0.848	B	0.26969	0.075	T	0.48969	-0.8987	10	0.62326	D	0.03	-20.1333	10.4343	0.44426	0.0:0.9074:0.0:0.0926	.	268	Q8IWZ5	TRI42_HUMAN	L	268	ENSP00000286349:S268L	ENSP00000286349:S268L	S	+	2	0	TRIM42	141884455	0.231000	0.23751	1.000000	0.80357	0.986000	0.74619	0.546000	0.23284	2.546000	0.85860	0.561000	0.74099	TCG	.		0.597	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047R	Colon(199;1504 1750 3362 26421 31210 32040)	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	PIK3CA-27752	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140G						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290	exon21			ATGCACATCATGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	156	0		179	38	NM_006218	0	0	6	6	0	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	.		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
ALG3	10195	hgsc.bcm.edu	37	3	183959508	183959508	+	IGR	SNP	A	A	C	rs28606531	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:183959508A>C	ENST00000397676.3	-	0	1528				MIR1224_ENST00000408193.1_RNA|VWA5B2_ENST00000426955.2_Silent_p.P1137P|VWA5B2_ENST00000273794.5_Silent_p.P919P|ALG3_ENST00000463495.1_5'Flank|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTGAGGGGCCAGGCCAGGTGG	0.746													A|||	346	0.0690895	0.0204	0.0735	5008	,	,		13734	0.0079		0.1451	False		,,,				2504	0.1166				p.P1137P		.											.	.	0			c.A3411C						.						3.0	4.0	4.0					3																	183959508		597	1420	2017	SO:0001628	intergenic_variant	90113	exon19			GGGGCCAGGCCAG	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183959508A>C		0	0		23	8	NM_138345	0	0	2	5	3	A8JZZ6|Q9BT71	Silent	SNP	ENST00000397676.3	37	CCDS46968.1																																																																																			A|0.927;C|0.073		0.746	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
IDUA	3425	broad.mit.edu	37	4	996204	996204	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:996204A>C	ENST00000247933.4	+	8	1208	c.1120A>C	c.(1120-1122)Acc>Ccc	p.T374P	IDUA_ENST00000453894.1_Missense_Mutation_p.T396P|IDUA_ENST00000514224.1_Missense_Mutation_p.T242P	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	374					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GGTCAACAACACCCGCCCGCC	0.711																																					p.T374P		.											.	IDUA-91	0			c.A1120C						.						26.0	28.0	27.0					4																	996204		2185	4282	6467	SO:0001583	missense	3425	exon8			AACAACACCCGCC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.1120A>C	4.37:g.996204A>C	ENSP00000247933:p.Thr374Pro	29	1		236	96	NM_000203	0	0	4	4	0	B3KWK6	Missense_Mutation	SNP	ENST00000247933.4	37	CCDS3343.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117066	0.77323	.	.	ENSG00000127415	ENST00000247933;ENST00000453894;ENST00000514224	D;D;D	0.94280	-3.39;-3.39;-3.39	5.31	5.31	0.75309	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.156849	0.56097	D	0.000026	D	0.96611	0.8894	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.96508	0.9376	10	0.46703	T	0.11	-7.29	13.2474	0.60029	1.0:0.0:0.0:0.0	.	396;374	B3KWK6;P35475	.;IDUA_HUMAN	P	374;396;242	ENSP00000247933:T374P;ENSP00000396458:T396P;ENSP00000425081:T242P	ENSP00000247933:T374P	T	+	1	0	IDUA	986204	1.000000	0.71417	0.995000	0.50966	0.426000	0.31534	5.967000	0.70403	2.024000	0.59613	0.454000	0.30748	ACC	.		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000201812.1	NM_000203	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		0	0		10	8	NM_175918	0	0	3	6	3	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000514014.1_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		0	0		4	4	NM_001098634	0	0	0	1	1	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
PHOX2B	8929	broad.mit.edu	37	4	41749416	41749416	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:41749416T>G	ENST00000226382.2	-	2	738	c.379A>C	c.(379-381)Act>Cct	p.T127P	RP11-227F19.2_ENST00000510602.1_lincRNA|RP11-227F19.1_ENST00000508038.1_RNA	NM_003924.3	NP_003915.2	Q99453	PHX2B_HUMAN	paired-like homeobox 2b	127					autonomic nervous system development (GO:0048483)|brainstem development (GO:0003360)|cell differentiation in hindbrain (GO:0021533)|cellular response to BMP stimulus (GO:0071773)|dopaminergic neuron differentiation (GO:0071542)|efferent axon development in a lateral line nerve (GO:0048894)|enteric nervous system development (GO:0048484)|glial cell differentiation (GO:0010001)|hindbrain tangential cell migration (GO:0021934)|inner ear development (GO:0048839)|medullary reticular formation development (GO:0021723)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron differentiation (GO:0003357)|parasympathetic nervous system development (GO:0048486)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression (GO:0010468)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory system development (GO:0060541)|retrotrapezoid nucleus neuron differentiation (GO:0061452)|skeletal muscle cell differentiation (GO:0035914)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			autonomic_ganglia(7)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	30						TCCTCCCGAGTGTAGATGTCG	0.652			"""Mis, F"""		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.T127P		.	yes	Rec	yes	familial neuroblastoma	4	4p12	8929	paired-like homeobox 2b	yes	O	.	PHOX2B-1970	0			c.A379C						.						51.0	55.0	54.0					4																	41749416		2203	4300	6503	SO:0001583	missense	8929	exon2	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	CCCGAGTGTAGAT	D82344	CCDS3463.1	4p13	2014-09-17	2003-02-10	2003-02-14	ENSG00000109132	ENSG00000109132		"""Homeoboxes / PRD class"""	9143	protein-coding gene	gene with protein product		603851	"""paired mesoderm homeobox 2b"""	PMX2B		9039501, 10395798	Standard	NM_003924		Approved	Phox2b, NBPhox	uc003gwf.4	Q99453	OTTHUMG00000099379	ENST00000226382.2:c.379A>C	4.37:g.41749416T>G	ENSP00000226382:p.Thr127Pro	53	0		57	3	NM_003924	0	0	0	0	0	Q6PJD9	Missense_Mutation	SNP	ENST00000226382.2	37	CCDS3463.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.660852	0.67700	.	.	ENSG00000109132	ENST00000226382	D	0.95788	-3.81	5.54	5.54	0.83059	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97983	0.9336	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98953	1.0795	10	0.87932	D	0	.	15.8465	0.78895	0.0:0.0:0.0:1.0	.	127	Q99453	PHX2B_HUMAN	P	127	ENSP00000226382:T127P	ENSP00000226382:T127P	T	-	1	0	PHOX2B	41444173	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.814000	0.86154	2.326000	0.78906	0.533000	0.62120	ACT	.		0.652	PHOX2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216832.2		
ZAR1	326340	hgsc.bcm.edu	37	4	48492434	48492434	+	Missense_Mutation	SNP	G	G	C	rs10008444	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:48492434G>C	ENST00000327939.4	+	1	166	c.126G>C	c.(124-126)caG>caC	p.Q42H		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	42					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						GCTGGCAGCAGCGCGGCAGGG	0.756													C|||	4938	0.986022	0.9493	0.9957	5008	,	,		9261	1.0		1.0	False		,,,				2504	1.0				p.Q42H		.											.	ZAR1-90	0			c.G126C						.	C	HIS/GLN	2851,89		1381,89,0	2.0	3.0	3.0		126	-0.2	0.0	4	dbSNP_119	3	6474,0		3237,0,0	no	missense	ZAR1	NM_175619.1	24	4618,89,0	CC,CG,GG		0.0,3.0272,0.9454	benign	42/425	48492434	9325,89	1470	3237	4707	SO:0001583	missense	326340	exon1			GCAGCAGCGCGGC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.126G>C	4.37:g.48492434G>C	ENSP00000329803:p.Gln42His	0	0		9	9	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	2130	0.9752747252747253	449	0.9126016260162602	359	0.9917127071823204	565	0.9877622377622378	757	0.9986807387862797	C	0.021	-1.426522	0.01117	0.969728	1.0	ENSG00000182223	ENST00000327939	.	.	.	4.09	-0.185	0.13276	.	0.811302	0.10779	N	0.635071	T	0.00012	0.0000	N	0.03608	-0.345	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	8	0.14252	T	0.57	-31.571	6.2995	0.21105	0.0:0.2927:0.4307:0.2766	rs10008444;rs58304706	42	Q86SH2	ZAR1_HUMAN	H	42	.	ENSP00000329803:Q42H	Q	+	3	2	ZAR1	48187191	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	0.053000	0.14184	-0.405000	0.07599	-0.676000	0.03789	CAG	G|0.025;C|0.975		0.756	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
NPFFR2	10886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	73012700	73012700	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:73012700A>G	ENST00000308744.6	+	4	838	c.740A>G	c.(739-741)cAg>cGg	p.Q247R	NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000358749.3_Missense_Mutation_p.Q145R|NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000395999.1_Missense_Mutation_p.Q148R	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	247					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			TGCAGGTTCCAGTGTGTGGTC	0.403																																					p.Q247R		.											.	NPFFR2-92	0			c.A740G						.						172.0	174.0	173.0					4																	73012700		2203	4300	6503	SO:0001583	missense	10886	exon4			GGTTCCAGTGTGT	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.740A>G	4.37:g.73012700A>G	ENSP00000307822:p.Gln247Arg	68	0		79	14	NM_004885	0	0	0	0	0	Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	37	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	G	0.585	-0.835509	0.02713	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.36520	1.25;1.25;1.25	5.81	4.97	0.65823	GPCR, rhodopsin-like superfamily (1);	0.259551	0.27876	N	0.017484	T	0.11537	0.0281	N	0.00855	-1.145	0.18873	N	0.999987	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26189	-1.0110	10	0.06494	T	0.89	.	12.7025	0.57041	0.1346:0.0:0.8654:0.0	.	148;247	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	R	247;148;145	ENSP00000307822:Q247R;ENSP00000379321:Q148R;ENSP00000351599:Q145R	ENSP00000307822:Q247R	Q	+	2	0	NPFFR2	73231564	0.994000	0.37717	0.983000	0.44433	0.137000	0.21094	3.431000	0.52814	0.824000	0.34613	-0.128000	0.14901	CAG	.		0.403	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
COQ2	27235	hgsc.bcm.edu	37	4	84205872	84205872	+	Missense_Mutation	SNP	C	C	A	rs6818847	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:84205872C>A	ENST00000311469.4	-	1	195	c.196G>T	c.(196-198)Gtg>Ttg	p.V66L	COQ2_ENST00000311461.7_Missense_Mutation_p.V16L|COQ2_ENST00000439031.2_Missense_Mutation_p.V29L	NM_015697.7	NP_056512.5	Q96H96	COQ2_HUMAN	coenzyme Q2 4-hydroxybenzoate polyprenyltransferase	16					cell death (GO:0008219)|glycerol metabolic process (GO:0006071)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	4-hydroxybenzoate decaprenyltransferase activity (GO:0002083)|4-hydroxybenzoate nonaprenyltransferase activity (GO:0047293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)	8		Hepatocellular(203;0.114)				GCCAGTGCCACAGCCCGCAGG	0.766													C|||	3254	0.64976	0.3775	0.647	5008	,	,		9689	0.8879		0.7227	False		,,,				2504	0.6994				p.V66L		.											.	COQ2-92	0			c.G196T						.	C	LEU/VAL	1570,1290		474,622,334	2.0	3.0	3.0		196	-2.7	0.0	4	dbSNP_116	3	4779,1627		1892,995,316	no	missense	COQ2	NM_015697.7	32	2366,1617,650	AA,AC,CC		25.3981,45.1049,31.4807	benign	66/422	84205872	6349,2917	1430	3203	4633	SO:0001583	missense	27235	exon1			GTGCCACAGCCCG		CCDS47090.1, CCDS47090.2	4q21.23	2013-05-23	2013-05-23				2.5.1.39		25223	protein-coding gene	gene with protein product	"""4-hydroxybenzoate polyprenyltransferase"""	609825	"""coenzyme Q2 homolog, prenyltransferase (yeast)"""			15153069, 17332895	Standard	NM_015697		Approved	CL640, FLJ26072	uc003hog.3	Q96H96		ENST00000311469.4:c.196G>T	4.37:g.84205872C>A	ENSP00000310873:p.Val66Leu	0	0		5	5	NM_015697	0	0	0	0	0	O95331|Q1JQ78|Q684R2	Missense_Mutation	SNP	ENST00000311469.4	37	CCDS47090.2	1475	0.6753663003663004	219	0.4451219512195122	244	0.6740331491712708	490	0.8566433566433567	522	0.6886543535620053	C	5.506	0.278257	0.10403	0.548951	0.746019	ENSG00000173085	ENST00000311469;ENST00000439031;ENST00000311461	T;T;T	0.77098	-1.07;-1.03;-1.0	3.59	-2.74	0.05932	.	2.205390	0.02429	N	0.083323	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.33445	-0.9868	8	0.07813	T	0.8	-2.056	4.7989	0.13287	0.0:0.2608:0.3311:0.4081	rs6818847;rs17850399;rs17858544	16	E2QRG7	.	L	66;29;16	ENSP00000310873:V66L;ENSP00000409275:V29L;ENSP00000311835:V16L	ENSP00000311835:V16L	V	-	1	0	COQ2	84424896	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.921000	0.01569	-0.746000	0.04766	0.467000	0.42956	GTG	C|0.324;A|0.676		0.766	COQ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363027.3	NM_015697	
GRID2	2895	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	4	94376818	94376818	+	Silent	SNP	C	C	T	rs560303075		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:94376818C>T	ENST00000282020.4	+	11	1809	c.1551C>T	c.(1549-1551)gcC>gcT	p.A517A	GRID2_ENST00000510992.1_Silent_p.A422A	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	517					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		CTCAGAGAGCCGACATAGGGA	0.408													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18711	0.0		0.0	False		,,,				2504	0.0				p.A517A		.											.	GRID2-159	0			c.C1551T						.						58.0	60.0	59.0					4																	94376818		2203	4300	6503	SO:0001819	synonymous_variant	2895	exon11			GAGAGCCGACATA	AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1551C>T	4.37:g.94376818C>T		123	0		149	21	NM_001510	0	0	0	0	0	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Silent	SNP	ENST00000282020.4	37	CCDS3637.1																																																																																			.		0.408	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253588.2		
RAPGEF2	9693	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	160275135	160275135	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr4:160275135A>G	ENST00000264431.4	+	22	4524	c.4105A>G	c.(4105-4107)Acc>Gcc	p.T1369A		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	1369					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TACGGAAGAAACCAAGCCTGT	0.488																																					p.T1369A		.											.	RAPGEF2-637	0			c.A4105G						.						43.0	44.0	44.0					4																	160275135		1946	4153	6099	SO:0001583	missense	9693	exon22			GAAGAAACCAAGC	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.4105A>G	4.37:g.160275135A>G	ENSP00000264431:p.Thr1369Ala	86	0		131	46	NM_014247	1	0	1	3	1	D3DP27	Missense_Mutation	SNP	ENST00000264431.4	37	CCDS43277.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.967|3.967	-0.009184|-0.009184	0.07727|0.07727	.|.	.|.	ENSG00000109756|ENSG00000109756	ENST00000505026|ENST00000264431	.|T	.|0.36878	.|1.23	6.17|6.17	-2.93|-2.93	0.05598|0.05598	.|.	.|0.438573	.|0.28031	.|N	.|0.016866	T|T	0.15176|0.15176	0.0366|0.0366	N|N	0.22421|0.22421	0.69|0.69	0.20764|0.20764	N|N	0.999859|0.999859	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.14727|0.14727	-1.0462|-1.0462	5|10	.|0.16896	.|T	.|0.51	.|.	2.6806|2.6806	0.05093|0.05093	0.3973:0.1978:0.3088:0.0961|0.3973:0.1978:0.3088:0.0961	.|.	.|1369	.|Q9Y4G8	.|RPGF2_HUMAN	S|A	303|1369	.|ENSP00000264431:T1369A	.|ENSP00000264431:T1369A	N|T	+|+	2|1	0|0	RAPGEF2|RAPGEF2	160494585|160494585	0.036000|0.036000	0.19791|0.19791	0.118000|0.118000	0.21660|0.21660	0.059000|0.059000	0.15707|0.15707	-0.231000|-0.231000	0.09069|0.09069	-0.684000|-0.684000	0.05183|0.05183	0.533000|0.533000	0.62120|0.62120	AAC|ACC	.		0.488	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
DNAH5	1767	broad.mit.edu;bcgsc.ca	37	5	13845019	13845019	+	Missense_Mutation	SNP	G	G	A	rs146087064		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr5:13845019G>A	ENST00000265104.4	-	32	5302	c.5198C>T	c.(5197-5199)tCg>tTg	p.S1733L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1733	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GTGGGAGTCCGACGCCTGCCC	0.463									Kartagener syndrome				G|||	0	0.0	0.0	0.0	5008	,	,		18049	0.0		0.0	False		,,,				2504	0.0				p.S1733L		.											.	DNAH5-182	0			c.C5198T						.	G	LEU/SER	1,4405	4.2+/-10.8	0,1,2202	110.0	110.0	110.0		5198	5.1	0.4	5	dbSNP_134	110	0,8600		0,0,4300	no	missense	DNAH5	NM_001369.2	145	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1733/4625	13845019	1,13005	2203	4300	6503	SO:0001583	missense	1767	exon32	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GAGTCCGACGCCT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5198C>T	5.37:g.13845019G>A	ENSP00000265104:p.Ser1733Leu	155	0		219	10	NM_001369	0	0	0	0	0	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	37	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215149	0.79352	2.27E-4	0.0	ENSG00000039139	ENST00000265104	T	0.61859	0.07	5.09	5.09	0.68999	Dynein heavy chain, domain-2 (1);	0.138751	0.50627	D	0.000104	D	0.85186	0.5639	H	0.97758	4.07	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90855	0.4734	10	0.87932	D	0	.	18.588	0.91197	0.0:0.0:1.0:0.0	.	1733	Q8TE73	DYH5_HUMAN	L	1733	ENSP00000265104:S1733L	ENSP00000265104:S1733L	S	-	2	0	DNAH5	13898019	1.000000	0.71417	0.414000	0.26521	0.341000	0.28922	7.827000	0.86722	2.384000	0.81235	0.650000	0.86243	TCG	G|1.000;A|0.000		0.463	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
FBN2	2201	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	127863580	127863580	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr5:127863580T>A	ENST00000508053.1	-	10	1491	c.517A>T	c.(517-519)Act>Tct	p.T173S	FBN2_ENST00000262464.4_Missense_Mutation_p.T173S|FBN2_ENST00000508989.1_Missense_Mutation_p.T140S			P35556	FBN2_HUMAN	fibrillin 2	173	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCACAATAAGTTCCAATATAT	0.378																																					p.T173S		.											.	FBN2-146	0			c.A517T						.						89.0	81.0	84.0					5																	127863580		2203	4300	6503	SO:0001583	missense	2201	exon4			AATAAGTTCCAAT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.517A>T	5.37:g.127863580T>A	ENSP00000424571:p.Thr173Ser	131	0		172	20	NM_001999	0	0	0	0	0	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	37	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	T	2.518	-0.311415	0.05422	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989;ENST00000502468	D;D;D;T	0.85171	-1.78;-1.78;-1.95;0.15	4.06	1.64	0.23874	Epidermal growth factor-like (1);EGF-like region, conserved site (2);	0.612294	0.16116	N	0.228854	T	0.68696	0.3029	N	0.11698	0.16	0.20975	N	0.999816	B;B;B;B	0.11235	0.0;0.004;0.001;0.001	B;B;B;B	0.12156	0.001;0.007;0.002;0.001	T	0.51028	-0.8757	10	0.16420	T	0.52	.	9.0398	0.36311	0.0:0.248:0.0:0.752	.	140;173;140;173	P35556-2;E9PHW4;D6RJI3;P35556	.;.;.;FBN2_HUMAN	S	173;173;140;173	ENSP00000262464:T173S;ENSP00000424571:T173S;ENSP00000425596:T140S;ENSP00000424753:T173S	ENSP00000262464:T173S	T	-	1	0	FBN2	127891479	0.990000	0.36364	0.995000	0.50966	0.092000	0.18411	2.535000	0.45685	0.051000	0.15978	-2.200000	0.00306	ACT	.		0.378	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
GDF9	2661	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	132197395	132197395	+	Silent	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr5:132197395C>T	ENST00000378673.2	-	3	2117	c.1251G>A	c.(1249-1251)ccG>ccA	p.P417P	GDF9_ENST00000296875.2_Silent_p.P417P|GDF9_ENST00000464378.1_5'Flank			O60383	GDF9_HUMAN	growth differentiation factor 9	417					female gamete generation (GO:0007292)|negative regulation of cell growth (GO:0030308)|oocyte growth (GO:0001555)|positive regulation of cell proliferation (GO:0008284)|regulation of progesterone secretion (GO:2000870)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)	p.P417P(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	22		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GTACACATGACGGTCTTGGCA	0.483																																					p.P417P		.											.	GDF9-227	1	Substitution - coding silent(1)	cervix(1)	c.G1251A						.						139.0	113.0	122.0					5																	132197395		2203	4300	6503	SO:0001819	synonymous_variant	2661	exon2			ACATGACGGTCTT		CCDS4162.1, CCDS75299.1	5q31.1	2014-01-30			ENSG00000164404	ENSG00000164404		"""Endogenous ligands"""	4224	protein-coding gene	gene with protein product		601918				7760846	Standard	NM_005260		Approved		uc003kxz.1	O60383	OTTHUMG00000059842	ENST00000378673.2:c.1251G>A	5.37:g.132197395C>T		133	0		209	13	NM_005260	0	0	0	0	0	Q4VAW5	Silent	SNP	ENST00000378673.2	37	CCDS4162.1																																																																																			.		0.483	GDF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133060.2	NM_005260	
SEC24A	10802	broad.mit.edu	37	5	134022586	134022586	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr5:134022586T>A	ENST00000398844.2	+	10	1886	c.1598T>A	c.(1597-1599)cTg>cAg	p.L533Q	SEC24A_ENST00000322887.4_Missense_Mutation_p.L533Q	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	533					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTAGACAATCTGGATTTGTAA	0.303																																					p.L533Q		.											.	SEC24A-68	0			c.T1598A						.						106.0	93.0	97.0					5																	134022586		1824	4080	5904	SO:0001583	missense	10802	exon10			ACAATCTGGATTT	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.1598T>A	5.37:g.134022586T>A	ENSP00000381823:p.Leu533Gln	29	0		57	4	NM_001252231	0	0	0	0	0	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	37	CCDS43363.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.5|25.5	4.648795|4.648795	0.87958|0.87958	.|.	.|.	ENSG00000113615|ENSG00000113615	ENST00000398844;ENST00000322887|ENST00000513123	D;D|.	0.85773|.	-2.03;-2.03|.	5.8|5.8	5.8|5.8	0.92144|0.92144	Sec23/Sec24, trunk domain (1);|.	0.202288|.	0.43260|.	D|.	0.000592|.	D|D	0.88112|0.88112	0.6349|0.6349	H|H	0.96576|0.96576	3.845|3.845	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	D|D	0.92051|0.92051	0.5648|0.5648	10|5	0.87932|.	D|.	0|.	-10.0175|-10.0175	16.1502|16.1502	0.81611|0.81611	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	297;533|.	B4E205;O95486|.	.;SC24A_HUMAN|.	Q|R	533|79	ENSP00000381823:L533Q;ENSP00000321749:L533Q|.	ENSP00000321749:L533Q|.	L|W	+|+	2|1	0|0	SEC24A|SEC24A	134050485|134050485	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.671000|7.671000	0.83941|0.83941	2.203000|2.203000	0.70933|0.70933	0.460000|0.460000	0.39030|0.39030	CTG|TGG	.		0.303	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371563.1		
ABLIM3	22885	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	148624490	148624490	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr5:148624490C>G	ENST00000506113.1	+	15	1880	c.1398C>G	c.(1396-1398)agC>agG	p.S466R	RP11-331K21.1_ENST00000522685.1_RNA|ABLIM3_ENST00000326685.7_Missense_Mutation_p.S371R|AC012613.2_ENST00000523176.1_RNA|ABLIM3_ENST00000508983.1_Missense_Mutation_p.S433R|ABLIM3_ENST00000356541.3_Missense_Mutation_p.S355R|ABLIM3_ENST00000309868.7_Missense_Mutation_p.S466R|ABLIM3_ENST00000517451.1_5'UTR|ABLIM3_ENST00000504238.1_Missense_Mutation_p.S355R|RP11-331K21.1_ENST00000512647.2_RNA			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	466					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGACATCAGCCAGACCTCCA	0.542																																					p.S466R		.											.	ABLIM3-93	0			c.C1398G						.						170.0	150.0	157.0					5																	148624490		2203	4300	6503	SO:0001583	missense	22885	exon16			CATCAGCCAGACC	AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1398C>G	5.37:g.148624490C>G	ENSP00000425394:p.Ser466Arg	178	0		222	81	NM_014945	0	0	1	5	4	A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	ENST00000506113.1	37	CCDS4294.1	.	.	.	.	.	.	.	.	.	.	C	10.60	1.394888	0.25205	.	.	ENSG00000173210	ENST00000326685;ENST00000356541;ENST00000309868;ENST00000506113;ENST00000504238;ENST00000508983	T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47	5.2	2.26	0.28386	.	0.437967	0.27354	N	0.019741	T	0.09992	0.0245	N	0.03608	-0.345	0.36981	D	0.89427	B;B;B	0.27416	0.001;0.178;0.0	B;B;B	0.25759	0.007;0.063;0.001	T	0.13202	-1.0518	10	0.17832	T	0.49	.	2.9817	0.05955	0.2134:0.5232:0.1099:0.1535	.	371;355;466	O94929-3;O94929-2;O94929	.;.;ABLM3_HUMAN	R	371;355;466;466;355;433	ENSP00000315841:S371R;ENSP00000348938:S355R;ENSP00000310309:S466R;ENSP00000425394:S466R;ENSP00000421183:S355R;ENSP00000420855:S433R	ENSP00000310309:S466R	S	+	3	2	ABLIM3	148604683	0.856000	0.29760	1.000000	0.80357	0.997000	0.91878	-0.075000	0.11431	0.584000	0.29591	0.563000	0.77884	AGC	.		0.542	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373435.1	NM_014945	
HLA-B	3106	hgsc.bcm.edu	37	6	31323953	31323960	+	Frame_Shift_Del	DEL	CCAGCTTG	CCAGCTTG	-	rs113893121|rs151341334|rs151341333|rs1131279|rs137854786|rs1131275|rs1131285	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	CCAGCTTG	CCAGCTTG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:31323953_31323960delCCAGCTTG	ENST00000412585.2	-	3	631_638	c.603_610delCAAGCTGG	c.(601-612)gacaagctggagfs	p.DKL201fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	201	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CCAGCGCGCTCCAGCTTGTCCTTCCCGT	0.654									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.201_204del		.											.	HLA-B-90	0			c.603_610del						.																																			SO:0001589	frameshift_variant	3106	exon3	Familial Cancer Database	;Lichen Sclerosis, Familial	CGCGCTCCAGCTT	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.603_610delCAAGCTGG	6.37:g.31323953_31323960delCCAGCTTG	ENSP00000399168:p.Asp201fs	22	0		85	0	NM_005514	0	0	0	0	0	Q29764	Frame_Shift_Del	DEL	ENST00000412585.2	37	CCDS34394.1																																																																																			.		0.654	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
EYS	346007	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	65622395	65622395	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:65622395G>A	ENST00000370621.3	-	16	3149	c.2623C>T	c.(2623-2625)Cat>Tat	p.H875Y	EYS_ENST00000503581.1_Missense_Mutation_p.H875Y|EYS_ENST00000370616.2_Missense_Mutation_p.H875Y			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	875	EGF-like 12. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CAAATACAATGCTGATTTGCG	0.353																																					p.H875Y		.											.	EYS-660	0			c.C2623T						.						143.0	113.0	122.0					6																	65622395		692	1591	2283	SO:0001583	missense	346007	exon16			TACAATGCTGATT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2623C>T	6.37:g.65622395G>A	ENSP00000359655:p.His875Tyr	165	0		171	19	NM_001142800	0	0	0	0	0	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	37		.	.	.	.	.	.	.	.	.	.	G	1.297	-0.606100	0.03717	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.91521	-2.86;-2.86;-2.86	4.88	-3.51	0.04696	.	1.499370	0.04680	N	0.412163	T	0.48696	0.1514	N	0.04994	-0.135	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.57423	-0.7814	10	0.02654	T	1	.	2.0511	0.03571	0.3814:0.1065:0.3526:0.1595	.	875	Q5T1H1-1	.	Y	875	ENSP00000424243:H875Y;ENSP00000359655:H875Y;ENSP00000359650:H875Y	ENSP00000359650:H875Y	H	-	1	0	EYS	65679116	0.001000	0.12720	0.000000	0.03702	0.624000	0.37722	-0.452000	0.06787	-0.264000	0.09365	-0.367000	0.07326	CAT	.		0.353	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
ROS1	6098	broad.mit.edu	37	6	117622297	117622297	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:117622297C>T	ENST00000368508.3	-	42	6771	c.6573G>A	c.(6571-6573)tgG>tgA	p.W2191*	ROS1_ENST00000368507.3_Nonsense_Mutation_p.W2185*|RN7SKP51_ENST00000410781.1_RNA|RN7SKP18_ENST00000516005.1_RNA	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2191	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TCATTAAATTCCACCTAAATA	0.353			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.W2191X		.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1-1353	0			c.G6573A						.						81.0	86.0	84.0					6																	117622297		2203	4300	6503	SO:0001587	stop_gained	6098	exon42			TAAATTCCACCTA	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6573G>A	6.37:g.117622297C>T	ENSP00000357494:p.Trp2191*	52	0		69	3	NM_002944	0	0	0	0	0	Q15368|Q5TDB5	Nonsense_Mutation	SNP	ENST00000368508.3	37	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	C	47	13.275274	0.99731	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	.	.	.	5.01	5.01	0.66863	.	0.114465	0.41823	D	0.000806	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	11.8761	0.52548	0.1863:0.8137:0.0:0.0	.	.	.	.	X	2191;2185	.	ENSP00000357493:W2185X	W	-	3	0	ROS1	117728990	1.000000	0.71417	1.000000	0.80357	0.442000	0.32017	2.851000	0.48302	2.710000	0.92621	0.650000	0.86243	TGG	.		0.353	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
MAP3K5	4217	broad.mit.edu;bcgsc.ca	37	6	136913613	136913613	+	Silent	SNP	T	T	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:136913613T>C	ENST00000359015.4	-	22	3378	c.3018A>G	c.(3016-3018)ggA>ggG	p.G1006G	MAP3K5_ENST00000355845.4_Silent_p.G253G	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	1006			G -> R (in dbSNP:rs45626535). {ECO:0000269|PubMed:17344846}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		CATCTCTTTCTCCGCAGGACT	0.478																																					p.G1006G		.											.	MAP3K5-982	0			c.A3018G						.						137.0	137.0	137.0					6																	136913613		2203	4300	6503	SO:0001819	synonymous_variant	4217	exon22			TCTTTCTCCGCAG	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.3018A>G	6.37:g.136913613T>C		126	0		175	7	NM_005923	0	0	2	2	0	A6NIA0|B4DGB2|Q5THN3|Q99461	Silent	SNP	ENST00000359015.4	37	CCDS5179.1																																																																																			.		0.478	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		
PPIL4	85313	hgsc.bcm.edu	37	6	149862718	149862718	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:149862718G>T	ENST00000253329.2	-	2	107	c.75C>A	c.(73-75)tgC>tgA	p.C25*		NM_139126.3	NP_624311.1	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 4	25	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	13		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		AGAAATTCAAGCAGGCTGAAA	0.274																																					p.C25X		.											.	PPIL4-90	0			c.C75A						.						59.0	61.0	60.0					6																	149862718		2203	4300	6503	SO:0001587	stop_gained	85313	exon2			ATTCAAGCAGGCT		CCDS34550.1	6q25.1	2013-02-12			ENSG00000131013	ENSG00000131013		"""RNA binding motif (RRM) containing"""	15702	protein-coding gene	gene with protein product		607609					Standard	NM_139126		Approved		uc003qmo.2	Q8WUA2	OTTHUMG00000015788	ENST00000253329.2:c.75C>A	6.37:g.149862718G>T	ENSP00000253329:p.Cys25*	56	0		77	4	NM_139126	0	0	0	0	0	B2RD34|Q7Z3Q5	Nonsense_Mutation	SNP	ENST00000253329.2	37	CCDS34550.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.381438	0.82792	.	.	ENSG00000131013	ENST00000253329	.	.	.	5.57	1.76	0.24704	.	0.048633	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.3696	0.38246	0.466:0.0:0.534:0.0	.	.	.	.	X	25	.	ENSP00000253329:C25X	C	-	3	2	PPIL4	149904411	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.587000	0.36622	0.381000	0.24851	-0.136000	0.14681	TGC	.		0.274	PPIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042642.1		
SYNE1	23345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	6	152832157	152832157	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:152832157G>T	ENST00000367255.5	-	7	992	c.391C>A	c.(391-393)Cta>Ata	p.L131I	SYNE1_ENST00000448038.1_Missense_Mutation_p.L138I|SYNE1_ENST00000367253.4_Missense_Mutation_p.L131I|SYNE1_ENST00000413186.2_Missense_Mutation_p.L131I|SYNE1_ENST00000341594.5_Missense_Mutation_p.L131I|SYNE1_ENST00000367248.3_Missense_Mutation_p.L138I|SYNE1_ENST00000466159.2_Missense_Mutation_p.L131I|SYNE1_ENST00000423061.1_Missense_Mutation_p.L138I|SYNE1_ENST00000265368.4_Missense_Mutation_p.L131I	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	131	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGGAAATATAGAATAATGGTC	0.378										HNSCC(10;0.0054)																											p.L138I		.											.	SYNE1-607	0			c.C412A						.						170.0	173.0	172.0					6																	152832157		2203	4300	6503	SO:0001583	missense	23345	exon7			AATATAGAATAAT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.391C>A	6.37:g.152832157G>T	ENSP00000356224:p.Leu131Ile	153	0		190	23	NM_033071	0	0	0	0	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933123	0.73442	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	D;D;D;D;D;D;D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66;-3.66;-3.66;-3.66;-3.66;-3.66;-3.66	5.65	1.88	0.25563	Calponin homology domain (5);	0.000000	0.45126	D	0.000390	D	0.97139	0.9065	H	0.94771	3.58	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.998	D	0.96984	0.9717	10	0.87932	D	0	.	10.3651	0.44019	0.3324:0.0:0.6676:0.0	.	131;131;131;131;138	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	I	131;138;131;138;131;131;138;131;131;131	ENSP00000356224:L131I;ENSP00000396024:L138I;ENSP00000265368:L131I;ENSP00000390975:L138I;ENSP00000341887:L131I;ENSP00000356222:L131I;ENSP00000356217:L138I;ENSP00000414510:L131I;ENSP00000446021:L131I;ENSP00000441264:L131I	ENSP00000265368:L131I	L	-	1	2	SYNE1	152873850	1.000000	0.71417	0.455000	0.27031	0.972000	0.66771	3.236000	0.51336	0.748000	0.32831	0.637000	0.83480	CTA	.		0.378	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
MTRF1L	54516	broad.mit.edu;bcgsc.ca	37	6	153315693	153315693	+	Silent	SNP	G	G	C	rs369828849		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:153315693G>C	ENST00000367233.5	-	4	641	c.642C>G	c.(640-642)gtC>gtG	p.V214V	MTRF1L_ENST00000464135.1_5'UTR|MTRF1L_ENST00000367231.5_Silent_p.V214V|MTRF1L_ENST00000367230.1_Silent_p.V178V	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	214			V -> I (in dbSNP:rs3192723).			mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		TGCTAGTATGGACGCGGCCTT	0.517																																					p.V214V		.											.	MTRF1L-90	0			c.C642G						.						184.0	160.0	168.0					6																	153315693		2203	4300	6503	SO:0001819	synonymous_variant	54516	exon4			AGTATGGACGCGG	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.642C>G	6.37:g.153315693G>C		112	0		151	6	NM_019041	0	0	1	1	0	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Silent	SNP	ENST00000367233.5	37	CCDS5243.1																																																																																			.		0.517	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
IGF2R	3482	broad.mit.edu;bcgsc.ca	37	6	160450598	160450598	+	Missense_Mutation	SNP	G	G	A	rs199715599		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:160450598G>A	ENST00000356956.1	+	7	941	c.793G>A	c.(793-795)Gtg>Atg	p.V265M		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	265					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CCTGAGTTACGTGAGGGAAGA	0.463																																					p.V265M		.											.	IGF2R-118	0			c.G793A						.						113.0	99.0	104.0					6																	160450598		2203	4300	6503	SO:0001583	missense	3482	exon7			AGTTACGTGAGGG	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.793G>A	6.37:g.160450598G>A	ENSP00000349437:p.Val265Met	103	0		136	6	NM_000876	0	0	1	1	0	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	ENST00000356956.1	37	CCDS5273.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232855	0.39498	.	.	ENSG00000197081	ENST00000356956	T	0.14516	2.5	4.91	3.97	0.46021	Mannose-6-phosphate receptor, binding (1);	0.343543	0.29699	N	0.011438	T	0.11665	0.0284	M	0.66939	2.045	0.37494	D	0.916507	P	0.47762	0.9	P	0.45881	0.496	T	0.03969	-1.0988	10	0.32370	T	0.25	-34.7656	13.3849	0.60791	0.0:0.0:0.8423:0.1577	.	265	P11717	MPRI_HUMAN	M	265	ENSP00000349437:V265M	ENSP00000349437:V265M	V	+	1	0	IGF2R	160370588	0.988000	0.35896	0.856000	0.33681	0.974000	0.67602	2.286000	0.43496	2.433000	0.82419	0.655000	0.94253	GTG	.		0.463	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042931.1	NM_000876	
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		0	0		5	4	NM_175922	0	0	0	0	0		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
VWDE	221806	bcgsc.ca	37	7	12414725	12414725	+	Nonsense_Mutation	SNP	G	G	A	rs17165936	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr7:12414725G>A	ENST00000275358.3	-	8	1341	c.1153C>T	c.(1153-1155)Cga>Tga	p.R385*		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	385						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TCTCCATCTCGAGAAAAATCT	0.428													G|||	835	0.166733	0.1997	0.0893	5008	,	,		13901	0.2004		0.1034	False		,,,				2504	0.2076				p.R385X		.											.	VWDE-68	0			c.C1153T						.	G	stop/ARG	289,1095		34,221,437	128.0	110.0	116.0		1153	3.8	0.6	7	dbSNP_123	116	362,2818		20,322,1248	yes	stop-gained	VWDE	NM_001135924.1		54,543,1685	AA,AG,GG		11.3836,20.8815,14.2638		385/1591	12414725	651,3913	692	1590	2282	SO:0001587	stop_gained	221806	exon8			CATCTCGAGAAAA		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.1153C>T	7.37:g.12414725G>A	ENSP00000275358:p.Arg385*	134	0		183	6	NM_001135924	0	0	0	0	0	B7ZM77|Q96SQ3	Nonsense_Mutation	SNP	ENST00000275358.3	37	CCDS47544.1	356	0.163003663003663	99	0.20121951219512196	33	0.09116022099447514	138	0.24125874125874125	86	0.11345646437994723	G	38	6.658276	0.97739	0.208815	0.113836	ENSG00000146530	ENST00000275358	.	.	.	4.68	3.78	0.43462	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2026	0.59776	0.0:0.3035:0.6965:0.0	rs17165936;rs57342406;rs17165936	.	.	.	X	385	.	ENSP00000275358:R385X	R	-	1	2	VWDE	12381250	0.012000	0.17670	0.601000	0.28877	0.592000	0.36648	1.788000	0.38714	1.164000	0.42652	0.585000	0.79938	CGA	G|0.840;A|0.160		0.428	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
SP8	221833	broad.mit.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022				p.165_165del		.											.	SP8-91	2	Deletion - In frame(2)	central_nervous_system(2)	c.493_495del						.		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833	exon2			GGAGGAGCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	4	0		39	8	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
CHN2	1124	bcgsc.ca	37	7	29407600	29407600	+	Silent	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr7:29407600G>T	ENST00000222792.6	+	3	671	c.141G>T	c.(139-141)cgG>cgT	p.R47R	CHN2_ENST00000539389.1_Silent_p.R47R|CHN2_ENST00000435288.2_Silent_p.R47R|CHN2_ENST00000495789.2_Silent_p.R60R|CHN2_ENST00000539406.1_Silent_p.R122R|CHN2_ENST00000546235.1_Silent_p.R32R	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2	47					positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						TTTGTCCTCGGGAGGTCAGTG	0.408																																					p.R47R	Ovarian(1;44 48 13232 18918 31480)	.											.	CHN2-229	0			c.G141T						.						115.0	112.0	113.0					7																	29407600		2203	4300	6503	SO:0001819	synonymous_variant	1124	exon3			TCCTCGGGAGGTC	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.141G>T	7.37:g.29407600G>T		59	0		60	4	NM_004067	0	0	0	0	0	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Silent	SNP	ENST00000222792.6	37	CCDS5420.1																																																																																			.		0.408	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067	
CHN2	1124	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	29519803	29519803	+	Intron	SNP	G	G	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr7:29519803G>A	ENST00000222792.6	+	7	1106				CHN2_ENST00000409041.4_Missense_Mutation_p.R26H|CHN2_ENST00000424025.2_Missense_Mutation_p.R26H|CHN2_ENST00000539389.1_Intron|CHN2_ENST00000435288.2_Intron|CHN2_ENST00000495789.2_Intron|CHN2_ENST00000439711.2_Missense_Mutation_p.R26H|CHN2_ENST00000421775.2_Missense_Mutation_p.R26H|CHN2_ENST00000539406.1_Intron|CHN2_ENST00000546235.1_Intron	NM_004067.2	NP_004058.1	P52757	CHIO_HUMAN	chimerin 2						positive regulation of GTPase activity (GO:0043547)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(3)|large_intestine(2)|lung(12)|ovary(2)|urinary_tract(2)	23						GGCAGGAAACGCCAAGAACTG	0.532																																					p.R26H	Ovarian(1;44 48 13232 18918 31480)	.											.	CHN2-229	0			c.G77A						.						116.0	128.0	124.0					7																	29519803		1327	2309	3636	SO:0001627	intron_variant	1124	exon1			GGAAACGCCAAGA	L29126	CCDS5420.1	7p15.3	2013-02-14	2012-10-17		ENSG00000106069	ENSG00000106069		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1944	protein-coding gene	gene with protein product	"""beta chimerin"", ""chimaerin 2"""	602857	"""chimerin (chimaerin) 2"""			8175705	Standard	XM_005249602		Approved	ARHGAP3, RhoGAP3	uc003szz.3	P52757	OTTHUMG00000023063	ENST00000222792.6:c.577-92G>A	7.37:g.29519803G>A		220	0		307	52	NM_001039936	0	0	0	0	0	A4D1A2|B3VCF1|B3VCF2|B3VCF3|B3VCF7|B3VCG1|C9J7B0|E9PGE0|F8QPL9|Q2M203|Q75MM2	Missense_Mutation	SNP	ENST00000222792.6	37	CCDS5420.1	.	.	.	.	.	.	.	.	.	.	G	11.49	1.655023	0.29425	.	.	ENSG00000106069	ENST00000409041;ENST00000424025;ENST00000439711;ENST00000421775	T;T;T;T	0.75589	-0.44;-0.04;-0.95;0.18	5.64	4.76	0.60689	.	.	.	.	.	T	0.81508	0.4837	L	0.50333	1.59	0.27348	N	0.956324	D;D;B;D;B;D;B;B	0.65815	0.987;0.967;0.013;0.995;0.018;0.992;0.014;0.018	P;P;B;P;B;P;B;B	0.61800	0.579;0.482;0.003;0.469;0.003;0.894;0.002;0.003	T	0.75007	-0.3469	9	0.49607	T	0.09	.	15.9203	0.79562	0.0:0.0:0.8635:0.1365	.	26;26;26;26;26;26;26;26	B3VCF1;B3VCF2;B3VCF5;B3VCF4;B3VCF7;B3VCF3;B3VCF6;E9PGE0	.;.;.;.;.;.;.;.	H	26	ENSP00000386849:R26H;ENSP00000406337:R26H;ENSP00000387425:R26H;ENSP00000394284:R26H	ENSP00000386849:R26H	R	+	2	0	CHN2	29486328	1.000000	0.71417	0.991000	0.47740	0.071000	0.16799	3.582000	0.53921	1.509000	0.48786	-0.188000	0.12872	CGC	.		0.532	CHN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000214228.2	NM_004067	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000584372.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		7	7	NM_002047	0	0	0	1	1	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
RBM48	84060	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	92164285	92164285	+	Splice_Site	SNP	G	G	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr7:92164285G>T	ENST00000265732.5	+	4	1058		c.e4+1		RBM48_ENST00000481551.1_Missense_Mutation_p.V340L	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48							nucleus (GO:0005634)	RNA binding (GO:0003723)										ACTTAAAGAGGTAAGGTTATT	0.318																																					.		.											.	.	0			c.1017+1G>T						.						30.0	29.0	30.0					7																	92164285		1807	4071	5878	SO:0001630	splice_region_variant	84060	exon4			AAAGAGGTAAGGT	AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.1017+1G>T	7.37:g.92164285G>T		107	0		124	13	NM_032120	0	0	1	1	0	B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Splice_Site	SNP	ENST00000265732.5	37	CCDS43615.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|G	16.67|16.67	3.187708|3.187708	0.57909|0.57909	.|.	.|.	ENSG00000127993|ENSG00000127993	ENST00000265732;ENST00000450580|ENST00000481551	.|.	.|.	.|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	.|.	.|.	.|.	.|.	.|T	.|0.79947	.|0.4534	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.78314	.|0.991	.|T	.|0.80077	.|-0.1533	.|6	.|.	.|.	.|.	.|-0.3204	18.7127|18.7127	0.91664|0.91664	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|340	.|B7Z2K5	.|.	.|L	-1|340	.|.	.|.	.|V	+|+	.|1	.|0	C7orf64|C7orf64	92002221|92002221	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.472000|0.472000	0.32918|0.32918	8.952000|8.952000	0.93031|0.93031	2.656000|2.656000	0.90262|0.90262	0.460000|0.460000	0.39030|0.39030	.|GTA	.		0.318	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356076.1	NM_032120	Intron
TRRAP	8295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	98581870	98581870	+	Silent	SNP	G	G	C			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr7:98581870G>C	ENST00000359863.4	+	60	9398	c.9189G>C	c.(9187-9189)cgG>cgC	p.R3063R	TRRAP_ENST00000446306.3_Silent_p.R3034R|TRRAP_ENST00000355540.3_Silent_p.R3034R	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3063	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TATTAAGTCGGATTCATACTA	0.463																																					p.R3063R		.											.	TRRAP-923	0			c.G9189C						.						187.0	172.0	177.0					7																	98581870		2203	4300	6503	SO:0001819	synonymous_variant	8295	exon60			AAGTCGGATTCAT	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.9189G>C	7.37:g.98581870G>C		151	0		204	16	NM_001244580	0	0	1	1	0	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	37	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	G	8.317	0.823387	0.16678	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.26	-7.42	0.01388	.	.	.	.	.	T	0.45538	0.1347	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47898	-0.9081	4	.	.	.	.	6.0445	0.19752	0.1781:0.4968:0.0957:0.2294	.	.	.	.	A	2774	.	.	G	+	2	0	TRRAP	98419806	0.000000	0.05858	0.660000	0.29694	0.994000	0.84299	-3.122000	0.00594	-1.875000	0.01132	-0.262000	0.10625	GGA	.		0.463	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
PTPRN2	5799	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	157333452	157333452	+	Missense_Mutation	SNP	C	C	T	rs138836883		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr7:157333452C>T	ENST00000389418.4	-	23	3013	c.3004G>A	c.(3004-3006)Gtg>Atg	p.V1002M	PTPRN2_ENST00000389413.3_Missense_Mutation_p.V973M|PTPRN2_ENST00000404321.2_Missense_Mutation_p.V1025M|PTPRN2_ENST00000389416.4_Missense_Mutation_p.V985M|PTPRN2_ENST00000409483.1_Missense_Mutation_p.V964M	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	1002	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TCCTCAGCCACGGCTGTCAGC	0.657																																					p.V1002M		.											.	PTPRN2-295	0			c.G3004A						.		MET/VAL,MET/VAL,MET/VAL	1,4389		0,1,2194	25.0	25.0	25.0		3004,2953,2917	4.7	0.9	7	dbSNP_134	25	0,8576		0,0,4288	no	missense,missense,missense	PTPRN2	NM_002847.3,NM_130842.2,NM_130843.2	21,21,21	0,1,6482	TT,TC,CC		0.0,0.0228,0.0077	probably-damaging,probably-damaging,probably-damaging	1002/1016,985/999,973/987	157333452	1,12965	2195	4288	6483	SO:0001583	missense	5799	exon23			CAGCCACGGCTGT	AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.3004G>A	7.37:g.157333452C>T	ENSP00000374069:p.Val1002Met	162	0		267	20	NM_002847	0	0	10	11	1	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Missense_Mutation	SNP	ENST00000389418.4	37	CCDS5947.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.602298	0.87055	2.28E-4	0.0	ENSG00000155093	ENST00000409483;ENST00000389413;ENST00000389416;ENST00000389418;ENST00000404321	D;D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92	4.66	4.66	0.58398	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.64402	D	0.000001	D	0.92344	0.7571	M	0.78456	2.415	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.981;0.989;0.969;1.0;0.982	D	0.93293	0.6670	10	0.66056	D	0.02	.	17.927	0.88986	0.0:1.0:0.0:0.0	.	1025;964;973;985;1002	Q92932-3;E7EM83;Q92932-2;E9PC57;Q92932	.;.;.;.;PTPR2_HUMAN	M	964;973;985;1002;1025	ENSP00000387114:V964M;ENSP00000374064:V973M;ENSP00000374067:V985M;ENSP00000374069:V1002M;ENSP00000385464:V1025M	ENSP00000374064:V973M	V	-	1	0	PTPRN2	157026213	1.000000	0.71417	0.931000	0.37212	0.761000	0.43186	7.052000	0.76634	2.307000	0.77673	0.561000	0.74099	GTG	C|1.000;T|0.000		0.657	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353214.1		
EBF2	64641	broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	25708132	25708132	+	Silent	SNP	G	G	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr8:25708132G>A	ENST00000520164.1	-	15	2211	c.1674C>T	c.(1672-1674)agC>agT	p.S558S	EBF2_ENST00000408929.3_Silent_p.S410S|EBF2_ENST00000535548.1_3'UTR	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	558					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TTCCATTGCCGCTGGAGCAGG	0.488																																					p.S558S	Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	.											.	EBF2-26	0			c.C1674T						.						127.0	125.0	126.0					8																	25708132		1948	4136	6084	SO:0001819	synonymous_variant	64641	exon15			ATTGCCGCTGGAG	AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1674C>T	8.37:g.25708132G>A		209	1		152	18	NM_022659	0	0	1	1	0	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Silent	SNP	ENST00000520164.1	37	CCDS43726.1																																																																																			.		0.488	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375886.2	NM_022659	
ADAM2	2515	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	39634610	39634610	+	Missense_Mutation	SNP	A	A	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr8:39634610A>T	ENST00000265708.4	-	11	1065	c.962T>A	c.(961-963)aTc>aAc	p.I321N	ADAM2_ENST00000347580.4_Missense_Mutation_p.I302N|ADAM2_ENST00000379853.2_Missense_Mutation_p.I195N|ADAM2_ENST00000521880.1_Missense_Mutation_p.I321N	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	321	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.			I -> T (in Ref. 1; AAC51110). {ECO:0000305}.	adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		ATCATAAGTGATCCCCATACT	0.353																																					p.I321N		.											.	ADAM2-227	0			c.T962A						.						75.0	72.0	73.0					8																	39634610		2203	4300	6503	SO:0001583	missense	2515	exon11			TAAGTGATCCCCA	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.962T>A	8.37:g.39634610A>T	ENSP00000265708:p.Ile321Asn	80	0		84	7	NM_001464	0	0	0	1	1	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	37	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	A	12.39	1.924431	0.34002	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.58	5.58	0.84498	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	D	0.83211	0.5205	M	0.86953	2.85	0.09310	N	1	D;D;D;D	0.89917	0.995;1.0;0.993;0.995	D;D;D;D	0.77004	0.981;0.989;0.967;0.986	T	0.76669	-0.2874	8	.	.	.	.	12.1357	0.53970	1.0:0.0:0.0:0.0	.	321;195;302;321	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	N	302;195;321;321	ENSP00000343854:I302N;ENSP00000369182:I195N;ENSP00000265708:I321N;ENSP00000429352:I321N	.	I	-	2	0	ADAM2	39753767	0.323000	0.24643	0.103000	0.21229	0.068000	0.16541	4.542000	0.60677	2.121000	0.65114	0.528000	0.53228	ATC	.		0.353	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
CHRNB3	1142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	42586825	42586825	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr8:42586825C>A	ENST00000289957.2	+	5	503	c.375C>A	c.(373-375)ttC>ttA	p.F125L		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	125					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)	p.F125F(2)		endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	ACGGCCGCTTCGAAGGCTCCC	0.507																																					p.F125L		.											.	CHRNB3-91	2	Substitution - coding silent(2)	large_intestine(2)	c.C375A						.						49.0	48.0	48.0					8																	42586825		2203	4300	6503	SO:0001583	missense	1142	exon5			CCGCTTCGAAGGC	U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.375C>A	8.37:g.42586825C>A	ENSP00000289957:p.Phe125Leu	112	0		106	61	NM_000749	0	0	0	0	0	Q15827	Missense_Mutation	SNP	ENST00000289957.2	37	CCDS6134.1	.	.	.	.	.	.	.	.	.	.	c	13.14	2.147648	0.37923	.	.	ENSG00000147432	ENST00000289957	T	0.79454	-1.27	5.35	-5.04	0.02964	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.84347	0.5452	M	0.71581	2.175	0.51482	D	0.999925	D	0.76494	0.999	D	0.87578	0.998	D	0.83923	0.0302	10	0.87932	D	0	.	15.8638	0.79047	0.0:0.2906:0.0:0.7094	.	125	Q05901	ACHB3_HUMAN	L	125	ENSP00000289957:F125L	ENSP00000289957:F125L	F	+	3	2	CHRNB3	42705982	0.334000	0.24739	0.584000	0.28653	0.081000	0.17604	-0.346000	0.07760	-1.335000	0.02241	-1.484000	0.00983	TTC	.		0.507	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383055.1		
PXDNL	137902	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	52321748	52321748	+	Silent	SNP	G	G	A			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr8:52321748G>A	ENST00000356297.4	-	17	2536	c.2436C>T	c.(2434-2436)caC>caT	p.H812H	PXDNL_ENST00000543296.1_Silent_p.H812H	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	812					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGTCCAAGTCGTGCTCTAGAA	0.677																																					p.H812H		.											.	PXDNL-70	0			c.C2436T						.						15.0	19.0	18.0					8																	52321748		2124	4234	6358	SO:0001819	synonymous_variant	137902	exon17			CAAGTCGTGCTCT		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2436C>T	8.37:g.52321748G>A		17	0		26	5	NM_144651	0	0	0	0	0	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	ENST00000356297.4	37	CCDS47855.1																																																																																			.		0.677	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
E2F5	1875	hgsc.bcm.edu	37	8	86089787	86089787	+	Silent	SNP	C	C	G	rs12926	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr8:86089787C>G	ENST00000416274.2	+	1	166	c.132C>G	c.(130-132)gcC>gcG	p.A44A	E2F5_ENST00000256117.5_Silent_p.A44A|RP11-219B4.3_ENST00000520129.1_RNA|RP11-219B4.7_ENST00000566000.1_RNA|RP11-219B4.7_ENST00000562577.1_RNA|E2F5_ENST00000418930.2_Silent_p.A44A	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	44					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						TCGGGGGCGCCGGGGGCGGCA	0.751													C|||	2815	0.562101	0.5545	0.549	5008	,	,		6370	0.4157		0.6928	False		,,,				2504	0.5982				p.A44A		.											.	E2F5-415	0			c.C132G						.	C	,	2392,1558		800,792,383	4.0	5.0	5.0		132,132	0.9	0.1	8	dbSNP_52	5	5668,2428		2076,1516,456	no	coding-synonymous,coding-synonymous	E2F5	NM_001083588.1,NM_001951.3	,	2876,2308,839	GG,GC,CC		29.9901,39.443,33.0898	,	44/346,44/347	86089787	8060,3986	1975	4048	6023	SO:0001819	synonymous_variant	1875	exon1			GGGCGCCGGGGGC	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.132C>G	8.37:g.86089787C>G		0	0		4	4	NM_001083588	0	0	0	0	0	E9PBN9|Q16601|Q92756	Silent	SNP	ENST00000416274.2	37	CCDS47885.1																																																																																			C|0.434;G|0.566		0.751	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380274.1	NM_001951	
ESRP1	54845	bcgsc.ca	37	8	95655596	95655596	+	Silent	SNP	T	T	C	rs72676907	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr8:95655596T>C	ENST00000433389.2	+	3	517	c.327T>C	c.(325-327)gaT>gaC	p.D109D	ESRP1_ENST00000454170.2_Silent_p.D109D|ESRP1_ENST00000423620.2_Silent_p.D109D|ESRP1_ENST00000358397.5_Silent_p.D109D	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	109					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						TCTGTACTGATGGGCAGCTTC	0.468													T|||	323	0.0644968	0.0053	0.0735	5008	,	,		19201	0.002		0.1968	False		,,,				2504	0.0665				p.D109D		.											.	ESRP1-94	0			c.T327C						.	T	,,,,	127,3771		4,119,1826	110.0	106.0	107.0		327,327,327,327,327	-2.6	0.9	8	dbSNP_130	107	1501,6773		135,1231,2771	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ESRP1	NM_001034915.2,NM_001122825.1,NM_001122826.1,NM_001122827.1,NM_017697.3	,,,,	139,1350,4597	CC,CT,TT		18.1412,3.2581,13.375	,,,,	109/678,109/609,109/660,109/605,109/682	95655596	1628,10544	1949	4137	6086	SO:0001819	synonymous_variant	54845	exon3			TACTGATGGGCAG	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.327T>C	8.37:g.95655596T>C		156	0		157	6	NM_001122827	0	0	0	0	0	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Silent	SNP	ENST00000433389.2	37	CCDS47897.1																																																																																			T|0.887;C|0.113		0.468	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379326.1	NM_017697	
SMARCA2	6595	bcgsc.ca	37	9	2191309	2191309	+	Missense_Mutation	SNP	C	C	G	rs2296212	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr9:2191309C>G	ENST00000382203.1	+	33	4847	c.4638C>G	c.(4636-4638)gaC>gaG	p.D1546E	SMARCA2_ENST00000382194.1_Missense_Mutation_p.D1528E|SMARCA2_ENST00000382186.1_Missense_Mutation_p.D210E|SMARCA2_ENST00000324954.5_Missense_Mutation_p.D192E|SMARCA2_ENST00000357248.2_Missense_Mutation_p.D1528E|SMARCA2_ENST00000382185.1_Missense_Mutation_p.D192E|SMARCA2_ENST00000302401.3_Missense_Mutation_p.D234E|SMARCA2_ENST00000349721.2_Missense_Mutation_p.D1546E			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1546			D -> E (in dbSNP:rs2296212).		aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AAAAAGATGACAAAGGCCGGG	0.413													G|||	1120	0.223642	0.3071	0.2061	5008	,	,		20895	0.2163		0.0984	False		,,,				2504	0.2597				p.D1546E		.											.	SMARCA2-653	0			c.C4638G						.	G	GLU/ASP,GLU/ASP	1187,3219	710.9+/-407.9	149,889,1165	111.0	95.0	100.0	http://omim.org/entry/600014	4584,4638	3.8	1.0	9	dbSNP_100	100	962,7638	775.6+/-407.7	53,856,3391	yes	missense,missense	SMARCA2	NM_139045.2,NM_003070.3	45,45	202,1745,4556	GG,GC,CC		11.186,26.9405,16.5231	benign,benign	1528/1573,1546/1591	2191309	2149,10857	2203	4300	6503	SO:0001583	missense	6595	exon33			AGATGACAAAGGC	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.4638C>G	9.37:g.2191309C>G	ENSP00000371638:p.Asp1546Glu	240	0		170	6	NM_003070	0	0	3	3	0	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	37	CCDS34977.1	397	0.18177655677655677	143	0.29065040650406504	70	0.19337016574585636	115	0.20104895104895104	69	0.09102902374670185	G	5.237	0.229183	0.09916	0.269405	0.11186	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194;ENST00000302401;ENST00000324954;ENST00000382186;ENST00000417599;ENST00000382185;ENST00000382183;ENST00000382182	D;D;D;D;T;T;T;T;T;T	0.86956	-2.19;-2.13;-2.19;-2.13;3.19;3.34;3.12;3.35;3.34;3.34	5.71	3.76	0.43208	.	0.232312	0.35466	N	0.003181	T	0.00012	0.0000	N	0.03115	-0.41	0.49798	P	1.7100000000003224E-4	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.04090	-1.0978	9	0.02654	T	1	-24.9	12.6243	0.56620	0.0717:0.5959:0.3323:0.0	rs2296212;rs2296212	232;234;1528;1546	B4DNT1;B1ALF6;P51531-2;P51531	.;.;.;SMCA2_HUMAN	E	1546;1528;1546;1528;234;192;210;232;192;192;75	ENSP00000265773:D1546E;ENSP00000349788:D1528E;ENSP00000371638:D1546E;ENSP00000371629:D1528E;ENSP00000305411:D234E;ENSP00000324770:D192E;ENSP00000371621:D210E;ENSP00000387486:D232E;ENSP00000371620:D192E;ENSP00000371618:D192E	ENSP00000305411:D234E	D	+	3	2	SMARCA2	2181309	0.982000	0.34865	1.000000	0.80357	0.994000	0.84299	0.094000	0.15107	0.742000	0.32697	-0.127000	0.14921	GAC	C|0.831;G|0.169		0.413	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
KDM4C	23081	bcgsc.ca	37	9	7174673	7174673	+	Missense_Mutation	SNP	G	G	A	rs913588	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr9:7174673G>A	ENST00000381309.3	+	22	3680	c.3115G>A	c.(3115-3117)Gta>Ata	p.V1039I	KDM4C_ENST00000428870.2_Missense_Mutation_p.V726I|KDM4C_ENST00000442236.2_Missense_Mutation_p.V784I	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	1039			V -> I (in dbSNP:rs913588). {ECO:0000269|PubMed:15489334}.		histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GGCCGACCCTGTATACCGCAC	0.468													G|||	1594	0.318291	0.3215	0.3919	5008	,	,		19345	0.1151		0.4751	False		,,,				2504	0.3098				p.V1039I		.											.	KDM4C-228	0			c.G3115A						.	G	ILE/VAL	1546,2860	488.0+/-361.1	271,1004,928	165.0	170.0	168.0		3115	4.7	1.0	9	dbSNP_86	168	4279,4321	576.0+/-390.3	1074,2131,1095	yes	missense	KDM4C	NM_015061.3	29	1345,3135,2023	AA,AG,GG		49.7558,35.0885,44.787	benign	1039/1057	7174673	5825,7181	2203	4300	6503	SO:0001583	missense	23081	exon22			GACCCTGTATACC	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.3115G>A	9.37:g.7174673G>A	ENSP00000370710:p.Val1039Ile	169	2		122	6	NM_015061	0	0	3	3	0	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	37	CCDS6471.1	753	0.3447802197802198	165	0.3353658536585366	133	0.3674033149171271	75	0.13111888111888112	380	0.5013192612137203	G	11.78	1.740653	0.30865	0.350885	0.497558	ENSG00000107077	ENST00000381309;ENST00000442236;ENST00000428870	T;T;T	0.34275	1.37;1.37;1.37	5.69	4.74	0.60224	.	0.240620	0.33005	N	0.005393	T	0.00012	0.0000	N	0.01874	-0.695	0.47153	P	6.610000000000227E-4	B;B	0.30406	0.278;0.011	B;B	0.24974	0.057;0.006	T	0.33420	-0.9869	9	0.32370	T	0.25	-13.4956	11.1935	0.48698	0.0:0.1374:0.7201:0.1425	rs913588;rs17597498;rs56477554;rs59891141;rs913588	784;1039	E7EV17;Q9H3R0	.;KDM4C_HUMAN	I	1039;784;726	ENSP00000370710:V1039I;ENSP00000409353:V784I;ENSP00000405739:V726I	ENSP00000370710:V1039I	V	+	1	0	KDM4C	7164673	0.447000	0.25673	0.994000	0.49952	0.875000	0.50365	2.329000	0.43876	2.671000	0.90904	0.591000	0.81541	GTA	G|0.609;A|0.391		0.468	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
SYK	6850	bcgsc.ca	37	9	93640009	93640009	+	Silent	SNP	G	G	A	rs2290887	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr9:93640009G>A	ENST00000375754.4	+	10	1486	c.1338G>A	c.(1336-1338)ctG>ctA	p.L446L	SYK_ENST00000375751.4_Silent_p.L423L|SYK_ENST00000375747.1_Silent_p.L423L|SYK_ENST00000375746.1_Silent_p.L446L	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	446	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						CCTGGATGCTGGTTATGGAGA	0.502			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""								G|||	982	0.196086	0.2095	0.366	5008	,	,		20829	0.2321		0.1362	False		,,,				2504	0.0818				p.L446L		.		Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	.	SYK-1402	0			c.G1338A						.	G	,,,	928,3478	355.1+/-312.9	91,746,1366	138.0	116.0	123.0		1269,1338,1269,1338	3.7	1.0	9	dbSNP_100	123	1215,7385	245.3+/-274.2	88,1039,3173	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SYK	NM_001135052.2,NM_001174167.1,NM_001174168.1,NM_003177.5	,,,	179,1785,4539	AA,AG,GG		14.1279,21.0622,16.477	,,,	423/613,446/636,423/613,446/636	93640009	2143,10863	2203	4300	6503	SO:0001819	synonymous_variant	6850	exon10			GATGCTGGTTATG	L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.1338G>A	9.37:g.93640009G>A		258	0		200	7	NM_003177	0	0	0	0	0		Silent	SNP	ENST00000375754.4	37	CCDS6688.1																																																																																			G|0.824;A|0.176		0.502	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053018.1		
AKAP2	11217	hgsc.bcm.edu	37	9	112811038	112811038	+	Missense_Mutation	SNP	C	C	T	rs78923754	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr9:112811038C>T	ENST00000374525.1	+	1	63	c.59C>T	c.(58-60)cCg>cTg	p.P20L	AKAP2_ENST00000434623.2_Missense_Mutation_p.P20L|PALM2-AKAP2_ENST00000302798.7_Intron|PALM2-AKAP2_ENST00000374530.3_Intron|AKAP2_ENST00000555236.1_Intron|AKAP2_ENST00000510514.5_Intron	NM_001004065.4	NP_001004065.2	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	374										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CCTGGACCCCCGGAGTCTCCT	0.776													-|||	379	0.0756789	0.0703	0.0879	5008	,	,		9335	0.0298		0.0954	False		,,,				2504	0.1012				p.P20L		.											.	AKAP2-24	0			c.C59T						.	C	LEU/PRO,LEU/PRO,,	146,2418		2,142,1138	2.0	3.0	2.0		59,59,,	0.3	0.0	9	dbSNP_132	2	557,5611		13,531,2540	no	missense,missense,intron,intron	AKAP2,PALM2-AKAP2	NM_001004065.4,NM_001198656.1,NM_007203.4,NM_147150.2	98,98,,	15,673,3678	TT,TC,CC		9.0305,5.6942,8.0508	,,,	20/949,20/962,,	112811038	703,8029	1282	3084	4366	SO:0001583	missense	11217	exon1			GACCCCCGGAGTC	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000374525.1:c.59C>T	9.37:g.112811038C>T	ENSP00000363649:p.Pro20Leu	0	0		10	10	NM_001004065	0	0	0	0	0	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	ENST00000374525.1	37	CCDS43861.1	184	0.08424908424908426	48	0.0975609756097561	42	0.11602209944751381	16	0.027972027972027972	78	0.10290237467018469	-	6.449	0.450901	0.12223	0.056942	0.090305	ENSG00000241978	ENST00000434623;ENST00000374525	T;T	0.44482	1.5;0.92	3.3	0.302	0.15786	.	.	.	.	.	T	0.00412	0.0013	.	.	.	0.58432	P	5.000000000032756E-6	B;B	0.11235	0.001;0.004	B;B	0.04013	0.001;0.001	T	0.06972	-1.0797	7	0.72032	D	0.01	-9.3294	7.3755	0.26825	0.0:0.6472:0.0:0.3528	.	20;21	Q9Y2D5-7;B1ALY1	.;.	L	20	ENSP00000404782:P20L;ENSP00000363649:P20L	ENSP00000363649:P20L	P	+	2	0	AKAP2	111850859	0.208000	0.23494	0.001000	0.08648	0.000000	0.00434	0.026000	0.13599	-0.068000	0.12953	-1.980000	0.00456	CCG	C|0.917;T|0.083		0.776	AKAP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000053609.3	NM_001004065	
PRDM12	59335	bcgsc.ca	37	9	133553993	133553993	+	Silent	SNP	C	C	T	rs7021384	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr9:133553993C>T	ENST00000253008.2	+	4	708	c.648C>T	c.(646-648)ccC>ccT	p.P216P		NM_021619.2	NP_067632.2	Q9H4Q4	PRD12_HUMAN	PR domain containing 12	216					neurogenesis (GO:0022008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	11		all_hematologic(13;0.0433)|Acute lymphoblastic leukemia(5;0.0534)		OV - Ovarian serous cystadenocarcinoma(145;0.000344)		CAGGTGTGCCCGGGCTAGAGG	0.592													C|||	1893	0.377995	0.3336	0.451	5008	,	,		18722	0.4722		0.3211	False		,,,				2504	0.3476				p.P216P		.											.	PRDM12-90	0			c.C648T						.	C		1542,2864	486.4+/-360.6	264,1014,925	89.0	85.0	86.0		648	-11.5	0.0	9	dbSNP_116	86	2733,5867	436.9+/-358.5	436,1861,2003	no	coding-synonymous	PRDM12	NM_021619.2		700,2875,2928	TT,TC,CC		31.7791,34.9977,32.8694		216/368	133553993	4275,8731	2203	4300	6503	SO:0001819	synonymous_variant	59335	exon4			TGTGCCCGGGCTA	AY004252	CCDS6934.1	9q33-q34	2013-01-08			ENSG00000130711	ENSG00000130711		"""Zinc fingers, C2H2-type"""	13997	protein-coding gene	gene with protein product	"""PR-domain containing protein 12"", ""PR-domain zinc finger protein 12"""					14523459	Standard	NM_021619		Approved		uc004bzt.1	Q9H4Q4	OTTHUMG00000020808	ENST00000253008.2:c.648C>T	9.37:g.133553993C>T		223	1		168	8	NM_021619	0	0	0	0	0	A3KFK9	Silent	SNP	ENST00000253008.2	37	CCDS6934.1																																																																																			C|0.650;T|0.350		0.592	PRDM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054664.1	NM_021619	
PPEF1	5475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	18822065	18822065	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chrX:18822065C>T	ENST00000361511.4	+	14	1615	c.1121C>T	c.(1120-1122)aCg>aTg	p.T374M	PPEF1_ENST00000359763.6_Missense_Mutation_p.T321M|PPEF1_ENST00000349874.5_Intron|PPEF1_ENST00000543630.1_Intron|PPEF1_ENST00000544635.1_Missense_Mutation_p.T309M	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	374	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					TTTCCAAATACGTGCCGAGGA	0.418																																					p.T374M		.											.	PPEF1-226	0			c.C1121T						.						141.0	128.0	132.0					X																	18822065		2203	4300	6503	SO:0001583	missense	5475	exon14			CAAATACGTGCCG	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1121C>T	X.37:g.18822065C>T	ENSP00000354871:p.Thr374Met	43	0		46	8	NM_006240	0	0	0	0	0	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	ENST00000361511.4	37	CCDS14188.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.450373	0.26074	.	.	ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000544635	T;T;T	0.06142	3.34;3.34;3.34	5.03	4.14	0.48551	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);Metallophosphoesterase domain (1);	0.311972	0.27846	N	0.017602	T	0.23492	0.0568	M	0.85373	2.75	0.29828	N	0.830246	D;D	0.89917	1.0;0.999	D;P	0.69824	0.966;0.855	T	0.11251	-1.0595	10	0.72032	D	0.01	-14.0088	7.396	0.26936	0.4569:0.4142:0.1289:0.0	.	374;346	O14829;O14829-3	PPE1_HUMAN;.	M	374;321;309	ENSP00000354871:T374M;ENSP00000352806:T321M;ENSP00000441289:T309M	ENSP00000352806:T321M	T	+	2	0	PPEF1	18731986	0.016000	0.18221	0.653000	0.29593	0.113000	0.19764	0.548000	0.23314	1.042000	0.40150	0.594000	0.82650	ACG	.		0.418	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055953.3	NM_006240	
RP1-274L7.1	0	broad.mit.edu	37	X	129631540	129631540	+	lincRNA	DEL	A	A	-			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chrX:129631540delA	ENST00000458525.1	-	0	1015				FAM45B_ENST00000592932.1_RNA																							tttgatattcaaaaaaaaaaa	0.244																																					.		.											.	FAM45B-63	0			.						.																																					55855	.			ATATTCAAAAAAA																													X.37:g.129631540delA		7	0		8	2	.	0	0	0	0	0		RNA	DEL	ENST00000458525.1	37																																																																																				.		0.244	RP1-274L7.1-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000058271.1		
Unknown	0	bcgsc.ca	37	Y	21154569	21154569	+	IGR	SNP	A	A	G	rs17855271		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chrY:21154569A>G								TTTY14 (114455 upstream) : RNU6-255P (26299 downstream)																							GCCCCAGCCCAAGCCTGGCCA	0.612																																					p.L9L		.											.	.	0			c.T27C						.																																			SO:0001628	intergenic_variant	100133941	exon1			CAGCCCAAGCCTG																													Y.37:g.21154569A>G		72	1		114	24	NM_013230	0	0	0	1	1		Silent	SNP		37																																																																																				.	0	0.612								
TTTY14	83869	bcgsc.ca	37	Y	21154603	21154603	+	IGR	SNP	A	A	C	rs79788321		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chrY:21154603A>C								TTTY14 (114489 upstream) : RNU6-255P (26265 downstream)																							CATGTCCCCTACGTCGGTGCG	0.662																																					.		.											.	.	0			.						.																																			SO:0001628	intergenic_variant	100133941	.			TCCCCTACGTCGG																													Y.37:g.21154603A>C		46	1		111	37	.	0	0	0	0	0		RNA	SNP		37																																																																																				.	0	0.662								
KCNN3	3782	broad.mit.edu	37	1	154842199	154842200	+	In_Frame_Ins	INS	-	-	GCTGCTGCT	rs56352724|rs3831942|rs367921715|rs58327065		TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr1:154842199_154842200insGCTGCTGCT	ENST00000271915.4	-	1	556_557	c.241_242insAGCAGCAGC	c.(241-243)cca>cAGCAGCAGCca	p.80_81insQQQ	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	80	Gln-rich.		Missing.		potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)	p.Q80_P81insQQ(2)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GGGATGCGGTGgctgctgctgc	0.698																																					p.P81delinsQQQP		.											.	KCNN3-91	2	Insertion - In frame(2)	prostate(2)	c.242_243insAGCAGCAGC						.																																			SO:0001652	inframe_insertion	3782	exon1			TGCGGTGGCTGCT	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.233_241dupAGCAGCAGC	1.37:g.154842200_154842208dupGCTGCTGCT	ENSP00000271915:p.Gln78_Gln80dup	17	0		65	14	NM_001204087	0	0	0	0	0	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Ins	INS	ENST00000271915.4	37	CCDS30880.1																																																																																			.		0.698	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
MN1	4330	broad.mit.edu	37	22	28194933	28194934	+	In_Frame_Ins	INS	-	-	TGC	rs572936881|rs34890218|rs373314940|rs71194738	byFrequency	TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr22:28194933_28194934insTGC	ENST00000302326.4	-	1	2552_2553	c.1598_1599insGCA	c.(1597-1599)caa>caGCAa	p.533_533Q>QQ		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	533	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						gctgctgctgttgctgctgctg	0.653			T	ETV6	"""AML, meningioma"""									447	0.0892572	0.0393	0.1196	5008	,	,		12327	0.0774		0.1789	False		,,,				2504	0.0552				p.Q533delinsQQ		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.1599_1600insGCA						.																																			SO:0001652	inframe_insertion	4330	exon1			CTGCTGTTGCTGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1596_1598dupGCA	22.37:g.28194940_28194942dupTGC	ENSP00000304956:p.Gln550dup	4	0		63	33	NM_002430	0	0	0	0	0	A9Z1V9	In_Frame_Ins	INS	ENST00000302326.4	37	CCDS42998.1																																																																																			.		0.653	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
SHOX2	6474	hgsc.bcm.edu	37	3	157823581	157823582	+	In_Frame_Ins	INS	-	-	CACCTCCTC			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chr3:157823581_157823582insCACCTCCTC	ENST00000425436.3	-	1	257_258	c.232_233insGAGGAGGTG	c.(232-234)gta>gGAGGAGGTGta	p.77_78insGGG	SHOX2_ENST00000483851.2_In_Frame_Ins_p.77_78insGGG|SHOX2_ENST00000389589.4_In_Frame_Ins_p.77_78insGGG|RSRC1_ENST00000480820.1_5'Flank|SHOX2_ENST00000490689.2_5'Flank|SHOX2_ENST00000441443.2_5'UTR|SHOX2_ENST00000554685.1_5'UTR	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	77	Poly-Gly.				cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			tcctcctcctacacctcctccg	0.787																																					p.V78delinsGGGV		.											.	SHOX2-90	0			c.233_234insGAGGAGGTG						.		,,	21,2419		6,9,1205					,,	-1.0	0.6			7	162,5396		41,80,2658	no	coding,coding,coding	SHOX2	NM_006884.3,NM_003030.4,NM_001163678.1	,,	47,89,3863	A1A1,A1R,RR		2.9147,0.8607,2.2881	,,	,,		183,7815				SO:0001652	inframe_insertion	6474	exon1			CCTCCTACACCTC	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.224_232dupGAGGAGGTG	3.37:g.157823582_157823590dupCACCTCCTC	ENSP00000398704:p.Gly80_Gly81dup	10	0		56	14	NM_001163678	0	0	0	0	0	O60465|O60467|O60903	In_Frame_Ins	INS	ENST00000425436.3	37	CCDS43164.1																																																																																			.		0.787	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352057.2		
TBL1X	6907	hgsc.bcm.edu;broad.mit.edu	37	X	9656179	9656180	+	In_Frame_Ins	INS	-	-	GCG			TCGA-OR-A5LK-01A-11D-A29I-10	TCGA-OR-A5LK-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	de28f978-5783-417f-acac-610329360c22	695b49cf-c521-442f-9074-e9b47b7200c9	g.chrX:9656179_9656180insGCG	ENST00000217964.7	+	7	1120_1121	c.480_481insGCG	c.(481-483)gcg>GCGgcg	p.161_161A>AA	TBL1X_ENST00000380961.1_In_Frame_Ins_p.110_110A>AA|TBL1X_ENST00000536365.1_In_Frame_Ins_p.110_110A>AA|TBL1X_ENST00000424279.1_In_Frame_Ins_p.110_110A>AA|TBL1X_ENST00000407597.2_In_Frame_Ins_p.161_161A>AA	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	161	Poly-Ala.				canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				AGCAAGCCAGTgcggcggcggc	0.658														2	0.000529801	0.0	0.0014	3775	,	,		12227	0.001		0.0	False		,,,				2504	0.0				p.S160delinsSA		.											.	TBL1X-131	0			c.480_481insGCG						.																																			SO:0001652	inframe_insertion	6907	exon7			AGCCAGTGCGGCG	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.493_495dupGCG	X.37:g.9656186_9656188dupGCG	ENSP00000217964:p.Ala168dup	14	0		81	28	NM_001139466	0	0	0	0	0	A8K044|A8K4J7|Q86UY2	In_Frame_Ins	INS	ENST00000217964.7	37	CCDS14133.1																																																																																			.		0.658	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
