#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GPR153	387509	broad.mit.edu	37	1	6310588	6310588	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:6310588G>T	ENST00000377893.2	-	5	1335	c.1076C>A	c.(1075-1077)gCc>gAc	p.A359D		NM_207370.2	NP_997253.2	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	359						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(1)|lung(7)|skin(1)	14	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		CTCATACTTGGCCATCCTATC	0.612																																					p.A359D		.											.	GPR153-514	0			c.C1076A						.						40.0	34.0	36.0					1																	6310588		2197	4297	6494	SO:0001583	missense	387509	exon5			TACTTGGCCATCC	AY255529	CCDS64.1	1p36.31	2012-08-21			ENSG00000158292	ENSG00000158292		"""GPCR / Class A : Orphans"""	23618	protein-coding gene	gene with protein product		614269				12679517	Standard	NM_207370		Approved	PGR1	uc001amp.2	Q6NV75	OTTHUMG00000001272	ENST00000377893.2:c.1076C>A	1.37:g.6310588G>T	ENSP00000367125:p.Ala359Asp	266	0		169	6	NM_207370	0	0	0	0	0	Q5TGR5|Q6AHW8|Q86SP8	Missense_Mutation	SNP	ENST00000377893.2	37	CCDS64.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436105	0.62955	.	.	ENSG00000158292	ENST00000377893	T	0.22743	1.94	5.17	4.26	0.50523	.	0.314710	0.33327	N	0.005032	T	0.17662	0.0424	L	0.48642	1.525	0.50467	D	0.999879	P	0.46064	0.872	B	0.37650	0.255	T	0.02378	-1.1168	10	0.36615	T	0.2	-13.5089	11.3967	0.49847	0.0892:0.0:0.9108:0.0	.	359	Q6NV75	GP153_HUMAN	D	359	ENSP00000367125:A359D	ENSP00000367125:A359D	A	-	2	0	GPR153	6233175	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	5.711000	0.68400	1.173000	0.42796	0.455000	0.32223	GCC	.		0.612	GPR153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003717.2		
UBE4B	10277	broad.mit.edu	37	1	10166330	10166330	+	Silent	SNP	A	A	C			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:10166330A>C	ENST00000343090.6	+	7	960	c.885A>C	c.(883-885)tcA>tcC	p.S295S	UBE4B_ENST00000377157.3_Intron|UBE4B_ENST00000253251.8_Intron	NM_001105562.2	NP_001099032.1			ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		CTCTTGCCTCACCTTCCCGTG	0.587																																					p.S295S		.											.	UBE4B-229	0			c.A885C						.						67.0	70.0	69.0					1																	10166330		1977	4165	6142	SO:0001819	synonymous_variant	10277	exon7			TGCCTCACCTTCC	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000343090.6:c.885A>C	1.37:g.10166330A>C		147	11		95	6	NM_001105562	0	0	0	0	0		Silent	SNP	ENST00000343090.6	37	CCDS41245.1																																																																																			.		0.587	UBE4B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000005016.1	NM_006048	
ATP13A2	23400	bcgsc.ca	37	1	17319011	17319011	+	Silent	SNP	G	G	A	rs2076603	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:17319011G>A	ENST00000326735.8	-	17	1848	c.1815C>T	c.(1813-1815)ccC>ccT	p.P605P	ATP13A2_ENST00000341676.5_Silent_p.P600P|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000452699.1_Silent_p.P600P			Q9NQ11	AT132_HUMAN	ATPase type 13A2	605					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CCCAAAGTGGGGGTCTCATCA	0.657													G|||	2246	0.448482	0.4145	0.5216	5008	,	,		16691	0.2589		0.6153	False		,,,				2504	0.4663				p.P605P		.											.	ATP13A2-93	0			c.C1815T						.	G	,,	1966,2440	553.5+/-378.8	426,1114,663	87.0	90.0	89.0		1800,1800,1815	1.4	1.0	1	dbSNP_96	89	5438,3162	649.6+/-400.6	1714,2010,576	no	coding-synonymous,coding-synonymous,coding-synonymous	ATP13A2	NM_001141973.1,NM_001141974.1,NM_022089.2	,,	2140,3124,1239	AA,AG,GG		36.7674,44.621,43.0724	,,	600/1176,600/1159,605/1181	17319011	7404,5602	2203	4300	6503	SO:0001819	synonymous_variant	23400	exon17			AAGTGGGGGTCTC	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.1815C>T	1.37:g.17319011G>A		219	2		111	7	NM_022089	0	0	1	1	0	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Silent	SNP	ENST00000326735.8	37	CCDS175.1																																																																																			T|0.129;G|0.314;C|0.153;A|0.404		0.657	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006617.1	NM_022089	
EPHA8	2046	bcgsc.ca	37	1	22902772	22902772	+	Silent	SNP	C	C	T	rs56218493	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:22902772C>T	ENST00000166244.3	+	3	294	c.222C>T	c.(220-222)aaC>aaT	p.N74N	EPHA8_ENST00000374644.4_Silent_p.N74N|EPHA8_ENST00000538803.1_Silent_p.N74N	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	74	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGGTTTGCAACGTCATGAGCC	0.607													C|||	514	0.102636	0.0681	0.0821	5008	,	,		18435	0.0516		0.1014	False		,,,				2504	0.2178				p.N74N		.											.	EPHA8-1380	0			c.C222T						.	C	,	348,4058	181.2+/-209.3	20,308,1875	103.0	99.0	100.0		222,222	1.5	1.0	1	dbSNP_129	100	783,7817	185.6+/-233.3	42,699,3559	no	coding-synonymous,coding-synonymous	EPHA8	NM_001006943.1,NM_020526.3	,	62,1007,5434	TT,TC,CC		9.1047,7.8983,8.696	,	74/496,74/1006	22902772	1131,11875	2203	4300	6503	SO:0001819	synonymous_variant	2046	exon3			TTGCAACGTCATG	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.222C>T	1.37:g.22902772C>T		464	2		291	8	NM_020526	0	0	0	0	0	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Silent	SNP	ENST00000166244.3	37	CCDS225.1																																																																																			C|0.911;T|0.089		0.607	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
NOTCH2	4853	hgsc.bcm.edu	37	1	120611964	120611964	+	Missense_Mutation	SNP	G	G	C	rs11810554	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:120611964G>C	ENST00000256646.2	-	1	276	c.57C>G	c.(55-57)tgC>tgG	p.C19W		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	19					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.C19W(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGGGGCCGCGCAGCACAGCC	0.766			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.C19W		.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2-1441	1	Substitution - Missense(1)	central_nervous_system(1)	c.C57G						.						6.0	8.0	8.0					1																	120611964		1705	3721	5426	SO:0001583	missense	4853	exon1	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGCCGCGCAGCAC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.57C>G	1.37:g.120611964G>C	ENSP00000256646:p.Cys19Trp	0	0		7	6	NM_024408	0	0	0	0	0	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	37	CCDS908.1	697|697	0.3191391941391941|0.3191391941391941	81|81	0.16463414634146342|0.16463414634146342	112|112	0.30939226519337015|0.30939226519337015	224|224	0.3916083916083916|0.3916083916083916	280|280	0.36939313984168864|0.36939313984168864	G|G	6.292|6.292	0.421956|0.421956	0.11928|0.11928	.|.	.|.	ENSG00000134250|ENSG00000134250	ENST00000538680|ENST00000256646	.|T	.|0.57436	.|0.4	3.09|3.09	2.04|2.04	0.26737|0.26737	.|.	.|.	.|.	.|.	.|.	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.14661|0.14661	0.345|0.345	0.26751|0.26751	N|N	0.970205|0.970205	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.14337|0.14337	-1.0476|-1.0476	6|9	0.87932|0.37606	D|T	0|0.19	.|.	6.7594|6.7594	0.23532|0.23532	0.0:0.0:0.7206:0.2794|0.0:0.0:0.7206:0.2794	rs11810554|rs11810554	.|19;19	.|Q6IQ50;Q04721	.|.;NOTC2_HUMAN	G|W	36|19	.|ENSP00000256646:C19W	ENSP00000439516:A36G|ENSP00000256646:C19W	A|C	-|-	2|3	0|2	NOTCH2|NOTCH2	120413487|120413487	0.998000|0.998000	0.40836|0.40836	0.998000|0.998000	0.56505|0.56505	0.313000|0.313000	0.28021|0.28021	0.766000|0.766000	0.26560|0.26560	1.760000|1.760000	0.52011|0.52011	0.184000|0.184000	0.17185|0.17185	GCG|TGC	G|0.680;C|0.320		0.766	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
THEM4	117145	hgsc.bcm.edu	37	1	151881885	151881885	+	Missense_Mutation	SNP	A	A	C	rs3748805	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:151881885A>C	ENST00000368814.3	-	1	399	c.50T>G	c.(49-51)cTg>cGg	p.L17R	THEM4_ENST00000489410.1_Missense_Mutation_p.L17R	NM_053055.4	NP_444283.2	Q5T1C6	THEM4_HUMAN	thioesterase superfamily member 4	17			L -> R (in dbSNP:rs3748805). {ECO:0000269|PubMed:11598301, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17013611, ECO:0000269|Ref.4}.		epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein kinase B signaling (GO:0043491)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	cell projection (GO:0042995)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(4)|lung(3)|urinary_tract(1)	9	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TACTGGCGGCAGGCACAGAGC	0.741													C|||	4622	0.922923	0.8986	0.9092	5008	,	,		8223	0.9494		0.9155	False		,,,				2504	0.9458				p.L17R		.											.	THEM4-522	0			c.T50G						.						1.0	1.0	1.0					1																	151881885		1068	2473	3541	SO:0001583	missense	117145	exon1			GGCGGCAGGCACA	AJ313515	CCDS1006.1	1q21.3	2008-02-05			ENSG00000159445	ENSG00000159445			17947	protein-coding gene	gene with protein product	"""C-terminal modulator protein"""	606388				11598301	Standard	NM_053055		Approved	CTMP	uc001ezj.2	Q5T1C6	OTTHUMG00000013049	ENST00000368814.3:c.50T>G	1.37:g.151881885A>C	ENSP00000357804:p.Leu17Arg	0	0		9	9	NM_053055	0	0	0	4	4	B2RBX2|Q96KR2	Missense_Mutation	SNP	ENST00000368814.3	37	CCDS1006.1	2023	0.9262820512820513	453	0.9207317073170732	320	0.8839779005524862	545	0.9527972027972028	705	0.9300791556728232	C	0.562	-0.845033	0.02671	.	.	ENSG00000159445	ENST00000368814;ENST00000489410	T;T	0.25579	2.45;1.79	1.92	-0.278	0.12894	.	16.336300	0.02935	N	0.139768	T	0.02455	0.0075	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.21143	-1.0254	9	0.10111	T	0.7	0.3431	0.4569	0.00510	0.2457:0.3181:0.2427:0.1934	rs3748805;rs17855960	17	Q5T1C6	THEM4_HUMAN	R	17	ENSP00000357804:L17R;ENSP00000433304:L17R	ENSP00000357804:L17R	L	-	2	0	THEM4	150148509	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.350000	0.07721	-0.432000	0.07297	-0.358000	0.07595	CTG	T|0.073;G|0.921		0.741	THEM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036615.1	NM_053055	
LCE1E	353135	bcgsc.ca	37	1	152760075	152760075	+	Silent	SNP	A	A	G	rs201660535	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:152760075A>G	ENST00000368770.3	+	2	353	c.300A>G	c.(298-300)tcA>tcG	p.S100S	LCE1E_ENST00000368771.1_Silent_p.S100S	NM_178353.1	NP_848130.1	Q5T753	LCE1E_HUMAN	late cornified envelope 1E	100	Cys-rich.				keratinization (GO:0031424)					lung(5)|stomach(1)	6	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCAGCCCTCAGGGGGCTCCA	0.642													G|||	1333	0.266174	0.3654	0.2406	5008	,	,		14498	0.3313		0.1064	False		,,,				2504	0.2474				p.S100S		.											.	LCE1E-90	0			c.A300G						.	G		355,3853		89,177,1838	36.0	52.0	47.0		300	-4.6	0.5	1	dbSNP_132	47	177,8331		25,127,4102	no	coding-synonymous	LCE1E	NM_178353.1		114,304,5940	GG,GA,AA		2.0804,8.4363,4.1837		100/119	152760075	532,12184	2104	4254	6358	SO:0001819	synonymous_variant	353135	exon2			GCCCTCAGGGGGC	BC038391	CCDS1024.1	1q21.3	2008-02-05			ENSG00000186226	ENSG00000186226		"""Late cornified envelopes"""	29466	protein-coding gene	gene with protein product		612607				11698679	Standard	NM_178353		Approved	LEP5	uc001fan.3	Q5T753	OTTHUMG00000012405	ENST00000368770.3:c.300A>G	1.37:g.152760075A>G		142	8		50	40	NM_178353	0	0	0	0	0	D3DV30	Silent	SNP	ENST00000368770.3	37	CCDS1024.1																																																																																			A|0.995;G|0.005		0.642	LCE1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034525.1	NM_178353	
IBA57	200205	broad.mit.edu	37	1	228362441	228362441	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:228362441C>A	ENST00000366711.3	+	2	392	c.390C>A	c.(388-390)agC>agA	p.S130R	IBA57_ENST00000546123.1_5'UTR|IBA57_ENST00000484749.1_3'UTR	NM_001010867.2	NP_001010867.1	Q5T440	CAF17_HUMAN	IBA57, iron-sulfur cluster assembly homolog (S. cerevisiae)	130					glycine catabolic process (GO:0006546)|heme biosynthetic process (GO:0006783)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|poly(A) RNA binding (GO:0044822)	p.S130R(2)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|prostate(1)	11						AGTGTGACAGCTCGGTGCAGG	0.662																																					p.S130R		.											.	IBA57-90	2	Substitution - Missense(2)	prostate(1)|central_nervous_system(1)	c.C390A						.						24.0	24.0	24.0					1																	228362441		2199	4296	6495	SO:0001583	missense	200205	exon2			TGACAGCTCGGTG	AK022796	CCDS31046.1	1q42.13	2011-03-11	2011-03-11	2011-03-11	ENSG00000181873	ENSG00000181873			27302	protein-coding gene	gene with protein product	"""iron-sulfur cluster assembly factor for biotin synthase- and aconitase-like mitochondrial proteins, with a mass of 57kDa"""	615316	"""chromosome 1 open reading frame 69"""	C1orf69			Standard	NM_001010867		Approved	FLJ12734	uc001hsl.4	Q5T440	OTTHUMG00000039769	ENST00000366711.3:c.390C>A	1.37:g.228362441C>A	ENSP00000355672:p.Ser130Arg	63	1		67	11	NM_001010867	0	0	2	2	0		Missense_Mutation	SNP	ENST00000366711.3	37	CCDS31046.1	.	.	.	.	.	.	.	.	.	.	C	7.793	0.711906	0.15306	.	.	ENSG00000181873	ENST00000366711	T	0.75154	-0.91	4.65	0.706	0.18133	Glycine cleavage T-protein, N-terminal (1);	0.591122	0.18565	N	0.137486	T	0.57651	0.2068	N	0.25647	0.755	0.20307	N	0.999915	B	0.12013	0.005	B	0.20384	0.029	T	0.42582	-0.9443	10	0.28530	T	0.3	-8.2527	8.9387	0.35715	0.0:0.6235:0.0:0.3765	.	130	Q5T440	CAF17_HUMAN	R	130	ENSP00000355672:S130R	ENSP00000355672:S130R	S	+	3	2	IBA57	226429064	0.000000	0.05858	0.001000	0.08648	0.127000	0.20565	-0.053000	0.11846	-0.022000	0.13986	0.655000	0.94253	AGC	.		0.662	IBA57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095980.1	NM_001010867	
ERO1LB	56605	bcgsc.ca	37	1	236385276	236385276	+	Missense_Mutation	SNP	C	C	T	rs116000191	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:236385276C>T	ENST00000354619.5	-	14	1358	c.1157G>A	c.(1156-1158)cGt>cAt	p.R386H		NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	386					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	GTCCATTATACGGGAGATATT	0.338													C|||	21	0.00419329	0.0151	0.0014	5008	,	,		18712	0.0		0.0	False		,,,				2504	0.0				p.R386H		.											.	ERO1LB-90	0			c.G1157A						.	C	HIS/ARG	45,4361	46.7+/-81.2	1,43,2159	102.0	100.0	101.0		1157	3.6	1.0	1	dbSNP_132	101	0,8600		0,0,4300	yes	missense	ERO1LB	NM_019891.3	29	1,43,6459	TT,TC,CC		0.0,1.0213,0.346	probably-damaging	386/468	236385276	45,12961	2203	4300	6503	SO:0001583	missense	56605	exon14			ATTATACGGGAGA	AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.1157G>A	1.37:g.236385276C>T	ENSP00000346635:p.Arg386His	218	0		191	8	NM_019891	0	0	6	6	0	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Missense_Mutation	SNP	ENST00000354619.5	37	CCDS31064.1	11	0.005036630036630037	10	0.02032520325203252	1	0.0027624309392265192	0	0.0	0	0.0	C	26.4	4.731542	0.89390	0.010213	0.0	ENSG00000086619	ENST00000354619;ENST00000264181	T;T	0.48522	0.81;0.81	5.49	3.63	0.41609	.	0.145255	0.64402	N	0.000010	T	0.55289	0.1911	M	0.88105	2.93	0.80722	D	1	D	0.76494	0.999	D	0.68353	0.957	T	0.69566	-0.5111	10	0.59425	D	0.04	-5.1311	11.9727	0.53071	0.0:0.8594:0.0:0.1406	.	386	Q86YB8	ERO1B_HUMAN	H	386;111	ENSP00000346635:R386H;ENSP00000264181:R111H	ENSP00000264181:R111H	R	-	2	0	ERO1LB	234451899	1.000000	0.71417	0.988000	0.46212	0.999000	0.98932	3.824000	0.55723	0.807000	0.34208	0.650000	0.86243	CGT	C|0.996;T|0.004		0.338	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096371.1	NM_019891	
OR2C3	81472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	247694861	247694861	+	Missense_Mutation	SNP	G	G	A	rs147306837		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr1:247694861G>A	ENST00000366487.3	-	2	1314	c.953C>T	c.(952-954)gCg>gTg	p.A318V	GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000366491.2_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	318						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A317V(1)		breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CTAAATTTGCGCCAGCTTGCC	0.512																																					p.A318V		.											.	OR2C3-70	1	Substitution - Missense(1)	endometrium(1)	c.C953T						.						56.0	53.0	54.0					1																	247694861		2203	4300	6503	SO:0001583	missense	81472	exon2			ATTTGCGCCAGCT	BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.953C>T	1.37:g.247694861G>A	ENSP00000355443:p.Ala318Val	152	1		93	86	NM_198074	0	0	0	0	0	Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	ENST00000366487.3	37	CCDS1634.2	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514533	0.27123	.	.	ENSG00000196242	ENST00000366487	T	0.00472	7.19	3.56	-2.08	0.07254	.	.	.	.	.	T	0.00178	0.0005	N	0.08118	0	0.09310	N	1	B	0.17465	0.022	B	0.06405	0.002	T	0.27571	-1.0070	9	0.16896	T	0.51	.	0.5934	0.00731	0.1689:0.3067:0.1824:0.342	.	318	Q8N628	OR2C3_HUMAN	V	318	ENSP00000355443:A318V	ENSP00000355443:A318V	A	-	2	0	OR2C3	245761484	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.285000	0.08410	-0.627000	0.05589	-0.867000	0.03001	GCG	G|1.000;T|0.000		0.512	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097626.2	NM_198074	
CUBN	8029	hgsc.bcm.edu	37	10	17087956	17087956	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr10:17087956G>T	ENST00000377833.4	-	24	3532	c.3467C>A	c.(3466-3468)gCt>gAt	p.A1156D		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1156	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATCCCAGTAAGCTGAGAATCC	0.398																																					p.A1156D		.											.	CUBN-166	0			c.C3467A						.						169.0	164.0	165.0					10																	17087956		2203	4300	6503	SO:0001583	missense	8029	exon24			CAGTAAGCTGAGA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.3467C>A	10.37:g.17087956G>T	ENSP00000367064:p.Ala1156Asp	95	0		94	5	NM_001081	0	0	0	0	0	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199196	0.79015	.	.	ENSG00000107611	ENST00000377833	T	0.42131	0.98	5.66	5.66	0.87406	CUB (5);	0.000000	0.43579	D	0.000560	T	0.78685	0.4322	H	0.98256	4.185	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	D	0.86471	0.1785	10	0.72032	D	0.01	.	19.348	0.94373	0.0:0.0:1.0:0.0	.	1156	O60494	CUBN_HUMAN	D	1156	ENSP00000367064:A1156D	ENSP00000367064:A1156D	A	-	2	0	CUBN	17127962	1.000000	0.71417	0.995000	0.50966	0.498000	0.33706	7.101000	0.76997	2.668000	0.90789	0.551000	0.68910	GCT	.		0.398	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
NFKB2	4791	hgsc.bcm.edu	37	10	104159196	104159196	+	Silent	SNP	A	A	G	rs4919633	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr10:104159196A>G	ENST00000369966.3	+	13	1519	c.1269A>G	c.(1267-1269)ccA>ccG	p.P423P	NFKB2_ENST00000428099.1_Silent_p.P423P|NFKB2_ENST00000189444.6_Silent_p.P423P|NFKB2_ENST00000336486.5_3'UTR	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	423					extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	CCGCGGAGCCAAGCGCCCCCT	0.786			T	IGH@	B-NHL								G|||	4942	0.986821	0.9539	0.9942	5008	,	,		10589	1.0		0.999	False		,,,				2504	1.0				p.P423P		.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2-522	0			c.A1269G						.	G	,,	2876,76		1401,74,1	3.0	5.0	4.0		1269,1269,1269	-4.9	0.0	10	dbSNP_111	4	6622,2		3310,2,0	no	coding-synonymous,coding-synonymous,coding-synonymous	NFKB2	NM_001077493.1,NM_001077494.1,NM_002502.3	,,	4711,76,1	GG,GA,AA		0.0302,2.5745,0.8145	,,	423/900,423/901,423/900	104159196	9498,78	1476	3312	4788	SO:0001819	synonymous_variant	4791	exon13			GGAGCCAAGCGCC	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.1269A>G	10.37:g.104159196A>G		0	0		9	9	NM_001077494	0	0	0	5	5	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Silent	SNP	ENST00000369966.3	37	CCDS41564.1																																																																																			A|0.009;G|0.991		0.786	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
SMC3	9126	broad.mit.edu;ucsc.edu;bcgsc.ca	37	10	112357947	112357947	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr10:112357947A>G	ENST00000361804.4	+	20	2293	c.2167A>G	c.(2167-2169)Acc>Gcc	p.T723A		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	723					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		ACAGATCGAGACCCAGCAAAG	0.348																																					p.T723A		.											.	SMC3-92	0			c.A2167G						.						127.0	136.0	133.0					10																	112357947		2203	4300	6503	SO:0001583	missense	9126	exon20			ATCGAGACCCAGC	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.2167A>G	10.37:g.112357947A>G	ENSP00000354720:p.Thr723Ala	71	1		73	19	NM_005445	0	0	9	12	3	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	A	15.42	2.828547	0.50845	.	.	ENSG00000108055	ENST00000361804	T	0.75477	-0.94	5.55	5.55	0.83447	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.64023	0.2561	L	0.28649	0.875	0.80722	D	1	P	0.45126	0.851	B	0.43103	0.408	T	0.62426	-0.6857	10	0.07644	T	0.81	.	15.9906	0.80202	1.0:0.0:0.0:0.0	.	723	Q9UQE7	SMC3_HUMAN	A	723	ENSP00000354720:T723A	ENSP00000354720:T723A	T	+	1	0	SMC3	112347937	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.733000	0.91539	2.238000	0.73509	0.477000	0.44152	ACC	.		0.348	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050337.1	NM_005445	
RASSF7	8045	bcgsc.ca	37	11	562421	562421	+	Missense_Mutation	SNP	G	G	A	rs2242182	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:562421G>A	ENST00000397583.3	+	3	900	c.467G>A	c.(466-468)cGg>cAg	p.R156Q	RASSF7_ENST00000431809.1_Missense_Mutation_p.R156Q|RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000344375.4_Missense_Mutation_p.R156Q|RASSF7_ENST00000454668.2_Missense_Mutation_p.R156Q|C11orf35_ENST00000329451.3_5'Flank|RASSF7_ENST00000524468.1_3'UTR|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000397582.3_Missense_Mutation_p.R156Q	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	156			R -> Q (in dbSNP:rs2242182).		apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACAGACCTGCGGGGCCTGGAG	0.701													G|||	409	0.0816693	0.003	0.1398	5008	,	,		16128	0.1696		0.0517	False		,,,				2504	0.0869				p.R156Q	Pancreas(184;1170 3913 7268)	.											.	RASSF7-91	0			c.G467A						.	G	GLN/ARG,GLN/ARG,GLN/ARG	33,4161		0,33,2064	12.0	11.0	12.0		467,467,467	1.1	1.0	11	dbSNP_98	12	314,8032		7,300,3866	yes	missense,missense,missense	RASSF7	NM_001143993.1,NM_001143994.1,NM_003475.3	43,43,43	7,333,5930	AA,AG,GG		3.7623,0.7868,2.7671	benign,benign,benign	156/338,156/321,156/374	562421	347,12193	2097	4173	6270	SO:0001583	missense	8045	exon3			ACCTGCGGGGCCT	M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.467G>A	11.37:g.562421G>A	ENSP00000380713:p.Arg156Gln	112	0		91	5	NM_001143994	0	0	4	4	0	G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	ENST00000397583.3	37	CCDS7702.1	170	0.07783882783882784	2	0.0040650406504065045	35	0.09668508287292818	92	0.16083916083916083	41	0.05408970976253298	G	0.055	-1.239467	0.01493	0.007868	0.037623	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668	T;T;T;T;T	0.28666	1.61;1.61;1.6;1.6;1.62	3.52	1.13	0.20643	.	0.374590	0.26650	N	0.023219	T	0.00039	0.0001	N	0.00347	-1.61	0.80722	P	0.0	B;B;B	0.10296	0.0;0.003;0.001	B;B;B	0.04013	0.001;0.0;0.001	T	0.36040	-0.9764	9	0.02654	T	1	0.0495	5.3402	0.15979	0.3872:0.0:0.6128:0.0	rs2242182	156;156;156	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	Q	156	ENSP00000403068:R156Q;ENSP00000380712:R156Q;ENSP00000344226:R156Q;ENSP00000380713:R156Q;ENSP00000405606:R156Q	ENSP00000344226:R156Q	R	+	2	0	RASSF7	552421	0.012000	0.17670	0.963000	0.40424	0.208000	0.24298	0.289000	0.18957	0.463000	0.27118	-0.379000	0.06801	CGG	G|0.923;A|0.077		0.701	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254972.2	NM_003475	
KRTAP5-4	387267	broad.mit.edu	37	11	1643255	1643255	+	Silent	SNP	G	G	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:1643255G>A	ENST00000399682.1	-	1	113	c.69C>T	c.(67-69)ggC>ggT	p.G23G		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)		p.G23G(1)		NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cagagccacagcccccacagc	0.687																																					p.G23G		.											.	.	1	Substitution - coding silent(1)	kidney(1)	c.C69T						.						4.0	8.0	7.0					11																	1643255		646	1526	2172	SO:0001819	synonymous_variant	387267	exon1			GCCACAGCCCCCA	AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.69C>T	11.37:g.1643255G>A		176	2		166	15	NM_001012709	0	0	0	0	0		Silent	SNP	ENST00000399682.1	37																																																																																				.		0.687	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000127918.1	NM_001012709	
SYT13	57586	broad.mit.edu	37	11	45274076	45274076	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:45274076G>T	ENST00000020926.3	-	4	853	c.742C>A	c.(742-744)Cgc>Agc	p.R248S	CTD-2560E9.5_ENST00000534342.1_RNA|CTD-2560E9.5_ENST00000531663.1_RNA	NM_001247987.1|NM_020826.2	NP_001234916.1|NP_065877.1	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	248	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				vesicle-mediated transport (GO:0016192)	integral component of plasma membrane (GO:0005887)|transport vesicle (GO:0030133)				breast(1)|large_intestine(3)|lung(16)|ovary(1)|skin(2)	23						CGGGAGAAGCGGTCGCAGGTC	0.701											OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R248S		.											.	SYT13-91	0			c.C742A						.						47.0	45.0	46.0					11																	45274076		2203	4299	6502	SO:0001583	missense	57586	exon4			AGAAGCGGTCGCA	AB037848	CCDS31470.1	11p12-p11	2013-01-21			ENSG00000019505	ENSG00000019505		"""Synaptotagmins"""	14962	protein-coding gene	gene with protein product		607716				11171101	Standard	NM_020826		Approved	KIAA1427	uc001myq.2	Q7L8C5	OTTHUMG00000166504	ENST00000020926.3:c.742C>A	11.37:g.45274076G>T	ENSP00000020926:p.Arg248Ser	155	0	930	109	4	NM_020826	0	0	0	0	0	A8K4P4|D3DQP1|Q9BQS3|Q9H041|Q9P2C0	Missense_Mutation	SNP	ENST00000020926.3	37	CCDS31470.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869815	0.91587	.	.	ENSG00000019505	ENST00000020926	T	0.08896	3.04	5.85	4.88	0.63580	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.057112	0.64402	D	0.000006	T	0.23249	0.0562	M	0.62723	1.935	0.46458	D	0.999053	D	0.57899	0.981	D	0.63113	0.911	T	0.00051	-1.2194	10	0.87932	D	0	.	13.6429	0.62263	0.0:0.0:0.769:0.231	.	248	Q7L8C5	SYT13_HUMAN	S	248	ENSP00000020926:R248S	ENSP00000020926:R248S	R	-	1	0	SYT13	45230652	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.024000	0.57218	2.771000	0.95319	0.561000	0.74099	CGC	.		0.701	SYT13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390110.1	NM_020826	
DTX4	23220	broad.mit.edu	37	11	58949674	58949674	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:58949674G>T	ENST00000227451.3	+	2	778	c.674G>T	c.(673-675)gGa>gTa	p.G225V	DTX4_ENST00000532982.1_Missense_Mutation_p.G119V	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	225					innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				CCGCCTCCTGGAGTGGTCAAG	0.627																																					p.G225V		.											.	DTX4-501	0			c.G674T						.						23.0	30.0	28.0					11																	58949674		2051	4188	6239	SO:0001583	missense	23220	exon2			CTCCTGGAGTGGT	AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.674G>T	11.37:g.58949674G>T	ENSP00000227451:p.Gly225Val	71	0		51	3	NM_015177	0	0	0	0	0	Q0VF38	Missense_Mutation	SNP	ENST00000227451.3	37	CCDS44612.1	.	.	.	.	.	.	.	.	.	.	G	0.025	-1.383660	0.01194	.	.	ENSG00000110042	ENST00000532982;ENST00000227451	T;T	0.11930	2.73;2.93	4.52	2.48	0.30137	.	2.358580	0.01455	N	0.015652	T	0.16854	0.0405	L	0.44542	1.39	0.32747	N	0.506893	B	0.34372	0.451	B	0.35470	0.203	T	0.29518	-1.0009	10	0.25751	T	0.34	.	11.9819	0.53125	0.0:0.3331:0.6669:0.0	.	225	Q9Y2E6	DTX4_HUMAN	V	119;225	ENSP00000434055:G119V;ENSP00000227451:G225V	ENSP00000227451:G225V	G	+	2	0	DTX4	58706250	0.039000	0.19947	0.031000	0.17742	0.050000	0.14768	0.305000	0.19254	1.087000	0.41251	0.655000	0.94253	GGA	.		0.627	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394228.1	XM_166213	
NRXN2	9379	hgsc.bcm.edu	37	11	64374949	64374949	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:64374949G>A	ENST00000377551.1	-	22	5069	c.4858C>T	c.(4858-4860)Cgg>Tgg	p.R1620W	NRXN2_ENST00000377559.3_Missense_Mutation_p.R1550W|NRXN2_ENST00000409571.1_Missense_Mutation_p.R1613W|NRXN2_ENST00000301894.2_Missense_Mutation_p.R574W|NRXN2_ENST00000265459.6_Missense_Mutation_p.R1620W			Q9P2S2	NRX2A_HUMAN	neurexin 2	1620					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						GGCGGGCCCCGCTCCCCAGGC	0.736																																					p.R1620W		.											.	NRXN2-232	0			c.C4858T						.						11.0	12.0	12.0					11																	64374949		2193	4280	6473	SO:0001583	missense	9379	exon23			GGCCCCGCTCCCC		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.4858C>T	11.37:g.64374949G>A	ENSP00000366774:p.Arg1620Trp	2	0		26	26	NM_015080	0	0	1	3	2	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	ENST00000377551.1	37	CCDS8077.1	.	.	.	.	.	.	.	.	.	.	G	14.41	2.527064	0.44969	.	.	ENSG00000110076	ENST00000301894;ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571	T;T;T;T;T	0.65364	0.43;-0.15;-0.15;-0.15;-0.05	3.78	3.78	0.43462	.	0.137262	0.24508	U	0.037919	T	0.70202	0.3197	L	0.54323	1.7	0.37235	D	0.905867	D;D;D;D	0.89917	0.998;0.999;0.998;1.0	D;D;P;D	0.67548	0.913;0.929;0.821;0.952	T	0.75416	-0.3325	10	0.87932	D	0	.	8.5555	0.33478	0.0:0.0:0.7697:0.2303	.	1550;1620;1366;574	Q9P2S2-2;Q9P2S2;E7EV67;P58401	.;NRX2A_HUMAN;.;NRX2B_HUMAN	W	574;1620;1550;1620;1550;1613	ENSP00000301894:R574W;ENSP00000366774:R1620W;ENSP00000366782:R1550W;ENSP00000265459:R1620W;ENSP00000386416:R1613W	ENSP00000265459:R1620W	R	-	1	2	NRXN2	64131525	0.927000	0.31430	1.000000	0.80357	0.948000	0.59901	0.858000	0.27845	1.954000	0.56735	0.313000	0.20887	CGG	.		0.736	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
MEN1	4221	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	64577330	64577333	+	Frame_Shift_Del	DEL	AGAC	AGAC	-	rs386134252		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	AGAC	AGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:64577330_64577333delAGAC	ENST00000337652.1	-	2	752_755	c.249_252delGTCT	c.(247-252)ctgtctfs	p.LS83fs	MEN1_ENST00000394374.2_Frame_Shift_Del_p.LS83fs|MEN1_ENST00000377321.1_Frame_Shift_Del_p.LS83fs|MEN1_ENST00000443283.1_Frame_Shift_Del_p.LS83fs|MEN1_ENST00000312049.6_Frame_Shift_Del_p.LS83fs|MEN1_ENST00000377316.2_Frame_Shift_Del_p.LS83fs|MEN1_ENST00000315422.4_Frame_Shift_Del_p.LS83fs|MEN1_ENST00000394376.1_Frame_Shift_Del_p.LS83fs|MEN1_ENST00000377313.1_Frame_Shift_Del_p.LS83fs|MEN1_ENST00000377326.3_Frame_Shift_Del_p.LS83fs	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	83					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.I85fs*33(6)|p.I85fs*32(2)|p.L83fs*28(1)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						CGGCGATGATAGACAGGTCGGCCA	0.672			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												p.83_84del	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	.	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	MEN1-3017	9	Deletion - Frameshift(7)|Insertion - Frameshift(2)	pancreas(4)|parathyroid(2)|small_intestine(1)|NS(1)|stomach(1)	c.249_252del	GRCh37	CD075467|CD972304|CI972638	MEN1	D|I		.																																			SO:0001589	frameshift_variant	4221	exon2	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	GATGATAGACAGG	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.249_252delGTCT	11.37:g.64577330_64577333delAGAC	ENSP00000337088:p.Leu83fs	167	0		81	67	NM_130800	0	0	0	0	0	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Frame_Shift_Del	DEL	ENST00000337652.1	37	CCDS8083.1																																																																																			.		0.672	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
TM7SF2	7108	hgsc.bcm.edu	37	11	64880090	64880090	+	Silent	SNP	G	G	C	rs4930284	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:64880090G>C	ENST00000279263.7	+	2	318	c.156G>C	c.(154-156)ccG>ccC	p.P52P	AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_Silent_p.P52P|TM7SF2_ENST00000540748.1_5'UTR	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	52					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGTCCCTGCCGGGGCTGGAGG	0.756													C|||	4990	0.996406	0.9879	0.9986	5008	,	,		10438	1.0		0.999	False		,,,				2504	1.0				p.P52P		.											.	TM7SF2-91	0			c.G156C						.	C		2924,8		1458,8,0	2.0	2.0	2.0		156	-9.8	0.0	11	dbSNP_111	2	6426,0		3213,0,0	no	coding-synonymous	TM7SF2	NM_003273.2		4671,8,0	CC,CG,GG		0.0,0.2729,0.0855		52/419	64880090	9350,8	1466	3213	4679	SO:0001819	synonymous_variant	7108	exon2			CCTGCCGGGGCTG	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.156G>C	11.37:g.64880090G>C		0	0		6	6	NM_003273	0	0	0	39	39	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Silent	SNP	ENST00000279263.7	37	CCDS41669.1																																																																																			G|0.005;C|0.995		0.756	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385234.1	NM_003273	
CST6	1474	hgsc.bcm.edu	37	11	65779590	65779590	+	Silent	SNP	C	C	T	rs1131544	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:65779590C>T	ENST00000312134.2	+	1	279	c.75C>T	c.(73-75)gaC>gaT	p.D25D		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	25					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TGCCACGCGACGCCCGGGCCC	0.746													C|||	356	0.0710863	0.0219	0.0922	5008	,	,		12347	0.001		0.162	False		,,,				2504	0.1012				p.D25D		.											.	CST6-523	0			c.C75T						.	C		164,3936		5,154,1891	5.0	6.0	5.0		75	-4.6	0.0	11	dbSNP_86	5	1227,6867		88,1051,2908	no	coding-synonymous	CST6	NM_001323.3		93,1205,4799	TT,TC,CC		15.1594,4.0,11.4072		25/150	65779590	1391,10803	2050	4047	6097	SO:0001819	synonymous_variant	1474	exon1			ACGCGACGCCCGG	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.75C>T	11.37:g.65779590C>T		0	0		14	14	NM_001323	0	0	0	0	0	Q540N7	Silent	SNP	ENST00000312134.2	37	CCDS8126.1																																																																																			C|0.921;T|0.079		0.746	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810209	65810209	+	Silent	SNP	C	C	T	rs61895584	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:65810209C>T	ENST00000312006.4	-	3	1346	c.1065G>A	c.(1063-1065)ccG>ccA	p.P355P	GAL3ST3_ENST00000527878.1_Silent_p.P355P	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	355					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						TGGGCTGCCACGGCTGCAGCT	0.741													C|||	3763	0.751398	0.5408	0.8746	5008	,	,		7225	0.7649		0.8549	False		,,,				2504	0.8282				p.P355P		.											.	GAL3ST3-91	0			c.G1065A						.	C		1752,666		619,514,76	3.0	2.0	2.0		1065	-9.2	0.7	11	dbSNP_129	2	4565,363		2119,327,18	no	coding-synonymous	GAL3ST3	NM_033036.2		2738,841,94	TT,TC,CC		7.3661,27.5434,14.0076		355/432	65810209	6317,1029	1209	2464	3673	SO:0001819	synonymous_variant	89792	exon3			CTGCCACGGCTGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1065G>A	11.37:g.65810209C>T		0	0		5	5	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			C|0.233;T|0.767		0.741	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
KRTAP5-8	57830	ucsc.edu	37	11	71249125	71249125	+	Silent	SNP	A	A	G	rs537752041|rs113379698|rs55848980	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:71249125A>G	ENST00000398534.3	+	1	55	c.24A>G	c.(22-24)ggA>ggG	p.G8G		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	8						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						GCTGCTCTGGAGGCTGTGGCT	0.652																																					p.G8G		.											.	KRTAP5-8-44	0			c.A24G						.						47.0	66.0	60.0					11																	71249125		2189	4280	6469	SO:0001819	synonymous_variant	57830	exon1			CTCTGGAGGCTGT	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.24A>G	11.37:g.71249125A>G		258	5		118	14	NM_021046	0	0	0	0	0	Q6L8G7|Q6UTX6	Silent	SNP	ENST00000398534.3	37	CCDS41683.1																																																																																			A|0.500;G|0.500		0.652	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
KRTAP5-8	57830	ucsc.edu	37	11	71249152	71249152	+	Silent	SNP	C	C	T	rs112809261	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:71249152C>T	ENST00000398534.3	+	1	82	c.51C>T	c.(49-51)tgC>tgT	p.C17C		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	17						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						GTGGGGGCTGCGGCTCTGGCT	0.652																																					p.C17C		.											.	KRTAP5-8-44	0			c.C51T						.						55.0	75.0	68.0					11																	71249152		2195	4284	6479	SO:0001819	synonymous_variant	57830	exon1			GGGCTGCGGCTCT	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	ENST00000398534.3:c.51C>T	11.37:g.71249152C>T		189	2		101	34	NM_021046	0	0	0	0	0	Q6L8G7|Q6UTX6	Silent	SNP	ENST00000398534.3	37	CCDS41683.1																																																																																			C|0.896;T|0.104		0.652	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127954.1	NM_021046	
ATM	472	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	108142086	108142098	+	Frame_Shift_Del	DEL	CACAAGGGATGCT	CACAAGGGATGCT	-	rs587782163		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	CACAAGGGATGCT	CACAAGGGATGCT	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:108142086_108142098delCACAAGGGATGCT	ENST00000452508.2	+	21	3219_3231	c.3030_3042delCACAAGGGATGCT	c.(3028-3042)aacacaagggatgctfs	p.NTRDA1010fs	ATM_ENST00000278616.4_Frame_Shift_Del_p.NTRDA1010fs			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1010					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ACTCTGAGAACACAAGGGATGCTCAAGGACAGT	0.371			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.1010_1014del		.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM-3419	0			c.3030_3042del						.																																			SO:0001589	frameshift_variant	472	exon20	Familial Cancer Database	AT, Louis-Bar syndrome	TGAGAACACAAGG	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3030_3042delCACAAGGGATGCT	11.37:g.108142086_108142098delCACAAGGGATGCT	ENSP00000388058:p.Asn1010fs	156	0		35	25	NM_000051	0	0	0	0	0	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Frame_Shift_Del	DEL	ENST00000452508.2	37	CCDS31669.1																																																																																			.		0.371	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
ZW10	9183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	113631587	113631587	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:113631587C>A	ENST00000200135.3	-	3	438	c.294G>T	c.(292-294)caG>caT	p.Q98H		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	98	Interaction with RINT1.				ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		CTCTTTCCAACTGCTGCTTTA	0.413																																					p.Q98H		.											.	ZW10-228	0			c.G294T						.						108.0	92.0	97.0					11																	113631587		2201	4296	6497	SO:0001583	missense	9183	exon3			TTCCAACTGCTGC	U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.294G>T	11.37:g.113631587C>A	ENSP00000200135:p.Gln98His	153	0		89	81	NM_004724	0	0	0	2	2	A1A528	Missense_Mutation	SNP	ENST00000200135.3	37	CCDS8363.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767567	0.69878	.	.	ENSG00000086827	ENST00000200135	T	0.54479	0.57	4.96	2.07	0.26955	.	0.051681	0.85682	D	0.000000	T	0.56572	0.1994	M	0.72118	2.19	0.53688	D	0.999978	P	0.39376	0.67	P	0.46796	0.527	T	0.56661	-0.7942	10	0.72032	D	0.01	-8.1246	8.1231	0.30982	0.0:0.7492:0.0:0.2508	.	98	O43264	ZW10_HUMAN	H	98	ENSP00000200135:Q98H	ENSP00000200135:Q98H	Q	-	3	2	ZW10	113136797	0.997000	0.39634	0.972000	0.41901	0.977000	0.68977	1.627000	0.37050	0.379000	0.24794	0.484000	0.47621	CAG	.		0.413	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398700.1	NM_004724	
TUBA1C	84790	ucsc.edu	37	12	49666152	49666152	+	Silent	SNP	G	G	A	rs199599214	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr12:49666152G>A	ENST00000301072.6	+	4	767	c.492G>A	c.(490-492)aaG>aaA	p.K164K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Silent_p.K234K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	164					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.K164K(1)		endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						ATGGCAAGAAGTCCAAGCTGG	0.547																																					p.K164K		.											.	TUBA1C-90	1	Substitution - coding silent(1)	large_intestine(1)	c.G492A						.						56.0	58.0	57.0					12																	49666152		2203	4300	6503	SO:0001819	synonymous_variant	84790	exon4			CAAGAAGTCCAAG	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.492G>A	12.37:g.49666152G>A		312	18		387	17	NM_032704	0	1	779	920	139		Silent	SNP	ENST00000301072.6	37	CCDS8782.1																																																																																			G|0.998;A|0.002		0.547	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404424.1	NM_032704	
C1QL4	338761	broad.mit.edu	37	12	49729895	49729895	+	Silent	SNP	A	A	C			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr12:49729895A>C	ENST00000334221.3	-	1	1076	c.366T>G	c.(364-366)ggT>ggG	p.G122G		NM_001008223.1	NP_001008224.1	Q86Z23	C1QL4_HUMAN	complement component 1, q subcomponent-like 4	122	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular region (GO:0005576)				large_intestine(2)|lung(1)|ovary(1)|skin(1)	5						GCACCTCGTAACCCTCGTGGG	0.697																																					p.G122G		.											.	C1QL4-90	0			c.T366G						.						20.0	20.0	20.0					12																	49729895		2200	4299	6499	SO:0001819	synonymous_variant	338761	exon1			CTCGTAACCCTCG		CCDS31793.1	12q13.12	2012-04-12				ENSG00000186897			31416	protein-coding gene	gene with protein product		615229					Standard	NM_001008223		Approved	C1QTNF11, CTRP11	uc001rtz.1	Q86Z23	OTTHUMG00000169515	ENST00000334221.3:c.366T>G	12.37:g.49729895A>C		97	4		147	19	NM_001008223	0	0	0	0	0		Silent	SNP	ENST00000334221.3	37	CCDS31793.1																																																																																			.		0.697	C1QL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404561.1	NM_001008223	
HOXC9	3225	hgsc.bcm.edu	37	12	54394337	54394337	+	Missense_Mutation	SNP	C	C	T	rs11829948	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr12:54394337C>T	ENST00000303450.4	+	1	435	c.365C>T	c.(364-366)gCc>gTc	p.A122V	HOXC-AS1_ENST00000512427.1_RNA|HOXC-AS1_ENST00000505700.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron|HOXC9_ENST00000508190.1_Missense_Mutation_p.A122V|HOXC9_ENST00000504557.1_Intron	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	122					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						AAGCCGGACGCCTACCCCGGG	0.756													C|||	95	0.0189696	0.0681	0.0072	5008	,	,		10439	0.0		0.0	False		,,,				2504	0.0				p.A122V		.											.	HOXC9-155	0			c.C365T						.	C	VAL/ALA	117,2951		1,115,1418	3.0	3.0	3.0		365	4.0	1.0	12	dbSNP_120	3	6,6564		0,6,3279	no	missense	HOXC9	NM_006897.1	64	1,121,4697	TT,TC,CC		0.0913,3.8136,1.2762	benign	122/261	54394337	123,9515	1534	3285	4819	SO:0001583	missense	3225	exon1			CGGACGCCTACCC		CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.365C>T	12.37:g.54394337C>T	ENSP00000302836:p.Ala122Val	0	0		9	6	NM_006897	0	0	0	0	0	B2RCN7|Q9H1I0	Missense_Mutation	SNP	ENST00000303450.4	37	CCDS8869.1	35	0.016025641025641024	34	0.06910569105691057	1	0.0027624309392265192	0	0.0	0	0.0	C	16.04	3.008860	0.54361	0.038136	9.13E-4	ENSG00000180806	ENST00000508190;ENST00000303450	D;D	0.93712	-3.27;-3.27	4.04	4.04	0.47022	Hox9, N-terminal activation domain (1);	0.072669	0.56097	D	0.000037	T	0.50034	0.1592	L	0.38692	1.165	0.80722	D	1	B	0.19200	0.034	B	0.22152	0.038	T	0.74500	-0.3645	10	0.40728	T	0.16	.	15.4974	0.75666	0.0:1.0:0.0:0.0	rs11829948	122	P31274	HXC9_HUMAN	V	122	ENSP00000423861:A122V;ENSP00000302836:A122V	ENSP00000302836:A122V	A	+	2	0	HOXC9	52680604	.	.	1.000000	0.80357	0.998000	0.95712	.	.	2.268000	0.75426	0.561000	0.74099	GCC	C|0.980;T|0.020		0.756	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358958.1		
LRRIQ1	84125	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	85449577	85449577	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr12:85449577C>T	ENST00000393217.2	+	8	1067	c.1006C>T	c.(1006-1008)Cga>Tga	p.R336*		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	336	Glu-rich.									breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		ggaagaaaatcgaaaaagatt	0.328																																					p.R336X		.											.	LRRIQ1-95	0			c.C1006T						.						22.0	22.0	22.0					12																	85449577		2189	4272	6461	SO:0001587	stop_gained	84125	exon8			GAAAATCGAAAAA	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1006C>T	12.37:g.85449577C>T	ENSP00000376910:p.Arg336*	102	0		146	75	NM_001079910	0	0	0	0	0	Q567P4|Q9BS17|Q9HA36	Nonsense_Mutation	SNP	ENST00000393217.2	37	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	C	12.69	2.013080	0.35511	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	5.27	-0.965	0.10323	.	1.932060	0.03227	N	0.178422	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5262	0.39165	0.5233:0.4032:0.0:0.0735	.	.	.	.	X	336;311;336	.	ENSP00000256007:R336X	R	+	1	2	LRRIQ1	83973708	0.000000	0.05858	0.000000	0.03702	0.146000	0.21551	-0.159000	0.10056	-0.055000	0.13244	0.313000	0.20887	CGA	.		0.328	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
AMDHD1	144193	hgsc.bcm.edu	37	12	96337225	96337225	+	Silent	SNP	C	C	T	rs1436121	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr12:96337225C>T	ENST00000266736.2	+	1	155	c.49C>T	c.(49-51)Ctg>Ttg	p.L17L	CCDC38_ENST00000549752.1_5'Flank|CCDC38_ENST00000546386.1_5'Flank|CCDC38_ENST00000344280.3_5'Flank	NM_152435.2	NP_689648.2	Q96NU7	HUTI_HUMAN	amidohydrolase domain containing 1	17					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	imidazolonepropionase activity (GO:0050480)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|skin(1)	22						GCAAGTGGTGCTGGTGTGCGC	0.741													C|||	1276	0.254792	0.09	0.1297	5008	,	,		11076	0.4732		0.2445	False		,,,				2504	0.3517				p.L17L		.											.	AMDHD1-90	0			c.C49T						.	C		259,2703		9,241,1231	3.0	4.0	4.0		49	1.4	1.0	12	dbSNP_88	4	983,4553		75,833,1860	no	coding-synonymous	AMDHD1	NM_152435.2		84,1074,3091	TT,TC,CC		17.7565,8.7441,14.6152		17/427	96337225	1242,7256	1481	2768	4249	SO:0001819	synonymous_variant	144193	exon1			GTGGTGCTGGTGT	AB075878	CCDS9057.1	12q23.1	2006-02-02				ENSG00000139344			28577	protein-coding gene	gene with protein product							Standard	NM_152435		Approved	MGC35366	uc001tel.2	Q96NU7	OTTHUMG00000170353	ENST00000266736.2:c.49C>T	12.37:g.96337225C>T		0	0		16	11	NM_152435	0	0	0	0	0	A8K463|Q68CI8	Silent	SNP	ENST00000266736.2	37	CCDS9057.1																																																																																			C|0.752;T|0.248		0.741	AMDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408640.1	NM_152435	
TMEM119	338773	broad.mit.edu;mdanderson.org	37	12	108985995	108985995	+	Silent	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr12:108985995C>T	ENST00000392806.3	-	2	333	c.165G>A	c.(163-165)ccG>ccA	p.P55P		NM_181724.2	NP_859075.2	Q4V9L6	TM119_HUMAN	transmembrane protein 119	55					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.P55P(1)		large_intestine(2)|lung(3)|ovary(1)|skin(1)	7						TCCAGGGTGGCGGGAGGCTCG	0.706																																					p.P55P		.											.	TMEM119-69	1	Substitution - coding silent(1)	large_intestine(1)	c.G165A						.						18.0	23.0	22.0					12																	108985995		2201	4293	6494	SO:0001819	synonymous_variant	338773	exon2			GGGTGGCGGGAGG	AK075501	CCDS9119.1	12q23.3	2014-02-12				ENSG00000183160			27884	protein-coding gene	gene with protein product						12975309	Standard	NM_181724		Approved		uc001tng.3	Q4V9L6		ENST00000392806.3:c.165G>A	12.37:g.108985995C>T		37	0		75	17	NM_181724	0	0	0	0	0	Q6UXE5|Q8N2F5	Silent	SNP	ENST00000392806.3	37	CCDS9119.1																																																																																			.		0.706	TMEM119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403900.1	NM_181724	
CLN5	1203	hgsc.bcm.edu	37	13	77566320	77566320	+	Silent	SNP	C	C	G	rs138037471	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr13:77566320C>G	ENST00000377453.3	+	1	1526	c.234C>G	c.(232-234)gcC>gcG	p.A78A	CLN5_ENST00000485938.1_3'UTR	NM_006493.2	NP_006484.1	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5	29					brain development (GO:0007420)|cell death (GO:0008219)|glycosylation (GO:0070085)|lysosomal lumen acidification (GO:0007042)|neurogenesis (GO:0022008)|neuron maturation (GO:0042551)|protein catabolic process (GO:0030163)|signal peptide processing (GO:0006465)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|vacuolar lumen (GO:0005775)	mannose binding (GO:0005537)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		GGTGCTGGGCCCTGGCGCTGC	0.751													C|||	65	0.0129792	0.0038	0.0245	5008	,	,		9947	0.0		0.0338	False		,,,				2504	0.0092				p.A78A		.											.	CLN5-91	0			c.C234G						.	C		32,4234		1,30,2102	9.0	12.0	11.0		234	-0.0	0.0	13	dbSNP_134	11	254,8136		2,250,3943	no	coding-synonymous	CLN5	NM_006493.2		3,280,6045	GG,GC,CC		3.0274,0.7501,2.2598		78/408	77566320	286,12370	2133	4195	6328	SO:0001819	synonymous_variant	1203	exon1			CTGGGCCCTGGCG		CCDS9456.1	13q21.2-q32	2014-09-17			ENSG00000102805	ENSG00000102805			2076	protein-coding gene	gene with protein product		608102				7942847, 8661106	Standard	NM_006493		Approved		uc001vkc.3	O75503	OTTHUMG00000017100	ENST00000377453.3:c.234C>G	13.37:g.77566320C>G		1	0		9	8	NM_006493	0	0	0	3	3	B3KQK7	Silent	SNP	ENST00000377453.3	37	CCDS9456.1																																																																																			C|0.985;G|0.015		0.751	CLN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045318.1	NM_006493	
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		0	0		8	8	NM_018139	0	0	0	1	1	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
HHIPL1	84439	bcgsc.ca;mdanderson.org	37	14	100141747	100141747	+	Silent	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr14:100141747C>T	ENST00000330710.5	+	9	2231	c.2133C>T	c.(2131-2133)gtC>gtT	p.V711V		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	711	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GCGCCGCCGTCGTGTGTCGCC	0.711																																					p.V711V		.											.	HHIPL1-70	0			c.C2133T						.						7.0	10.0	9.0					14																	100141747		678	1573	2251	SO:0001819	synonymous_variant	84439	exon9			CGCCGTCGTGTGT	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2133C>T	14.37:g.100141747C>T		9	1		53	53	NM_001127258	0	0	0	0	0	A2RUF8|B2RN09|Q6UXX2	Silent	SNP	ENST00000330710.5	37	CCDS45162.1																																																																																			.		0.711	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
DYX1C1	161582	broad.mit.edu	37	15	55759242	55759242	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr15:55759242delT	ENST00000321149.3	-	5	890	c.523delA	c.(523-525)attfs	p.I175fs	DYX1C1_ENST00000348518.3_Frame_Shift_Del_p.I175fs|DYX1C1_ENST00000457155.2_Frame_Shift_Del_p.I175fs|DYX1C1_ENST00000380679.1_Frame_Shift_Del_p.I175fs|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000448430.2_Frame_Shift_Del_p.I175fs	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	175					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)	p.I175fs*21(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		tctctctgaatttttttttgc	0.279																																					p.I175fs		.											.	DYX1C1-91	1	Deletion - Frameshift(1)	ovary(1)	c.523delA						.		,,	58,4074		8,42,2016	49.0	42.0	45.0		,,	1.2	0.0	15		44	114,7900		12,90,3905	no	frameshift,frameshift,frameshift	DYX1C1	NM_130810.3,NM_001033560.1,NM_001033559.2	,,	20,132,5921	A1A1,A1R,RR		1.4225,1.4037,1.4161	,,	,,	55759242	172,11974	2140	4191	6331	SO:0001589	frameshift_variant	161582	exon5			TCTGAATTTTTTT		CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.523delA	15.37:g.55759242delT	ENSP00000323275:p.Ile175fs	8	0		6	2	NM_001033560	0	0	0	0	0	Q6P5Y9|Q8N1S6	Frame_Shift_Del	DEL	ENST00000321149.3	37	CCDS10154.1																																																																																			.		0.279	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254976.1	NM_130810	
LRRK1	79705	broad.mit.edu	37	15	101606029	101606029	+	Missense_Mutation	SNP	C	C	A	rs34876840	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr15:101606029C>A	ENST00000388948.3	+	32	5746	c.5387C>A	c.(5386-5388)cCc>cAc	p.P1796H	RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000532145.1_3'UTR|LRRK1_ENST00000284395.5_Missense_Mutation_p.P1793H	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GACACGGAACCCCCGGCAGCC	0.647													C|||	18	0.00359425	0.0	0.0058	5008	,	,		16574	0.0		0.0089	False		,,,				2504	0.0051				p.P1796H		.											.	LRRK1-602	0			c.C5387A						.	C	HIS/PRO	6,4040		0,6,2017	40.0	48.0	45.0		5387	2.4	0.0	15	dbSNP_126	45	69,8259		0,69,4095	yes	missense	LRRK1	NM_024652.3	77	0,75,6112	AA,AC,CC		0.8285,0.1483,0.6061	benign	1796/2016	101606029	75,12299	2023	4164	6187	SO:0001583	missense	79705	exon32			CGGAACCCCCGGC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.5387C>A	15.37:g.101606029C>A	ENSP00000373600:p.Pro1796His	86	0		47	4	NM_024652	0	0	0	0	0		Missense_Mutation	SNP	ENST00000388948.3	37	CCDS42086.1	5	0.0022893772893772895	0	0.0	2	0.0055248618784530384	0	0.0	3	0.00395778364116095	C	8.266	0.812297	0.16537	0.001483	0.008285	ENSG00000154237	ENST00000388948;ENST00000284395;ENST00000529762;ENST00000542170	T;T	0.72282	-0.62;-0.64	5.7	2.39	0.29439	.	0.851070	0.10915	N	0.620128	T	0.46386	0.1390	L	0.29908	0.895	0.09310	N	1	B	0.24368	0.102	B	0.27262	0.078	T	0.41395	-0.9511	10	0.37606	T	0.19	.	2.8787	0.05640	0.0:0.4378:0.2424:0.3199	rs34876840	1796	Q38SD2	LRRK1_HUMAN	H	1796;1793;487;350	ENSP00000373600:P1796H;ENSP00000284395:P1793H	ENSP00000284395:P1793H	P	+	2	0	LRRK1	99423552	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.512000	0.22755	0.729000	0.32403	0.655000	0.94253	CCC	C|0.996;A|0.004		0.647	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
SIAH1	6477	broad.mit.edu	37	16	48396114	48396114	+	Silent	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr16:48396114G>T	ENST00000380006.2	-	1	1679	c.226C>A	c.(226-228)Cgg>Agg	p.R76R	SIAH1_ENST00000394725.2_Silent_p.R76R|SIAH1_ENST00000573005.1_5'Flank|SIAH1_ENST00000356721.3_Silent_p.R107R			Q8IUQ4	SIAH1_HUMAN	siah E3 ubiquitin protein ligase 1	76					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell cycle (GO:0007049)|nervous system development (GO:0007399)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein catabolic process (GO:0030163)|protein destabilization (GO:0031648)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	beta-catenin destruction complex (GO:0030877)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R76W(1)|p.R107W(1)		endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|stomach(1)	7		all_cancers(37;0.157)|all_lung(18;0.11)|Breast(268;0.238)				AAAGGGCCCCGGCAAGTTGGA	0.463																																					p.R107R		.											.	SIAH1-415	2	Substitution - Missense(2)	endometrium(2)	c.C319A						.						75.0	73.0	74.0					16																	48396114		2200	4300	6500	SO:0001819	synonymous_variant	6477	exon2			GGCCCCGGCAAGT	U76247	CCDS10735.1, CCDS32444.1	16q12.1	2013-06-03	2012-02-23		ENSG00000196470	ENSG00000196470			10857	protein-coding gene	gene with protein product		602212	"""seven in absentia homolog 1 (Drosophila)"""			9403064, 9334332	Standard	NM_001006610		Approved	hSIAH1	uc002efo.1	Q8IUQ4	OTTHUMG00000175417	ENST00000380006.2:c.226C>A	16.37:g.48396114G>T		106	0		104	4	NM_001006610	0	0	21	21	0	A0FKF3|O43269|Q49A58|Q92880	Silent	SNP	ENST00000380006.2	37	CCDS10735.1																																																																																			.		0.463	SIAH1-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256842.12		
HEATR3	55027	bcgsc.ca	37	16	50112894	50112894	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr16:50112894G>T	ENST00000299192.7	+	7	1197	c.1006G>T	c.(1006-1008)Gtc>Ttc	p.V336F	HEATR3_ENST00000285767.4_Missense_Mutation_p.V250F	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	336										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TAAAAGAAGAGTCAGAAGGAA	0.358																																					p.V336F		.											.	HEATR3-92	0			c.G1006T						.						71.0	77.0	75.0					16																	50112894		2198	4300	6498	SO:0001583	missense	55027	exon7			AGAAGAGTCAGAA	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1006G>T	16.37:g.50112894G>T	ENSP00000299192:p.Val336Phe	57	0		71	4	NM_182922	0	0	3	3	0	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	ENST00000299192.7	37	CCDS10739.1	.	.	.	.	.	.	.	.	.	.	G	7.727	0.698486	0.15106	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.32023	1.47;1.47	5.84	3.85	0.44370	Armadillo-type fold (1);	0.753997	0.13096	N	0.414146	T	0.24812	0.0602	L	0.41236	1.265	0.33413	D	0.578924	B;B	0.33919	0.432;0.148	B;B	0.27500	0.075;0.08	T	0.28267	-1.0049	10	0.54805	T	0.06	.	11.3485	0.49575	0.0688:0.1315:0.7997:0.0	.	250;336	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	F	250;336	ENSP00000285767:V250F;ENSP00000299192:V336F	ENSP00000285767:V250F	V	+	1	0	HEATR3	48670395	0.997000	0.39634	0.999000	0.59377	0.435000	0.31806	0.992000	0.29667	0.774000	0.33427	0.551000	0.68910	GTC	.		0.358	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
THAP11	57215	hgsc.bcm.edu	37	16	67876796	67876796	+	Silent	SNP	A	A	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr16:67876796A>G	ENST00000303596.1	+	1	584	c.339A>G	c.(337-339)caA>caG	p.Q113Q	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	113	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		agcagcagcaacagcagcaac	0.687																																					p.Q113Q		.											.	THAP11-90	0			c.A339G						.						17.0	22.0	20.0					16																	67876796		1979	3907	5886	SO:0001819	synonymous_variant	57215	exon1			GCAGCAACAGCAG	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.339A>G	16.37:g.67876796A>G		13	0		31	5	NM_020457	0	0	7	18	11	A4UCT5|A8K002|O94795	Silent	SNP	ENST00000303596.1	37	CCDS10847.1																																																																																			.		0.687	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457	
THAP11	57215	hgsc.bcm.edu;ucsc.edu	37	16	67876805	67876805	+	Silent	SNP	A	A	G	rs28434205	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr16:67876805A>G	ENST00000303596.1	+	1	593	c.348A>G	c.(346-348)caA>caG	p.Q116Q	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	116	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.Q116Q(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		aacagcagcaacagcagcagc	0.682																																					p.Q116Q		.											.	THAP11-90	1	Substitution - coding silent(1)	lung(1)	c.A348G						.	G	,	14,3828		0,14,1907	21.0	26.0	24.0		348,	-3.2	0.7	16	dbSNP_125	24	20,7612		0,20,3796	no	coding-synonymous,intron	THAP11,CENPT	NM_020457.2,NM_025082.3	,	0,34,5703	GG,GA,AA		0.2621,0.3644,0.2963	,	116/315,	67876805	34,11440	1921	3816	5737	SO:0001819	synonymous_variant	57215	exon1			GCAGCAACAGCAG	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.348A>G	16.37:g.67876805A>G		16	0		30	12	NM_020457	0	0	5	41	36	A4UCT5|A8K002|O94795	Silent	SNP	ENST00000303596.1	37	CCDS10847.1																																																																																			A|0.991;G|0.009		0.682	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457	
THAP11	57215	hgsc.bcm.edu	37	16	67876814	67876814	+	Silent	SNP	G	G	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr16:67876814G>A	ENST00000303596.1	+	1	602	c.357G>A	c.(355-357)caG>caA	p.Q119Q	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	119	Gln-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		aacagcagcagcagcagcaac	0.662																																					p.Q119Q		.											.	THAP11-90	0			c.G357A						.						24.0	30.0	28.0					16																	67876814		1929	3820	5749	SO:0001819	synonymous_variant	57215	exon1			GCAGCAGCAGCAG	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.357G>A	16.37:g.67876814G>A		18	0		27	6	NM_020457	0	0	13	13	0	A4UCT5|A8K002|O94795	Silent	SNP	ENST00000303596.1	37	CCDS10847.1																																																																																			G|0.997;A|0.003		0.662	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268879.1	NM_020457	
IST1	9798	ucsc.edu	37	16	71956517	71956517	+	Silent	SNP	C	C	A	rs549750934|rs372825060	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr16:71956517C>A	ENST00000378799.6	+	7	1049	c.693C>A	c.(691-693)ccC>ccA	p.P231P	IST1_ENST00000541571.2_Silent_p.P231P|IST1_ENST00000329908.8_Silent_p.P231P|IST1_ENST00000538850.1_Silent_p.P83P|IST1_ENST00000538565.1_3'UTR|RP11-498D10.5_ENST00000567146.1_RNA|IST1_ENST00000535424.1_Silent_p.P244P|IST1_ENST00000606369.1_Silent_p.P83P|IST1_ENST00000544564.1_Silent_p.P231P|IST1_ENST00000378798.5_Silent_p.P231P			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	229	Interaction with VPS37B.|Interaction with VTA1.				abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										tgccaatgcccatgcccatgc	0.498																																					p.P244P		.											.	.	0			c.C732A						.						102.0	70.0	81.0					16																	71956517		2198	4300	6498	SO:0001819	synonymous_variant	9798	exon8			AATGCCCATGCCC	BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.693C>A	16.37:g.71956517C>A		77	3		83	21	NM_001270976	0	0	0	0	0	A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Silent	SNP	ENST00000378799.6	37	CCDS59272.1	.	.	.	.	.	.	.	.	.	.	C	7.943	0.743115	0.15642	.	.	ENSG00000182149	ENST00000541848	.	.	.	5.54	-4.88	0.03113	.	0.046113	0.85682	D	0.000000	T	0.58750	0.2144	.	.	.	0.58432	D	0.999993	.	.	.	.	.	.	T	0.60454	-0.7260	6	0.62326	D	0.03	-2.7071	8.7497	0.34609	0.1145:0.2195:0.0:0.666	.	.	.	.	Q	118	.	ENSP00000437499:P118Q	P	+	2	0	KIAA0174	70514018	0.000000	0.05858	0.488000	0.27440	0.917000	0.54804	-3.886000	0.00342	-0.979000	0.03529	-0.122000	0.15005	CCA	C|0.984;A|0.016		0.498	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269005.2	NM_014761	
IST1	9798	ucsc.edu	37	16	71956529	71956529	+	Silent	SNP	C	C	T	rs28701631	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr16:71956529C>T	ENST00000378799.6	+	7	1061	c.705C>T	c.(703-705)ccC>ccT	p.P235P	IST1_ENST00000541571.2_Silent_p.P235P|IST1_ENST00000329908.8_Silent_p.P235P|IST1_ENST00000538850.1_Silent_p.P87P|IST1_ENST00000538565.1_3'UTR|RP11-498D10.5_ENST00000567146.1_RNA|IST1_ENST00000535424.1_Silent_p.P248P|IST1_ENST00000606369.1_Silent_p.P87P|IST1_ENST00000544564.1_Silent_p.P235P|IST1_ENST00000378798.5_Silent_p.P235P			P53990	IST1_HUMAN	increased sodium tolerance 1 homolog (yeast)	233	Interaction with VPS37B.|Interaction with VTA1.				abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of proteolysis (GO:0045862)|protein localization (GO:0008104)|viral capsid secondary envelopment (GO:0046745)|viral release from host cell (GO:0019076)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|midbody (GO:0030496)	MIT domain binding (GO:0090541)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)										tgcccatgcccatgcctatgc	0.483													C|||	230	0.0459265	0.0197	0.0274	5008	,	,		18639	0.0258		0.0427	False		,,,				2504	0.1186				p.P248P		.											.	.	0			c.C744T						.						101.0	73.0	83.0					16																	71956529		2198	4300	6498	SO:0001819	synonymous_variant	9798	exon8			CATGCCCATGCCT	BC004359	CCDS10905.1, CCDS59271.1, CCDS59272.1, CCDS59273.1, CCDS59274.1	16q22.2	2011-08-18	2011-08-18	2011-08-18	ENSG00000182149	ENSG00000182149			28977	protein-coding gene	gene with protein product			"""KIAA0174"""	KIAA0174		8724849, 19129480	Standard	NM_001270975		Approved		uc002fbm.2	P53990	OTTHUMG00000137597	ENST00000378799.6:c.705C>T	16.37:g.71956529C>T		76	0		75	15	NM_001270976	0	0	0	0	0	A8KAH5|J3QLU7|Q3SYM4|Q9BQ81|Q9BWN2	Silent	SNP	ENST00000378799.6	37	CCDS59272.1	58	0.026556776556776556	9	0.018292682926829267	10	0.027624309392265192	25	0.043706293706293704	14	0.018469656992084433	C	6.629	0.484439	0.12641	.	.	ENSG00000182149	ENST00000541848	.	.	.	.	.	.	.	0.095345	0.85682	D	0.000000	T	0.22551	0.0544	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.12967	-1.0527	4	0.26408	T	0.33	-5.2082	.	.	.	rs28701631	.	.	.	L	122	.	ENSP00000437499:P122L	P	+	2	0	KIAA0174	70514030	0.004000	0.15560	0.997000	0.53966	0.971000	0.66376	-3.311000	0.00517	0.361000	0.24292	0.366000	0.22137	CCA	C|0.988;T|0.012		0.483	IST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269005.2	NM_014761	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	3	0		27	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZZEF1	23140	hgsc.bcm.edu	37	17	4046101	4046101	+	Missense_Mutation	SNP	A	A	G	rs1454121	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:4046101A>G	ENST00000381638.2	-	1	213	c.89T>C	c.(88-90)gTc>gCc	p.V30A	CYB5D2_ENST00000575251.1_5'Flank|CYB5D2_ENST00000301391.3_5'Flank|ZZEF1_ENST00000574474.1_5'UTR|CYB5D2_ENST00000573984.1_5'Flank	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	30			V -> A (in dbSNP:rs1454121). {ECO:0000269|PubMed:14702039}.				calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CGTGCCCGAGACCGCGGCCCA	0.746													A|||	4028	0.804313	0.4781	0.8617	5008	,	,		11055	1.0		0.8529	False		,,,				2504	0.953				p.V30A		.											.	ZZEF1-93	0			c.T89C						.						2.0	2.0	2.0					17																	4046101		1609	3070	4679	SO:0001583	missense	23140	exon1			CCCGAGACCGCGG	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.89T>C	17.37:g.4046101A>G	ENSP00000371051:p.Val30Ala	0	0		8	8	NM_015113	0	0	0	0	0	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	37	CCDS11043.1	1773	0.8118131868131868	254	0.516260162601626	308	0.850828729281768	572	1.0	639	0.8430079155672823	A	12.64	1.999923	0.35320	.	.	ENSG00000074755	ENST00000381638	T	0.18810	2.19	4.8	1.17	0.20885	.	0.614467	0.15724	N	0.247743	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20107	-1.0285	9	0.33940	T	0.23	-2.2642	0.9962	0.01467	0.1675:0.1675:0.1581:0.5069	rs1454121	30;30	O43149-3;O43149	.;ZZEF1_HUMAN	A	30	ENSP00000371051:V30A	ENSP00000371051:V30A	V	-	2	0	ZZEF1	3992850	0.343000	0.24818	0.021000	0.16686	0.882000	0.50991	0.278000	0.18753	0.760000	0.33108	-0.527000	0.04329	GTC	A|0.188;G|0.812		0.746	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000519970.1_Intron	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y		.											.	.	0			c.G152A						.						274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	201158	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr	357	25		415	35	NM_145301	0	0	0	19	19	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT	.		0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000130705.2	NM_145301	
C17orf96	100170841	hgsc.bcm.edu	37	17	36830459	36830459	+	Missense_Mutation	SNP	G	G	A	rs111565436	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:36830459G>A	ENST00000325814.5	-	1	728	c.290C>T	c.(289-291)cCc>cTc	p.P97L		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	97	Pro-rich.				neuron fate commitment (GO:0048663)												AGGAACGCCGGGCCGCCCGGT	0.776													G|||	1323	0.264177	0.5272	0.1671	5008	,	,		10122	0.0942		0.1789	False		,,,				2504	0.2403				p.P97L		.											.	.	0			c.C290T						.						2.0	3.0	3.0					17																	36830459		485	1247	1732	SO:0001583	missense	100170841	exon1			ACGCCGGGCCGCC		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.290C>T	17.37:g.36830459G>A	ENSP00000317905:p.Pro97Leu	0	0		7	7	NM_001130677	0	0	0	0	0		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	546	0.25	273	0.5548780487804879	71	0.19613259668508287	65	0.11363636363636363	137	0.18073878627968337	G	12.55	1.970645	0.34754	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.57	1.42	0.22433	.	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.80722	P	0.0	B	0.24426	0.103	B	0.25405	0.06	T	0.43782	-0.9370	7	0.87932	D	0	.	6.42	0.21738	0.0:0.2024:0.589:0.2087	.	97	A6NHQ4	CQ096_HUMAN	L	97	.	ENSP00000317905:P97L	P	-	2	0	C17orf96	34083985	0.001000	0.12720	0.308000	0.25141	0.049000	0.14656	0.571000	0.23669	0.121000	0.18284	0.313000	0.20887	CCC	G|0.750;A|0.250		0.776	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255465.2	NM_001130677	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305774	39305774	+	Missense_Mutation	SNP	C	C	G	rs137947981		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:39305774C>G	ENST00000343246.4	-	1	280	c.246G>C	c.(244-246)caG>caC	p.Q82H		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	82	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcaggtggtctggcagcagc	0.652																																					p.Q82H		.											.	KRTAP4-5-90	1	Substitution - Missense(1)	lung(1)	c.G246C						.						14.0	21.0	19.0					17																	39305774		2102	4215	6317	SO:0001583	missense	85289	exon1			GGTGGTCTGGCAG	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.246G>C	17.37:g.39305774C>G	ENSP00000340546:p.Gln82His	67	0		132	19	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	6.243	0.412973	0.11812	.	.	ENSG00000198271	ENST00000343246	T	0.00594	6.33	2.03	-0.354	0.12591	.	.	.	.	.	T	0.01320	0.0043	M	0.79693	2.465	0.09310	N	1	B	0.21147	0.052	B	0.35182	0.197	T	0.25950	-1.0117	9	0.45353	T	0.12	.	12.081	0.53671	0.0:0.7361:0.2639:0.0	.	87	Q9BYR2	KRA45_HUMAN	H	82	ENSP00000340546:Q82H	ENSP00000340546:Q82H	Q	-	3	2	KRTAP4-5	36559300	0.000000	0.05858	0.005000	0.12908	0.001000	0.01503	-3.389000	0.00488	-0.371000	0.08004	-1.872000	0.00552	CAG	.		0.652	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305800	39305800	+	Missense_Mutation	SNP	T	T	A	rs141998775		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:39305800T>A	ENST00000343246.4	-	1	254	c.220A>T	c.(220-222)Agc>Tgc	p.S74C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	74	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cggcagcagctggattcacag	0.657																																					p.S74C		.											.	KRTAP4-5-90	0			c.A220T						.						12.0	18.0	16.0					17																	39305800		2056	4148	6204	SO:0001583	missense	85289	exon1			AGCAGCTGGATTC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.220A>T	17.37:g.39305800T>A	ENSP00000340546:p.Ser74Cys	66	0		130	10	NM_033188	0	0	0	0	0		Missense_Mutation	SNP	ENST00000343246.4	37	CCDS32650.1	.	.	.	.	.	.	.	.	.	.	.	12.46	1.946118	0.34377	.	.	ENSG00000198271	ENST00000343246	T	0.00633	6.08	3.65	2.55	0.30701	.	.	.	.	.	T	0.01287	0.0042	N	0.25957	0.775	0.22412	N	0.999125	D	0.76494	0.999	D	0.63703	0.917	T	0.57015	-0.7883	9	0.59425	D	0.04	.	7.2679	0.26239	0.0:0.1123:0.0:0.8877	.	74	Q9BYR2	KRA45_HUMAN	C	74	ENSP00000340546:S74C	ENSP00000340546:S74C	S	-	1	0	KRTAP4-5	36559326	0.004000	0.15560	0.084000	0.20598	0.021000	0.10359	-0.223000	0.09177	0.555000	0.29079	0.358000	0.22013	AGC	.		0.657	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
TTC25	83538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	40093013	40093013	+	RNA	SNP	A	A	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:40093013A>G	ENST00000591658.1	+	0	527							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				CCATTTTCTCAGAATATAAAA	0.537																																					.		.											.	TTC25-23	0			c.460-2A>G						.						44.0	46.0	46.0					17																	40093013		1928	4132	6060			83538	exon5			TTTCTCAGAATAT	AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40093013A>G		79	0		85	38	NM_031421	0	0	0	0	0	Q6NX40|Q6PJ04|Q9H0K5	Splice_Site	SNP	ENST00000591658.1	37		.	.	.	.	.	.	.	.	.	.	A	9.607	1.130310	0.21041	.	.	ENSG00000204815	ENST00000377540	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4113	0.74923	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC091172.1	37346539	1.000000	0.71417	0.421000	0.26609	0.021000	0.10359	6.287000	0.72671	2.317000	0.78254	0.459000	0.35465	.	.		0.537	TTC25-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000449237.1	NM_031421	
ASB16	92591	hgsc.bcm.edu	37	17	42254281	42254281	+	Missense_Mutation	SNP	A	A	G	rs7212573	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:42254281A>G	ENST00000293414.1	+	3	829	c.745A>G	c.(745-747)Acg>Gcg	p.T249A	ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000592897.1_RNA|ASB16-AS1_ENST00000591166.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16	249				T -> A (in Ref. 1; BAB70800/BAG37167, 3; AAH75088 and 4; AAL57353). {ECO:0000305}.	intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TGCGCTGAACACGGCGTGCGC	0.756													G|||	2594	0.517971	0.702	0.4424	5008	,	,		11135	0.752		0.2932	False		,,,				2504	0.3129				p.T249A		.											.	ASB16-227	0			c.A745G						.	G	ALA/THR,ARG/CYS	2530,1736		801,928,404	7.0	8.0	7.0		745,340	3.1	0.7	17	dbSNP_116	7	2387,5811		422,1543,2134	no	missense,missense	ASB16,C17orf65	NM_080863.4,NM_178542.3	58,180	1223,2471,2538	GG,GA,AA		29.1169,40.6939,39.4496	benign,benign	249/454,114/194	42254281	4917,7547	2133	4099	6232	SO:0001583	missense	92591	exon3			CTGAACACGGCGT	AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.745A>G	17.37:g.42254281A>G	ENSP00000293414:p.Thr249Ala	0	0		18	18	NM_080863	0	0	0	2	2	B2RBC0|Q8WXK0	Missense_Mutation	SNP	ENST00000293414.1	37	CCDS11478.1	1144|1144	0.5238095238095238|0.5238095238095238	349|349	0.709349593495935|0.709349593495935	142|142	0.39226519337016574|0.39226519337016574	420|420	0.7342657342657343|0.7342657342657343	233|233	0.3073878627968338|0.3073878627968338	G|G	5.919|5.919	0.353578|0.353578	0.11182|0.11182	0.593061|0.593061	0.291169|0.291169	ENSG00000168597|ENSG00000161664	ENST00000303061|ENST00000293414	.|T	.|0.51817	.|0.69	5.22|5.22	3.08|3.08	0.35506|0.35506	.|Ankyrin repeat-containing domain (4);	.|0.157781	.|0.56097	.|N	.|0.000038	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.04148|0.04148	-0.265|-0.265	0.58432|0.58432	P|P	8.000000000008E-6|8.000000000008E-6	B|B	0.02656|0.02656	0.0|0.0	B|B	0.01281|0.01281	0.0|0.0	T|T	0.41502|0.41502	-0.9505|-0.9505	7|9	0.87932|0.05833	D|T	0|0.94	-9.3151|-9.3151	9.5645|9.5645	0.39389|0.39389	0.0761:0.0:0.6662:0.2577|0.0761:0.0:0.6662:0.2577	rs7212573|rs7212573	114|249	Q495Z4|Q96NS5	CQ065_HUMAN|ASB16_HUMAN	R|A	114|249	.|ENSP00000293414:T249A	ENSP00000366342:C114R|ENSP00000293414:T249A	C|T	-|+	1|1	0|0	C17orf65|ASB16	39609807|39609807	0.002000|0.002000	0.14202|0.14202	0.723000|0.723000	0.30687|0.30687	0.056000|0.056000	0.15407|0.15407	1.059000|1.059000	0.30517|0.30517	0.777000|0.777000	0.33496|0.33496	-0.227000|-0.227000	0.12334|0.12334	TGT|ACG	A|0.476;G|0.524		0.756	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457703.1		
SMG8	55181	ucsc.edu	37	17	57289754	57289754	+	Silent	SNP	A	A	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:57289754A>G	ENST00000543872.2	+	3	2076	c.1812A>G	c.(1810-1812)cgA>cgG	p.R604R	SMG8_ENST00000300917.5_Silent_p.R604R|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000580498.1_3'UTR			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	604					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						ACAATAGCCGAGCTCGATCTA	0.418																																					p.R604R		.											.	SMG8-93	0			c.A1812G						.						103.0	111.0	108.0					17																	57289754		2203	4300	6503	SO:0001819	synonymous_variant	55181	exon2			TAGCCGAGCTCGA	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1812A>G	17.37:g.57289754A>G		43	0		58	1	NM_018149	0	0	3	3	0	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	ENST00000543872.2	37	CCDS11615.1																																																																																			.		0.418	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
BPTF	2186	ucsc.edu;bcgsc.ca	37	17	65822317	65822317	+	Silent	SNP	G	G	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:65822317G>A	ENST00000321892.4	+	1	538	c.477G>A	c.(475-477)gaG>gaA	p.E159E	BPTF_ENST00000335221.5_Silent_p.E159E|BPTF_ENST00000424123.3_Silent_p.E20E|BPTF_ENST00000306378.6_Silent_p.E159E			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	159	Asp-rich.|Glu-rich.				anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGGATTCTGAGGACGACGAGG	0.597																																					p.E159E		.											.	BPTF-94	0			c.G477A						.						79.0	71.0	74.0					17																	65822317		2203	4300	6503	SO:0001819	synonymous_variant	2186	exon1			TTCTGAGGACGAC	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.477G>A	17.37:g.65822317G>A		546	2		450	221	NM_004459	0	0	0	0	0	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	ENST00000321892.4	37																																																																																				.		0.597	BPTF-201	KNOWN	basic	protein_coding	protein_coding		NM_182641, NM_004459	
CDC42EP4	23580	ucsc.edu;bcgsc.ca	37	17	71282046	71282046	+	Silent	SNP	G	G	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:71282046G>A	ENST00000335793.3	-	2	988	c.594C>T	c.(592-594)taC>taT	p.Y198Y	CDC42EP4_ENST00000581014.1_Intron|CDC42EP4_ENST00000439510.2_Silent_p.Y128Y			Q9H3Q1	BORG4_HUMAN	CDC42 effector protein (Rho GTPase binding) 4	198					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(7)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			GCTTCAGCCCGTACGTGGCCT	0.627																																					p.Y198Y		.											.	CDC42EP4-90	0			c.C594T						.						87.0	74.0	78.0					17																	71282046		2203	4300	6503	SO:0001819	synonymous_variant	23580	exon2			CAGCCCGTACGTG	AB042237	CCDS11695.1	17q24-q25	2008-07-18				ENSG00000179604			17147	protein-coding gene	gene with protein product	"""Cdc42 effector protein 4"", ""binder of Rho GTPases 4"""	605468				11035016, 10490598	Standard	NM_012121		Approved	CEP4, KAIA1777, BORG4, MGC3740, MGC17125	uc002jjo.3	Q9H3Q1		ENST00000335793.3:c.594C>T	17.37:g.71282046G>A		200	2		193	85	NM_012121	0	0	5	6	1	B3KUS7|O95828|Q96FT3	Silent	SNP	ENST00000335793.3	37	CCDS11695.1																																																																																			.		0.627	CDC42EP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441898.1	NM_012121	
SLC25A19	60386	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	17	73282384	73282384	+	Splice_Site	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:73282384C>T	ENST00000402418.3	-	2	1198		c.e2+1		SLC25A19_ENST00000320362.3_Splice_Site|SLC25A19_ENST00000375261.4_Splice_Site|SLC25A19_ENST00000442286.2_Splice_Site|SLC25A19_ENST00000580994.1_Splice_Site|SLC25A19_ENST00000416858.2_Splice_Site			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19						deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			TTGCCACCTACTTGGACAGCT	0.612																																					.		.											.	SLC25A19-91	0			c.288+1G>A						.						128.0	132.0	131.0					17																	73282384		2203	4300	6503	SO:0001630	splice_region_variant	60386	exon5			CACCTACTTGGAC		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.288+1G>A	17.37:g.73282384C>T		93	0		113	19	NM_021734	0	0	0	0	0	E9PF74|Q6V9R7	Splice_Site	SNP	ENST00000402418.3	37	CCDS11720.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.586012	0.86748	.	.	ENSG00000125454	ENST00000416858;ENST00000442286;ENST00000320362;ENST00000402418;ENST00000375261	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0036	0.97427	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC25A19	70793979	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.354000	0.79424	2.824000	0.97209	0.655000	0.94253	.	.		0.612	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447282.1	NM_021734	Intron
CEP192	55125	broad.mit.edu	37	18	13048939	13048939	+	Missense_Mutation	SNP	A	A	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr18:13048939A>G	ENST00000325971.8	+	14	1954	c.361A>G	c.(361-363)Acc>Gcc	p.T121A	CEP192_ENST00000430049.2_Missense_Mutation_p.T242A|CEP192_ENST00000506447.1_Missense_Mutation_p.T717A			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	121					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TAGGATCAGCACCATTGCTTC	0.403																																					p.T717A		.											.	CEP192-27	0			c.A2149G						.						76.0	76.0	76.0					18																	13048939		2203	4300	6503	SO:0001583	missense	55125	exon16			ATCAGCACCATTG	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.361A>G	18.37:g.13048939A>G	ENSP00000317156:p.Thr121Ala	173	2		90	4	NM_032142	0	0	0	0	0	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	ENST00000325971.8	37		.	.	.	.	.	.	.	.	.	.	A	11.54	1.670359	0.29693	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.12569	2.78;2.67;2.71	5.14	3.96	0.45880	.	0.216425	0.23395	N	0.048644	T	0.13072	0.0317	L	0.29908	0.895	0.40955	D	0.984578	P;P;P	0.41041	0.549;0.549;0.736	B;B;B	0.42771	0.188;0.188;0.397	T	0.04017	-1.0984	10	0.72032	D	0.01	-7.6158	11.1922	0.48691	0.9265:0.0:0.0735:0.0	.	242;717;121	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	A	717;121;121;242	ENSP00000427550:T717A;ENSP00000317156:T121A;ENSP00000389190:T242A	ENSP00000317156:T121A	T	+	1	0	CEP192	13038939	1.000000	0.71417	1.000000	0.80357	0.199000	0.23934	5.294000	0.65687	0.886000	0.36113	0.528000	0.53228	ACC	.		0.403	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	
KISS1R	84634	hgsc.bcm.edu	37	19	917526	917526	+	Silent	SNP	A	A	G	rs10407968	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:917526A>G	ENST00000234371.5	+	1	177	c.24A>G	c.(22-24)ggA>ggG	p.G8G	KISS1R_ENST00000606939.1_Silent_p.G8G	NM_032551.4	NP_115940.2	Q969F8	KISSR_HUMAN	KISS1 receptor	8					activation of MAPKK activity (GO:0000186)|arachidonic acid secretion (GO:0050482)|calcium-mediated signaling (GO:0019722)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|positive regulation of hormone secretion (GO:0046887)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission (GO:0050806)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide binding (GO:0042923)|neuropeptide receptor activity (GO:0008188)			cervix(1)|kidney(1)|ovary(1)|pancreas(1)|skin(1)	5		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTACGTCCGGACCCAACGCGT	0.781													g|||	933	0.186302	0.233	0.1758	5008	,	,		2673	0.1339		0.159	False		,,,				2504	0.2127				p.G8G		.											.	KISS1R-91	0			c.A24G						.	G		616,3176		47,522,1327	5.0	5.0	5.0		24	-3.6	0.0	19	dbSNP_119	5	742,6668		44,654,3007	no	coding-synonymous	KISS1R	NM_032551.4		91,1176,4334	GG,GA,AA		10.0135,16.2447,12.1228		8/399	917526	1358,9844	1896	3705	5601	SO:0001819	synonymous_variant	84634	exon1			GTCCGGACCCAAC	AB051065	CCDS12049.1	19p13.3	2012-08-10	2006-02-15	2006-02-15	ENSG00000116014	ENSG00000116014		"""GPCR / Class A : RF amide peptide receptors"""	4510	protein-coding gene	gene with protein product		604161	"""G protein-coupled receptor 54"""	GPR54		10100623	Standard	NM_032551		Approved	HOT7T175, AXOR12	uc002lqk.4	Q969F8		ENST00000234371.5:c.24A>G	19.37:g.917526A>G		2	0		7	5	NM_032551	0	0	0	0	0	A5D8U2|B2RTV1|Q96QG0	Silent	SNP	ENST00000234371.5	37	CCDS12049.1																																																																																			A|0.821;G|0.179		0.781	KISS1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458217.3	NM_032551	
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		0	0		10	10	NM_005224	0	0	0	0	0	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
PLPPR2	64748	broad.mit.edu	37	19	11472132	11472132	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:11472132G>T	ENST00000251473.5	+	6	1007	c.631G>T	c.(631-633)Gcc>Tcc	p.A211S	DKFZP761J1410_ENST00000591608.1_Missense_Mutation_p.A186S	NM_001170635.1|NM_022737.2	NP_001164106.1|NP_073574.2																					CAAGGATGCGGCCCTCTGCGC	0.692																																					p.A211S		.											.	LPPR2-153	0			c.G631T						.						26.0	29.0	28.0					19																	11472132		2199	4277	6476	SO:0001583	missense	0	exon6			GATGCGGCCCTCT																												ENST00000251473.5:c.631G>T	19.37:g.11472132G>T	ENSP00000251473:p.Ala211Ser	22	0		152	14	NM_022737	0	0	17	17	0		Missense_Mutation	SNP	ENST00000251473.5	37	CCDS12258.1	.	.	.	.	.	.	.	.	.	.	g	33	5.243323	0.95272	.	.	ENSG00000105520	ENST00000251473	T	0.75477	-0.94	5.36	5.36	0.76844	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	N	0.16166	0.38	0.80722	D	1	P;P	0.45902	0.851;0.868	P;P	0.59012	0.58;0.85	T	0.64415	-0.6413	10	0.02654	T	1	-25.3512	17.8761	0.88825	0.0:0.0:1.0:0.0	.	186;211	Q96GM1-2;Q96GM1	.;LPPR2_HUMAN	S	211	ENSP00000251473:A211S	ENSP00000251473:A211S	A	+	1	0	AC024575.1	11333132	1.000000	0.71417	0.969000	0.41365	0.979000	0.70002	7.161000	0.77505	2.524000	0.85096	0.550000	0.68814	GCC	.		0.692	DKFZP761J1410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458779.1		
CACNA1A	773	hgsc.bcm.edu	37	19	13409696	13409696	+	Missense_Mutation	SNP	C	C	G	rs16022	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:13409696C>G	ENST00000360228.5	-	19	2750	c.2751G>C	c.(2749-2751)gaG>gaC	p.E917D	CACNA1A_ENST00000573710.2_Missense_Mutation_p.E918D	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	918					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)	p.E918D(3)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CGGCCTCGCCCTCCCAGAACC	0.776													C|||	530	0.105831	0.0605	0.1254	5008	,	,		10618	0.1171		0.1471	False		,,,				2504	0.0992				p.E918D		.											.	CACNA1A-67	3	Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(3)	c.G2754C						.	C	ASP/GLU,ASP/GLU,ASP/GLU,ASP/GLU,ASP/GLU	206,3316		5,196,1560	8.0	9.0	8.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2763,2754,2751,2754,2763	1.5	0.9	19	dbSNP_54	8	883,6727		33,817,2955	no	missense,missense,missense,missense,missense	CACNA1A	NM_000068.3,NM_001127221.1,NM_001127222.1,NM_001174080.1,NM_023035.2	45,45,45,45,45	38,1013,4515	GG,GC,CC		11.6032,5.8489,9.7826	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	921/2267,918/2262,917/2507,918/2264,921/2513	13409696	1089,10043	1761	3805	5566	SO:0001583	missense	773	exon19			CTCGCCCTCCCAG	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2751G>C	19.37:g.13409696C>G	ENSP00000353362:p.Glu917Asp	0	0		8	7	NM_001127221	0	0	0	0	0	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	37	CCDS45998.1	247	0.1130952380952381	27	0.054878048780487805	43	0.11878453038674033	69	0.12062937062937062	108	0.1424802110817942	C	2.711	-0.268795	0.05716	0.058489	0.116032	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.96265	-3.96	3.79	1.49	0.22878	.	4.032560	0.00550	N	0.000240	T	0.06508	0.0167	N	0.03608	-0.345	0.58432	P	9.99999999995449E-6	B;B;B	0.24963	0.0;0.001;0.115	B;B;B	0.24848	0.001;0.003;0.056	T	0.70303	-0.4909	9	0.30854	T	0.27	.	5.84	0.18629	0.0:0.484:0.3995:0.1165	rs16022;rs3752173	918;921;917	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	D	917;921;918;918	ENSP00000353362:E917D	ENSP00000317661:E918D	E	-	3	2	CACNA1A	13270696	0.372000	0.25064	0.886000	0.34754	0.118000	0.20060	0.109000	0.15417	0.091000	0.17302	0.462000	0.41574	GAG	C|0.363;G|0.637		0.776	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
TECR	9524	broad.mit.edu	37	19	14674673	14674673	+	Silent	SNP	A	A	C			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:14674673A>C	ENST00000215567.5	+	5	362	c.225A>C	c.(223-225)acA>acC	p.T75T	TECR_ENST00000436007.2_Silent_p.T90T|TECR_ENST00000596164.1_3'UTR|TECR_ENST00000600083.1_5'UTR|TECR_ENST00000596073.1_5'UTR	NM_138501.5	NP_612510.1	Q9NZ01	TECR_HUMAN	trans-2,3-enoyl-CoA reductase	75				TTAT -> PRAH (in Ref. 1; AAC39872). {ECO:0000305}.	cellular lipid metabolic process (GO:0044255)|fatty acid elongation (GO:0030497)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|nucleus (GO:0005634)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|large_intestine(1)|ovary(1)	3						CCACGGCCACACTGTACTTCC	0.652																																					p.T75T		.											.	TECR-90	0			c.A225C						.						53.0	58.0	56.0					19																	14674673		2203	4300	6503	SO:0001819	synonymous_variant	9524	exon5			GGCCACACTGTAC	AK001416	CCDS12313.1	19p13.12	2014-05-27	2009-07-21	2009-07-21	ENSG00000099797	ENSG00000099797			4551	protein-coding gene	gene with protein product		610057	"""glycoprotein, synaptic 2"""	SC2, GPSN2		9653160, 12482854	Standard	NM_138501		Approved	TER, MRT14	uc002mza.3	Q9NZ01		ENST00000215567.5:c.225A>C	19.37:g.14674673A>C		124	0		129	4	NM_138501	0	0	634	636	2	B2RD55|O75350|Q6IBB2|Q9BWK3|Q9Y6P0	Silent	SNP	ENST00000215567.5	37	CCDS12313.1																																																																																			.		0.652	TECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466000.1	NM_138501	
MAP1S	55201	hgsc.bcm.edu	37	19	17837425	17837425	+	Missense_Mutation	SNP	C	C	G	rs17710707	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:17837425C>G	ENST00000324096.4	+	5	1383	c.1232C>G	c.(1231-1233)tCt>tGt	p.S411C	MAP1S_ENST00000544059.2_Missense_Mutation_p.S385C|CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	411	Necessary for the microtubule-organizing center localization.		S -> C (in dbSNP:rs17710707). {ECO:0000269|PubMed:15489334}.		apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						ACGCTGGCCTCTGTGTGCGCC	0.731													C|||	574	0.114617	0.0832	0.1772	5008	,	,		12607	0.0169		0.2068	False		,,,				2504	0.1186				p.S411C		.											.	MAP1S-90	0			c.C1232G						.	C	CYS/SER	344,3714		17,310,1702	5.0	5.0	5.0		1232	2.6	0.2	19	dbSNP_123	5	1234,6710		91,1052,2829	no	missense	MAP1S	NM_018174.4	112	108,1362,4531	GG,GC,CC		15.5337,8.4771,13.1478	probably-damaging	411/1060	17837425	1578,10424	2029	3972	6001	SO:0001583	missense	55201	exon5			TGGCCTCTGTGTG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1232C>G	19.37:g.17837425C>G	ENSP00000325313:p.Ser411Cys	1	0		40	12	NM_018174	0	0	3	6	3	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	257	0.11767399267399267	34	0.06910569105691057	66	0.18232044198895028	7	0.012237762237762238	150	0.19788918205804748	C	15.12	2.738952	0.49045	0.084771	0.155337	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.03801	3.8;3.8	3.67	2.61	0.31194	.	0.155772	0.30277	N	0.009981	T	0.00012	0.0000	M	0.79614	2.46	0.09310	P	0.99999454915	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.06006	-1.0851	9	0.87932	D	0	-16.5051	8.9574	0.35827	0.0:0.8847:0.0:0.1153	rs17710707	385;411	B4DH53;Q66K74	.;MAP1S_HUMAN	C	411;385	ENSP00000325313:S411C;ENSP00000439243:S385C	ENSP00000325313:S411C	S	+	2	0	MAP1S	17698425	0.998000	0.40836	0.209000	0.23619	0.382000	0.30200	7.628000	0.83189	0.516000	0.28340	-0.291000	0.09656	TCT	C|0.883;G|0.117		0.731	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
KCNN1	3780	hgsc.bcm.edu	37	19	18084724	18084724	+	Silent	SNP	C	C	T	rs77030907	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:18084724C>T	ENST00000222249.9	+	3	346	c.27C>T	c.(25-27)agC>agT	p.S9S	RNA5SP468_ENST00000516782.1_RNA	NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	9					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	ACAATGGCAGCGTGGGGCGGC	0.756													C|||	48	0.00958466	0.0356	0.0014	5008	,	,		12575	0.0		0.0	False		,,,				2504	0.0				p.S9S		.											.	KCNN1-22	0			c.C27T						.						3.0	3.0	3.0					19																	18084724		1475	3351	4826	SO:0001819	synonymous_variant	3780	exon3			TGGCAGCGTGGGG	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.27C>T	19.37:g.18084724C>T		2	0		51	28	NM_002248	0	0	0	0	0	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	37																																																																																				C|0.990;T|0.010		0.756	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
KCNN1	3780	hgsc.bcm.edu	37	19	18084775	18084775	+	Silent	SNP	G	G	A	rs75754669	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:18084775G>A	ENST00000222249.9	+	3	397	c.78G>A	c.(76-78)ccG>ccA	p.P26P	RNA5SP468_ENST00000516782.1_RNA	NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	26					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	GAGACCCTCCGGACCCTGAGG	0.736													G|||	47	0.00938498	0.0348	0.0014	5008	,	,		10833	0.0		0.0	False		,,,				2504	0.0				p.P26P		.											.	KCNN1-22	0			c.G78A						.	G		61,3441		0,61,1690	6.0	9.0	8.0		78	-0.2	0.2	19	dbSNP_131	8	2,7602		0,2,3800	no	coding-synonymous	KCNN1	NM_002248.3		0,63,5490	AA,AG,GG		0.0263,1.7419,0.5673		26/544	18084775	63,11043	1751	3802	5553	SO:0001819	synonymous_variant	3780	exon3			CCCTCCGGACCCT	U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.78G>A	19.37:g.18084775G>A		2	0		34	23	NM_002248	0	0	0	0	0	Q5KR10|Q6DJU4	Silent	SNP	ENST00000222249.9	37																																																																																				G|0.990;A|0.010		0.736	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471896.2	NM_002248	
FBXO17	115290	hgsc.bcm.edu	37	19	39440918	39440918	+	Silent	SNP	T	T	C	rs2304117	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:39440918T>C	ENST00000292852.4	-	2	383	c.42A>G	c.(40-42)ccA>ccG	p.P14P	CTC-360G5.8_ENST00000599996.1_5'Flank|SARS2_ENST00000448145.2_5'Flank|FBXO17_ENST00000595329.1_Silent_p.P14P	NM_024907.5	NP_079183.4	Q96EF6	FBX17_HUMAN	F-box protein 17	14						SCF ubiquitin ligase complex (GO:0019005)	glycoprotein binding (GO:0001948)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	7	all_cancers(60;8.37e-07)|all_lung(34;3.71e-07)|Lung NSC(34;4.17e-07)|all_epithelial(25;1.13e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGGCCAGGGATGGGTCCGCCG	0.731													c|||	2378	0.47484	0.3336	0.3746	5008	,	,		11867	0.6796		0.4195	False		,,,				2504	0.5828				p.P23P		.											.	FBXO17-226	0			c.A69G						.		,	1052,2556		213,626,965	3.0	4.0	3.0		42,69	0.5	0.0	19	dbSNP_100	3	2265,4819		496,1273,1773	no	coding-synonymous,coding-synonymous	FBXO17	NM_024907.5,NM_148169.1	,	709,1899,2738	CC,CT,TT		31.9735,29.1574,31.0232	,	14/279,23/288	39440918	3317,7375	1804	3542	5346	SO:0001819	synonymous_variant	115290	exon2			CAGGGATGGGTCC	AF386743	CCDS12526.1	19q13.2	2010-07-02	2004-06-15	2004-06-16		ENSG00000269190		"""F-boxes /  ""other"""""	18754	protein-coding gene	gene with protein product	"""F-box only protein 26"""	609094	"""F-box only protein 17"""	FBXO26			Standard	NM_148169		Approved	FBG4, FLJ25205, MGC9379, FLJ11798, Fbx17		Q96EF6		ENST00000292852.4:c.42A>G	19.37:g.39440918T>C		0	0		19	5	NM_148169	0	0	0	1	1	Q96LQ4	Silent	SNP	ENST00000292852.4	37	CCDS12526.1																																																																																			T|0.545;C|0.455		0.731	FBXO17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463273.1	NM_024907	
PTGIR	5739	hgsc.bcm.edu	37	19	47127324	47127324	+	Silent	SNP	C	C	G	rs2229128	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:47127324C>G	ENST00000291294.2	-	2	292	c.159G>C	c.(157-159)gtG>gtC	p.V53V	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000596260.1_Silent_p.V53V|PTGIR_ENST00000594275.1_Intron	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	53					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CCAGTCCGGTCACCAGCACCG	0.731													G|||	1139	0.227436	0.1362	0.2133	5008	,	,		13968	0.3313		0.2465	False		,,,				2504	0.2342				p.V53V		.											.	PTGIR-522	0			c.G159C						.	G		523,3103		62,399,1352	3.0	5.0	5.0		159	2.2	1.0	19	dbSNP_98	5	1678,5498		231,1216,2141	no	coding-synonymous	PTGIR	NM_000960.3		293,1615,3493	GG,GC,CC		23.3835,14.4236,20.3759		53/387	47127324	2201,8601	1813	3588	5401	SO:0001819	synonymous_variant	5739	exon2			TCCGGTCACCAGC		CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.159G>C	19.37:g.47127324C>G		4	0		25	16	NM_000960	0	0	0	0	0		Silent	SNP	ENST00000291294.2	37	CCDS12686.1																																																																																			C|0.254;G|0.746		0.731	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466581.1		
NLRP11	204801	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	56296996	56296996	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:56296996G>T	ENST00000589093.1	-	10	3190	c.3097C>A	c.(3097-3099)Ctt>Att	p.L1033I	NLRP11_ENST00000589824.2_Missense_Mutation_p.L979I|NLRP11_ENST00000592953.1_Missense_Mutation_p.L934I|NLRP11_ENST00000360133.3_Missense_Mutation_p.L979I|NLRP11_ENST00000443188.1_Missense_Mutation_p.L1033I			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	1033							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CATGATCAAAGGGGTTGCCTA	0.348																																					p.L1033I		.											.	NLRP11-169	0			c.C3097A						.						85.0	83.0	84.0					19																	56296996		2203	4300	6503	SO:0001583	missense	204801	exon12			ATCAAAGGGGTTG	AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.3097C>A	19.37:g.56296996G>T	ENSP00000466285:p.Leu1033Ile	318	0		369	170	NM_145007	0	0	0	0	0	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	ENST00000589093.1	37	CCDS12935.1	.	.	.	.	.	.	.	.	.	.	G	8.535	0.871868	0.17322	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.75367	-0.93;-0.9	1.27	-1.13	0.09775	.	.	.	.	.	T	0.46908	0.1417	N	0.08118	0	0.09310	N	1	B;B	0.28128	0.127;0.201	B;B	0.17722	0.008;0.019	T	0.35226	-0.9797	9	0.87932	D	0	.	2.6577	0.05017	0.2209:0.311:0.4681:0.0	.	1033;979	P59045;P59045-2	NAL11_HUMAN;.	I	1033;979	ENSP00000409898:L1033I;ENSP00000353251:L979I	ENSP00000353251:L979I	L	-	1	0	NLRP11	60988808	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.236000	0.09003	-0.274000	0.09232	-0.257000	0.10917	CTT	.		0.348	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453657.1	NM_145007	
ZNF814	730051	ucsc.edu	37	19	58384712	58384712	+	Silent	SNP	A	A	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:58384712A>G	ENST00000435989.2	-	3	2280	c.2046T>C	c.(2044-2046)caT>caC	p.H682H	ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	682					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTTCTCCAGTATGGCCATGCT	0.408																																					p.H682H		.											.	.	0			c.T2046C						.						68.0	57.0	60.0					19																	58384712		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			TCCAGTATGGCCA		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2046T>C	19.37:g.58384712A>G		178	0		232	1	NM_001144989	0	0	2	5	3	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.408	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
ZNF324	25799	broad.mit.edu	37	19	58983240	58983240	+	Missense_Mutation	SNP	G	G	T	rs386811423		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr19:58983240G>T	ENST00000536459.2	+	4	2090	c.1381G>T	c.(1381-1383)Gcc>Tcc	p.A461S	ZNF324_ENST00000196482.3_Missense_Mutation_p.A461S|ZNF446_ENST00000596341.1_5'Flank|ZNF324_ENST00000535298.1_Missense_Mutation_p.A238S			O75467	Z324A_HUMAN	zinc finger protein 324	461					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A461S(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(2)|prostate(2)|urinary_tract(2)	16		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CTGTGGCAAGGCCTTCGCCAA	0.697																																					p.A461S		.											.	ZNF324-90	1	Substitution - Missense(1)	prostate(1)	c.G1381T						.						38.0	39.0	38.0					19																	58983240		2203	4298	6501	SO:0001583	missense	25799	exon4			GGCAAGGCCTTCG	AF060503	CCDS12981.1	19q13.43	2013-01-08				ENSG00000083812		"""Zinc fingers, C2H2-type"", ""-"""	14096	protein-coding gene	gene with protein product							Standard	NM_014347		Approved	ZF5128, ZNF324A	uc002qsw.2	O75467		ENST00000536459.2:c.1381G>T	19.37:g.58983240G>T	ENSP00000444812:p.Ala461Ser	29	1		256	15	NM_014347	0	0	1	1	0	B3KRX1	Missense_Mutation	SNP	ENST00000536459.2	37	CCDS12981.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626438	0.28978	.	.	ENSG00000083812	ENST00000196482;ENST00000536459;ENST00000539101;ENST00000535298	T;T;T	0.18338	2.22;2.22;2.22	3.84	3.84	0.44239	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40302	N	0.001121	T	0.07052	0.0179	N	0.01640	-0.785	0.31849	N	0.622504	B	0.18461	0.028	B	0.29077	0.098	T	0.03969	-1.0988	10	0.56958	D	0.05	.	9.0291	0.36247	0.0:0.0:0.7802:0.2197	.	461	O75467	Z324A_HUMAN	S	461;461;451;238	ENSP00000196482:A461S;ENSP00000444812:A461S;ENSP00000439588:A238S	ENSP00000196482:A461S	A	+	1	0	ZNF324	63675052	0.000000	0.05858	1.000000	0.80357	0.277000	0.26821	-0.020000	0.12525	2.433000	0.82419	0.400000	0.26472	GCC	.		0.697	ZNF324-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000467044.1	NM_014347	
ARHGEF33	100271715	hgsc.bcm.edu	37	2	39187519	39187519	+	Silent	SNP	A	A	G	rs958412	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr2:39187519A>G	ENST00000536934.1	+	14	2158	c.2073A>G	c.(2071-2073)aaA>aaG	p.K691K	AC019171.1_ENST00000601251.1_5'Flank|ARHGEF33_ENST00000409978.1_Silent_p.K691K|ARHGEF33_ENST00000398800.4_Silent_p.K691K			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	691							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						GCGCCTACAAACTGGAGGCGG	0.746													G|||	4508	0.90016	0.9523	0.9481	5008	,	,		7469	0.8403		0.9354	False		,,,				2504	0.8211				p.K691K		.											.	ARHGEF33-46	0			c.A2073G						.						1.0	1.0	1.0					2																	39187519		286	830	1116	SO:0001819	synonymous_variant	100271715	exon14			CTACAAACTGGAG		CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.2073A>G	2.37:g.39187519A>G		0	0		6	6	NM_001145451	0	0	0	1	1	J3KPX2	Silent	SNP	ENST00000536934.1	37																																																																																				A|0.086;G|0.914		0.746	ARHGEF33-202	KNOWN	basic	protein_coding	protein_coding		NM_001145451	
EGR4	1961	hgsc.bcm.edu	37	2	73518964	73518964	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr2:73518964C>T	ENST00000545030.1	-	2	1465	c.1391G>A	c.(1390-1392)cGc>cAc	p.R464H	EGR4_ENST00000436467.2_Missense_Mutation_p.R361H	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	464					cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GCCGCCGCGGCGCCCCTTGCG	0.731																																					p.R464H		.											.	EGR4-90	0			c.G1391A						.						6.0	8.0	7.0					2																	73518964		2119	4124	6243	SO:0001583	missense	1961	exon2			CCGCGGCGCCCCT		CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.1391G>A	2.37:g.73518964C>T	ENSP00000445626:p.Arg464His	1	0		9	8	NM_001965	0	0	0	0	0	B2RAE3|G3V1T5|Q2Z1P5	Missense_Mutation	SNP	ENST00000545030.1	37	CCDS1925.2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074539	0.76415	.	.	ENSG00000135625	ENST00000545030;ENST00000436467	T;T	0.16457	2.34;2.65	4.95	4.95	0.65309	.	0.180144	0.39834	N	0.001259	T	0.17704	0.0425	N	0.08118	0	0.37562	D	0.919106	D;D	0.76494	0.998;0.999	P;P	0.60236	0.747;0.871	T	0.11542	-1.0583	10	0.66056	D	0.02	-21.4428	10.51	0.44855	0.0:0.9109:0.0:0.0891	.	361;464	Q05215;G3V1T5	EGR4_HUMAN;.	H	464;361	ENSP00000445626:R464H;ENSP00000419687:R361H	ENSP00000419687:R361H	R	-	2	0	EGR4	73372472	0.999000	0.42202	1.000000	0.80357	0.985000	0.73830	2.327000	0.43858	2.561000	0.86390	0.655000	0.94253	CGC	.		0.731	EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_001965	
SOWAHC	65124	hgsc.bcm.edu	37	2	110372192	110372192	+	Silent	SNP	A	A	G	rs6594048		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr2:110372192A>G	ENST00000356454.3	+	1	282	c.126A>G	c.(124-126)ctA>ctG	p.L42L	SEPT10_ENST00000397712.2_5'Flank|SEPT10_ENST00000415095.1_5'Flank|SEPT10_ENST00000356688.4_5'Flank|SEPT10_ENST00000545389.1_5'Flank|SEPT10_ENST00000397714.2_5'Flank|SEPT10_ENST00000334001.6_5'Flank|SEPT10_ENST00000437928.1_5'Flank	NM_023016.3	NP_075392.2	Q53LP3	SWAHC_HUMAN	sosondowah ankyrin repeat domain family member C	42																	GGGGCGCCCTAGGCGGCGAAC	0.771													G|||	5008	1.0	1.0	1.0	5008	,	,		6158	1.0		1.0	False		,,,				2504	1.0				p.L42L		.											.	.	0			c.A126G						.						1.0	2.0	2.0					2																	110372192		1239	2477	3716	SO:0001819	synonymous_variant	65124	exon1			CGCCCTAGGCGGC	AK023346	CCDS33270.1	2q13	2013-01-10	2012-01-12	2012-01-12	ENSG00000198142	ENSG00000198142		"""Ankyrin repeat domain containing"""	26149	protein-coding gene	gene with protein product			"""ankyrin repeat domain 57"""	C2orf26, ANKRD57		22234889	Standard	NM_023016		Approved	FLJ21870	uc002tfb.3	Q53LP3	OTTHUMG00000153219	ENST00000356454.3:c.126A>G	2.37:g.110372192A>G		0	0		9	9	NM_023016	0	0	0	1	1	Q8NE15|Q9H6U1	Silent	SNP	ENST00000356454.3	37	CCDS33270.1																																																																																			A|0.029;G|0.971		0.771	SOWAHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330168.1	NM_023016	
DPP10	57628	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	116497402	116497402	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr2:116497402C>A	ENST00000410059.1	+	9	1265	c.785C>A	c.(784-786)cCc>cAc	p.P262H	DPP10_ENST00000393147.2_Missense_Mutation_p.P266H|DPP10_ENST00000409163.1_Missense_Mutation_p.P212H|DPP10_ENST00000310323.8_Missense_Mutation_p.P255H	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	262						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TCTTTGGTACCCACCATGGTT	0.443																																					p.P266H		.											.	DPP10-142	0			c.C797A						.						233.0	200.0	211.0					2																	116497402		2203	4300	6503	SO:0001583	missense	57628	exon9			TGGTACCCACCAT	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.785C>A	2.37:g.116497402C>A	ENSP00000386565:p.Pro262His	419	0		235	20	NM_001178034	0	0	0	0	0	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	37	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.936023	0.73442	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393146;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34	4.95	4.95	0.65309	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.79693	2.465	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.999	T	0.68254	-0.5457	10	0.87932	D	0	-4.7498	17.7074	0.88312	0.0:1.0:0.0:0.0	.	255;266;258;262	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	H	262;212;258;266;255;212	ENSP00000386565:P262H;ENSP00000387038:P212H;ENSP00000376854:P258H;ENSP00000376855:P266H;ENSP00000309066:P255H	ENSP00000309066:P255H	P	+	2	0	DPP10	116213872	1.000000	0.71417	1.000000	0.80357	0.360000	0.29518	7.609000	0.82925	2.737000	0.93849	0.563000	0.77884	CCC	.		0.443	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
DDX18	8886	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	118582643	118582643	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr2:118582643T>C	ENST00000263239.2	+	9	1462	c.1334T>C	c.(1333-1335)cTg>cCg	p.L445P		NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	445	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TATGAGTTGCTGAACTACATT	0.368																																					p.L445P		.											.	DDX18-290	0			c.T1334C						.						149.0	147.0	148.0					2																	118582643		2203	4300	6503	SO:0001583	missense	8886	exon9			AGTTGCTGAACTA	X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.1334T>C	2.37:g.118582643T>C	ENSP00000263239:p.Leu445Pro	202	0		147	57	NM_006773	0	0	3	6	3	Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Missense_Mutation	SNP	ENST00000263239.2	37	CCDS2120.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.347546	0.82022	.	.	ENSG00000088205	ENST00000263239;ENST00000539346;ENST00000415038	T;T	0.13420	2.59;2.59	5.17	5.17	0.71159	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.44414	0.1292	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.54384	-0.8302	10	0.87932	D	0	.	15.3109	0.74031	0.0:0.0:0.0:1.0	.	445	Q9NVP1	DDX18_HUMAN	P	445;184;109	ENSP00000263239:L445P;ENSP00000415604:L109P	ENSP00000263239:L445P	L	+	2	0	DDX18	118299113	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.432000	0.80349	2.089000	0.63090	0.528000	0.53228	CTG	.		0.368	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129632.3	NM_006773	
SCN7A	6332	broad.mit.edu	37	2	167289175	167289175	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr2:167289175G>T	ENST00000409855.1	-	15	2371	c.2245C>A	c.(2245-2247)Cag>Aag	p.Q749K		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	749					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	ACTGCAAGCTGGAGATTTTTT	0.358																																					p.Q749K		.											.	SCN7A-67	0			c.C2245A						.						59.0	56.0	57.0					2																	167289175		1849	4106	5955	SO:0001583	missense	6332	exon15			CAAGCTGGAGATT	M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2245C>A	2.37:g.167289175G>T	ENSP00000386796:p.Gln749Lys	60	0		50	4	NM_002976	0	0	0	0	0		Missense_Mutation	SNP	ENST00000409855.1	37	CCDS46442.1	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807118	0.50421	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992	D;D	0.86769	-2.17;-2.17	6.17	5.3	0.74995	Sodium ion transport-associated (1);	0.106954	0.41712	D	0.000822	D	0.89315	0.6680	M	0.88181	2.935	0.35852	D	0.826832	B	0.31752	0.338	B	0.32980	0.156	D	0.91990	0.5602	10	0.87932	D	0	.	13.3519	0.60607	0.0754:0.0:0.9246:0.0	.	749	Q01118	SCN7A_HUMAN	K	749	ENSP00000386796:Q749K;ENSP00000413699:Q749K	ENSP00000259060:Q749K	Q	-	1	0	SCN7A	166997421	1.000000	0.71417	0.923000	0.36655	0.544000	0.35116	8.735000	0.91549	1.632000	0.50472	0.655000	0.94253	CAG	.		0.358	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333745.1		
MAP2	4133	bcgsc.ca	37	2	210558162	210558162	+	Missense_Mutation	SNP	G	G	A	rs741006	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr2:210558162G>A	ENST00000360351.4	+	7	1774	c.1268G>A	c.(1267-1269)aGg>aAg	p.R423K	MAP2_ENST00000447185.1_Missense_Mutation_p.R419K|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	423			R -> K (in dbSNP:rs741006).		axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	GTGCAGCAAAGGGATACTTTC	0.418													A|||	822	0.164137	0.2746	0.0692	5008	,	,		19500	0.1974		0.0765	False		,,,				2504	0.138				p.R423K	Pancreas(27;423 979 28787 29963)	.											.	MAP2-591	0			c.G1268A						.	A	,LYS/ARG,,	1090,3316	712.4+/-408.1	145,800,1258	89.0	91.0	90.0		,1268,,	0.5	0.0	2	dbSNP_86	90	599,8001	788.3+/-407.6	19,561,3720	yes	intron,missense,intron,intron	MAP2	NM_001039538.1,NM_002374.3,NM_031845.2,NM_031847.2	,26,,	164,1361,4978	AA,AG,GG		6.9651,24.739,12.9863	,benign,,	,423/1828,,	210558162	1689,11317	2203	4300	6503	SO:0001583	missense	4133	exon7			AGCAAAGGGATAC		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.1268G>A	2.37:g.210558162G>A	ENSP00000353508:p.Arg423Lys	225	0		129	5	NM_002374	0	0	0	0	0	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	37	CCDS2384.1	311	0.1423992673992674	119	0.241869918699187	28	0.07734806629834254	109	0.19055944055944055	55	0.07255936675461741	A	0	-2.587322	0.00128	0.24739	0.069651	ENSG00000078018	ENST00000360351;ENST00000445941;ENST00000447185	T;T;T	0.14391	2.51;2.51;2.51	5.8	0.492	0.16872	MAP2/Tau projection (1);	0.451737	0.22705	N	0.056642	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.35624	-0.9781	9	0.02654	T	1	-4.1355	2.293	0.04143	0.5161:0.2401:0.1286:0.1152	rs741006;rs59017203;rs741006	419;423	P11137-3;P11137	.;MAP2_HUMAN	K	423;505;419	ENSP00000353508:R423K;ENSP00000409969:R505K;ENSP00000392164:R419K	ENSP00000353508:R423K	R	+	2	0	MAP2	210266407	0.945000	0.32115	0.000000	0.03702	0.003000	0.03518	0.818000	0.27295	-0.412000	0.07519	-0.269000	0.10298	AGG	G|0.850;A|0.150		0.418	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
IRS1	3667	broad.mit.edu	37	2	227659840	227659840	+	Silent	SNP	T	T	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr2:227659840T>G	ENST00000305123.5	-	1	4635	c.3615A>C	c.(3613-3615)ccA>ccC	p.P1205P	IRS1_ENST00000498335.1_5'UTR	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	1205	Pro-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GATGAGGGGGTGGGGGTGGGG	0.577																																					p.P1205P		.											.	IRS1-1272	0			c.A3615C						.																																			SO:0001819	synonymous_variant	3667	exon1			AGGGGGTGGGGGT		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.3615A>C	2.37:g.227659840T>G		29	6		21	6	NM_005544	0	0	0	0	0		Silent	SNP	ENST00000305123.5	37	CCDS2463.1																																																																																			.		0.577	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
ADAM33	80332	hgsc.bcm.edu	37	20	3654433	3654433	+	Silent	SNP	C	C	T	rs2271511	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr20:3654433C>T	ENST00000356518.2	-	9	1105	c.864G>A	c.(862-864)ggG>ggA	p.G288G	ADAM33_ENST00000350009.2_Silent_p.G288G|ADAM33_ENST00000379861.4_Silent_p.G288G|ADAM33_ENST00000466620.1_5'Flank	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	288	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GCGCCCACAGCCCCCGGCGCC	0.771													C|||	1379	0.275359	0.4319	0.1354	5008	,	,		9169	0.2212		0.1869	False		,,,				2504	0.3098				p.G288G		.											.	ADAM33-291	0			c.G864A						.	C	,	1271,2579		236,799,890	4.0	5.0	4.0		864,864	-0.6	0.0	20	dbSNP_100	4	1108,6216		89,930,2643	no	coding-synonymous,coding-synonymous	ADAM33	NM_025220.2,NM_153202.1	,	325,1729,3533	TT,TC,CC		15.1283,33.013,21.2905	,	288/814,288/788	3654433	2379,8795	1925	3662	5587	SO:0001819	synonymous_variant	80332	exon9			CCACAGCCCCCGG	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.864G>A	20.37:g.3654433C>T		0	0		9	6	NM_025220	0	0	0	0	0	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Silent	SNP	ENST00000356518.2	37	CCDS13058.1																																																																																			C|0.751;T|0.249		0.771	ADAM33-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077763.2	NM_025220	
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A|PANK2_ENST00000497424.1_Intron	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		7	7	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
FAM182B	728882	broad.mit.edu	37	20	25755510	25755510	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr20:25755510C>T	ENST00000376403.1	-	3	824	c.446G>A	c.(445-447)cGc>cAc	p.R149H	FAM182B_ENST00000478164.1_Intron|FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	149										lung(1)	1						CCTTCCATCGCGGCCACCATG	0.706																																					.		.											.	.	0			.						.																																			SO:0001583	missense	728882	.			CCATCGCGGCCAC			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.446G>A	20.37:g.25755510C>T	ENSP00000365585:p.Arg149His	47	0		118	5	.	0	0	0	0	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	2.423	-0.332565	0.05314	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.18425	0.0442	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.30822	-0.9965	3	0.15066	T	0.55	.	.	.	.	.	.	.	.	H	149	.	ENSP00000365585:R149H	R	-	2	0	FAM182B	25703510	0.001000	0.12720	0.047000	0.18901	0.048000	0.14542	-1.599000	0.02085	0.064000	0.16427	0.064000	0.15345	CGC	.		0.706	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000078463.2	NR_026714	
C20orf166-AS1	253868	broad.mit.edu;bcgsc.ca	37	20	61143819	61143819	+	RNA	SNP	G	G	A	rs111651569	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr20:61143819G>A	ENST00000475015.1	-	0	519				C20orf166-AS1_ENST00000436101.1_RNA|C20orf166-AS1_ENST00000412495.1_RNA			Q96NR2	C2AS1_HUMAN	C20orf166 antisense RNA 1									p.A10E(1)									CCCCTCGTGCGCGAGGTGCCC	0.672																																					.		.											.	.	1	Substitution - Missense(1)	large_intestine(1)	.						.						107.0	97.0	100.0					20																	61143819		2203	4300	6503			253868	.			TCGTGCGCGAGGT	AK054875		20q13.33	2012-10-12	2012-08-15	2011-08-10	ENSG00000174403	ENSG00000174403		"""Long non-coding RNAs"""	26393	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 200"", ""non-protein coding RNA 335"", ""C20orf166 antisense RNA 1 (non-protein coding)"""	C20orf200, NCRNA00335			Standard	NR_033263		Approved	FLJ30313	uc002ycz.3	Q96NR2	OTTHUMG00000048002		20.37:g.61143819G>A		132	0		137	7	.	0	0	0	0	0	Q52LN1	RNA	SNP	ENST00000475015.1	37																																																																																				G|0.500;A|0.500		0.672	C20orf166-AS1-002	KNOWN	basic	antisense	antisense	OTTHUMT00000109266.2	NR_033263	
OGFR	11054	hgsc.bcm.edu	37	20	61444569	61444569	+	Silent	SNP	A	A	G	rs3204348		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr20:61444569A>G	ENST00000290291.6	+	7	1627	c.1602A>G	c.(1600-1602)ccA>ccG	p.P534P	OGFR_ENST00000370461.1_Silent_p.P482P	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	534	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GGGACGAGCCAGCCGAGAGCC	0.721																																					p.P534P		.											.	OGFR-68	0			c.A1602G						.						11.0	17.0	15.0					20																	61444569		2124	4201	6325	SO:0001819	synonymous_variant	11054	exon7			CGAGCCAGCCGAG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1602A>G	20.37:g.61444569A>G		29	0		44	7	NM_007346	0	0	165	189	24	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	ENST00000290291.6	37	CCDS13504.1																																																																																			A|0.979;G|0.021		0.721	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444633	61444633	+	Missense_Mutation	SNP	G	G	A	rs75570150		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr20:61444633G>A	ENST00000290291.6	+	7	1691	c.1666G>A	c.(1666-1668)Gag>Aag	p.E556K	OGFR_ENST00000370461.1_Missense_Mutation_p.E504K	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	556	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.E556K(1)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CGAGCCAGCCGAGAGCCCATC	0.756																																					p.E556K		.											.	OGFR-68	1	Substitution - Missense(1)	skin(1)	c.G1666A						.						6.0	11.0	9.0					20																	61444633		1936	3778	5714	SO:0001583	missense	11054	exon7			CCAGCCGAGAGCC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1666G>A	20.37:g.61444633G>A	ENSP00000290291:p.Glu556Lys	2	0		26	7	NM_007346	0	0	149	150	1	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	A	2.693	-0.272793	0.05716	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.52983	0.64;0.64	0.773	-1.55	0.08558	.	.	.	.	.	T	0.25195	0.0612	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.04013	0.0;0.001;0.0	T	0.12785	-1.0534	9	0.34782	T	0.22	.	5.1465	0.14987	0.4456:0.0:0.5544:0.0	.	556;539;556	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	K	556;536;391;504	ENSP00000290291:E556K;ENSP00000359491:E504K	ENSP00000290291:E556K	E	+	1	0	OGFR	60915078	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.269000	0.00532	-0.808000	0.04387	-1.125000	0.01998	GAG	.		0.756	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
OGFR	11054	hgsc.bcm.edu	37	20	61444637	61444637	+	Missense_Mutation	SNP	G	G	C	rs78981100		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr20:61444637G>C	ENST00000290291.6	+	7	1695	c.1670G>C	c.(1669-1671)aGc>aCc	p.S557T	OGFR_ENST00000370461.1_Missense_Mutation_p.S505T	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	557	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.S557T(3)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCAGCCGAGAGCCCATCGGAG	0.746																																					p.S557T		.											.	OGFR-68	3	Substitution - Missense(3)	upper_aerodigestive_tract(1)|prostate(1)|skin(1)	c.G1670C						.						5.0	10.0	8.0					20																	61444637		1884	3696	5580	SO:0001583	missense	11054	exon7			CCGAGAGCCCATC	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1670G>C	20.37:g.61444637G>C	ENSP00000290291:p.Ser557Thr	2	0		28	7	NM_007346	0	0	155	155	0	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	7.631	0.678796	0.14841	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.40225	1.04;1.04	0.773	0.773	0.18516	.	.	.	.	.	T	0.20373	0.0490	N	0.24115	0.695	0.09310	N	1	P;B;P	0.45594	0.862;0.386;0.862	B;B;B	0.38655	0.278;0.099;0.278	T	0.08868	-1.0701	9	0.09338	T	0.73	3.6159	4.5226	0.11966	0.2481:0.0:0.7519:0.0	.	557;540;557	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	T	557;537;392;505	ENSP00000290291:S557T;ENSP00000359491:S505T	ENSP00000290291:S557T	S	+	2	0	OGFR	60915082	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-1.934000	0.01552	0.687000	0.31509	0.185000	0.17295	AGC	.		0.746	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080067.1		
KCNJ15	3772	bcgsc.ca	37	21	39671447	39671447	+	Silent	SNP	C	C	T	rs3746876	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr21:39671447C>T	ENST00000328656.4	+	4	567	c.264C>T	c.(262-264)atC>atT	p.I88I	KCNJ15_ENST00000398930.1_Silent_p.I88I|KCNJ15_ENST00000398938.2_Silent_p.I88I|KCNJ15_ENST00000398932.1_Silent_p.I88I|KCNJ15_ENST00000398934.1_Silent_p.I88I	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	88					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	ACTATGCCATCGCGTTTATTC	0.483													C|||	238	0.047524	0.0976	0.0115	5008	,	,		21208	0.0873		0.0089	False		,,,				2504	0.0041				p.K88N		.											.	KCNJ15-157	0			c.A264T						.	C	,,	351,4055	182.6+/-210.3	11,329,1863	136.0	127.0	130.0	http://www.ncbi.nlm.nih.gov/omim/125853,602106|http://omim.org/entry/602106|http://omim.org/entry/125853	264,264,264	-10.0	0.0	21	dbSNP_107	130	66,8534	39.8+/-96.3	0,66,4234	no	coding-synonymous,coding-synonymous,coding-synonymous	KCNJ15	NM_002243.3,NM_170736.1,NM_170737.1	,,	11,395,6097	TT,TC,CC		0.7674,7.9664,3.2062	,,	88/376,88/376,88/376	39671447	417,12589	2203	4300	6503	SO:0001819	synonymous_variant	3772	exon4			TGCCATCGCGTTT	Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.264C>T	21.37:g.39671447C>T		153	1		67	4	NM_002243	0	0	0	0	0	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	ENST00000328656.4	37	CCDS13656.1																																																																																			C|0.960;G|0.001		0.483	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207181.2	NM_002243	
PCNT	5116	hgsc.bcm.edu	37	21	47836750	47836750	+	Silent	SNP	T	T	C	rs61738290	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr21:47836750T>C	ENST00000359568.5	+	30	7025	c.6918T>C	c.(6916-6918)gcT>gcC	p.A2306A	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2306					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					AGAGGACGGCTGTGGTAGGTG	0.667													T|||	114	0.0227636	0.0189	0.0418	5008	,	,		15424	0.0		0.0408	False		,,,				2504	0.0194				p.A2306A		.											.	PCNT-141	0			c.T6918C						.	T		72,3720		0,72,1824	20.0	22.0	21.0		6918	-1.0	0.3	21	dbSNP_129	21	338,7058		7,324,3367	no	coding-synonymous	PCNT	NM_006031.5		7,396,5191	CC,CT,TT		4.57,1.8987,3.6646		2306/3337	47836750	410,10778	1896	3698	5594	SO:0001819	synonymous_variant	5116	exon30			GACGGCTGTGGTA	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.6918T>C	21.37:g.47836750T>C		3	0		6	6	NM_006031	0	0	0	0	0	O43152|Q7Z7C9	Silent	SNP	ENST00000359568.5	37	CCDS33592.1																																																																																			T|0.969;C|0.031		0.667	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207336.1	NM_006031	
PRSS50	29122	hgsc.bcm.edu	37	3	46759293	46759293	+	Missense_Mutation	SNP	C	C	T	rs143548046	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr3:46759293C>T	ENST00000460241.1	-	6	1692	c.22G>A	c.(22-24)Gtc>Atc	p.V8I	PRSS50_ENST00000315170.7_Missense_Mutation_p.V8I			Q9UI38	TSP50_HUMAN	protease, serine, 50	8					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						CCGCGCGCGACGGTCTGGCAC	0.741													C|||	16	0.00319489	0.0113	0.0014	5008	,	,		11390	0.0		0.0	False		,,,				2504	0.0				p.V8I	Pancreas(41;915 1239 11561 17469)	.											.	PRSS50-90	0			c.G22A						.	C	ILE/VAL	38,3980		0,38,1971	9.0	11.0	10.0		22	0.3	0.0	3	dbSNP_134	10	2,7708		0,2,3853	no	missense	PRSS50	NM_013270.4	29	0,40,5824	TT,TC,CC		0.0259,0.9457,0.3411	benign	8/386	46759293	40,11688	2009	3855	5864	SO:0001583	missense	29122	exon1			GCGCGACGGTCTG	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.22G>A	3.37:g.46759293C>T	ENSP00000418875:p.Val8Ile	0	0		21	18	NM_013270	0	0	0	0	0		Missense_Mutation	SNP	ENST00000460241.1	37	CCDS2745.1	11	0.005036630036630037	10	0.02032520325203252	1	0.0027624309392265192	0	0.0	0	0.0	C	3.939	-0.014537	0.07681	0.009457	2.59E-4	ENSG00000206549	ENST00000315170;ENST00000460241	D;D	0.88431	-2.38;-2.38	2.15	0.302	0.15786	.	5.013500	0.00924	N	0.002636	T	0.62307	0.2417	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.62459	-0.6850	10	0.15066	T	0.55	.	3.6566	0.08223	0.1599:0.2589:0.5813:0.0	.	8	Q9UI38	TSP50_HUMAN	I	8	ENSP00000326598:V8I;ENSP00000418875:V8I	ENSP00000326598:V8I	V	-	1	0	PRSS50	46734297	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.384000	0.07389	0.051000	0.15978	-0.375000	0.07067	GTC	C|0.995;T|0.005		0.741	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1		
WDR6	11180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49050657	49050657	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr3:49050657C>A	ENST00000608424.1	+	2	1729	c.1690C>A	c.(1690-1692)Ccc>Acc	p.P564T	WDR6_ENST00000415265.2_Intron|WDR6_ENST00000489684.1_Intron|WDR6_ENST00000395474.3_Missense_Mutation_p.P594T|WDR6_ENST00000448293.1_Missense_Mutation_p.P513T			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	564					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		GTCTACCCTGCCCTCTCTGCA	0.597																																					p.P594T		.											.	WDR6-90	0			c.C1780A						.						58.0	43.0	48.0					3																	49050657		2203	4300	6503	SO:0001583	missense	11180	exon2			ACCCTGCCCTCTC	AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.1690C>A	3.37:g.49050657C>A	ENSP00000477389:p.Pro564Thr	132	0		89	57	NM_018031	0	0	26	116	90	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	ENST00000608424.1	37		.	.	.	.	.	.	.	.	.	.	C	10.23	1.292951	0.23564	.	.	ENSG00000178252	ENST00000395474;ENST00000448293	T;D	0.90004	0.33;-2.6	5.35	4.36	0.52297	Quinoprotein amine dehydrogenase, beta chain-like (1);Six-bladed beta-propeller, TolB-like (1);	0.277811	0.40469	N	0.001090	T	0.77418	0.4127	L	0.29908	0.895	0.31694	N	0.641572	B;B	0.17667	0.023;0.005	B;B	0.17722	0.019;0.008	T	0.66118	-0.6003	10	0.13108	T	0.6	-6.8237	3.4853	0.07617	0.0:0.6291:0.0:0.3709	.	564;513	Q9NNW5;E9PDU5	WDR6_HUMAN;.	T	594;513	ENSP00000378857:P594T;ENSP00000413432:P513T	ENSP00000378857:P594T	P	+	1	0	WDR6	49025661	0.997000	0.39634	0.980000	0.43619	0.938000	0.57974	4.282000	0.58971	2.503000	0.84419	0.561000	0.74099	CCC	.		0.597	WDR6-024	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000471652.1		
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	0	0		5	5	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		8	8	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
ROBO1	6091	broad.mit.edu;ucsc.edu;bcgsc.ca	37	3	78680354	78680354	+	Missense_Mutation	SNP	G	G	C			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr3:78680354G>C	ENST00000464233.1	-	25	3696	c.3583C>G	c.(3583-3585)Cca>Gca	p.P1195A	ROBO1_ENST00000467549.1_Missense_Mutation_p.P1095A|ROBO1_ENST00000495273.1_Missense_Mutation_p.P1150A|ROBO1_ENST00000436010.2_Missense_Mutation_p.P1156A	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1195					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TTGCTGTGTGGAGGAGGATGT	0.483																																					p.P1195A		.											.	ROBO1-67	0			c.C3583G						.						187.0	183.0	184.0					3																	78680354		2078	4204	6282	SO:0001583	missense	6091	exon25			TGTGTGGAGGAGG	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3583C>G	3.37:g.78680354G>C	ENSP00000420321:p.Pro1195Ala	206	2		144	38	NM_002941	0	0	2	2	0	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	ENST00000464233.1	37	CCDS54611.1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.124922	0.37533	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.90120	0.6913	M	0.61703	1.905	0.80722	D	1	D;B;P;B;B	0.76494	0.999;0.036;0.595;0.329;0.046	D;B;B;B;B	0.83275	0.996;0.028;0.192;0.077;0.053	D	0.88845	0.3315	9	.	.	.	.	19.5035	0.95105	0.0:0.0:1.0:0.0	.	1159;1195;1150;1095;1156	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	A	1156;1150;1195;1150;1095;1199	ENSP00000406043:P1156A;ENSP00000420321:P1195A;ENSP00000420637:P1150A;ENSP00000417992:P1095A	.	P	-	1	0	ROBO1	78763044	1.000000	0.71417	0.953000	0.39169	0.506000	0.33950	9.294000	0.96088	2.674000	0.91012	0.655000	0.94253	CCA	.		0.483	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
DCBLD2	131566	broad.mit.edu	37	3	98600400	98600400	+	Silent	SNP	G	G	T	rs370431447		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr3:98600400G>T	ENST00000326840.6	-	2	779	c.417C>A	c.(415-417)gtC>gtA	p.V139V	DCBLD2_ENST00000326857.9_Silent_p.V139V|DCBLD2_ENST00000469648.1_Intron	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	139	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						CAGTTCTGCTGACTCCAATTC	0.299																																					p.V139V		.											.	DCBLD2-92	0			c.C417A						.	G		0,3724		0,0,1862	98.0	100.0	100.0		417	0.9	0.6	3		100	1,8213		0,1,4106	no	coding-synonymous	DCBLD2	NM_080927.3		0,1,5968	TT,TG,GG		0.0122,0.0,0.0084		139/776	98600400	1,11937	1862	4107	5969	SO:0001819	synonymous_variant	131566	exon2			TCTGCTGACTCCA		CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.417C>A	3.37:g.98600400G>T		78	0		108	3	NM_080927	0	0	0	0	0	B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Silent	SNP	ENST00000326840.6	37	CCDS46878.1																																																																																			.		0.299	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2	NM_080927	
ZBTB20	26137	broad.mit.edu	37	3	114057884	114057884	+	Missense_Mutation	SNP	C	C	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr3:114057884C>A	ENST00000474710.1	-	5	2372	c.2194G>T	c.(2194-2196)Gac>Tac	p.D732Y	ZBTB20_ENST00000357258.3_Missense_Mutation_p.D659Y|ZBTB20_ENST00000462705.1_Missense_Mutation_p.D659Y|ZBTB20_ENST00000471418.1_Missense_Mutation_p.D659Y|ZBTB20_ENST00000393785.2_Missense_Mutation_p.D659Y|ZBTB20_ENST00000481632.1_Missense_Mutation_p.D659Y|ZBTB20_ENST00000464560.1_Missense_Mutation_p.D659Y	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	732						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CTCATGTGGTCGTTGAACTGC	0.488																																					p.D732Y	NSCLC(69;748 1344 9802 11203 30933)	.											.	ZBTB20-95	0			c.G2194T						.						82.0	80.0	81.0					3																	114057884		2203	4298	6501	SO:0001583	missense	26137	exon5			TGTGGTCGTTGAA	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.2194G>T	3.37:g.114057884C>A	ENSP00000419153:p.Asp732Tyr	112	0		142	5	NM_001164342	0	0	0	0	0	Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	ENST00000474710.1	37	CCDS54626.1	.	.	.	.	.	.	.	.	.	.	C	16.95	3.262802	0.59431	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.10288	2.91;2.91;2.91;2.91;2.89;2.91;2.91	5.87	5.87	0.94306	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.105010	0.64402	D	0.000004	T	0.26666	0.0652	L	0.33093	0.98	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.00226	-1.1900	10	0.59425	D	0.04	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	732	Q9HC78	ZBT20_HUMAN	Y	659;659;659;659;732;659;659	ENSP00000420324:D659Y;ENSP00000377375:D659Y;ENSP00000418092:D659Y;ENSP00000419902:D659Y;ENSP00000419153:D732Y;ENSP00000349803:D659Y;ENSP00000417307:D659Y	ENSP00000349803:D659Y	D	-	1	0	ZBTB20	115540574	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.568000	0.82369	2.941000	0.99782	0.655000	0.94253	GAC	.		0.488	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354951.1	NM_015642	
NRROS	375387	ucsc.edu;bcgsc.ca	37	3	196387312	196387312	+	Silent	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr3:196387312G>T	ENST00000328557.4	+	3	1001	c.798G>T	c.(796-798)ccG>ccT	p.P266P		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	266					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TGTTCTTCCCGCTGCTGCCCC	0.622																																					p.P266P		.											.	LRRC33-92	0			c.G798T						.						88.0	90.0	89.0					3																	196387312		2203	4300	6503	SO:0001819	synonymous_variant	375387	exon3			CTTCCCGCTGCTG	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.798G>T	3.37:g.196387312G>T		230	2		156	99	NM_198565	0	0	0	0	0		Silent	SNP	ENST00000328557.4	37	CCDS3319.1																																																																																			.		0.622	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
UVSSA	57654	broad.mit.edu;bcgsc.ca	37	4	1373985	1373985	+	Silent	SNP	C	C	T	rs536749926		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr4:1373985C>T	ENST00000389851.4	+	11	2166	c.1719C>T	c.(1717-1719)gaC>gaT	p.D573D	UVSSA_ENST00000512728.1_Silent_p.D124D|UVSSA_ENST00000511216.1_Silent_p.D573D|UVSSA_ENST00000507531.1_Silent_p.D573D|UVSSA_ENST00000511563.1_Silent_p.D124D	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	573					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										CGAGGCCAGACGGCCGGCTCT	0.682																																					p.D573D		.											.	.	0			c.C1719T						.						43.0	42.0	42.0					4																	1373985		2200	4300	6500	SO:0001819	synonymous_variant	57654	exon11			GCCAGACGGCCGG	BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.1719C>T	4.37:g.1373985C>T		156	0		299	12	NM_020894	0	0	16	16	0	A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Silent	SNP	ENST00000389851.4	37	CCDS33938.1																																																																																			.		0.682	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359480.1	NM_020894	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388755	1388755	+	Silent	SNP	C	C	G	rs373946226	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr4:1388755C>G	ENST00000324803.4	+	1	3416	c.456C>G	c.(454-456)ccC>ccG	p.P152P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	152					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	566	0.113019	0.0772	0.1657	5008	,	,		16075	0.0139		0.1441	False		,,,				2504	0.1943				p.P152P		.											.	CRIPAK-90	0			c.C456G						.						75.0	67.0	69.0					4																	1388755		2201	4282	6483	SO:0001819	synonymous_variant	285464	exon1			CGTGCCCATGCGG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.456C>G	4.37:g.1388755C>G		0	0		45	26	NM_175918	0	0	5	16	11	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1	.	.	.	.	.	.	.	.	.	.	-	3.606	-0.080629	0.07141	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.9	0.07665	.	.	.	.	.	T	0.13713	0.0332	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26643	-1.0097	5	0.12430	T	0.62	.	2.6602	0.05024	0.0:0.3324:0.2607:0.407	.	.	.	.	D	136	.	ENSP00000372402:H136D	H	+	1	0	CRIPAK	1378755	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	-4.277000	0.00261	-0.599000	0.05798	-1.737000	0.00689	CAT	C|0.960;G|0.040		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	13	0		90	7	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000515809.1_Intron|RBM47_ENST00000381795.6_Silent_p.S19S|RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000514014.1_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		0	0		6	5	NM_001098634	0	0	0	1	1	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
FRG1	2483	bcgsc.ca	37	4	190878626	190878626	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr4:190878626G>A	ENST00000226798.4	+	6	728	c.506G>A	c.(505-507)aGt>aAt	p.S169N	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	169					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.S169N(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		GAAGCAAAAAGTAAAACAGCA	0.363																																					p.S169N		.											.	FRG1-90	1	Substitution - Missense(1)	skin(1)	c.G506A						.						49.0	46.0	47.0					4																	190878626		2184	4282	6466	SO:0001583	missense	2483	exon6			CAAAAAGTAAAAC	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.506G>A	4.37:g.190878626G>A	ENSP00000226798:p.Ser169Asn	910	17		700	18	NM_004477	0	0	54	54	0	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	14.80	2.642895	0.47153	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.48522	1.77;0.81	4.19	2.41	0.29592	Actin cross-linking (1);	0.160510	0.64402	N	0.000002	T	0.36552	0.0971	N	0.17723	0.515	0.45777	D	0.998661	P	0.35982	0.531	P	0.45406	0.479	T	0.07578	-1.0765	10	0.30854	T	0.27	0.1847	7.6816	0.28518	0.219:0.0:0.781:0.0	.	169	Q14331	FRG1_HUMAN	N	169;41;106	ENSP00000226798:S169N;ENSP00000435943:S106N	ENSP00000226798:S169N	S	+	2	0	FRG1	191115620	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	1.784000	0.38674	0.340000	0.23745	0.454000	0.30748	AGT	G|0.500;A|0.500		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
PAPD7	11044	broad.mit.edu	37	5	6755013	6755014	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr5:6755013_6755014delAC	ENST00000230859.6	+	13	1713_1714	c.1584_1585delAC	c.(1582-1587)aaacacfs	p.H529fs		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	759					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GGAGGAAAAAACACACACACAC	0.653																																					p.528_529del	NSCLC(7;212 333 5667 23379 46547)	.											.	PAPD7-69	0			c.1584_1585del						.																																			SO:0001589	frameshift_variant	11044	exon13			GAAAAAACACACA	AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1584_1585delAC	5.37:g.6755023_6755024delAC	ENSP00000230859:p.His529fs	121	0		167	7	NM_006999	0	0	0	0	0	A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Frame_Shift_Del	DEL	ENST00000230859.6	37	CCDS3871.1																																																																																			.		0.653	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206904.1	NM_006999	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	0	0		9	8	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		1	0		9	8	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
PHYKPL	85007	hgsc.bcm.edu	37	5	177659519	177659519	+	Silent	SNP	C	C	G	rs116735771	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr5:177659519C>G	ENST00000308158.5	-	1	267	c.33G>C	c.(31-33)acG>acC	p.T11T	PHYKPL_ENST00000476170.2_Silent_p.T11T|PHYKPL_ENST00000481811.1_5'Flank	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	11						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	TCAGGGCCAGCGTGTCGGCCT	0.776													G|||	765	0.152756	0.3419	0.0663	5008	,	,		8862	0.1052		0.0755	False		,,,				2504	0.0869				p.T11T		.											.	AGXT2L2-91	0			c.G33C						.	G		758,2778		67,624,1077	3.0	3.0	3.0		33	-4.8	0.9	5	dbSNP_132	3	393,6805		10,373,3216	no	coding-synonymous	AGXT2L2	NM_153373.2		77,997,4293	GG,GC,CC		5.4598,21.4367,10.7229		11/451	177659519	1151,9583	1768	3599	5367	SO:0001819	synonymous_variant	85007	exon1			GGCCAGCGTGTCG	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.33G>C	5.37:g.177659519C>G		0	0		10	10	NM_153373	0	0	0	6	6	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Silent	SNP	ENST00000308158.5	37	CCDS4434.1																																																																																			C|0.854;G|0.146		0.776	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
COL23A1	91522	broad.mit.edu	37	5	177690210	177690210	+	Splice_Site	SNP	G	G	T	rs112924647		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr5:177690210G>T	ENST00000390654.3	-	9	995	c.638C>A	c.(637-639)gCg>gAg	p.A213E	COL23A1_ENST00000407622.1_Splice_Site_p.A177E	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	213	Collagen-like 1.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A213E(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		CTCTCTTACCGCTGGGCCTTG	0.657																																					p.A213E		.											.	COL23A1-91	1	Substitution - Missense(1)	lung(1)	c.C638A						.						49.0	51.0	50.0					5																	177690210		1948	4133	6081	SO:0001630	splice_region_variant	91522	exon9			CTTACCGCTGGGC	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.639+1C>A	5.37:g.177690210G>T		82	0		119	5	NM_173465	0	0	0	0	0	Q8IVR4|Q9NT93	Missense_Mutation	SNP	ENST00000390654.3	37	CCDS4436.1	.	.	.	.	.	.	.	.	.	.	G	1.102	-0.660672	0.03454	.	.	ENSG00000050767	ENST00000390654;ENST00000407622	D;D	0.94330	-3.4;-3.34	4.48	-6.4	0.01944	.	1.017330	0.07908	N	0.973844	D	0.87188	0.6115	L	0.41573	1.285	0.21553	N	0.999647	P	0.35208	0.49	B	0.42163	0.378	T	0.76979	-0.2758	10	0.07175	T	0.84	0.2871	5.9678	0.19334	0.2232:0.0:0.3793:0.3976	.	213	Q86Y22	CONA1_HUMAN	E	213;177	ENSP00000375069:A213E;ENSP00000385092:A177E	ENSP00000375069:A213E	A	-	2	0	COL23A1	177622816	0.265000	0.24102	0.825000	0.32803	0.076000	0.17211	0.023000	0.13533	-1.521000	0.01771	-1.786000	0.00637	GCG	G|0.500;A|0.500		0.657	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	Missense_Mutation
SYNGAP1	8831	broad.mit.edu	37	6	33419613	33419615	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr6:33419613_33419615delCAG	ENST00000418600.2	+	19	4063_4065	c.3962_3964delCAG	c.(3961-3966)ccagcc>ccc	p.A1322del	ZBTB9_ENST00000395064.2_5'Flank|SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000428982.2_In_Frame_Del_p.A1263del	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	1322					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CTGGCCCCCCCAGCCCCACCACC	0.631																																					p.1321_1322del		.											.	SYNGAP1-48	0			c.3962_3964del						.																																			SO:0001651	inframe_deletion	8831	exon19			CCCCCCCAGCCCC	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.3962_3964delCAG	6.37:g.33419613_33419615delCAG	ENSP00000403636:p.Ala1322del	12	0		6	1	NM_006772	0	0	0	0	0	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	In_Frame_Del	DEL	ENST00000418600.2	37	CCDS34434.2																																																																																			.		0.631	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
C6orf222	389384	broad.mit.edu	37	6	36297915	36297915	+	Missense_Mutation	SNP	A	A	C			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr6:36297915A>C	ENST00000437635.2	-	2	730	c.553T>G	c.(553-555)Tcc>Gcc	p.S185A		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	185										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						GCTGCCTTGGACAACCCTTCC	0.642																																					p.S185A		.											.	C6orf222-93	0			c.T553G						.						69.0	56.0	60.0					6																	36297915		2203	4300	6503	SO:0001583	missense	389384	exon2			CCTTGGACAACCC		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.553T>G	6.37:g.36297915A>C	ENSP00000418983:p.Ser185Ala	93	0		47	3	NM_001010903	0	0	0	0	0	B2RTY8	Missense_Mutation	SNP	ENST00000437635.2	37	CCDS34439.1	.	.	.	.	.	.	.	.	.	.	A	7.571	0.666742	0.14710	.	.	ENSG00000189325	ENST00000437635	T	0.44482	0.92	3.62	-0.611	0.11601	.	0.526148	0.14357	N	0.324738	T	0.05731	0.0150	N	0.22421	0.69	0.09310	N	1	B	0.28801	0.223	B	0.28139	0.086	T	0.38394	-0.9663	10	0.02654	T	1	.	3.1931	0.06624	0.2866:0.0:0.5234:0.19	.	185	P0C671	CF222_HUMAN	A	185	ENSP00000418983:S185A	ENSP00000418983:S185A	S	-	1	0	C6orf222	36405893	0.093000	0.21703	0.000000	0.03702	0.034000	0.12701	0.275000	0.18698	-0.106000	0.12110	0.240000	0.17902	TCC	.		0.642	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	0	0		14	14	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		1	0		14	13	NM_000287	0	0	0	4	4	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
FIG4	9896	ucsc.edu;bcgsc.ca	37	6	110064928	110064928	+	Missense_Mutation	SNP	A	A	T	rs2295837	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr6:110064928A>T	ENST00000230124.3	+	10	1214	c.1090A>T	c.(1090-1092)Atg>Ttg	p.M364L	FIG4_ENST00000441478.2_Missense_Mutation_p.M87L	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	364	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.		M -> L (in dbSNP:rs2295837).		cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		CTTTGACCAGATGTTCCAGAG	0.438													A|||	501	0.10004	0.0174	0.1153	5008	,	,		17593	0.1984		0.0408	False		,,,				2504	0.1605				p.M364L		.											.	FIG4-69	0			c.A1090T						.	A	LEU/MET	95,4311	76.8+/-115.0	0,95,2108	141.0	129.0	133.0		1090	4.9	1.0	6	dbSNP_100	133	307,8293	111.0+/-171.3	6,295,3999	yes	missense	FIG4	NM_014845.5	15	6,390,6107	TT,TA,AA		3.5698,2.1562,3.0909	benign	364/908	110064928	402,12604	2203	4300	6503	SO:0001583	missense	9896	exon10			GACCAGATGTTCC	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1090A>T	6.37:g.110064928A>T	ENSP00000230124:p.Met364Leu	55	0		46	5	NM_014845	0	0	3	3	0	Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	CCDS5078.1	216	0.0989010989010989	11	0.022357723577235773	30	0.08287292817679558	137	0.2395104895104895	38	0.05013192612137203	A	9.724	1.160495	0.21454	0.021562	0.035698	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.40476	1.03;1.03	4.88	4.88	0.63580	Synaptojanin, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.04092	0.0114	N	0.00385	-1.57	0.09310	P	0.99999639549	B;B	0.18610	0.0;0.029	B;B	0.16289	0.001;0.015	T	0.28299	-1.0048	9	0.02654	T	1	-12.8017	14.7843	0.69790	1.0:0.0:0.0:0.0	rs2295837;rs2295837	87;364	F5H8L9;Q92562	.;FIG4_HUMAN	L	87;364	ENSP00000399443:M87L;ENSP00000230124:M364L	ENSP00000230124:M364L	M	+	1	0	FIG4	110171621	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.970000	0.93415	1.957000	0.56846	0.528000	0.53228	ATG	A|0.937;T|0.063		0.438	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845	
GARS	2617	hgsc.bcm.edu	37	7	30634661	30634661	+	Missense_Mutation	SNP	C	C	G	rs1049402	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr7:30634661C>G	ENST00000389266.3	+	1	365	c.124C>G	c.(124-126)Ccc>Gcc	p.P42A	AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000582549.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000581665.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	42			P -> A (in dbSNP:rs1049402). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7753621, ECO:0000269|PubMed:7961834, ECO:0000269|PubMed:7962006}.		cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)	p.P42fs*20(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GGCCTCCTGCCCCCCGATCTC	0.736													G|||	3252	0.649361	0.5219	0.7147	5008	,	,		13746	0.6677		0.7634	False		,,,				2504	0.6391				p.P42A		.											.	GARS-91	1	Insertion - Frameshift(1)	large_intestine(1)	c.C124G						.	G	ALA/PRO	2445,1427		776,893,267	5.0	8.0	7.0		124	-6.6	0.0	7	dbSNP_86	7	6367,1671		2577,1213,229	no	missense	GARS	NM_002047.2	27	3353,2106,496	GG,GC,CC		20.7888,36.8543,26.0118	benign	42/740	30634661	8812,3098	1936	4019	5955	SO:0001583	missense	2617	exon1			TCCTGCCCCCCGA	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.124C>G	7.37:g.30634661C>G	ENSP00000373918:p.Pro42Ala	1	0		8	8	NM_002047	0	0	0	1	1	B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	ENST00000389266.3	37	CCDS43564.1	1456	0.6666666666666666	278	0.5650406504065041	268	0.7403314917127072	337	0.5891608391608392	573	0.7559366754617414	G	0.005	-2.164835	0.00318	0.631457	0.792112	ENSG00000106105	ENST00000389266	T	0.80393	-1.37	3.31	-6.63	0.01807	.	1.037800	0.07609	N	0.925137	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.13575	-1.0504	9	0.08179	T	0.78	.	5.5596	0.17135	0.0726:0.2689:0.1197:0.5389	rs1049402;rs3189564;rs11553500;rs17856223;rs17856227;rs1049402	42	P41250	SYG_HUMAN	A	42	ENSP00000373918:P42A	ENSP00000373918:P42A	P	+	1	0	GARS	30601186	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.671000	0.05250	-2.551000	0.00479	-0.744000	0.03518	CCC	C|0.329;G|0.671		0.736	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
CLDN23	137075	hgsc.bcm.edu	37	8	8560536	8560536	+	Missense_Mutation	SNP	G	G	A	rs12548737	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr8:8560536G>A	ENST00000519106.1	+	1	1089	c.628G>A	c.(628-630)Gtg>Atg	p.V210M		NM_194284.2	NP_919260.2	Q96B33	CLD23_HUMAN	claudin 23	210			V -> M (in dbSNP:rs12548737).		calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)	2		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.071)|READ - Rectum adenocarcinoma(644;0.238)		CACCATCCAAGTGGAGTGGCC	0.731													G|||	569	0.113618	0.0083	0.1916	5008	,	,		12622	0.1488		0.0954	False		,,,				2504	0.183				p.V210M		.											.	.	0			c.G628A						.	G	MET/VAL	84,3832		0,84,1874	5.0	8.0	7.0		628	2.3	0.8	8	dbSNP_120	7	857,7211		50,757,3227	yes	missense	CLDN23	NM_194284.2	21	50,841,5101	AA,AG,GG		10.6222,2.145,7.8521	possibly-damaging	210/293	8560536	941,11043	1958	4034	5992	SO:0001583	missense	137075	exon1			ATCCAAGTGGAGT	AK123547	CCDS55195.1	8p23.1	2006-04-12				ENSG00000253958		"""Claudins"""	17591	protein-coding gene	gene with protein product		609203				12736707	Standard	NM_194284		Approved	CLDNL	uc003wsi.3	Q96B33		ENST00000519106.1:c.628G>A	8.37:g.8560536G>A	ENSP00000428780:p.Val210Met	1	0		8	8	NM_194284	0	0	0	0	0	Q08AJ3	Missense_Mutation	SNP	ENST00000519106.1	37	CCDS55195.1	199	0.09111721611721611	8	0.016260162601626018	54	0.14917127071823205	69	0.12062937062937062	68	0.08970976253298153	G	12.41	1.930863	0.34096	0.02145	0.106222	ENSG00000253958	ENST00000519106	T	0.61859	0.07	4.12	2.31	0.28768	.	.	.	.	.	T	0.00300	0.0009	L	0.27053	0.805	0.40159	P	0.022958000000000034	P	0.48162	0.906	P	0.46585	0.521	T	0.03524	-1.1028	8	0.33940	T	0.23	.	8.182	0.31315	0.2087:0.0:0.7913:0.0	rs12548737	210	Q96B33	CLD23_HUMAN	M	210	ENSP00000428780:V210M	ENSP00000428780:V210M	V	+	1	0	CLDN23	8597946	0.949000	0.32298	0.846000	0.33378	0.051000	0.14879	3.623000	0.54224	1.090000	0.41315	0.407000	0.27541	GTG	G|0.907;A|0.093		0.731	CLDN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374721.1	NM_194284	
JPH1	56704	broad.mit.edu	37	8	75233186	75233186	+	Missense_Mutation	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr8:75233186C>T	ENST00000342232.4	-	1	377	c.337G>A	c.(337-339)Ggg>Agg	p.G113R		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	113	Gly-rich.				calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			TCTTGCAGCCCGTTACTCCAG	0.692																																					p.G113R		.											.	JPH1-91	0			c.G337A						.						50.0	37.0	42.0					8																	75233186		2203	4297	6500	SO:0001583	missense	56704	exon1			GCAGCCCGTTACT	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.337G>A	8.37:g.75233186C>T	ENSP00000344488:p.Gly113Arg	196	0		131	4	NM_020647	0	0	0	0	0	B2RTZ0	Missense_Mutation	SNP	ENST00000342232.4	37	CCDS6217.1	.	.	.	.	.	.	.	.	.	.	c	27.9	4.875323	0.91664	.	.	ENSG00000104369	ENST00000342232	T	0.75589	-0.95	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	D	0.89125	0.6626	H	0.94808	3.585	0.80722	D	1	D	0.71674	0.998	D	0.65874	0.939	D	0.92685	0.6161	10	0.87932	D	0	.	16.2109	0.82158	0.0:1.0:0.0:0.0	.	113	Q9HDC5	JPH1_HUMAN	R	113	ENSP00000344488:G113R	ENSP00000344488:G113R	G	-	1	0	JPH1	75395741	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.557000	0.82243	2.120000	0.65058	0.401000	0.26515	GGG	.		0.692	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
TMEM67	91147	broad.mit.edu	37	8	94809628	94809628	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr8:94809628G>T	ENST00000453321.3	+	20	2088	c.2030G>T	c.(2029-2031)tGg>tTg	p.W677L	TMEM67_ENST00000409623.3_Missense_Mutation_p.W596L	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	677					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			GCAAATGAATGGAATGAAATT	0.358																																					p.W677L		.											.	TMEM67-92	0			c.G2030T						.						156.0	147.0	150.0					8																	94809628		2203	4300	6503	SO:0001583	missense	91147	exon20			ATGAATGGAATGA	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.2030G>T	8.37:g.94809628G>T	ENSP00000389998:p.Trp677Leu	133	0		79	4	NM_153704	0	0	1	1	0	B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	ENST00000453321.3	37	CCDS6258.2	.	.	.	.	.	.	.	.	.	.	G	29.6	5.018880	0.93404	.	.	ENSG00000164953	ENST00000453321;ENST00000409623	D;D	0.96334	-3.98;-3.98	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.98324	0.9444	M	0.86268	2.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.77004	0.989;0.989;0.981	D	0.99026	1.0819	10	0.87932	D	0	-7.4039	19.6576	0.95849	0.0:0.0:1.0:0.0	.	677;596;596	Q5HYA8;B3KRU5;G5E9H2	MKS3_HUMAN;.;.	L	677;596	ENSP00000389998:W677L;ENSP00000386966:W596L	ENSP00000314488:W667L	W	+	2	0	TMEM67	94878804	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.651000	0.90000	0.650000	0.86243	TGG	.		0.358	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329641.2	NM_153704	
TATDN1	83940	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	125498340	125498340	+	IGR	SNP	C	C	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr8:125498340C>G	ENST00000276692.6	-	0	1018				RNF139_ENST00000303545.3_Missense_Mutation_p.I150M|RP11-158K1.3_ENST00000518639.1_RNA	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TTCATTCCATCTATTCACAAT	0.398																																					p.I150M		.											.	RNF139-226	0			c.C450G						.						114.0	108.0	110.0					8																	125498340		2203	4300	6503	SO:0001628	intergenic_variant	11236	exon2			TTCCATCTATTCA	AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		8.37:g.125498340C>G		249	0		106	6	NM_007218	0	0	4	4	0	B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	ENST00000276692.6	37	CCDS6351.1	.	.	.	.	.	.	.	.	.	.	C	8.833	0.940406	0.18281	.	.	ENSG00000170881	ENST00000303545;ENST00000517684	T	0.26660	1.72	5.34	4.4	0.53042	.	0.380726	0.25584	N	0.029673	T	0.18173	0.0436	L	0.38175	1.15	0.36058	D	0.841238	B	0.30068	0.267	B	0.27380	0.079	T	0.11743	-1.0575	10	0.36615	T	0.2	-1.7626	8.4726	0.32995	0.2171:0.6456:0.1373:0.0	.	150	Q8WU17	RN139_HUMAN	M	150;23	ENSP00000304051:I150M	ENSP00000304051:I150M	I	+	3	3	RNF139	125567521	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	1.370000	0.34238	2.642000	0.89623	0.650000	0.86243	ATC	.		0.398	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381655.1	NM_032026	
TSNARE1	203062	hgsc.bcm.edu;ucsc.edu;bcgsc.ca	37	8	143396409	143396409	+	Missense_Mutation	SNP	T	T	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr8:143396409T>G	ENST00000307180.3	-	8	1146	c.1029A>C	c.(1027-1029)aaA>aaC	p.K343N	TSNARE1_ENST00000524325.1_Missense_Mutation_p.K342N|TSNARE1_ENST00000520166.1_Missense_Mutation_p.K342N|TSNARE1_ENST00000519651.1_Missense_Mutation_p.K123N|TSNARE1_ENST00000518928.1_5'UTR	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	343					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGAGCTGGGTTTTCAGCCGGT	0.657																																					p.K343N		.											.	TSNARE1-90	0			c.A1029C						.						122.0	87.0	99.0					8																	143396409		2203	4300	6503	SO:0001583	missense	203062	exon8			CTGGGTTTTCAGC			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.1029A>C	8.37:g.143396409T>G	ENSP00000303437:p.Lys343Asn	294	2		150	134	NM_145003	0	0	0	0	0	B7ZLB0|Q14D03	Missense_Mutation	SNP	ENST00000307180.3	37	CCDS6384.1	.	.	.	.	.	.	.	.	.	.	T	9.070	0.996771	0.19043	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166;ENST00000519651	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	4.49	-2.13	0.07144	t-SNARE (1);	0.227256	0.21033	U	0.081304	T	0.24661	0.0598	L	0.59436	1.845	0.09310	N	1	P;P;P;P	0.44627	0.839;0.799;0.839;0.839	B;B;B;B	0.43623	0.425;0.343;0.425;0.425	T	0.12451	-1.0547	10	0.38643	T	0.18	.	4.3125	0.10977	0.0:0.2693:0.334:0.3967	.	342;123;343;343	B7ZLB0;E5RHT3;Q96NA8;A0AVG3	.;.;TSNA1_HUMAN;.	N	342;343;342;123	ENSP00000428763:K342N;ENSP00000303437:K343N;ENSP00000427770:K342N;ENSP00000429679:K123N	ENSP00000303437:K343N	K	-	3	2	TSNARE1	143394316	0.000000	0.05858	0.004000	0.12327	0.115000	0.19883	-0.608000	0.05641	-0.141000	0.11374	-0.265000	0.10407	AAA	.		0.657	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003	
PLEC	5339	hgsc.bcm.edu	37	8	144998190	144998190	+	Silent	SNP	A	A	G	rs2857829	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr8:144998190A>G	ENST00000322810.4	-	31	6487	c.6318T>C	c.(6316-6318)gcT>gcC	p.A2106A	PLEC_ENST00000354589.3_Silent_p.A1969A|PLEC_ENST00000398774.2_Silent_p.A1937A|PLEC_ENST00000345136.3_Silent_p.A1969A|PLEC_ENST00000436759.2_Silent_p.A1996A|PLEC_ENST00000356346.3_Silent_p.A1955A|PLEC_ENST00000354958.2_Silent_p.A1947A|PLEC_ENST00000357649.2_Silent_p.A1973A|PLEC_ENST00000527096.1_Silent_p.A1992A	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2106	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCTGCCTCGCAGCCTCCAGCT	0.746													a|||	1156	0.230831	0.028	0.2968	5008	,	,		12955	0.1429		0.4274	False		,,,				2504	0.3466				p.A2106A		.											.	PLEC-141	0			c.T6318C						.	G	,,,,,,,	343,3813		21,301,1756	7.0	8.0	8.0		5988,5865,5841,6318,5811,5907,5919,5907	-8.1	0.0	8	dbSNP_100	8	3082,5166		620,1842,1662	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	641,2143,3418	GG,GA,AA		37.3666,8.2531,27.6121	,,,,,,,	1996/4575,1955/4534,1947/4526,2106/4685,1937/4516,1969/4548,1973/4552,1969/4548	144998190	3425,8979	2078	4124	6202	SO:0001819	synonymous_variant	5339	exon31			CCTCGCAGCCTCC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6318T>C	8.37:g.144998190A>G		2	0		12	12	NM_201380	0	0	0	11	11	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			A|0.738;G|0.262		0.746	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001588	145001588	+	Missense_Mutation	SNP	C	C	T	rs11136334	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr8:145001588C>T	ENST00000322810.4	-	27	4326	c.4157G>A	c.(4156-4158)cGg>cAg	p.R1386Q	PLEC_ENST00000354589.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000398774.2_Missense_Mutation_p.R1217Q|PLEC_ENST00000345136.3_Missense_Mutation_p.R1249Q|PLEC_ENST00000436759.2_Missense_Mutation_p.R1276Q|PLEC_ENST00000356346.3_Missense_Mutation_p.R1235Q|PLEC_ENST00000354958.2_Missense_Mutation_p.R1227Q|PLEC_ENST00000357649.2_Missense_Mutation_p.R1253Q|PLEC_ENST00000527096.1_Missense_Mutation_p.R1272Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1386	Globular 1.		R -> Q (in dbSNP:rs11136334).		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTGCTCCTGCCGCAGCTGCTC	0.736													C|||	1156	0.230831	0.028	0.2954	5008	,	,		13418	0.1429		0.4274	False		,,,				2504	0.3476				p.R1386Q		.											.	PLEC-141	0			c.G4157A						.	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	388,3674		38,312,1681	12.0	16.0	15.0		3746,3758,3746,3650,4157,3680,3704,3827	-0.7	1.0	8	dbSNP_120	15	3413,4885		747,1919,1483	no	missense,missense,missense,missense,missense,missense,missense,missense	PLEC	NM_201384.1,NM_201383.1,NM_201382.2,NM_201381.1,NM_201380.2,NM_201379.1,NM_201378.2,NM_000445.3	43,43,43,43,43,43,43,43	785,2231,3164	TT,TC,CC		41.1304,9.5519,30.7524	benign,benign,benign,benign,benign,benign,benign,benign	1249/4548,1253/4552,1249/4548,1217/4516,1386/4685,1227/4526,1235/4534,1276/4575	145001588	3801,8559	2031	4149	6180	SO:0001583	missense	5339	exon27			TCCTGCCGCAGCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4157G>A	8.37:g.145001588C>T	ENSP00000323856:p.Arg1386Gln	0	0		12	12	NM_201380	0	0	0	0	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	536	0.2454212454212454	15	0.03048780487804878	108	0.2983425414364641	94	0.16433566433566432	319	0.420844327176781	C	12.61	1.989397	0.35131	0.095519	0.411304	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38;1.38	5.1	-0.662	0.11413	.	1.260670	0.05768	N	0.606168	T	0.00012	0.0000	N	0.02011	-0.69	0.41093	P	0.014382000000000006	B;B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0;0.0;0.0	T	0.44605	-0.9317	9	0.19590	T	0.45	.	4.6892	0.12772	0.2556:0.2308:0.0:0.5136	rs11136334	1276;1235;1227;1386;1217;1249;1253;1249	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	1249;1253;1249;1217;1386;1227;1235;1276;1272	ENSP00000344848:R1249Q;ENSP00000350277:R1253Q;ENSP00000346602:R1249Q;ENSP00000381756:R1217Q;ENSP00000323856:R1386Q;ENSP00000347044:R1227Q;ENSP00000348702:R1235Q;ENSP00000388180:R1276Q;ENSP00000434583:R1272Q	ENSP00000323856:R1386Q	R	-	2	0	PLEC	145073576	0.001000	0.12720	0.979000	0.43373	0.833000	0.47200	0.002000	0.13061	-0.040000	0.13580	-0.369000	0.07265	CGG	C|0.707;T|0.293		0.736	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
PLEC	5339	hgsc.bcm.edu	37	8	145001784	145001784	+	Silent	SNP	A	A	G	rs3135109	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr8:145001784A>G	ENST00000322810.4	-	27	4130	c.3961T>C	c.(3961-3963)Ttg>Ctg	p.L1321L	PLEC_ENST00000354589.3_Silent_p.L1184L|PLEC_ENST00000398774.2_Silent_p.L1152L|PLEC_ENST00000345136.3_Silent_p.L1184L|PLEC_ENST00000436759.2_Silent_p.L1211L|PLEC_ENST00000356346.3_Silent_p.L1170L|PLEC_ENST00000354958.2_Silent_p.L1162L|PLEC_ENST00000357649.2_Silent_p.L1188L|PLEC_ENST00000527096.1_Silent_p.L1207L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1321	Globular 1.		L -> V (in dbSNP:rs3135109). {ECO:0000269|PubMed:8698233}.		apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCAAGCAACTGGGCGACC	0.716													G|||	1156	0.230831	0.028	0.2954	5008	,	,		12494	0.1429		0.4274	False		,,,				2504	0.3476				p.L1321L		.											.	PLEC-141	0			c.T3961C						.	G	,,,,,,,	296,3620		20,256,1682	5.0	6.0	6.0		3631,3508,3484,3961,3454,3550,3562,3550	4.4	0.9	8	dbSNP_103	6	2835,5065		532,1771,1647	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PLEC	NM_000445.3,NM_201378.2,NM_201379.1,NM_201380.2,NM_201381.1,NM_201382.2,NM_201383.1,NM_201384.1	,,,,,,,	552,2027,3329	GG,GA,AA		35.8861,7.5587,26.498	,,,,,,,	1211/4575,1170/4534,1162/4526,1321/4685,1152/4516,1184/4548,1188/4552,1184/4548	145001784	3131,8685	1958	3950	5908	SO:0001819	synonymous_variant	5339	exon27			CAAGCAACTGGGC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3961T>C	8.37:g.145001784A>G		0	0		10	10	NM_201380	0	0	0	4	4	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	ENST00000322810.4	37	CCDS43772.1																																																																																			G|0.246;A|0.754		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
CDKN2B	1030	bcgsc.ca;mdanderson.org	37	9	22009141	22009141	+	5'UTR	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr9:22009141C>T	ENST00000276925.6	-	0	221				CDKN2B-AS1_ENST00000584637.1_RNA|CDKN2B-AS1_ENST00000580467.1_RNA|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2B-AS1_ENST00000577551.1_RNA|CDKN2B-AS1_ENST00000585267.1_RNA|CDKN2B-AS1_ENST00000582301.1_RNA|CDKN2B-AS1_ENST00000580576.1_RNA|CDKN2B-AS1_ENST00000584816.1_RNA|CDKN2B-AS1_ENST00000582072.1_RNA|CDKN2B_ENST00000380142.4_5'UTR|CDKN2B-AS1_ENST00000428597.1_RNA|CDKN2B-AS1_ENST00000584351.1_RNA|CDKN2B-AS1_ENST00000583719.1_RNA|CDKN2B-AS1_ENST00000581051.1_RNA|CDKN2B_ENST00000539462.1_5'Flank|CDKN2B-AS1_ENST00000468603.2_RNA|CDKN2B-AS1_ENST00000455933.2_RNA|CDKN2B-AS1_ENST00000584020.1_RNA	NM_004936.3|NM_078487.2	NP_004927.2|NP_511042.1	P42772	CDN2B_HUMAN	cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)						aging (GO:0007568)|cell cycle arrest (GO:0007050)|cellular response to extracellular stimulus (GO:0031668)|cellular response to nutrient (GO:0031670)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|liver development (GO:0001889)|megakaryocyte differentiation (GO:0030219)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to cytokine (GO:0034097)|response to organic cyclic compound (GO:0014070)|spleen development (GO:0048536)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)	p.0(1)|p.0?(1)		lung(2)	2		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;1.31e-280)|Lung NSC(2;2.28e-131)|all_lung(2;2.11e-123)|Glioma(2;5.66e-57)|all_neural(2;3.05e-50)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;8.01e-33)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00369)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;3.29e-71)|Epithelial(2;9.08e-60)|LUSC - Lung squamous cell carcinoma(2;5.8e-46)|LUAD - Lung adenocarcinoma(2;1.43e-25)|BRCA - Breast invasive adenocarcinoma(2;5.37e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;6.92e-07)|KIRC - Kidney renal clear cell carcinoma(2;8.63e-07)|OV - Ovarian serous cystadenocarcinoma(39;0.014)|COAD - Colon adenocarcinoma(8;0.143)		AGCGGCCGGTCGTTAGCTCCG	0.662											OREG0019127	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		.											.	CDKN2B-792	2	Whole gene deletion(2)	lung(2)	.						.																																			SO:0001623	5_prime_UTR_variant	1030	.			GCCGGTCGTTAGC	AB060808	CCDS6512.1, CCDS6513.1	9p21	2008-07-21			ENSG00000147883	ENSG00000147883			1788	protein-coding gene	gene with protein product		600431				8078588	Standard	NM_004936		Approved	P15, MTS2, INK4B, TP15, CDK4I, p15INK4b	uc003zpo.3	P42772	OTTHUMG00000019691	ENST00000276925.6:c.-189G>A	9.37:g.22009141C>T		86	2	752	111	58	.	0	0	3	3	0	O15125|Q6FI09	RNA	SNP	ENST00000276925.6	37	CCDS6512.1																																																																																			.		0.662	CDKN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051932.2	NM_004936	
BICD2	23299	broad.mit.edu	37	9	95526977	95526977	+	Missense_Mutation	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr9:95526977G>T	ENST00000375512.3	-	1	117	c.50C>A	c.(49-51)gCg>gAg	p.A17E	BICD2_ENST00000356884.6_Missense_Mutation_p.A17E	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	17					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTCCGGCTGCGCCTCCATCAC	0.731																																					p.A17E		.											.	BICD2-226	0			c.C50A						.						9.0	10.0	9.0					9																	95526977		2068	4116	6184	SO:0001583	missense	23299	exon1			GGCTGCGCCTCCA	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.50C>A	9.37:g.95526977G>T	ENSP00000364662:p.Ala17Glu	18	1		81	16	NM_001003800	0	0	0	0	0	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	37	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	.	16.77	3.215213	0.58452	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.44881	0.91;0.92	4.35	4.35	0.52113	.	0.211686	0.38548	N	0.001654	T	0.42539	0.1207	L	0.34521	1.04	0.43512	D	0.995772	D;P	0.55800	0.973;0.954	P;P	0.53360	0.724;0.534	T	0.10660	-1.0620	10	0.17832	T	0.49	-38.5328	15.1518	0.72706	0.0:0.0:1.0:0.0	.	17;17	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	E	17	ENSP00000349351:A17E;ENSP00000364662:A17E	ENSP00000349351:A17E	A	-	2	0	BICD2	94566798	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	8.700000	0.91322	2.349000	0.79799	0.195000	0.17529	GCG	.		0.731	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250	
MORN5	254956	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	124936830	124936830	+	Nonsense_Mutation	SNP	C	C	G			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr9:124936830C>G	ENST00000373764.3	+	4	425	c.363C>G	c.(361-363)taC>taG	p.Y121*	MORN5_ENST00000486801.1_3'UTR|MORN5_ENST00000536616.1_Nonsense_Mutation_p.Y121*	NM_198469.2	NP_940871.2	Q5VZ52	MORN5_HUMAN	MORN repeat containing 5	121								p.Y121Y(2)		endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	9						AGGGCTATTACGATTGTGGAG	0.463																																					p.Y121X		.											.	MORN5-90	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)	c.C363G						.						103.0	100.0	101.0					9																	124936830		2203	4300	6503	SO:0001587	stop_gained	254956	exon4			CTATTACGATTGT	AK128877	CCDS6836.1, CCDS75894.1	9q34.11	2008-06-23	2008-06-23	2008-06-23	ENSG00000185681	ENSG00000185681			17841	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 113"", ""chromosome 9 open reading frame 18"""	C9orf113, C9orf18			Standard	XM_005251878		Approved	FLJ46909	uc004blw.2	Q5VZ52	OTTHUMG00000020599	ENST00000373764.3:c.363C>G	9.37:g.124936830C>G	ENSP00000362869:p.Tyr121*	112	0		146	31	NM_198469	0	0	7	7	0	B7Z7I5|Q6ZQN1	Nonsense_Mutation	SNP	ENST00000373764.3	37	CCDS6836.1	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604059	0.28534	.	.	ENSG00000185681	ENST00000373764;ENST00000536616;ENST00000418632	.	.	.	5.65	-3.6	0.04570	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5602	7.2327	0.26051	0.0:0.3728:0.1172:0.51	.	.	.	.	X	121;121;105	.	ENSP00000362869:Y121X	Y	+	3	2	MORN5	123976651	0.939000	0.31865	0.496000	0.27539	0.334000	0.28698	-0.079000	0.11357	-0.466000	0.06943	-0.303000	0.09236	TAC	.		0.463	MORN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053910.2	NM_198469	
NAIF1	203245	broad.mit.edu	37	9	130828964	130828964	+	Silent	SNP	G	G	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr9:130828964G>T	ENST00000373078.4	-	1	636	c.417C>A	c.(415-417)gcC>gcA	p.A139A	NAIF1_ENST00000488519.1_5'Flank|SLC25A25_ENST00000373069.5_5'Flank|SLC25A25_ENST00000373068.2_5'Flank	NM_197956.3	NP_931045.1	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	139					negative regulation of cell growth (GO:0030308)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TGATGATGGTGGCCTCGCCCA	0.672																																					p.A139A		.											.	NAIF1-68	0			c.C417A						.						59.0	58.0	58.0					9																	130828964		2202	4300	6502	SO:0001819	synonymous_variant	203245	exon1			GATGGTGGCCTCG	AK122729	CCDS6889.1	9q34.11	2008-04-10	2008-04-10	2008-04-10	ENSG00000171169	ENSG00000171169			25446	protein-coding gene	gene with protein product	"""nuclear apoptosis-inducing factor 1"""	610673	"""chromosome 9 open reading frame 90"""	C9orf90		14702039, 16378748	Standard	NM_197956		Approved	DKFZp762G199, bA379C10.2	uc004bta.3	Q69YI7	OTTHUMG00000020727	ENST00000373078.4:c.417C>A	9.37:g.130828964G>T		106	0		130	5	NM_197956	0	0	4	4	0	B3KV81|Q8WU12	Silent	SNP	ENST00000373078.4	37	CCDS6889.1																																																																																			.		0.672	NAIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054330.1	NM_197956	
WDR34	89891	hgsc.bcm.edu	37	9	131418828	131418828	+	Missense_Mutation	SNP	A	A	C	rs4837292		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr9:131418828A>C	ENST00000372715.2	-	1	238	c.178T>G	c.(178-180)Tgg>Ggg	p.W60G		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	60				W -> G (in Ref. 2; AAH11874/AAH01614). {ECO:0000305}.		axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						ACCGTCTCCCAGCGGATGCCC	0.806																																					p.W60G		.											.	WDR34-92	0			c.T178G						.	C	GLY/TRP	1803,9		897,9,0	1.0	1.0	1.0		178	2.1	1.0	9	dbSNP_111	1	3858,0		1929,0,0	no	missense	WDR34	NM_052844.3	184	2826,9,0	CC,CA,AA		0.0,0.4967,0.1587	benign	60/537	131418828	5661,9	906	1929	2835	SO:0001583	missense	89891	exon1			TCTCCCAGCGGAT	BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.178T>G	9.37:g.131418828A>C	ENSP00000361800:p.Trp60Gly	0	0		5	5	NM_052844	0	0	0	0	0	Q5VXV4|Q9BV46	Missense_Mutation	SNP	ENST00000372715.2	37	CCDS6906.2	2170	0.9935897435897436	486	0.9878048780487805	362	1.0	571	0.9982517482517482	751	0.9907651715039578	C	7.343	0.621247	0.14193	0.995033	1.0	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T;T;T	0.74106	-0.81;-0.81;-0.81	4.02	2.12	0.27331	.	0.538297	0.18788	N	0.131154	T	0.00012	0.0000	N	0.00538	-1.39	0.58432	P	1.999999999946489E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.34625	-0.9821	9	0.08381	T	0.77	-3.0135	7.4804	0.27402	0.1755:0.4462:0.3784:0.0	rs4837292;rs56752541	45;60	A2A3F8;Q96EX3	.;WDR34_HUMAN	G	60;51;45	ENSP00000361800:W60G;ENSP00000411370:W51G;ENSP00000415421:W45G	ENSP00000361800:W60G	W	-	1	0	WDR34	130458649	1.000000	0.71417	0.994000	0.49952	0.970000	0.65996	0.709000	0.25734	0.259000	0.21709	-0.126000	0.14955	TGG	A|0.006;C|0.994		0.806	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054463.1	NM_052844	
SAPCD2	89958	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	139959388	139959388	+	Missense_Mutation	SNP	G	G	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr9:139959388G>A	ENST00000409687.3	-	5	1110	c.983C>T	c.(982-984)aCg>aTg	p.T328M	RP11-229P13.22_ENST00000435463.2_RNA|RP11-229P13.23_ENST00000456356.2_RNA	NM_178448.3	NP_848543.2	Q86UD0	SAPC2_HUMAN	suppressor APC domain containing 2	328						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)											TGAGGTGGACGTcagggcagg	0.701																																					p.T328M		.											.	.	0			c.C983T						.						8.0	8.0	8.0					9																	139959388		2123	4184	6307	SO:0001583	missense	89958	exon5			GTGGACGTCAGGG	BC024299	CCDS7027.2	9q34.3	2012-02-08	2012-02-08	2012-02-08	ENSG00000186193	ENSG00000186193			28055	protein-coding gene	gene with protein product		612057	"""chromosome 9 open reading frame 140"""	C9orf140		12477932	Standard	NM_178448		Approved	p42.3	uc011men.2	Q86UD0	OTTHUMG00000020961	ENST00000409687.3:c.983C>T	9.37:g.139959388G>A	ENSP00000386348:p.Thr328Met	39	0		92	42	NM_178448	0	0	5	7	2		Missense_Mutation	SNP	ENST00000409687.3	37	CCDS7027.2	.	.	.	.	.	.	.	.	.	.	g	0.247	-1.009364	0.02095	.	.	ENSG00000186193	ENST00000409687	T	0.45276	0.9	2.98	-0.0543	0.13814	.	1.438730	0.04655	N	0.407813	T	0.23727	0.0574	N	0.22421	0.69	0.09310	N	1	P	0.37708	0.606	B	0.26864	0.074	T	0.15521	-1.0434	10	0.51188	T	0.08	-18.0158	4.0904	0.09967	0.2372:0.3851:0.3777:0.0	.	328	Q86UD0	CI140_HUMAN	M	328	ENSP00000386348:T328M	ENSP00000386348:T328M	T	-	2	0	C9orf140	139079209	0.001000	0.12720	0.000000	0.03702	0.049000	0.14656	0.442000	0.21628	-0.254000	0.09500	-0.648000	0.03929	ACG	.		0.701	SAPCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055215.2	NM_178448	
POLA1	5422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	24844592	24844592	+	Silent	SNP	C	C	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chrX:24844592C>T	ENST00000379059.3	+	32	3607	c.3592C>T	c.(3592-3594)Ctg>Ttg	p.L1198L	POLA1_ENST00000379068.3_Silent_p.L1204L	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	1198					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	GCCTGAGCAGCTGCAGAAACA	0.463																																					p.L1198L		.											.	POLA1-229	0			c.C3592T						.						116.0	75.0	89.0					X																	24844592		2203	4300	6503	SO:0001819	synonymous_variant	5422	exon32			GAGCAGCTGCAGA		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.3592C>T	X.37:g.24844592C>T		96	0		88	79	NM_016937	0	0	0	2	2	Q86UQ7	Silent	SNP	ENST00000379059.3	37	CCDS14214.1																																																																																			.		0.463	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
ATRX	546	broad.mit.edu	37	X	76856021	76856021	+	Missense_Mutation	SNP	T	T	C	rs45439799	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chrX:76856021T>C	ENST00000373344.5	-	23	5793	c.5579A>G	c.(5578-5580)aAt>aGt	p.N1860S	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Missense_Mutation_p.N1822S	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1860			N -> S (rare polymorphism; dbSNP:rs45439799). {ECO:0000269|PubMed:8968741}.		ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ACCTTCACTATTATTGCCCAC	0.363			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						T|||	11	0.00291391	0.0	0.0014	3775	,	,		11702	0.0		0.008	False		,,,				2504	0.002				p.N1860S		.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX-248	1	Unknown(1)	bone(1)	c.A5579G	GRCh37	CM950125	ATRX	M	rs45439799	.	T	SER/ASN,SER/ASN	2,3833		0,2,0,1630,571	179.0	156.0	164.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	5579,5465	3.4	1.0	X	dbSNP_127	164	65,6658		0,51,14,2376,1855	yes	missense,missense	ATRX	NM_000489.3,NM_138270.2	46,46	0,53,14,4006,2426	CC,CT,C,TT,T		0.9668,0.0522,0.6346	benign,benign	1860/2493,1822/2455	76856021	67,10491	2203	4296	6499	SO:0001583	missense	546	exon23			TCACTATTATTGC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5579A>G	X.37:g.76856021T>C	ENSP00000362441:p.Asn1860Ser	68	0		84	4	NM_000489	0	0	0	0	0	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	37	CCDS14434.1	6	0.003616636528028933	0	0.0	1	0.0027624309392265192	0	0.0	5	0.006596306068601583	T	5.672	0.308668	0.10733	5.22E-4	0.009668	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92595	-3.07;-3.07	5.2	3.41	0.39046	SNF2-related (1);	0.422825	0.24748	N	0.035929	T	0.71945	0.3400	N	0.05078	-0.115	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.65496	-0.6154	10	0.02654	T	1	-0.5634	8.8569	0.35234	0.0:0.7457:0.0:0.2543	rs45439799;rs61752452	1822;1860	P46100-4;P46100	.;ATRX_HUMAN	S	1860;1822	ENSP00000362441:N1860S;ENSP00000378967:N1822S	ENSP00000362441:N1860S	N	-	2	0	ATRX	76742677	0.975000	0.34042	0.982000	0.44146	0.547000	0.35210	0.994000	0.29693	0.389000	0.25086	-0.499000	0.04595	AAT	T|0.730;0|0.006		0.363	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
DIAPH2	1730	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	96603202	96603202	+	Missense_Mutation	SNP	T	T	C			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chrX:96603202T>C	ENST00000324765.8	+	24	3279	c.2932T>C	c.(2932-2934)Tac>Cac	p.Y978H	DIAPH2_ENST00000355827.4_Missense_Mutation_p.Y978H|DIAPH2_ENST00000373049.4_Missense_Mutation_p.Y978H|DIAPH2_ENST00000373061.3_Missense_Mutation_p.Y978H|DIAPH2_ENST00000373054.4_Missense_Mutation_p.Y974H			O60879	DIAP2_HUMAN	diaphanous-related formin 2	978	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						TCTTGGAGAATACTTCATTTT	0.368																																					p.Y978H		.											.	DIAPH2-133	0			c.T2932C						.						116.0	100.0	105.0					X																	96603202		2203	4300	6503	SO:0001583	missense	1730	exon24			GGAGAATACTTCA	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2932T>C	X.37:g.96603202T>C	ENSP00000321348:p.Tyr978His	127	2		169	166	NM_007309	0	0	0	5	5	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	ENST00000324765.8	37	CCDS14467.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.475141	0.84640	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.77	5.77	0.91146	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.078210	0.53938	D	0.000058	T	0.57198	0.2037	M	0.66378	2.025	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.77004	0.989;0.981	T	0.54523	-0.8281	10	0.29301	T	0.29	.	15.0168	0.71591	0.0:0.0:0.0:1.0	.	978;978	O60879;O60879-2	DIAP2_HUMAN;.	H	978;974;978;978;978;985	ENSP00000362152:Y978H;ENSP00000362145:Y974H;ENSP00000348082:Y978H;ENSP00000362140:Y978H;ENSP00000321348:Y978H	ENSP00000321348:Y978H	Y	+	1	0	DIAPH2	96489858	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.953000	0.87836	1.929000	0.55896	0.486000	0.48141	TAC	.		0.368	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651199	1651200	+	In_Frame_Ins	INS	-	-	GGCTGTGGCTCC	rs71025763|rs144216147	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:1651199_1651200insGGCTGTGGCTCC	ENST00000399676.2	+	1	167_168	c.129_130insGGCTGTGGCTCC	c.(130-132)ggc>GGCTGTGGCTCCggc	p.44_44G>GCGSG		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggctgtggggg	0.713																																					p.G43delinsGGCGS		.											.	KRTAP5-5-23	0			c.129_130insGGCTGTGGCTCC						.																																			SO:0001652	inframe_insertion	439915	exon1			CTGTGGAGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651199_1651200insGGCTGTGGCTCC	Exception_encountered	31	0		58	32	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Ins	INS	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.713	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
PGAP2	27315	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	3846588	3846589	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr11:3846588_3846589insT	ENST00000463452.2	+	6	748_749	c.665_666insT	c.(664-669)actgttfs	p.V223fs	PGAP2_ENST00000493547.2_3'UTR|PGAP2_ENST00000465307.2_3'UTR|PGAP2_ENST00000532017.1_3'UTR|PGAP2_ENST00000278243.4_Frame_Shift_Ins_p.V284fs|PGAP2_ENST00000300730.6_Frame_Shift_Ins_p.V276fs|PGAP2_ENST00000479072.1_Frame_Shift_Ins_p.V63fs|PGAP2_ENST00000396986.2_Frame_Shift_Ins_p.V280fs|PGAP2_ENST00000396993.4_3'UTR|PGAP2_ENST00000496834.2_Frame_Shift_Ins_p.V67fs|PGAP2_ENST00000396991.2_Frame_Shift_Ins_p.V284fs	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	223					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						CTGGAGTACACTGTTGTCTTAA	0.505											OREG0020703	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T340fs		.											.	PGAP2-90	0			c.1019_1020insT						.																																			SO:0001589	frameshift_variant	27315	exon8			AGTACACTGTTGT	AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.666dupT	11.37:g.3846589_3846589dupT	ENSP00000435223:p.Val223fs	241	0	614	154	143	NM_001256236	0	0	0	0	0	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Frame_Shift_Ins	INS	ENST00000463452.2	37	CCDS58112.1																																																																																			.		0.505	PGAP2-049	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000383260.1		
SCAF11	9169	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	46328052	46328053	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr12:46328052_46328053insA	ENST00000369367.3	-	8	771_772	c.538_539insT	c.(538-540)tggfs	p.W180fs	SCAF11_ENST00000549162.1_5'UTR|SCAF11_ENST00000419565.2_Frame_Shift_Ins_p.W180fs	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	180					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						ATTTGTACTCCAATTTGATCTC	0.307																																					p.W180fs		.											.	SCAF11-93	0			c.539_540insT						.																																			SO:0001589	frameshift_variant	9169	exon8			GTACTCCAATTTG	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.539dupT	12.37:g.46328054_46328054dupA	ENSP00000358374:p.Trp180fs	92	0		96	38	NM_004719	0	0	0	0	0	A6NEU9|A6NLW5|Q8IW59	Frame_Shift_Ins	INS	ENST00000369367.3	37	CCDS8748.2																																																																																			.		0.307	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
VTN	7448	hgsc.bcm.edu	37	17	26699367	26699368	+	5'Flank	INS	-	-	C	rs11437594		TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr17:26699367_26699368insC	ENST00000226218.4	-	0	0				CTB-96E2.3_ENST00000591482.1_RNA|VTN_ENST00000536498.1_5'Flank|SARM1_ENST00000457710.3_Frame_Shift_Ins_p.A72fs|TMEM199_ENST00000509083.1_Intron|SARM1_ENST00000379061.4_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin						cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	CCTGGCTGCTGCGGCCGTGGGC	0.743													CC|C|CC|deletion	5008	1.0	1.0	1.0	5008	,	,		10362	1.0		1.0	False		,,,				2504	1.0				p.A105fs		.											.	.	0			c.313_314insC						.			2410,14		1203,4,5						0.8	1.0		dbSNP_120	3	4457,19		2225,7,6	no	frameshift	SARM1	NM_015077.2		3428,11,11	A1A1,A1R,RR		0.4245,0.5776,0.4783				6867,33				SO:0001631	upstream_gene_variant	23098	exon2			GCTGCTGCGGCCG	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500		17.37:g.26699368_26699368dupC	Exception_encountered	0	0		12	12	NM_015077	0	0	0	0	0	B2R7G0|P01141|Q9BSH7	Frame_Shift_Ins	INS	ENST00000226218.4	37	CCDS11229.1																																																																																			-|0.009;C|0.991		0.743	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255680.2	NM_000638	
KRTAP10-6	386674	broad.mit.edu	37	21	46012219	46012220	+	In_Frame_Ins	INS	-	-	GGGGCGCAGCAGCTG	rs374776064|rs587611810|rs71199613	byFrequency	TCGA-OR-A5LT-01A-11D-A29I-10	TCGA-OR-A5LT-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	9eaee6db-6b65-45ec-9394-7338c2e3b8db	b493ceba-ee9d-477a-b108-83c06d00d87e	g.chr21:46012219_46012220insGGGGCGCAGCAGCTG	ENST00000400368.1	-	1	166_167	c.146_147insCAGCTGCTGCGCCCC	c.(145-147)ccg>ccCAGCTGCTGCGCCCCg	p.49_49P>PSCCAP	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	49	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						GGCAGGGGGCCGGGGCGCAGCA	0.688														1042	0.208067	0.1188	0.2522	5008	,	,		15055	0.1379		0.3231	False		,,,				2504	0.2515				p.P49delinsPSCCAP		.											.	KRTAP10-6-90	0			c.147_148insCAGCTGCTGCGCCCC						.																																			SO:0001652	inframe_insertion	386674	exon1			GGGGGCCGGGGCG	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.146_147insCAGCTGCTGCGCCCC	21.37:g.46012219_46012220insGGGGCGCAGCAGCTG	Exception_encountered	90	0		153	10	NM_198688	0	0	0	0	0		In_Frame_Ins	INS	ENST00000400368.1	37	CCDS42959.1																																																																																			.		0.688	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128037.1	NM_198688	
