#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ANKRD65	441869	broad.mit.edu	37	1	1354515	1354515	+	Missense_Mutation	SNP	C	C	G	rs534554090|rs904589	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:1354515C>G	ENST00000537107.1	-	4	1302	c.1165G>C	c.(1165-1167)Gag>Cag	p.E389Q	ANKRD65_ENST00000520296.1_3'UTR|ANKRD65_ENST00000454272.1_5'UTR|ANKRD65_ENST00000427211.1_3'UTR|RP4-758J18.7_ENST00000428932.1_RNA	NM_001145210.2	NP_001138682.1	E5RJM6	ANR65_HUMAN	ankyrin repeat domain 65	389										breast(1)	1						CACTCCTTCTCCCCCCCTCCA	0.687													G|||	1617	0.322883	0.8222	0.1945	5008	,	,		16520	0.1131		0.0964	False		,,,				2504	0.1881				p.E389Q		.											.	.	0			c.G1165C						.						2.0	3.0	3.0					1																	1354515		507	1316	1823	SO:0001583	missense	441869	exon4			CCTTCTCCCCCCC		CCDS55558.1, CCDS57962.1, CCDS57963.1	1p36.33	2013-01-10			ENSG00000235098	ENSG00000235098		"""Ankyrin repeat domain containing"""	42950	protein-coding gene	gene with protein product							Standard	NM_001243535		Approved		uc010nyo.2	E5RJM6	OTTHUMG00000002911	ENST00000537107.1:c.1165G>C	1.37:g.1354515C>G	ENSP00000445688:p.Glu389Gln	107	0		149	5	NM_001145210	0	0	1	1	0	J3KR93	Missense_Mutation	SNP	ENST00000537107.1	37	CCDS55558.1	622	0.2847985347985348	404	0.8211382113821138	79	0.21823204419889503	67	0.11713286713286714	72	0.09498680738786279	G	0.243	-1.012516	0.02095	.	.	ENSG00000235098	ENST00000537107	T	0.68624	-0.34	1.28	0.254	0.15557	.	.	.	.	.	T	0.00012	0.0000	N	0.24115	0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.38520	-0.9657	8	0.10902	T	0.67	.	6.8436	0.23977	0.0:0.5817:0.4183:0.0	rs904589;rs3766168	389	E5RJM6	ANR65_HUMAN	Q	389	ENSP00000445688:E389Q	ENSP00000445688:E389Q	E	-	1	0	RP4-758J18.6	1344378	0.004000	0.15560	0.001000	0.08648	0.007000	0.05969	-0.137000	0.10389	-0.272000	0.09259	-0.497000	0.04613	GAG	C|0.285;G|0.715		0.687	ANKRD65-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ANKRD65	441869	broad.mit.edu	37	1	1354570	1354570	+	Silent	SNP	C	C	T	rs191154418	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:1354570C>T	ENST00000537107.1	-	4	1247	c.1110G>A	c.(1108-1110)gtG>gtA	p.V370V	ANKRD65_ENST00000520296.1_3'UTR|ANKRD65_ENST00000454272.1_5'UTR|ANKRD65_ENST00000442470.1_3'UTR|ANKRD65_ENST00000427211.1_3'UTR|RP4-758J18.7_ENST00000428932.1_RNA	NM_001145210.2	NP_001138682.1	E5RJM6	ANR65_HUMAN	ankyrin repeat domain 65	370										breast(1)	1						GCATCTGGGCCACCTCGGCCC	0.697													C|||	5	0.000998403	0.0038	0.0	5008	,	,		16016	0.0		0.0	False		,,,				2504	0.0				p.V370V		.											.	.	0			c.G1110A						.						4.0	6.0	6.0					1																	1354570		652	1520	2172	SO:0001819	synonymous_variant	441869	exon4			CTGGGCCACCTCG		CCDS55558.1, CCDS57962.1, CCDS57963.1	1p36.33	2013-01-10			ENSG00000235098	ENSG00000235098		"""Ankyrin repeat domain containing"""	42950	protein-coding gene	gene with protein product							Standard	NM_001243535		Approved		uc010nyo.2	E5RJM6	OTTHUMG00000002911	ENST00000537107.1:c.1110G>A	1.37:g.1354570C>T		32	0		131	4	NM_001145210	0	0	1	1	0	J3KR93	Silent	SNP	ENST00000537107.1	37	CCDS55558.1																																																																																			C|0.997;T|0.003		0.697	ANKRD65-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PRDM16	63976	hgsc.bcm.edu	37	1	3329229	3329229	+	Missense_Mutation	SNP	G	G	C	rs371654192	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:3329229G>C	ENST00000270722.5	+	9	2517	c.2468G>C	c.(2467-2469)cGc>cCc	p.R823P	PRDM16_ENST00000511072.1_Missense_Mutation_p.R824P|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378398.3_Missense_Mutation_p.R824P|PRDM16_ENST00000514189.1_Missense_Mutation_p.R824P|PRDM16_ENST00000441472.2_Missense_Mutation_p.R823P|PRDM16_ENST00000378391.2_Missense_Mutation_p.R823P|PRDM16_ENST00000442529.2_Missense_Mutation_p.R823P			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	823	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CGGGAGCCCCGCAAGAACCAC	0.756			T	EVI1	"""MDS, AML"""								G|||	4	0.000798722	0.0	0.0014	5008	,	,		10688	0.0		0.003	False		,,,				2504	0.0				p.R823P		.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16-660	0			c.G2468C						.	G	PRO/ARG,PRO/ARG	3,3321		0,3,1659	5.0	7.0	6.0		2468,2468	4.3	1.0	1		6	14,7354		0,14,3670	no	missense,missense	PRDM16	NM_022114.3,NM_199454.2	103,103	0,17,5329	CC,CG,GG		0.19,0.0903,0.159	possibly-damaging,possibly-damaging	823/1277,823/1258	3329229	17,10675	1662	3684	5346	SO:0001583	missense	63976	exon9			AGCCCCGCAAGAA	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2468G>C	1.37:g.3329229G>C	ENSP00000270722:p.Arg823Pro	0	0		21	18	NM_022114	0	0	0	0	0	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	37	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	G	13.88	2.368596	0.42003	9.03E-4	0.0019	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.08008	3.22;3.17;3.19;3.15;3.22;3.22;3.25;3.19;3.14	4.32	4.32	0.51571	.	0.000000	0.47852	U	0.000211	T	0.28466	0.0704	M	0.73962	2.25	0.54753	D	0.999989	D;D;D;D	0.76494	0.999;0.996;0.999;0.993	D;D;D;P	0.66351	0.942;0.93;0.943;0.853	T	0.08534	-1.0717	10	0.87932	D	0	.	17.1561	0.86791	0.0:0.0:1.0:0.0	.	823;823;823;823	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	P	824;824;823;823;823;824;823;639;639;632	ENSP00000426975:R824P;ENSP00000367651:R824P;ENSP00000407968:R823P;ENSP00000405253:R823P;ENSP00000367643:R823P;ENSP00000421400:R824P;ENSP00000270722:R823P;ENSP00000422504:R639P;ENSP00000425796:R632P	ENSP00000270722:R823P	R	+	2	0	PRDM16	3319089	1.000000	0.71417	0.996000	0.52242	0.805000	0.45488	6.191000	0.72063	2.122000	0.65172	0.551000	0.68910	CGC	.		0.756	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
PRAMEF4	400735	ucsc.edu	37	1	12939904	12939904	+	Missense_Mutation	SNP	A	A	C	rs3895133		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:12939904A>C	ENST00000235349.5	-	4	968	c.898T>G	c.(898-900)Ttc>Gtc	p.F300V		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	300					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTGTGAGGAACTTTAACGAG	0.483																																					p.F300V		.											.	PRAMEF4-45	0			c.T898G						.						50.0	69.0	62.0					1																	12939904		1404	2644	4048	SO:0001583	missense	400735	exon4			TGAGGAACTTTAA		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.898T>G	1.37:g.12939904A>C	ENSP00000235349:p.Phe300Val	62	5		24	11	NM_001009611	0	0	0	0	0	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	t	1.416	-0.574302	0.03882	.	.	ENSG00000243073	ENST00000235349	T	0.38887	1.11	1.48	-2.96	0.05547	.	1.221790	0.05721	N	0.597800	T	0.18759	0.0450	N	0.04132	-0.27	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09207	-1.0685	10	0.37606	T	0.19	.	3.305	0.06997	0.5711:0.149:0.0:0.2799	.	300	O60810	PRAM4_HUMAN	V	300	ENSP00000235349:F300V	ENSP00000235349:F300V	F	-	1	0	PRAMEF4	12862491	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.518000	0.02246	-3.281000	0.00197	-4.216000	0.00009	TTC	A|0.500;C|0.500		0.483	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		14	14	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
GNL2	29889	broad.mit.edu	37	1	38048389	38048389	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:38048389G>T	ENST00000373062.3	-	7	883	c.785C>A	c.(784-786)aCc>aAc	p.T262N		NM_013285.2	NP_037417.1	Q13823	NOG2_HUMAN	guanine nucleotide binding protein-like 2 (nucleolar)	262	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	30		Myeloproliferative disorder(586;0.0393)				TGTTGCCCAGGTTGGAACAAG	0.408																																					p.T262N		.											.	GNL2-91	0			c.C785A						.						153.0	146.0	148.0					1																	38048389		2203	4300	6503	SO:0001583	missense	29889	exon7			GCCCAGGTTGGAA	L05425	CCDS421.1	1p34	2008-02-05			ENSG00000134697	ENSG00000134697			29925	protein-coding gene	gene with protein product		609365				8822211	Standard	NM_013285		Approved	Ngp-1, HUMAUANTIG	uc001cbk.3	Q13823	OTTHUMG00000004322	ENST00000373062.3:c.785C>A	1.37:g.38048389G>T	ENSP00000362153:p.Thr262Asn	58	0		38	3	NM_013285	0	0	0	0	0	Q9BWN7	Missense_Mutation	SNP	ENST00000373062.3	37	CCDS421.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.87|19.87	3.906821|3.906821	0.72868|0.72868	.|.	.|.	ENSG00000134697|ENSG00000134697	ENST00000538069|ENST00000373062;ENST00000545489	.|T	.|0.14022	.|2.54	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	.|0.136701	.|0.64402	.|D	.|0.000003	T|T	0.34279|0.34279	0.0892|0.0892	M|M	0.67700|0.67700	2.07|2.07	0.80722|0.80722	D|D	1|1	.|D	.|0.56968	.|0.978	.|P	.|0.58266	.|0.836	T|T	0.00395|0.00395	-1.1766|-1.1766	5|10	.|0.42905	.|T	.|0.14	-11.3829|-11.3829	20.1854|20.1854	0.98212|0.98212	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|262	.|Q13823	.|NOG2_HUMAN	T|N	46|262;103	.|ENSP00000362153:T262N	.|ENSP00000362153:T262N	P|T	-|-	1|2	0|0	GNL2|GNL2	37820976|37820976	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	9.822000|9.822000	0.99363|0.99363	2.772000|2.772000	0.95346|0.95346	0.585000|0.585000	0.79938|0.79938	CCT|ACC	.		0.408	GNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012478.1	NM_013285	
HIVEP3	59269	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	42047867	42047867	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:42047867C>A	ENST00000372583.1	-	4	3487	c.2602G>T	c.(2602-2604)Gac>Tac	p.D868Y	HIVEP3_ENST00000429157.2_Missense_Mutation_p.D868Y|HIVEP3_ENST00000372584.1_Missense_Mutation_p.D868Y|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Missense_Mutation_p.D868Y	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	868	Acidic 2.|Glu/Pro-rich.|No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GGCTCTGTGTCCGGCCGGTCA	0.612																																					p.D868Y		.											.	HIVEP3-157	0			c.G2602T						.						58.0	67.0	64.0					1																	42047867		2203	4300	6503	SO:0001583	missense	59269	exon4			CTGTGTCCGGCCG	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2602G>T	1.37:g.42047867C>A	ENSP00000361664:p.Asp868Tyr	68	0		69	10	NM_024503	0	0	0	0	0	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	ENST00000372583.1	37	CCDS463.1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931196	0.52866	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	4.95	4.04	0.47022	.	0.109676	0.40818	N	0.001011	T	0.53610	0.1807	L	0.40543	1.245	0.40040	D	0.975636	D;D	0.76494	0.999;0.999	D;D	0.73380	0.98;0.956	T	0.58589	-0.7610	10	0.87932	D	0	4.659	12.8975	0.58108	0.0:0.9209:0.0:0.0791	.	868;868	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	Y	868	ENSP00000361665:D868Y;ENSP00000361664:D868Y;ENSP00000247584:D868Y;ENSP00000410828:D868Y	ENSP00000247584:D868Y	D	-	1	0	HIVEP3	41820454	0.989000	0.36119	0.770000	0.31555	0.742000	0.42306	2.766000	0.47629	1.309000	0.44985	0.462000	0.41574	GAC	.		0.612	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
MAST2	23139	bcgsc.ca	37	1	46476587	46476587	+	Missense_Mutation	SNP	T	T	G	rs11211247	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:46476587T>G	ENST00000361297.2	+	10	1447	c.1164T>G	c.(1162-1164)gaT>gaG	p.D388E	MAST2_ENST00000372009.2_Intron	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					AACTTCAAGATAATTTGGAGA	0.423													G|||	4379	0.874401	0.9221	0.8674	5008	,	,		20236	0.9841		0.7177	False		,,,				2504	0.863				p.D388E		.											.	MAST2-581	0			c.T1164G						.	G	GLU/ASP	3329,409		1487,355,27	63.0	60.0	61.0		1164	2.7	1.0	1	dbSNP_120	61	6062,2142		2242,1578,282	yes	missense	MAST2	NM_015112.2	45	3729,1933,309	GG,GT,TT		26.1092,10.9417,21.3616	benign	388/1799	46476587	9391,2551	1869	4102	5971	SO:0001583	missense	23139	exon10			TCAAGATAATTTG	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.1164T>G	1.37:g.46476587T>G	ENSP00000354671:p.Asp388Glu	62	0		69	4	NM_015112	0	0	3	3	0		Missense_Mutation	SNP	ENST00000361297.2	37	CCDS41326.1	1873	0.8576007326007326	451	0.9166666666666666	311	0.8591160220994475	568	0.993006993006993	543	0.716358839050132	G	2.521	-0.310747	0.05458	0.890583	0.738908	ENSG00000086015	ENST00000361297;ENST00000432341;ENST00000372008	T;T	0.24151	1.87;1.87	5.6	2.69	0.31865	Microtubule-associated serine/threonine-protein kinase, domain (1);Microtubule-associated serine/threonine-protein kinase, pre-PK domain (2);	0.052698	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00661	-1.28	0.09310	P	1.0	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.34625	-0.9821	9	0.02654	T	1	-15.9658	5.815	0.18488	0.313:0.0:0.5596:0.1275	rs11211247;rs59577154;rs11211247	96;388	E7EWL1;Q6P0Q8	.;MAST2_HUMAN	E	388;96;273	ENSP00000354671:D388E;ENSP00000361078:D273E	ENSP00000354671:D388E	D	+	3	2	MAST2	46249174	1.000000	0.71417	1.000000	0.80357	0.481000	0.33189	1.326000	0.33735	0.330000	0.23485	-0.999000	0.02512	GAT	T|0.153;G|0.847		0.423	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
MKNK1	8569	broad.mit.edu	37	1	47028362	47028362	+	Missense_Mutation	SNP	C	C	T	rs55791614	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:47028362C>T	ENST00000371946.4	-	11	1085	c.922G>A	c.(922-924)Gac>Aac	p.D308N	MKNK1_ENST00000428112.2_Missense_Mutation_p.D267N|MKNK1_ENST00000371944.4_Missense_Mutation_p.D172N|MKNK1-AS1_ENST00000602433.1_RNA|MKNK1_ENST00000371945.4_Missense_Mutation_p.D267N|MKNK1_ENST00000341183.5_Missense_Mutation_p.D267N	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	308	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> N (in dbSNP:rs55791614). {ECO:0000269|PubMed:17344846}.		extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					CAGCCACAGTCGGCCCCGCAG	0.662													C|||	10	0.00199681	0.0	0.0043	5008	,	,		16040	0.0		0.005	False		,,,				2504	0.002				p.D308N		.											.	MKNK1-978	0			c.G922A						.	C	ASN/ASP,ASN/ASP,ASN/ASP	11,4385		0,11,2187	27.0	24.0	25.0		799,922,799	4.5	1.0	1	dbSNP_129	25	60,8500		1,58,4221	no	missense,missense,missense	MKNK1	NM_001135553.1,NM_003684.4,NM_198973.2	23,23,23	1,69,6408	TT,TC,CC		0.7009,0.2502,0.548	benign,benign,benign	267/425,308/466,267/348	47028362	71,12885	2198	4280	6478	SO:0001583	missense	8569	exon11			CACAGTCGGCCCC	AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.922G>A	1.37:g.47028362C>T	ENSP00000361014:p.Asp308Asn	129	1		212	5	NM_003684	0	0	6	6	0	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	ENST00000371946.4	37	CCDS538.1	3	0.0013736263736263737	0	0.0	0	0.0	0	0.0	3	0.00395778364116095	C	15.55	2.866573	0.51588	0.002502	0.007009	ENSG00000079277	ENST00000371946;ENST00000371945;ENST00000371944;ENST00000341183;ENST00000428112	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	5.42	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.086825	0.85682	D	0.000000	T	0.08358	0.0208	N	0.12502	0.225	0.80722	D	1	B;B;B;B;B;P	0.42649	0.102;0.245;0.102;0.083;0.193;0.786	B;B;B;B;B;B	0.37888	0.031;0.054;0.031;0.018;0.09;0.26	T	0.09596	-1.0667	10	0.32370	T	0.25	.	13.8642	0.63578	0.0:0.9252:0.0:0.0748	rs55791614	172;172;267;267;267;308	B4DQK5;Q7Z319;A8K341;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.;.;.;.;.;MKNK1_HUMAN	N	308;267;172;267;267	ENSP00000361014:D308N;ENSP00000361013:D267N;ENSP00000361012:D172N;ENSP00000339573:D267N;ENSP00000411135:D267N	ENSP00000339573:D267N	D	-	1	0	MKNK1	46800949	0.994000	0.37717	0.977000	0.42913	0.672000	0.39443	3.119000	0.50422	2.826000	0.97356	0.563000	0.77884	GAC	C|0.996;T|0.004		0.662	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2	NM_003684	
SSBP3	23648	broad.mit.edu	37	1	54871665	54871665	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:54871665T>C	ENST00000371320.3	-	1	427	c.17A>G	c.(16-18)aAa>aGa	p.K6R	SSBP3_ENST00000417664.2_5'Flank|SSBP3_ENST00000371319.3_Missense_Mutation_p.K6R|SSBP3_ENST00000357475.4_Missense_Mutation_p.K6R	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3	6					head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						CGCCGAGCCTTTGCCTTTGGC	0.736																																					p.K6R		.											.	SSBP3-90	0			c.A17G						.						4.0	5.0	5.0					1																	54871665		2079	4010	6089	SO:0001583	missense	23648	exon1			GAGCCTTTGCCTT		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.17A>G	1.37:g.54871665T>C	ENSP00000360371:p.Lys6Arg	22	0		77	8	NM_001009955	0	0	11	11	0	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	Missense_Mutation	SNP	ENST00000371320.3	37	CCDS591.1	.	.	.	.	.	.	.	.	.	.	T	14.81	2.645914	0.47258	.	.	ENSG00000157216	ENST00000371320;ENST00000371319;ENST00000357475	.	.	.	2.64	2.64	0.31445	.	0.000000	0.46758	U	0.000271	T	0.45155	0.1328	L	0.38838	1.175	0.35702	D	0.815734	B;B;B	0.18968	0.02;0.004;0.032	B;B;B	0.24006	0.018;0.012;0.05	T	0.52540	-0.8562	9	0.62326	D	0.03	.	8.2855	0.31926	0.0:0.0:0.0:1.0	.	6;6;6	Q9BWW4-2;Q9BWW4-3;Q9BWW4	.;.;SSBP3_HUMAN	R	6	.	ENSP00000350067:K6R	K	-	2	0	SSBP3	54644253	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	3.586000	0.53950	0.978000	0.38470	0.240000	0.17902	AAA	.		0.736	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022721.1	NM_018070	
TCHH	7062	broad.mit.edu	37	1	152084234	152084234	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:152084234G>T	ENST00000368804.1	-	2	1458	c.1459C>A	c.(1459-1461)Cgt>Agt	p.R487S		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	487	9 X 28 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)	p.R487S(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTCAGCCAACGTTCGCGCCTc	0.667																																					p.R487S		.											.	TCHH-72	1	Substitution - Missense(1)	endometrium(1)	c.C1459A						.						66.0	72.0	70.0					1																	152084234		2122	4226	6348	SO:0001583	missense	7062	exon3			GCCAACGTTCGCG	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1459C>A	1.37:g.152084234G>T	ENSP00000357794:p.Arg487Ser	29	0		87	3	NM_007113	0	0	0	0	0	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	37	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	g	7.490	0.650445	0.14516	.	.	ENSG00000159450	ENST00000368804	T	0.04654	3.58	3.2	-5.95	0.02241	.	.	.	.	.	T	0.00666	0.0022	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.11329	0.006	T	0.47923	-0.9079	9	0.12430	T	0.62	.	12.2395	0.54534	0.0936:0.7008:0.2056:0.0	.	487	Q07283	TRHY_HUMAN	S	487	ENSP00000357794:R487S	ENSP00000357794:R487S	R	-	1	0	TCHH	150350858	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.388000	0.07352	-1.114000	0.02977	-1.146000	0.01853	CGT	.		0.667	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	0	0		16	16	NM_022371	0	0	0	3	3	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
CR1	1378	bcgsc.ca	37	1	207787796	207787796	+	Missense_Mutation	SNP	T	T	C	rs61822976		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:207787796T>C	ENST00000367049.4	+	40	6623	c.6623T>C	c.(6622-6624)aTg>aCg	p.M2208T	CR1_ENST00000367052.1_Missense_Mutation_p.M1758T|CR1_ENST00000400960.2_Missense_Mutation_p.M1758T|CR1_ENST00000367051.1_Missense_Mutation_p.M1758T|CR1_ENST00000367053.1_Missense_Mutation_p.M1758T	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1758					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.M1758T(1)|p.M2208T(1)|p.M1763T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTGGCTGGAATGAAAGCCCTT	0.408																																					p.M2208T		.											.	CR1-93	3	Substitution - Missense(3)	prostate(3)	c.T6623C						.						128.0	121.0	123.0					1																	207787796		1882	4112	5994	SO:0001583	missense	1378	exon40			CTGGAATGAAAGC	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6623T>C	1.37:g.207787796T>C	ENSP00000356016:p.Met2208Thr	266	7		355	31	NM_000651	0	0	1	1	0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	T	3.803	-0.041226	0.07452	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96	4.29	-5.87	0.02297	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.09335	0.0230	N	0.20986	0.625	0.09310	N	1	B;P	0.46457	0.043;0.878	B;B	0.42422	0.009;0.387	T	0.19614	-1.0300	9	0.18276	T	0.48	.	1.2481	0.01977	0.4109:0.0944:0.2677:0.2271	rs61822976	1758;2208	P17927;E9PDY4	CR1_HUMAN;.	T	1758;1758;1758;1758;2208	ENSP00000356019:M1758T;ENSP00000356018:M1758T;ENSP00000356020:M1758T;ENSP00000383744:M1758T;ENSP00000356016:M2208T	ENSP00000356016:M2208T	M	+	2	0	CR1	205854419	0.002000	0.14202	0.000000	0.03702	0.554000	0.35429	-0.327000	0.07955	-0.793000	0.04475	0.358000	0.22013	ATG	.		0.408	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
NSL1	25936	broad.mit.edu	37	1	212965096	212965096	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:212965096A>C	ENST00000366977.3	-	1	28	c.10T>G	c.(10-12)Tct>Gct	p.S4A	NSL1_ENST00000473995.1_5'Flank|NSL1_ENST00000422588.2_Missense_Mutation_p.S4A|NSL1_ENST00000366976.1_Missense_Mutation_p.S4A|TATDN3_ENST00000531963.1_5'Flank|NSL1_ENST00000366978.1_5'Flank|NSL1_ENST00000366975.6_Missense_Mutation_p.S4A|TATDN3_ENST00000366974.4_5'Flank|TATDN3_ENST00000526641.1_5'Flank|TATDN3_ENST00000532324.1_5'Flank|TATDN3_ENST00000526997.1_5'Flank|TATDN3_ENST00000530441.1_5'Flank|TATDN3_ENST00000366973.4_5'Flank	NM_015471.3	NP_056286.3	Q96IY1	NSL1_HUMAN	NSL1, MIS12 kinetochore complex component	4			S -> F (in dbSNP:rs17856201). {ECO:0000269|PubMed:15489334}.		chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				breast(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00597)|all cancers(67;0.00893)|GBM - Glioblastoma multiforme(131;0.0514)|Epithelial(68;0.102)		AACTCAGGAGACCCCGCCATT	0.612																																					p.S4A		.											.	NSL1-91	0			c.T10G						.						14.0	18.0	17.0					1																	212965096		2203	4291	6494	SO:0001583	missense	25936	exon1			CAGGAGACCCCGC	AF255793	CCDS1509.1, CCDS73025.1	1q41	2013-07-03	2013-07-03	2006-11-07	ENSG00000117697	ENSG00000117697			24548	protein-coding gene	gene with protein product		609174	"""chromosome 1 open reading frame 48"", ""NSL1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C1orf48		20819937	Standard	NM_015471		Approved	DC8, DKFZP566O1646, MIS14	uc001hjn.3	Q96IY1	OTTHUMG00000036806	ENST00000366977.3:c.10T>G	1.37:g.212965096A>C	ENSP00000355944:p.Ser4Ala	37	8		85	16	NM_015471	0	0	0	0	0	E7ETD5|Q5SY75|Q9H2M5|Q9NRN8|Q9Y415	Missense_Mutation	SNP	ENST00000366977.3	37	CCDS1509.1	.	.	.	.	.	.	.	.	.	.	A	1.012	-0.687649	0.03328	.	.	ENSG00000117697	ENST00000366977;ENST00000422588;ENST00000366975;ENST00000366976	T;T;T;T	0.44482	1.65;0.92;1.65;1.05	5.13	-2.04	0.07343	.	0.958527	0.08627	N	0.917615	T	0.13329	0.0323	N	0.01109	-1.01	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31916	-0.9926	9	.	.	.	4.0511	8.6023	0.33751	0.5137:0.248:0.2383:0.0	.	4;4;4	B4E071;Q96IY1;E7ETD5	.;NSL1_HUMAN;.	A	4	ENSP00000355944:S4A;ENSP00000388406:S4A;ENSP00000355942:S4A;ENSP00000355943:S4A	.	S	-	1	0	NSL1	211031719	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-2.229000	0.01208	-0.560000	0.06102	-0.468000	0.05107	TCT	.		0.612	NSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089398.2	NM_015471	
JMJD4	65094	hgsc.bcm.edu	37	1	227923081	227923081	+	Missense_Mutation	SNP	G	G	A	rs7419238		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:227923081G>A	ENST00000366758.3	-	1	31	c.32C>T	c.(31-33)gCg>gTg	p.A11V	JMJD4_ENST00000438896.2_Missense_Mutation_p.A11V|SNAP47_ENST00000366760.1_Intron|SNAP47_ENST00000366759.4_5'UTR|JMJD4_ENST00000485807.1_5'Flank|SNAP47_ENST00000315781.5_5'UTR	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	11			A -> V (in dbSNP:rs7419238). {ECO:0000269|PubMed:14702039}.							endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				TTTCTGCCCCGCCAGCGCCTG	0.741													A|||	5008	1.0	1.0	1.0	5008	,	,		11222	1.0		1.0	False		,,,				2504	1.0				p.A11V		.											.	JMJD4-226	0			c.C32T						.	A	VAL/ALA,VAL/ALA,	4035,1		2017,1,0	6.0	7.0	7.0		32,32,	2.0	0.0	1	dbSNP_116	7	8000,0		4000,0,0	yes	missense,missense,utr-5	JMJD4,SNAP47	NM_001161465.1,NM_023007.2,NM_053052.3	64,64,	6017,1,0	AA,AG,GG		0.0,0.0248,0.0083	benign,benign,	11/448,11/464,	227923081	12035,1	2018	4000	6018	SO:0001583	missense	65094	exon1			TGCCCCGCCAGCG	AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.32C>T	1.37:g.227923081G>A	ENSP00000355720:p.Ala11Val	0	0		11	11	NM_023007	0	0	0	0	0	Q5TBZ1|Q5TBZ6|Q9H970	Missense_Mutation	SNP	ENST00000366758.3	37	CCDS1561.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	361|361	0.9972375690607734|0.9972375690607734	572|572	1.0|1.0	754|754	0.9947229551451188|0.9947229551451188	A|A	2.779|2.779	-0.253926|-0.253926	0.05829|0.05829	0.999752|0.999752	1.0|1.0	ENSG00000081692|ENSG00000081692	ENST00000366758|ENST00000438896	T|.	0.19806|.	2.12|.	3.58|3.58	1.99|1.99	0.26369|0.26369	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.03608|0.03608	-0.345|-0.345	0.80722|0.80722	P|P	0.0|0.0	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.01281|.	0.0;0.0|.	T|T	0.27400|0.27400	-1.0075|-1.0075	8|4	0.02654|.	T|.	1|.	.|.	5.7765|5.7765	0.18281|0.18281	0.6536:0.0:0.3464:0.0|0.6536:0.0:0.3464:0.0	rs7419238;rs58641567;rs7419238|rs7419238;rs58641567;rs7419238	11;11|.	Q9H9V9-2;Q9H9V9|.	.;JMJD4_HUMAN|.	V|W	11|4	ENSP00000355720:A11V|.	ENSP00000355720:A11V|.	A|R	-|-	2|1	0|2	JMJD4|JMJD4	225989704|225989704	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.100000|-0.100000	0.10990|0.10990	-0.047000|-0.047000	0.13423|0.13423	-0.268000|-0.268000	0.10319|0.10319	GCG|CGG	G|0.002;A|0.998		0.741	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091970.1	NM_023007	
OBSCN	84033	hgsc.bcm.edu	37	1	228504669	228504669	+	Silent	SNP	G	G	A	rs61825302	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:228504669G>A	ENST00000422127.1	+	51	13589	c.13545G>A	c.(13543-13545)gcG>gcA	p.A4515A	OBSCN_ENST00000284548.11_Silent_p.A4515A|OBSCN_ENST00000366709.4_Silent_p.A1634A|OBSCN_ENST00000570156.2_Silent_p.A5472A|OBSCN_ENST00000366707.4_Silent_p.A2149A	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4515	Ig-like 46.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TGGCCTCTGCGCGGCTCACCG	0.731													g|||	729	0.145567	0.1218	0.2349	5008	,	,		13931	0.1518		0.159	False		,,,				2504	0.0941				p.A5472A		.											.	OBSCN-403	0			c.G16416A						.		,	507,3253		36,435,1409	5.0	6.0	6.0		13545,13545	-6.2	0.0	1	dbSNP_129	6	1105,6501		71,963,2769	no	coding-synonymous,coding-synonymous	OBSCN	NM_001098623.1,NM_052843.2	,	107,1398,4178	AA,AG,GG		14.528,13.484,14.1827	,	4515/7969,4515/6621	228504669	1612,9754	1880	3803	5683	SO:0001819	synonymous_variant	84033	exon62			CTCTGCGCGGCTC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.13545G>A	1.37:g.228504669G>A		0	0		74	69	NM_001271223	0	0	0	0	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																			G|0.841;A|0.159		0.731	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
TARBP1	6894	hgsc.bcm.edu	37	1	234601455	234601456	+	Splice_Site	DEL	CT	CT	-	rs202014861|rs138363068|rs560466095|rs531256921	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	CT	CT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:234601455_234601456delCT	ENST00000040877.1	-	5	1248		c.e5-1			NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1						regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			Caataataaactaaaaaaaaaa	0.312																																					.		.											.	TARBP1-93	0			.						.																																			SO:0001630	splice_region_variant	6894	.			AATAAACTAAAAA		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.1249-1AG>-	1.37:g.234601455_234601456delCT		45	0		61	0	.	0	0	0	0	0	Q9H581	Splice_Site	DEL	ENST00000040877.1	37	CCDS1601.1																																																																																			.		0.312	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092616.1	NM_005646	Intron
KIF26B	55083	hgsc.bcm.edu	37	1	245851609	245851609	+	Missense_Mutation	SNP	C	C	G	rs150834033	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr1:245851609C>G	ENST00000407071.2	+	12	5764	c.5324C>G	c.(5323-5325)cCc>cGc	p.P1775R	KIF26B_ENST00000366518.4_Missense_Mutation_p.P1394R	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1775	Ser-rich.				establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			AGCTCGCCCCCCGGTGGGAAG	0.721													C|||	70	0.0139776	0.0023	0.0274	5008	,	,		10300	0.002		0.0308	False		,,,				2504	0.0153				p.P1775R		.											.	KIF26B-25	0			c.C5324G						.	C	ARG/PRO	25,3179		2,21,1579	8.0	9.0	9.0		5324	5.3	0.0	1	dbSNP_134	9	219,6715		2,215,3250	yes	missense	KIF26B	NM_018012.3	103	4,236,4829	GG,GC,CC		3.1584,0.7803,2.4068	probably-damaging	1775/2109	245851609	244,9894	1602	3467	5069	SO:0001583	missense	55083	exon12			CGCCCCCCGGTGG	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.5324C>G	1.37:g.245851609C>G	ENSP00000385545:p.Pro1775Arg	0	0		35	32	NM_018012	0	0	0	1	1	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	37	CCDS44342.1	37	0.01694139194139194	4	0.008130081300813009	10	0.027624309392265192	1	0.0017482517482517483	22	0.029023746701846966	C	12.79	2.043373	0.36085	0.007803	0.031584	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	D;D	0.83837	-1.77;-1.76	5.29	5.29	0.74685	.	.	.	.	.	T	0.76744	0.4030	M	0.78801	2.425	0.80722	D	1	D;D	0.57899	0.981;0.966	P;P	0.52758	0.708;0.564	D	0.85045	0.0925	9	0.87932	D	0	.	18.9252	0.92541	0.0:1.0:0.0:0.0	.	1394;1775	B7WPD9;Q2KJY2	.;KI26B_HUMAN	R	1775;1394;1391	ENSP00000385545:P1775R;ENSP00000355475:P1394R	ENSP00000355475:P1394R	P	+	2	0	KIF26B	243918232	0.998000	0.40836	0.016000	0.15963	0.081000	0.17604	7.547000	0.82146	2.475000	0.83589	0.462000	0.41574	CCC	C|0.982;G|0.018		0.721	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
HECTD2	143279	hgsc.bcm.edu	37	10	93170250	93170250	+	Missense_Mutation	SNP	C	C	G	rs7081569		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr10:93170250C>G	ENST00000298068.5	+	1	149	c.55C>G	c.(55-57)Ccc>Gcc	p.P19A	HECTD2_ENST00000371681.4_Missense_Mutation_p.P19A|HECTD2_ENST00000446394.1_Missense_Mutation_p.P19A	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	19			P -> A (in dbSNP:rs7081569). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						GGTGGCGGCGCCCGCGCCTGA	0.761													G|||	5008	1.0	1.0	1.0	5008	,	,		7483	1.0		1.0	False		,,,				2504	1.0				p.P19A	NSCLC(12;376 469 1699 39910 41417)	.											.	HECTD2-658	0			c.C55G						.						2.0	2.0	2.0					10																	93170250		1173	2544	3717	SO:0001583	missense	143279	exon1			GCGGCGCCCGCGC	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.55C>G	10.37:g.93170250C>G	ENSP00000298068:p.Pro19Ala	0	0		6	6	NM_182765	0	0	0	1	1	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	ENST00000298068.5	37	CCDS7414.1	1998	0.9148351648351648	429	0.8719512195121951	335	0.925414364640884	529	0.9248251748251748	705	0.9300791556728232	g	1.760	-0.486925	0.04352	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.36699	1.5;1.24;1.5	2.37	2.37	0.29283	.	0.964307	0.08409	N	0.950145	T	0.00012	0.0000	N	0.00538	-1.39	0.46241	P	0.001052000000000053	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32534	-0.9903	9	0.02654	T	1	.	7.1033	0.25351	0.0:0.2826:0.7174:0.0	rs7081569	19;19;19	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	A	19	ENSP00000401023:P19A;ENSP00000360746:P19A;ENSP00000298068:P19A	ENSP00000298068:P19A	P	+	1	0	HECTD2	93160230	0.858000	0.29795	0.231000	0.23993	0.735000	0.41995	-0.544000	0.06077	0.556000	0.29098	-0.370000	0.07254	CCC	C|0.154;G|0.846		0.761	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098620.1		
TBC1D12	23232	hgsc.bcm.edu	37	10	96163039	96163039	+	Silent	SNP	C	C	G	rs2477534	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr10:96163039C>G	ENST00000225235.4	+	1	779	c.669C>G	c.(667-669)ccC>ccG	p.P223P		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	223							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GGGACAGCCCCGCCAGCAGCT	0.751													G|||	3411	0.68111	0.6165	0.5648	5008	,	,		8936	0.8373		0.6342	False		,,,				2504	0.7382				p.P223P		.											.	TBC1D12-68	0			c.C669G						.	G		1895,863		709,477,193	2.0	3.0	3.0		669	-2.0	0.0	10	dbSNP_100	3	4435,1895		1664,1107,394	yes	coding-synonymous	TBC1D12	NM_015188.1		2373,1584,587	GG,GC,CC		29.9368,31.2908,30.3477		223/776	96163039	6330,2758	1379	3165	4544	SO:0001819	synonymous_variant	23232	exon1			CAGCCCCGCCAGC	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.669C>G	10.37:g.96163039C>G		1	0		41	14	NM_015188	0	0	0	2	2	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Silent	SNP	ENST00000225235.4	37	CCDS41553.1																																																																																			C|0.339;G|0.661		0.751	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
PPRC1	23082	hgsc.bcm.edu	37	10	103892888	103892888	+	Silent	SNP	G	G	T	rs34756593	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr10:103892888G>T	ENST00000278070.2	+	1	102	c.63G>T	c.(61-63)ccG>ccT	p.P21P	PPRC1_ENST00000413464.2_Silent_p.P21P	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	21					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GCCCCGGTCCGGACCCTGGCG	0.726													.|||	57	0.0113818	0.0023	0.0432	5008	,	,		11916	0.0		0.0159	False		,,,				2504	0.0082				p.P21P		.											.	PPRC1-227	0			c.G63T						.	G		8,3968		0,8,1980	4.0	5.0	4.0		63	-10.3	0.2	10	dbSNP_126	4	96,7832		0,96,3868	no	coding-synonymous	PPRC1	NM_015062.3		0,104,5848	TT,TG,GG		1.2109,0.2012,0.8737		21/1665	103892888	104,11800	1988	3964	5952	SO:0001819	synonymous_variant	23082	exon1			CGGTCCGGACCCT	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.63G>T	10.37:g.103892888G>T		0	0		54	22	NM_015062	0	0	0	2	2	Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Silent	SNP	ENST00000278070.2	37	CCDS7529.1																																																																																			G|0.986;T|0.014		0.726	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050021.1	NM_015062	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		0	0		21	20	NM_001077494	0	0	0	12	12	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
TAF5	6877	hgsc.bcm.edu	37	10	105128134	105128134	+	Missense_Mutation	SNP	T	T	G	rs10883859	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr10:105128134T>G	ENST00000369839.3	+	1	411	c.388T>G	c.(388-390)Tcc>Gcc	p.S130A	TAF5_ENST00000351396.4_Missense_Mutation_p.S130A	NM_006951.3	NP_008882.2	Q15542	TAF5_HUMAN	TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa	130			S -> A (in dbSNP:rs10883859). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8758937, ECO:0000269|PubMed:9045704, ECO:0000269|Ref.5}.		chromatin modification (GO:0016568)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	protein dimerization activity (GO:0046983)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)	15		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;1.83e-09)|all cancers(201;1.4e-08)|BRCA - Breast invasive adenocarcinoma(275;0.198)		AGTGGCGGGCTCCGGAGCCCC	0.741													T|||	1553	0.310104	0.1952	0.4078	5008	,	,		9029	0.4206		0.329	False		,,,				2504	0.2628				p.S130A		.											.	TAF5-92	0			c.T388G						.	T	ALA/SER	635,2955		63,509,1223	3.0	5.0	4.0		388	1.9	1.0	10	dbSNP_120	4	2122,5176		327,1468,1854	no	missense	TAF5	NM_006951.3	99	390,1977,3077	GG,GT,TT		29.0765,17.688,25.3215	benign	130/801	105128134	2757,8131	1795	3649	5444	SO:0001583	missense	6877	exon1			GCGGGCTCCGGAG	X95525	CCDS7547.1	10q24-q25.2	2013-01-10	2002-08-29	2001-12-07	ENSG00000148835	ENSG00000148835		"""WD repeat domain containing"""	11539	protein-coding gene	gene with protein product		601787	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, D, 100kD"""	TAF2D		8884287, 8942982	Standard	NM_006951		Approved	TAFII100	uc001kwv.3	Q15542	OTTHUMG00000018985	ENST00000369839.3:c.388T>G	10.37:g.105128134T>G	ENSP00000358854:p.Ser130Ala	0	0		17	9	NM_006951	0	0	1	1	0	A8K5B4|B2RMR0|B7ZKJ6|Q53EM4|Q5SYD5|Q86UZ7|Q9Y4K5	Missense_Mutation	SNP	ENST00000369839.3	37	CCDS7547.1	821	0.3759157509157509	127	0.258130081300813	150	0.4143646408839779	277	0.48426573426573427	267	0.35224274406332456	T	12.78	2.040311	0.35989	0.17688	0.290765	ENSG00000148835	ENST00000369839;ENST00000351396	T;T	0.55930	0.73;0.49	4.45	1.88	0.25563	.	0.435426	0.24978	N	0.034100	T	0.00012	0.0000	N	0.04508	-0.205	0.41867	P	0.009742999999999946	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.46373	-0.9196	9	0.09338	T	0.73	-0.0936	6.2404	0.20787	0.1492:0.0:0.2595:0.5913	rs10883859	130;130	Q15542-2;Q15542	.;TAF5_HUMAN	A	130	ENSP00000358854:S130A;ENSP00000311024:S130A	ENSP00000311024:S130A	S	+	1	0	TAF5	105118124	0.988000	0.35896	1.000000	0.80357	0.948000	0.59901	0.932000	0.28884	0.814000	0.34374	0.459000	0.35465	TCC	T|0.623;G|0.377		0.741	TAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050144.1		
MUC5B	727897	hgsc.bcm.edu	37	11	1253976	1253976	+	Missense_Mutation	SNP	A	A	G	rs76956995		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:1253976A>G	ENST00000529681.1	+	17	2099	c.2041A>G	c.(2041-2043)Agc>Ggc	p.S681G	MUC5B_ENST00000447027.1_Missense_Mutation_p.S684G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	681					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGTACAGCTCAGCGACTGGAG	0.687																																					p.S681G		.											.	.	0			c.A2041G						.						22.0	25.0	24.0					11																	1253976		2121	4235	6356	SO:0001583	missense	727897	exon17			CAGCTCAGCGACT	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2041A>G	11.37:g.1253976A>G	ENSP00000436812:p.Ser681Gly	8	0		117	15	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	5.230	0.228008	0.09916	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76578	-1.03;-1.03	4.6	-7.0	0.01599	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.70605	0.3243	N	0.25144	0.715	0.09310	N	1	B;D;D	0.59357	0.425;0.985;0.985	B;P;P	0.54499	0.131;0.675;0.754	T	0.69614	-0.5098	9	0.87932	D	0	.	10.9271	0.47197	0.2958:0.5687:0.1355:0.0	.	681;1340;684	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	681;684;682;717	ENSP00000436812:S681G;ENSP00000415793:S684G	ENSP00000343037:S682G	S	+	1	0	MUC5B	1210552	0.000000	0.05858	0.011000	0.14972	0.067000	0.16453	-4.642000	0.00204	-1.098000	0.03038	0.260000	0.18958	AGC	.		0.687	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	hgsc.bcm.edu	37	11	1253980	1253980	+	Missense_Mutation	SNP	A	A	G	rs202127660		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:1253980A>G	ENST00000529681.1	+	17	2103	c.2045A>G	c.(2044-2046)gAc>gGc	p.D682G	MUC5B_ENST00000447027.1_Missense_Mutation_p.D685G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	682					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CAGCTCAGCGACTGGAGGGAC	0.682																																					p.D682G		.											.	.	0			c.A2045G						.						21.0	24.0	23.0					11																	1253980		2116	4228	6344	SO:0001583	missense	727897	exon17			TCAGCGACTGGAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.2045A>G	11.37:g.1253980A>G	ENSP00000436812:p.Asp682Gly	7	0		113	13	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660740	0.14645	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.76060	-0.99;-0.99	4.6	2.72	0.32119	Uncharacterised domain, cysteine-rich (2);	.	.	.	.	T	0.50103	0.1596	N	0.02960	-0.455	0.24874	N	0.992269	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45920	-0.9228	9	0.87932	D	0	.	8.6635	0.34108	0.2416:0.0:0.7584:0.0	.	682;1341;685	Q9HC84;A7Y9J9;E9PBJ0	MUC5B_HUMAN;.;.	G	682;685;683;718	ENSP00000436812:D682G;ENSP00000415793:D685G	ENSP00000343037:D683G	D	+	2	0	MUC5B	1210556	0.999000	0.42202	0.632000	0.29296	0.070000	0.16714	2.607000	0.46300	0.373000	0.24621	-1.983000	0.00453	GAC	.		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
KRTAP5-4	387267	hgsc.bcm.edu	37	11	1643216	1643216	+	Silent	SNP	C	C	T	rs184923323		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:1643216C>T	ENST00000399682.1	-	1	152	c.108G>A	c.(106-108)ggG>ggA	p.G36G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		agccacagcccccacagccgg	0.692																																					p.G36G		.											.	.	0			c.G108A						.						4.0	12.0	10.0					11																	1643216		510	1324	1834	SO:0001819	synonymous_variant	387267	exon1			ACAGCCCCCACAG	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.108G>A	11.37:g.1643216C>T		19	0		150	8	NM_001012709	0	0	0	0	0		Silent	SNP	ENST00000399682.1	37																																																																																				C|0.983;T|0.017		0.692	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
KRTAP5-4	387267	broad.mit.edu	37	11	1643255	1643255	+	Silent	SNP	G	G	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:1643255G>A	ENST00000399682.1	-	1	113	c.69C>T	c.(67-69)ggC>ggT	p.G23G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)		p.G23G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagagccacagcccccacagc	0.687																																					p.G23G		.											.	.	1	Substitution - coding silent(1)	kidney(1)	c.C69T						.						4.0	8.0	7.0					11																	1643255		646	1526	2172	SO:0001819	synonymous_variant	387267	exon1			GCCACAGCCCCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.69C>T	11.37:g.1643255G>A		54	0		234	10	NM_001012709	0	0	0	0	0		Silent	SNP	ENST00000399682.1	37																																																																																				.		0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
KRTAP5-4	387267	broad.mit.edu	37	11	1643258	1643258	+	Silent	SNP	C	C	T	rs28696103		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:1643258C>T	ENST00000399682.1	-	1	110	c.66G>A	c.(64-66)ggG>ggA	p.G22G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		agccacagcccccacagccgg	0.687																																					p.G22G		.											.	.	0			c.G66A						.						5.0	8.0	7.0					11																	1643258		651	1535	2186	SO:0001819	synonymous_variant	387267	exon1			ACAGCCCCCACAG	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.66G>A	11.37:g.1643258C>T		74	3		253	14	NM_001012709	0	0	0	0	0		Silent	SNP	ENST00000399682.1	37																																																																																				.		0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
TMEM132A	54972	hgsc.bcm.edu	37	11	60701987	60701987	+	Silent	SNP	G	G	A	rs7715	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:60701987G>A	ENST00000453848.2	+	9	1745	c.1587G>A	c.(1585-1587)tcG>tcA	p.S529S	TMEM132A_ENST00000005286.4_Silent_p.S530S			Q24JP5	T132A_HUMAN	transmembrane protein 132A	529						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CAGAGGCGTCGGATGAGGCCG	0.776													A|||	2111	0.421526	0.4713	0.4467	5008	,	,		10338	0.3165		0.4225	False		,,,				2504	0.4438				p.S530S		.											.	TMEM132A-227	0			c.G1590A						.	A	,	942,1508		213,516,496	2.0	2.0	2.0		1590,1587	-7.2	0.0	11	dbSNP_52	2	2096,3524		468,1160,1182	no	coding-synonymous,coding-synonymous	TMEM132A	NM_017870.3,NM_178031.2	,	681,1676,1678	AA,AG,GG		37.2954,38.449,37.6456	,	530/1025,529/1024	60701987	3038,5032	1225	2810	4035	SO:0001819	synonymous_variant	54972	exon9			GGCGTCGGATGAG	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.1587G>A	11.37:g.60701987G>A		0	0		5	5	NM_017870	0	0	2	27	25	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Silent	SNP	ENST00000453848.2	37	CCDS44618.1	914	0.4184981684981685	245	0.49796747967479676	164	0.4530386740331492	185	0.32342657342657344	320	0.42216358839050133	A	4.934	0.173621	0.09391	0.38449	0.372954	ENSG00000006118	ENST00000536409	.	.	.	3.58	-7.16	0.01516	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999658343	.	.	.	.	.	.	T	0.36792	-0.9733	3	.	.	.	.	2.6854	0.05106	0.499:0.0869:0.2045:0.2096	rs7715;rs1054244;rs3168133;rs17341674;rs17349396;rs60745855	.	.	.	R	121	.	.	G	+	1	0	TMEM132A	60458563	.	.	0.000000	0.03702	0.000000	0.00434	.	.	-2.810000	0.00348	-1.376000	0.01182	GGA	G|0.581;A|0.419		0.776	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000396352.1	NM_017870	
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	TM7SF2_ENST00000540748.1_5'UTR|AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		0	0		8	8	NM_003273	0	0	0	147	147	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
FAM86C1	55199	hgsc.bcm.edu	37	11	71498671	71498671	+	Missense_Mutation	SNP	G	G	C	rs12283346	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:71498671G>C	ENST00000359244.4	+	1	112	c.89G>C	c.(88-90)cGc>cCc	p.R30P	FAM86C1_ENST00000426628.2_Missense_Mutation_p.R30P|FAM86C1_ENST00000346333.6_Missense_Mutation_p.R30P	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1	30			R -> P (in dbSNP:rs12283346). {ECO:0000269|PubMed:14702039}.							lung(1)	1						CGCTCCTTCCGCTGGCAGGTG	0.741													.|||	2261	0.451478	0.3351	0.3516	5008	,	,		10448	0.3452		0.5666	False		,,,				2504	0.6708				p.R30P		.											.	FAM86C1-90	0			c.G89C						.						3.0	3.0	3.0					11																	71498671		1774	3427	5201	SO:0001583	missense	55199	exon1			CCTTCCGCTGGCA	AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.89G>C	11.37:g.71498671G>C	ENSP00000352182:p.Arg30Pro	1	0		10	8	NM_152563	0	0	0	0	0	Q8N5D3	Missense_Mutation	SNP	ENST00000359244.4	37	CCDS41686.1	871	0.39880952380952384	166	0.33739837398373984	136	0.3756906077348066	173	0.30244755244755245	396	0.5224274406332454	.	1.506	-0.550640	0.03996	.	.	ENSG00000158483	ENST00000346333;ENST00000359244;ENST00000426628;ENST00000528685	T;T;T;T	0.08634	3.07;3.07;3.07;3.07	2.47	2.47	0.30058	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	4.000000000004E-6	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.44483	-0.9325	7	0.02654	T	1	.	7.3824	0.26864	0.0:0.7256:0.2744:0.0	rs12283346	30;30;30	G3V0F7;Q9NVL1-2;Q9NVL1	.;.;FA86C_HUMAN	P	30	ENSP00000325662:R30P;ENSP00000352182:R30P;ENSP00000391329:R30P;ENSP00000436598:R30P	ENSP00000325662:R30P	R	+	2	0	FAM86C1	71176319	0.633000	0.27181	0.784000	0.31847	0.041000	0.13682	0.888000	0.28268	0.155000	0.19261	-1.123000	0.02005	CGC	G|0.601;C|0.399		0.741	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000361120.1	NM_152563	
B3GNT6	192134	hgsc.bcm.edu	37	11	76751542	76751542	+	Frame_Shift_Del	DEL	T	T	-	rs11292198		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:76751542delT	ENST00000533140.1	+	2	1085	c.947delT	c.(946-948)cttfs	p.L316fs	B3GNT6_ENST00000354301.5_Splice_Site_p.L316fs|B3GNT6_ENST00000421061.1_Intron			O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase)	0					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			central_nervous_system(1)|kidney(2)|lung(4)|prostate(1)	8						GGCATGTGTCTTGGAGCGCGC	0.741													T|TT|T|insertion	5008	1.0	1.0	1.0	5008	,	,		12582	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.946+1T>-						.						1.0	1.0	1.0					11																	76751542		431	917	1348	SO:0001589	frameshift_variant	192134	exon2			TGTGTCTTGGAGC	AB073740	CCDS53681.1	11q13.4	2013-02-19			ENSG00000198488	ENSG00000198488		"""Beta 3-glycosyltransferases"""	24141	protein-coding gene	gene with protein product		615315				11821425	Standard	NM_138706		Approved	B3Gn-T6	uc021qnp.1	Q6ZMB0		ENST00000533140.1:c.947delT	11.37:g.76751542delT	ENSP00000435352:p.Leu316fs	0	0		19	19	NM_138706	0	0	0	0	0	Q4TTN0	Splice_Site	DEL	ENST00000533140.1	37	CCDS53681.1																																																																																			.		0.741	B3GNT6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000382740.2	NM_138706	
MAML2	84441	broad.mit.edu	37	11	95825221	95825221	+	Silent	SNP	C	C	T	rs571656416	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:95825221C>T	ENST00000524717.1	-	2	3258	c.1974G>A	c.(1972-1974)caG>caA	p.Q658Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	658					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgctgttgttgct	0.527			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid								C|||	4	0.000798722	0.0015	0.0	5008	,	,		17889	0.002		0.0	False		,,,				2504	0.0				p.Q658Q		.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	.	MAML2-850	0			c.G1974A						.																																			SO:0001819	synonymous_variant	84441	exon2			CTGCTGCTGTTGT	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1974G>A	11.37:g.95825221C>T		125	2		113	5	NM_032427	0	0	0	0	0	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	37	CCDS44714.1																																																																																			.		0.527	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
ROBO4	54538	broad.mit.edu	37	11	124756982	124756982	+	Missense_Mutation	SNP	G	G	A	rs138481093	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:124756982G>A	ENST00000306534.3	-	15	2811	c.2326C>T	c.(2326-2328)Cgc>Tgc	p.R776C	RP11-664I21.5_ENST00000524453.1_RNA|ROBO4_ENST00000533054.1_Missense_Mutation_p.R631C	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	776	Pro/Ser-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CTGGACAGGCGACTGGAAGCT	0.647													g|||	10	0.00199681	0.0008	0.0029	5008	,	,		14144	0.001		0.006	False		,,,				2504	0.0				p.R776C		.											.	ROBO4-92	0			c.C2326T						.		CYS/ARG	11,4391	14.3+/-33.2	0,11,2190	35.0	37.0	36.0		2326	3.8	0.8	11	dbSNP_134	36	64,8534	37.8+/-93.5	0,64,4235	yes	missense	ROBO4	NM_019055.5	180	0,75,6425	AA,AG,GG		0.7444,0.2499,0.5769	probably-damaging	776/1008	124756982	75,12925	2201	4299	6500	SO:0001583	missense	54538	exon15			ACAGGCGACTGGA	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.2326C>T	11.37:g.124756982G>A	ENSP00000304945:p.Arg776Cys	123	0		97	3	NM_019055	0	0	6	6	0	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	37	CCDS8455.1	8	0.003663003663003663	2	0.0040650406504065045	1	0.0027624309392265192	1	0.0017482517482517483	4	0.005277044854881266	g	14.26	2.483817	0.44147	0.002499	0.007444	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.65916	-0.18;0.18	4.77	3.83	0.44106	.	1.646620	0.04040	N	0.302927	T	0.57562	0.2062	L	0.56769	1.78	0.23795	N	0.996828	D;D;D	0.59767	0.986;0.986;0.975	P;P;B	0.47015	0.534;0.534;0.23	T	0.45963	-0.9225	10	0.48119	T	0.1	.	7.7999	0.29168	0.0:0.1714:0.637:0.1915	.	776;666;776	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	C	776;666;631	ENSP00000304945:R776C;ENSP00000437129:R631C	ENSP00000304945:R776C	R	-	1	0	ROBO4	124262192	0.553000	0.26513	0.840000	0.33206	0.983000	0.72400	1.196000	0.32198	0.955000	0.37878	0.552000	0.68991	CGC	G|0.996;A|0.004		0.647	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055	
ARHGAP32	9743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	128857997	128857997	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr11:128857997T>C	ENST00000310343.9	-	12	1176	c.1177A>G	c.(1177-1179)Aca>Gca	p.T393A	ARHGAP32_ENST00000392657.3_Missense_Mutation_p.T44A|ARHGAP32_ENST00000524655.1_Missense_Mutation_p.T319A|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.T44A	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	393	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						ATGAATGCTGTGCAGCTTTGA	0.393																																					p.T393A		.											.	ARHGAP32-231	0			c.A1177G						.						79.0	74.0	76.0					11																	128857997		2201	4297	6498	SO:0001583	missense	9743	exon12			ATGCTGTGCAGCT	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.1177A>G	11.37:g.128857997T>C	ENSP00000310561:p.Thr393Ala	35	0		30	8	NM_001142685	0	0	0	0	0	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	37	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	T	8.217	0.801693	0.16397	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272;ENST00000356092	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.97	5.97	0.96955	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.156118	0.56097	D	0.000038	T	0.11239	0.0274	N	0.04162	-0.26	0.80722	D	1	B;B;B	0.21821	0.026;0.061;0.0	B;B;B	0.29862	0.038;0.108;0.001	T	0.11251	-1.0595	10	0.06099	T	0.92	.	16.1296	0.81418	0.0:0.0:0.0:1.0	.	327;393;211	Q86T64;A7KAX9;Q86UT2	.;RHG32_HUMAN;.	A	393;44;319;327;44;103	ENSP00000310561:T393A;ENSP00000376425:T44A;ENSP00000432468:T319A;ENSP00000432862:T44A	ENSP00000310561:T393A	T	-	1	0	ARHGAP32	128363207	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	3.980000	0.56895	2.289000	0.77006	0.459000	0.35465	ACA	.		0.393	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
TAS2R43	259289	hgsc.bcm.edu	37	12	11244814	11244814	+	Silent	SNP	T	T	C	rs377076131		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr12:11244814T>C	ENST00000531678.1	-	1	98	c.15A>G	c.(13-15)ctA>ctG	p.L5L	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	5					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		AAATGATGGGTAGAAAAGTTA	0.393																																					p.L5L		.											.	TAS2R43-1	0			c.A15G						.						26.0	22.0	24.0					12																	11244814		1654	3274	4928	SO:0001819	synonymous_variant	259289	exon1			GATGGGTAGAAAA	AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.15A>G	12.37:g.11244814T>C		124	0		181	10	NM_176884	0	0	0	0	0	P59546|Q645X4	Silent	SNP	ENST00000531678.1	37	CCDS53749.1																																																																																			.		0.393	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383561.1	NM_176884	
SRRM4	84530	hgsc.bcm.edu	37	12	119594512	119594512	+	Missense_Mutation	SNP	G	G	C	rs140426282	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr12:119594512G>C	ENST00000267260.4	+	13	2133	c.1745G>C	c.(1744-1746)cGg>cCg	p.R582P		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	582	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						TCCCGCagccggagccggagc	0.716													G|||	37	0.00738818	0.0008	0.0159	5008	,	,		11859	0.0		0.0219	False		,,,				2504	0.0031				p.R582P		.											.	SRRM4-2	0			c.G1745C						.	G	PRO/ARG	6,3266		0,6,1630	2.0	4.0	4.0		1745	2.5	0.8	12	dbSNP_134	4	67,6959		0,67,3446	no	missense	SRRM4	NM_194286.3	103	0,73,5076	CC,CG,GG		0.9536,0.1834,0.7089	possibly-damaging	582/612	119594512	73,10225	1636	3513	5149	SO:0001583	missense	84530	exon13			GCAGCCGGAGCCG	AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1745G>C	12.37:g.119594512G>C	ENSP00000267260:p.Arg582Pro	0	0		56	28	NM_194286	0	0	0	0	0	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	ENST00000267260.4	37	CCDS44994.1	24	0.01098901098901099	1	0.0020325203252032522	7	0.019337016574585635	0	0.0	16	0.021108179419525065	G	12.44	1.937207	0.34189	0.001834	0.009536	ENSG00000139767	ENST00000267260	T	0.26518	1.73	4.42	2.54	0.30619	.	0.356243	0.18124	U	0.150962	T	0.06554	0.0168	N	0.08118	0	0.21184	N	0.999765	P	0.41214	0.742	B	0.42692	0.395	T	0.11916	-1.0568	9	.	.	.	-1.3819	8.1375	0.31063	0.2624:0.0:0.7376:0.0	.	582	A7MD48	SRRM4_HUMAN	P	582	ENSP00000267260:R582P	.	R	+	2	0	SRRM4	118078895	0.994000	0.37717	0.795000	0.32087	0.902000	0.53008	0.270000	0.18607	0.839000	0.34971	0.650000	0.86243	CGG	G|0.989;C|0.011		0.716	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401640.2	NM_194286	
SCARB1	949	hgsc.bcm.edu	37	12	125348263	125348263	+	Missense_Mutation	SNP	C	C	T	rs4238001	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr12:125348263C>T	ENST00000415380.2	-	1	129	c.4G>A	c.(4-6)Ggc>Agc	p.G2S	SCARB1_ENST00000339570.5_Missense_Mutation_p.G2S|SCARB1_ENST00000261693.6_Missense_Mutation_p.G2S|SCARB1_ENST00000376788.1_Missense_Mutation_p.G2S|SCARB1_ENST00000546215.1_Missense_Mutation_p.G2S|SCARB1_ENST00000535005.1_Intron			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	2			G -> S (associated with higher plasma triglyceride concentration in subjects with hypercholesterolemia; dbSNP:rs4238001). {ECO:0000269|PubMed:12519372, ECO:0000269|PubMed:12966036}.		adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	GCGGAGCAGCCCATGTCTGCG	0.741													C|||	322	0.0642971	0.0666	0.0994	5008	,	,		9316	0.003		0.1163	False		,,,				2504	0.046				p.G2S		.											.	SCARB1-226	0			c.G4A	GRCh37	CM994635	SCARB1	M	rs4238001	.	C	SER/GLY,SER/GLY	221,3989		8,205,1892	10.0	9.0	9.0		4,4	3.2	1.0	12	dbSNP_111	9	800,7270		43,714,3278	no	missense,missense	SCARB1	NM_001082959.1,NM_005505.4	56,56	51,919,5170	TT,TC,CC		9.9133,5.2494,8.3143	probably-damaging,probably-damaging	2/507,2/510	125348263	1021,11259	2105	4035	6140	SO:0001583	missense	949	exon1			AGCAGCCCATGTC	Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.4G>A	12.37:g.125348263C>T	ENSP00000414979:p.Gly2Ser	0	0		54	28	NM_005505	0	1	324	862	537	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Missense_Mutation	SNP	ENST00000415380.2	37		165	0.07554945054945054	44	0.08943089430894309	36	0.09944751381215469	0	0.0	85	0.11213720316622691	C	18.49	3.635365	0.67130	0.052494	0.099133	ENSG00000073060	ENST00000339570;ENST00000415380;ENST00000261693;ENST00000376788;ENST00000546215;ENST00000545493	T;T;T;T;T;T	0.78481	-0.07;-0.07;-0.08;-1.18;-0.01;0.18	3.22	3.22	0.36961	.	1.157680	0.06728	U	0.776122	T	0.12518	0.0304	L	0.60455	1.87	0.09310	P	0.9999999999958479	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.80764	0.986;0.986;0.986;0.994;0.994	T	0.59757	-0.7394	9	0.62326	D	0.03	-23.5156	10.5912	0.45310	0.0:1.0:0.0:0.0	rs4238001	2;2;2;2;2	B7ZKQ9;B4E3I1;Q8WTV0;F8W8N0;Q8WTV0-2	.;.;SCRB1_HUMAN;.;.	S	2	ENSP00000343795:G2S;ENSP00000414979:G2S;ENSP00000261693:G2S;ENSP00000365984:G2S;ENSP00000442862:G2S;ENSP00000443454:G2S	ENSP00000261693:G2S	G	-	1	0	SCARB1	123914216	1.000000	0.71417	0.996000	0.52242	0.247000	0.25773	1.365000	0.34182	1.734000	0.51633	0.185000	0.17295	GGC	C|0.935;T|0.065		0.741	SCARB1-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000400165.1	NM_005505	
EP400	57634	broad.mit.edu	37	12	132547096	132547097	+	Frame_Shift_Del	DEL	GC	GC	-	rs74479394|rs113304321	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr12:132547096_132547097delGC	ENST00000333577.4	+	48	8401_8402	c.8292_8293delGC	c.(8290-8295)cagcagfs	p.QQ2764fs	EP400_ENST00000332482.4_Frame_Shift_Del_p.QQ2691fs|EP400_ENST00000389562.2_Frame_Shift_Del_p.QQ2727fs|EP400_ENST00000389561.2_Frame_Shift_Del_p.QQ2728fs|EP400_ENST00000330386.6_Frame_Shift_Del_p.QQ2647fs			Q96L91	EP400_HUMAN	E1A binding protein p400	2764	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcaacaacagcagcagcagca	0.569																																					p.2728_2729del		.											.	EP400-520	0			c.8184_8185del						.																																			SO:0001589	frameshift_variant	57634	exon47			ACAACAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8292_8293delGC	12.37:g.132547096_132547097delGC	ENSP00000333602:p.Gln2764fs	143	0		239	7	NM_015409	0	0	0	0	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Frame_Shift_Del	DEL	ENST00000333577.4	37																																																																																				.		0.569	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
EP400	57634	hgsc.bcm.edu;broad.mit.edu	37	12	132547099	132547099	+	Silent	SNP	G	G	A	rs145603866		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr12:132547099G>A	ENST00000333577.4	+	48	8404	c.8295G>A	c.(8293-8295)caG>caA	p.Q2765Q	EP400_ENST00000332482.4_Silent_p.Q2692Q|EP400_ENST00000389562.2_Silent_p.Q2728Q|EP400_ENST00000389561.2_Silent_p.Q2729Q|EP400_ENST00000330386.6_Silent_p.Q2648Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2765	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		aacaacagcagcagcagcagc	0.577																																					p.Q2729Q		.											.	EP400-520	0			c.G8187A						.						23.0	28.0	26.0					12																	132547099		2139	4139	6278	SO:0001819	synonymous_variant	57634	exon47			ACAGCAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8295G>A	12.37:g.132547099G>A		138	0		253	24	NM_015409	0	0	9	9	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				G|0.997;A|0.003		0.577	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
EP400	57634	broad.mit.edu	37	12	132547129	132547129	+	Silent	SNP	G	G	A	rs540349271	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr12:132547129G>A	ENST00000333577.4	+	48	8434	c.8325G>A	c.(8323-8325)caG>caA	p.Q2775Q	EP400_ENST00000332482.4_Silent_p.Q2702Q|EP400_ENST00000389562.2_Silent_p.Q2738Q|EP400_ENST00000389561.2_Silent_p.Q2739Q|EP400_ENST00000330386.6_Silent_p.Q2658Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2775	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcagcagcaac	0.587													G|||	2	0.000399361	0.0008	0.0	5008	,	,		15010	0.0		0.0	False		,,,				2504	0.001				p.Q2739Q		.											.	EP400-520	0			c.G8217A						.						35.0	32.0	33.0					12																	132547129		2199	4290	6489	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8325G>A	12.37:g.132547129G>A		195	0		321	15	NM_015409	0	0	20	29	9	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																				G|1.000;A|0.000		0.587	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
DLEU1	10301	broad.mit.edu	37	13	50656582	50656582	+	Missense_Mutation	SNP	T	T	A	rs2066575	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr13:50656582T>A	ENST00000378180.4	+	1	276	c.10T>A	c.(10-12)Tgt>Agt	p.C4S	DLEU1_ENST00000490577.1_3'UTR			O43261	LEU1_HUMAN	deleted in lymphocytic leukemia 1 (non-protein coding)	4																	AATGAGACCTTGTATATGGAT	0.463													T|||	812	0.162141	0.0446	0.1902	5008	,	,		19726	0.2847		0.2276	False		,,,				2504	0.1074				.		.											.	.	0			.						.																																			SO:0001583	missense	10301	.			AGACCTTGTATAT	Y15227		13q14.3	2014-07-18	2008-08-13		ENSG00000176124	ENSG00000176124		"""-"""	13747	non-coding RNA	RNA, long non-coding	"""B-cell neoplasia-associated gene with multiple splicing"", ""non-protein coding RNA 21"", ""long intergenic non-protein coding RNA 21"""	605765	"""deleted in lymphocytic leukemia, 1"""	DLB1, BCMS		9395242, 11406609	Standard	NR_109973		Approved	LEU1, XTP6, NCRNA00021, LINC00021, BCMS1		O43261	OTTHUMG00000016934	ENST00000378180.4:c.10T>A	13.37:g.50656582T>A	ENSP00000367422:p.Cys4Ser	107	0		57	4	.	0	0	3	3	0	Q547G6|Q8TE10|Q96QY5	RNA	SNP	ENST00000378180.4	37		489	0.2239010989010989	26	0.052845528455284556	81	0.22375690607734808	198	0.34615384615384615	184	0.24274406332453827	T	11.11	1.541423	0.27563	.	.	ENSG00000176124	ENST00000378180	.	.	.	4.1	-0.103	0.13609	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.35674	-0.9779	4	0.87932	D	0	.	3.7715	0.08643	0.0:0.213:0.1886:0.5984	rs2066575;rs9562950;rs56439730;rs2066575	.	.	.	S	4	.	ENSP00000367422:C4S	C	+	1	0	DLEU1	49554583	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.013000	0.13310	-0.064000	0.13043	0.260000	0.18958	TGT	T|0.787;A|0.213		0.463	DLEU1-033	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000045000.1	NR_002605	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	0	0		23	8	NM_001127258	0	0	1	1	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
EPB42	2038	broad.mit.edu	37	15	43501531	43501531	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr15:43501531C>A	ENST00000441366.2	-	6	998	c.773G>T	c.(772-774)gGc>gTc	p.G258V	EPB42_ENST00000300215.3_Missense_Mutation_p.G288V|EPB42_ENST00000563128.1_5'Flank|EPB42_ENST00000540029.1_Missense_Mutation_p.G180V	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	258					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		TCGGCCTCGGCCGGTGAGCCA	0.677																																					p.G288V		.											.	EPB42-92	0			c.G863T						.						46.0	44.0	45.0					15																	43501531		2203	4299	6502	SO:0001583	missense	2038	exon6			CCTCGGCCGGTGA	M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.773G>T	15.37:g.43501531C>A	ENSP00000396616:p.Gly258Val	28	0		151	9	NM_000119	0	0	0	0	0	Q4KKX0|Q4VB97	Missense_Mutation	SNP	ENST00000441366.2	37	CCDS45249.1	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528930	0.27387	.	.	ENSG00000166947	ENST00000300215;ENST00000540029;ENST00000441366;ENST00000397027	T;T;T	0.52295	0.67;0.67;0.67	4.69	4.69	0.59074	Transglutaminase-like (1);	0.481828	0.23587	N	0.046600	T	0.62925	0.2468	M	0.78049	2.395	0.22511	N	0.999034	D;D;D;D	0.89917	1.0;0.998;0.997;0.998	D;D;P;D	0.77004	0.989;0.926;0.878;0.926	T	0.54840	-0.8233	10	0.17369	T	0.5	-22.3396	8.9578	0.35829	0.0:0.9008:0.0:0.0992	.	180;258;288;258	F5H563;B7Z4C3;P16452-2;P16452	.;.;.;EPB42_HUMAN	V	288;180;258;258	ENSP00000300215:G288V;ENSP00000444699:G180V;ENSP00000396616:G258V	ENSP00000300215:G288V	G	-	2	0	EPB42	41288823	0.000000	0.05858	0.896000	0.35187	0.071000	0.16799	0.094000	0.15107	2.568000	0.86640	0.655000	0.94253	GGC	.		0.677	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432219.1	NM_000119	
TPSD1	23430	hgsc.bcm.edu	37	16	1306346	1306346	+	Missense_Mutation	SNP	C	C	G	rs3865205	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:1306346C>G	ENST00000211076.3	+	1	213	c.65C>G	c.(64-66)cCg>cGg	p.P22R	RP11-616M22.5_ENST00000566997.1_RNA|TPSD1_ENST00000397534.2_Missense_Mutation_p.P15R	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	22			P -> R (in dbSNP:rs3865205). {ECO:0000269|PubMed:9920877}.			extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				CTGGCGAGCCCGGCCTACGTG	0.721													-|||	1100	0.219649	0.112	0.1571	5008	,	,		14799	0.3641		0.1938	False		,,,				2504	0.2873				p.P22R		.											.	TPSD1-90	0			c.C65G						.						32.0	40.0	37.0					16																	1306346		2197	4298	6495	SO:0001583	missense	23430	exon1			CGAGCCCGGCCTA	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.65C>G	16.37:g.1306346C>G	ENSP00000211076:p.Pro22Arg	5	0		352	19	NM_012217	0	0	0	0	0	O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Missense_Mutation	SNP	ENST00000211076.3	37	CCDS10432.1	.	.	.	.	.	.	.	.	.	.	-	3.814	-0.039033	0.07497	.	.	ENSG00000095917	ENST00000397534;ENST00000211076	D;D	0.81579	-1.51;-1.51	2.55	0.112	0.14623	.	2.133630	0.02279	N	0.069280	T	0.64571	0.2610	N	0.08118	0	0.09310	N	1	B	0.22003	0.063	B	0.26693	0.072	T	0.51317	-0.8721	10	0.20046	T	0.44	.	6.9607	0.24595	0.0:0.3788:0.0:0.6212	rs3865205;rs3891050	22	Q9BZJ3	TRYD_HUMAN	R	15;22	ENSP00000380668:P15R;ENSP00000211076:P22R	ENSP00000211076:P22R	P	+	2	0	TPSD1	1246347	0.000000	0.05858	0.007000	0.13788	0.001000	0.01503	-2.678000	0.00839	-0.544000	0.06232	-2.646000	0.00150	CCG	C|0.851;T|0.149		0.721	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2		
PKD1	5310	broad.mit.edu	37	16	2152129	2152129	+	Silent	SNP	A	A	G	rs144582212	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:2152129A>G	ENST00000262304.4	-	26	9538	c.9330T>C	c.(9328-9330)ccT>ccC	p.P3110P	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Silent_p.P3110P	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3110					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCCCACAGAAAGGGATGGCGC	0.667													g|||	695	0.138778	0.3911	0.0994	5008	,	,		16303	0.0		0.0815	False		,,,				2504	0.0276				p.P3110P		.											.	PKD1-91	0			c.T9330C						.																																			SO:0001819	synonymous_variant	5310	exon26			ACAGAAAGGGATG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.9330T>C	16.37:g.2152129A>G		87	1		318	44	NM_000296	0	0	3	30	27	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			A|0.500;G|0.500		0.667	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PKD1	5310	hgsc.bcm.edu	37	16	2156447	2156447	+	Silent	SNP	G	G	A	rs2003782	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:2156447G>A	ENST00000262304.4	-	18	7649	c.7441C>T	c.(7441-7443)Ctg>Ttg	p.L2481L	PKD1_ENST00000561991.1_5'Flank|PKD1_ENST00000423118.1_Silent_p.L2481L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2481	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						ACAGCGCCCAGTGGGAAGAGG	0.716													a|||	1082	0.216054	0.5439	0.1715	5008	,	,		15215	0.0		0.159	False		,,,				2504	0.0859				p.L2481L		.											.	PKD1-91	0			c.C7441T						.		,	1033,1813		192,649,582	3.0	4.0	4.0		7441,7441	0.4	0.0	16	dbSNP_92	4	861,5451		64,733,2359	no	coding-synonymous,coding-synonymous	PKD1	NM_000296.3,NM_001009944.2	,	256,1382,2941	AA,AG,GG		13.6407,36.2966,20.6814	,	2481/4303,2481/4304	2156447	1894,7264	1423	3156	4579	SO:0001819	synonymous_variant	5310	exon18			CGCCCAGTGGGAA	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.7441C>T	16.37:g.2156447G>A		1	0		58	25	NM_000296	0	0	28	32	4	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																			G|0.793;A|0.207		0.716	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341688.1		
PRSS27	83886	broad.mit.edu	37	16	2762757	2762757	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:2762757A>C	ENST00000302641.3	-	6	791	c.737T>G	c.(736-738)gTg>gGg	p.V246G	AC092117.1_ENST00000410123.1_RNA	NM_031948.3	NP_114154.1	Q9BQR3	PRS27_HUMAN	protease, serine 27	246	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8						CCAGCTGATCACCCCCGCCTG	0.667																																					p.V246G		.											.	PRSS27-91	0			c.T737G						.						27.0	24.0	25.0					16																	2762757		2178	4284	6462	SO:0001583	missense	83886	exon6			CTGATCACCCCCG	AB056161	CCDS10476.1	16p13.3	2010-05-07			ENSG00000172382	ENSG00000172382		"""Serine peptidases / Serine peptidases"""	15475	protein-coding gene	gene with protein product		608018					Standard	NM_031948		Approved	MPN, pancreasin, CAPH2, marapsin	uc002crf.3	Q9BQR3	OTTHUMG00000128929	ENST00000302641.3:c.737T>G	16.37:g.2762757A>C	ENSP00000306390:p.Val246Gly	27	8		138	38	NM_031948	0	0	2	3	1		Missense_Mutation	SNP	ENST00000302641.3	37	CCDS10476.1	.	.	.	.	.	.	.	.	.	.	.	16.11	3.030268	0.54790	.	.	ENSG00000172382	ENST00000302641;ENST00000543965	D	0.85861	-2.04	5.21	5.21	0.72293	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.48286	D	0.000182	D	0.94670	0.8281	H	0.96777	3.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.987;0.992	D	0.96007	0.8998	10	0.87932	D	0	.	13.0312	0.58842	1.0:0.0:0.0:0.0	.	246;210	Q9BQR3;B3KP25	PRS27_HUMAN;.	G	246;210	ENSP00000306390:V246G	ENSP00000306390:V246G	V	-	2	0	PRSS27	2702758	0.956000	0.32656	0.212000	0.23672	0.512000	0.34134	8.849000	0.92178	1.969000	0.57287	0.459000	0.35465	GTG	.		0.667	PRSS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250908.1	NM_031948	
C16orf82	162083	broad.mit.edu	37	16	27078705	27078705	+	lincRNA	SNP	T	T	C	rs115398674	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:27078705T>C	ENST00000505035.1	+	0	678				RP11-673P17.2_ENST00000565783.1_RNA			Q7Z2V1	TNT_HUMAN	chromosome 16 open reading frame 82																		CTGGGCTCCATAGACCCTCCC	0.652													C|||	96	0.0191693	0.0711	0.0014	5008	,	,		17209	0.0		0.001	False		,,,				2504	0.0				p.I130T		.											.	.	0			c.T389C						.	C	THR/ILE	203,3827		4,195,1816	8.0	12.0	10.0		389	-4.4	0.0	16	dbSNP_132	10	4,8292		0,4,4144	yes	missense	C16orf82	NM_001145545.1	89	4,199,5960	CC,CT,TT		0.0482,5.0372,1.6794	benign	130/155	27078705	207,12119	2015	4148	6163			162083	exon1			GCTCCATAGACCC	BC031257		16p12.1	2013-01-24			ENSG00000234186	ENSG00000234186			30755	other	unknown						12477932	Standard	NM_001145545		Approved	TNT	uc010vcm.2	Q7Z2V1	OTTHUMG00000161986		16.37:g.27078705T>C		31	0		85	4	NM_001145545	0	0	0	0	0	B9EGC2|Q8NEF0	Missense_Mutation	SNP	ENST00000505035.1	37																																																																																				T|0.980;C|0.020		0.652	C16orf82-001	KNOWN	basic	lincRNA	lincRNA	OTTHUMT00000366634.1	NM_001145545	
GPT2	84706	broad.mit.edu	37	16	46956237	46956237	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:46956237G>T	ENST00000340124.4	+	9	1233	c.1121G>T	c.(1120-1122)cGc>cTc	p.R374L	GPT2_ENST00000440783.2_Missense_Mutation_p.R274L	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	374					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)	p.R374H(1)		NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	CTGTCGGTGCGCCTGTGCCCC	0.607																																					p.R374L		.											.	GPT2-92	1	Substitution - Missense(1)	large_intestine(1)	c.G1121T						.						88.0	75.0	79.0					16																	46956237		2203	4300	6503	SO:0001583	missense	84706	exon9			CGGTGCGCCTGTG		CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.1121G>T	16.37:g.46956237G>T	ENSP00000345282:p.Arg374Leu	98	0		171	3	NM_133443	0	0	31	31	0	Q8N9E2	Missense_Mutation	SNP	ENST00000340124.4	37	CCDS10725.1	.	.	.	.	.	.	.	.	.	.	G	17.08	3.299046	0.60195	.	.	ENSG00000166123	ENST00000340124;ENST00000440783	D;D	0.89552	-2.53;-2.53	5.07	5.07	0.68467	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.90106	0.6909	M	0.87328	2.875	0.80722	D	1	B	0.27882	0.192	B	0.19946	0.027	D	0.88203	0.2885	10	0.30854	T	0.27	.	18.7928	0.91982	0.0:0.0:1.0:0.0	.	374	Q8TD30	ALAT2_HUMAN	L	374;274	ENSP00000345282:R374L;ENSP00000413804:R274L	ENSP00000345282:R374L	R	+	2	0	GPT2	45513738	1.000000	0.71417	0.313000	0.25210	0.559000	0.35586	9.697000	0.98697	2.525000	0.85131	0.462000	0.41574	CGC	.		0.607	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255741.2		
SALL1	6299	hgsc.bcm.edu	37	16	51175655	51175655	+	Missense_Mutation	SNP	C	C	T	rs113614842|rs199760974	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:51175655C>T	ENST00000251020.4	-	2	511	c.478G>A	c.(478-480)Ggc>Agc	p.G160S	SALL1_ENST00000440970.1_Missense_Mutation_p.G63S|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	160	Poly-Gly.				adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			ccgccgccgccgctgctgctg	0.632													c|||	53	0.0105831	0.0234	0.0014	5008	,	,		12568	0.0		0.0	False		,,,				2504	0.0215				p.G160S	GBM(103;1352 1446 1855 4775 8890)	.											.	SALL1-98	0			c.G478A						.						24.0	26.0	25.0					16																	51175655		2196	4299	6495	SO:0001583	missense	6299	exon2			CGCCGCCGCTGCT	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.478G>A	16.37:g.51175655C>T	ENSP00000251020:p.Gly160Ser	46	0		150	17	NM_002968	0	0	0	0	0	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	37	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.627404	0.00007	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06849	3.36;3.25	0.817	-1.63	0.08345	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.44003	-0.9356	9	0.02654	T	1	.	4.4659	0.11689	0.0:0.5444:0.0:0.4556	.	160	Q9NSC2	SALL1_HUMAN	S	160;63;124	ENSP00000251020:G160S;ENSP00000407914:G63S	ENSP00000251020:G160S	G	-	1	0	SALL1	49733156	1.000000	0.71417	0.002000	0.10522	0.010000	0.07245	1.889000	0.39718	-0.863000	0.04084	-1.054000	0.02325	GGC	.		0.632	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	0	0		7	7	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
CCDC102A	92922	hgsc.bcm.edu	37	16	57562804	57562804	+	Missense_Mutation	SNP	G	G	A	rs12935069		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:57562804G>A	ENST00000258214.2	-	2	532	c.286C>T	c.(286-288)Cgg>Tgg	p.R96W		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	96				R -> W (in Ref. 2; AAH08285/AAH09941). {ECO:0000305}.						endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						TCCGACCACCGGCGCATGGTC	0.731													A|||	5008	1.0	1.0	1.0	5008	,	,		3757	1.0		1.0	False		,,,				2504	1.0				p.R96W		.											.	CCDC102A-91	0			c.C286T						.						8.0	10.0	9.0					16																	57562804		1834	3717	5551	SO:0001583	missense	92922	exon2			ACCACCGGCGCAT	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.286C>T	16.37:g.57562804G>A	ENSP00000258214:p.Arg96Trp	0	0		11	11	NM_033212	0	0	0	0	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	2180	0.9981684981684982	492	1.0	360	0.994475138121547	570	0.9965034965034965	758	1.0	A	10.17	1.277909	0.23307	.	.	ENSG00000135736	ENST00000258214	T	0.37752	1.18	4.82	4.82	0.62117	.	0.000000	0.64402	N	0.000001	T	0.00012	0.0000	N	0.00049	-2.415	0.40217	P	0.022302999999999962	B	0.02656	0.0	B	0.01281	0.0	T	0.44787	-0.9305	9	0.33141	T	0.24	-23.2491	9.5348	0.39216	0.9152:0.0:0.0848:0.0	rs12935069;rs12935069	96	Q96A19	C102A_HUMAN	W	96	ENSP00000258214:R96W	ENSP00000258214:R96W	R	-	1	2	CCDC102A	56120305	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.801000	0.75170	0.698000	0.31739	-0.556000	0.04195	CGG	G|0.001;A|0.999		0.731	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
CDH8	1006	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	61851433	61851433	+	Silent	SNP	C	C	G			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:61851433C>G	ENST00000577390.1	-	7	2181	c.1227G>C	c.(1225-1227)gtG>gtC	p.V409V	CDH8_ENST00000577730.1_Silent_p.V409V|CDH8_ENST00000584337.1_Silent_p.V409V|CDH8_ENST00000299345.6_Silent_p.V409V	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	409	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CTTGCCCAATCACGGAGTTTA	0.433																																					p.V409V		.											.	CDH8-161	0			c.G1227C						.						90.0	82.0	85.0					16																	61851433		2203	4300	6503	SO:0001819	synonymous_variant	1006	exon7			CCCAATCACGGAG	L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.1227G>C	16.37:g.61851433C>G		153	0		242	91	NM_001796	0	0	2	2	0	B3KWC1|Q14DC6|Q9ULB2	Silent	SNP	ENST00000577390.1	37	CCDS10802.1																																																																																			.		0.433	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268754.3	NM_001796	
FUK	197258	hgsc.bcm.edu	37	16	70507214	70507214	+	Missense_Mutation	SNP	C	C	T	rs201801842	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:70507214C>T	ENST00000288078.6	+	15	1967	c.1735C>T	c.(1735-1737)Cgc>Tgc	p.R579C	FUK_ENST00000571514.1_Missense_Mutation_p.R72C|FUK_ENST00000378912.2_Missense_Mutation_p.R611C	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	579						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				GGCTGCTGTCCGCGAGGGCTG	0.711													C|||	4	0.000798722	0.0	0.0014	5008	,	,		16431	0.0		0.002	False		,,,				2504	0.001				p.R579C		.											.	FUK-91	0			c.C1735T						.	C	CYS/ARG	0,2864		0,0,1432	2.0	2.0	2.0		1735	-0.6	0.0	16		2	8,5832		0,8,2912	no	missense	FUK	NM_145059.2	180	0,8,4344	TT,TC,CC		0.137,0.0,0.0919	possibly-damaging	579/1085	70507214	8,8696	1432	2920	4352	SO:0001583	missense	197258	exon15			GCTGTCCGCGAGG		CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.1735C>T	16.37:g.70507214C>T	ENSP00000288078:p.Arg579Cys	1	0		75	44	NM_145059	0	0	4	5	1	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	ENST00000288078.6	37	CCDS10891.2	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	8.725	0.915260	0.17907	0.0	0.00137	ENSG00000157353	ENST00000288078;ENST00000378912	T;T	0.07567	3.18;3.18	5.17	-0.644	0.11479	.	1.041060	0.07479	N	0.903495	T	0.05318	0.0141	N	0.08118	0	0.18873	N	0.999986	D;P;P	0.56521	0.976;0.876;0.876	P;B;B	0.46758	0.526;0.232;0.232	T	0.31971	-0.9924	10	0.56958	D	0.05	0.9352	4.1327	0.10156	0.1161:0.5131:0.2369:0.1339	.	611;485;579	Q8N0W3-2;B2RDL5;Q8N0W3	.;.;FUK_HUMAN	C	579;611	ENSP00000288078:R579C;ENSP00000368192:R611C	ENSP00000288078:R579C	R	+	1	0	FUK	69064715	0.076000	0.21285	0.001000	0.08648	0.383000	0.30230	0.491000	0.22419	0.021000	0.15133	0.655000	0.94253	CGC	C|0.999;T|0.000		0.711	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157291.2	NM_145059	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	RP11-486L19.2_ENST00000561900.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000567413.1_3'UTR	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	0	0		21	11	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	0	0		25	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		23	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	0	0		17	13	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	0	0		14	13	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
C17orf97	400566	hgsc.bcm.edu	37	17	260182	260182	+	Silent	SNP	T	T	C	rs7502594	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr17:260182T>C	ENST00000571106.1	+	1	55	c.49T>C	c.(49-51)Tta>Cta	p.L17L	AC108004.3_ENST00000599026.1_RNA|AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000360127.6_Silent_p.L17L			Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	17										breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GAGTCGCCGATTAGTCGGCAT	0.751													c|||	1929	0.385184	0.6286	0.2666	5008	,	,		13427	0.3125		0.2396	False		,,,				2504	0.365				p.L17L		.											.	C17orf97-91	0			c.T49C						.			1512,2124		272,968,578	3.0	4.0	4.0		49	2.9	0.0	17	dbSNP_116	4	1503,5991		176,1151,2420	no	coding-synonymous	C17orf97	NM_001013672.4		448,2119,2998	CC,CT,TT		20.056,41.5842,27.0889		17/424	260182	3015,8115	1818	3747	5565	SO:0001819	synonymous_variant	400566	exon1			CGCCGATTAGTCG	AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000571106.1:c.49T>C	17.37:g.260182T>C		0	0		22	22	NM_001013672	0	0	0	0	0	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	ENST00000571106.1	37																																																																																				T|0.657;C|0.343		0.751	C17orf97-003	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000436874.1	NM_001013672	
ZZEF1	23140	hgsc.bcm.edu	37	17	4046054	4046054	+	Missense_Mutation	SNP	G	G	A	rs199896183	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr17:4046054G>A	ENST00000381638.2	-	1	260	c.136C>T	c.(136-138)Ccc>Tcc	p.P46S	CYB5D2_ENST00000573984.1_5'Flank|ZZEF1_ENST00000574474.1_5'UTR|CYB5D2_ENST00000575251.1_5'Flank|CYB5D2_ENST00000301391.3_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	46							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GCCGCGGCGGGTGGTAGCGCT	0.776													G|||	4	0.000798722	0.0	0.0029	5008	,	,		11446	0.0		0.002	False		,,,				2504	0.0				p.P46S		.											.	ZZEF1-93	0			c.C136T						.	G	SER/PRO	1,2843		0,1,1421	2.0	2.0	2.0		136	2.9	0.0	17		2	10,5896		0,10,2943	no	missense	ZZEF1	NM_015113.3	74	0,11,4364	AA,AG,GG		0.1693,0.0352,0.1257	benign	46/2962	4046054	11,8739	1422	2953	4375	SO:0001583	missense	23140	exon1			CGGCGGGTGGTAG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.136C>T	17.37:g.4046054G>A	ENSP00000371051:p.Pro46Ser	0	0		16	16	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	G	0.652	-0.809240	0.02798	3.52E-4	0.001693	ENSG00000074755	ENST00000381638	T	0.18960	2.18	5.01	2.92	0.33932	.	0.482752	0.22900	N	0.054271	T	0.08403	0.0209	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38693	-0.9649	10	0.09843	T	0.71	-0.4449	7.0937	0.25297	0.2976:0.0:0.7024:0.0	.	46;46	O43149-3;O43149	.;ZZEF1_HUMAN	S	46	ENSP00000371051:P46S	ENSP00000371051:P46S	P	-	1	0	ZZEF1	3992803	0.924000	0.31332	0.021000	0.16686	0.291000	0.27294	2.058000	0.41374	0.524000	0.28502	0.561000	0.74099	CCC	.		0.776	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
GLTPD2	388323	hgsc.bcm.edu	37	17	4693342	4693342	+	Missense_Mutation	SNP	C	C	A	rs35910358	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr17:4693342C>A	ENST00000331264.7	+	4	680	c.627C>A	c.(625-627)gaC>gaA	p.D209E		NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	209				D -> E (in Ref. 2; AAI50537). {ECO:0000305}.		cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						GAGGCCCGGACGCGGGCGTGC	0.761													C|||	4904	0.979233	0.9228	1.0	5008	,	,		11019	1.0		0.998	False		,,,				2504	1.0				p.D209E		.											.	GLTPD2-68	0			c.C627A						.	C	GLU/ASP	2706,78		1314,78,0	2.0	2.0	2.0		627	0.2	0.1	17	dbSNP_126	2	6028,0		3014,0,0	no	missense	GLTPD2	NM_001014985.2	45	4328,78,0	AA,AC,CC		0.0,2.8017,0.8852	benign	209/292	4693342	8734,78	1392	3014	4406	SO:0001583	missense	388323	exon4			CCCGGACGCGGGC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.627C>A	17.37:g.4693342C>A	ENSP00000328070:p.Asp209Glu	0	0		10	10	NM_001014985	0	0	0	0	0	A7E2T2	Missense_Mutation	SNP	ENST00000331264.7	37	CCDS32534.1	2151	0.9848901098901099	466	0.9471544715447154	362	1.0	572	1.0	751	0.9907651715039578	C	9.155	1.017148	0.19355	0.971983	1.0	ENSG00000182327	ENST00000331264	.	.	.	4.58	0.162	0.14981	Glycolipid transfer protein domain (3);	.	.	.	.	T	0.00012	0.0000	L	0.41027	1.25	0.80722	P	0.0	B	0.22080	0.064	B	0.31614	0.133	T	0.34650	-0.9820	7	0.12103	T	0.63	-20.1635	5.889	0.18897	0.0:0.5269:0.298:0.1751	rs35910358	209	A6NH11	GLTD2_HUMAN	E	209	.	ENSP00000328070:D209E	D	+	3	2	GLTPD2	4640082	0.004000	0.15560	0.082000	0.20525	0.081000	0.17604	0.011000	0.13264	-0.068000	0.12953	0.555000	0.69702	GAC	C|0.015;A|0.985		0.761	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439781.1	NM_001014985	
DNAH9	1770	broad.mit.edu	37	17	11778273	11778273	+	Missense_Mutation	SNP	T	T	G	rs141082617	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr17:11778273T>G	ENST00000262442.4	+	53	10318	c.10250T>G	c.(10249-10251)aTt>aGt	p.I3417S	DNAH9_ENST00000454412.2_Missense_Mutation_p.I3417S|RP11-628O18.1_ENST00000579621.1_RNA	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3417					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGACTCCCATTCCAGTCACC	0.567													T|||	16	0.00319489	0.0113	0.0	5008	,	,		16219	0.0		0.001	False		,,,				2504	0.0				p.I3417S		.											.	DNAH9-168	0			c.T10250G						.	T	SER/ILE	54,4352	53.6+/-89.4	0,54,2149	97.0	85.0	89.0		10250	4.5	0.6	17	dbSNP_134	89	2,8598	2.2+/-6.3	0,2,4298	yes	missense	DNAH9	NM_001372.3	142	0,56,6447	GG,GT,TT		0.0233,1.2256,0.4306	possibly-damaging	3417/4487	11778273	56,12950	2203	4300	6503	SO:0001583	missense	1770	exon53			CTCCCATTCCAGT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10250T>G	17.37:g.11778273T>G	ENSP00000262442:p.Ile3417Ser	144	1		99	3	NM_001372	0	0	0	0	0	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	2	9.157509157509158E-4	2	0.0040650406504065045	0	0.0	0	0.0	0	0.0	T	20.5	4.002641	0.74932	0.012256	2.33E-4	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.36157	1.32;1.27	4.51	4.51	0.55191	.	0.275088	0.33916	N	0.004435	T	0.68787	0.3039	H	0.99770	4.765	0.80722	D	1	D	0.62365	0.991	D	0.63192	0.912	D	0.85275	0.1058	10	0.87932	D	0	.	13.989	0.64353	0.0:0.0:0.0:1.0	.	3417	Q9NYC9	DYH9_HUMAN	S	3417;3417;1999	ENSP00000262442:I3417S;ENSP00000414874:I3417S	ENSP00000262442:I3417S	I	+	2	0	DNAH9	11718998	1.000000	0.71417	0.599000	0.28851	0.015000	0.08874	7.825000	0.86693	1.909000	0.55274	0.533000	0.62120	ATT	T|0.996;G|0.004		0.567	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
C17orf96	100170841	hgsc.bcm.edu	37	17	36830459	36830459	+	Missense_Mutation	SNP	G	G	A	rs111565436	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr17:36830459G>A	ENST00000325814.5	-	1	728	c.290C>T	c.(289-291)cCc>cTc	p.P97L		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	97	Pro-rich.				neuron fate commitment (GO:0048663)												AGGAACGCCGGGCCGCCCGGT	0.776													G|||	1323	0.264177	0.5272	0.1671	5008	,	,		10122	0.0942		0.1789	False		,,,				2504	0.2403				p.P97L		.											.	.	0			c.C290T						.						2.0	3.0	3.0					17																	36830459		485	1247	1732	SO:0001583	missense	100170841	exon1			ACGCCGGGCCGCC		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.290C>T	17.37:g.36830459G>A	ENSP00000317905:p.Pro97Leu	0	0		4	4	NM_001130677	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	546	0.25	273	0.5548780487804879	71	0.19613259668508287	65	0.11363636363636363	137	0.18073878627968337	G	12.55	1.970645	0.34754	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.57	1.42	0.22433	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.24426	0.103	B	0.25405	0.06	T	0.43782	-0.9370	7	0.87932	D	0	.	6.42	0.21738	0.0:0.2024:0.589:0.2087	.	97	A6NHQ4	CQ096_HUMAN	L	97	.	ENSP00000317905:P97L	P	-	2	0	C17orf96	34083985	0.001000	0.12720	0.308000	0.25141	0.049000	0.14656	0.571000	0.23669	0.121000	0.18284	0.313000	0.20887	CCC	G|0.750;A|0.250		0.776	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
C17orf53	78995	bcgsc.ca	37	17	42225547	42225547	+	Missense_Mutation	SNP	A	A	C	rs227584	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr17:42225547A>C	ENST00000319977.4	+	3	613	c.376A>C	c.(376-378)Aca>Cca	p.T126P	C17orf53_ENST00000245382.6_Missense_Mutation_p.T126P|C17orf53_ENST00000585683.1_Missense_Mutation_p.T126P	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	126			T -> P (in dbSNP:rs227584). {ECO:0000269|PubMed:15489334}.							NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		GCTCAGAGAGACAGCAAGACC	0.522													C|||	2887	0.576478	0.9047	0.4582	5008	,	,		20956	0.7589		0.2992	False		,,,				2504	0.3139				p.T126P		.											.	C17orf53-90	0			c.A376C						.	C	PRO/THR,PRO/THR	3497,909	350.8+/-311.0	1401,695,107	130.0	136.0	134.0	http://www.ncbi.nlm.nih.gov/pubmed?term	376,376	1.5	0.7	17	dbSNP_79	134	2666,5934	685.3+/-404.0	417,1832,2051	yes	missense,missense	C17orf53	NM_001171251.1,NM_024032.3	38,38	1818,2527,2158	CC,CA,AA	http://www.ncbi.nlm.nih.gov/pubmed?term	31.0,20.631,47.3858	benign,benign	126/647,126/648	42225547	6163,6843	2203	4300	6503	SO:0001583	missense	78995	exon3			AGAGAGACAGCAA	AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.376A>C	17.37:g.42225547A>C	ENSP00000313500:p.Thr126Pro	284	3		235	6	NM_001171251	0	0	0	0	0	A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	ENST00000319977.4	37	CCDS11477.1	1253	0.5737179487179487	445	0.9044715447154471	149	0.4116022099447514	424	0.7412587412587412	235	0.3100263852242744	C	0.355	-0.942870	0.02322	0.79369	0.31	ENSG00000125319	ENST00000319977;ENST00000245382	T;T	0.42513	0.97;0.97	4.61	1.5	0.22942	.	0.782162	0.11770	N	0.531181	T	0.00012	0.0000	N	0.00308	-1.67	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33343	-0.9872	9	0.02654	T	1	-1.4987	3.1789	0.06578	0.319:0.4178:0.0:0.2632	rs227584;rs3744431;rs17844825;rs17857536;rs57825870;rs227584	126;126;126	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	P	126	ENSP00000313500:T126P;ENSP00000245382:T126P	ENSP00000245382:T126P	T	+	1	0	C17orf53	39581073	0.082000	0.21442	0.737000	0.30932	0.059000	0.15707	0.105000	0.15333	0.023000	0.15187	-0.217000	0.12591	ACA	T|0.094;G|0.124		0.522	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457697.1	NM_024032	
AATK	9625	hgsc.bcm.edu	37	17	79096100	79096100	+	Missense_Mutation	SNP	C	C	G	rs62073020	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr17:79096100C>G	ENST00000326724.4	-	11	1660	c.1636G>C	c.(1636-1638)Gac>Cac	p.D546H	MIR657_ENST00000385003.1_RNA|AATK_ENST00000417379.1_Missense_Mutation_p.D443H|AATK_ENST00000572339.1_5'Flank	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	546					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CCGGCGCAGTCAGGGTCGTGG	0.746													C|||	10	0.00199681	0.0	0.0014	5008	,	,		8349	0.0		0.004	False		,,,				2504	0.0051				p.D546H		.											.	AATK-933	0			c.G1636C						.	C	HIS/ASP,HIS/ASP	3,2899		0,3,1448	2.0	3.0	2.0		1636,1327	4.0	0.5	17	dbSNP_129	2	5,5973		0,5,2984	no	missense,missense	AATK	NM_001080395.2,NM_004920.2	81,81	0,8,4432	GG,GC,CC		0.0836,0.1034,0.0901	probably-damaging,probably-damaging	546/1375,443/1272	79096100	8,8872	1451	2989	4440	SO:0001583	missense	9625	exon11			CGCAGTCAGGGTC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.1636G>C	17.37:g.79096100C>G	ENSP00000324196:p.Asp546His	0	0		9	7	NM_001080395	0	0	0	1	1	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.104323	0.56291	0.001034	8.36E-4	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.79653	-1.27;-1.29	3.96	3.96	0.45880	.	0.218250	0.36893	N	0.002349	D	0.85881	0.5800	L	0.52573	1.65	0.40902	D	0.984165	D	0.89917	1.0	D	0.72625	0.978	D	0.87951	0.2723	10	0.87932	D	0	.	13.7929	0.63152	0.0:1.0:0.0:0.0	rs62073020	546	Q6ZMQ8	LMTK1_HUMAN	H	546;510	ENSP00000324196:D546H;ENSP00000363924:D510H	ENSP00000324196:D546H	D	-	1	0	AATK	76710695	1.000000	0.71417	0.461000	0.27105	0.273000	0.26683	4.564000	0.60830	1.742000	0.51746	0.561000	0.74099	GAC	.		0.746	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
ACTG1	71	bcgsc.ca	37	17	79478007	79478007	+	Silent	SNP	G	G	A	rs1135989	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr17:79478007G>A	ENST00000575842.1	-	4	1356	c.930C>T	c.(928-930)gcC>gcT	p.A310A	AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Silent_p.A310A|ACTG1_ENST00000331925.2_Silent_p.A310A|ACTG1_ENST00000573283.1_Silent_p.A310A			P63261	ACTG_HUMAN	actin, gamma 1	310					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GCATCCTGTCGGCAATGCCCG	0.612													g|||	928	0.185304	0.1505	0.2522	5008	,	,		20969	0.005		0.3966	False		,,,				2504	0.1534				p.A310A		.											.	ACTG1-91	0			c.C930T						.	G	,	852,3554	331.0+/-301.8	89,674,1440	67.0	64.0	65.0		930,930	-6.6	0.6	17	dbSNP_86	65	3263,5337	483.9+/-371.3	603,2057,1640	no	coding-synonymous,coding-synonymous	ACTG1	NM_001199954.1,NM_001614.3	,	692,2731,3080	AA,AG,GG		37.9419,19.3373,31.6392	,	310/376,310/376	79478007	4115,8891	2203	4300	6503	SO:0001819	synonymous_variant	71	exon5			CCTGTCGGCAATG		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.930C>T	17.37:g.79478007G>A		213	2		207	7	NM_001614	0	0	16	16	0	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Silent	SNP	ENST00000575842.1	37	CCDS11782.1																																																																																			G|0.711;A|0.289		0.612	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	
MOCOS	55034	hgsc.bcm.edu	37	18	33767568	33767568	+	Missense_Mutation	SNP	C	C	A	rs113873219	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr18:33767568C>A	ENST00000261326.5	+	1	87	c.66C>A	c.(64-66)agC>agA	p.S22R	RP11-49I11.1_ENST00000568654.1_RNA	NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GGGACCCGAGCGCACCGCGGC	0.786													C|||	232	0.0463259	0.0204	0.0778	5008	,	,		10186	0.0069		0.1103	False		,,,				2504	0.0337				p.S22R		.											.	MOCOS-91	0			c.C66A						.	C	ARG/SER	76,3392		0,76,1658	3.0	4.0	4.0		66	2.0	0.0	18	dbSNP_132	4	538,6436		17,504,2966	no	missense	MOCOS	NM_017947.2	110	17,580,4624	AA,AC,CC		7.7144,2.1915,5.8801	possibly-damaging	22/889	33767568	614,9828	1734	3487	5221	SO:0001583	missense	55034	exon1			CCCGAGCGCACCG	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.66C>A	18.37:g.33767568C>A	ENSP00000261326:p.Ser22Arg	0	0		14	14	NM_017947	0	0	0	23	23		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	123	0.05631868131868132	13	0.026422764227642278	30	0.08287292817679558	4	0.006993006993006993	76	0.10026385224274406	C	18.52	3.641158	0.67244	0.021915	0.077144	ENSG00000075643	ENST00000261326	T	0.14766	2.48	3.83	2.05	0.26809	.	0.527792	0.19351	N	0.116394	T	0.00241	0.0007	N	0.08118	0	0.80722	P	0.0	D	0.54397	0.966	P	0.50860	0.652	T	0.27839	-1.0062	9	0.20046	T	0.44	-8.4772	6.078	0.19925	0.0:0.7664:0.0:0.2336	.	22	Q96EN8	MOCOS_HUMAN	R	22	ENSP00000261326:S22R	ENSP00000261326:S22R	S	+	3	2	MOCOS	32021566	0.000000	0.05858	0.005000	0.12908	0.167000	0.22549	-0.697000	0.05098	0.586000	0.29626	0.491000	0.48974	AGC	C|0.943;A|0.057		0.786	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
KCNG2	26251	hgsc.bcm.edu	37	18	77624240	77624240	+	Silent	SNP	C	C	T	rs140218057	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr18:77624240C>T	ENST00000316249.3	+	1	573	c.573C>T	c.(571-573)gcC>gcT	p.A191A		NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	191					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CCGTCACGGCCGTGGGCCTCT	0.771																																					p.A191A		.											.	KCNG2-90	0			c.C573T						.	C		0,3992		0,0,1996	17.0	16.0	17.0		573	0.2	0.8	18	dbSNP_134	17	2,7986		0,2,3992	no	coding-synonymous	KCNG2	NM_012283.1		0,2,5988	TT,TC,CC		0.025,0.0,0.0167		191/467	77624240	2,11978	1996	3994	5990	SO:0001819	synonymous_variant	26251	exon1			CACGGCCGTGGGC	AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.573C>T	18.37:g.77624240C>T		0	0		72	60	NM_012283	0	0	0	0	0		Silent	SNP	ENST00000316249.3	37	CCDS12019.1																																																																																			C|0.999;T|0.001		0.771	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103906.1	NM_012283	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		0	0		18	18	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	ABCA7_ENST00000435683.2_Silent_p.G1915G|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000586866.1_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000313093.2_5'Flank|HMHA1_ENST00000590214.1_5'Flank	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		0	0		45	45	NM_019112	0	0	0	10	10	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
KANK3	256949	hgsc.bcm.edu	37	19	8399628	8399628	+	Silent	SNP	A	A	G	rs710949	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:8399628A>G	ENST00000593649.1	-	3	1148	c.1083T>C	c.(1081-1083)agT>agC	p.S361S	KANK3_ENST00000330915.3_Silent_p.S361S			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	361										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GGTGCTCCAGACTGGCGCGCA	0.766													G|||	3017	0.602436	0.7443	0.6153	5008	,	,		10732	0.4147		0.5984	False		,,,				2504	0.5992				p.S361S		.											.	KANK3-90	0			c.T1083C						.	G		1917,541		783,351,95	1.0	1.0	1.0		1083	3.4	1.0	19	dbSNP_86	1	3649,1585		1364,921,332	no	coding-synonymous	KANK3	NM_198471.2		2147,1272,427	GG,GA,AA		30.2828,22.0098,27.6391		361/822	8399628	5566,2126	1229	2617	3846	SO:0001819	synonymous_variant	256949	exon3			CTCCAGACTGGCG	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1083T>C	19.37:g.8399628A>G		0	0		16	9	NM_198471	0	0	1	1	0	Q6NZI1|Q6ZQR3|Q8IUV2	Silent	SNP	ENST00000593649.1	37																																																																																				A|0.411;G|0.589		0.766	KANK3-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000461379.1	NM_198471	
HNRNPM	4670	hgsc.bcm.edu	37	19	8551112	8551112	+	Silent	SNP	G	G	T	rs12977861	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:8551112G>T	ENST00000325495.4	+	14	1841	c.1800G>T	c.(1798-1800)ctG>ctT	p.L600L	HNRNPM_ENST00000348943.3_Silent_p.L561L	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	600	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GCCCGGCCCTGGGCGCTGGCA	0.697													G|||	195	0.0389377	0.0038	0.0317	5008	,	,		16020	0.0337		0.0616	False		,,,				2504	0.0736				p.L600L		.											.	HNRNPM-68	0			c.G1800T						.	G	,	58,4338		1,56,2141	27.0	31.0	30.0		1800,1683	0.3	1.0	19	dbSNP_121	30	520,8074		23,474,3800	no	coding-synonymous,coding-synonymous	HNRNPM	NM_005968.4,NM_031203.3	,	24,530,5941	TT,TG,GG		6.0507,1.3194,4.4496	,	600/731,561/692	8551112	578,12412	2198	4297	6495	SO:0001819	synonymous_variant	4670	exon14			GGCCCTGGGCGCT	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1800G>T	19.37:g.8551112G>T		0	0		94	61	NM_005968	0	0	41	79	38	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Silent	SNP	ENST00000325495.4	37	CCDS12203.1																																																																																			G|0.960;T|0.040		0.697	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
ZNF414	84330	hgsc.bcm.edu	37	19	8576670	8576670	+	Silent	SNP	C	C	T	rs7175	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:8576670C>T	ENST00000255616.8	-	5	806	c.705G>A	c.(703-705)ccG>ccA	p.P235P	ZNF414_ENST00000393927.4_Silent_p.P235P	NM_032370.2	NP_115746.2	Q96IQ9	ZN414_HUMAN	zinc finger protein 414	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(2)	2						GCAGCGGGAACGGCAGGCCCG	0.771													C|||	1010	0.201677	0.2897	0.1686	5008	,	,		8403	0.1746		0.1988	False		,,,				2504	0.137				p.P235P		.											.	ZNF414-90	0			c.G705A						.	C	,	887,3039		132,623,1208	4.0	6.0	5.0		705,705	-2.0	0.0	19	dbSNP_52	5	1238,6388		127,984,2702	no	coding-synonymous,coding-synonymous	ZNF414	NM_001146175.1,NM_032370.2	,	259,1607,3910	TT,TC,CC		16.2339,22.593,18.3951	,	235/391,235/313	8576670	2125,9427	1963	3813	5776	SO:0001819	synonymous_variant	84330	exon5			CGGGAACGGCAGG	AK074191	CCDS12205.1, CCDS54211.1	19p13.2	2008-02-05				ENSG00000133250		"""Zinc fingers, C2H2-type"""	20630	protein-coding gene	gene with protein product							Standard	NM_032370		Approved	MGC15716, Zfp414	uc002mke.4	Q96IQ9		ENST00000255616.8:c.705G>A	19.37:g.8576670C>T		0	0		16	7	NM_032370	0	0	2	5	3	A8MY94	Silent	SNP	ENST00000255616.8	37	CCDS12205.1																																																																																			C|0.788;T|0.212		0.771	ZNF414-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460199.2	NM_032370	
CCDC105	126402	hgsc.bcm.edu	37	19	15133926	15133926	+	Missense_Mutation	SNP	C	C	A	rs8112667	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:15133926C>A	ENST00000292574.3	+	7	1577	c.1495C>A	c.(1495-1497)Ccc>Acc	p.P499T		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	499			P -> T (in dbSNP:rs8112667).			extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						CAGCGCGGACCCCTAGTGACC	0.716													c|||	1705	0.340455	0.1929	0.438	5008	,	,		11943	0.5208		0.2326	False		,,,				2504	0.3957				p.P499T		.											.	CCDC105-91	0			c.C1495A						.		THR/PRO	868,3356		95,678,1339	7.0	9.0	8.0		1495	-6.6	0.0	19	dbSNP_116	8	1799,6519		206,1387,2566	yes	missense	CCDC105	NM_173482.2	38	301,2065,3905	AA,AC,CC		21.6278,20.5492,21.2646	benign	499/500	15133926	2667,9875	2112	4159	6271	SO:0001583	missense	126402	exon7			GCGGACCCCTAGT	AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1495C>A	19.37:g.15133926C>A	ENSP00000292574:p.Pro499Thr	0	0		52	31	NM_173482	0	0	0	0	0	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	ENST00000292574.3	37	CCDS12322.1	718	0.32875457875457875	102	0.2073170731707317	139	0.3839779005524862	297	0.5192307692307693	180	0.23746701846965698	c	12.70	2.017064	0.35606	0.205492	0.216278	ENSG00000160994	ENST00000292574	T	0.15139	2.45	3.29	-6.58	0.01836	.	1.321340	0.05609	N	0.577760	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44528	-0.9322	9	0.87932	D	0	.	0.9387	0.01351	0.3527:0.1586:0.3022:0.1865	rs8112667;rs59368867;rs8112667	499	Q8IYK2	CC105_HUMAN	T	499	ENSP00000292574:P499T	ENSP00000292574:P499T	P	+	1	0	CCDC105	14994926	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.281000	0.00528	-1.857000	0.01159	-1.528000	0.00924	CCC	C|0.671;A|0.329		0.716	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466293.1	NM_173482	
PGLS	25796	hgsc.bcm.edu	37	19	17622614	17622614	+	Silent	SNP	C	C	T	rs11086075	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:17622614C>T	ENST00000252603.2	+	1	177	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	CTD-3131K8.2_ENST00000596643.1_lincRNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	45					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CGCGCTCGGCCTGTCGGGCGG	0.736													C|||	1862	0.371805	0.2496	0.4207	5008	,	,		10575	0.377		0.4851	False		,,,				2504	0.3804				p.L45L		.											.	PGLS-90	0			c.C133T						.	C		662,2504		107,448,1028	2.0	2.0	2.0		133	2.6	1.0	19	dbSNP_120	2	2200,4094		507,1186,1454	no	coding-synonymous	PGLS	NM_012088.2		614,1634,2482	TT,TC,CC		34.9539,20.9097,30.2537		45/259	17622614	2862,6598	1583	3147	4730	SO:0001819	synonymous_variant	25796	exon1			CTCGGCCTGTCGG	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.133C>T	19.37:g.17622614C>T		0	0		28	9	NM_012088	0	0	7	20	13		Silent	SNP	ENST00000252603.2	37	CCDS12361.1																																																																																			C|0.617;T|0.383		0.736	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
MAP1S	55201	hgsc.bcm.edu	37	19	17837425	17837425	+	Missense_Mutation	SNP	C	C	G	rs17710707	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:17837425C>G	ENST00000324096.4	+	5	1383	c.1232C>G	c.(1231-1233)tCt>tGt	p.S411C	CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Missense_Mutation_p.S385C|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	411	Necessary for the microtubule-organizing center localization.		S -> C (in dbSNP:rs17710707). {ECO:0000269|PubMed:15489334}.		apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						ACGCTGGCCTCTGTGTGCGCC	0.731													C|||	574	0.114617	0.0832	0.1772	5008	,	,		12607	0.0169		0.2068	False		,,,				2504	0.1186				p.S411C		.											.	MAP1S-90	0			c.C1232G						.	C	CYS/SER	344,3714		17,310,1702	5.0	5.0	5.0		1232	2.6	0.2	19	dbSNP_123	5	1234,6710		91,1052,2829	no	missense	MAP1S	NM_018174.4	112	108,1362,4531	GG,GC,CC		15.5337,8.4771,13.1478	probably-damaging	411/1060	17837425	1578,10424	2029	3972	6001	SO:0001583	missense	55201	exon5			TGGCCTCTGTGTG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1232C>G	19.37:g.17837425C>G	ENSP00000325313:p.Ser411Cys	1	0		41	19	NM_018174	0	0	2	4	2	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	257	0.11767399267399267	34	0.06910569105691057	66	0.18232044198895028	7	0.012237762237762238	150	0.19788918205804748	C	15.12	2.738952	0.49045	0.084771	0.155337	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.03801	3.8;3.8	3.67	2.61	0.31194	.	0.155772	0.30277	N	0.009981	T	0.00012	0.0000	M	0.79614	2.46	0.09310	P	0.99999454915	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.06006	-1.0851	9	0.87932	D	0	-16.5051	8.9574	0.35827	0.0:0.8847:0.0:0.1153	rs17710707	385;411	B4DH53;Q66K74	.;MAP1S_HUMAN	C	411;385	ENSP00000325313:S411C;ENSP00000439243:S385C	ENSP00000325313:S411C	S	+	2	0	MAP1S	17698425	0.998000	0.40836	0.209000	0.23619	0.382000	0.30200	7.628000	0.83189	0.516000	0.28340	-0.291000	0.09656	TCT	C|0.883;G|0.117		0.731	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
GDF1	2657	hgsc.bcm.edu	37	19	18980172	18980172	+	Missense_Mutation	SNP	G	G	A	rs4808863	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:18980172G>A	ENST00000247005.6	-	8	1698	c.353C>T	c.(352-354)gCc>gTc	p.A118V	CERS1_ENST00000427170.2_3'UTR			P27539	GDF1_HUMAN	growth differentiation factor 1	118			A -> V (in dbSNP:rs4808863). {ECO:0000269|PubMed:2034669}.		growth (GO:0040007)	extracellular space (GO:0005615)											CGCGGCCGAGGCAGGCTCCGA	0.716													g|||	1171	0.233826	0.0401	0.4986	5008	,	,		5099	0.1687		0.3946	False		,,,				2504	0.2096				p.A118V		.											.	GDF1-226	0			c.C353T						.						2.0	2.0	2.0					19																	18980172		1157	2328	3485	SO:0001583	missense	2657	exon8			GCCGAGGCAGGCT	M62302	CCDS42526.1	19p13.11	2014-01-30			ENSG00000130283	ENSG00000130283		"""Endogenous ligands"""	4214	protein-coding gene	gene with protein product		602880				2034669	Standard	NM_001492		Approved			P27539		ENST00000247005.6:c.353C>T	19.37:g.18980172G>A	ENSP00000247005:p.Ala118Val	0	0		9	6	NM_001492	0	0	0	0	0	O43344	Missense_Mutation	SNP	ENST00000247005.6	37	CCDS42526.1	621	0.28434065934065933	39	0.07926829268292683	184	0.5082872928176796	110	0.19230769230769232	288	0.37994722955145116	g	11.82	1.752739	0.31046	.	.	ENSG00000130283	ENST00000247005	T	0.78481	-1.18	3.33	0.926	0.19430	.	0.692776	0.14240	U	0.332130	T	0.00012	0.0000	L	0.44542	1.39	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.41805	-0.9488	7	0.16896	T	0.51	.	9.0728	0.36502	0.0:0.4429:0.5571:0.0	rs4808863	.	.	.	V	118	ENSP00000247005:A118V	ENSP00000247005:A118V	A	-	2	0	GDF1	18841172	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.201000	0.17276	-0.047000	0.13423	-0.546000	0.04227	GCC	G|0.715;A|0.285		0.716	GDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465926.1	NM_001492	
CILP2	148113	hgsc.bcm.edu	37	19	19651140	19651140	+	Silent	SNP	A	A	G	rs4808970	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:19651140A>G	ENST00000291495.5	+	3	376	c.291A>G	c.(289-291)gaA>gaG	p.E97E	CILP2_ENST00000586018.1_Silent_p.E103E	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	97						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TGGCGCTGGAAGCGCGCACCA	0.726													A|||	593	0.118411	0.1626	0.1167	5008	,	,		10102	0.0		0.168	False		,,,				2504	0.1309				p.E97E		.											.	CILP2-91	0			c.A291G						.	A		612,3678		42,528,1575	10.0	11.0	11.0		291	3.2	1.0	19	dbSNP_111	11	1223,7149		89,1045,3052	no	coding-synonymous	CILP2	NM_153221.2		131,1573,4627	GG,GA,AA		14.6082,14.2657,14.4922		97/1157	19651140	1835,10827	2145	4186	6331	SO:0001819	synonymous_variant	148113	exon3			GCTGGAAGCGCGC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.291A>G	19.37:g.19651140A>G		0	0		30	30	NM_153221	0	0	0	0	0	Q6NV88|Q8N4A6|Q8WV21	Silent	SNP	ENST00000291495.5	37	CCDS12405.1																																																																																			A|0.873;G|0.127		0.726	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459738.3	NM_153221	
LSM14A	26065	broad.mit.edu	37	19	34710315	34710315	+	Silent	SNP	T	T	G	rs201741862		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:34710315T>G	ENST00000433627.5	+	7	876	c.801T>G	c.(799-801)gcT>gcG	p.A267A	LSM14A_ENST00000544216.3_Silent_p.A267A|LSM14A_ENST00000540746.2_Silent_p.A226A	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	267					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.A267A(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					CTCCTTCAGCTCCAAGGAGAG	0.438																																					p.A267A		.											.	LSM14A-91	2	Substitution - coding silent(2)	endometrium(1)|kidney(1)	c.T801G						.						64.0	74.0	71.0					19																	34710315		2203	4300	6503	SO:0001819	synonymous_variant	26065	exon7			TTCAGCTCCAAGG	AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.801T>G	19.37:g.34710315T>G		65	1		90	4	NM_001114093	0	0	10	10	0	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Silent	SNP	ENST00000433627.5	37	CCDS46040.1																																																																																			T|0.999;G|0.001		0.438	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451576.3	NM_015578	
PROSER3	148137	hgsc.bcm.edu	37	19	36258934	36258934	+	Missense_Mutation	SNP	C	C	T	rs200267133		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:36258934C>T	ENST00000544099.1	+	9	1250	c.1187C>T	c.(1186-1188)gCc>gTc	p.A396V	C19orf55_ENST00000396908.4_Missense_Mutation_p.A396V|AC002398.13_ENST00000589397.1_RNA			Q2NL68	PRSR3_HUMAN		325										cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCCCTGCTTGCCCAGGGCCGC	0.736																																					p.A396V		.											.	C19orf55-23	0			c.C1187T						.						7.0	8.0	7.0					19																	36258934		1852	3993	5845	SO:0001583	missense	148137	exon9			TGCTTGCCCAGGG																												ENST00000544099.1:c.1187C>T	19.37:g.36258934C>T	ENSP00000467267:p.Ala396Val	1	0		56	26	NM_001039887	0	0	0	0	0	Q8NDI3|Q8WWC8|Q96NL4	Missense_Mutation	SNP	ENST00000544099.1	37		.	.	.	.	.	.	.	.	.	.	C	12.17	1.858374	0.32791	.	.	ENSG00000167595	ENST00000396908	T	0.33216	1.42	4.37	-3.21	0.05140	.	.	.	.	.	T	0.10680	0.0261	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.16289	0.015	T	0.30327	-0.9982	9	0.19147	T	0.46	2.0736	1.0723	0.01624	0.1443:0.3141:0.2818:0.2598	.	396	E5RFB9	.	V	396	ENSP00000380116:A396V	ENSP00000380116:A396V	A	+	2	0	C19orf55	40950774	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.145000	0.16157	-0.390000	0.07774	-1.138000	0.01928	GCC	.		0.736	C19orf55-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000398160.2		
PRODH2	58510	broad.mit.edu	37	19	36303169	36303169	+	Missense_Mutation	SNP	G	G	T	rs531508774		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:36303169G>T	ENST00000301175.3	-	4	622	c.605C>A	c.(604-606)gCg>gAg	p.A202E		NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	202					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCATACCACGCCTCACTGCC	0.672																																					p.A202E		.											.	PRODH2-92	0			c.C605A						.						70.0	69.0	70.0					19																	36303169		2203	4300	6503	SO:0001583	missense	58510	exon4			TACCACGCCTCAC	U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.605C>A	19.37:g.36303169G>T	ENSP00000301175:p.Ala202Glu	26	0		151	5	NM_021232	0	0	0	0	0		Missense_Mutation	SNP	ENST00000301175.3	37	CCDS12478.1	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464345	0.26335	.	.	ENSG00000250799	ENST00000301175	T	0.22134	1.97	5.34	1.67	0.24075	.	.	.	.	.	T	0.14787	0.0357	M	0.62723	1.935	0.80722	D	1	B	0.19073	0.033	B	0.08055	0.003	T	0.16100	-1.0414	9	0.02654	T	1	.	4.9024	0.13781	0.0845:0.1374:0.6159:0.1622	.	202	Q9UF12	PROD2_HUMAN	E	202	ENSP00000301175:A202E	ENSP00000301175:A202E	A	-	2	0	PRODH2	40995009	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	1.056000	0.30480	0.544000	0.28883	0.650000	0.86243	GCG	.		0.672	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452552.2	NM_021232	
GGN	199720	hgsc.bcm.edu	37	19	38876383	38876383	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:38876383G>A	ENST00000334928.6	-	3	1651	c.1519C>T	c.(1519-1521)Ccc>Tcc	p.P507S	AC005789.9_ENST00000585411.1_RNA|GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	507	Interactions with ZNF403/GGNBP2 and OAZ3. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ggcggcgagggctcagccacg	0.756																																					p.P507S		.											.	GGN-90	0			c.C1519T						.						6.0	8.0	7.0					19																	38876383		1990	3927	5917	SO:0001583	missense	199720	exon3			GCGAGGGCTCAGC	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1519C>T	19.37:g.38876383G>A	ENSP00000334940:p.Pro507Ser	0	0		29	11	NM_152657	0	0	0	0	0	Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	ENST00000334928.6	37	CCDS12516.1	.	.	.	.	.	.	.	.	.	.	G	4.009	-0.000929	0.07819	.	.	ENSG00000179168	ENST00000334928	.	.	.	3.28	2.2	0.27929	.	0.183439	0.26503	N	0.024007	T	0.19406	0.0466	N	0.24115	0.695	0.09310	N	1	P;P	0.40476	0.718;0.718	B;B	0.38616	0.277;0.277	T	0.15983	-1.0418	9	0.09338	T	0.73	-2.5766	8.551	0.33451	0.0:0.2372:0.7628:0.0	.	424;507	Q86UU5-2;Q86UU5	.;GGN_HUMAN	S	507	.	ENSP00000334940:P507S	P	-	1	0	GGN	43568223	0.956000	0.32656	0.006000	0.13384	0.063000	0.16089	2.201000	0.42734	0.667000	0.31107	0.455000	0.32223	CCC	.		0.756	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
RINL	126432	hgsc.bcm.edu	37	19	39360720	39360720	+	Missense_Mutation	SNP	G	G	A	rs8110393	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:39360720G>A	ENST00000591812.1	-	9	1291	c.1205C>T	c.(1204-1206)cCc>cTc	p.P402L	RINL_ENST00000340740.3_Missense_Mutation_p.P288L|RINL_ENST00000602238.1_5'Flank|CTC-360G5.6_ENST00000593830.1_RNA|RINL_ENST00000598904.1_Missense_Mutation_p.P288L			Q6ZS11	RINL_HUMAN	Ras and Rab interactor-like	402	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.		P -> L (in dbSNP:rs8110393).		endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|ruffle (GO:0001726)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|urinary_tract(2)	17						GGCGGGGGCGGGGCTCTGCCC	0.781													G|||	3477	0.694289	0.9289	0.6153	5008	,	,		10275	0.7619		0.4642	False		,,,				2504	0.6002				p.P402L		.											.	RINL-91	0			c.C1205T						.	G	LEU/PRO,LEU/PRO	3328,464		1489,350,57	4.0	4.0	4.0		1205,863	3.5	1.0	19	dbSNP_116	4	4059,3433		1245,1569,932	no	missense,missense	RINL	NM_001195833.1,NM_198445.3	98,98	2734,1919,989	AA,AG,GG		45.8222,12.2363,34.5356	probably-damaging,probably-damaging	402/567,288/453	39360720	7387,3897	1896	3746	5642	SO:0001583	missense	126432	exon9			GGGGCGGGGCTCT	AK127808	CCDS12522.1, CCDS59386.1	19q13.2	2010-07-13			ENSG00000187994	ENSG00000187994			24795	protein-coding gene	gene with protein product							Standard	NM_001195833		Approved	FLJ45909	uc010xuo.2	Q6ZS11		ENST00000591812.1:c.1205C>T	19.37:g.39360720G>A	ENSP00000467107:p.Pro402Leu	0	0		28	18	NM_001195833	0	0	0	0	0	B4DPG5	Missense_Mutation	SNP	ENST00000591812.1	37	CCDS59386.1	1421	0.6506410256410257	458	0.9308943089430894	225	0.6215469613259669	401	0.701048951048951	337	0.4445910290237467	G	17.17	3.320891	0.60634	0.877637	0.541778	ENSG00000187994	ENST00000340740;ENST00000536520	T	0.28454	1.61	4.57	3.53	0.40419	Vacuolar sorting protein 9 (1);	0.269737	0.35235	N	0.003350	T	0.00012	0.0000	M	0.67700	2.07	0.21553	P	0.999649277	B;B	0.21225	0.053;0.053	B;B	0.22152	0.038;0.038	T	0.17776	-1.0358	9	0.72032	D	0.01	-26.0247	8.5759	0.33598	0.1063:0.0:0.8937:0.0	rs8110393;rs61482706	402;288	B4DPG5;Q6ZS11	.;RINL_HUMAN	L	288	ENSP00000340369:P288L	ENSP00000340369:P288L	P	-	2	0	RINL	44052560	1.000000	0.71417	0.987000	0.45799	0.313000	0.28021	4.771000	0.62318	1.273000	0.44346	0.407000	0.27541	CCC	G|0.349;A|0.651		0.781	RINL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460433.1	NM_198445	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	SARS2_ENST00000448145.2_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P|CTC-360G5.8_ENST00000599996.1_5'Flank	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		0	0		32	31	NM_148169	0	0	0	0	0	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
DMRTC2	63946	broad.mit.edu	37	19	42354650	42354650	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:42354650G>T	ENST00000269945.3	+	8	924	c.873G>T	c.(871-873)caG>caT	p.Q291H	DMRTC2_ENST00000596827.1_Missense_Mutation_p.Q342H	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	291	Pro-rich.				male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q291H(1)		endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						GGCAGCTGCAGCAAGAGGCAG	0.632																																					p.Q291H		.											.	DMRTC2-90	1	Substitution - Missense(1)	prostate(1)	c.G873T						.						38.0	43.0	42.0					19																	42354650		2203	4300	6503	SO:0001583	missense	63946	exon8			GCTGCAGCAAGAG	AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.873G>T	19.37:g.42354650G>T	ENSP00000269945:p.Gln291His	44	0		57	4	NM_001040283	0	0	0	0	0	Q8N6Q2|Q96M39|Q96SD4	Missense_Mutation	SNP	ENST00000269945.3	37	CCDS33034.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927851	0.73327	.	.	ENSG00000142025	ENST00000269945	T	0.34072	1.38	4.91	4.91	0.64330	.	1.769320	0.03244	N	0.180886	T	0.63082	0.2481	M	0.63428	1.95	0.33174	D	0.548676	D;D	0.71674	0.998;0.995	D;D	0.79784	0.993;0.99	T	0.48222	-0.9054	10	0.62326	D	0.03	-8.8974	13.9691	0.64228	0.0:0.0:1.0:0.0	.	342;291	B4DX56;Q8IXT2	.;DMRTD_HUMAN	H	291	ENSP00000269945:Q291H	ENSP00000269945:Q291H	Q	+	3	2	DMRTC2	47046490	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.647000	0.37260	2.467000	0.83353	0.591000	0.81541	CAG	.		0.632	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463045.1	NM_001040283	
ZNF221	7638	broad.mit.edu;bcgsc.ca	37	19	44469119	44469119	+	Silent	SNP	G	G	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:44469119G>A	ENST00000251269.5	+	4	427	c.99G>A	c.(97-99)aaG>aaA	p.K33K	ZNF221_ENST00000592350.1_Silent_p.K33K|ZNF221_ENST00000587682.1_Silent_p.K33K	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	33	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TGACATTCAAGGATGTGGCTG	0.483																																					p.K33K		.											.	ZNF221-91	0			c.G99A						.						283.0	284.0	284.0					19																	44469119		2203	4300	6503	SO:0001819	synonymous_variant	7638	exon4			ATTCAAGGATGTG	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.99G>A	19.37:g.44469119G>A		199	0		251	7	NM_013359	0	0	0	0	0	B2RAI6|Q2M2H2|Q9P1U8	Silent	SNP	ENST00000251269.5	37	CCDS12633.1																																																																																			.		0.483	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460068.1		
BCL3	602	hgsc.bcm.edu	37	19	45261520	45261520	+	Silent	SNP	C	C	T	rs34401216	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:45261520C>T	ENST00000164227.5	+	7	1153	c.909C>T	c.(907-909)aaC>aaT	p.N303N		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	303					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				CCAACGTGAACGCGCAAATGT	0.751			T	IGH@	CLL								C|||	25	0.00499201	0.0	0.0173	5008	,	,		13077	0.0		0.007	False		,,,				2504	0.0061				p.N303N		.		Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	.	BCL3-848	0			c.C909T						.	C		10,4142		0,10,2066	7.0	9.0	9.0		909	0.1	1.0	19	dbSNP_126	9	90,8166		0,90,4038	no	coding-synonymous	BCL3	NM_005178.4		0,100,6104	TT,TC,CC		1.0901,0.2408,0.8059		303/455	45261520	100,12308	2076	4128	6204	SO:0001819	synonymous_variant	602	exon7			CGTGAACGCGCAA	M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.909C>T	19.37:g.45261520C>T		0	0		34	21	NM_005178	0	0	2	9	7		Silent	SNP	ENST00000164227.5	37	CCDS12642.2	15	0.006868131868131868	0	0.0	9	0.024861878453038673	0	0.0	6	0.0079155672823219	C	10.01	1.233425	0.22626	0.002408	0.010901	ENSG00000069399	ENST00000444487	.	.	.	4.65	0.0581	0.14326	.	.	.	.	.	T	0.38480	0.1042	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40308	-0.9570	4	.	.	.	-20.2645	8.3688	0.32402	0.0:0.6457:0.0:0.3543	rs34401216	.	.	.	C	187	.	.	R	+	1	0	BCL3	49953360	0.999000	0.42202	0.998000	0.56505	0.831000	0.47069	0.480000	0.22244	0.396000	0.25283	-0.332000	0.08345	CGC	C|0.993;T|0.007		0.751	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322976.1	NM_005178	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	1	0		48	25	NM_000400	0	0	3	4	1	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
RUVBL2	10856	ucsc.edu	37	19	49507542	49507542	+	Silent	SNP	A	A	G	rs11558800	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:49507542A>G	ENST00000595090.1	+	4	596	c.132A>G	c.(130-132)caA>caG	p.Q44Q	RUVBL2_ENST00000413176.2_5'UTR|RUVBL2_ENST00000601968.1_5'UTR	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	44					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		AGGCTTCGCAAGGCATGGTGG	0.607													G|||	357	0.0712859	0.1082	0.0504	5008	,	,		13052	0.0575		0.0974	False		,,,				2504	0.0235				p.Q44Q		.											.	RUVBL2-227	0			c.A132G						.	G		391,3569		26,339,1615	43.0	49.0	47.0		132	3.7	1.0	19	dbSNP_120	47	632,7630		30,572,3529	no	coding-synonymous	RUVBL2	NM_006666.1		56,911,5144	GG,GA,AA		7.6495,9.8737,8.3702		44/464	49507542	1023,11199	1980	4131	6111	SO:0001819	synonymous_variant	10856	exon4			TTCGCAAGGCATG	AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.132A>G	19.37:g.49507542A>G		13	0		140	77	NM_006666	0	0	0	0	0	B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Silent	SNP	ENST00000595090.1	37	CCDS42588.1																																																																																			A|0.924;G|0.076		0.607	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466235.1		
FCGRT	2217	broad.mit.edu	37	19	50028734	50028734	+	Missense_Mutation	SNP	G	G	T	rs34522905	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:50028734G>T	ENST00000221466.5	+	6	1378	c.892G>T	c.(892-894)Gtg>Ttg	p.V298L	FCGRT_ENST00000596975.1_Missense_Mutation_p.V206L|FCGRT_ENST00000426395.3_Missense_Mutation_p.V298L|RCN3_ENST00000270645.3_5'Flank|FCGRT_ENST00000599988.1_Missense_Mutation_p.V32L	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	298					antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		CAAGTCCTCCGTGCTCGTGGT	0.617													G|||	6	0.00119808	0.0008	0.0058	5008	,	,		17952	0.0		0.001	False		,,,				2504	0.0				p.V298L		.											.	FCGRT-91	0			c.G892T						.	G	LEU/VAL,LEU/VAL	5,4401	9.9+/-24.2	0,5,2198	105.0	89.0	95.0		892,892	1.1	0.0	19	dbSNP_126	95	24,8576	17.9+/-57.8	1,22,4277	yes	missense,missense	FCGRT	NM_001136019.2,NM_004107.4	32,32	1,27,6475	TT,TG,GG		0.2791,0.1135,0.223	benign,benign	298/366,298/366	50028734	29,12977	2203	4300	6503	SO:0001583	missense	2217	exon6			TCCTCCGTGCTCG	U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.892G>T	19.37:g.50028734G>T	ENSP00000221466:p.Val298Leu	86	0		146	4	NM_001136019	0	0	26	26	0	Q5HYM5|Q9HBV7|Q9NZ19	Missense_Mutation	SNP	ENST00000221466.5	37	CCDS12770.1	5	0.0022893772893772895	1	0.0020325203252032522	4	0.011049723756906077	0	0.0	0	0.0	G	11.41	1.631859	0.29068	0.001135	0.002791	ENSG00000104870	ENST00000221466;ENST00000426395	T;T	0.00737	5.76;5.76	4.49	1.15	0.20763	Immunoglobulin-like fold (1);	0.628978	0.13101	N	0.413771	T	0.00754	0.0025	L	0.54323	1.7	0.09310	N	0.999997	B	0.18166	0.026	B	0.13407	0.009	T	0.42430	-0.9452	10	0.87932	D	0	.	7.3786	0.26843	0.2337:0.0:0.7663:0.0	rs34522905	298	P55899	FCGRN_HUMAN	L	298	ENSP00000221466:V298L;ENSP00000410798:V298L	ENSP00000221466:V298L	V	+	1	0	FCGRT	54720546	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.581000	0.05820	0.251000	0.21505	0.563000	0.77884	GTG	G|0.996;T|0.004		0.617	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465267.1		
ASPDH	554235	hgsc.bcm.edu	37	19	51015404	51015404	+	Missense_Mutation	SNP	T	T	C	rs12977172	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:51015404T>C	ENST00000389208.4	-	6	858	c.797A>G	c.(796-798)cAg>cGg	p.Q266R	JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|ASPDH_ENST00000376916.3_Missense_Mutation_p.Q161R|JOSD2_ENST00000595669.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	266			Q -> R (in dbSNP:rs12977172). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.		NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CAGGAGGCTCTGCCAGAAGGC	0.706													C|||	3986	0.795927	0.9728	0.7781	5008	,	,		10864	0.7143		0.6849	False		,,,				2504	0.7679				p.Q266R		.											.	ASPDH-90	0			c.A797G						.	C	ARG/GLN,ARG/GLN	3799,331		1771,257,37	6.0	9.0	8.0		482,797	1.9	1.0	19	dbSNP_121	8	5527,2593		1919,1689,452	no	missense,missense	ASPDH	NM_001024656.2,NM_001114598.1	43,43	3690,1946,489	CC,CT,TT		31.9335,8.0145,23.8694	benign,benign	161/179,266/284	51015404	9326,2924	2065	4060	6125	SO:0001583	missense	554235	exon6			AGGCTCTGCCAGA		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.797A>G	19.37:g.51015404T>C	ENSP00000373860:p.Gln266Arg	0	0		22	11	NM_001114598	0	0	1	1	0	Q6NZ37	Missense_Mutation	SNP	ENST00000389208.4	37	CCDS46153.1	1681	0.7696886446886447	481	0.9776422764227642	273	0.7541436464088398	412	0.7202797202797203	515	0.679419525065963	C	3.606	-0.080592	0.07141	0.919855	0.680665	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.39997	1.05;1.05	2.95	1.88	0.25563	Aspartate dehydrogenase (1);	1.158050	0.06646	N	0.761872	T	0.00012	0.0000	N	0.01705	-0.755	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.30794	-0.9966	9	0.06099	T	0.92	-1.7519	4.8935	0.13738	0.0:0.6813:0.0:0.3187	rs12977172	266;161	A6ND91;A6ND91-2	ASPD_HUMAN;.	R	161;266	ENSP00000366114:Q161R;ENSP00000373860:Q266R	ENSP00000366114:Q161R	Q	-	2	0	ASPDH	55707216	0.916000	0.31088	0.989000	0.46669	0.553000	0.35397	0.171000	0.16685	0.125000	0.18397	-0.355000	0.07637	CAG	T|0.228;C|0.772		0.706	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464861.1	NM_001024656	
VSIG10L	147645	broad.mit.edu	37	19	51844471	51844471	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:51844471G>T	ENST00000335624.4	-	2	830	c.831C>A	c.(829-831)taC>taA	p.Y277*	CTD-2616J11.16_ENST00000594311.1_RNA|CTD-2616J11.16_ENST00000601148.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	277						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						CCTCAGCCGTGTAGACCCCTG	0.662																																					p.Y277X		.											.	.	0			c.C831A						.						19.0	26.0	24.0					19																	51844471		692	1590	2282	SO:0001587	stop_gained	147645	exon2			AGCCGTGTAGACC		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.831C>A	19.37:g.51844471G>T	ENSP00000335623:p.Tyr277*	36	0		158	4	NM_001163922	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000335624.4	37	CCDS54300.1	.	.	.	.	.	.	.	.	.	.	G	34	5.391658	0.95988	.	.	ENSG00000186806	ENST00000335624	.	.	.	3.73	2.64	0.31445	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.3148	0.26495	0.1286:0.0:0.8714:0.0	.	.	.	.	X	277	.	ENSP00000335623:Y277X	Y	-	3	2	VSIG10L	56536283	1.000000	0.71417	0.993000	0.49108	0.757000	0.42996	2.179000	0.42528	1.894000	0.54839	0.313000	0.20887	TAC	.		0.662	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464535.1	NM_001163922	
PPP2R1A	5518	broad.mit.edu	37	19	52714629	52714629	+	Silent	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:52714629G>T	ENST00000322088.6	+	4	445	c.387G>T	c.(385-387)gtG>gtT	p.V129V	PPP2R1A_ENST00000444322.2_Silent_p.V74V|PPP2R1A_ENST00000462990.1_5'UTR|PPP2R1A_ENST00000473455.2_3'UTR	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	129	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.|SV40 small T antigen binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CGCACTTTGTGCCGCTAGTGA	0.657			Mis		clear cell ovarian carcinoma																																p.V129V		.		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	.	PPP2R1A-1666	0			c.G387T						.						62.0	66.0	65.0					19																	52714629		2203	4300	6503	SO:0001819	synonymous_variant	5518	exon4			CTTTGTGCCGCTA		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.387G>T	19.37:g.52714629G>T		43	0		158	7	NM_014225	1	1	253	280	25	Q13773|Q6ICQ3|Q96DH3	Silent	SNP	ENST00000322088.6	37	CCDS12849.1																																																																																			.		0.657	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
ZNF534	147658	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52941934	52941934	+	Silent	SNP	G	G	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:52941934G>A	ENST00000332323.6	+	4	1321	c.1260G>A	c.(1258-1260)ggG>ggA	p.G420G	ZNF534_ENST00000301085.4_Intron|ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000433050.1_Silent_p.G407G	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	420					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						ATACTGGGGGGAGGCGTTACA	0.413																																					p.G420G		.											.	ZNF534-68	0			c.G1260A						.						89.0	81.0	84.0					19																	52941934		692	1591	2283	SO:0001819	synonymous_variant	147658	exon4			TGGGGGGAGGCGT	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.1260G>A	19.37:g.52941934G>A		98	0		149	36	NM_001143939	0	0	0	0	0	Q76KX9	Silent	SNP	ENST00000332323.6	37	CCDS46165.1																																																																																			.		0.413	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
EPN1	29924	broad.mit.edu	37	19	56188543	56188543	+	Intron	SNP	T	T	G			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:56188543T>G	ENST00000270460.6	+	2	210				EPN1_ENST00000411543.2_Silent_p.G2G|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.12_ENST00000585940.1_RNA|EPN1_ENST00000085079.7_Intron	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1						embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		CATAGATGGGTGATCAGAGct	0.582																																					p.G2G		.											.	.	0			c.T6G						.						85.0	88.0	87.0					19																	56188543		692	1591	2283	SO:0001627	intron_variant	29924	exon1			GATGGGTGATCAG	AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.-101-1350T>G	19.37:g.56188543T>G		86	7		163	18	NM_001130071	0	0	7	7	0	Q86ST3|Q9HA18	Silent	SNP	ENST00000270460.6	37	CCDS46199.1																																																																																			.		0.582	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453610.1	NM_013333	
ZNF787	126208	hgsc.bcm.edu	37	19	56599438	56599440	+	In_Frame_Del	DEL	TCG	TCG	-	rs5828672|rs71696054	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	TCG	TCG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:56599438_56599440delTCG	ENST00000270459.3	-	3	1219_1221	c.1101_1103delCGA	c.(1099-1104)gacgag>gag	p.D367del		NM_001002836.2	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	367					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)	5		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		GCCCGCGGCCTCGTCGTCGTCGT	0.778														4509	0.900359	0.9939	0.732	5008	,	,		3238	0.7252		0.9821	False		,,,				2504	0.9898				p.367_368del		.											.	ZNF787-69	0			c.1101_1103del						.																																			SO:0001651	inframe_deletion	126208	exon3			GCGGCCTCGTCGT	BC077728, AF000560	CCDS42634.1	19q13.42	2013-01-08				ENSG00000142409		"""Zinc fingers, C2H2-type"""	26998	protein-coding gene	gene with protein product							Standard	NM_001002836		Approved		uc010eth.1	Q6DD87		ENST00000270459.3:c.1101_1103delCGA	19.37:g.56599447_56599449delTCG	ENSP00000270459:p.Asp367del	0	0		16	14	NM_001002836	0	0	0	0	0	O00455	In_Frame_Del	DEL	ENST00000270459.3	37	CCDS42634.1																																																																																			.		0.778	ZNF787-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457498.1	NM_001002836	
ZNF837	116412	hgsc.bcm.edu	37	19	58879606	58879606	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:58879606C>A	ENST00000427624.2	-	3	1416	c.1094G>T	c.(1093-1095)tGc>tTc	p.C365F	ZNF837_ENST00000597582.1_Missense_Mutation_p.C365F|CTD-2619J13.3_ENST00000599889.1_RNA			Q96EG3	ZN837_HUMAN	zinc finger protein 837	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						GCAGTCGGCGCACTCGTACGG	0.746																																					p.C365F		.											.	ZNF837-68	0			c.G1094T						.						13.0	13.0	13.0					19																	58879606		691	1588	2279	SO:0001583	missense	116412	exon3			TCGGCGCACTCGT	BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.1094G>T	19.37:g.58879606C>A	ENSP00000405699:p.Cys365Phe	0	0		83	54	NM_138466	0	0	0	0	0		Missense_Mutation	SNP	ENST00000427624.2	37	CCDS46216.1	.	.	.	.	.	.	.	.	.	.	C	10.99	1.506006	0.26949	.	.	ENSG00000152475	ENST00000427624	T	0.15603	2.41	1.1	1.1	0.20463	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53045	0.1772	H	0.97758	4.07	0.21933	N	0.999463	D	0.89917	1.0	D	0.79108	0.992	T	0.43261	-0.9402	9	0.87932	D	0	.	9.7272	0.40339	0.0:1.0:0.0:0.0	.	365	Q96EG3	ZN837_HUMAN	F	365	ENSP00000405699:C365F	ENSP00000405699:C365F	C	-	2	0	ZNF837	63571418	0.987000	0.35691	0.021000	0.16686	0.016000	0.09150	5.573000	0.67417	0.897000	0.36392	0.467000	0.42956	TGC	.		0.746	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
SLC27A5	10998	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	59010241	59010241	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr19:59010241G>C	ENST00000263093.2	-	9	1916	c.1807C>G	c.(1807-1809)Ccc>Gcc	p.P603A	SLC27A5_ENST00000601355.1_Missense_Mutation_p.P519A|SLC27A5_ENST00000594786.1_Missense_Mutation_p.P8A|SLC27A5_ENST00000599700.1_Intron	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	603					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		GTCTGGCCGGGGGCTAGCTGC	0.622																																					p.P603A		.											.	SLC27A5-90	0			c.C1807G						.						55.0	55.0	55.0					19																	59010241		2203	4300	6503	SO:0001583	missense	10998	exon9			GGCCGGGGGCTAG	AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.1807C>G	19.37:g.59010241G>C	ENSP00000263093:p.Pro603Ala	90	0		182	76	NM_012254	0	0	16	21	5	B3KVP6|B4DPQ1	Missense_Mutation	SNP	ENST00000263093.2	37	CCDS12983.1	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980318	0.53827	.	.	ENSG00000083807	ENST00000263093	T	0.50548	0.74	4.99	4.99	0.66335	.	0.204155	0.42821	D	0.000649	T	0.46795	0.1411	M	0.62723	1.935	0.31604	N	0.652386	B	0.20887	0.049	B	0.16722	0.016	T	0.56220	-0.8015	10	0.56958	D	0.05	-25.0788	14.1388	0.65306	0.0:0.0:1.0:0.0	.	603	Q9Y2P5	S27A5_HUMAN	A	603	ENSP00000263093:P603A	ENSP00000263093:P603A	P	-	1	0	SLC27A5	63702053	0.589000	0.26807	0.687000	0.30102	0.972000	0.66771	2.047000	0.41269	2.470000	0.83445	0.650000	0.86243	CCC	.		0.622	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467060.1	NM_012254	
EPT1	85465	broad.mit.edu	37	2	26587743	26587743	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:26587743G>T	ENST00000260585.7	+	3	289	c.170G>T	c.(169-171)gGc>gTc	p.G57V		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	57					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)										ACTTTTTCTGGCTTTCTGCTG	0.323																																					.		.											.	.	0			.						.						106.0	95.0	99.0					2																	26587743		1806	4062	5868	SO:0001583	missense	85465	.			TTTCTGGCTTTCT		CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.170G>T	2.37:g.26587743G>T	ENSP00000260585:p.Gly57Val	65	0		38	4	.	0	0	4	4	0	Q63ZE3	Missense_Mutation	SNP	ENST00000260585.7	37	CCDS46240.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569774	0.86439	.	.	ENSG00000138018	ENST00000442141;ENST00000260585;ENST00000447170	T;T	0.48201	0.82;0.82	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.78935	0.4362	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83958	0.0320	10	0.87932	D	0	-13.6399	18.9858	0.92769	0.0:0.0:1.0:0.0	.	57	Q9C0D9	EPT1_HUMAN	V	25;57;57	ENSP00000415280:G25V;ENSP00000260585:G57V	ENSP00000260585:G57V	G	+	2	0	EPT1	26441247	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	8.943000	0.92975	2.832000	0.97577	0.655000	0.94253	GGC	.		0.323	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding	OTTHUMT00000324484.3	NM_033505.2	
KCNK3	3777	hgsc.bcm.edu	37	2	26915985	26915985	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:26915985C>G	ENST00000302909.3	+	1	367	c.242C>G	c.(241-243)gCc>gGc	p.A81G		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	81					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	TGGCGCTTCGCCGGCTCCTTC	0.721																																					p.A81G	GBM(80;1457 1631 27100 45946)	.											.	KCNK3-91	0			c.C242G						.						15.0	17.0	16.0					2																	26915985		2152	4244	6396	SO:0001583	missense	3777	exon1			GCTTCGCCGGCTC	AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.242C>G	2.37:g.26915985C>G	ENSP00000306275:p.Ala81Gly	3	0		43	17	NM_002246	0	0	36	72	36	Q53SU2	Missense_Mutation	SNP	ENST00000302909.3	37	CCDS1727.1	.	.	.	.	.	.	.	.	.	.	C	18.73	3.686624	0.68157	.	.	ENSG00000171303	ENST00000302909	T	0.28454	1.61	3.15	3.15	0.36227	Ion transport 2 (1);	0.000000	0.64402	D	0.000001	T	0.27205	0.0667	L	0.31120	0.905	0.58432	D	0.999998	B	0.32128	0.357	B	0.40477	0.33	T	0.11641	-1.0579	10	0.40728	T	0.16	.	11.793	0.52080	0.0:1.0:0.0:0.0	.	81	O14649	KCNK3_HUMAN	G	81	ENSP00000306275:A81G	ENSP00000306275:A81G	A	+	2	0	KCNK3	26769489	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	6.941000	0.75922	1.625000	0.50366	0.305000	0.20034	GCC	.		0.721	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246861.2	NM_002246	
PSME4	23198	bcgsc.ca	37	2	54115096	54115096	+	Silent	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:54115096G>T	ENST00000404125.1	-	39	4474	c.4419C>A	c.(4417-4419)gcC>gcA	p.A1473A	PSME4_ENST00000421748.2_Silent_p.A617A|PSME4_ENST00000476586.1_5'Flank	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	1473					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ATTCTTGCTGGGCAAGGCCAC	0.413																																					p.A1473A		.											.	PSME4-275	0			c.C4419A						.						121.0	107.0	112.0					2																	54115096		2203	4300	6503	SO:0001819	synonymous_variant	23198	exon39			TTGCTGGGCAAGG	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.4419C>A	2.37:g.54115096G>T		90	0		85	5	NM_014614	0	0	13	13	0	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	ENST00000404125.1	37	CCDS33197.2																																																																																			.		0.413	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
USP34	9736	broad.mit.edu	37	2	61493260	61493260	+	Missense_Mutation	SNP	T	T	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:61493260T>A	ENST00000398571.2	-	42	5552	c.5476A>T	c.(5476-5478)Agt>Tgt	p.S1826C		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1826					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TCCTTTAGACTTGGCAACAAA	0.373																																					p.S1826C		.											.	USP34-579	0			c.A5476T						.						87.0	79.0	82.0					2																	61493260		1831	4088	5919	SO:0001583	missense	9736	exon42			TTAGACTTGGCAA	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.5476A>T	2.37:g.61493260T>A	ENSP00000381577:p.Ser1826Cys	77	0		60	3	NM_014709	0	0	1	1	0	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	37	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	T	18.68	3.676251	0.67928	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571;ENST00000453734	T;T	0.04603	3.7;3.59	5.44	5.44	0.79542	Armadillo-type fold (1);	0.087501	0.85682	D	0.000000	T	0.08980	0.0222	M	0.71581	2.175	0.58432	D	0.999992	B	0.25609	0.13	B	0.21360	0.034	T	0.02042	-1.1224	10	0.87932	D	0	.	14.0764	0.64893	0.0:0.0:0.0:1.0	.	1826	Q70CQ2	UBP34_HUMAN	C	1674;1674;1826;104	ENSP00000381577:S1826C;ENSP00000410559:S104C	ENSP00000263989:S1674C	S	-	1	0	USP34	61346764	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.040000	0.89188	2.065000	0.61736	0.460000	0.39030	AGT	.		0.373	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
C2orf81	388963	broad.mit.edu	37	2	74642280	74642280	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:74642280T>G	ENST00000517883.1	-	1	1430	c.739A>C	c.(739-741)Acc>Ccc	p.T247P	C2orf81_ENST00000290390.5_Missense_Mutation_p.T315P			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	308										endometrium(3)|kidney(1)	4						GAGGGGCGGGTGGCGCCGCCC	0.716																																					p.T315P		.											.	.	0			c.A943C						.						7.0	10.0	9.0					2																	74642280		682	1575	2257	SO:0001583	missense	388963	exon4			GGCGGGTGGCGCC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.739A>C	2.37:g.74642280T>G	ENSP00000431103:p.Thr247Pro	22	6		108	64	NM_001145054	0	0	2	3	1		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	t	12.14	1.849844	0.32699	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	3.91	-3.99	0.04069	.	1.321610	0.05237	N	0.511487	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B	0.19073	0.033	B	0.22601	0.04	T	0.39396	-0.9616	9	0.72032	D	0.01	-3.9874	1.2321	0.01946	0.1409:0.2887:0.2874:0.283	.	315	G3XAA6	.	P	247;315	.	ENSP00000290390:T315P	T	-	1	0	C2orf81	74495788	0.007000	0.16637	0.000000	0.03702	0.008000	0.06430	0.309000	0.19332	-0.435000	0.07264	0.454000	0.30748	ACC	.		0.716	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000437928.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		0	0		6	6	NM_023016	0	0	0	0	0	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
CPS1	1373	ucsc.edu;bcgsc.ca	37	2	211504722	211504722	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:211504722G>T	ENST00000233072.5	+	24	3094	c.2898G>T	c.(2896-2898)gaG>gaT	p.E966D	CPS1_ENST00000497121.1_3'UTR|CPS1_ENST00000430249.2_Missense_Mutation_p.E972D|CPS1_ENST00000451903.2_Missense_Mutation_p.E515D	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	966					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TTCCTCAGGAGCATGATGTCA	0.313																																					p.E972D		.											.	CPS1-162	0			c.G2916T						.						131.0	126.0	128.0					2																	211504722		2203	4299	6502	SO:0001583	missense	1373	exon25			TCAGGAGCATGAT	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.2898G>T	2.37:g.211504722G>T	ENSP00000233072:p.Glu966Asp	26	0		38	4	NM_001122633	0	0	0	0	0	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308559	0.60305	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97256	-4.31;-4.31;-4.31	5.42	1.55	0.23275	Pre-ATP-grasp fold (1);Carbamoyl-phosphate synthetase, large subunit, oligomerisation (1);	0.000000	0.85682	D	0.000000	D	0.96750	0.8939	M	0.86805	2.84	0.43994	D	0.996693	P;P	0.35612	0.512;0.512	B;B	0.40636	0.335;0.335	D	0.94815	0.7982	10	0.51188	T	0.08	-13.8475	11.159	0.48505	0.3459:0.0:0.6541:0.0	.	976;966	Q59HF8;P31327	.;CPSM_HUMAN	D	972;974;966;515	ENSP00000402608:E972D;ENSP00000233072:E966D;ENSP00000406136:E515D	ENSP00000233072:E966D	E	+	3	2	CPS1	211212967	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	1.712000	0.37940	0.349000	0.23975	-0.126000	0.14955	GAG	.		0.313	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
SPEG	10290	hgsc.bcm.edu	37	2	220313680	220313680	+	Silent	SNP	G	G	C	rs60593157	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:220313680G>C	ENST00000312358.7	+	4	1932	c.1800G>C	c.(1798-1800)cgG>cgC	p.R600R	SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396698.1_Silent_p.R496R|SPEG_ENST00000396695.2_5'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	600	Pro-rich.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CGCTGACCCGGAGCAGAGCCA	0.746													G|||	353	0.0704872	0.1906	0.0447	5008	,	,		10821	0.0		0.0338	False		,,,				2504	0.0368				p.R600R		.											.	SPEG-383	0			c.G1800C						.	G		437,3257		15,407,1425	4.0	7.0	6.0		1800	2.8	1.0	2	dbSNP_129	6	231,7643		4,223,3710	no	coding-synonymous	SPEG	NM_005876.4		19,630,5135	CC,CG,GG		2.9337,11.83,5.7746		600/3268	220313680	668,10900	1847	3937	5784	SO:0001819	synonymous_variant	10290	exon4			GACCCGGAGCAGA	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.1800G>C	2.37:g.220313680G>C		0	0		16	9	NM_005876	0	0	0	1	1	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	37	CCDS42824.1																																																																																			G|0.945;C|0.055		0.746	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
PRR21	643905	bcgsc.ca	37	2	240981459	240981459	+	Missense_Mutation	SNP	A	A	G	rs147134334	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:240981459A>G	ENST00000408934.1	-	1	940	c.941T>C	c.(940-942)aTg>aCg	p.M314T		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	314	Pro-rich.									NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGGCATGGACGAAGG	0.607																																					p.M314T		.											.	PRR21-70	0			c.T941C						.						91.0	81.0	84.0					2																	240981459		2203	4298	6501	SO:0001583	missense	643905	exon1			AGAGGCATGGACG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.941T>C	2.37:g.240981459A>G	ENSP00000386166:p.Met314Thr	124	7		123	33	NM_001080835	0	0	0	0	0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	a	0.001	-2.984731	0.00046	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13196	2.61;2.61	0.113	0.113	0.14631	.	.	.	.	.	T	0.05823	0.0152	N	0.08118	0	0.80722	P	0.0	B	0.17852	0.024	B	0.04013	0.001	T	0.37454	-0.9705	7	0.24483	T	0.36	.	.	.	.	.	314	Q8WXC7	PRR21_HUMAN	T	314	ENSP00000386166:M314T;ENSP00000418240:M314T	ENSP00000386166:M314T	M	-	2	0	PRR21	240630132	0.000000	0.05858	0.016000	0.15963	0.033000	0.12548	-1.632000	0.02024	0.158000	0.19367	0.156000	0.16432	ATG	A|0.993;G|0.007		0.607	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
PRR21	643905	bcgsc.ca	37	2	240982075	240982075	+	Missense_Mutation	SNP	A	A	G	rs139834525	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr2:240982075A>G	ENST00000408934.1	-	1	324	c.325T>C	c.(325-327)Tgc>Cgc	p.C109R		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	109	Pro-rich.									NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGGCATGGACGAAGG	0.622													-|||	2216	0.442492	0.4455	0.4179	5008	,	,		21359	0.5446		0.4076	False		,,,				2504	0.3865				p.C109R		.											.	PRR21-70	0			c.T325C						.						27.0	28.0	27.0					2																	240982075		2113	4234	6347	SO:0001583	missense	643905	exon1			AGAGGCATGGACG	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.325T>C	2.37:g.240982075A>G	ENSP00000386166:p.Cys109Arg	129	10		62	35	NM_001080835	0	0	0	0	0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	-	0.034	-1.314994	0.01331	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13420	2.59;2.59	1.79	-3.59	0.04583	.	.	.	.	.	T	0.05318	0.0141	N	0.08118	0	0.80722	P	0.0	B	0.12013	0.005	B	0.01281	0.0	T	0.33701	-0.9858	8	0.23891	T	0.37	.	5.6495	0.17608	0.3839:0.3611:0.255:0.0	.	109	Q8WXC7	PRR21_HUMAN	R	109	ENSP00000386166:C109R;ENSP00000418240:C109R	ENSP00000386166:C109R	C	-	1	0	PRR21	240630748	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.426000	0.07008	-2.813000	0.00347	-1.763000	0.00667	TGC	A|0.968;G|0.032		0.622	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080835	
TCF15	6939	hgsc.bcm.edu	37	20	590456	590456	+	Silent	SNP	A	A	G	rs282164	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr20:590456A>G	ENST00000246080.3	-	1	586	c.426T>C	c.(424-426)cgT>cgC	p.R142R		NM_004609.3	NP_004600.2	Q12870	TCF15_HUMAN	transcription factor 15 (basic helix-loop-helix)	142					death (GO:0016265)|ear development (GO:0043583)|eating behavior (GO:0042755)|establishment of epithelial cell apical/basal polarity (GO:0045198)|mesenchymal to epithelial transition (GO:0060231)|mesoderm development (GO:0007498)|muscle organ morphogenesis (GO:0048644)|neuromuscular process controlling posture (GO:0050884)|paraxial mesoderm development (GO:0048339)|post-anal tail morphogenesis (GO:0036342)|regulation of gene expression involved in extracellular matrix organization (GO:1901311)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|lung(2)|prostate(1)	4		Breast(17;0.231)				TGCCCGCGGCACGGAAGCACG	0.736													g|||	4317	0.862021	0.7413	0.9035	5008	,	,		6474	0.998		0.8072	False		,,,				2504	0.9121				p.R142R		.											.	TCF15-90	0			c.T426C						.			3211,1033		1232,747,143	7.0	8.0	8.0		426	-9.0	0.0	20	dbSNP_79	8	6663,1669		2708,1247,211	no	coding-synonymous	TCF15	NM_004609.3		3940,1994,354	GG,GA,AA		20.0312,24.3402,21.4854		142/200	590456	9874,2702	2122	4166	6288	SO:0001819	synonymous_variant	6939	exon1			CGCGGCACGGAAG		CCDS33432.1	20p13	2013-05-21			ENSG00000125878	ENSG00000125878		"""Basic helix-loop-helix proteins"""	11627	protein-coding gene	gene with protein product		601010				8825648, 8041747	Standard	NM_004609		Approved	EC2, PARAXIS, bHLHa40	uc002wdz.3	Q12870	OTTHUMG00000031640	ENST00000246080.3:c.426T>C	20.37:g.590456A>G		0	0		15	15	NM_004609	0	0	0	0	0	Q9NQQ1	Silent	SNP	ENST00000246080.3	37	CCDS33432.1																																																																																			A|0.165;G|0.835		0.736	TCF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077475.2	NM_004609	
SDCBP2	27111	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	1293253	1293253	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr20:1293253T>C	ENST00000360779.3	-	6	711	c.538A>G	c.(538-540)Att>Gtt	p.I180V	SDCBP2_ENST00000467129.1_5'Flank|SDCBP2_ENST00000339987.3_Missense_Mutation_p.I180V|SDCBP2_ENST00000381808.3_Missense_Mutation_p.I95V|SDCBP2_ENST00000381812.1_Missense_Mutation_p.I180V	NM_080489.4	NP_536737.3	Q9H190	SDCB2_HUMAN	syndecan binding protein (syntenin) 2	180	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	7						ACCACGACAATCTTATCGCCT	0.627																																					p.I180V		.											.	SDCBP2-154	0			c.A538G						.						108.0	92.0	97.0					20																	1293253		2203	4300	6503	SO:0001583	missense	27111	exon6			CGACAATCTTATC	AF131809	CCDS13013.1, CCDS42848.1	20p13	2008-07-02			ENSG00000125775	ENSG00000125775			15756	protein-coding gene	gene with protein product						11152476	Standard	NM_080489		Approved	ST-2, SITAC18	uc021vzn.1	Q9H190	OTTHUMG00000031661	ENST00000360779.3:c.538A>G	20.37:g.1293253T>C	ENSP00000354013:p.Ile180Val	191	0		241	75	NM_080489	0	0	2	4	2	O95892|Q5W0X1|Q9BZ42|Q9H567|Q9NRY8	Missense_Mutation	SNP	ENST00000360779.3	37	CCDS42848.1	.	.	.	.	.	.	.	.	.	.	t	12.64	1.999190	0.35226	.	.	ENSG00000125775	ENST00000381812;ENST00000381808;ENST00000360779;ENST00000339987	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	4.51	4.51	0.55191	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.29389	0.0732	L	0.49350	1.555	0.58432	D	0.999993	B	0.18166	0.026	B	0.31869	0.137	T	0.11817	-1.0572	10	0.52906	T	0.07	-11.5551	13.9619	0.64185	0.0:0.0:0.0:1.0	.	180	Q9H190	SDCB2_HUMAN	V	180;95;180;180	ENSP00000371233:I180V;ENSP00000371229:I95V;ENSP00000354013:I180V;ENSP00000342935:I180V	ENSP00000342935:I180V	I	-	1	0	SDCBP2	1241253	1.000000	0.71417	0.998000	0.56505	0.208000	0.24298	7.759000	0.85235	2.005000	0.58758	0.459000	0.35465	ATT	.		0.627	SDCBP2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077513.2	NM_080489	
LZTS3	9762	broad.mit.edu	37	20	3145141	3145141	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr20:3145141T>G	ENST00000329152.3	-	3	3378	c.1981A>C	c.(1981-1983)Acc>Ccc	p.T661P	LZTS3_ENST00000360342.3_Missense_Mutation_p.T615P|LZTS3_ENST00000337576.5_Missense_Mutation_p.T615P			O60299	LZTS3_HUMAN		661						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)											CGGGAGGGGGTCCAGGCCTTC	0.652																																					p.T661P		.											.	.	0			c.A1981C						.						58.0	58.0	58.0					20																	3145141		2203	4300	6503	SO:0001583	missense	0	exon3			AGGGGGTCCAGGC																												ENST00000329152.3:c.1981A>C	20.37:g.3145141T>G	ENSP00000332123:p.Thr661Pro	55	0		153	24	NM_014731	0	0	6	7	1	A2A2Q7|D3DVX6|Q8IXX8	Missense_Mutation	SNP	ENST00000329152.3	37	CCDS13049.1	.	.	.	.	.	.	.	.	.	.	T	14.91	2.676668	0.47886	.	.	ENSG00000088899	ENST00000329152;ENST00000360342;ENST00000337576	T;T;T	0.34072	1.38;1.43;1.43	4.69	3.6	0.41247	.	0.250490	0.40222	N	0.001159	T	0.32763	0.0840	L	0.27053	0.805	0.42605	D	0.993294	B;D	0.61080	0.0;0.989	B;P	0.50590	0.004;0.645	T	0.06588	-1.0818	10	0.49607	T	0.09	-24.2074	10.0654	0.42299	0.0:0.0792:0.0:0.9208	.	615;661	O60299-2;O60299	.;PRIP1_HUMAN	P	661;615;615	ENSP00000332123:T661P;ENSP00000353496:T615P;ENSP00000338166:T615P	ENSP00000332123:T661P	T	-	1	0	RP5-1187M17.10	3093141	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	2.852000	0.48310	0.844000	0.35094	0.454000	0.30748	ACC	.		0.652	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077715.2		
FRG1B	284802	broad.mit.edu	37	20	29631557	29631557	+	Missense_Mutation	SNP	A	A	G	rs11525721		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr20:29631557A>G	ENST00000278882.3	+	7	733	c.353A>G	c.(352-354)aAa>aGa	p.K118R	FRG1B_ENST00000358464.4_Missense_Mutation_p.K118R			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	118								p.K118R(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TGTGCTGAAAAAGAAACCAAG	0.333																																					.		.											.	FRG1B-22	2	Substitution - Missense(2)	endometrium(2)	.						.																																			SO:0001583	missense	284802	.			CTGAAAAAGAAAC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.353A>G	20.37:g.29631557A>G	ENSP00000278882:p.Lys118Arg	334	1		337	10	.	0	0	40	137	97	C4AME5	RNA	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	a	0.014	-1.602257	0.00849	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	2.03	1.07	0.20283	.	0.100689	0.64402	N	0.000003	T	0.12475	0.0303	.	.	.	0.22378	N	0.999156	B	0.02656	0.0	B	0.01281	0.0	T	0.34079	-0.9843	8	0.02654	T	1	.	7.0418	0.25025	0.1556:0.0:0.8444:0.0	rs11525721	118	Q9BZ01	FRG1B_HUMAN	R	118	.	ENSP00000278882:K118R	K	+	2	0	FRG1B	28245218	1.000000	0.71417	0.998000	0.56505	0.630000	0.37929	4.500000	0.60387	0.419000	0.25927	-0.343000	0.07986	AAA	.		0.333	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000078494.2	NR_003579	
TMEM189-UBE2V1	387522	hgsc.bcm.edu	37	20	48770159	48770159	+	Missense_Mutation	SNP	T	T	C	rs232733		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr20:48770159T>C	ENST00000341698.2	-	1	15	c.16A>G	c.(16-18)Aac>Gac	p.N6D	TMEM189_ENST00000557021.1_Missense_Mutation_p.N6D|TMEM189_ENST00000371650.5_Missense_Mutation_p.N6D|TMEM189_ENST00000371652.4_Missense_Mutation_p.N6D	NM_001257399.1	NP_001244328.1			TMEM189-UBE2V1 readthrough											breast(1)|endometrium(4)|large_intestine(6)|lung(6)	17			BRCA - Breast invasive adenocarcinoma(9;8.29e-07)			CCCGGCCAGTTCTCGGCGCCC	0.766													C|||	5008	1.0	1.0	1.0	5008	,	,		6103	1.0		1.0	False		,,,				2504	1.0				p.N6D		.											.	TMEM189-22	0			c.A16G						.						2.0	2.0	2.0					20																	48770159		1101	2248	3349	SO:0001583	missense	387521	exon1			GCCAGTTCTCGGC	U39361	CCDS13424.1	20q13.13	2011-05-31			ENSG00000124208	ENSG00000124208			33521	other	readthrough						11076860	Standard	NM_199203		Approved	Kua-UEV, CROC-1B	uc002xvf.3		OTTHUMG00000033085	ENST00000341698.2:c.16A>G	20.37:g.48770159T>C	ENSP00000344166:p.Asn6Asp	0	0		5	5	NM_199129	0	0	0	2	2		Missense_Mutation	SNP	ENST00000341698.2	37	CCDS13424.1	2182	0.9990842490842491	492	1.0	360	0.994475138121547	572	1.0	758	1.0	C	0.054	-1.242740	0.01481	.	.	ENSG00000124208;ENSG00000240849;ENSG00000240849;ENSG00000240849	ENST00000341698;ENST00000557021;ENST00000371650;ENST00000371652	T;T;T;T	0.46819	0.86;0.86;1.11;1.11	3.81	0.707	0.18139	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40757	-0.9546	8	0.02654	T	1	.	3.4688	0.07559	0.1731:0.5239:0.0:0.303	rs232733;rs674252;rs56654084	6;6;6	Q5TGE1;A5PLL7;G3V2F7	.;TM189_HUMAN;.	D	6	ENSP00000344166:N6D;ENSP00000450635:N6D;ENSP00000360713:N6D;ENSP00000360715:N6D	ENSP00000360713:N6D	N	-	1	0	TMEM189-UBE2V1;TMEM189	48203566	1.000000	0.71417	0.503000	0.27626	0.073000	0.16967	0.497000	0.22514	-0.274000	0.09232	-2.268000	0.00277	AAC	C|0.999;T|0.001		0.766	TMEM189-UBE2V1-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000080532.5		
EVA1C	59271	bcgsc.ca	37	21	33840095	33840095	+	Silent	SNP	C	C	T	rs8130653	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr21:33840095C>T	ENST00000300255.2	+	4	1046	c.573C>T	c.(571-573)taC>taT	p.Y191Y	EVA1C_ENST00000382699.3_Silent_p.Y191Y|EVA1C_ENST00000401402.3_Silent_p.Y191Y	NM_058187.3	NP_478067.2	P58658	EVA1C_HUMAN	eva-1 homolog C (C. elegans)	191	SUEL-type lectin 2. {ECO:0000255|PROSITE- ProRule:PRU00260}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										CTGCGACCTACGGCAGGAGGA	0.502													C|||	327	0.0652955	0.0439	0.062	5008	,	,		13438	0.0149		0.1173	False		,,,				2504	0.0951				p.Y191Y		.											.	.	0			c.C573T						.	C		211,4195	129.8+/-166.5	5,201,1997	84.0	68.0	73.0		573	-11.1	0.1	21	dbSNP_116	73	902,7698	201.4+/-244.9	55,792,3453	no	coding-synonymous	C21orf63	NM_058187.3		60,993,5450	TT,TC,CC		10.4884,4.7889,8.5576		191/442	33840095	1113,11893	2203	4300	6503	SO:0001819	synonymous_variant	59271	exon4			GACCTACGGCAGG	AF358258	CCDS13614.1, CCDS68186.1	21q22.11	2012-11-05	2012-11-05	2012-11-05	ENSG00000166979	ENSG00000166979			13239	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 64"", ""chromosome 21 open reading frame 63"", ""family with sequence similarity 176, member C"""	C21orf64, C21orf63, FAM176C		11707072, 19470522	Standard	NM_058187		Approved	B18, PRED34, B19	uc002ypr.1	P58658	OTTHUMG00000064922	ENST00000300255.2:c.573C>T	21.37:g.33840095C>T		64	0		78	6	NM_058187	0	0	3	3	0	A6ND58|Q8IXZ0	Silent	SNP	ENST00000300255.2	37	CCDS13614.1																																																																																			C|0.917;T|0.083		0.502	EVA1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139403.1	NM_058187	
C21orf33	8209	ucsc.edu	37	21	45553596	45553596	+	Missense_Mutation	SNP	T	T	C	rs968714	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr21:45553596T>C	ENST00000291577.6	+	1	110	c.17T>C	c.(16-18)gTc>gCc	p.V6A	C21orf33_ENST00000348499.5_Missense_Mutation_p.V6A|C21orf33_ENST00000493883.1_3'UTR|C21orf33_ENST00000427803.2_Missense_Mutation_p.V6A	NM_004649.6	NP_004640	P30042	ES1_HUMAN	chromosome 21 open reading frame 33	6			V -> A (in dbSNP:rs968714). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8753807, ECO:0000269|PubMed:8975701, ECO:0000269|PubMed:9150728}.			mitochondrion (GO:0005739)				NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8				STAD - Stomach adenocarcinoma(101;0.168)|Colorectal(79;0.191)		GCTGTGAGGGTCCTGGTGGCC	0.692													C|||	2964	0.591853	0.3139	0.6816	5008	,	,		13909	0.7004		0.8211	False		,,,				2504	0.5562				p.V6A		.											.	C21orf33-91	0			c.T17C						.	C	ALA/VAL,ALA/VAL	1627,2771		334,959,906	29.0	23.0	25.0		17,17	-1.3	0.0	21	dbSNP_86	25	6925,1665		2843,1239,213	yes	missense,missense	C21orf33	NM_198155.3,NM_004649.6	64,64	3177,2198,1119	CC,CT,TT		19.383,36.9941,34.1546	benign,benign	6/238,6/269	45553596	8552,4436	2199	4295	6494	SO:0001583	missense	8209	exon1			TGAGGGTCCTGGT	Y07572	CCDS33580.1, CCDS33581.1	21q22.3	2008-07-29			ENSG00000160221	ENSG00000160221			1273	protein-coding gene	gene with protein product		601659				9150728, 8975701	Standard	NM_004649		Approved	KNP-Ia, GT335, ES1, HES1, D21S2048E, KNPI, KNPH, KNP-I	uc002zec.4	P30042	OTTHUMG00000086916	ENST00000291577.6:c.17T>C	21.37:g.45553596T>C	ENSP00000291577:p.Val6Ala	14	0		367	172	NM_198155	0	1	50	99	48	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	ENST00000291577.6	37	CCDS33580.1	1441	0.6597985347985348	166	0.33739837398373984	255	0.7044198895027625	403	0.7045454545454546	617	0.8139841688654353	C	2.537	-0.307097	0.05458	0.369941	0.80617	ENSG00000160221	ENST00000291577;ENST00000427803;ENST00000348499	T;T;T	0.35048	1.87;1.33;1.85	3.96	-1.32	0.09201	.	0.993292	0.08177	N	0.986026	T	0.00012	0.0000	N	0.02142	-0.665	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-0.2574	8.8345	0.35104	0.0:0.348:0.0:0.652	rs968714;rs17844987;rs17856059;rs17857746;rs58914271;rs968714	6;6	P30042-2;P30042	.;ES1_HUMAN	A	6	ENSP00000291577:V6A;ENSP00000396655:V6A;ENSP00000344901:V6A	ENSP00000291577:V6A	V	+	2	0	C21orf33	44378024	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.246000	0.02896	-0.466000	0.06943	-0.974000	0.02594	GTC	T|0.378;C|0.622		0.692	C21orf33-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195824.1	NM_004649	
KRTAP10-10	353333	ucsc.edu	37	21	46057418	46057418	+	Missense_Mutation	SNP	G	G	C	rs116673061|rs587619383|rs375905135|rs386819192	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr21:46057418G>C	ENST00000380095.1	+	1	146	c.84G>C	c.(82-84)gaG>gaC	p.E28D	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	28	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						GCTGCTGCGAGCCCTGCTGCT	0.682														1444	0.288339	0.2337	0.2075	5008	,	,		16541	0.253		0.3101	False		,,,				2504	0.4335				p.E28D		.											.	KRTAP10-10-90	0			c.G84C						.						65.0	70.0	68.0					21																	46057418		2203	4299	6502	SO:0001583	missense	353333	exon1			CTGCGAGCCCTGC	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.84G>C	21.37:g.46057418G>C	ENSP00000369438:p.Glu28Asp	11	0		123	51	NM_181688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380095.1	37	CCDS33585.1	473	0.21657509157509158	80	0.16260162601626016	68	0.1878453038674033	129	0.22552447552447552	196	0.25857519788918204	g	11.63	1.696515	0.30142	.	.	ENSG00000221859	ENST00000380095	T	0.14144	2.53	3.52	2.6	0.31112	.	.	.	.	.	T	0.00012	0.0000	M	0.88031	2.925	0.43678	P	0.003882000000000052	P	0.51057	0.941	B	0.41374	0.355	T	0.25257	-1.0137	8	0.59425	D	0.04	.	8.1233	0.30984	0.1271:0.0:0.8729:0.0	.	28	P60014	KR10A_HUMAN	D	28	ENSP00000369438:E28D	ENSP00000369438:E28D	E	+	3	2	KRTAP10-10	44881846	0.638000	0.27225	0.995000	0.50966	0.010000	0.07245	1.085000	0.30840	1.661000	0.50771	0.467000	0.42956	GAG	G|0.757;C|0.243		0.682	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
KRTAP10-10	353333	ucsc.edu	37	21	46057422	46057422	+	Missense_Mutation	SNP	T	T	A	rs112205018|rs386819192	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr21:46057422T>A	ENST00000380095.1	+	1	150	c.88T>A	c.(88-90)Tgc>Agc	p.C30S	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	30	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						CTGCGAGCCCTGCTGCTGTGC	0.677													T|||	1453	0.290136	0.2337	0.2075	5008	,	,		16831	0.253		0.3101	False		,,,				2504	0.4427				p.C30S		.											.	KRTAP10-10-90	0			c.T88A						.						64.0	70.0	68.0					21																	46057422		2203	4299	6502	SO:0001583	missense	353333	exon1			GAGCCCTGCTGCT	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.88T>A	21.37:g.46057422T>A	ENSP00000369438:p.Cys30Ser	11	0		126	55	NM_181688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000380095.1	37	CCDS33585.1	540	0.24725274725274726	93	0.18902439024390244	74	0.20441988950276244	138	0.24125874125874125	235	0.3100263852242744	t	0.004	-2.351941	0.00217	.	.	ENSG00000221859	ENST00000380095	T	0.09911	2.93	3.09	0.455	0.16649	.	.	.	.	.	T	0.00012	0.0000	N	0.01686	-0.76	0.50313	P	1.3399999999996748E-4	B	0.16166	0.016	B	0.10450	0.005	T	0.45948	-0.9226	8	0.06365	T	0.9	.	5.6129	0.17416	0.0:0.6006:0.0:0.3994	.	30	P60014	KR10A_HUMAN	S	30	ENSP00000369438:C30S	ENSP00000369438:C30S	C	+	1	0	KRTAP10-10	44881850	.	.	0.910000	0.35882	0.005000	0.04900	.	.	-0.062000	0.13088	-0.407000	0.06327	TGC	T|0.746;A|0.254		0.677	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128034.1	NM_181688	
SCARF2	91179	hgsc.bcm.edu	37	22	20780097	20780097	+	Silent	SNP	G	G	C	rs759609		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr22:20780097G>C	ENST00000266214.5	-	11	2285	c.2181C>G	c.(2179-2181)cgC>cgG	p.R727R	SCARF2_ENST00000405555.3_Silent_p.R722R	NM_153334.4	NP_699165.2	Q96GP6	SREC2_HUMAN	scavenger receptor class F, member 2	727	Pro-rich.				cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	10	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GCCCCGGGGGGCGCGGCGTTG	0.781																																					p.R727R		.											.	SCARF2-341	0			c.C2181G						.	C	,	3271,119		1585,101,9	5.0	5.0	5.0		2181,2166	-5.3	0.0	22	dbSNP_86	5	6306,190		3060,186,2	no	coding-synonymous,coding-synonymous	SCARF2	NM_153334.4,NM_182895.2	,	4645,287,11	CC,CG,GG		2.9249,3.5103,3.1256	,	727/871,722/866	20780097	9577,309	1695	3248	4943	SO:0001819	synonymous_variant	91179	exon11			CGGGGGGCGCGGC	AF522196	CCDS13779.1, CCDS46666.1	22q11.21	2011-10-10			ENSG00000244486	ENSG00000244486			19869	protein-coding gene	gene with protein product		613619				12154095	Standard	XM_006724364		Approved	SREC-II, SREC2, HUMZD58C02	uc002zsk.2	Q96GP6	OTTHUMG00000150779	ENST00000266214.5:c.2181C>G	22.37:g.20780097G>C		0	0		7	7	NM_153334	0	0	0	0	0	E5RFB8|Q58A83|Q8IXF3|Q9BW74	Silent	SNP	ENST00000266214.5	37	CCDS13779.1																																																																																			G|0.826;C|0.174		0.781	SCARF2-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320047.1		
MIF	4282	hgsc.bcm.edu	37	22	24237074	24237074	+	Missense_Mutation	SNP	C	C	T	rs182012324	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr22:24237074C>T	ENST00000215754.7	+	2	695	c.224C>T	c.(223-225)tCc>tTc	p.S75F	AP000350.10_ENST00000433835.3_Missense_Mutation_p.P183S|AP000350.4_ENST00000406213.1_3'UTR	NM_002415.1	NP_002406.1	P03971	MIS_HUMAN	macrophage migration inhibitory factor (glycosylation-inhibiting factor)	0					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			urinary_tract(1)	1						CAGAACCGCTCCTACAGCAAG	0.741													c|||	2	0.000399361	0.0	0.0	5008	,	,		9651	0.0		0.001	False		,,,				2504	0.001				p.S75F		.											.	MIF-514	0			c.C224T						.		PHE/SER	0,3942		0,0,1971	3.0	4.0	4.0		224	2.8	0.8	22		4	7,7811		0,7,3902	yes	missense	MIF	NM_002415.1	155	0,7,5873	TT,TC,CC		0.0895,0.0,0.0595	benign	75/116	24237074	7,11753	1971	3909	5880	SO:0001583	missense	4282	exon2			ACCGCTCCTACAG	M25639	CCDS13819.1	22q11.23	2007-04-26			ENSG00000240972	ENSG00000240972			7097	protein-coding gene	gene with protein product		153620		GLIF		7558020, 2552447	Standard	NM_002415		Approved	GIF	uc002zyr.1	P14174	OTTHUMG00000150773	ENST00000215754.7:c.224C>T	22.37:g.24237074C>T	ENSP00000215754:p.Ser75Phe	0	0		24	7	NM_002415	0	0	402	403	1	O75246|Q6GTN3	Missense_Mutation	SNP	ENST00000215754.7	37	CCDS13819.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	N	14.96	2.691564	0.48097	0.0	8.95E-4	ENSG00000240972	ENST00000215754	.	.	.	4.96	2.76	0.32466	Tautomerase (2);	0.780131	0.12276	N	0.483326	T	0.34629	0.0904	L	0.52905	1.665	0.09310	N	0.999996	B	0.30973	0.302	B	0.28553	0.091	T	0.33752	-0.9856	9	0.66056	D	0.02	-14.5498	5.3544	0.16053	0.1511:0.6297:0.1378:0.0814	.	75	P14174	MIF_HUMAN	F	75	.	ENSP00000215754:S75F	S	+	2	0	MIF	22567074	0.023000	0.18921	0.847000	0.33407	0.658000	0.38924	0.867000	0.27968	1.175000	0.42826	0.448000	0.29417	TCC	C|0.999;T|0.000		0.741	MIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320009.1	NM_002415	
TRIOBP	11078	hgsc.bcm.edu	37	22	38122462	38122462	+	Missense_Mutation	SNP	A	A	G	rs739138	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr22:38122462A>G	ENST00000406386.3	+	7	4154	c.3899A>G	c.(3898-3900)cAc>cGc	p.H1300R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1300			H -> R (in dbSNP:rs739138).		actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					GGCCGCACCCACAGCCCTGGC	0.741													G|||	3010	0.601038	0.1944	0.5836	5008	,	,		13399	0.8859		0.7157	False		,,,				2504	0.7515				p.H1300R		.											.	TRIOBP-136	0			c.A3899G						.	G	ARG/HIS	1221,2235		265,691,772	4.0	6.0	5.0		3899	3.9	1.0	22	dbSNP_86	5	5694,1808		2238,1218,295	yes	missense	TRIOBP	NM_001039141.2	29	2503,1909,1067	GG,GA,AA		24.1002,35.3299,36.8954	benign	1300/2366	38122462	6915,4043	1728	3751	5479	SO:0001583	missense	11078	exon7			GCACCCACAGCCC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.3899A>G	22.37:g.38122462A>G	ENSP00000384312:p.His1300Arg	0	0		30	28	NM_001039141	0	0	0	0	0	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	1409	0.6451465201465202	110	0.22357723577235772	222	0.6132596685082873	531	0.9283216783216783	546	0.7203166226912929	G	12.86	2.065195	0.36470	0.353299	0.758998	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.11063	2.81	4.93	3.9	0.45041	.	.	.	.	.	T	0.00012	0.0000	N	0.01576	-0.805	0.09310	P	0.999999999370294	B	0.02656	0.0	B	0.01281	0.0	T	0.29671	-1.0004	8	0.02654	T	1	.	4.383	0.11304	0.2555:0.0:0.5874:0.1571	rs739138	1300	Q9H2D6	TARA_HUMAN	R	1300	ENSP00000384312:H1300R	ENSP00000384312:H1300R	H	+	2	0	TRIOBP	36452408	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	1.338000	0.33873	0.503000	0.28060	-0.366000	0.07423	CAC	A|0.354;G|0.646		0.741	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
BAIAP2L2	80115	broad.mit.edu;bcgsc.ca	37	22	38482353	38482394	+	In_Frame_Del	DEL	TGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	TGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	-	rs371997714|rs66500630|rs113792005|rs376182024|rs541462698|rs369923129|rs553799224	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr22:38482353_38482394delTGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	ENST00000381669.3	-	12	1466_1507	c.1322_1363delTAGCACCCTCGGAGTACTGGGATGGCCAGTCCCGCTCCCGCA	c.(1321-1365)atagcaccctcggagtactgggatggccagtcccgctcccgcacc>acc	p.IAPSEYWDGQSRSR441del	SLC16A8_ENST00000469516.1_5'Flank	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	441					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					CGGCTTGGGGTGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTATGGAGTTGCC	0.674														708	0.141374	0.0272	0.2291	5008	,	,		20774	0.0565		0.1918	False		,,,				2504	0.2689				p.441_455del		.											.	BAIAP2L2-91	0			c.1322_1363del						.			138,3818		23,92,1863						2.2	0.8		dbSNP_130	20	1131,6525		291,549,2988	no	coding	BAIAP2L2	NM_025045.4		314,641,4851	A1A1,A1R,RR		14.7727,3.4884,10.9283				1269,10343				SO:0001651	inframe_deletion	80115	exon12			TTGGGGTGCGGGA	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1322_1363delTAGCACCCTCGGAGTACTGGGATGGCCAGTCCCGCTCCCGCA	22.37:g.38482353_38482394delTGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	ENSP00000371085:p.Ile441_Arg454del	18	0		85	0	NM_025045	0	0	0	0	0	B0QYE2|Q96BG7	In_Frame_Del	DEL	ENST00000381669.3	37	CCDS43018.1																																																																																			.		0.674	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321727.1	NM_025045	
BHLHE40	8553	bcgsc.ca	37	3	5024771	5024771	+	Silent	SNP	T	T	C	rs908078	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:5024771T>C	ENST00000256495.3	+	5	1236	c.633T>C	c.(631-633)ggT>ggC	p.G211G		NM_003670.2	NP_003661.1	O14503	BHE40_HUMAN	basic helix-loop-helix family, member e40	211					circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|MRF binding (GO:0043426)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)	12						CGGCCAAAGGTTCGGAAGGTC	0.592													C|||	791	0.157947	0.0855	0.2435	5008	,	,		17832	0.1915		0.1471	False		,,,				2504	0.1718				p.G211G		.											.	BHLHE40-91	0			c.T633C						.	C		388,4018	786.8+/-414.8	15,358,1830	42.0	46.0	45.0		633	3.8	1.0	3	dbSNP_86	45	1334,7266	752.8+/-407.4	91,1152,3057	no	coding-synonymous	BHLHE40	NM_003670.2		106,1510,4887	CC,CT,TT		15.5116,8.8062,13.24		211/413	5024771	1722,11284	2203	4300	6503	SO:0001819	synonymous_variant	8553	exon5			CAAAGGTTCGGAA	AB004066	CCDS2565.1	3p26	2009-01-12	2009-01-12	2009-01-12	ENSG00000134107	ENSG00000134107		"""Basic helix-loop-helix proteins"""	1046	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 1"", "" differentiated embryo chondrocyte expressed gene 1"""	604256	"""basic helix-loop-helix domain containing, class B, 2"""	STRA13, BHLHB2		9240428, 10449910, 18557763	Standard	NM_003670		Approved	DEC1, bHLHe40	uc003bqf.3	O14503	OTTHUMG00000119035	ENST00000256495.3:c.633T>C	3.37:g.5024771T>C		134	1		108	7	NM_003670	0	0	3	3	0	Q96TD3	Silent	SNP	ENST00000256495.3	37	CCDS2565.1																																																																																			T|0.855;C|0.145		0.592	BHLHE40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239244.2	NM_003670	
TRAK1	22906	broad.mit.edu	37	3	42251607	42251607	+	Intron	DEL	A	A	-			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:42251607delA	ENST00000327628.5	+	14	2363				TRAK1_ENST00000487159.1_Intron|TRAK1_ENST00000341421.3_Frame_Shift_Del_p.E640fs|TRAK1_ENST00000396175.1_Intron	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						gaggaggaggaggGGTCTGGT	0.622																																					p.E698fs	GBM(44;195 884 22595 31865 41850)	.											.	TRAK1-91	0			c.2093delA						.						93.0	102.0	99.0					3																	42251607		2203	4299	6502	SO:0001627	intron_variant	22906	exon14			AGGAGGAGGGGTC		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1963+130A>-	3.37:g.42251607delA		93	0		82	9	NM_001265608	0	0	0	0	0	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Frame_Shift_Del	DEL	ENST00000327628.5	37	CCDS43072.1																																																																																			.		0.622	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
TRAK1	22906	broad.mit.edu	37	3	42251611	42251612	+	Intron	DEL	GT	GT	-			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:42251611_42251612delGT	ENST00000327628.5	+	14	2363				TRAK1_ENST00000487159.1_Intron|TRAK1_ENST00000341421.3_Frame_Shift_Del_p.S642fs|TRAK1_ENST00000396175.1_Intron	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						aggaggaggGGTCTGGTGAGGG	0.624																																					p.699_700del	GBM(44;195 884 22595 31865 41850)	.											.	TRAK1-91	0			c.2097_2098del						.																																			SO:0001627	intron_variant	22906	exon14			GGAGGGGTCTGGT		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1963+134GT>-	3.37:g.42251611_42251612delGT		103	0		86	9	NM_001265608	0	0	0	0	0	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Frame_Shift_Del	DEL	ENST00000327628.5	37	CCDS43072.1																																																																																			.		0.624	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
DHX30	22907	broad.mit.edu	37	3	47888819	47888819	+	Silent	SNP	C	C	T	rs114902473	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:47888819C>T	ENST00000445061.1	+	12	2393	c.1986C>T	c.(1984-1986)atC>atT	p.I662I	DHX30_ENST00000348968.4_Silent_p.I634I|MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000446256.2_Silent_p.I623I|DHX30_ENST00000457607.1_Silent_p.I690I	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	662	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		TTCTGCACATCGATGCTCGCG	0.607													C|||	14	0.00279553	0.0038	0.0043	5008	,	,		20354	0.0		0.004	False		,,,				2504	0.002				p.I662I		.											.	DHX30-228	0			c.C1986T						.	C	,	9,4397	15.5+/-35.6	0,9,2194	177.0	144.0	155.0		1869,1986	-5.0	0.9	3	dbSNP_132	155	21,8579	14.0+/-48.4	0,21,4279	no	coding-synonymous,coding-synonymous	DHX30	NM_014966.3,NM_138615.2	,	0,30,6473	TT,TC,CC		0.2442,0.2043,0.2307	,	623/1156,662/1195	47888819	30,12976	2203	4300	6503	SO:0001819	synonymous_variant	22907	exon12			GCACATCGATGCT	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1986C>T	3.37:g.47888819C>T		249	0		212	6	NM_138615	0	0	21	21	0	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Silent	SNP	ENST00000445061.1	37	CCDS2759.1																																																																																			C|0.998;T|0.002		0.607	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
IFRD2	7866	broad.mit.edu	37	3	50325647	50325647	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:50325647C>T	ENST00000429673.2	-	12	1495	c.1496G>A	c.(1495-1497)cGg>cAg	p.R499Q	IFRD2_ENST00000436390.1_Missense_Mutation_p.R435Q|IFRD2_ENST00000484043.1_5'Flank|IFRD2_ENST00000417626.2_Missense_Mutation_p.R435Q|IFRD2_ENST00000336089.4_Missense_Mutation_p.R601Q			Q12894	IFRD2_HUMAN	interferon-related developmental regulator 2	499						nucleus (GO:0005634)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCGCTTGTCCCGCACACGGCT	0.557																																					p.R499Q		.											.	IFRD2-212	0			c.G1496A						.						38.0	40.0	39.0					3																	50325647		1973	4155	6128	SO:0001583	missense	7866	exon12			TTGTCCCGCACAC	U09585		3p21.3	2008-07-18			ENSG00000214706	ENSG00000214706			5457	protein-coding gene	gene with protein product	"""interferon-related protein"""	602725				9050919	Standard	NM_006764		Approved	SKMc15, SM15, IFNRP	uc011bdp.2	Q12894	OTTHUMG00000156935	ENST00000429673.2:c.1496G>A	3.37:g.50325647C>T	ENSP00000398971:p.Arg499Gln	110	0		77	4	NM_006764	0	0	36	37	1	Q9BVB4|Q9UJ88	Missense_Mutation	SNP	ENST00000429673.2	37	CCDS46831.1	.	.	.	.	.	.	.	.	.	.	C	34	5.292050	0.95546	.	.	ENSG00000214706	ENST00000417626;ENST00000426499;ENST00000436390;ENST00000336089;ENST00000429673	D;D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71;-1.71	5.93	5.06	0.68205	Interferon-related developmental regulator, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92136	0.7507	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.93388	0.6749	10	0.87932	D	0	-19.2583	12.979	0.58554	0.0:0.9225:0.0:0.0775	.	499;601	Q12894;Q9UJ88	IFRD2_HUMAN;.	Q	435;64;435;601;499	ENSP00000402849:R435Q;ENSP00000408549:R64Q;ENSP00000392316:R435Q;ENSP00000336936:R601Q;ENSP00000398971:R499Q	ENSP00000336936:R601Q	R	-	2	0	IFRD2	50300651	1.000000	0.71417	0.910000	0.35882	0.993000	0.82548	7.252000	0.78309	1.538000	0.49270	0.655000	0.94253	CGG	.		0.557	IFRD2-202	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_006764	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	0	0		5	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		7	7	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
SEMA5B	54437	hgsc.bcm.edu	37	3	122631896	122631896	+	Missense_Mutation	SNP	A	A	T	rs2276782	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:122631896A>T	ENST00000357599.3	-	18	2905	c.2519T>A	c.(2518-2520)gTc>gAc	p.V840D	SEMA5B_ENST00000195173.4_Missense_Mutation_p.V839D|SEMA5B_ENST00000451055.2_Missense_Mutation_p.V894D	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	840			V -> D (in dbSNP:rs2276782). {ECO:0000269|PubMed:10819331, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.		cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCGCAGGAGGACCTCCACCAG	0.791													T|||	3010	0.601038	0.5348	0.621	5008	,	,		11243	0.3522		0.8082	False		,,,				2504	0.7198				p.V894D		.											.	SEMA5B-157	0			c.T2681A						.	T	ASP/VAL	2573,1477		827,919,279	4.0	5.0	5.0		2519	5.0	1.0	3	dbSNP_100	5	6625,1195		2828,969,113	no	missense	SEMA5B	NM_001031702.2	152	3655,1888,392	TT,TA,AA		15.2813,36.4691,22.5105	benign	840/1152	122631896	9198,2672	2025	3910	5935	SO:0001583	missense	54437	exon18			AGGAGGACCTCCA	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2519T>A	3.37:g.122631896A>T	ENSP00000350215:p.Val840Asp	1	0		22	12	NM_001256347	0	0	0	0	0	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	1286	0.5888278388278388	247	0.5020325203252033	243	0.6712707182320442	193	0.3374125874125874	603	0.7955145118733509	T	5.344	0.248763	0.10130	0.635309	0.847187	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.34072	1.43;1.38;1.48;1.5	5.01	5.01	0.66863	.	0.161766	0.52532	N	0.000069	T	0.00012	0.0000	N	0.00246	-1.78	0.30182	P	0.8002819999999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39354	-0.9618	9	0.02654	T	1	.	10.6514	0.45651	0.1435:0.0:0.0:0.8565	rs2276782	782;840	D3YTI7;Q9P283	.;SEM5B_HUMAN	D	840;839;782;894;840	ENSP00000350215:V840D;ENSP00000195173:V839D;ENSP00000389588:V894D;ENSP00000377208:V840D	ENSP00000195173:V839D	V	-	2	0	SEMA5B	124114586	1.000000	0.71417	0.990000	0.47175	0.785000	0.44390	4.886000	0.63149	0.945000	0.37605	-0.257000	0.10917	GTC	T|0.412;A|0.588		0.791	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
ADCY5	111	hgsc.bcm.edu	37	3	123167249	123167249	+	Silent	SNP	G	G	A	rs4678027	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:123167249G>A	ENST00000462833.1	-	1	1356	c.144C>T	c.(142-144)ggC>ggT	p.G48G		NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	48					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CGCGGGCAGAGCCCCCGGGGG	0.756													A|||	4941	0.986621	0.9501	0.9986	5008	,	,		7224	1.0		1.0	False		,,,				2504	1.0				p.G48G		.											.	ADCY5-94	0			c.C144T						.	A		2646,76		1285,76,0	2.0	2.0	2.0		144	-2.7	0.8	3	dbSNP_111	2	5980,0		2990,0,0	no	coding-synonymous	ADCY5	NM_183357.2		4275,76,0	AA,AG,GG		0.0,2.7921,0.8734		48/1262	123167249	8626,76	1361	2990	4351	SO:0001819	synonymous_variant	111	exon1			GGCAGAGCCCCCG	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.144C>T	3.37:g.123167249G>A		0	0		10	10	NM_183357	0	0	0	0	0	B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	37	CCDS3022.1																																																																																			G|0.028;A|0.972		0.756	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355889.4	XM_171048	
CHST13	166012	hgsc.bcm.edu	37	3	126260995	126260995	+	Silent	SNP	C	C	T	rs7614066	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:126260995C>T	ENST00000319340.2	+	3	650	c.600C>T	c.(598-600)taC>taT	p.Y200Y		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	200					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		AGAGGCGCTACGGTGCACGCA	0.721													C|||	273	0.0545128	0.1248	0.0288	5008	,	,		7896	0.002		0.0258	False		,,,				2504	0.0613				p.Y200Y		.											.	CHST13-90	0			c.C600T						.	C		331,3793		10,311,1741	6.0	7.0	6.0		600	-5.3	0.2	3	dbSNP_116	6	189,7819		2,185,3817	no	coding-synonymous	CHST13	NM_152889.2		12,496,5558	TT,TC,CC		2.3601,8.0262,4.2862		200/342	126260995	520,11612	2062	4004	6066	SO:0001819	synonymous_variant	166012	exon3			GCGCTACGGTGCA	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.600C>T	3.37:g.126260995C>T		0	0		28	18	NM_152889	0	0	0	0	0	Q3SYA3|Q3SYA5	Silent	SNP	ENST00000319340.2	37	CCDS3039.1																																																																																			C|0.956;T|0.044		0.721	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370201.2	NM_152889	
EFCC1	79825	broad.mit.edu	37	3	128751736	128751736	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:128751736T>G	ENST00000480450.1	+	4	1210	c.1210T>G	c.(1210-1212)Tgg>Ggg	p.W404G	EFCC1_ENST00000436022.2_5'UTR			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	404							calcium ion binding (GO:0005509)										ggaggagaggtggcaggagga	0.677																																					p.W404G		.											.	.	0			c.T1210G						.						46.0	60.0	56.0					3																	128751736		692	1591	2283	SO:0001583	missense	79825	exon4			GAGAGGTGGCAGG	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.1210T>G	3.37:g.128751736T>G	ENSP00000420075:p.Trp404Gly	91	7		331	24	NM_024768	0	0	0	0	0	A8MYE2	Missense_Mutation	SNP	ENST00000480450.1	37	CCDS3054.2	.	.	.	.	.	.	.	.	.	.	T	10.69	1.420448	0.25639	.	.	ENSG00000114654	ENST00000480450	T	0.50813	0.73	4.87	4.87	0.63330	.	.	.	.	.	T	0.61937	0.2387	L	0.61218	1.895	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.58880	-0.7558	9	0.23302	T	0.38	.	12.4271	0.55553	0.0:0.0:0.0:1.0	.	404	Q9HA90	CCD48_HUMAN	G	404	ENSP00000420075:W404G	ENSP00000420075:W404G	W	+	1	0	CCDC48	130234426	1.000000	0.71417	0.764000	0.31436	0.140000	0.21249	3.471000	0.53107	1.811000	0.52892	0.482000	0.46254	TGG	.		0.677	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000352832.1	NM_024768	
SI	6476	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	164783069	164783069	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:164783069G>A	ENST00000264382.3	-	7	849	c.787C>T	c.(787-789)Cga>Tga	p.R263*		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	263	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AGTTGGTCTCGAGTAAAAATT	0.323										HNSCC(35;0.089)																											p.R263X		.											.	SI-104	0			c.C787T						.						69.0	68.0	69.0					3																	164783069		2203	4300	6503	SO:0001587	stop_gained	6476	exon7			GGTCTCGAGTAAA	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.787C>T	3.37:g.164783069G>A	ENSP00000264382:p.Arg263*	154	1		211	96	NM_001041	0	0	0	0	0	A2RUC3|Q1JQ80|Q1RMC2	Nonsense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	37	6.410972	0.97546	.	.	ENSG00000090402	ENST00000264382	.	.	.	5.9	4.05	0.47172	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6002	0.68435	0.0:0.0:0.5091:0.4909	.	.	.	.	X	263	.	ENSP00000264382:R263X	R	-	1	2	SI	166265763	1.000000	0.71417	0.963000	0.40424	0.885000	0.51271	2.884000	0.48562	0.780000	0.33566	0.650000	0.86243	CGA	.		0.323	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
TNK2	10188	hgsc.bcm.edu	37	3	195595405	195595405	+	Silent	SNP	G	G	A	rs1056726	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr3:195595405G>A	ENST00000333602.6	-	12	2336	c.1719C>T	c.(1717-1719)ttC>ttT	p.F573F	TNK2_ENST00000381916.2_Silent_p.F651F|TNK2_ENST00000428187.1_Silent_p.F605F|TNK2_ENST00000392400.1_Silent_p.F573F	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	573				Missing (in Ref. 4; AAH08884). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GCTCCTCACCGAAGTCGATGA	0.746													a|||	310	0.061901	0.0847	0.0259	5008	,	,		10834	0.0704		0.0467	False		,,,				2504	0.0634				p.F651F		.											.	TNK2-957	0			c.C1953T						.		,	269,3657		9,251,1703	5.0	6.0	6.0		1953,1719	-5.7	0.0	3	dbSNP_86	6	322,7600		4,314,3643	no	coding-synonymous,coding-synonymous	TNK2	NM_001010938.1,NM_005781.4	,	13,565,5346	AA,AG,GG		4.0646,6.8518,4.9882	,	651/1087,573/1039	195595405	591,11257	1963	3961	5924	SO:0001819	synonymous_variant	10188	exon13			CTCACCGAAGTCG	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.1719C>T	3.37:g.195595405G>A		0	0		12	9	NM_001010938	0	0	3	5	2	Q6ZMQ0|Q8N6U7|Q96H59	Silent	SNP	ENST00000333602.6	37	CCDS33928.1	134	0.06135531135531135	38	0.07723577235772358	10	0.027624309392265192	53	0.09265734265734266	33	0.04353562005277045	A	0.025	-1.382365	0.01204	0.068518	0.040646	ENSG00000061938	ENST00000424563	.	.	.	5.41	-5.74	0.02391	.	.	.	.	.	T	0.06096	0.0158	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56288	-0.8004	4	.	.	.	.	15.998	0.80265	0.6944:0.0:0.3056:0.0	rs1056726;rs3197336;rs57297005	.	.	.	L	183	.	.	S	-	2	0	TNK2	197079802	0.028000	0.19301	0.045000	0.18777	0.071000	0.16799	-0.555000	0.05999	-1.423000	0.02002	-2.075000	0.00382	TCG	G|0.936;A|0.064		0.746	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		0	0		116	30	NM_175918	0	0	6	29	23	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
FAM184B	27146	hgsc.bcm.edu	37	4	17643848	17643848	+	Missense_Mutation	SNP	G	G	A	rs2286771	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:17643848G>A	ENST00000265018.3	-	13	2562	c.2350C>T	c.(2350-2352)Cgg>Tgg	p.R784W		NM_015688.1	NP_056503.1	Q9ULE4	F184B_HUMAN	family with sequence similarity 184, member B	784				R -> W (in Ref. 1; BAA86590). {ECO:0000305}.						NS(1)|central_nervous_system(1)|endometrium(1)|prostate(1)	4						GGGCCGCCCCGCTCCTGAGGA	0.701													G|||	2697	0.538538	0.1725	0.6599	5008	,	,		10215	0.8522		0.6233	False		,,,				2504	0.5368				p.R784W		.											.	FAM184B-23	0			c.C2350T						.						1.0	2.0	2.0					4																	17643848		374	1044	1418	SO:0001583	missense	27146	exon13			CGCCCCGCTCCTG		CCDS47033.1	4p16	2009-04-22			ENSG00000047662	ENSG00000047662			29235	protein-coding gene	gene with protein product						10574462	Standard	NM_015688		Approved	KIAA1276	uc003gpm.4	Q9ULE4	OTTHUMG00000160287	ENST00000265018.3:c.2350C>T	4.37:g.17643848G>A	ENSP00000265018:p.Arg784Trp	0	0		21	21	NM_015688	0	0	0	0	0		Missense_Mutation	SNP	ENST00000265018.3	37	CCDS47033.1	1272	0.5824175824175825	75	0.1524390243902439	232	0.6408839779005525	493	0.8618881118881119	472	0.6226912928759895	G	13.83	2.354233	0.41700	.	.	ENSG00000047662	ENST00000265018	T	0.34072	1.38	3.29	-3.67	0.04476	.	3.541600	0.00901	N	0.002342	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	D	0.56968	0.978	B	0.40741	0.339	T	0.48547	-0.9026	9	0.72032	D	0.01	2.0681	6.7491	0.23477	0.107:0.2547:0.5506:0.0877	rs2286771;rs58699512;rs2286771	784	Q9ULE4	F184B_HUMAN	W	784	ENSP00000265018:R784W	ENSP00000265018:R784W	R	-	1	2	FAM184B	17252946	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.323000	0.07997	-1.014000	0.03379	-0.369000	0.07265	CGG	G|0.440;A|0.560		0.701	FAM184B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360137.1	NM_015688	
ZAR1	326340	hgsc.bcm.edu	37	4	48492769	48492769	+	Missense_Mutation	SNP	A	A	T	rs74929644	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:48492769A>T	ENST00000327939.4	+	1	501	c.461A>T	c.(460-462)cAg>cTg	p.Q154L		NM_175619.1	NP_783318.1	Q86SH2	ZAR1_HUMAN	zygote arrest 1	154					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)	5						TTCTCCCAGCAGCCATCCCGT	0.781													A|||	1944	0.388179	0.171	0.572	5008	,	,		7581	0.4454		0.5089	False		,,,				2504	0.3681				p.Q154L		.											.	ZAR1-90	0			c.A461T						.	A	LEU/GLN	483,2381		61,361,1010	4.0	4.0	4.0		461	-6.2	0.0	4	dbSNP_131	4	2428,3758		540,1348,1205	no	missense	ZAR1	NM_175619.1	113	601,1709,2215	TT,TA,AA		39.2499,16.8645,32.1657	benign	154/425	48492769	2911,6139	1432	3093	4525	SO:0001583	missense	326340	exon1			CCCAGCAGCCATC	AY193890	CCDS3483.1	4p11	2014-02-20			ENSG00000182223	ENSG00000182223			20436	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 6"""	607520				12539046	Standard	NM_175619		Approved	Z3CXXC6	uc003gyd.3	Q86SH2	OTTHUMG00000102093	ENST00000327939.4:c.461A>T	4.37:g.48492769A>T	ENSP00000329803:p.Gln154Leu	0	0		8	8	NM_175619	0	0	0	0	0		Missense_Mutation	SNP	ENST00000327939.4	37	CCDS3483.1	979	0.4482600732600733	95	0.19308943089430894	212	0.585635359116022	288	0.5034965034965035	384	0.5065963060686016	A	12.09	1.834066	0.32421	0.168645	0.392499	ENSG00000182223	ENST00000327939	.	.	.	3.61	-6.17	0.02091	.	.	.	.	.	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.49194	-0.8965	7	0.25751	T	0.34	.	0.9878	0.01450	0.443:0.2168:0.1793:0.1609	.	154	Q86SH2	ZAR1_HUMAN	L	154	.	ENSP00000329803:Q154L	Q	+	2	0	ZAR1	48187526	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.738000	0.04871	-0.489000	0.06716	-0.680000	0.03767	CAG	A|0.552;T|0.448		0.781	ZAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219927.3		
MUC7	4589	bcgsc.ca	37	4	71347240	71347240	+	Missense_Mutation	SNP	T	T	C	rs145745951	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:71347240T>C	ENST00000304887.5	+	3	969	c.779T>C	c.(778-780)gTc>gCc	p.V260A	MUC7_ENST00000456088.1_Missense_Mutation_p.V260A|MUC7_ENST00000413702.1_Missense_Mutation_p.V260A	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	260	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.V260A(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCACAGCTGTCCCACCCACA	0.587													C|||	16	0.00319489	0.0038	0.0029	5008	,	,		19991	0.0		0.008	False		,,,				2504	0.001				p.V260A		.											.	MUC7-93	1	Substitution - Missense(1)	skin(1)	c.T779C						.						521.0	441.0	468.0					4																	71347240		2201	4300	6501	SO:0001583	missense	4589	exon4			CAGCTGTCCCACC	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.779T>C	4.37:g.71347240T>C	ENSP00000302021:p.Val260Ala	382	29		537	49	NM_001145007	0	0	0	0	0	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	ENST00000304887.5	37	CCDS3541.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.737530	0.00681	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.44482	0.92;0.92;0.92	1.11	-2.23	0.06930	.	.	.	.	.	T	0.13543	0.0328	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20438	-1.0275	8	.	.	.	.	3.5881	0.07978	0.0:0.2514:0.2169:0.5317	.	260	Q8TAX7	MUC7_HUMAN	A	260	ENSP00000407422:V260A;ENSP00000400585:V260A;ENSP00000302021:V260A	.	V	+	2	0	MUC7	71381829	0.000000	0.05858	0.003000	0.11579	0.040000	0.13550	-0.078000	0.11375	-1.146000	0.02854	-0.330000	0.08379	GTC	T|1.000;C|0.000		0.587	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252168.2	NM_152291	
SLC4A4	8671	broad.mit.edu	37	4	72215748	72215748	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:72215748T>C	ENST00000264485.5	+	5	626	c.509T>C	c.(508-510)aTc>aCc	p.I170T	SLC4A4_ENST00000340595.3_Missense_Mutation_p.I126T|SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000425175.1_Missense_Mutation_p.I170T|SLC4A4_ENST00000512686.1_Missense_Mutation_p.I126T|SLC4A4_ENST00000351898.6_Missense_Mutation_p.I170T	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	170					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	AAAGGATCCATCATGCTTGAT	0.463																																					p.I170T		.											.	SLC4A4-95	0			c.T509C						.						188.0	173.0	178.0					4																	72215748		2203	4300	6503	SO:0001583	missense	8671	exon5			GATCCATCATGCT	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.509T>C	4.37:g.72215748T>C	ENSP00000264485:p.Ile170Thr	75	2		140	4	NM_001098484	0	0	0	0	0	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	ENST00000264485.5	37	CCDS43236.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.728732	0.89390	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898;ENST00000512686;ENST00000340595	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	5.64	5.64	0.86602	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	T	0.81202	0.4773	M	0.73319	2.225	0.80722	D	1	P;D;P;D;P;P	0.76494	0.898;0.984;0.938;0.999;0.898;0.949	P;P;P;D;P;D	0.87578	0.883;0.712;0.882;0.998;0.881;0.911	D	0.83447	0.0046	10	0.87932	D	0	.	15.8582	0.79000	0.0:0.0:0.0:1.0	.	170;170;126;126;150;170	A5JJ20;Q9Y6R1-4;Q9Y6R1-2;Q9Y6R1-3;Q9Y6R3;Q9Y6R1	.;.;.;.;.;S4A4_HUMAN	T	170;170;170;126;126	ENSP00000264485:I170T;ENSP00000393557:I170T;ENSP00000307349:I170T;ENSP00000422400:I126T;ENSP00000344272:I126T	ENSP00000264485:I170T	I	+	2	0	SLC4A4	72434612	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.013000	0.88655	2.136000	0.66102	0.455000	0.32223	ATC	.		0.463	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362090.1	NM_003759	
C4orf32	132720	hgsc.bcm.edu	37	4	113066831	113066831	+	Missense_Mutation	SNP	G	G	A	rs10002700	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:113066831G>A	ENST00000309733.5	+	1	279	c.95G>A	c.(94-96)gGg>gAg	p.G32E		NM_152400.2	NP_689613.1	Q8N8J7	CD032_HUMAN	chromosome 4 open reading frame 32	32				G -> E (in Ref. 1; BAC04841 and 3; AAH22534). {ECO:0000305}.		integral component of membrane (GO:0016021)							Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.00198)		gcagggaccgggtgggatccc	0.806													A|||	5004	0.999201	1.0	1.0	5008	,	,		5782	1.0		0.996	False		,,,				2504	1.0				p.G32E		.											.	C4orf32-90	0			c.G95A						.	A	GLU/GLY	2990,0		1495,0,0	3.0	5.0	4.0		95	2.0	0.1	4	dbSNP_119	4	6170,26		3072,26,0	no	missense	C4orf32	NM_152400.2	98	4567,26,0	AA,AG,GG		0.4196,0.0,0.283	benign	32/133	113066831	9160,26	1495	3098	4593	SO:0001583	missense	132720	exon1			GGACCGGGTGGGA	AK096689	CCDS3695.1	4q25	2008-02-05			ENSG00000174749	ENSG00000174749			26813	protein-coding gene	gene with protein product						12477932	Standard	NM_152400		Approved	FLJ39370	uc003iah.2	Q8N8J7	OTTHUMG00000132851	ENST00000309733.5:c.95G>A	4.37:g.113066831G>A	ENSP00000310182:p.Gly32Glu	0	0		6	6	NM_152400	0	0	0	4	4	Q49A91|Q4W5C7|Q8TBF9	Missense_Mutation	SNP	ENST00000309733.5	37	CCDS3695.1	2136	0.978021978021978	469	0.9532520325203252	355	0.9806629834254144	563	0.9842657342657343	749	0.9881266490765171	A	0.015	-1.569980	0.00895	1.0	0.995804	ENSG00000174749	ENST00000309733	T	0.42513	0.97	3.18	2.02	0.26589	.	0.619595	0.14277	N	0.329768	T	0.00012	0.0000	N	0.00538	-1.39	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32561	-0.9902	9	0.02654	T	1	-1.079	4.6216	0.12455	0.712:0.0:0.288:0.0	rs10002700;rs17845705;rs17858649	32	Q8N8J7	CD032_HUMAN	E	32	ENSP00000310182:G32E	ENSP00000310182:G32E	G	+	2	0	C4orf32	113286280	0.547000	0.26465	0.070000	0.20053	0.008000	0.06430	0.688000	0.25422	0.414000	0.25790	-0.893000	0.02921	GGG	G|0.022;A|0.978		0.806	C4orf32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256325.2	NM_152400	
SEC24D	9871	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	119653957	119653957	+	Missense_Mutation	SNP	C	C	G			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:119653957C>G	ENST00000280551.6	-	20	2845	c.2607G>C	c.(2605-2607)caG>caC	p.Q869H	SEC24D_ENST00000379735.5_Missense_Mutation_p.Q870H|SEC24D_ENST00000511481.1_Missense_Mutation_p.Q500H|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000429811.2_3'UTR			O94855	SC24D_HUMAN	SEC24 family member D	869					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						CCAGCTGTCTCTGGTATGCTC	0.468																																					p.Q869H		.											.	SEC24D-90	0			c.G2607C						.						191.0	155.0	167.0					4																	119653957		2203	4300	6503	SO:0001583	missense	9871	exon20			CTGTCTCTGGTAT	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.2607G>C	4.37:g.119653957C>G	ENSP00000280551:p.Gln869His	256	1		366	75	NM_014822	0	0	11	13	2	Q8IYI7	Missense_Mutation	SNP	ENST00000280551.6	37	CCDS3710.1	.	.	.	.	.	.	.	.	.	.	C	10.96	1.497399	0.26861	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000511481	D;D;D	0.89415	-2.51;-2.51;-2.51	5.62	4.77	0.60923	Sec23/Sec24, helical domain (2);	0.109922	0.64402	D	0.000004	T	0.78046	0.4222	N	0.25485	0.75	0.80722	D	1	B;B;B	0.22146	0.065;0.025;0.012	B;B;B	0.17979	0.018;0.02;0.014	T	0.68232	-0.5463	10	0.15066	T	0.55	-15.1842	5.7101	0.17931	0.1172:0.5399:0.2679:0.075	.	31;870;869	Q9NWP5;O94855-2;O94855	.;.;SC24D_HUMAN	H	869;870;500	ENSP00000280551:Q869H;ENSP00000369059:Q870H;ENSP00000425491:Q500H	ENSP00000280551:Q869H	Q	-	3	2	SEC24D	119873405	0.981000	0.34729	0.942000	0.38095	0.799000	0.45148	0.691000	0.25467	1.343000	0.45638	0.591000	0.81541	CAG	.		0.468	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256514.4		
FRG1	2483	bcgsc.ca	37	4	190876283	190876283	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:190876283C>A	ENST00000226798.4	+	5	631	c.409C>A	c.(409-411)Caa>Aaa	p.Q137K	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	137					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ACCAAGAGAACAATGGGAACC	0.353																																					p.Q137K		.											.	FRG1-90	0			c.C409A						.						88.0	87.0	87.0					4																	190876283		2203	4300	6503	SO:0001583	missense	2483	exon5			AGAGAACAATGGG	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.409C>A	4.37:g.190876283C>A	ENSP00000226798:p.Gln137Lys	284	7		328	21	NM_004477	0	0	128	128	0	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	16.72	3.202137	0.58234	.	.	ENSG00000109536	ENST00000226798;ENST00000531991	T;T	0.49139	2.03;0.79	4.04	4.04	0.47022	Actin cross-linking (1);	0.103449	0.64402	D	0.000002	T	0.54902	0.1887	M	0.88377	2.95	0.80722	D	1	B	0.11235	0.004	B	0.15484	0.013	T	0.60078	-0.7333	10	0.42905	T	0.14	-3.5101	14.1451	0.65347	0.0:1.0:0.0:0.0	.	137	Q14331	FRG1_HUMAN	K	137;74	ENSP00000226798:Q137K;ENSP00000435943:Q74K	ENSP00000226798:Q137K	Q	+	1	0	FRG1	191113277	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.292000	0.78731	1.964000	0.57103	0.567000	0.79289	CAA	.		0.353	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
IRX4	50805	hgsc.bcm.edu	37	5	1882129	1882129	+	Silent	SNP	T	T	G	rs2232374	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr5:1882129T>G	ENST00000505790.1	-	3	546	c.90A>C	c.(88-90)ggA>ggC	p.G30G	IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000231357.2_Silent_p.G30G|IRX4_ENST00000513692.1_Silent_p.G30G|CTD-2194D22.3_ENST00000506335.1_RNA	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	30					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		GCGTGCGGCCTCCGGACTCGC	0.741													N|||	1389	0.277356	0.2821	0.3141	5008	,	,		10764	0.3313		0.2177	False		,,,				2504	0.2505				p.G30G		.											.	IRX4-226	0			c.A90C						.			440,2456		29,382,1037	2.0	2.0	2.0		90	-2.3	0.0	5	dbSNP_98	2	967,5425		81,805,2310	no	coding-synonymous	IRX4	NM_016358.2		110,1187,3347	GG,GT,TT		15.1283,15.1934,15.1486		30/520	1882129	1407,7881	1448	3196	4644	SO:0001819	synonymous_variant	50805	exon2			GCGGCCTCCGGAC	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.90A>C	5.37:g.1882129T>G		0	0		5	4	NM_016358	0	0	0	0	0	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	37	CCDS3867.1																																																																																			T|0.735;G|0.265		0.741	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
ICE1	23379	broad.mit.edu	37	5	5460838	5460838	+	Missense_Mutation	SNP	G	G	T	rs376649755		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr5:5460838G>T	ENST00000296564.7	+	13	1613	c.1391G>T	c.(1390-1392)tGg>tTg	p.W464L		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		464					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GAAAAACACTGGACCACAGCA	0.408																																					p.W464L		.											.	KIAA0947-48	0			c.G1391T						.						82.0	77.0	79.0					5																	5460838		1955	4148	6103	SO:0001583	missense	23379	exon13			AACACTGGACCAC																												ENST00000296564.7:c.1391G>T	5.37:g.5460838G>T	ENSP00000296564:p.Trp464Leu	157	1		222	5	NM_015325	0	0	4	4	0	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	37	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284333	0.40394	.	.	ENSG00000164151	ENST00000296564	T	0.09350	2.99	4.38	-2.26	0.06867	.	1.790160	0.02693	N	0.110853	T	0.06962	0.0177	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.35699	-0.9778	10	0.27785	T	0.31	-2.5564	6.4907	0.22113	0.0:0.3043:0.2167:0.4789	.	464	Q9Y2F5	K0947_HUMAN	L	464	ENSP00000296564:W464L	ENSP00000296564:W464L	W	+	2	0	KIAA0947	5513838	0.000000	0.05858	0.000000	0.03702	0.917000	0.54804	-0.347000	0.07750	-0.291000	0.09012	0.305000	0.20034	TGG	.		0.408	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
SLCO4C1	353189	broad.mit.edu;bcgsc.ca	37	5	101592982	101592982	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr5:101592982G>A	ENST00000310954.6	-	8	1592	c.1306C>T	c.(1306-1308)Caa>Taa	p.Q436*		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		CCTAAAATTTGACCGAGAGCA	0.378																																					p.Q436X		.											.	SLCO4C1-93	0			c.C1306T						.						67.0	69.0	69.0					5																	101592982		2203	4300	6503	SO:0001587	stop_gained	353189	exon8			AAATTTGACCGAG	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1306C>T	5.37:g.101592982G>A	ENSP00000309741:p.Gln436*	145	0		313	12	NM_180991	0	0	0	0	0		Nonsense_Mutation	SNP	ENST00000310954.6	37	CCDS34205.1	.	.	.	.	.	.	.	.	.	.	G	40	8.314168	0.98754	.	.	ENSG00000173930	ENST00000310954	.	.	.	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	19.9918	0.97368	0.0:0.0:1.0:0.0	.	.	.	.	X	436	.	ENSP00000309741:Q436X	Q	-	1	0	SLCO4C1	101620881	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	6.960000	0.76036	2.728000	0.93425	0.585000	0.79938	CAA	.		0.378	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370332.1	NM_180991	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	0	0		9	9	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
CDKL3	51265	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	133640095	133640095	+	Splice_Site	SNP	C	C	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr5:133640095C>A	ENST00000265334.4	-	11	1740		c.e11+1		CDKL3_ENST00000435240.2_Splice_Site|CDKL3_ENST00000521118.1_Splice_Site|CDKL3_ENST00000523054.1_Splice_Site|CTD-2410N18.4_ENST00000518409.1_RNA|CDKL3_ENST00000536186.1_Splice_Site|CDKL3_ENST00000609383.1_Splice_Site|CDKL3_ENST00000609654.1_Splice_Site	NM_001113575.1	NP_001107047.1	Q8IVW4	CDKL3_HUMAN	cyclin-dependent kinase-like 3						cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(3)	11			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CAAATGTGTACCTTCCATTCC	0.294																																					.		.											.	CDKL3-389	0			c.1621+1G>T						.						146.0	124.0	131.0					5																	133640095		1568	3582	5150	SO:0001630	splice_region_variant	51265	exon12			TGTGTACCTTCCA	AF130372	CCDS47264.1, CCDS47265.1, CCDS75303.1	5q31.1	2014-09-09			ENSG00000006837	ENSG00000006837	2.7.11.22	"""Cyclin-dependent kinases"""	15483	protein-coding gene	gene with protein product	"""serine-threonine protein kinase NKIAMRE"""	608459				10463609	Standard	NM_016508		Approved	NKIAMRE	uc003kzf.4	Q8IVW4	OTTHUMG00000186341	ENST00000265334.4:c.1621+1G>T	5.37:g.133640095C>A		68	0		126	40	NM_001113575	0	0	0	0	0	D3DQA0|D3DQA1|Q9P114	Splice_Site	SNP	ENST00000265334.4	37	CCDS47264.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.537720	0.27475	.	.	ENSG00000006837	ENST00000536186;ENST00000435240;ENST00000265334;ENST00000518990;ENST00000523054;ENST00000521118	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8601	0.86016	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CDKL3	133667994	1.000000	0.71417	1.000000	0.80357	0.249000	0.25844	4.339000	0.59322	2.716000	0.92895	0.655000	0.94253	.	.		0.294	CDKL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377697.1	NM_001113575	Intron
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		0	0		14	14	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086070	5086070	+	Silent	SNP	A	A	G	rs667752		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr6:5086070A>G	ENST00000405617.2	+	1	351	c.351A>G	c.(349-351)gcA>gcG	p.A117A		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	117					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						CGGAGGACGCACAGCTCGGCC	0.692													G|||	5008	1.0	1.0	1.0	5008	,	,		12505	1.0		1.0	False		,,,				2504	1.0				p.A117A		.											.	PPP1R3G-136	0			c.A351G						.						1.0	2.0	2.0					6																	5086070		400	1062	1462	SO:0001819	synonymous_variant	648791	exon1			GGACGCACAGCTC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.351A>G	6.37:g.5086070A>G		0	0		14	14	NM_001145115	0	0	0	4	4		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			A|0.006;G|0.994		0.692	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
PPP1R3G	648791	hgsc.bcm.edu	37	6	5086211	5086211	+	Silent	SNP	G	G	C	rs584962		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr6:5086211G>C	ENST00000405617.2	+	1	492	c.492G>C	c.(490-492)ctG>ctC	p.L164L		NM_001145115.1	NP_001138587.1	B7ZBB8	PP13G_HUMAN	protein phosphatase 1, regulatory subunit 3G	164					glucose homeostasis (GO:0042593)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)	cytoplasm (GO:0005737)	glycogen binding (GO:2001069)			kidney(2)	2						TCTCGCGCCTGCGAAGCTTCC	0.736													C|||	5008	1.0	1.0	1.0	5008	,	,		12118	1.0		1.0	False		,,,				2504	1.0				p.L164L		.											.	PPP1R3G-136	0			c.G492C						.						1.0	2.0	1.0					6																	5086211		271	872	1143	SO:0001819	synonymous_variant	648791	exon1			GCGCCTGCGAAGC		CCDS47366.1	6p25.1	2012-04-17	2011-10-04		ENSG00000219607	ENSG00000219607		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14945	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3G"""			11948623	Standard	NM_001145115		Approved		uc011dia.1	B7ZBB8	OTTHUMG00000014172	ENST00000405617.2:c.492G>C	6.37:g.5086211G>C		0	0		5	5	NM_001145115	0	0	0	3	3		Silent	SNP	ENST00000405617.2	37	CCDS47366.1																																																																																			G|0.000;C|1.000		0.736	PPP1R3G-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039740.3	NM_001145115	
HLA-C	3107	mdanderson.org	37	6	31239049	31239049	+	Silent	SNP	G	G	T	rs1065406	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr6:31239049G>T	ENST00000376228.5	-	3	434	c.420C>A	c.(418-420)tcC>tcA	p.S140S	HLA-C_ENST00000383329.3_Silent_p.S140S	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	140	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CGTCGTAGGCGGACTGGTCAT	0.706													g|||	270	0.0539137	0.0439	0.049	5008	,	,		13032	0.0377		0.0398	False		,,,				2504	0.1022				p.S140S		.											.	HLA-C-90	0			c.C420A						.						34.0	26.0	29.0					6																	31239049		2177	4252	6429	SO:0001819	synonymous_variant	3107	exon3			GTAGGCGGACTGG	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.420C>A	6.37:g.31239049G>T		27	1		117	57	NM_002117	0	0	15	15	0	O02864|O02958|Q29643|Q9MY30	Silent	SNP	ENST00000376228.5	37	CCDS34393.1	150	0.06868131868131869	32	0.06504065040650407	18	0.049723756906077346	57	0.09965034965034965	43	0.05672823218997362	.	5.915	0.352896	0.11182	.	.	ENSG00000204525	ENST00000415537	.	.	.	2.59	-3.28	0.05033	.	.	.	.	.	T	0.07188	0.0182	.	.	.	0.24072	N	0.995975	.	.	.	.	.	.	T	0.34800	-0.9814	4	.	.	.	.	3.1816	0.06587	0.3131:0.0:0.2669:0.42	rs1065406;rs2308578;rs3176001;rs3180085;rs16868251;rs17840081	.	.	.	S	140	.	.	R	-	1	0	HLA-C	31347028	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.910000	0.00699	-0.884000	0.03976	-1.236000	0.01555	CGC	T|0.044;G|0.956		0.706	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	0	0		17	17	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
REV3L	5980	broad.mit.edu	37	6	111711365	111711365	+	Silent	SNP	A	A	G			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr6:111711365A>G	ENST00000358835.3	-	7	1135	c.681T>C	c.(679-681)ggT>ggC	p.G227G	REV3L_ENST00000368802.3_Silent_p.G227G|REV3L_ENST00000368805.1_Silent_p.G227G|REV3L_ENST00000435970.1_Silent_p.G149G			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	227					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GTGGTTCAACACCTTCCAATA	0.299								DNA polymerases (catalytic subunits)																													p.G227G		.											.	REV3L-294	0			c.T681C						.						91.0	89.0	90.0					6																	111711365		2203	4300	6503	SO:0001819	synonymous_variant	5980	exon6			TTCAACACCTTCC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.681T>C	6.37:g.111711365A>G		187	0		135	4	NM_002912	0	0	1	1	0	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																			.		0.299	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
PRR18	285800	hgsc.bcm.edu	37	6	166720806	166720806	+	Silent	SNP	G	G	C	rs911203	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr6:166720806G>C	ENST00000322583.3	-	1	1065	c.825C>G	c.(823-825)tcC>tcG	p.S275S		NM_175922.3	NP_787118.2	Q8N4B5	PRR18_HUMAN	proline rich 18	275										haematopoietic_and_lymphoid_tissue(2)|lung(1)	3		Breast(66;2.35e-05)|Ovarian(120;0.0606)|Prostate(117;0.0959)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-19)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;7.96e-05)		cggcagccgcggACTCCACGC	0.741													C|||	3992	0.797125	0.8525	0.6196	5008	,	,		7867	0.9206		0.7465	False		,,,				2504	0.773				p.S275S		.											.	PRR18-514	0			c.C825G						.	C		3541,683		1503,535,74	7.0	7.0	7.0		825	2.4	1.0	6	dbSNP_86	7	6180,2074		2355,1470,302	no	coding-synonymous	PRR18	NM_175922.3		3858,2005,376	CC,CG,GG		25.1272,16.1695,22.0949		275/296	166720806	9721,2757	2112	4127	6239	SO:0001819	synonymous_variant	285800	exon1			AGCCGCGGACTCC	BC034775	CCDS5291.1	6q27	2009-01-27	2009-01-27						28574	protein-coding gene	gene with protein product			"""proline rich region 18"""			12477932	Standard	NM_175922		Approved	MGC35308	uc003quw.1	Q8N4B5		ENST00000322583.3:c.825C>G	6.37:g.166720806G>C		0	0		5	5	NM_175922	0	0	0	1	1		Silent	SNP	ENST00000322583.3	37	CCDS5291.1																																																																																			G|0.796;C|0.204		0.741	PRR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392563.3	NM_175922	
MICALL2	79778	hgsc.bcm.edu	37	7	1484572	1484572	+	Silent	SNP	A	A	G	rs10435184	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr7:1484572A>G	ENST00000297508.7	-	6	1309	c.1134T>C	c.(1132-1134)ggT>ggC	p.G378G	MICALL2_ENST00000405088.4_Silent_p.G166G	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	378	Mediates targeting to the cell plasma membrane. {ECO:0000250}.|Necessary and sufficient for interaction with actinins. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGCTCCCCCACCCTGGGGTG	0.716													G|||	4980	0.994409	0.9985	0.9914	5008	,	,		11496	1.0		0.9801	False		,,,				2504	1.0				p.G378G		.											.	MICALL2-90	0			c.T1134C						.			3824,4		1910,4,0	4.0	4.0	4.0		1134	1.5	0.0	7	dbSNP_119	4	7610,92		3759,92,0	yes	coding-synonymous	MICALL2	NM_182924.3		5669,96,0	GG,GA,AA		1.1945,0.1045,0.8326		378/905	1484572	11434,96	1914	3851	5765	SO:0001819	synonymous_variant	79778	exon6			TCCCCCACCCTGG	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1134T>C	7.37:g.1484572A>G		0	0		18	18	NM_182924	0	0	0	47	47	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	ENST00000297508.7	37	CCDS5324.1																																																																																			A|0.009;G|0.991		0.716	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
CDCA7L	55536	broad.mit.edu	37	7	21939689	21939689	+	IGR	SNP	T	T	G	rs527548552	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr7:21939689T>G	ENST00000406877.3	-	0	3066				DNAH11_ENST00000328843.6_Nonsense_Mutation_p.Y4425*|DNAH11_ENST00000409508.3_Nonsense_Mutation_p.Y4418*	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like						positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						AGGAAGATTATGGACACCCGC	0.483																																					.		.											.	DNAH11-146	0			.						.						60.0	60.0	60.0					7																	21939689		1884	4099	5983	SO:0001628	intergenic_variant	8701	.			AGATTATGGACAC		CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429		7.37:g.21939689T>G		149	0		209	10	.	0	0	27	27	0	A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Nonsense_Mutation	SNP	ENST00000406877.3	37	CCDS5374.1	.	.	.	.	.	.	.	.	.	.	T	53	20.403600	0.99930	.	.	ENSG00000105877	ENST00000328843	.	.	.	5.52	-10.4	0.00318	.	0.220291	0.46758	D	0.000276	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	19.4229	0.94729	0.0:0.5777:0.0:0.4223	.	.	.	.	X	4425	.	ENSP00000330671:Y4425X	Y	+	3	2	DNAH11	21906214	0.003000	0.15002	0.009000	0.14445	0.574000	0.36063	-1.315000	0.02713	-2.213000	0.00735	-0.290000	0.09829	TAT	.		0.483	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250218.4	NM_018719	
MPP6	51678	broad.mit.edu	37	7	24705291	24705291	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr7:24705291G>T	ENST00000222644.5	+	7	1118	c.868G>T	c.(868-870)Gac>Tac	p.D290Y	MPP6_ENST00000396475.2_Missense_Mutation_p.D290Y|MPP6_ENST00000409761.1_Missense_Mutation_p.D178Y			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						TGTTAGAAGAGACTGGGACAA	0.413																																					p.D290Y		.											.	MPP6-90	0			c.G868T						.						105.0	100.0	102.0					7																	24705291		2203	4300	6503	SO:0001583	missense	51678	exon8			AGAAGAGACTGGG	AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.868G>T	7.37:g.24705291G>T	ENSP00000222644:p.Asp290Tyr	129	0		191	5	NM_016447	0	0	7	7	0	B2RAF0	Missense_Mutation	SNP	ENST00000222644.5	37	CCDS5388.1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369523	0.82463	.	.	ENSG00000105926	ENST00000222644;ENST00000409761;ENST00000396475;ENST00000430180	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.16	5.16	0.70880	Src homology-3 domain (1);	0.000000	0.56097	D	0.000022	D	0.90665	0.7072	M	0.74881	2.28	0.80722	D	1	D	0.76494	0.999	D	0.66847	0.947	D	0.91797	0.5448	10	0.87932	D	0	.	18.6501	0.91428	0.0:0.0:1.0:0.0	.	290	Q9NZW5	MPP6_HUMAN	Y	290;178;290;290	ENSP00000222644:D290Y;ENSP00000386262:D178Y;ENSP00000379737:D290Y;ENSP00000391020:D290Y	ENSP00000222644:D290Y	D	+	1	0	MPP6	24671816	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.444000	0.97578	2.392000	0.81423	0.591000	0.81541	GAC	.		0.413	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250272.4		
GARS	2617	hgsc.bcm.edu	37	7	30634630	30634630	+	Silent	SNP	G	G	C	rs2529438	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr7:30634630G>C	ENST00000389266.3	+	1	334	c.93G>C	c.(91-93)ctG>ctC	p.L31L	AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000578994.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	31					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	CCTCGCTCCTGCTCCGCCGGT	0.741													G|||	705	0.140775	0.1218	0.0994	5008	,	,		12290	0.1776		0.0726	False		,,,				2504	0.228				p.L31L		.											.	GARS-91	0			c.G93C						.	G		360,3594		14,332,1631	6.0	8.0	7.0		93	2.7	0.0	7	dbSNP_100	7	669,7413		24,621,3396	no	coding-synonymous	GARS	NM_002047.2		38,953,5027	CC,CG,GG		8.2777,9.1047,8.5494		31/740	30634630	1029,11007	1977	4041	6018	SO:0001819	synonymous_variant	2617	exon1			GCTCCTGCTCCGC	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.93G>C	7.37:g.30634630G>C		0	0		32	22	NM_002047	0	0	14	34	20	B3KQA2|B4DIA0|Q969Y1	Silent	SNP	ENST00000389266.3	37	CCDS43564.1																																																																																			G|0.889;C|0.111		0.741	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000578994.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	0	0		23	23	NM_002047	0	0	0	21	21	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	0	0		84	19	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	0	0		17	13	NM_194284	0	0	0	2	2	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
NSMAF	8439	hgsc.bcm.edu	37	8	59571856	59571856	+	Intron	SNP	A	A	C	rs59606339	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr8:59571856A>C	ENST00000038176.3	-	1	272				snoU13_ENST00000459488.1_RNA|NSMAF_ENST00000427130.2_Missense_Mutation_p.I17S	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor						ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				GCACTGCCGGATAGCTCGGCA	0.761													C|||	1348	0.269169	0.4697	0.1037	5008	,	,		10863	0.497		0.0467	False		,,,				2504	0.1094				p.I17S		.											.	NSMAF-91	0			c.T50G						.						4.0	7.0	6.0					8																	59571856		613	1513	2126	SO:0001627	intron_variant	8439	exon1			TGCCGGATAGCTC	X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.59+275T>G	8.37:g.59571856A>C		0	0		23	21	NM_001144772	0	0	0	0	0	B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	ENST00000038176.3	37	CCDS6173.1	496	0.2271062271062271	186	0.3780487804878049	31	0.0856353591160221	244	0.42657342657342656	35	0.04617414248021108	C	0.151	-1.090991	0.01858	.	.	ENSG00000035681	ENST00000427130	T	0.55413	0.52	1.89	-0.128	0.13506	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45308	-0.9270	6	.	.	.	.	0.796	0.01066	0.2394:0.3623:0.2355:0.1628	rs59606339	17	Q92636-2	.	S	17	ENSP00000411012:I17S	.	I	-	2	0	NSMAF	59734410	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.459000	0.21908	-0.396000	0.07703	-0.358000	0.07595	ATC	A|0.754;C|0.246		0.761	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378384.1	NM_003580	
CRH	1392	hgsc.bcm.edu	37	8	67089425	67089425	+	Silent	SNP	T	T	G	rs6159	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr8:67089425T>G	ENST00000276571.3	-	2	734	c.288A>C	c.(286-288)ggA>ggC	p.G96G		NM_000756.2	NP_000747.1	P06850	CRF_HUMAN	corticotropin releasing hormone	96					adrenal gland development (GO:0030325)|associative learning (GO:0008306)|cellular response to cocaine (GO:0071314)|cellular response to dexamethasone stimulus (GO:0071549)|diterpenoid metabolic process (GO:0016101)|feeding behavior (GO:0007631)|female pregnancy (GO:0007565)|ferulate metabolic process (GO:0033494)|glucocorticoid biosynthetic process (GO:0006704)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hypothalamus development (GO:0021854)|inflammatory response (GO:0006954)|ion homeostasis (GO:0050801)|learning or memory (GO:0007611)|locomotory exploration behavior (GO:0035641)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|lung development (GO:0030324)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell death (GO:0060548)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of gene expression (GO:0010629)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of luteinizing hormone secretion (GO:0033685)|negative regulation of norepinephrine secretion (GO:0010700)|parturition (GO:0007567)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of circadian sleep/wake cycle, wakefulness (GO:0010841)|positive regulation of corticosterone secretion (GO:2000854)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of digestive system process (GO:0060456)|positive regulation of gene expression (GO:0010628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein phosphorylation (GO:0001934)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of serotonin secretion (GO:0014062)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to immobilization stress (GO:0035902)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|varicosity (GO:0043196)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|lung(2)|urinary_tract(1)	5		all_cancers(86;2.58e-06)|all_epithelial(80;6.27e-09)|all_lung(136;0.000414)|Lung NSC(129;0.0011)	Epithelial(68;0.0136)|all cancers(69;0.0507)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)		Corticotropin(DB01285)	TGCCGCTGCCTCCGGCGAGGA	0.701											OREG0018805	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1938	0.386981	0.7557	0.3646	5008	,	,		12753	0.3433		0.1392	False		,,,				2504	0.2045				p.G96G		.											.	CRH-90	0			c.A288C						.	G		1011,1897		182,647,625	2.0	3.0	3.0		288	-2.7	0.0	8	dbSNP_52	3	578,6556		47,484,3036	no	coding-synonymous	CRH	NM_000756.2		229,1131,3661	GG,GT,TT		8.102,34.7662,15.8235		96/197	67089425	1589,8453	1454	3567	5021	SO:0001819	synonymous_variant	1392	exon2			GCTGCCTCCGGCG		CCDS6188.1	8q13	2013-02-25				ENSG00000147571		"""Endogenous ligands"""	2355	protein-coding gene	gene with protein product	"""corticotropin-releasing factor"", ""corticoliberin"""	122560					Standard	NM_000756		Approved	CRF	uc003xvy.2	P06850		ENST00000276571.3:c.288A>C	8.37:g.67089425T>G		0	0	1096	23	23	NM_000756	0	0	0	0	0	B3KQS4	Silent	SNP	ENST00000276571.3	37	CCDS6188.1																																																																																			T|0.642;G|0.358		0.701	CRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378926.1	NM_000756	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		0	0		11	11	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
EPPK1	83481	bcgsc.ca	37	8	144940290	144940290	+	Missense_Mutation	SNP	C	C	G	rs201976887		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr8:144940290C>G	ENST00000525985.1	-	2	7203	c.7132G>C	c.(7132-7134)Gac>Cac	p.D2378H				P58107	EPIPL_HUMAN	epiplakin 1	2378						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCGCTGGGGTCGGCCAGGACG	0.682																																					p.D2378H		.											.	EPPK1-25	0			c.G7132C						.	C	HIS/ASP	51,4341	20.2+/-43.8	0,51,2145	315.0	292.0	300.0		7132	3.6	0.8	8		300	22,8530	7.1+/-27.0	0,22,4254	no	missense	EPPK1	NM_031308.1	81	0,73,6399	GG,GC,CC		0.2572,1.1612,0.564	probably-damaging	2378/2420	144940290	73,12871	2196	4276	6472	SO:0001583	missense	83481	exon1			TGGGGTCGGCCAG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.7132G>C	8.37:g.144940290C>G	ENSP00000436337:p.Asp2378His	77	0		368	28	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	37		.	.	.	.	.	.	.	.	.	.	C	22.4	4.279155	0.80692	0.011612	0.002572	ENSG00000227184	ENST00000525985	T	0.74737	-0.87	4.43	3.56	0.40772	.	.	.	.	.	D	0.83133	0.5188	M	0.89785	3.06	0.42176	D	0.991666	D	0.89917	1.0	D	0.91635	0.999	D	0.86316	0.1689	9	0.62326	D	0.03	.	10.4012	0.44231	0.0:0.9038:0.0:0.0962	.	2378	E9PPU0	.	H	2378	ENSP00000436337:D2378H	ENSP00000436337:D2378H	D	-	1	0	EPPK1	145012278	1.000000	0.71417	0.773000	0.31616	0.942000	0.58702	7.555000	0.82223	1.223000	0.43536	0.591000	0.81541	GAC	.		0.682	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
FOXH1	8928	hgsc.bcm.edu	37	8	145700381	145700381	+	Missense_Mutation	SNP	C	C	G	rs144830740	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr8:145700381C>G	ENST00000377317.4	-	3	916	c.338G>C	c.(337-339)aGc>aCc	p.S113T	FOXH1_ENST00000525197.1_5'UTR	NM_003923.2	NP_003914.1	O75593	FOXH1_HUMAN	forkhead box H1	113			S -> T (in colorectal cancer; dbSNP:rs144830740). {ECO:0000269|PubMed:9702198}.		aorta morphogenesis (GO:0035909)|axial mesoderm development (GO:0048318)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|heart looping (GO:0001947)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|secondary heart field specification (GO:0003139)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular trabecula myocardium morphogenesis (GO:0003222)	activin responsive factor complex (GO:0032444)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|co-SMAD binding (GO:0070410)|enhancer binding (GO:0035326)|protein domain specific binding (GO:0019904)|R-SMAD binding (GO:0070412)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			TGGGATCAGGCTCACGTCGAC	0.692													C|||	6	0.00119808	0.0008	0.0	5008	,	,		14184	0.0		0.005	False		,,,				2504	0.0				p.S113T		.											.	FOXH1-226	0			c.G338C	GRCh37	CM082688	FOXH1	M	rs144830740	.	C	THR/SER	3,4383		0,3,2190	15.0	12.0	13.0		338	3.4	1.0	8	dbSNP_134	13	57,8499		0,57,4221	yes	missense	FOXH1	NM_003923.2	58	0,60,6411	GG,GC,CC		0.6662,0.0684,0.4636	benign	113/366	145700381	60,12882	2193	4278	6471	SO:0001583	missense	8928	exon3			ATCAGGCTCACGT	AF076292	CCDS6428.1	8q24.3	2014-08-12			ENSG00000160973			"""Forkhead boxes"""	3814	protein-coding gene	gene with protein product		603621				9702198	Standard	NM_003923		Approved	FAST1	uc003zdc.3	O75593	OTTHUMG00000165172	ENST00000377317.4:c.338G>C	8.37:g.145700381C>G	ENSP00000366534:p.Ser113Thr	2	0		49	42	NM_003923	0	0	0	0	0	D3DWM4	Missense_Mutation	SNP	ENST00000377317.4	37	CCDS6428.1	4	0.0018315018315018315	0	0.0	0	0.0	0	0.0	4	0.005277044854881266	C	15.87	2.961609	0.53400	6.84E-4	0.006662	ENSG00000160973	ENST00000377317;ENST00000292541	D	0.95656	-3.77	4.25	3.38	0.38709	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.162902	0.52532	D	0.000063	D	0.92433	0.7598	L	0.28740	0.885	0.40239	D	0.977932	D	0.65815	0.995	D	0.69307	0.963	D	0.90732	0.4643	10	0.41790	T	0.15	-34.9462	6.0626	0.19846	0.0:0.7061:0.1908:0.103	.	113	O75593	FOXH1_HUMAN	T	113;140	ENSP00000366534:S113T	ENSP00000292541:S140T	S	-	2	0	FOXH1	145671189	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	0.924000	0.28777	1.019000	0.39547	-0.355000	0.07637	AGC	C|0.997;G|0.003		0.692	FOXH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382451.1		
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000525105.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		18	18	NM_213605	0	0	0	0	0		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		0	0		34	33	NM_024896	0	0	0	2	2	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
TUSC1	286319	hgsc.bcm.edu	37	9	25678122	25678122	+	Silent	SNP	G	G	C	rs72631814	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr9:25678122G>C	ENST00000358022.3	-	1	734	c.198C>G	c.(196-198)gcC>gcG	p.A66A		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	66										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		CCGCCAGGTCGGCAAACCGCT	0.776													G|||	885	0.176717	0.1324	0.1772	5008	,	,		7019	0.1151		0.3002	False		,,,				2504	0.1728				p.A66A	Pancreas(19;648 672 25630 30820 31331)	.											.	TUSC1-90	0			c.C198G						.	G		389,3633		24,341,1646	6.0	6.0	6.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	198	0.6	1.0	9	dbSNP_130	6	1826,6086		225,1376,2355	no	coding-synonymous	TUSC1	NM_001004125.2		249,1717,4001	CC,CG,GG		23.0789,9.6718,18.5604		66/213	25678122	2215,9719	2011	3956	5967	SO:0001819	synonymous_variant	286319	exon1			CAGGTCGGCAAAC	AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.198C>G	9.37:g.25678122G>C		0	0		59	29	NM_001004125	0	0	3	6	3	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Silent	SNP	ENST00000358022.3	37	CCDS34999.1																																																																																			G|0.807;C|0.193		0.776	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	0	0		9	9	NM_004957	0	0	0	2	2	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
IER5L	389792	hgsc.bcm.edu	37	9	131940019	131940019	+	Missense_Mutation	SNP	G	G	A	rs184457	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr9:131940019G>A	ENST00000372491.2	-	1	521	c.313C>T	c.(313-315)Ccg>Tcg	p.P105S	RP11-247A12.8_ENST00000599172.2_RNA|RP11-247A12.2_ENST00000372490.3_RNA	NM_203434.2	NP_982258.2	Q5T953	IER5L_HUMAN	immediate early response 5-like	105	Gln-rich.		P -> S (in dbSNP:rs184457). {ECO:0000269|PubMed:15489334}.										Ovarian(14;0.0448)|Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		cgGGCGGCCGGCTCGCGCGCC	0.771													g|||	926	0.184904	0.0855	0.1859	5008	,	,		4977	0.1567		0.2783	False		,,,				2504	0.2515				p.P105S		.											.	IER5L-226	0			c.C313T						.						1.0	1.0	1.0					9																	131940019		635	1317	1952	SO:0001583	missense	389792	exon1			CGGCCGGCTCGCG	BC013070	CCDS43888.1	9q34.11	2013-09-20			ENSG00000188483	ENSG00000188483			23679	protein-coding gene	gene with protein product							Standard	NM_203434		Approved	bA247A12.2	uc010myt.1	Q5T953	OTTHUMG00000020773	ENST00000372491.2:c.313C>T	9.37:g.131940019G>A	ENSP00000361569:p.Pro105Ser	0	0		4	4	NM_203434	0	0	0	0	0	Q6P3E2	Missense_Mutation	SNP	ENST00000372491.2	37	CCDS43888.1	447	0.20467032967032966	67	0.13617886178861788	70	0.19337016574585636	90	0.15734265734265734	220	0.29023746701846964	G	15.79	2.937521	0.52972	.	.	ENSG00000188483	ENST00000372491	T	0.41400	1.0	3.39	3.39	0.38822	.	1.136290	0.06835	U	0.794746	T	0.00012	0.0000	N	0.14661	0.345	0.41388	P	0.012405	B	0.29301	0.241	B	0.28916	0.096	T	0.19976	-1.0289	9	0.45353	T	0.12	-3.5623	12.3275	0.55020	0.0:0.0:1.0:0.0	rs184457;rs639957;rs17855889	105	Q5T953	IER5L_HUMAN	S	105	ENSP00000361569:P105S	ENSP00000361569:P105S	P	-	1	0	IER5L	130979840	1.000000	0.71417	0.989000	0.46669	0.975000	0.68041	3.495000	0.53280	1.737000	0.51674	0.298000	0.19748	CCG	G|0.700;A|0.300		0.771	IER5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054556.2		
SOHLH1	402381	broad.mit.edu	37	9	138590196	138590196	+	Silent	SNP	C	C	A			TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr9:138590196C>A	ENST00000298466.5	-	3	384	c.324G>T	c.(322-324)ggG>ggT	p.G108G	SOHLH1_ENST00000425225.1_Silent_p.G108G	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	108					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		CCTGACTGGGCCCCAGGGCGC	0.652																																					p.G108G		.											.	SOHLH1-135	0			c.G324T						.						68.0	71.0	70.0					9																	138590196		2203	4299	6502	SO:0001819	synonymous_variant	402381	exon3			ACTGGGCCCCAGG	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.324G>T	9.37:g.138590196C>A		59	0		348	11	NM_001012415	0	0	1	1	0	C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Silent	SNP	ENST00000298466.5	37	CCDS35174.1																																																																																			.		0.652	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415	
VCX	26609	broad.mit.edu	37	X	7811644	7811644	+	Missense_Mutation	SNP	G	G	A	rs199801261		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chrX:7811644G>A	ENST00000381059.3	+	3	427	c.208G>A	c.(208-210)Gcg>Acg	p.A70T	VCX_ENST00000341408.4_Missense_Mutation_p.A70T	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	70			A -> G (in dbSNP:rs6639946). {ECO:0000269|PubMed:10607842, ECO:0000269|PubMed:15489334}.		chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				GGCGGAGAGCGCGCCAGCGGC	0.692																																					p.A70T		.											.	VCX-22	0			c.G208A						.						8.0	11.0	10.0					X																	7811644		1996	3724	5720	SO:0001583	missense	26609	exon3			GAGAGCGCGCCAG	AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.208G>A	X.37:g.7811644G>A	ENSP00000370447:p.Ala70Thr	13	0		52	3	NM_013452	0	0	0	0	0	A0JNS5|Q4V774|Q9P0H3	Missense_Mutation	SNP	ENST00000381059.3	37	CCDS14128.1	.	.	.	.	.	.	.	.	.	.	-	12.46	1.945570	0.34377	.	.	ENSG00000182583	ENST00000381059;ENST00000341408	T;T	0.17213	2.29;2.29	0.167	0.167	0.15006	.	.	.	.	.	T	0.05456	0.0144	N	0.08118	0	0.09310	N	0.999996	B	0.34290	0.447	B	0.16722	0.016	T	0.38200	-0.9672	9	0.12430	T	0.62	.	6.1566	0.20340	4.0E-4:0.0:0.9996:0.0	.	70	Q9H320	VCX1_HUMAN	T	70	ENSP00000370447:A70T;ENSP00000344144:A70T	ENSP00000344144:A70T	A	+	1	0	VCX	7771644	0.006000	0.16342	0.009000	0.14445	0.009000	0.06853	1.341000	0.33907	0.270000	0.21984	0.274000	0.19336	GCG	.		0.692	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071474.1	NM_013452	
AMOT	154796	broad.mit.edu	37	X	112059030	112059030	+	Silent	SNP	A	A	G	rs143986904		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chrX:112059030A>G	ENST00000524145.1	-	3	1022	c.948T>C	c.(946-948)tcT>tcC	p.S316S	AMOT_ENST00000371962.1_Silent_p.S84S|AMOT_ENST00000371959.3_Silent_p.S316S|AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371958.1_Silent_p.S84S			Q4VCS5	AMOT_HUMAN	angiomotin	316					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						AGGACCCCCCAGAGGTCAGAG	0.572													A|||	44	0.0116556	0.0325	0.0014	3775	,	,		13691	0.0		0.0	False		,,,				2504	0.0				p.S316S		.											.	AMOT-131	0			c.T948C						.	A	,	54,1155		2,46,4,469,171	64.0	60.0	61.0		948,	0.7	1.0	X	dbSNP_134	61	0,2391		0,0,0,800,791	no	coding-synonymous,utr-5	AMOT	NM_001113490.1,NM_133265.2	,	2,46,4,1269,962	GG,GA,G,AA,A		0.0,4.4665,1.5	,	316/1085,	112059030	54,3546	692	1591	2283	SO:0001819	synonymous_variant	154796	exon2			CCCCCCAGAGGTC	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.948T>C	X.37:g.112059030A>G		216	1		182	5	NM_001113490	0	0	1	1	0	Q504X5|Q9HD27|Q9UPT1	Silent	SNP	ENST00000524145.1	37	CCDS48154.1																																																																																			A|0.995;G|0.005		0.572	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378570.1	NM_133265	
FBXL15	79176	broad.mit.edu	37	10	104182716	104182717	+	Frame_Shift_Ins	INS	-	-	G	rs145311924		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr10:104182716_104182717insG	ENST00000224862.3	+	4	2185_2186	c.869_870insG	c.(868-873)gcgggcfs	p.AG290fs	CUEDC2_ENST00000465409.1_5'Flank|FBXL15_ENST00000369956.2_Frame_Shift_Ins_p.AG286fs|PSD_ENST00000492902.2_5'Flank	NM_024326.3	NP_077302.3	Q9H469	FXL15_HUMAN	F-box and leucine-rich repeat protein 15	290					bone mineralization (GO:0030282)|dorsal/ventral pattern formation (GO:0009953)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of BMP signaling pathway (GO:0030513)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)				kidney(1)	1		Colorectal(252;0.207)		Epithelial(162;1.19e-08)|all cancers(201;2.65e-07)		CAGGATATGGCGGGCTTCGCAC	0.649											OREG0020479	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A290fs		.											.	FBXL15-226	0			c.869_870insG						.																																			SO:0001589	frameshift_variant	79176	exon4			ATATGGCGGGCTT	BC036120	CCDS31273.1	10q24.32	2011-06-09	2004-06-15	2004-06-16	ENSG00000107872	ENSG00000107872		"""F-boxes / Leucine-rich repeats"""	28155	protein-coding gene	gene with protein product		610287	"""F-box only protein 37"""	FBXO37			Standard	NM_024326		Approved	MGC11279, Fbl15	uc001kvk.2	Q9H469	OTTHUMG00000018957	ENST00000224862.3:c.872dupG	10.37:g.104182719_104182719dupG	ENSP00000224862:p.Ala290fs	48	0	1379	224	9	NM_024326	0	0	0	0	0	A1L4J8|B1AKX8|B1AKX9|B1AKY0|B1AKY1|C9JWA4|Q0D2Q3|Q49AL7|Q5JWA5	Frame_Shift_Ins	INS	ENST00000224862.3	37	CCDS31273.1																																																																																			.		0.649	FBXL15-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		XM_370575	
SIX6	4990	broad.mit.edu	37	14	60977896	60977897	+	Frame_Shift_Ins	INS	-	-	C	rs372216093		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr14:60977896_60977897insC	ENST00000327720.5	+	2	1115_1116	c.667_668insC	c.(667-669)gccfs	p.A223fs		NM_007374.2	NP_031400.2	O95475	SIX6_HUMAN	SIX homeobox 6	223					organ morphogenesis (GO:0009887)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)	11				OV - Ovarian serous cystadenocarcinoma(108;0.088)		CACCAGCCCGGCCGCCAGTCTA	0.663																																					p.A223fs		.											.	SIX6-90	0			c.667_668insC						.																																			SO:0001589	frameshift_variant	4990	exon2			AGCCCGGCCGCCA	AF141651	CCDS9747.1	14q23.1	2011-06-20	2007-07-13		ENSG00000184302	ENSG00000184302		"""Homeoboxes / SINE class"""	10892	protein-coding gene	gene with protein product		606326	"""sine oculis homeobox (Drosophila) homolog 6"", ""sine oculis homeobox homolog 6 (Drosophila)"""	OPTX2		10512683	Standard	NM_007374		Approved	Six9	uc001xfa.4	O95475	OTTHUMG00000152339	ENST00000327720.5:c.669dupC	14.37:g.60977898_60977898dupC	ENSP00000328596:p.Ala223fs	28	0		138	11	NM_007374	0	0	0	0	0	Q6NT42|Q9P1X8	Frame_Shift_Ins	INS	ENST00000327720.5	37	CCDS9747.1																																																																																			.		0.663	SIX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276952.2		
PAQR4	124222	broad.mit.edu	37	16	3019781	3019782	+	Frame_Shift_Ins	INS	-	-	C	rs144682481		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:3019781_3019782insC	ENST00000318782.8	+	1	536_537	c.106_107insC	c.(106-108)tcgfs	p.S36fs	PKMYT1_ENST00000431515.2_Intron|PKMYT1_ENST00000571102.1_Intron|PAQR4_ENST00000293978.8_Frame_Shift_Ins_p.S36fs|PAQR4_ENST00000576565.1_Intron|PAQR4_ENST00000572687.1_Frame_Shift_Ins_p.S36fs|PAQR4_ENST00000574988.1_5'Flank	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	36						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						CAGCAGCGGCTCGGGCTGCCTG	0.698																																					p.S36fs		.											.	PAQR4-68	0			c.106_107insC						.																																			SO:0001589	frameshift_variant	124222	exon1			AGCGGCTCGGGCT		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.107dupC	16.37:g.3019782_3019782dupC	ENSP00000321804:p.Ser36fs	16	0		222	11	NM_152341	0	0	0	0	0	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Frame_Shift_Ins	INS	ENST00000318782.8	37	CCDS10485.1																																																																																			.		0.698	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250966.1	NM_152341	
PIEZO1	9780	broad.mit.edu	37	16	88789666	88789667	+	In_Frame_Ins	INS	-	-	CCTGCT	rs11281795	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr16:88789666_88789667insCCTGCT	ENST00000301015.9	-	32	4651_4652	c.4405_4406insAGCAGG	c.(4405-4407)gca>gAGCAGGca	p.1468_1469insEQ	RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1468					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						TTCCTGCCTTGCCTGCTCCTGC	0.693														570	0.113818	0.2126	0.0749	5008	,	,		15281	0.0635		0.1004	False		,,,				2504	0.0736				p.A1469delinsEQA		.											.	.	0			c.4406_4407insAGCAGG						.			656,2422		158,340,1041						-4.8	0.0		dbSNP_120	27	690,5228		145,400,2414	no	coding	PIEZO1	NM_001142864.2		303,740,3455	A1A1,A1R,RR		11.6593,21.3125,14.9622				1346,7650				SO:0001652	inframe_insertion	9780	exon32			TGCCTTGCCTGCT	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.4400_4405dupAGCAGG	16.37:g.88789667_88789672dupCCTGCT	ENSP00000301015:p.Glu1467_Gln1468dup	9	0		85	24	NM_001142864	0	0	0	0	0	A6NHT9|A7E2B7|Q0KKZ9	In_Frame_Ins	INS	ENST00000301015.9	37	CCDS54058.1																																																																																			-|0.897;CCTGCT|0.103		0.693	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000345699.4	NM_014745	
CRIPAK	285464	broad.mit.edu	37	4	1388622	1388623	+	Frame_Shift_Ins	INS	-	-	CA	rs79704405|rs540461234|rs558358960	byFrequency	TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr4:1388622_1388623insCA	ENST00000324803.4	+	1	3283_3284	c.323_324insCA	c.(322-327)ctcacgfs	p.LT108fs		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	108					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L108H(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GCCCGCCTGCTCACGTGCCCAT	0.668														506	0.101038	0.0567	0.1427	5008	,	,		19207	0.0169		0.1759	False		,,,				2504	0.1411				p.L108fs		.											.	CRIPAK-90	1	Substitution - Missense(1)	pancreas(1)	c.323_324insCA						.																																			SO:0001589	frameshift_variant	285464	exon1			GCCTGCTCACGTG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.324_325dupCA	4.37:g.1388623_1388624dupCA	ENSP00000323978:p.Leu108fs	16	0		213	47	NM_175918	0	0	0	0	0	Q8NB03	Frame_Shift_Ins	INS	ENST00000324803.4	37	CCDS3349.1																																																																																			.		0.668	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
LURAP1L	286343	broad.mit.edu	37	9	12775861	12775862	+	In_Frame_Ins	INS	-	-	GGCGGCGGC	rs3833707|rs139315731		TCGA-OR-A5LS-01A-11D-A29I-10	TCGA-OR-A5LS-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	3c55b33a-f83d-46c7-9814-58bc5109ff6a	03b19a61-1fbe-46e5-9de0-19bf2e02cb24	g.chr9:12775861_12775862insGGCGGCGGC	ENST00000319264.3	+	1	842_843	c.147_148insGGCGGCGGC	c.(148-150)ggc>GGCGGCGGCggc	p.50_50G>GGGG	RP11-3L8.3_ENST00000417638.1_RNA|LURAP1L_ENST00000489107.1_3'UTR	NM_203403.1	NP_981948.1	Q8IV03	LUR1L_HUMAN	leucine rich adaptor protein 1-like	53	Gly-rich.							p.G49_G50insGGG(2)|p.G50_G52delGGG(1)									gcggtggtggtggcggcggcgg	0.688																																					p.G49delinsGGGG		.											.	.	3	Insertion - In frame(2)|Deletion - In frame(1)	large_intestine(1)|prostate(1)|central_nervous_system(1)	c.147_148insGGCGGCGGC						.																																			SO:0001652	inframe_insertion	286343	exon1			TGGTGGTGGCGGC	AK095824	CCDS6473.1	9p22.3	2012-02-01	2012-02-01	2012-02-01	ENSG00000153714	ENSG00000153714			31452	protein-coding gene	gene with protein product	"""similar to DNA segment, Chr 4, Brigham & Womens Genetics 0951 expressed"""		"""chromosome 9 open reading frame 150"""	C9orf150		12766061	Standard	NM_203403		Approved	MGC46502, FLJ38505, bA3L8.2	uc003zkw.3	Q8IV03	OTTHUMG00000019557	ENST00000319264.3:c.157_165dupGGCGGCGGC	9.37:g.12775862_12775870dupGGCGGCGGC	ENSP00000321026:p.GlyGlyGly53dup	9	0		98	0	NM_203403	0	0	0	0	0	Q5VZX7|Q8N923|Q8NCG2	In_Frame_Ins	INS	ENST00000319264.3	37	CCDS6473.1																																																																																			.		0.688	LURAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051730.1	NM_203403	
