#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CROCC	9696	broad.mit.edu;ucsc.edu;mdanderson.org	37	1	17274918	17274918	+	Silent	SNP	T	T	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:17274918T>G	ENST00000375541.5	+	18	2676	c.2607T>G	c.(2605-2607)cgT>cgG	p.R869R	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GAGCGGCCCGTGAGAAGGAGG	0.731																																					p.R869R		.											.	CROCC-137	0			c.T2607G						.						12.0	12.0	12.0					1																	17274918		2159	4216	6375	SO:0001819	synonymous_variant	9696	exon18			GGCCCGTGAGAAG	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.2607T>G	1.37:g.17274918T>G		18	1		85	46	NM_014675	0	0	0	4	4		Silent	SNP	ENST00000375541.5	37	CCDS30616.1																																																																																			.		0.731	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006249.2	NM_014675	
AKR7L	246181	hgsc.bcm.edu	37	1	19600479	19600501	+	RNA	DEL	TGCGGCGCTGGTGGGCGCGTCCA	TGCGGCGCTGGTGGGCGCGTCCA	-	rs573930529	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	TGCGGCGCTGGTGGGCGCGTCCA	TGCGGCGCTGGTGGGCGCGTCCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:19600479_19600501delTGCGGCGCTGGTGGGCGCGTCCA	ENST00000429712.1	-	0	187_209				AKR7L_ENST00000420396.2_RNA			Q8NHP1	ARK74_HUMAN	aldo-keto reductase family 7-like							extracellular vesicular exosome (GO:0070062)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|ovary(1)|prostate(1)|urinary_tract(1)	6						CGCGCGTGACTGCGGCGCTGGTGGGCGCGTCCATGCGGCGCCC	0.722														155	0.0309505	0.0	0.0202	5008	,	,		16736	0.0476		0.0288	False		,,,				2504	0.0654				.		.											.	AKR7L-90	0			.						.			8,4132		1,6,2063						1.0	0.0			23	91,7993		9,73,3960	no	intergenic				10,79,6023	A1A1,A1R,RR		1.1257,0.1932,0.8099				99,12125						246181	.			CGTGACTGCGGCG			1p36.1-p35	2008-12-09			ENSG00000211454	ENSG00000211454			24056	protein-coding gene	gene with protein product		608478				12879023	Standard	NR_040288		Approved	AFAR3	uc021ohn.1	Q8NHP1	OTTHUMG00000002520		1.37:g.19600479_19600501delTGCGGCGCTGGTGGGCGCGTCCA		55	0		85	18	.	0	0	0	0	0	Q5U614	RNA	DEL	ENST00000429712.1	37																																																																																				.		0.722	AKR7L-001	KNOWN	basic	polymorphic_pseudogene	polymorphic_pseudogene	OTTHUMT00000007163.3	NM_201252	
AKR7A3	22977	hgsc.bcm.edu	37	1	19615114	19615136	+	Frame_Shift_Del	DEL	TGCGGCGCTGGTGGGCGCGTCCA	TGCGGCGCTGGTGGGCGCGTCCA	-	rs552561219		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	TGCGGCGCTGGTGGGCGCGTCCA	TGCGGCGCTGGTGGGCGCGTCCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:19615114_19615136delTGCGGCGCTGGTGGGCGCGTCCA	ENST00000361640.4	-	1	608_630	c.68_90delTGGACGCGCCCACCAGCGCCGCA	c.(67-90)atggacgcgcccaccagcgccgcafs	p.MDAPTSAA23fs		NM_012067.2	NP_036199.2	O95154	ARK73_HUMAN	aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase)	23					cellular aldehyde metabolic process (GO:0006081)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)			NS(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)	13		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;1.78e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|GBM - Glioblastoma multiforme(114;0.00276)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CGCGCGTGACTGCGGCGCTGGTGGGCGCGTCCATGCGGCGCCC	0.722																																					p.23_30del		.											.	AKR7A3-90	0			c.68_90del						.			11,4179		0,11,2084						-1.4	0.0			14	63,8041		2,59,3991	no	frameshift	AKR7A3	NM_012067.2		2,70,6075	A1A1,A1R,RR		0.7774,0.2625,0.6019				74,12220				SO:0001589	frameshift_variant	22977	exon1			CGTGACTGCGGCG	AF040639	CCDS193.1	1p36.13	2008-05-14			ENSG00000162482	ENSG00000162482		"""Aldo-keto reductases"""	390	protein-coding gene	gene with protein product		608477				10383892	Standard	NM_012067		Approved		uc001bbv.1	O95154	OTTHUMG00000002523	ENST00000361640.4:c.68_90delTGGACGCGCCCACCAGCGCCGCA	1.37:g.19615114_19615136delTGCGGCGCTGGTGGGCGCGTCCA	ENSP00000355377:p.Met23fs	43	1		186	22	NM_012067	0	0	0	0	0	Q86SR4|Q8IVN6|Q8N5V6|Q8TAX1|Q9NUC3	Frame_Shift_Del	DEL	ENST00000361640.4	37	CCDS193.1																																																																																			.		0.722	AKR7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007166.1	NM_012067	
CELA3B	23436	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	22304887	22304887	+	Silent	SNP	T	T	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:22304887T>C	ENST00000337107.6	+	2	88	c.69T>C	c.(67-69)tcT>tcC	p.S23S	RN7SL421P_ENST00000582599.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B	23					cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						CACCTTCCTCTCGCCCTTCCA	0.617																																					p.S23S		.											.	CELA3B-91	0			c.T69C						.						165.0	102.0	123.0					1																	22304887		2203	4300	6503	SO:0001819	synonymous_variant	23436	exon2			TTCCTCTCGCCCT	M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.69T>C	1.37:g.22304887T>C		169	0		118	72	NM_007352	0	0	0	0	0	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	ENST00000337107.6	37	CCDS219.1																																																																																			.		0.617	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007797.1	NM_007352	
OPRD1	4985	hgsc.bcm.edu	37	1	29138975	29138975	+	Missense_Mutation	SNP	G	G	T	rs1042114	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:29138975G>T	ENST00000234961.2	+	1	322	c.80G>T	c.(79-81)tGc>tTc	p.C27F		NM_000911.3	NP_000902.3	P41143	OPRD_HUMAN	opioid receptor, delta 1	27			C -> F (improved maturation and increased expression at the cell surface; dbSNP:rs1042114). {ECO:0000269|PubMed:10982041, ECO:0000269|PubMed:8201839, ECO:0000269|Ref.4}.		adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adult locomotory behavior (GO:0008344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|negative regulation of gene expression (GO:0010629)|negative regulation of protein oligomerization (GO:0032460)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein import into nucleus, translocation (GO:0000060)|regulation of calcium ion transport (GO:0051924)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of sensory perception of pain (GO:0051930)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	enkephalin receptor activity (GO:0038046)|opioid receptor activity (GO:0004985)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CCTAGCGCCTGCCCCAGCGCT	0.771													T|||	4730	0.944489	0.9796	0.9193	5008	,	,		9147	1.0		0.8678	False		,,,				2504	0.9366				p.C27F		.											.	OPRD1-69	0			c.G80T						.	T	PHE/CYS	3689,115		1788,113,1	4.0	6.0	5.0	http://www.ncbi.nlm.nih.gov/omim/103780,165195|http://omim.org/entry/165195|http://omim.org/entry/103780	80	2.9	1.0	1	dbSNP_86	5	6762,846		2982,798,24	no	missense	OPRD1	NM_000911.3	205	4770,911,25	TT,TG,GG		11.1199,3.0231,8.421	benign	27/373	29138975	10451,961	1902	3804	5706	SO:0001583	missense	4985	exon1			GCGCCTGCCCCAG	U10504	CCDS329.1	1p36.1-p34.3	2012-08-08			ENSG00000116329	ENSG00000116329		"""GPCR / Class A : Opioid receptors"""	8153	protein-coding gene	gene with protein product		165195				8415697	Standard	NM_000911		Approved		uc001brf.1	P41143	OTTHUMG00000003646	ENST00000234961.2:c.80G>T	1.37:g.29138975G>T	ENSP00000234961:p.Cys27Phe	0	0		9	9	NM_000911	0	0	0	0	0	B5B0B8	Missense_Mutation	SNP	ENST00000234961.2	37	CCDS329.1	2035	0.9317765567765568	474	0.9634146341463414	331	0.914364640883978	572	1.0	658	0.8680738786279684	T	0.016	-1.513433	0.00975	0.969769	0.888801	ENSG00000116329	ENST00000234961;ENST00000536280	T	0.67698	-0.28	4.0	2.89	0.33648	.	1.802200	0.02327	N	0.073605	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.41342	-0.9514	9	0.09338	T	0.73	.	3.8109	0.08796	0.0:0.1144:0.2238:0.6618	rs1042114;rs59349662;rs1042114	27	P41143	OPRD_HUMAN	F	27	ENSP00000234961:C27F	ENSP00000234961:C27F	C	+	2	0	OPRD1	29011562	0.002000	0.14202	0.992000	0.48379	0.116000	0.19942	0.521000	0.22893	0.713000	0.32060	-0.694000	0.03704	TGC	G|0.061;T|0.939		0.771	OPRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010330.1	NM_000911	
C1orf141	400757	ucsc.edu;bcgsc.ca	37	1	67569025	67569025	+	Intron	SNP	T	T	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:67569025T>C	ENST00000371007.2	-	6	456				C1orf141_ENST00000544837.1_Intron|C1orf141_ENST00000371006.1_Intron|SNORA31_ENST00000516624.1_RNA	NM_001276351.1	NP_001263280.1	Q5JVX7	CA141_HUMAN	chromosome 1 open reading frame 141											NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|skin(1)	18						TGCTTGTCTATGCTGTGAATA	0.323																																					p.H152R		.											.	C1orf141-91	0			c.A455G						.																																			SO:0001627	intron_variant	400757	exon7			TGTCTATGCTGTG	BC090886	CCDS30745.1, CCDS72804.1	1p31.2	2012-07-23			ENSG00000203963	ENSG00000203963			32044	protein-coding gene	gene with protein product							Standard	NM_001276351		Approved		uc001ddm.2	Q5JVX7	OTTHUMG00000009406	ENST00000371007.2:c.347-7021A>G	1.37:g.67569025T>C		55	0		24	4	NM_001276352	0	0	0	0	0	Q0P5P5|Q5JVX5	Missense_Mutation	SNP	ENST00000371007.2	37	CCDS30745.1	.	.	.	.	.	.	.	.	.	.	T	9.065	0.995436	0.19043	.	.	ENSG00000203963	ENST00000371005;ENST00000448166	.	.	.	3.94	-3.18	0.05186	.	.	.	.	.	T	0.19886	0.0478	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39921	-0.9590	5	0.51188	T	0.08	.	8.8772	0.35352	0.0:0.0958:0.645:0.2592	.	.	.	.	R	152	.	ENSP00000360044:H152R	H	-	2	0	C1orf141	67341613	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-0.511000	0.06321	-0.585000	0.05905	0.460000	0.39030	CAT	.		0.323	C1orf141-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026096.2	NM_001013674	
KIAA1324	57535	bcgsc.ca	37	1	109737063	109737063	+	Silent	SNP	C	C	T	rs2359246	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:109737063C>T	ENST00000369939.3	+	15	2151	c.1968C>T	c.(1966-1968)aaC>aaT	p.N656N	KIAA1324_ENST00000369938.1_3'UTR|KIAA1324_ENST00000529753.1_Silent_p.N569N	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	656					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		TGTGCTACAACGATTGCACCT	0.562													C|||	3574	0.713658	0.3033	0.7968	5008	,	,		17619	0.9702		0.7634	False		,,,				2504	0.8937				p.N656N		.											.	KIAA1324-157	0			c.C1968T						.	C		1623,2783	500.3+/-364.7	298,1027,878	122.0	97.0	106.0		1968	-4.2	0.8	1	dbSNP_100	106	6527,2073	718.3+/-406.2	2473,1581,246	no	coding-synonymous	KIAA1324	NM_020775.3		2771,2608,1124	TT,TC,CC		24.1047,36.8361,37.3366		656/1014	109737063	8150,4856	2203	4300	6503	SO:0001819	synonymous_variant	57535	exon15			CTACAACGATTGC	AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.1968C>T	1.37:g.109737063C>T		104	0		86	5	NM_020775	0	0	0	0	0	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Silent	SNP	ENST00000369939.3	37	CCDS794.1																																																																																			C|0.338;T|0.662		0.562	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032389.2	NM_020775	
DCST1	149095	hgsc.bcm.edu	37	1	155020586	155020586	+	Silent	SNP	A	A	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:155020586A>G	ENST00000295542.1	+	16	1905	c.1809A>G	c.(1807-1809)gcA>gcG	p.A603A	DCST1_ENST00000392480.1_Silent_p.A603A|DCST1_ENST00000368419.2_Silent_p.A603A|RP11-307C12.11_ENST00000452962.1_RNA|DCST1_ENST00000423025.2_Silent_p.A578A	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	603						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			AGAAAAGAGCAGCCTTCACCA	0.567																																					p.A603A		.											.	DCST1-92	0			c.A1809G						.						72.0	72.0	72.0					1																	155020586		2203	4300	6503	SO:0001819	synonymous_variant	149095	exon16			AAGAGCAGCCTTC	AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1809A>G	1.37:g.155020586A>G		84	0		66	4	NM_152494	0	0	0	0	0	B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Silent	SNP	ENST00000295542.1	37	CCDS1083.1																																																																																			.		0.567	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099006.1	NM_152494	
CFH	3075	broad.mit.edu	37	1	196706701	196706701	+	Missense_Mutation	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:196706701G>T	ENST00000367429.4	+	17	2933	c.2693G>T	c.(2692-2694)aGt>aTt	p.S898I		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	898	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ACTAAATTGAGTTATACTTGT	0.393																																					p.S898I		.											.	CFH-566	0			c.G2693T						.						84.0	79.0	80.0					1																	196706701		2203	4300	6503	SO:0001583	missense	3075	exon17			AATTGAGTTATAC	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2693G>T	1.37:g.196706701G>T	ENSP00000356399:p.Ser898Ile	111	0		113	3	NM_000186	0	0	11	11	0	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	ENST00000367429.4	37	CCDS1385.1	.	.	.	.	.	.	.	.	.	.	.	17.00	3.275963	0.59649	.	.	ENSG00000000971	ENST00000367429	T	0.65364	-0.15	6.04	-10.7	0.00240	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.65026	0.2652	M	0.72353	2.195	0.09310	N	0.999998	D	0.61697	0.99	P	0.55577	0.779	T	0.65417	-0.6173	9	0.17369	T	0.5	.	14.8899	0.70600	0.7303:0.0874:0.1823:0.0	.	898	P08603	CFAH_HUMAN	I	898	ENSP00000356399:S898I	ENSP00000356399:S898I	S	+	2	0	CFH	194973324	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.771000	0.04699	-2.129000	0.00817	0.650000	0.86243	AGT	.		0.393	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086412.2	NM_000186	
ASPM	259266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	197071136	197071136	+	Missense_Mutation	SNP	C	C	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:197071136C>G	ENST00000367409.4	-	18	7501	c.7245G>C	c.(7243-7245)caG>caC	p.Q2415H	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2415	IQ 24. {ECO:0000255|PROSITE- ProRule:PRU00116}.|IQ 25. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TAAACCTACTCTGAATAAGGG	0.408																																					p.Q2415H		.											.	ASPM-615	0			c.G7245C						.						116.0	117.0	117.0					1																	197071136		2203	4299	6502	SO:0001583	missense	259266	exon18			CCTACTCTGAATA	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.7245G>C	1.37:g.197071136C>G	ENSP00000356379:p.Gln2415His	74	0		46	28	NM_018136	0	0	0	1	1	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	c	15.60	2.880101	0.51801	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.80653	-1.4	4.13	1.19	0.21007	.	0.000000	0.56097	D	0.000029	D	0.91119	0.7204	H	0.97635	4.045	0.80722	D	1	D;D	0.76494	0.967;0.999	D;D	0.91635	0.964;0.999	D	0.88215	0.2893	10	0.87932	D	0	.	5.5077	0.16864	0.0:0.473:0.0:0.527	.	401;2415	E7EQ84;Q8IZT6	.;ASPM_HUMAN	H	2415;401	ENSP00000356379:Q2415H	ENSP00000356376:Q401H	Q	-	3	2	ASPM	195337759	0.942000	0.31987	0.978000	0.43139	0.994000	0.84299	0.187000	0.16998	0.476000	0.27440	0.558000	0.71614	CAG	.		0.408	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
CTSE	1510	bcgsc.ca	37	1	206327546	206327546	+	Silent	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:206327546G>T	ENST00000358184.2	+	6	853	c.735G>T	c.(733-735)ctG>ctT	p.L245L	CTSE_ENST00000361052.3_Silent_p.L250L|CTSE_ENST00000360218.2_Silent_p.L245L|CTSE_ENST00000432969.2_Silent_p.L170L|CTSE_ENST00000468617.1_3'UTR	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	250					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			CTGGGAGCCTGAATTGGGTCC	0.493																																					p.L245L		.											.	CTSE-91	0			c.G735T						.						157.0	161.0	160.0					1																	206327546		2203	4300	6503	SO:0001819	synonymous_variant	1510	exon6			GAGCCTGAATTGG	BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.735G>T	1.37:g.206327546G>T		41	0		56	4	NM_001910	0	0	0	0	0	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Silent	SNP	ENST00000358184.2	37	CCDS1462.1																																																																																			.		0.493	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000087998.1	NM_001910	
OR2T27	403239	bcgsc.ca	37	1	248813749	248813749	+	Missense_Mutation	SNP	G	G	A	rs151135924	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:248813749G>A	ENST00000344889.3	-	1	436	c.437C>T	c.(436-438)gCg>gTg	p.A146V		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A146E(1)		breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCAGGCTGCCGCCACAATCAA	0.557													G|||	242	0.0483227	0.146	0.0346	5008	,	,		22556	0.001		0.0199	False		,,,				2504	0.0041				p.A146V		.											.	OR2T27-47	1	Substitution - Missense(1)	lung(1)	c.C437T						.	A	VAL/ALA	610,3782		32,546,1618	52.0	39.0	43.0		437	-1.8	0.1	1	dbSNP_134	43	128,8364		0,128,4118	no	missense	OR2T27	NM_001001824.1	64	32,674,5736	AA,AG,GG		1.5073,13.8889,5.728	benign	146/318	248813749	738,12146	2196	4246	6442	SO:0001583	missense	403239	exon1			GCTGCCGCCACAA		CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.437C>T	1.37:g.248813749G>A	ENSP00000342008:p.Ala146Val	295	3		67	5	NM_001001824	0	0	0	0	0		Missense_Mutation	SNP	ENST00000344889.3	37	CCDS31124.1	103	0.04716117216117216	77	0.1565040650406504	10	0.027624309392265192	2	0.0034965034965034965	14	0.018469656992084433	.	1.086	-0.665498	0.03428	0.138889	0.015073	ENSG00000187701	ENST00000344889	T	0.38077	1.16	3.3	-1.81	0.07882	GPCR, rhodopsin-like superfamily (1);	1.680850	0.03711	N	0.250303	T	0.00109	0.0003	N	0.26130	0.795	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.15122	-1.0448	10	0.22706	T	0.39	.	8.5008	0.33156	0.58:0.0:0.42:0.0	.	146	Q8NH04	O2T27_HUMAN	V	146	ENSP00000342008:A146V	ENSP00000342008:A146V	A	-	2	0	OR2T27	246880372	0.000000	0.05858	0.075000	0.20258	0.051000	0.14879	-1.413000	0.02473	-0.181000	0.10619	-1.031000	0.02408	GCG	.		0.557	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824	
PROSER2	254427	hgsc.bcm.edu	37	10	11912144	11912144	+	Silent	SNP	C	C	T	rs17851505	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:11912144C>T	ENST00000277570.5	+	4	1201	c.1047C>T	c.(1045-1047)caC>caT	p.H349H	PROSER2_ENST00000379200.1_Silent_p.H153H|PROSER2-AS1_ENST00000453242.1_RNA|PROSER2-AS1_ENST00000445498.1_RNA	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	349																	CAAGTGCGCACGAGGCCCTGA	0.766													C|||	360	0.071885	0.0923	0.049	5008	,	,		5950	0.001		0.0805	False		,,,				2504	0.1247				p.H349H		.											.	.	0			c.C1047T						.	C		209,2543		3,203,1170	2.0	3.0	2.0		1047	-2.8	0.7	10	dbSNP_123	2	285,5043		6,273,2385	no	coding-synonymous	C10orf47	NM_153256.3		9,476,3555	TT,TC,CC		5.3491,7.5945,6.1139		349/436	11912144	494,7586	1376	2664	4040	SO:0001819	synonymous_variant	254427	exon4			TGCGCACGAGGCC	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.1047C>T	10.37:g.11912144C>T		0	0		15	15	NM_153256	0	0	0	0	0	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Silent	SNP	ENST00000277570.5	37	CCDS7085.1																																																																																			C|0.932;T|0.068		0.766	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
NCOA4	8031	broad.mit.edu	37	10	51585100	51585100	+	Missense_Mutation	SNP	T	T	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:51585100T>G	ENST00000443446.1	+	8	1428	c.1199T>G	c.(1198-1200)gTa>gGa	p.V400G	NCOA4_ENST00000430396.2_Missense_Mutation_p.V300G|NCOA4_ENST00000374082.1_Missense_Mutation_p.V400G|NCOA4_ENST00000374087.4_Missense_Mutation_p.V400G|NCOA4_ENST00000452682.1_Missense_Mutation_p.V416G|NCOA4_ENST00000438493.1_Missense_Mutation_p.V416G|NCOA4_ENST00000344348.6_Missense_Mutation_p.V400G|NCOA4_ENST00000414907.2_Missense_Mutation_p.V234G	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	400					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						CCATGTAAGGTAGAGGAGGTG	0.507			T	RET	papillary thyroid																																p.V416G		.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4-1042	0			c.T1247G						.						56.0	54.0	55.0					10																	51585100		2203	4299	6502	SO:0001583	missense	8031	exon9			GTAAGGTAGAGGA	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1199T>G	10.37:g.51585100T>G	ENSP00000390713:p.Val400Gly	134	11		179	18	NM_001145261	0	0	66	68	2	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	T	13.29	2.193738	0.38707	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.6	5.6	0.85130	.	0.197739	0.45126	D	0.000388	T	0.63295	0.2499	M	0.69823	2.125	0.58432	D	0.999991	D;P;P;D	0.76494	0.999;0.666;0.666;0.999	D;B;B;D	0.66196	0.942;0.154;0.212;0.942	T	0.64888	-0.6301	9	.	.	.	-4.4427	10.1741	0.42929	0.0:0.0742:0.0:0.9258	.	300;416;416;400	B4DF87;B4E260;E9PAV7;Q13772	.;.;.;NCOA4_HUMAN	G	416;416;300;400;234;400;400;400	ENSP00000405146:V416G;ENSP00000395465:V416G;ENSP00000393053:V300G;ENSP00000363200:V400G;ENSP00000411018:V234G;ENSP00000344552:V400G;ENSP00000363195:V400G;ENSP00000390713:V400G	.	V	+	2	0	NCOA4	51255106	1.000000	0.71417	1.000000	0.80357	0.327000	0.28475	4.826000	0.62715	2.139000	0.66308	0.528000	0.53228	GTA	.		0.507	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
PCDH15	65217	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	55943228	55943228	+	Missense_Mutation	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:55943228C>T	ENST00000320301.6	-	13	1960	c.1566G>A	c.(1564-1566)atG>atA	p.M522I	PCDH15_ENST00000373957.3_Missense_Mutation_p.M500I|PCDH15_ENST00000409834.1_Missense_Mutation_p.M133I|PCDH15_ENST00000373955.1_Missense_Mutation_p.M522I|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000414778.1_Missense_Mutation_p.M527I|PCDH15_ENST00000361849.3_Missense_Mutation_p.M522I|PCDH15_ENST00000437009.1_Missense_Mutation_p.M522I|PCDH15_ENST00000395433.1_Missense_Mutation_p.M500I|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.M529I|PCDH15_ENST00000395438.1_Missense_Mutation_p.M522I|PCDH15_ENST00000395432.2_Missense_Mutation_p.M485I|PCDH15_ENST00000395446.1_Missense_Mutation_p.M522I|PCDH15_ENST00000395445.1_Missense_Mutation_p.M529I|PCDH15_ENST00000395430.1_Missense_Mutation_p.M522I	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	522	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CCCCAGGTCTCATGTCTGTAT	0.378										HNSCC(58;0.16)																											p.M527I		.											.	PCDH15-193	0			c.G1581A						.						225.0	197.0	207.0					10																	55943228		2203	4300	6503	SO:0001583	missense	65217	exon14			AGGTCTCATGTCT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1566G>A	10.37:g.55943228C>T	ENSP00000322604:p.Met522Ile	127	0		185	73	NM_001142763	0	0	0	0	0	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	37	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727702	0.30593	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.12	5.12	0.69794	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45196	0.1330	L	0.31476	0.935	0.80722	D	1	P;B;B;B;P;P;P;B;B;B;B;B;B;B;B	0.43024	0.771;0.333;0.392;0.392;0.798;0.592;0.771;0.099;0.182;0.182;0.044;0.099;0.028;0.094;0.333	P;B;B;B;B;B;P;B;B;B;B;B;B;B;B	0.48334	0.574;0.241;0.173;0.348;0.326;0.241;0.574;0.085;0.241;0.173;0.101;0.058;0.03;0.05;0.241	T	0.42582	-0.9443	9	0.56958	D	0.05	.	12.7668	0.57396	0.1643:0.8357:0.0:0.0	.	500;522;522;527;522;485;522;522;529;529;522;527;522;500;522	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	I	529;527;522;522;133;529;522;485;522;500;500;522;522;527;522;522	ENSP00000363076:M529I;ENSP00000410304:M527I;ENSP00000378826:M522I;ENSP00000386693:M133I;ENSP00000378832:M529I;ENSP00000378833:M522I;ENSP00000378820:M485I;ENSP00000354950:M522I;ENSP00000378821:M500I;ENSP00000363068:M500I;ENSP00000322604:M522I;ENSP00000378818:M522I;ENSP00000412628:M522I;ENSP00000363066:M522I	ENSP00000322604:M522I	M	-	3	0	PCDH15	55613234	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	5.624000	0.67764	2.546000	0.85860	0.655000	0.94253	ATG	.		0.378	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
LZTS2	84445	broad.mit.edu	37	10	102766682	102766682	+	Silent	SNP	T	T	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:102766682T>G	ENST00000370220.1	+	4	4830	c.1767T>G	c.(1765-1767)ggT>ggG	p.G589G	LZTS2_ENST00000370223.3_Silent_p.G589G					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		GGCGGCGGGGTGAGGAGCAGC	0.682																																					p.G589G	Esophageal Squamous(8;38 437 13604 19902 37640)	.											.	LZTS2-155	0			c.T1767G						.						21.0	13.0	16.0					10																	102766682		2080	4135	6215	SO:0001819	synonymous_variant	84445	exon5			GCGGGGTGAGGAG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.1767T>G	10.37:g.102766682T>G		73	9		209	36	NM_032429	0	0	19	26	7		Silent	SNP	ENST00000370220.1	37	CCDS7507.1																																																																																			.		0.682	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
NEURL1	9148	hgsc.bcm.edu	37	10	105344756	105344756	+	Silent	SNP	T	T	C	rs2236209	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:105344756T>C	ENST00000369780.4	+	4	1522	c.1113T>C	c.(1111-1113)ccT>ccC	p.P371P	NEURL_ENST00000369777.2_Silent_p.P354P	NM_004210.4	NP_004201.3	O76050	NEUL1_HUMAN		371	NHR 2. {ECO:0000255|PROSITE- ProRule:PRU00400}.				brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|lactation (GO:0007595)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Notch signaling pathway (GO:0045746)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse maturation (GO:0090129)|protein monoubiquitination (GO:0006513)|skeletal muscle tissue development (GO:0007519)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)	apical dendrite (GO:0097440)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|translation factor activity, non-nucleic acid binding (GO:0045183)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	17				Epithelial(162;2.12e-09)|all cancers(201;6.99e-08)|BRCA - Breast invasive adenocarcinoma(275;0.125)		CCGACCTGCCTTTCAGCCCTG	0.731													C|||	2650	0.529153	0.3964	0.5173	5008	,	,		11202	0.6478		0.5378	False		,,,				2504	0.5859				p.P371P		.											.	NEURL-226	0			c.T1113C						.	C		1415,2517		309,797,860	6.0	5.0	5.0		1113	2.7	1.0	10	dbSNP_98	5	3978,3894		1122,1734,1080	no	coding-synonymous	NEURL	NM_004210.4		1431,2531,1940	CC,CT,TT		49.4665,35.9868,45.6879		371/575	105344756	5393,6411	1966	3936	5902	SO:0001819	synonymous_variant	9148	exon4			CCTGCCTTTCAGC																												ENST00000369780.4:c.1113T>C	10.37:g.105344756T>C		0	0		5	5	NM_004210	0	0	0	0	0	Q5TDR2|Q5TDR3|Q8TAN0|Q9H463	Silent	SNP	ENST00000369780.4	37	CCDS7551.1																																																																																			T|0.455;C|0.545		0.731	NEURL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050170.1		
RBM20	282996	hgsc.bcm.edu	37	10	112404302	112404302	+	Silent	SNP	G	G	A	rs35141404	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:112404302G>A	ENST00000369519.3	+	1	148	c.90G>A	c.(88-90)cgG>cgA	p.R30R	Y_RNA_ENST00000411370.1_RNA	NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	30	Pro-rich.				heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CTGGTGCCCGGGCGTCCCCGG	0.746													G|||	1113	0.222244	0.4206	0.1354	5008	,	,		7996	0.1617		0.1392	False		,,,				2504	0.1636				p.R30R		.											.	.	0			c.G90A						.						4.0	9.0	7.0					10																	112404302		625	1495	2120	SO:0001819	synonymous_variant	282996	exon1			TGCCCGGGCGTCC	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.90G>A	10.37:g.112404302G>A		3	0		31	23	NM_001134363	0	0	0	0	0	A6NIP5|B5A868|Q5JVI1	Silent	SNP	ENST00000369519.3	37	CCDS44477.1																																																																																			G|0.808;A|0.192		0.746	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050339.2	NM_001134363	
CTBP2	1488	bcgsc.ca	37	10	126714966	126714966	+	Intron	SNP	A	A	G	rs3012075	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:126714966A>G	ENST00000337195.5	-	3	458				CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000309035.6_Missense_Mutation_p.Y455H	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TGCAGGGGGTACGTGGGGCTC	0.672													A|||	2243	0.447883	0.298	0.3343	5008	,	,		14085	0.6597		0.4811	False		,,,				2504	0.4785				p.Y455H		.											.	CTBP2-90	0			c.T1363C						.	A	,,HIS/TYR	1449,2953		226,997,978	35.0	40.0	38.0		,,1363	4.0	0.0	10	dbSNP_101	38	4276,4324		1059,2158,1083	yes	intron,intron,missense	CTBP2	NM_001083914.1,NM_001329.2,NM_022802.2	,,83	1285,3155,2061	GG,GA,AA		49.7209,32.9169,44.0317	,,possibly-damaging	,,455/986	126714966	5725,7277	2201	4300	6501	SO:0001627	intron_variant	1488	exon1			GGGGGTACGTGGG	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12599T>C	10.37:g.126714966A>G		30	0		72	5	NM_022802	0	0	0	0	0	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Missense_Mutation	SNP	ENST00000337195.5	37	CCDS7643.1	1004	0.4597069597069597	160	0.3252032520325203	124	0.3425414364640884	353	0.6171328671328671	367	0.4841688654353562	A	14.35	2.507941	0.44558	0.329169	0.497209	ENSG00000175029	ENST00000309035	D	0.83250	-1.7	4.04	4.04	0.47022	.	1.938270	0.02364	N	0.077162	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999341817	B	0.06786	0.001	B	0.08055	0.003	T	0.42582	-0.9443	8	0.62326	D	0.03	.	12.024	0.53360	1.0:0.0:0.0:0.0	rs3012075;rs3781414;rs17710513;rs60363956;rs3012075	455	P56545-2	.	H	455	ENSP00000311825:Y455H	ENSP00000311825:Y455H	Y	-	1	0	CTBP2	126704956	0.534000	0.26362	0.003000	0.11579	0.562000	0.35680	4.895000	0.63214	1.829000	0.53265	0.383000	0.25322	TAC	A|0.547;G|0.453		0.672	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219036	134219036	+	Silent	SNP	G	G	A	rs11817589	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:134219036G>A	ENST00000305233.5	+	2	1091	c.1032G>A	c.(1030-1032)gaG>gaA	p.E344E	PWWP2B_ENST00000368609.4_Silent_p.E344E	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	344										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		GGGACAGCGAGCACGAGCCCG	0.726													G|||	516	0.103035	0.1241	0.0908	5008	,	,		12864	0.0813		0.0875	False		,,,				2504	0.1217				p.E344E		.											.	PWWP2B-90	0			c.G1032A						.	G	,	353,3895		15,323,1786	15.0	19.0	18.0		1032,1032	4.5	0.0	10	dbSNP_120	18	549,7817		13,523,3647	no	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	28,846,5433	AA,AG,GG		6.5623,8.3098,7.1508	,	344/500,344/591	134219036	902,11712	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CAGCGAGCACGAG	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1032G>A	10.37:g.134219036G>A		0	0		17	9	NM_001098637	0	0	28	28	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			G|0.909;A|0.091		0.726	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219045	134219045	+	Silent	SNP	C	C	T	rs11146364	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:134219045C>T	ENST00000305233.5	+	2	1100	c.1041C>T	c.(1039-1041)ccC>ccT	p.P347P	PWWP2B_ENST00000368609.4_Silent_p.P347P	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	347										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		AGCACGAGCCCGTGTACCGGG	0.721													C|||	820	0.163738	0.2027	0.2104	5008	,	,		13504	0.1429		0.1074	False		,,,				2504	0.1575				p.P347P		.											.	PWWP2B-90	0			c.C1041T						.	C	,	636,3612		51,534,1539	16.0	21.0	20.0		1041,1041	-2.7	0.1	10	dbSNP_120	20	704,7662		24,656,3503	yes	coding-synonymous,coding-synonymous	PWWP2B	NM_001098637.1,NM_138499.3	,	75,1190,5042	TT,TC,CC		8.415,14.9718,10.6231	,	347/500,347/591	134219045	1340,11274	2124	4183	6307	SO:0001819	synonymous_variant	170394	exon2			CGAGCCCGTGTAC	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1041C>T	10.37:g.134219045C>T		1	0		24	13	NM_001098637	0	0	29	29	0	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Silent	SNP	ENST00000305233.5	37	CCDS7667.2																																																																																			C|0.860;T|0.140		0.721	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
KNDC1	85442	hgsc.bcm.edu	37	10	135012430	135012430	+	Silent	SNP	T	T	C	rs386749477|rs3008389	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr10:135012430T>C	ENST00000304613.3	+	14	2439	c.2418T>C	c.(2416-2418)gtT>gtC	p.V806V	KNDC1_ENST00000368572.2_Silent_p.V806V|KNDC1_ENST00000368571.2_Silent_p.V741V			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	806	Pro-rich.			V -> D (in Ref. 1; BAD12625). {ECO:0000305}.	cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		CACCTGGAGTTGCTTCCGGGG	0.746													C|||	2730	0.545128	0.5166	0.4942	5008	,	,		10776	0.5486		0.5318	False		,,,				2504	0.6299				p.V806V		.											.	KNDC1-229	0			c.T2418C						.			1858,1296		588,682,307	4.0	5.0	4.0		2418	2.5	0.0	10	dbSNP_101	4	4179,3011		1338,1503,754	no	coding-synonymous	KNDC1	NM_152643.6		1926,2185,1061	CC,CT,TT		41.8776,41.0907,41.6377		806/1750	135012430	6037,4307	1577	3595	5172	SO:0001819	synonymous_variant	85442	exon14			TGGAGTTGCTTCC	AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.2418T>C	10.37:g.135012430T>C		4	0		9	5	NM_152643	0	0	1	4	3	B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Silent	SNP	ENST00000304613.3	37	CCDS7674.1																																																																																			T|0.470;C|0.530		0.746	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000277044.3	NM_152643	
OR51Q1	390061	bcgsc.ca	37	11	5443442	5443442	+	Silent	SNP	G	G	C	rs2736590	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr11:5443442G>C	ENST00000300778.4	+	1	102	c.12G>C	c.(10-12)gtG>gtC	p.V4V	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTCCCAGGTGACTAACACCA	0.453													G|||	2382	0.475639	0.3623	0.4006	5008	,	,		22376	0.7024		0.3986	False		,,,				2504	0.5276				p.V4V		.											.	OR51Q1-69	0			c.G12C						.	G		1585,2817	495.5+/-363.3	287,1011,903	199.0	150.0	167.0		12	-1.0	0.0	11	dbSNP_100	167	3379,5215	500.2+/-375.2	680,2019,1598	no	coding-synonymous	OR51Q1	NM_001004757.2		967,3030,2501	CC,CG,GG		39.3181,36.0064,38.1964		4/318	5443442	4964,8032	2201	4297	6498	SO:0001819	synonymous_variant	390061	exon1			CCAGGTGACTAAC	AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.12G>C	11.37:g.5443442G>C		127	1		89	4	NM_001004757	0	0	0	0	0	B2RNN1	Silent	SNP	ENST00000300778.4	37	CCDS31381.1																																																																																			G|0.569;C|0.431		0.453	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143373.1	NM_001004757	
DCHS1	8642	hgsc.bcm.edu	37	11	6651810	6651810	+	Silent	SNP	A	A	G	rs2659872	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr11:6651810A>G	ENST00000299441.3	-	10	4626	c.4215T>C	c.(4213-4215)ctT>ctC	p.L1405L	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1405	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGCGTACCGTAAGCGCGCGCC	0.731													G|||	2653	0.529752	0.8026	0.4481	5008	,	,		9160	0.4365		0.4016	False		,,,				2504	0.4468				p.L1405L		.											.	DCHS1-73	0			c.T4215C						.	G		1515,1135		437,641,247	2.0	3.0	3.0		4215	4.1	1.0	11	dbSNP_100	3	1950,4148		398,1154,1497	no	coding-synonymous	DCHS1	NM_003737.2		835,1795,1744	GG,GA,AA		31.9777,42.8302,39.6091		1405/3299	6651810	3465,5283	1325	3049	4374	SO:0001819	synonymous_variant	8642	exon10			TACCGTAAGCGCG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.4215T>C	11.37:g.6651810A>G		0	0		6	4	NM_003737	0	0	0	0	0	O15098	Silent	SNP	ENST00000299441.3	37	CCDS7771.1																																																																																			A|0.491;G|0.509		0.731	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
GAL3ST3	89792	hgsc.bcm.edu	37	11	65810239	65810239	+	Silent	SNP	G	G	A	rs78578425	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr11:65810239G>A	ENST00000312006.4	-	3	1316	c.1035C>T	c.(1033-1035)gcC>gcT	p.A345A	GAL3ST3_ENST00000527878.1_Silent_p.A345A	NM_033036.2	NP_149025.1	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	345					monosaccharide metabolic process (GO:0005996)|oligosaccharide metabolic process (GO:0009311)|poly-N-acetyllactosamine metabolic process (GO:0030309)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|carbohydrate binding (GO:0030246)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			kidney(1)|lung(9)|ovary(2)|skin(2)	14						GGATCTGCGCGGCAGGCCGCA	0.766													G|||	727	0.145168	0.1377	0.1239	5008	,	,		7095	0.1181		0.161	False		,,,				2504	0.182				p.A345A		.											.	GAL3ST3-91	0			c.C1035T						.						2.0	2.0	2.0					11																	65810239		1057	2089	3146	SO:0001819	synonymous_variant	89792	exon3			CTGCGCGGCAGGC	AY026481	CCDS8128.1	11q13.1	2014-08-12			ENSG00000175229	ENSG00000175229		"""Sulfotransferases, membrane-bound"""	24144	protein-coding gene	gene with protein product		608234				11323440, 11356829	Standard	NM_033036		Approved	GAL3ST2	uc001ogw.3	Q96A11	OTTHUMG00000166667	ENST00000312006.4:c.1035C>T	11.37:g.65810239G>A		0	0		5	5	NM_033036	0	0	0	0	0	Q14D05	Silent	SNP	ENST00000312006.4	37	CCDS8128.1																																																																																			G|0.867;A|0.133		0.766	GAL3ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391052.1	NM_033036	
FADD	8772	broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	70049689	70049689	+	Missense_Mutation	SNP	G	G	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr11:70049689G>C	ENST00000301838.4	+	1	421	c.124G>C	c.(124-126)Ggc>Cgc	p.G42R	RP11-805J14.5_ENST00000526174.1_RNA|RP11-805J14.5_ENST00000527232.1_RNA	NM_003824.3	NP_003815.1	Q13158	FADD_HUMAN	Fas (TNFRSF6)-associated via death domain	42	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|lymph node development (GO:0048535)|motor neuron apoptotic process (GO:0097049)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic signaling pathway (GO:0097527)|negative regulation of activation-induced cell death of T cells (GO:0070236)|negative regulation of necroptotic process (GO:0060546)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of CD8-positive, alpha-beta cytotoxic T cell extravasation (GO:2000454)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of proteolysis (GO:0045862)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|protein heterooligomerization (GO:0051291)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|ripoptosome (GO:0097342)	death effector domain binding (GO:0035877)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|tumor necrosis factor receptor superfamily binding (GO:0032813)			endometrium(1)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(2)	9	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CGTGCAGAGCGGCCTAGACCT	0.682																																					p.G42R		.											.	FADD-660	0			c.G124C						.						22.0	25.0	24.0					11																	70049689		2195	4281	6476	SO:0001583	missense	8772	exon1			CAGAGCGGCCTAG	U24231	CCDS8196.1	11q13.3	2014-09-17			ENSG00000168040	ENSG00000168040			3573	protein-coding gene	gene with protein product	"""Fas-associating protein with death domain"", ""Fas-associating death domain-containing protein"", ""mediator of receptor-induced toxicity"", ""growth-inhibiting gene 3 protein"""	602457				7536190, 7538907	Standard	NM_003824		Approved	MORT1, GIG3	uc001opm.2	Q13158	OTTHUMG00000167264	ENST00000301838.4:c.124G>C	11.37:g.70049689G>C	ENSP00000301838:p.Gly42Arg	111	1		121	78	NM_003824	0	0	0	9	9	Q14866|Q6IBR4	Missense_Mutation	SNP	ENST00000301838.4	37	CCDS8196.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477188	0.84640	.	.	ENSG00000168040	ENST00000301838	D	0.83914	-1.78	4.39	4.39	0.52855	DEATH-like (2);Death effector (3);	0.119181	0.56097	D	0.000031	D	0.91382	0.7281	M	0.85041	2.73	0.09310	N	0.999995	D	0.89917	1.0	D	0.91635	0.999	D	0.85024	0.0913	10	0.72032	D	0.01	-38.9489	14.7887	0.69824	0.0:0.0:1.0:0.0	.	42	Q13158	FADD_HUMAN	R	42	ENSP00000301838:G42R	ENSP00000301838:G42R	G	+	1	0	FADD	69727337	0.712000	0.27916	0.800000	0.32199	0.939000	0.58152	2.962000	0.49176	2.158000	0.67659	0.491000	0.48974	GGC	.		0.682	FADD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393902.1	NM_003824	
MMP27	64066	broad.mit.edu	37	11	102575318	102575318	+	Silent	SNP	G	G	T	rs372158467		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr11:102575318G>T	ENST00000260229.4	-	2	382	c.291C>A	c.(289-291)ggC>ggA	p.G97G		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	97					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	AGCCATACTGGCCCACATCAG	0.478																																					p.G97G		.											.	MMP27-229	0			c.C291A						.						119.0	116.0	117.0					11																	102575318		2203	4299	6502	SO:0001819	synonymous_variant	64066	exon2			ATACTGGCCCACA	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.291C>A	11.37:g.102575318G>T		82	0		73	3	NM_022122	0	0	0	0	0	Q6UWK6	Silent	SNP	ENST00000260229.4	37	CCDS8319.1																																																																																			.		0.478	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398128.1	NM_022122	
C2CD2L	9854	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	118986791	118986791	+	Missense_Mutation	SNP	G	G	T	rs370366974		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr11:118986791G>T	ENST00000336702.3	+	14	2308	c.1949G>T	c.(1948-1950)cGc>cTc	p.R650L	C2CD2L_ENST00000528586.1_3'UTR	NM_014807.3	NP_055622.3	O14523	C2C2L_HUMAN	C2CD2-like	649						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						CTCATCTTCCGCCGGAGGCCT	0.637																																					p.R650L		.											.	C2CD2L-68	0			c.G1949T						.						57.0	54.0	55.0					11																	118986791		2200	4295	6495	SO:0001583	missense	9854	exon14			TCTTCCGCCGGAG	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000336702.3:c.1949G>T	11.37:g.118986791G>T	ENSP00000338885:p.Arg650Leu	81	0		53	4	NM_014807	0	0	7	7	0	Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000336702.3	37	CCDS8413.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.993875	0.93167	.	.	ENSG00000172375	ENST00000336702	T	0.58797	0.31	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	M	0.73217	2.22	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.78262	-0.2272	10	0.87932	D	0	-0.333	17.918	0.88958	0.0:0.0:1.0:0.0	.	649;650	O14523;O14523-2	C2C2L_HUMAN;.	L	650	ENSP00000338885:R650L	ENSP00000338885:R650L	R	+	2	0	C2CD2L	118492001	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.017000	0.93651	2.693000	0.91896	0.655000	0.94253	CGC	.		0.637	C2CD2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388197.2	NM_014807	
CCDC15	80071	ucsc.edu;bcgsc.ca	37	11	124863136	124863136	+	Silent	SNP	C	C	A	rs7951202	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr11:124863136C>A	ENST00000344762.5	+	11	2470	c.2211C>A	c.(2209-2211)ccC>ccA	p.P737P	CCDC15_ENST00000529051.1_Silent_p.P737P	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	737						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		CTGGAGTGCCCTTGGTATGTT	0.358													A|||	1437	0.286941	0.4705	0.1801	5008	,	,		21131	0.1935		0.1958	False		,,,				2504	0.3047				p.P737P		.											.	CCDC15-69	0			c.C2211A						.	A		1594,2086		362,870,608	69.0	64.0	65.0		2211	-7.2	0.0	11	dbSNP_116	65	1643,6523		170,1303,2610	no	coding-synonymous	CCDC15	NM_025004.2		532,2173,3218	AA,AC,CC		20.12,43.3152,27.3257		737/952	124863136	3237,8609	1840	4083	5923	SO:0001819	synonymous_variant	80071	exon11			AGTGCCCTTGGTA	BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.2211C>A	11.37:g.124863136C>A		62	0		39	4	NM_025004	0	0	0	0	0	Q9H8U7	Silent	SNP	ENST00000344762.5	37	CCDS44756.1																																																																																			C|0.718;A|0.282		0.358	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387131.1	NM_025004	
KIAA1551	55196	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	32136338	32136338	+	Missense_Mutation	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr12:32136338G>T	ENST00000312561.4	+	4	2863	c.2449G>T	c.(2449-2451)Gat>Tat	p.D817Y	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	817																	TTTGAAAGTTGATGTTAGTGG	0.378																																					p.D817Y		.											.	.	0			c.G2449T						.						76.0	72.0	73.0					12																	32136338		2203	4300	6503	SO:0001583	missense	55196	exon4			AAAGTTGATGTTA	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2449G>T	12.37:g.32136338G>T	ENSP00000310338:p.Asp817Tyr	85	0		98	5	NM_018169	0	0	5	5	0	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	G	12.85	2.062210	0.36373	.	.	ENSG00000174718	ENST00000312561	T	0.13901	2.55	5.5	-8.25	0.01025	.	1.554130	0.03648	N	0.240588	T	0.07773	0.0195	L	0.34521	1.04	0.09310	N	1	B	0.20671	0.047	B	0.22152	0.038	T	0.29305	-1.0016	9	.	.	.	.	2.0223	0.03512	0.2072:0.1006:0.3904:0.3017	.	817	Q9HCM1	CL035_HUMAN	Y	817	ENSP00000310338:D817Y	.	D	+	1	0	C12orf35	32027605	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.405000	0.07196	-1.186000	0.02713	0.650000	0.86243	GAT	.		0.378	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
ITGB7	3695	hgsc.bcm.edu	37	12	53591607	53591607	+	Silent	SNP	C	C	T	rs181619182	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr12:53591607C>T	ENST00000267082.5	-	4	561	c.330G>A	c.(328-330)ccG>ccA	p.P110P	ITGB7_ENST00000422257.3_Silent_p.P110P|ITGB7_ENST00000550743.2_Silent_p.P110P|ITGB7_ENST00000338737.4_Silent_p.P110P	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	110					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCTGGCTGAGCGGCTGGTCCT	0.771													C|||	7	0.00139776	0.003	0.0029	5008	,	,		10634	0.0		0.001	False		,,,				2504	0.0				p.P110P		.											.	ITGB7-231	0			c.G330A						.						2.0	3.0	3.0					12																	53591607		1563	3327	4890	SO:0001819	synonymous_variant	3695	exon4			GCTGAGCGGCTGG		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.330G>A	12.37:g.53591607C>T		1	0		7	7	NM_000889	0	0	0	0	0	Q9UCP7|Q9UCS7	Silent	SNP	ENST00000267082.5	37	CCDS8849.1																																																																																			C|0.999;T|0.001		0.771	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405821.2		
ATF7	11016	broad.mit.edu	37	12	53910930	53910930	+	Silent	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr12:53910930C>T	ENST00000548446.2	-	12	1588	c.1476G>A	c.(1474-1476)gcG>gcA	p.A492A	ATF7_ENST00000456903.4_Silent_p.A481A|ATF7_ENST00000420353.2_Silent_p.A481A|ATF7_ENST00000328463.7_Silent_p.A492A|RP11-793H13.10_ENST00000591834.1_Intron|ATF7_ENST00000415113.1_Silent_p.A460A|ATF7_ENST00000546661.1_5'UTR|RP11-793H13.3_ENST00000548347.1_RNA			P17544	ATF7_HUMAN	activating transcription factor 7	492	Essential for binding adenovirus 2 E1A.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	ATCATCTGCCCGCAGACTGGG	0.582																																					p.A481A		.											.	ATF7-455	0			c.G1443A						.						85.0	83.0	84.0					12																	53910930		2082	4208	6290	SO:0001819	synonymous_variant	11016	exon12			TCTGCCCGCAGAC	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.1476G>A	12.37:g.53910930C>T		41	0		48	3	NM_006856	0	0	1	1	0	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Silent	SNP	ENST00000548446.2	37																																																																																				.		0.582	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000406302.2	NM_001130059	
CPSF6	11052	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	69646896	69646896	+	Frame_Shift_Del	DEL	A	A	-			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr12:69646896delA	ENST00000435070.2	+	3	446	c.336delA	c.(334-336)atafs	p.I112fs	CPSF6_ENST00000550987.1_3'UTR|CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000266679.8_Frame_Shift_Del_p.I112fs|CPSF6_ENST00000456847.3_Frame_Shift_Del_p.I112fs	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	112	Necessary for interaction with NUDT21/CPSF5.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			TTTTGGAGATAAAATTTTTTG	0.323																																					p.I112fs		.											.	CPSF6-226	0			c.336delA						.						61.0	66.0	64.0					12																	69646896		2203	4299	6502	SO:0001589	frameshift_variant	11052	exon3			GGAGATAAAATTT	X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.336delA	12.37:g.69646896delA	ENSP00000391774:p.Ile112fs	164	0		160	77	NM_007007	0	0	0	0	0	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Frame_Shift_Del	DEL	ENST00000435070.2	37	CCDS8988.1																																																																																			.		0.323	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007	
CPSF6	11052	bcgsc.ca;mdanderson.org	37	12	69646898	69646898	+	Missense_Mutation	SNP	A	A	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr12:69646898A>C	ENST00000435070.2	+	3	448	c.338A>C	c.(337-339)aAa>aCa	p.K113T	CPSF6_ENST00000550987.1_3'UTR|CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000266679.8_Missense_Mutation_p.K113T|CPSF6_ENST00000456847.3_Missense_Mutation_p.K113T	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	113	Necessary for interaction with NUDT21/CPSF5.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			TTGGAGATAAAATTTTTTGAA	0.323																																					p.K113T		.											.	CPSF6-226	0			c.A338C						.						60.0	65.0	63.0					12																	69646898		2203	4299	6502	SO:0001583	missense	11052	exon3			AGATAAAATTTTT	X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.338A>C	12.37:g.69646898A>C	ENSP00000391774:p.Lys113Thr	165	1		157	77	NM_007007	0	0	14	14	0	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	ENST00000435070.2	37	CCDS8988.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.967397	0.74131	.	.	ENSG00000111605	ENST00000435070;ENST00000456847;ENST00000266679	T;T;T	0.08896	3.04;3.04;3.04	5.18	5.18	0.71444	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.26810	0.0656	M	0.65677	2.01	0.80722	D	1	D;D	0.62365	0.989;0.991	D;D	0.74023	0.969;0.982	T	0.00500	-1.1703	9	.	.	.	-12.785	15.749	0.77969	1.0:0.0:0.0:0.0	.	113;113	Q16630-2;Q16630	.;CPSF6_HUMAN	T	113	ENSP00000391774:K113T;ENSP00000391437:K113T;ENSP00000266679:K113T	.	K	+	2	0	CPSF6	67933165	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.281000	0.95811	2.261000	0.74972	0.533000	0.62120	AAA	.		0.323	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007	
CPSF6	11052	hgsc.bcm.edu	37	12	69646903	69646903	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr12:69646903delT	ENST00000435070.2	+	3	453	c.343delT	c.(343-345)tttfs	p.F115fs	CPSF6_ENST00000550987.1_3'UTR|CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000266679.8_Frame_Shift_Del_p.F115fs|CPSF6_ENST00000456847.3_Frame_Shift_Del_p.F115fs	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	115	Necessary for interaction with NUDT21/CPSF5.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			GATAAAATTTTTTGAAAATCG	0.333																																					p.F115fs		.											.	CPSF6-226	0			c.343delT						.						59.0	64.0	62.0					12																	69646903		2203	4299	6502	SO:0001589	frameshift_variant	11052	exon3			AAATTTTTTGAAA	X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.343delT	12.37:g.69646903delT	ENSP00000391774:p.Phe115fs	159	0		158	0	NM_007007	0	0	0	0	0	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Frame_Shift_Del	DEL	ENST00000435070.2	37	CCDS8988.1																																																																																			.		0.333	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007	
TPTE2	93492	broad.mit.edu	37	13	20025336	20025336	+	Silent	SNP	A	A	G	rs545861513	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr13:20025336A>G	ENST00000400230.2	-	11	815	c.771T>C	c.(769-771)caT>caC	p.H257H	TPTE2_ENST00000382978.1_Silent_p.H217H|TPTE2_ENST00000457266.2_Silent_p.H146H|TPTE2_ENST00000400103.2_Silent_p.H146H|TPTE2_ENST00000390680.2_Silent_p.H180H|TPTE2_ENST00000382975.4_Silent_p.H217H|TPTE2_ENST00000255310.6_Silent_p.H180H|TPTE2_ENST00000382977.4_Silent_p.H257H			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	257	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGTGGTTTCGATGTTTCTTAT	0.358													a|||	6	0.00119808	0.003	0.0014	5008	,	,		20859	0.0		0.001	False		,,,				2504	0.0				p.H257H		.											.	TPTE2-92	0			c.T771C						.						132.0	116.0	122.0					13																	20025336		2203	4299	6502	SO:0001819	synonymous_variant	93492	exon12			GTTTCGATGTTTC	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.771T>C	13.37:g.20025336A>G		95	1		74	7	NM_199254	0	0	0	0	0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	ENST00000400230.2	37	CCDS45014.1																																																																																			.		0.358	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_199254	
PCCA	5095	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	100925450	100925450	+	Splice_Site	SNP	C	C	A			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr13:100925450C>A	ENST00000376285.1	+	12	953	c.915C>A	c.(913-915)agC>agA	p.S305R	PCCA_ENST00000376279.3_Splice_Site_p.S305R|PCCA_ENST00000376286.4_Splice_Site_p.S279R	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	305	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	GTATATGTAGCATTTTTTTGG	0.378																																					p.S305R		.											.	PCCA-227	0			c.C915A						.						63.0	65.0	65.0					13																	100925450		2203	4300	6503	SO:0001630	splice_region_variant	5095	exon12			ATGTAGCATTTTT	X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.915-1C>A	13.37:g.100925450C>A		61	0		39	20	NM_001178004	0	0	0	0	0	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	37	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802222	0.50315	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.98105	-4.72;-4.72;-4.72	5.56	1.87	0.25490	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.127042	0.64402	D	0.000001	D	0.99208	0.9725	H	0.99415	4.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98102	1.0415	9	.	.	.	.	10.3117	0.43712	0.0:0.6855:0.0:0.3145	.	305;279;305	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	R	279;305;305	ENSP00000365463:S279R;ENSP00000365456:S305R;ENSP00000365462:S305R	.	S	+	3	2	PCCA	99723451	1.000000	0.71417	0.984000	0.44739	0.529000	0.34654	0.883000	0.28200	0.397000	0.25310	-0.150000	0.13652	AGC	.		0.378	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		Missense_Mutation
NOVA1	4857	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	26917292	26917292	+	Missense_Mutation	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr14:26917292C>T	ENST00000539517.2	-	5	1714	c.1397G>A	c.(1396-1398)gGc>gAc	p.G466D	NOVA1_ENST00000465357.2_Missense_Mutation_p.G442D|NOVA1_ENST00000267422.7_Missense_Mutation_p.G344D	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	469	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		ATTCCTTGTGCCAGGTACGAA	0.443																																					p.G466D		.											.	NOVA1-229	0			c.G1397A						.						164.0	135.0	145.0					14																	26917292		2203	4300	6503	SO:0001583	missense	4857	exon5			CTTGTGCCAGGTA	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.1397G>A	14.37:g.26917292C>T	ENSP00000438875:p.Gly466Asp	234	0		274	116	NM_002515	0	0	1	5	4	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	ENST00000539517.2	37	CCDS32061.1	.	.	.	.	.	.	.	.	.	.	C	16.63	3.175514	0.57692	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000267422	T;T;T	0.29397	1.57;1.57;1.57	5.92	5.92	0.95590	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.64402	D	0.000001	T	0.62551	0.2437	M	0.82193	2.58	0.80722	D	1	D;D;D	0.76494	0.999;0.987;0.999	D;D;D	0.87578	0.998;0.988;0.991	T	0.64166	-0.6471	10	0.62326	D	0.03	-22.96	20.3151	0.98650	0.0:1.0:0.0:0.0	.	469;442;466	P51513;D3DS81;P51513-4	NOVA1_HUMAN;.;.	D	442;466;344	ENSP00000447391:G442D;ENSP00000438875:G466D;ENSP00000267422:G344D	ENSP00000267422:G344D	G	-	2	0	NOVA1	25987132	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.809000	0.96659	0.467000	0.42956	GGC	.		0.443	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491	
NPAS3	64067	bcgsc.ca	37	14	34270138	34270138	+	Silent	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr14:34270138C>T	ENST00000356141.4	+	12	2625	c.2625C>T	c.(2623-2625)caC>caT	p.H875H	NPAS3_ENST00000548645.1_Silent_p.H845H|NPAS3_ENST00000346562.2_Silent_p.H843H|NPAS3_ENST00000357798.5_Silent_p.H862H|NPAS3_ENST00000551492.1_Silent_p.H880H			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	875					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TCTACCACCACGTGCACCGGC	0.647																																					p.H875H		.											.	NPAS3-93	0			c.C2625T						.						45.0	28.0	34.0					14																	34270138		2201	4299	6500	SO:0001819	synonymous_variant	64067	exon12			CCACCACGTGCAC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2625C>T	14.37:g.34270138C>T		122	3		200	81	NM_001164749	0	0	0	1	1	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	ENST00000356141.4	37	CCDS53891.1																																																																																			.		0.647	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
DNAAF2	55172	hgsc.bcm.edu	37	14	50100683	50100683	+	Silent	SNP	C	C	G	rs2985686	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr14:50100683C>G	ENST00000298292.8	-	1	1265	c.1185G>C	c.(1183-1185)gcG>gcC	p.A395A	DNAAF2_ENST00000406043.3_Silent_p.A395A	NM_018139.2	NP_060609.2	Q9NVR5	KTU_HUMAN	dynein, axonemal, assembly factor 2	395					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)				kidney(1)|lung(4)	5						CTCCGTCCTCCGCGCGACTCC	0.781													G|||	2800	0.559105	0.6702	0.6715	5008	,	,		11594	0.1736		0.7604	False		,,,				2504	0.5194				p.A395A		.											.	.	0			c.G1185C						.						1.0	1.0	1.0					14																	50100683		917	2082	2999	SO:0001819	synonymous_variant	55172	exon1			GTCCTCCGCGCGA	AK001425	CCDS9691.2, CCDS45100.1	14q21.3	2012-05-03	2011-06-09	2011-06-09	ENSG00000165506	ENSG00000165506			20188	protein-coding gene	gene with protein product	"""kintoun"""	612517	"""chromosome 14 open reading frame 104"""	C14orf104			Standard	NM_001083908		Approved	FLJ10563, KTU, PF13, CILD10	uc001wws.4	Q9NVR5	OTTHUMG00000152331	ENST00000298292.8:c.1185G>C	14.37:g.50100683C>G		0	0		10	10	NM_018139	0	0	0	0	0	B9WS54|C0JAP7|Q86TR1|Q86TY8|Q969Z5	Silent	SNP	ENST00000298292.8	37	CCDS9691.2																																																																																			C|0.569;G|0.431		0.781	DNAAF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276813.1		
SPTB	6710	bcgsc.ca	37	14	65260227	65260227	+	Silent	SNP	T	T	G	rs229591	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr14:65260227T>G	ENST00000389721.5	-	13	2186	c.2154A>C	c.(2152-2154)atA>atC	p.I718I	SPTB_ENST00000542895.1_Silent_p.I718I|SPTB_ENST00000556626.1_Silent_p.I718I|SPTB_ENST00000389720.3_Silent_p.I718I|SPTB_ENST00000389722.3_Silent_p.I718I	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	718					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ACACCTCCTTTATGCGGGCCT	0.592													G|||	2255	0.45028	0.7201	0.3372	5008	,	,		19756	0.2004		0.3588	False		,,,				2504	0.5174				p.I718I		.											.	SPTB-100	0			c.A2154C						.	G	,	2836,1570	489.6+/-361.5	916,1004,283	56.0	53.0	54.0		2154,2154	3.8	0.7	14	dbSNP_79	54	3147,5453	655.4+/-401.3	566,2015,1719	no	coding-synonymous,coding-synonymous	SPTB	NM_000347.5,NM_001024858.2	,	1482,3019,2002	GG,GT,TT		36.593,35.6332,46.0018	,	718/2138,718/2329	65260227	5983,7023	2203	4300	6503	SO:0001819	synonymous_variant	6710	exon13			CTCCTTTATGCGG		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.2154A>C	14.37:g.65260227T>G		104	0		116	6	NM_000347	0	0	1	1	0	Q15510|Q15519	Silent	SNP	ENST00000389721.5	37	CCDS32100.1																																																																																			T|0.558;G|0.442		0.592	SPTB-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414080.1		
SERPINA3	12	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	95085645	95085645	+	Missense_Mutation	SNP	T	T	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr14:95085645T>C	ENST00000467132.1	+	3	1905	c.757T>C	c.(757-759)Tac>Cac	p.Y253H	SERPINA3_ENST00000393080.4_Missense_Mutation_p.Y253H|SERPINA3_ENST00000482740.1_Missense_Mutation_p.Y35H|SERPINA3_ENST00000393078.3_Missense_Mutation_p.Y253H|RP11-986E7.7_ENST00000553947.1_3'UTR			P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3	253					acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of endopeptidase activity (GO:0010951)|regulation of lipid metabolic process (GO:0019216)|regulation of proteolysis (GO:0030162)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	DNA binding (GO:0003677)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(17)|ovary(2)|pancreas(1)|skin(3)|stomach(1)	40		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		GACTATACCTTACTTCCGGGA	0.512																																					p.Y253H		.											.	SERPINA3-653	0			c.T757C						.						135.0	101.0	112.0					14																	95085645		2203	4300	6503	SO:0001583	missense	12	exon3			ATACCTTACTTCC	K01500	CCDS32150.1	14q32.1	2014-06-03	2005-08-18		ENSG00000196136	ENSG00000196136		"""Serine (or cysteine) peptidase inhibitors"""	16	protein-coding gene	gene with protein product		107280	"""alpha-1-antichymotrypsin"", ""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3"""	AACT		3260956, 24172014	Standard	NM_001085		Approved	ACT, alpha-1-antichymotrypsin	uc001ydp.3	P01011	OTTHUMG00000029851	ENST00000467132.1:c.757T>C	14.37:g.95085645T>C	ENSP00000450540:p.Tyr253His	258	0		351	29	NM_001085	0	0	75	77	2	B3KVQ7|Q13703|Q2TU87|Q2TU88|Q59GP9|Q6LBY8|Q6LDT7|Q6NSC9|Q8N177|Q96DW8|Q9UC47|Q9UNU9	Missense_Mutation	SNP	ENST00000467132.1	37	CCDS32150.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.300432	0.23650	.	.	ENSG00000196136	ENST00000553947;ENST00000393078;ENST00000393080;ENST00000555820;ENST00000467132;ENST00000482740	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	4.66	2.2	0.27929	Serpin domain (3);	0.607393	0.15382	N	0.265249	D	0.83626	0.5295	L	0.60455	1.87	0.09310	N	1	B;B	0.33583	0.418;0.381	P;P	0.45343	0.477;0.463	T	0.75091	-0.3440	10	0.52906	T	0.07	.	2.869	0.05610	0.1371:0.086:0.1598:0.6171	.	253;278	P01011;G3V5I3	AACT_HUMAN;.	H	278;253;253;253;253;35	ENSP00000452367:Y278H;ENSP00000376793:Y253H;ENSP00000376795:Y253H;ENSP00000450540:Y253H;ENSP00000451119:Y35H	ENSP00000376793:Y253H	Y	+	1	0	SERPINA3	94155398	0.085000	0.21516	0.753000	0.31225	0.095000	0.18619	0.811000	0.27198	0.795000	0.33922	0.454000	0.30748	TAC	.		0.512	SERPINA3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268080.3	NM_001085	
HHIPL1	84439	hgsc.bcm.edu	37	14	100141689	100141689	+	Missense_Mutation	SNP	T	T	C	rs7158073	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr14:100141689T>C	ENST00000330710.5	+	9	2173	c.2075T>C	c.(2074-2076)gTg>gCg	p.V692A		NM_001127258.1	NP_001120730.1	Q96JK4	HIPL1_HUMAN	HHIP-like 1	692	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.		V -> A (in dbSNP:rs7158073).		carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|skin(2)	15		Melanoma(154;0.128)				GAGGTGTTCGTGGGCGGACGC	0.746													T|||	2585	0.516174	0.3933	0.536	5008	,	,		7828	0.6131		0.5676	False		,,,				2504	0.5153				p.V692A		.											.	HHIPL1-70	0			c.T2075C						.	T	ALA/VAL	503,863		120,263,300	7.0	9.0	8.0		2075	-3.8	0.0	14	dbSNP_116	8	1711,1441		496,719,361	no	missense	HHIPL1	NM_001127258.1	64	616,982,661	CC,CT,TT		45.717,36.8228,49.004	benign	692/783	100141689	2214,2304	683	1576	2259	SO:0001583	missense	84439	exon9			TGTTCGTGGGCGG	AB058725	CCDS9953.1, CCDS45162.1	14q32	2008-01-16	2008-01-16	2008-01-16		ENSG00000182218			19710	protein-coding gene	gene with protein product			"""KIAA1822"""	KIAA1822			Standard	NM_032425		Approved		uc010avs.3	Q96JK4		ENST00000330710.5:c.2075T>C	14.37:g.100141689T>C	ENSP00000330601:p.Val692Ala	0	0		20	20	NM_001127258	0	0	0	0	0	A2RUF8|B2RN09|Q6UXX2	Missense_Mutation	SNP	ENST00000330710.5	37	CCDS45162.1	1146	0.5247252747252747	201	0.40853658536585363	196	0.5414364640883977	347	0.6066433566433567	402	0.5303430079155673	T	4.106	0.017676	0.07959	0.368228	0.54283	ENSG00000182218	ENST00000330710	T	0.28895	1.59	4.74	-3.78	0.04333	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.00012	0.0000	N	0.17872	0.535	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.47459	-0.9116	8	0.16420	T	0.52	.	1.8306	0.03130	0.1251:0.2661:0.1277:0.4811	rs7158073;rs57071746;rs7158073	692	Q96JK4	HIPL1_HUMAN	A	692	ENSP00000330601:V692A	ENSP00000330601:V692A	V	+	2	0	HHIPL1	99211442	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.153000	0.16323	-0.525000	0.06391	-0.468000	0.05107	GTG	T|0.478;C|0.522		0.746	HHIPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413811.1	XM_041566	
EXOC3L4	91828	hgsc.bcm.edu	37	14	103568729	103568729	+	Silent	SNP	A	A	G	rs10142200	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr14:103568729A>G	ENST00000380069.3	+	2	745	c.669A>G	c.(667-669)gaA>gaG	p.E223E		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	223					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						CGGAGGAGGAAGCCCACCCTT	0.756													G|||	2646	0.528355	0.5666	0.5303	5008	,	,		12079	0.6042		0.3917	False		,,,				2504	0.5378				p.E223E		.											.	EXOC3L4-23	0			c.A669G						.	G		2098,2000		603,892,554	5.0	5.0	5.0		669	2.5	0.8	14	dbSNP_119	5	2949,5055		663,1623,1716	no	coding-synonymous	EXOC3L4	NM_001077594.1		1266,2515,2270	GG,GA,AA		36.8441,48.8043,41.7039		223/723	103568729	5047,7055	2049	4002	6051	SO:0001819	synonymous_variant	91828	exon2			GGAGGAAGCCCAC	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.669A>G	14.37:g.103568729A>G		0	0		8	4	NM_001077594	0	0	0	0	0	Q14CR2	Silent	SNP	ENST00000380069.3	37	CCDS32163.1																																																																																			A|0.486;G|0.514		0.756	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
CKB	1152	hgsc.bcm.edu	37	14	103988180	103988180	+	Silent	SNP	G	G	T	rs1136165	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr14:103988180G>T	ENST00000348956.2	-	4	813	c.456C>A	c.(454-456)cgC>cgA	p.R152R		NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	152	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	TCTCGATGGCGCGGCGCTCCC	0.756													G|||	3294	0.657748	0.5416	0.7349	5008	,	,		7060	0.8264		0.6233	False		,,,				2504	0.6217				p.R152R	Esophageal Squamous(186;2492 2823 49929 50127)	.											.	CKB-115	0			c.C456A						.	G		1738,1164		574,590,287	3.0	4.0	3.0		456	-0.0	1.0	14	dbSNP_86	3	4002,2154		1387,1228,463	no	coding-synonymous	CKB	NM_001823.3		1961,1818,750	TT,TG,GG		34.9903,40.1103,36.6306		152/382	103988180	5740,3318	1451	3078	4529	SO:0001819	synonymous_variant	1152	exon4			GATGGCGCGGCGC		CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.456C>A	14.37:g.103988180G>T		0	0		5	4	NM_001823	0	0	52	79	27	A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Silent	SNP	ENST00000348956.2	37	CCDS9981.1	1462	0.6694139194139194	285	0.5792682926829268	250	0.6906077348066298	460	0.8041958041958042	467	0.6160949868073878	G	13.11	2.138272	0.37728	0.598897	0.650097	ENSG00000166165	ENST00000428256	.	.	.	4.64	-0.0349	0.13894	.	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999999624	.	.	.	.	.	.	T	0.17592	-1.0364	5	0.41790	T	0.15	-18.9304	4.9837	0.14180	0.3841:0.2745:0.3414:0.0	rs1136165;rs2227867;rs2765044;rs3179077;rs3199393;rs17366340;rs17423634;rs17849441;rs17850309;rs17850603;rs17851735;rs17851741;rs17857802	.	.	.	S	118	.	ENSP00000395515:R118S	R	-	1	0	CKB	103057933	0.001000	0.12720	0.999000	0.59377	0.996000	0.88848	-2.081000	0.01367	0.066000	0.16515	0.449000	0.29647	CGC	G|0.327;T|0.673		0.756	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415111.1		
GABRG3	2567	bcgsc.ca	37	15	27772676	27772676	+	Silent	SNP	C	C	T	rs140679	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr15:27772676C>T	ENST00000333743.6	+	8	1217	c.963C>T	c.(961-963)acC>acT	p.T321T	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	321					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTTTTGTGACCGTGTGCTTCC	0.557													C|||	2586	0.516374	0.3026	0.6844	5008	,	,		20370	0.6577		0.5467	False		,,,				2504	0.5092				p.T321T	NSCLC(114;800 1656 7410 37729 45293)	.											.	.	0			c.C963T						.	C		1351,2995		231,889,1053	139.0	127.0	131.0		963	-8.3	0.5	15	dbSNP_78	131	4580,3972		1233,2114,929	no	coding-synonymous	GABRG3	NM_033223.4		1464,3003,1982	TT,TC,CC		46.4453,31.0861,45.9839		321/468	27772676	5931,6967	2173	4276	6449	SO:0001819	synonymous_variant	2567	exon8			TGTGACCGTGTGC		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.963C>T	15.37:g.27772676C>T		243	2		154	7	NM_033223	0	0	0	0	0	G3V594|Q9HD46|Q9NYT2	Silent	SNP	ENST00000333743.6	37	CCDS45195.1	1190	0.5448717948717948	150	0.3048780487804878	238	0.6574585635359116	394	0.6888111888111889	408	0.5382585751978892	C	9.780	1.175068	0.21704	0.310861	0.535547	ENSG00000182256	ENST00000451330	.	.	.	5.48	-8.26	0.01021	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.00995	-1.1487	3	.	.	.	.	18.8379	0.92169	0.0:0.1181:0.0:0.8819	rs140679;rs17649404;rs140679	.	.	.	L	84	.	.	P	+	2	0	GABRG3	25446271	0.001000	0.12720	0.503000	0.27626	0.903000	0.53119	-1.707000	0.01893	-2.099000	0.00849	-0.251000	0.11542	CCG	C|0.473;T|0.527		0.557	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
KBTBD13	390594	hgsc.bcm.edu	37	15	65369441	65369441	+	Missense_Mutation	SNP	T	T	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr15:65369441T>G	ENST00000432196.2	+	1	288	c.288T>G	c.(286-288)ttT>ttG	p.F96L	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	96					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						TGGCTCGCTTTCTGGAGCACA	0.716																																					p.F96L		.											.	.	0			c.T288G						.						2.0	3.0	3.0					15																	65369441		1648	3451	5099	SO:0001583	missense	390594	exon1			TCGCTTTCTGGAG		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.288T>G	15.37:g.65369441T>G	ENSP00000388723:p.Phe96Leu	5	0		18	15	NM_001101362	0	0	0	0	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.610036	0.00835	.	.	ENSG00000234438	ENST00000432196	T	0.64803	-0.12	4.36	-2.18	0.07037	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.49218	0.1544	L	0.34521	1.04	0.22851	N	0.998653	B	0.27013	0.166	B	0.28916	0.096	T	0.36962	-0.9726	9	0.41790	T	0.15	.	11.8393	0.52344	0.0:0.6683:0.0:0.3317	.	96	C9JR72	KBTBD_HUMAN	L	96	ENSP00000388723:F96L	ENSP00000388723:F96L	F	+	3	2	KBTBD13	63156494	0.000000	0.05858	0.570000	0.28473	0.004000	0.04260	-0.665000	0.05286	-0.710000	0.05001	-0.874000	0.02982	TTT	.		0.716	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418468.2	NM_001101362	
FAM219B	57184	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	75195092	75195092	+	Silent	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr15:75195092C>T	ENST00000357635.5	-	5	785	c.465G>A	c.(463-465)caG>caA	p.Q155Q	FAM219B_ENST00000565772.1_Silent_p.Q69Q|FAM219B_ENST00000563706.1_5'UTR|CTD-2235H24.2_ENST00000564692.1_RNA|FAM219B_ENST00000563119.1_Silent_p.Q155Q	NM_020447.3	NP_065180.1	Q5XKK7	F219B_HUMAN	family with sequence similarity 219, member B	155																	GATACCCATCCTGAAGCAGCT	0.537																																					p.Q155Q		.											.	.	0			c.G465A						.						126.0	110.0	115.0					15																	75195092		2197	4295	6492	SO:0001819	synonymous_variant	57184	exon5			CCCATCCTGAAGC	AK000005	CCDS32295.1	15q23	2012-03-06	2012-03-06	2012-03-06	ENSG00000178761	ENSG00000178761			24695	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 17"""	C15orf17		11214971	Standard	NM_020447		Approved	FLJ00005	uc002azh.4	Q5XKK7	OTTHUMG00000172715	ENST00000357635.5:c.465G>A	15.37:g.75195092C>T		151	0		107	7	NM_020447	0	0	46	48	2	A8K4Q5|B4DK57|Q9NXY0	Silent	SNP	ENST00000357635.5	37	CCDS32295.1																																																																																			.		0.537	FAM219B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420165.1	NM_020447	
ADAMTS7	11173	hgsc.bcm.edu	37	15	79092603	79092603	+	Silent	SNP	G	G	A	rs6495329	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr15:79092603G>A	ENST00000388820.4	-	2	597	c.387C>T	c.(385-387)caC>caT	p.H129H	ADAMTS7_ENST00000566303.1_5'UTR	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	129					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.H129H(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGCCAAGCAGGTGGCAGGCCG	0.726													G|||	2065	0.41234	0.5598	0.3847	5008	,	,		11724	0.3323		0.328	False		,,,				2504	0.4018				p.H129H		.											.	ADAMTS7-226	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.C387T						.	G		1838,2076		467,904,586	10.0	11.0	11.0		387	1.8	1.0	15	dbSNP_116	11	2443,5723		421,1601,2061	no	coding-synonymous	ADAMTS7	NM_014272.3		888,2505,2647	AA,AG,GG		29.9167,46.9596,35.4387		129/1687	79092603	4281,7799	1957	4083	6040	SO:0001819	synonymous_variant	11173	exon2			AAGCAGGTGGCAG	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.387C>T	15.37:g.79092603G>A		0	0		5	5	NM_014272	0	0	0	2	2	Q14F51|Q6P7J9	Silent	SNP	ENST00000388820.4	37	CCDS32303.1																																																																																			G|0.616;A|0.384		0.726	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
FANCI	55215	bcgsc.ca	37	15	89804043	89804043	+	Missense_Mutation	SNP	C	C	T	rs17803620	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr15:89804043C>T	ENST00000310775.7	+	4	343	c.257C>T	c.(256-258)gCg>gTg	p.A86V	FANCI_ENST00000451393.2_5'UTR|FANCI_ENST00000300027.8_Missense_Mutation_p.A86V|FANCI_ENST00000567996.1_Missense_Mutation_p.A86V	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	86			A -> V (in dbSNP:rs17803620). {ECO:0000269|PubMed:15489334}.		cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					AAAGAAATAGCGTCTGAGATC	0.438								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				C|||	1301	0.259784	0.0393	0.3458	5008	,	,		17597	0.3036		0.3787	False		,,,				2504	0.3292				p.A86V		.											.	FANCI-92	0			c.C257T						.	C	VAL/ALA,VAL/ALA	417,3983	205.2+/-227.1	19,379,1802	124.0	118.0	120.0		257,257	4.4	1.0	15	dbSNP_123	120	3304,5294	493.6+/-373.6	635,2034,1630	yes	missense,missense	FANCI	NM_001113378.1,NM_018193.2	64,64	654,2413,3432	TT,TC,CC		38.4275,9.4773,28.6275	benign,benign	86/1329,86/1269	89804043	3721,9277	2200	4299	6499	SO:0001583	missense	55215	exon4	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AAATAGCGTCTGA	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.257C>T	15.37:g.89804043C>T	ENSP00000310842:p.Ala86Val	105	1		115	5	NM_001113378	0	0	2	2	0	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	ENST00000310775.7	37	CCDS45346.1	623	0.28525641025641024	29	0.05894308943089431	120	0.3314917127071823	173	0.30244755244755245	301	0.3970976253298153	C	15.55	2.866199	0.51588	0.094773	0.384275	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.43294	0.95;0.95;0.95	5.43	4.45	0.53987	.	0.000000	0.64402	D	0.000001	T	0.00012	0.0000	L	0.38838	1.175	0.09310	P	1.0	B;P	0.41345	0.191;0.746	B;B	0.25614	0.055;0.062	T	0.39375	-0.9617	9	0.08381	T	0.77	-8.5811	9.6142	0.39681	0.0:0.7708:0.1457:0.0835	rs17803620;rs17803620	86;86	Q9NVI1;Q9NVI1-1	FANCI_HUMAN;.	V	86	ENSP00000300027:A86V;ENSP00000310842:A86V;ENSP00000413249:A86V	ENSP00000300027:A86V	A	+	2	0	FANCI	87605047	0.997000	0.39634	1.000000	0.80357	0.955000	0.61496	1.970000	0.40520	2.534000	0.85438	0.655000	0.94253	GCG	C|0.726;T|0.274		0.438	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421140.1	NM_018193	
OR4F15	390649	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	102359139	102359139	+	Missense_Mutation	SNP	C	C	A	rs149793188	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr15:102359139C>A	ENST00000332238.4	+	1	774	c.750C>A	c.(748-750)ttC>ttA	p.F250L		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TCATCTTGTTCTTTGGGCCAC	0.428																																					p.F250L		.											.	OR4F15-68	0			c.C750A						.						303.0	249.0	267.0					15																	102359139		2203	4300	6503	SO:0001583	missense	390649	exon1			CTTGTTCTTTGGG	BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.750C>A	15.37:g.102359139C>A	ENSP00000333184:p.Phe250Leu	139	0		82	6	NM_001001674	0	0	0	0	0	B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	ENST00000332238.4	37	CCDS32342.1	.	.	.	.	.	.	.	.	.	.	.	16.70	3.194844	0.58017	.	.	ENSG00000182854	ENST00000332238	T	0.00285	8.3	5.57	1.59	0.23543	GPCR, rhodopsin-like superfamily (1);	0.094069	0.47455	D	0.000235	T	0.00552	0.0018	M	0.86420	2.815	0.29476	N	0.85671	P	0.48407	0.91	P	0.59643	0.861	T	0.15549	-1.0433	9	.	.	.	.	7.7835	0.29078	0.0:0.589:0.0:0.411	.	250	Q8NGB8	O4F15_HUMAN	L	250	ENSP00000333184:F250L	.	F	+	3	2	OR4F15	100176662	0.959000	0.32827	0.982000	0.44146	0.751000	0.42716	0.022000	0.13511	0.467000	0.27218	0.650000	0.86243	TTC	C|1.000;T|0.000		0.428	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417594.1	NM_001001674	
WFIKKN1	117166	broad.mit.edu	37	16	683832	683832	+	Silent	SNP	C	C	A	rs541743223		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:683832C>A	ENST00000319070.2	+	2	1744	c.1422C>A	c.(1420-1422)ggC>ggA	p.G474G		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	474	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				AGTTCTTGGGCACCAAGTACC	0.677																																					p.G474G		.											.	WFIKKN1-90	0			c.C1422A						.						76.0	42.0	53.0					16																	683832		2178	4291	6469	SO:0001819	synonymous_variant	117166	exon2			CTTGGGCACCAAG	AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.1422C>A	16.37:g.683832C>A		153	1		316	10	NM_053284	0	0	1	1	0	Q7LDW0|Q8NBQ1|Q96S20	Silent	SNP	ENST00000319070.2	37	CCDS10414.1																																																																																			.		0.677	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206731.2	NM_053284	
NTN3	4917	broad.mit.edu	37	16	2521965	2521965	+	Missense_Mutation	SNP	C	C	A	rs201589632		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:2521965C>A	ENST00000293973.1	+	1	466	c.263C>A	c.(262-264)gCc>gAc	p.A88D		NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	88	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)		p.A88D(1)		breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						GGGGGCACGGCCAGCCCTCTG	0.721																																					p.A88D		.											.	NTN3-90	1	Substitution - Missense(1)	prostate(1)	c.C263A						.																																			SO:0001583	missense	4917	exon1			GCACGGCCAGCCC	U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.263C>A	16.37:g.2521965C>A	ENSP00000293973:p.Ala88Asp	12	0		30	4	NM_006181	0	0	0	0	0		Missense_Mutation	SNP	ENST00000293973.1	37	CCDS10469.1	.	.	.	.	.	.	.	.	.	.	C	3.333	-0.136221	0.06711	.	.	ENSG00000162068	ENST00000293973	T	0.75938	-0.98	3.62	3.62	0.41486	Laminin, N-terminal (3);	0.342788	0.27236	N	0.020283	T	0.57725	0.2073	N	0.08118	0	0.20074	N	0.999934	B	0.30542	0.284	B	0.39299	0.296	T	0.46965	-0.9153	10	0.10902	T	0.67	.	14.0129	0.64507	0.0:1.0:0.0:0.0	.	88	O00634	NET3_HUMAN	D	88	ENSP00000293973:A88D	ENSP00000293973:A88D	A	+	2	0	NTN3	2461966	0.016000	0.18221	0.002000	0.10522	0.359000	0.29487	1.971000	0.40530	1.864000	0.54056	0.448000	0.29417	GCC	.		0.721	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250812.1	NM_006181	
ZNF764	92595	ucsc.edu	37	16	30567377	30567377	+	Missense_Mutation	SNP	T	T	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:30567377T>C	ENST00000252797.2	-	3	445	c.365A>G	c.(364-366)gAg>gGg	p.E122G	ZNF764_ENST00000395091.2_Missense_Mutation_p.E121G|AC002310.13_ENST00000568114.1_Intron	NM_001172679.1|NM_033410.3	NP_001166150.1|NP_219363.2	Q96H86	ZN764_HUMAN	zinc finger protein 764	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7						GTCGGGCTTCTCCAGGGCTCC	0.617																																					p.E122G		.											.	ZNF764-91	0			c.A365G						.						48.0	55.0	53.0					16																	30567377		2197	4300	6497	SO:0001583	missense	92595	exon3			GGCTTCTCCAGGG	BC008821	CCDS10683.1, CCDS54001.1	16p11.2	2013-01-08			ENSG00000169951	ENSG00000169951		"""Zinc fingers, C2H2-type"", ""-"""	28200	protein-coding gene	gene with protein product						12477932	Standard	NM_033410		Approved	MGC13138	uc002dyq.3	Q96H86	OTTHUMG00000132406	ENST00000252797.2:c.365A>G	16.37:g.30567377T>C	ENSP00000252797:p.Glu122Gly	28	0		33	4	NM_033410	0	0	22	22	0	A8MZF4|B3KSN2|H9KV99|Q9BWS1	Missense_Mutation	SNP	ENST00000252797.2	37	CCDS10683.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.614105	0.28712	.	.	ENSG00000169951	ENST00000252797;ENST00000395091	T;T	0.06849	3.26;3.25	4.74	1.34	0.21922	.	0.188143	0.25869	N	0.027780	T	0.03434	0.0099	N	0.04959	-0.14	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.40308	-0.9570	10	0.34782	T	0.22	-7.4827	5.8276	0.18562	0.0:0.3529:0.0:0.6471	.	121;122	B3KSN2;Q96H86	.;ZN764_HUMAN	G	122;121	ENSP00000252797:E122G;ENSP00000378526:E121G	ENSP00000252797:E122G	E	-	2	0	ZNF764	30474878	0.000000	0.05858	0.001000	0.08648	0.029000	0.11900	-0.107000	0.10873	0.414000	0.25790	-0.371000	0.07208	GAG	.		0.617	ZNF764-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255541.1	NM_033410	
TGFB1I1	7041	broad.mit.edu	37	16	31488760	31488760	+	Missense_Mutation	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:31488760G>T	ENST00000394863.3	+	11	1379	c.1249G>T	c.(1249-1251)Gtg>Ttg	p.V417L	TGFB1I1_ENST00000567607.1_Missense_Mutation_p.V400L|TGFB1I1_ENST00000394858.2_Missense_Mutation_p.V400L|TGFB1I1_ENST00000361773.3_Missense_Mutation_p.V400L	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	417	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						CGGCCGCTGCGTGTCGGCCCT	0.697																																					p.V417L		.											.	TGFB1I1-90	0			c.G1249T						.						15.0	15.0	15.0					16																	31488760		2191	4293	6484	SO:0001583	missense	7041	exon11			CGCTGCGTGTCGG	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.1249G>T	16.37:g.31488760G>T	ENSP00000378332:p.Val417Leu	41	0		252	7	NM_001042454	0	0	14	14	0	B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	37	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.898560	0.91962	.	.	ENSG00000140682	ENST00000394863;ENST00000361773;ENST00000394858	D;D;D	0.87029	-2.2;-2.2;-2.2	5.1	5.1	0.69264	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.88618	0.6485	N	0.25992	0.78	0.58432	D	0.999993	D	0.59767	0.986	D	0.66196	0.942	D	0.88998	0.3419	10	0.48119	T	0.1	.	16.369	0.83346	0.0:0.0:1.0:0.0	.	417	O43294	TGFI1_HUMAN	L	417;400;400	ENSP00000378332:V417L;ENSP00000355117:V400L;ENSP00000378327:V400L	ENSP00000355117:V400L	V	+	1	0	TGFB1I1	31396261	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.295000	0.33377	2.534000	0.85438	0.484000	0.47621	GTG	.		0.697	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3		
IRX3	79191	hgsc.bcm.edu	37	16	54318528	54318528	+	Missense_Mutation	SNP	A	A	G	rs1450355	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:54318528A>G	ENST00000329734.3	-	2	1977	c.1265T>C	c.(1264-1266)cTg>cCg	p.L422P		NM_024336.2	NP_077312.2	P78415	IRX3_HUMAN	iroquois homeobox 3	422	Pro-rich.		L -> P (in dbSNP:rs1450355). {ECO:0000269|PubMed:15489334}.		mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of neuron differentiation (GO:0045666)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|soft_tissue(1)|urinary_tract(1)	14						GAGCGGGTGCAGGCGGGGGCC	0.776													g|||	4851	0.96865	0.888	0.987	5008	,	,		8017	1.0		1.0	False		,,,				2504	1.0				p.L422P	GBM(143;1830 1866 4487 4646 37383)	.											.	IRX3-90	0			c.T1265C						.	T	PRO/LEU	1678,102		788,102,0	1.0	2.0	2.0		1265	2.5	1.0	16	dbSNP_88	2	4195,3		2096,3,0	no	missense	IRX3	NM_024336.2	98	2884,105,0	GG,GA,AA		0.0715,5.7303,1.7564	benign	422/502	54318528	5873,105	890	2099	2989	SO:0001583	missense	79191	exon2			GGGTGCAGGCGGG	U90308	CCDS10750.1	16q12.2	2011-06-20	2007-07-13		ENSG00000177508	ENSG00000177508		"""Homeoboxes / TALE class"""	14360	protein-coding gene	gene with protein product		612985					Standard	NM_024336		Approved	IRX-1	uc002eht.1	P78415	OTTHUMG00000133200	ENST00000329734.3:c.1265T>C	16.37:g.54318528A>G	ENSP00000331608:p.Leu422Pro	0	0		11	11	NM_024336	0	0	0	0	0	Q7Z4A4|Q7Z4A5|Q8IVC6	Missense_Mutation	SNP	ENST00000329734.3	37	CCDS10750.1	2108	0.9652014652014652	433	0.8800813008130082	354	0.9779005524861878	567	0.9912587412587412	754	0.9947229551451188	g	5.642	0.303067	0.10678	0.942697	0.999285	ENSG00000177508	ENST00000329734	T	0.54279	0.58	4.4	2.45	0.29901	.	0.652897	0.14990	N	0.286760	T	0.00012	0.0000	N	0.01352	-0.895	0.29914	P	0.82336	B	0.02656	0.0	B	0.01281	0.0	T	0.21861	-1.0233	9	0.33940	T	0.23	-4.0049	5.143	0.14969	0.1733:0.0:0.6627:0.164	rs1450355;rs17852160;rs60836119	422	P78415	IRX3_HUMAN	P	422	ENSP00000331608:L422P	ENSP00000331608:L422P	L	-	2	0	IRX3	52876029	1.000000	0.71417	0.984000	0.44739	0.000000	0.00434	1.455000	0.35190	0.155000	0.19261	-1.528000	0.00924	CTG	T|0.035;G|0.004		0.776	IRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256910.2		
ZFHX3	463	broad.mit.edu	37	16	72821594	72821602	+	In_Frame_Del	DEL	GCCGCCGCC	GCCGCCGCC	-			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:72821594_72821602delGCCGCCGCC	ENST00000268489.5	-	10	11245_11253	c.10573_10581delGGCGGCGGC	c.(10573-10581)ggcggcggcdel	p.GGG3525del	AC004943.1_ENST00000584072.1_RNA|ZFHX3_ENST00000397992.5_In_Frame_Del_p.GGG2611del|RP5-991G20.1_ENST00000563328.2_RNA|RP5-991G20.4_ENST00000569195.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3525	Poly-Gly.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				AGTGGTACGAgccgccgccgccgccgccg	0.689																																					p.3525_3527del		.											.	ZFHX3-72	0			c.10573_10581del						.																																			SO:0001651	inframe_deletion	463	exon10			GTACGAGCCGCCG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.10573_10581delGGCGGCGGC	16.37:g.72821603_72821611delGCCGCCGCC	ENSP00000268489:p.Gly3525_Gly3527del	27	0		56	19	NM_006885	0	0	0	0	0	D3DWS8|O15101|Q13719	In_Frame_Del	DEL	ENST00000268489.5	37	CCDS10908.1																																																																																			.		0.689	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269008.1	NM_006885	
ADAD2	161931	hgsc.bcm.edu	37	16	84224967	84224967	+	Missense_Mutation	SNP	G	G	A	rs8044695|rs554488585	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:84224967G>A	ENST00000315906.5	+	1	183	c.131G>A	c.(130-132)gGg>gAg	p.G44E	RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|ADAD2_ENST00000567413.1_3'UTR|ADAD2_ENST00000268624.3_Missense_Mutation_p.G44E	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	44			G -> E (in dbSNP:rs8044695). {ECO:0000269|PubMed:14702039, ECO:0000269|Ref.3}.		RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						AGTGCCTgggggcccgcgccc	0.751														3435	0.685903	0.8616	0.6686	5008	,	,		11640	0.6677		0.6471	False		,,,				2504	0.5194				p.G44E		.											.	ADAD2-68	0			c.G131A						.	A	GLU/GLY,GLU/GLY	3145,519		1356,433,43	5.0	7.0	7.0		131,131	-1.1	0.0	16	dbSNP_116	7	5102,2224		1808,1486,369	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	98,98	3164,1919,412	AA,AG,GG		30.3576,14.1648,24.9591	benign,benign	44/584,44/666	84224967	8247,2743	1832	3663	5495	SO:0001583	missense	161931	exon1			CCTGGGGGCCCGC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.131G>A	16.37:g.84224967G>A	ENSP00000325153:p.Gly44Glu	0	0		21	20	NM_001145400	0	0	0	0	0	B2RCL6|Q8NA94	Missense_Mutation	SNP	ENST00000315906.5	37	CCDS45536.1	1545	0.7074175824175825	420	0.8536585365853658	227	0.6270718232044199	403	0.7045454545454546	495	0.6530343007915568	A	0.689	-0.795256	0.02862	0.858352	0.696424	ENSG00000140955	ENST00000315906;ENST00000268624	T;T	0.16196	2.36;2.47	3.61	-1.07	0.09968	.	1.276770	0.06034	N	0.653713	T	0.00012	0.0000	N	0.01874	-0.695	0.80722	P	0.0	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.30297	-0.9983	9	0.02654	T	1	-5.6132	8.9029	0.35505	0.4397:0.0:0.5603:0.0	rs8044695;rs57310648	44;44	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	E	44	ENSP00000325153:G44E;ENSP00000268624:G44E	ENSP00000268624:G44E	G	+	2	0	ADAD2	82782468	0.057000	0.20700	0.000000	0.03702	0.002000	0.02628	-0.069000	0.11542	-0.575000	0.05982	-1.305000	0.01319	GGG	G|0.292;A|0.708		0.751	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433385.1	NM_139174	
ZFPM1	161882	hgsc.bcm.edu	37	16	88599696	88599697	+	Frame_Shift_Del	DEL	GA	GA	-	rs368520732|rs67712719	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:88599696_88599697delGA	ENST00000319555.3	+	10	1652_1653	c.1330_1331delGA	c.(1330-1332)gagfs	p.E444fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGCCAGAGCGGAGCCTCTGGCC	0.743														4881	0.974641	0.9138	0.9914	5008	,	,		7261	0.996		1.0	False		,,,				2504	0.9969				p.444_444del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1330_1331del						.			2219,383		1063,93,145						-6.5	0.0		dbSNP_130	3	4709,133		2339,31,51	no	frameshift	ZFPM1	NM_153813.2		3402,124,196	A1A1,A1R,RR		2.7468,14.7194,6.9318				6928,516				SO:0001589	frameshift_variant	161882	exon10			AGAGCGGAGCCTC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1330_1331delGA	16.37:g.88599696_88599697delGA	ENSP00000326630:p.Glu444fs	0	0		23	16	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.743	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599697	88599705	+	In_Frame_Del	DEL	AGCCTCTGG	AGCCTCTGG	-	rs67873604|rs149145771|rs368520732|rs67322929|rs201915453|rs67712719	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	AGCCTCTGG	AGCCTCTGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:88599697_88599705delAGCCTCTGG	ENST00000319555.3	+	10	1653_1661	c.1331_1339delAGCCTCTGG	c.(1330-1341)gagcctctggcc>gcc	p.EPL444del	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	444				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCCAGAGCGGAGCCTCTGGCCCAGAATGG	0.746																																					p.444_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1331_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			GAGCGGAGCCTCT	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1331_1339delAGCCTCTGG	16.37:g.88599697_88599705delAGCCTCTGG	ENSP00000326630:p.Glu444_Leu446del	0	0		23	0	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599701	88599701	+	Frame_Shift_Del	DEL	T	T	-	rs67322929|rs149145771	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:88599701delT	ENST00000319555.3	+	10	1657	c.1335delT	c.(1333-1335)cctfs	p.P445fs	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	445				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GAGCGGAGCCTCTGGCCCAGA	0.746													-|T|-|insertion	4871	0.972644	0.9145	0.9899	5008	,	,		7405	0.995		0.994	False		,,,				2504	0.9939				p.P445fs	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1335delT						.						1.0	1.0	1.0					16																	88599701		392	657	1049	SO:0001589	frameshift_variant	161882	exon10			GGAGCCTCTGGCC	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1335delT	16.37:g.88599701delT	ENSP00000326630:p.Pro445fs	0	0		19	16	NM_153813	0	0	0	0	0		Frame_Shift_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.746	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
ZFPM1	161882	hgsc.bcm.edu	37	16	88599703	88599705	+	In_Frame_Del	DEL	TGG	TGG	-	rs149145771|rs67873604	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	TGG	TGG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr16:88599703_88599705delTGG	ENST00000319555.3	+	10	1659_1661	c.1337_1339delTGG	c.(1336-1341)ctggcc>ccc	p.446_447LA>P	RP11-21B21.4_ENST00000563243.1_RNA	NM_153813.2	NP_722520.2	Q8IX07	FOG1_HUMAN	zinc finger protein, FOG family member 1	446				EPLA -> AP (in Ref. 1; AAN45858). {ECO:0000305}.	atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|cardiac muscle tissue morphogenesis (GO:0055008)|definitive erythrocyte differentiation (GO:0060318)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|mitral valve formation (GO:0003192)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of interleukin-4 biosynthetic process (GO:0045403)|negative regulation of mast cell differentiation (GO:0060377)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract morphogenesis (GO:0003151)|platelet formation (GO:0030220)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|primitive erythrocyte differentiation (GO:0060319)|regulation of chemokine production (GO:0032642)|regulation of definitive erythrocyte differentiation (GO:0010724)|T-helper cell lineage commitment (GO:0002295)|transcriptional activation by promoter-enhancer looping (GO:0071733)|tricuspid valve formation (GO:0003195)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)			central_nervous_system(1)|ovary(2)|urinary_tract(1)	4				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GCGGAGCCTCTGGCCCAGAATGG	0.739														4871	0.972644	0.9145	0.9899	5008	,	,		7191	0.995		0.994	False		,,,				2504	0.9939				p.446_447del	Pancreas(49;850 1106 29641 32847 38344)	.											.	ZFPM1-90	0			c.1337_1339del						.																																			SO:0001651	inframe_deletion	161882	exon10			AGCCTCTGGCCCA	AF488691	CCDS32502.1	16q24.2	2013-01-10	2012-11-27		ENSG00000179588	ENSG00000179588		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	19762	protein-coding gene	gene with protein product		601950	"""zinc finger protein, multitype 1"""				Standard	NM_153813		Approved	FOG1, FOG, ZNF89A, ZC2HC11A	uc002fkv.3	Q8IX07	OTTHUMG00000173152	ENST00000319555.3:c.1337_1339delTGG	16.37:g.88599703_88599705delTGG	ENSP00000326630:p.Leu446_Ala447delinsPro	0	0		17	16	NM_153813	0	0	0	0	0		In_Frame_Del	DEL	ENST00000319555.3	37	CCDS32502.1																																																																																			.		0.739	ZFPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422270.2		
RAP1GAP2	23108	bcgsc.ca	37	17	2929674	2929674	+	Silent	SNP	T	T	C	rs12941934	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr17:2929674T>C	ENST00000254695.8	+	21	1986	c.1896T>C	c.(1894-1896)cgT>cgC	p.R632R	RAP1GAP2_ENST00000540393.2_Silent_p.R613R|RAP1GAP2_ENST00000542807.1_Silent_p.R632R|RAP1GAP2_ENST00000366401.4_Silent_p.R617R	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	632	Ser-rich.				negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)	p.R632R(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						AAAACGGCCGTGCCATCTCCC	0.672													C|||	2914	0.581869	0.4312	0.6744	5008	,	,		16616	0.6429		0.5606	False		,,,				2504	0.6789				p.R632R		.											.	RAP1GAP2-1	2	Substitution - coding silent(2)	haematopoietic_and_lymphoid_tissue(2)	c.T1896C						.	C	,	1939,2059		530,879,590	15.0	18.0	17.0		1851,1896	-9.8	0.3	17	dbSNP_121	17	4907,3181		1615,1677,752	no	coding-synonymous,coding-synonymous	RAP1GAP2	NM_001100398.1,NM_015085.4	,	2145,2556,1342	CC,CT,TT		39.3299,48.4992,43.3559	,	617/716,632/731	2929674	6846,5240	1999	4044	6043	SO:0001819	synonymous_variant	23108	exon21			CGGCCGTGCCATC	AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.1896T>C	17.37:g.2929674T>C		209	3		184	7	NM_015085	0	0	0	0	0	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Silent	SNP	ENST00000254695.8	37	CCDS45573.1																																																																																			T|0.420;C|0.580		0.672	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2		
PLD2	5338	broad.mit.edu	37	17	4711145	4711145	+	Missense_Mutation	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr17:4711145G>T	ENST00000263088.6	+	2	209	c.78G>T	c.(76-78)gaG>gaT	p.E26D	PLD2_ENST00000572940.1_Missense_Mutation_p.E26D|RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	26					cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	AGTCCGATGAGGTGGACACCC	0.632																																					p.E26D		.											.	PLD2-291	0			c.G78T						.						58.0	56.0	57.0					17																	4711145		2203	4300	6503	SO:0001583	missense	5338	exon2			CGATGAGGTGGAC	AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.78G>T	17.37:g.4711145G>T	ENSP00000263088:p.Glu26Asp	74	0		75	4	NM_001243108	0	0	0	0	0	I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	ENST00000263088.6	37	CCDS11057.1	.	.	.	.	.	.	.	.	.	.	G	17.86	3.493097	0.64186	.	.	ENSG00000129219	ENST00000263088	T	0.07688	3.17	5.1	-1.78	0.07957	.	0.000000	0.44902	D	0.000414	T	0.05135	0.0137	L	0.29908	0.895	0.26184	N	0.979686	B;B	0.31153	0.002;0.31	B;B	0.25614	0.023;0.062	T	0.31998	-0.9923	10	0.37606	T	0.19	-24.0482	9.9645	0.41717	0.4169:0.0:0.5831:0.0	.	26;26	O14939-2;O14939	.;PLD2_HUMAN	D	26	ENSP00000263088:E26D	ENSP00000263088:E26D	E	+	3	2	PLD2	4658109	0.979000	0.34478	0.976000	0.42696	0.961000	0.63080	0.172000	0.16704	-0.268000	0.09312	0.563000	0.77884	GAG	.		0.632	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207561.3	NM_002663	
FLII	2314	bcgsc.ca	37	17	18148485	18148485	+	Silent	SNP	G	G	A	rs7498	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr17:18148485G>A	ENST00000327031.4	-	30	4002	c.3777C>T	c.(3775-3777)caC>caT	p.H1259H	FLII_ENST00000379450.4_Silent_p.H1173H|FLII_ENST00000579294.1_Silent_p.H1248H|FLII_ENST00000578558.1_Missense_Mutation_p.T669M|FLII_ENST00000545457.2_Silent_p.H1204H	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	1259					multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					CGCTCCAGGCGTGGAAGCAGC	0.627													A|||	1280	0.255591	0.2882	0.2622	5008	,	,		18123	0.3204		0.2435	False		,,,				2504	0.1524				p.H1259H		.											.	FLII-91	0			c.C3777T						.	A		1213,3193	699.9+/-406.5	168,877,1158	85.0	93.0	90.0		3777	-7.1	0.6	17	dbSNP_52	90	2167,6433	706.2+/-405.5	271,1625,2404	no	coding-synonymous	FLII	NM_002018.2		439,2502,3562	AA,AG,GG		25.1977,27.5306,25.988		1259/1270	18148485	3380,9626	2203	4300	6503	SO:0001819	synonymous_variant	2314	exon30			CCAGGCGTGGAAG	U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.3777C>T	17.37:g.18148485G>A		150	0		159	6	NM_002018	0	0	112	112	0	B4DIL0|F5H407|J3QLG3	Silent	SNP	ENST00000327031.4	37	CCDS11192.1																																																																																			G|0.728;A|0.272		0.627	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132032.2	NM_002018	
KRT34	3885	bcgsc.ca	37	17	39535859	39535859	+	Missense_Mutation	SNP	A	A	G	rs2239710	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr17:39535859A>G	ENST00000394001.1	-	4	869	c.839T>C	c.(838-840)aTt>aCt	p.I280T		NM_021013.3	NP_066293.2	O76011	KRT34_HUMAN	keratin 34	280	Coil 2.|Rod.		I -> T (in dbSNP:rs2239710). {ECO:0000269|PubMed:15489334}.		epidermis development (GO:0008544)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Breast(137;0.000496)				CCTGCGGTTAATTTCCACCAG	0.612													g|||	3729	0.744609	0.9682	0.6744	5008	,	,		21248	0.5873		0.6451	False		,,,				2504	0.7566				p.I280T		.											.	KRT34-90	0			c.T839C						.	G	THR/ILE	4020,386	193.0+/-218.2	1838,344,21	127.0	99.0	108.0		839	3.6	1.0	17	dbSNP_98	108	5599,3001	464.4+/-366.2	1811,1977,512	no	missense	KRT34	NM_021013.3	89	3649,2321,533	GG,GA,AA		34.8953,8.7608,26.0418	benign	280/437	39535859	9619,3387	2203	4300	6503	SO:0001583	missense	3885	exon4			CGGTTAATTTCCA	Y16790	CCDS11390.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000131737	ENSG00000131737		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6452	protein-coding gene	gene with protein product	"""hard keratin type I 4"""	602763	"""keratin, hair, acidic, 4"""	KRTHA4		2431943, 9756910, 16831889	Standard	NM_021013		Approved	Ha-4	uc002hwm.3	O76011	OTTHUMG00000133436	ENST00000394001.1:c.839T>C	17.37:g.39535859A>G	ENSP00000377570:p.Ile280Thr	163	1		147	7	NM_021013	0	0	0	0	0	Q8IUT8|Q8N4W2	Missense_Mutation	SNP	ENST00000394001.1	37	CCDS11390.1	1567	0.7174908424908425	469	0.9532520325203252	255	0.7044198895027625	346	0.6048951048951049	497	0.6556728232189973	g	0.012	-1.679480	0.00751	0.912392	0.651047	ENSG00000131737	ENST00000394001;ENST00000251648	.	.	.	4.6	3.56	0.40772	Filament (1);	0.093789	0.47093	N	0.000259	T	0.00012	0.0000	N	0.00110	-2.1	0.48040	P	4.229999999999512E-4	B	0.02656	0.0	B	0.01281	0.0	T	0.35674	-0.9779	8	0.02654	T	1	.	7.2738	0.26273	0.0953:0.0:0.6346:0.2701	rs2239710;rs16966705;rs17846298;rs17859323;rs61572775;rs2239710	280	O76011	KRT34_HUMAN	T	238;280	.	ENSP00000251648:I280T	I	-	2	0	KRT34	36789385	1.000000	0.71417	1.000000	0.80357	0.206000	0.24218	2.515000	0.45512	1.064000	0.40671	-0.176000	0.13171	ATT	A|0.261;G|0.739		0.612	KRT34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257304.3	NM_021013	
SPATA32	124783	ucsc.edu;bcgsc.ca	37	17	43333125	43333125	+	Missense_Mutation	SNP	C	C	T	rs11651968	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr17:43333125C>T	ENST00000331780.4	-	4	519	c.424G>A	c.(424-426)Gtg>Atg	p.V142M	MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|SPATA32_ENST00000543122.1_Missense_Mutation_p.V121M|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA	NM_152343.2	NP_689556.2	Q96LK8	SPT32_HUMAN	spermatogenesis associated 32	142			V -> M (in dbSNP:rs11651968). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.2}.		spermatogenesis (GO:0007283)	perinuclear region of cytoplasm (GO:0048471)											CAGGCAGACACGTGGTTCTCC	0.587													C|||	1558	0.311102	0.1104	0.4294	5008	,	,		17541	0.3046		0.4245	False		,,,				2504	0.3885				p.V142M		.											.	.	0			c.G424A						.	C	MET/VAL	671,3735	285.5+/-278.2	47,577,1579	101.0	93.0	96.0		424	-3.8	0.0	17	dbSNP_120	96	3960,4640	550.7+/-385.8	917,2126,1257	yes	missense	C17orf46	NM_152343.2	21	964,2703,2836	TT,TC,CC		46.0465,15.2292,35.6066	possibly-damaging	142/385	43333125	4631,8375	2203	4300	6503	SO:0001583	missense	124783	exon4			CAGACACGTGGTT	AK058143	CCDS32669.1	17q21.31	2013-10-11	2012-10-08	2012-10-08	ENSG00000184361	ENSG00000184361			26349	protein-coding gene	gene with protein product	"""acrosome expressed 2"""		"""chromosome 17 open reading frame 46"", ""testis expressed 34"""	C17orf46, TEX34		18621766	Standard	NM_152343		Approved	FLJ25414, AEP2, VAD1.2	uc002iis.1	Q96LK8	OTTHUMG00000180363	ENST00000331780.4:c.424G>A	17.37:g.43333125C>T	ENSP00000331532:p.Val142Met	94	1		47	5	NM_152343	0	0	0	0	0	Q7Z4U1|Q8N6V6	Missense_Mutation	SNP	ENST00000331780.4	37	CCDS32669.1	723	0.33104395604395603	67	0.13617886178861788	148	0.4088397790055249	188	0.32867132867132864	320	0.42216358839050133	C	12.47	1.946359	0.34377	0.152292	0.460465	ENSG00000184361	ENST00000331780;ENST00000543122	T;T	0.53857	0.6;0.6	3.9	-3.82	0.04281	.	1.610090	0.03935	N	0.285979	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P	0.47350	0.894	B	0.37346	0.247	T	0.20840	-1.0263	9	0.35671	T	0.21	1.1262	5.3052	0.15799	0.0:0.275:0.1646:0.5604	rs11651968;rs17845838;rs17858807;rs58610600;rs11651968	142	Q96LK8	CQ046_HUMAN	M	142;121	ENSP00000331532:V142M;ENSP00000442724:V121M	ENSP00000331532:V142M	V	-	1	0	C17orf46	40688908	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-2.742000	0.00798	-0.575000	0.05982	0.555000	0.69702	GTG	C|0.650;G|0.000;T|0.350		0.587	SPATA32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450946.1	NM_152343	
SLC26A11	284129	broad.mit.edu;bcgsc.ca	37	17	78220405	78220405	+	Silent	SNP	G	G	T	rs137973400		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr17:78220405G>T	ENST00000361193.3	+	13	1531	c.1251G>T	c.(1249-1251)ccG>ccT	p.P417P	SLC26A11_ENST00000411502.3_Silent_p.P417P|SLC26A11_ENST00000572725.1_Silent_p.P417P|SLC26A11_ENST00000546047.2_Silent_p.P417P	NM_001166347.1|NM_173626.3	NP_001159819.1|NP_775897.3			solute carrier family 26 (anion exchanger), member 11											central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	28	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			CCGTGGCCCCGCTGTTCGACA	0.587													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18895	0.0		0.0	False		,,,				2504	0.0				p.P417P		.											.	SLC26A11-90	0			c.G1251T						.	G	,,,	0,4406		0,0,2203	115.0	73.0	87.0		1251,1251,1251,1251	-6.2	0.5	17	dbSNP_134	87	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SLC26A11	NM_001166347.1,NM_001166348.1,NM_001166349.1,NM_173626.3	,,,	0,3,6500	TT,TG,GG		0.0349,0.0,0.0231	,,,	417/607,417/607,417/607,417/607	78220405	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	284129	exon13			GGCCCCGCTGTTC		CCDS11771.2	17q25	2013-07-18	2013-07-18		ENSG00000181045	ENSG00000181045		"""Solute carriers"""	14471	protein-coding gene	gene with protein product		610117	"""solute carrier family 26, member 11"""				Standard	NM_001166347		Approved		uc010dhv.2	Q86WA9	OTTHUMG00000133419	ENST00000361193.3:c.1251G>T	17.37:g.78220405G>T		155	2		116	6	NM_173626	0	0	24	24	0		Silent	SNP	ENST00000361193.3	37	CCDS11771.2																																																																																			G|1.000;T|0.000		0.587	SLC26A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257281.1		
MOCOS	55034	hgsc.bcm.edu	37	18	33767568	33767568	+	Missense_Mutation	SNP	C	C	A	rs113873219	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr18:33767568C>A	ENST00000261326.5	+	1	87	c.66C>A	c.(64-66)agC>agA	p.S22R	RP11-49I11.1_ENST00000568654.1_RNA	NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GGGACCCGAGCGCACCGCGGC	0.786													C|||	232	0.0463259	0.0204	0.0778	5008	,	,		10186	0.0069		0.1103	False		,,,				2504	0.0337				p.S22R		.											.	MOCOS-91	0			c.C66A						.	C	ARG/SER	76,3392		0,76,1658	3.0	4.0	4.0		66	2.0	0.0	18	dbSNP_132	4	538,6436		17,504,2966	no	missense	MOCOS	NM_017947.2	110	17,580,4624	AA,AC,CC		7.7144,2.1915,5.8801	possibly-damaging	22/889	33767568	614,9828	1734	3487	5221	SO:0001583	missense	55034	exon1			CCCGAGCGCACCG	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.66C>A	18.37:g.33767568C>A	ENSP00000261326:p.Ser22Arg	0	0		14	14	NM_017947	0	0	0	18	18		Missense_Mutation	SNP	ENST00000261326.5	37	CCDS11919.1	123	0.05631868131868132	13	0.026422764227642278	30	0.08287292817679558	4	0.006993006993006993	76	0.10026385224274406	C	18.52	3.641158	0.67244	0.021915	0.077144	ENSG00000075643	ENST00000261326	T	0.14766	2.48	3.83	2.05	0.26809	.	0.527792	0.19351	N	0.116394	T	0.00241	0.0007	N	0.08118	0	0.80722	P	0.0	D	0.54397	0.966	P	0.50860	0.652	T	0.27839	-1.0062	9	0.20046	T	0.44	-8.4772	6.078	0.19925	0.0:0.7664:0.0:0.2336	.	22	Q96EN8	MOCOS_HUMAN	R	22	ENSP00000261326:S22R	ENSP00000261326:S22R	S	+	3	2	MOCOS	32021566	0.000000	0.05858	0.005000	0.12908	0.167000	0.22549	-0.697000	0.05098	0.586000	0.29626	0.491000	0.48974	AGC	C|0.943;A|0.057		0.786	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
DSEL	92126	broad.mit.edu	37	18	65180328	65180328	+	Silent	SNP	T	T	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr18:65180328T>G	ENST00000310045.7	-	2	3021	c.1548A>C	c.(1546-1548)tcA>tcC	p.S516S	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	506					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GGCTTGAGGGTGATGGAGCAA	0.488																																					p.S516S		.											.	DSEL-157	0			c.A1548C						.						78.0	69.0	72.0					18																	65180328		2203	4300	6503	SO:0001819	synonymous_variant	92126	exon2			TGAGGGTGATGGA	AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1548A>C	18.37:g.65180328T>G		76	0		46	7	NM_032160	0	0	2	2	0	Q17RH1|Q6P5Z3	Silent	SNP	ENST00000310045.7	37	CCDS11995.1																																																																																			.		0.488	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256221.1	NM_032160	
ATP9B	374868	hgsc.bcm.edu	37	18	76829525	76829525	+	Missense_Mutation	SNP	A	A	G	rs4078115	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr18:76829525A>G	ENST00000426216.2	+	1	132	c.115A>G	c.(115-117)Agc>Ggc	p.S39G	ATP9B_ENST00000458297.2_5'UTR|ATP9B_ENST00000591464.1_3'UTR|ATP9B_ENST00000586722.1_Missense_Mutation_p.S39G|ATP9B_ENST00000307671.7_Missense_Mutation_p.S39G	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	39			S -> G (in dbSNP:rs4078115). {ECO:0000269|PubMed:15489334}.		establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		CGACCGGCACAGCAGGTAACC	0.771													a|||	1574	0.314297	0.2277	0.2046	5008	,	,		9814	0.4494		0.2565	False		,,,				2504	0.4294				p.S39G		.											.	ATP9B-93	0			c.A115G						.		GLY/SER	504,2920		44,416,1252	3.0	4.0	4.0		115	-0.3	1.0	18	dbSNP_108	4	1215,5401		129,957,2222	no	missense	ATP9B	NM_198531.3	56	173,1373,3474	GG,GA,AA		18.3646,14.7196,17.1215	benign	39/1148	76829525	1719,8321	1712	3308	5020	SO:0001583	missense	374868	exon1			CGGCACAGCAGGT	R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.115A>G	18.37:g.76829525A>G	ENSP00000398076:p.Ser39Gly	0	0		6	6	NM_198531	0	0	0	0	0	O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	ENST00000426216.2	37	CCDS12014.1	670	0.3067765567765568	104	0.21138211382113822	83	0.2292817679558011	281	0.49125874125874125	202	0.26649076517150394	a	7.584	0.669300	0.14776	0.147196	0.183646	ENSG00000166377	ENST00000426216;ENST00000307671	T;T	0.56103	0.48;0.48	2.56	-0.308	0.12773	.	1.710450	0.03865	N	0.274617	T	0.00012	0.0000	N	0.03608	-0.345	0.09310	P	0.99999999821082	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.41016	-0.9532	9	0.23302	T	0.38	.	4.8264	0.13417	0.5235:0.0:0.4765:0.0	rs4078115;rs4327119	39;39;39	O43861;O43861-2;B4DJ94	ATP9B_HUMAN;.;.	G	39	ENSP00000398076:S39G;ENSP00000304500:S39G	ENSP00000304500:S39G	S	+	1	0	ATP9B	74930513	1.000000	0.71417	0.996000	0.52242	0.256000	0.26092	1.165000	0.31822	-0.197000	0.10350	-0.465000	0.05216	AGC	A|0.693;G|0.307		0.771	ATP9B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256402.3	NM_198531	
ABCA7	10347	hgsc.bcm.edu	37	19	1065044	1065044	+	Silent	SNP	C	C	T	rs4147935	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:1065044C>T	ENST00000263094.6	+	46	6390	c.6159C>T	c.(6157-6159)ggC>ggT	p.G2053G	HMHA1_ENST00000590214.1_5'Flank|HMHA1_ENST00000536472.1_5'Flank|HMHA1_ENST00000539243.2_5'Flank|HMHA1_ENST00000313093.2_5'Flank|ABCA7_ENST00000433129.1_Silent_p.G2053G|HMHA1_ENST00000586866.1_5'Flank|ABCA7_ENST00000435683.2_Silent_p.G1915G	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	2053					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACATGGAGGCCGCCTGCGCT	0.736																																					p.G2053G		.											.	ABCA7-98	0			c.C6159T						.	C		327,3757		20,287,1735	5.0	6.0	6.0		6159	1.5	0.8	19	dbSNP_110	6	2858,5242		553,1752,1745	no	coding-synonymous	ABCA7	NM_019112.3		573,2039,3480	TT,TC,CC		35.284,8.0069,26.1408		2053/2147	1065044	3185,8999	2042	4050	6092	SO:0001819	synonymous_variant	10347	exon46			TGGAGGCCGCCTG	AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.6159C>T	19.37:g.1065044C>T		0	0		17	16	NM_019112	0	0	0	1	1	Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Silent	SNP	ENST00000263094.6	37	CCDS12055.1																																																																																			C|0.766;T|0.234		0.736	ABCA7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394993.1	NM_019112	
C19orf71	100128569	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	3543552	3543552	+	Splice_Site	SNP	G	G	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:3543552G>C	ENST00000329493.5	+	3	346		c.e3-1		MFSD12_ENST00000398558.4_Intron|MFSD12_ENST00000389395.3_Intron|AC005786.7_ENST00000589360.1_RNA	NM_001135580.1	NP_001129052.1	A6NCJ1	CS071_HUMAN	chromosome 19 open reading frame 71											endometrium(2)	2						CCCCACCGCAGCCTACACCCA	0.726																																					.		.											.	.	0			c.323-1G>C						.						37.0	59.0	53.0					19																	3543552		692	1590	2282	SO:0001630	splice_region_variant	100128569	exon3			ACCGCAGCCTACA		CCDS45918.1	19p13.3	2012-10-26			ENSG00000183397	ENSG00000183397			34496	protein-coding gene	gene with protein product							Standard	NM_001135580		Approved	LOC100128569	uc010xhm.2	A6NCJ1		ENST00000329493.5:c.323-1G>C	19.37:g.3543552G>C		18	0		74	21	NM_001135580	0	0	0	0	0		Splice_Site	SNP	ENST00000329493.5	37	CCDS45918.1	.	.	.	.	.	.	.	.	.	.	G	9.391	1.075598	0.20227	.	.	ENSG00000183397	ENST00000329493	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6951	0.56999	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C19orf71	3494552	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	3.711000	0.54868	2.044000	0.60594	0.313000	0.20887	.	.		0.726	C19orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452943.1	NM_001135580	Intron
ZNF414	84330	hgsc.bcm.edu	37	19	8576670	8576670	+	Silent	SNP	C	C	T	rs7175	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:8576670C>T	ENST00000255616.8	-	5	806	c.705G>A	c.(703-705)ccG>ccA	p.P235P	ZNF414_ENST00000393927.4_Silent_p.P235P	NM_032370.2	NP_115746.2	Q96IQ9	ZN414_HUMAN	zinc finger protein 414	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(2)	2						GCAGCGGGAACGGCAGGCCCG	0.771													C|||	1010	0.201677	0.2897	0.1686	5008	,	,		8403	0.1746		0.1988	False		,,,				2504	0.137				p.P235P		.											.	ZNF414-90	0			c.G705A						.	C	,	887,3039		132,623,1208	4.0	6.0	5.0		705,705	-2.0	0.0	19	dbSNP_52	5	1238,6388		127,984,2702	no	coding-synonymous,coding-synonymous	ZNF414	NM_001146175.1,NM_032370.2	,	259,1607,3910	TT,TC,CC		16.2339,22.593,18.3951	,	235/391,235/313	8576670	2125,9427	1963	3813	5776	SO:0001819	synonymous_variant	84330	exon5			CGGGAACGGCAGG	AK074191	CCDS12205.1, CCDS54211.1	19p13.2	2008-02-05				ENSG00000133250		"""Zinc fingers, C2H2-type"""	20630	protein-coding gene	gene with protein product							Standard	NM_032370		Approved	MGC15716, Zfp414	uc002mke.4	Q96IQ9		ENST00000255616.8:c.705G>A	19.37:g.8576670C>T		1	0		34	24	NM_032370	0	0	2	7	5	A8MY94	Silent	SNP	ENST00000255616.8	37	CCDS12205.1																																																																																			C|0.788;T|0.212		0.771	ZNF414-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000460199.2	NM_032370	
KEAP1	9817	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	10610253	10610253	+	Missense_Mutation	SNP	G	G	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:10610253G>C	ENST00000171111.5	-	2	1004	c.457C>G	c.(457-459)Ctc>Gtc	p.L153V	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.L153V	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	153					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	ATGACGTGGAGGACACACTTC	0.582																																					p.L153V		.											.	KEAP1-637	0			c.C457G						.						185.0	145.0	158.0					19																	10610253		2203	4300	6503	SO:0001583	missense	9817	exon2			CGTGGAGGACACA	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.457C>G	19.37:g.10610253G>C	ENSP00000171111:p.Leu153Val	277	1		487	104	NM_012289	0	0	50	52	2	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	37	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892823	0.33442	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.66099	-0.19;-0.19	4.68	2.54	0.30619	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.210307	0.39834	N	0.001258	T	0.57548	0.2061	L	0.42632	1.34	0.34793	D	0.735918	P	0.42993	0.797	P	0.51918	0.684	T	0.62158	-0.6913	10	0.33940	T	0.23	.	3.6398	0.08162	0.207:0.0:0.5958:0.1972	.	153	Q14145	KEAP1_HUMAN	V	153	ENSP00000171111:L153V;ENSP00000377245:L153V	ENSP00000171111:L153V	L	-	1	0	KEAP1	10471253	0.970000	0.33590	0.992000	0.48379	0.364000	0.29643	1.897000	0.39799	0.966000	0.38159	0.462000	0.41574	CTC	.		0.582	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
SMARCA4	6597	hgsc.bcm.edu	37	19	11097222	11097222	+	Missense_Mutation	SNP	C	C	G	rs568390760	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:11097222C>G	ENST00000429416.3	+	5	994	c.713C>G	c.(712-714)cCc>cGc	p.P238R	SMARCA4_ENST00000589677.1_Missense_Mutation_p.P238R|SMARCA4_ENST00000358026.2_Missense_Mutation_p.P238R|SMARCA4_ENST00000413806.3_Missense_Mutation_p.P238R|SMARCA4_ENST00000590574.1_Missense_Mutation_p.P238R|SMARCA4_ENST00000450717.3_Missense_Mutation_p.P238R|SMARCA4_ENST00000541122.2_Missense_Mutation_p.P238R|SMARCA4_ENST00000444061.3_Missense_Mutation_p.P238R|SMARCA4_ENST00000344626.4_Missense_Mutation_p.P238R	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	238	Necessary for interaction with SS18L1/CREST. {ECO:0000250}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ggccctggccccggcccgggt	0.697			"""F, N, Mis"""		NSCLC																																p.P238R		.		Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	.	SMARCA4-1523	1	Unknown(1)	lung(1)	c.C713G						.						3.0	3.0	3.0					19																	11097222		1777	3467	5244	SO:0001583	missense	6597	exon4			CTGGCCCCGGCCC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.713C>G	19.37:g.11097222C>G	ENSP00000395654:p.Pro238Arg	0	0		31	9	NM_003072	0	0	8	8	0	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	ENST00000429416.3	37	CCDS12253.1	.	.	.	.	.	.	.	.	.	.	C	8.691	0.907538	0.17833	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.86956	-2.18;-2.17;-2.18;-2.19;-2.18;-2.16;-2.19	4.76	4.76	0.60689	.	0.237554	0.33235	N	0.005123	T	0.78368	0.4272	L	0.29908	0.895	0.40002	D	0.975172	B;B;B;P;B;B;B	0.44578	0.346;0.346;0.346;0.838;0.346;0.346;0.346	B;B;B;B;B;B;B	0.35413	0.094;0.094;0.094;0.202;0.094;0.146;0.146	T	0.80281	-0.1448	10	0.36615	T	0.2	-12.1117	14.6953	0.69118	0.0:1.0:0.0:0.0	.	238;238;238;238;238;238;238	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	R	238	ENSP00000395654:P238R;ENSP00000350720:P238R;ENSP00000343896:P238R;ENSP00000445036:P238R;ENSP00000392837:P238R;ENSP00000397783:P238R;ENSP00000414727:P238R	ENSP00000343896:P238R	P	+	2	0	SMARCA4	10958222	1.000000	0.71417	0.909000	0.35828	0.230000	0.25150	3.941000	0.56607	2.195000	0.70347	0.462000	0.41574	CCC	.		0.697	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000452638.2	NM_003072	
MYO9B	4650	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17311225	17311225	+	Missense_Mutation	SNP	G	G	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:17311225G>C	ENST00000594824.1	+	25	4509	c.4362G>C	c.(4360-4362)aaG>aaC	p.K1454N	MYO9B_ENST00000397274.2_Missense_Mutation_p.K1454N|MYO9B_ENST00000595618.1_Missense_Mutation_p.K1454N			Q13459	MYO9B_HUMAN	myosin IXB	1454	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CCATGAAGAAGGGCCTGGAAG	0.577																																					p.K1454N		.											.	MYO9B-67	0			c.G4362C						.						23.0	29.0	27.0					19																	17311225		2033	4183	6216	SO:0001583	missense	4650	exon25			GAAGAAGGGCCTG		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4362G>C	19.37:g.17311225G>C	ENSP00000471367:p.Lys1454Asn	122	0		235	64	NM_001130065	0	0	0	0	0	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	37		.	.	.	.	.	.	.	.	.	.	G	13.65	2.300419	0.40694	.	.	ENSG00000099331	ENST00000397274	D	0.85088	-1.94	4.76	1.33	0.21861	.	0.230116	0.30410	N	0.009692	T	0.82015	0.4945	L	0.57536	1.79	0.09310	N	1	P;P;P;P	0.43352	0.704;0.804;0.704;0.704	B;P;B;B	0.45681	0.277;0.49;0.277;0.296	T	0.72107	-0.4390	10	0.42905	T	0.14	.	7.2232	0.25999	0.3008:0.0:0.6992:0.0	.	1454;1454;1454;1460	Q13459;Q13459-2;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.;.	N	1454	ENSP00000380444:K1454N	ENSP00000380444:K1454N	K	+	3	2	MYO9B	17172225	0.479000	0.25925	0.089000	0.20774	0.392000	0.30506	0.765000	0.26546	0.428000	0.26173	0.491000	0.48974	AAG	.		0.577	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
MAP1S	55201	hgsc.bcm.edu	37	19	17837425	17837425	+	Missense_Mutation	SNP	C	C	G	rs17710707	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:17837425C>G	ENST00000324096.4	+	5	1383	c.1232C>G	c.(1231-1233)tCt>tGt	p.S411C	MAP1S_ENST00000544059.2_Missense_Mutation_p.S385C|MAP1S_ENST00000597681.1_Intron|CTD-3149D2.4_ENST00000595363.1_RNA	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	411	Necessary for the microtubule-organizing center localization.		S -> C (in dbSNP:rs17710707). {ECO:0000269|PubMed:15489334}.		apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						ACGCTGGCCTCTGTGTGCGCC	0.731													C|||	574	0.114617	0.0832	0.1772	5008	,	,		12607	0.0169		0.2068	False		,,,				2504	0.1186				p.S411C		.											.	MAP1S-90	0			c.C1232G						.	C	CYS/SER	344,3714		17,310,1702	5.0	5.0	5.0		1232	2.6	0.2	19	dbSNP_123	5	1234,6710		91,1052,2829	no	missense	MAP1S	NM_018174.4	112	108,1362,4531	GG,GC,CC		15.5337,8.4771,13.1478	probably-damaging	411/1060	17837425	1578,10424	2029	3972	6001	SO:0001583	missense	55201	exon5			TGGCCTCTGTGTG	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1232C>G	19.37:g.17837425C>G	ENSP00000325313:p.Ser411Cys	1	0		45	10	NM_018174	0	0	10	12	2	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	37	CCDS32954.1	257	0.11767399267399267	34	0.06910569105691057	66	0.18232044198895028	7	0.012237762237762238	150	0.19788918205804748	C	15.12	2.738952	0.49045	0.084771	0.155337	ENSG00000130479	ENST00000324096;ENST00000544059	T;T	0.03801	3.8;3.8	3.67	2.61	0.31194	.	0.155772	0.30277	N	0.009981	T	0.00012	0.0000	M	0.79614	2.46	0.09310	P	0.99999454915	D;D	0.89917	1.0;1.0	D;D	0.80764	0.977;0.994	T	0.06006	-1.0851	9	0.87932	D	0	-16.5051	8.9574	0.35827	0.0:0.8847:0.0:0.1153	rs17710707	385;411	B4DH53;Q66K74	.;MAP1S_HUMAN	C	411;385	ENSP00000325313:S411C;ENSP00000439243:S385C	ENSP00000325313:S411C	S	+	2	0	MAP1S	17698425	0.998000	0.40836	0.209000	0.23619	0.382000	0.30200	7.628000	0.83189	0.516000	0.28340	-0.291000	0.09656	TCT	C|0.883;G|0.117		0.731	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
ZNF714	148206	hgsc.bcm.edu;broad.mit.edu	37	19	21300738	21300738	+	Missense_Mutation	SNP	T	T	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:21300738T>C	ENST00000596143.1	+	5	1593	c.1268T>C	c.(1267-1269)cTc>cCc	p.L423P	ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000601416.1_3'UTR|ZNF714_ENST00000596053.1_Intron	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	423					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						GGAGAGAAACTCTACAAATGT	0.368																																					p.L423P		.											.	ZNF714-67	0			c.T1268C						.						38.0	41.0	40.0					19																	21300738		2170	4287	6457	SO:0001583	missense	148206	exon5			AGAAACTCTACAA	AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.1268T>C	19.37:g.21300738T>C	ENSP00000472368:p.Leu423Pro	9	0		17	6	NM_182515	2	0	12	449	435	Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	ENST00000596143.1	37	CCDS54239.1	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.950278	0.00051	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	1.05	-2.11	0.07187	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05044	0.0135	N	0.00154	-1.97	0.19575	N	0.999962	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.001;0.002	T	0.24404	-1.0161	8	0.02654	T	1	.	7.1125	0.25399	0.0:0.6617:0.0:0.3383	.	424;423;424	Q96N38-2;A6NEM4;Q96N38	.;.;ZN714_HUMAN	P	423	.	ENSP00000291770:L423P	L	+	2	0	ZNF714	21092578	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.309000	0.19332	-1.683000	0.01444	-1.712000	0.00714	CTC	.		0.368	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1	NM_182515	
PRX	57716	ucsc.edu;bcgsc.ca	37	19	40903238	40903238	+	Missense_Mutation	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:40903238C>T	ENST00000324001.7	-	7	1291	c.1021G>A	c.(1021-1023)Ggt>Agt	p.G341S	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	341					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACCTCTGCACCCGGCAAGGCC	0.647																																					p.G341S		.											.	PRX-92	0			c.G1021A						.						20.0	23.0	22.0					19																	40903238		2175	4253	6428	SO:0001583	missense	57716	exon7			CTGCACCCGGCAA	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1021G>A	19.37:g.40903238C>T	ENSP00000326018:p.Gly341Ser	117	2		119	59	NM_181882	0	0	3	4	1	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	37	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	9.738	1.163969	0.21538	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.02787	4.16	4.56	2.38	0.29361	.	0.501907	0.18802	N	0.130754	T	0.06005	0.0156	L	0.33189	0.99	0.48975	D	0.999731	D	0.76494	0.999	D	0.71656	0.974	T	0.54741	-0.8248	10	0.15499	T	0.54	-9.5057	8.4957	0.33127	0.0:0.741:0.0:0.259	.	341	Q9BXM0	PRAX_HUMAN	S	341	ENSP00000326018:G341S	ENSP00000326018:G341S	G	-	1	0	PRX	45595078	0.000000	0.05858	0.044000	0.18714	0.076000	0.17211	0.272000	0.18644	1.138000	0.42230	-0.258000	0.10820	GGT	.		0.647	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
ERCC2	2068	hgsc.bcm.edu	37	19	45867259	45867259	+	Missense_Mutation	SNP	C	C	T	rs1799793	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:45867259C>T	ENST00000391945.4	-	10	1011	c.934G>A	c.(934-936)Gac>Aac	p.D312N	ERCC2_ENST00000391940.4_Missense_Mutation_p.D288N|ERCC2_ENST00000391944.3_Missense_Mutation_p.D234N|ERCC2_ENST00000221481.6_3'UTR|ERCC2_ENST00000485403.2_Missense_Mutation_p.D288N	NM_000400.3	NP_000391.1	P18074	ERCC2_HUMAN	excision repair cross-complementation group 2	312			D -> N (in dbSNP:rs1799793). {ECO:0000269|PubMed:11245433, ECO:0000269|PubMed:11470747, ECO:0000269|PubMed:11709541, ECO:0000269|Ref.3}.		7-methylguanosine mRNA capping (GO:0006370)|aging (GO:0007568)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|central nervous system myelin formation (GO:0032289)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|embryonic cleavage (GO:0040016)|erythrocyte maturation (GO:0043249)|extracellular matrix organization (GO:0030198)|gene expression (GO:0010467)|hair cell differentiation (GO:0035315)|hair follicle maturation (GO:0048820)|hematopoietic stem cell differentiation (GO:0060218)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision (GO:0033683)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|MMXD complex (GO:0071817)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		AGCACTTCGTCGGGCAGCACG	0.746			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum				C|||	974	0.194489	0.0734	0.1988	5008	,	,		10423	0.0496		0.3588	False		,,,				2504	0.3354				p.D312N		.	yes	Rec		Xeroderma pigmentosum (D)	19	19q13.2-q13.3	2068	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 (xeroderma pigmentosum D)"""		E	.	ERCC2-848	0			c.G934A	GRCh37	CM015299	ERCC2	M	rs1799793	.	C	ASN/ASP,ASN/ASP	387,3577		30,327,1625	5.0	8.0	7.0		934,862	5.2	0.5	19	dbSNP_89	7	2507,5397		444,1619,1889	no	missense,missense	ERCC2	NM_000400.3,NM_001130867.1	23,23	474,1946,3514	TT,TC,CC		31.7181,9.7629,24.3849	benign,benign	312/761,288/406	45867259	2894,8974	1982	3952	5934	SO:0001583	missense	2068	exon10	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	CTTCGTCGGGCAG		CCDS33049.1, CCDS46112.1	19q13.3	2014-09-17	2014-03-07		ENSG00000104884	ENSG00000104884	3.6.4.12	"""General transcription factor IIH complex subunits"""	3434	protein-coding gene	gene with protein product	"""excision repair cross-complementing rodent repair deficiency, complementation group 2 protein"", ""TFIIH basal transcription factor complex helicase XPB subunit"""	126340	"""xeroderma pigmentosum complementary group D"", ""excision repair cross-complementing rodent repair deficiency, complementation group 2"""	XPD		8413672, 2184031	Standard	NM_000400		Approved	MAG, EM9, MGC102762, MGC126218, MGC126219, TFIIH	uc002pbj.2	P18074	OTTHUMG00000048190	ENST00000391945.4:c.934G>A	19.37:g.45867259C>T	ENSP00000375809:p.Asp312Asn	0	0		25	12	NM_000400	0	0	10	13	3	Q2TB78|Q2YDY2|Q7KZU6|Q8N721	Missense_Mutation	SNP	ENST00000391945.4	37	CCDS33049.1	423	0.1936813186813187	34	0.06910569105691057	70	0.19337016574585636	38	0.06643356643356643	281	0.370712401055409	C	20.0	3.930510	0.73327	0.097629	0.317181	ENSG00000104884	ENST00000391941;ENST00000391942;ENST00000391945;ENST00000391944;ENST00000391940	T;T;T	0.64438	-0.1;-0.1;-0.1	5.15	5.15	0.70609	Domain of unknown function DUF1227 (1);	0.000000	0.85682	D	0.000000	T	0.00012	0.0000	L	0.46947	1.48	0.09310	P	1.0	B;P;B	0.34639	0.065;0.461;0.053	B;B;B	0.35353	0.059;0.201;0.051	T	0.28267	-1.0049	9	0.33940	T	0.23	-30.0006	16.1268	0.81402	0.0:1.0:0.0:0.0	rs1799793;rs3916814;rs58989209;rs1799793	234;288;312	E7EVE9;Q7KZU6;P18074	.;.;ERCC2_HUMAN	N	262;288;312;234;288	ENSP00000375809:D312N;ENSP00000375808:D234N;ENSP00000375804:D288N	ENSP00000375804:D288N	D	-	1	0	ERCC2	50559099	1.000000	0.71417	0.523000	0.27875	0.865000	0.49528	7.192000	0.77771	2.388000	0.81334	0.561000	0.74099	GAC	C|0.804;T|0.196		0.746	ERCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109626.2	NM_000400	
PPFIA3	8541	broad.mit.edu	37	19	49641586	49641586	+	Missense_Mutation	SNP	A	A	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:49641586A>C	ENST00000334186.4	+	16	2327	c.1978A>C	c.(1978-1980)Acc>Ccc	p.T660P	PPFIA3_ENST00000602351.1_Missense_Mutation_p.T660P	NM_003660.2	NP_003651.1	O75145	LIPA3_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3	660					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|presynaptic active zone (GO:0048786)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(16)|pancreas(1)|prostate(1)|skin(4)|urinary_tract(1)	35		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000203)|GBM - Glioblastoma multiforme(486;0.00307)|Epithelial(262;0.00677)		CCCCTCCCTCACCACCTCTAC	0.677																																					p.T660P		.											.	PPFIA3-226	0			c.A1978C						.						27.0	29.0	28.0					19																	49641586		2203	4299	6502	SO:0001583	missense	8541	exon16			TCCCTCACCACCT	AF034800	CCDS12758.1	19q13.33	2013-09-23			ENSG00000177380	ENSG00000177380		"""Sterile alpha motif (SAM) domain containing"""	9247	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase, receptor type, f polypeptide, alpha 3"", ""liprin-alpha 3"", ""liprin"""	603144				9624153, 9734811	Standard	NM_003660		Approved	KIAA0654, LPNA3, MGC126567, MGC126569	uc002pmr.3	O75145	OTTHUMG00000183213	ENST00000334186.4:c.1978A>C	19.37:g.49641586A>C	ENSP00000335614:p.Thr660Pro	48	2		62	9	NM_003660	0	0	6	6	0	A8K142|Q3MJA0|Q9H8B5|Q9UEW4	Missense_Mutation	SNP	ENST00000334186.4	37	CCDS12758.1	.	.	.	.	.	.	.	.	.	.	A	14.77	2.635250	0.47049	.	.	ENSG00000177380	ENST00000334186	T	0.52295	0.67	4.23	4.23	0.50019	.	0.000000	0.48767	D	0.000168	T	0.59362	0.2188	L	0.60455	1.87	0.80722	D	1	B;D	0.76494	0.044;0.999	B;D	0.66351	0.049;0.943	T	0.55768	-0.8089	10	0.22109	T	0.4	-21.1863	12.5946	0.56461	1.0:0.0:0.0:0.0	.	660;660	O75145-2;O75145	.;LIPA3_HUMAN	P	660	ENSP00000335614:T660P	ENSP00000335614:T660P	T	+	1	0	PPFIA3	54333398	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.650000	0.67944	1.674000	0.50907	0.455000	0.32223	ACC	.		0.677	PPFIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465688.1	NM_003660	
NLRP9	338321	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	56243992	56243992	+	Missense_Mutation	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:56243992C>T	ENST00000332836.2	-	2	1232	c.1205G>A	c.(1204-1206)gGa>gAa	p.G402E		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	402	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.					cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TGTCCAAATTCCCTCTGCAGC	0.468																																					p.G402E		.											.	NLRP9-294	0			c.G1205A						.						83.0	83.0	83.0					19																	56243992		2203	4300	6503	SO:0001583	missense	338321	exon2			CAAATTCCCTCTG	AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.1205G>A	19.37:g.56243992C>T	ENSP00000331857:p.Gly402Glu	76	0		69	23	NM_176820	0	0	0	0	0	B2RN12|Q86W27	Missense_Mutation	SNP	ENST00000332836.2	37	CCDS12934.1	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029339	0.35797	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	D	0.83419	-1.72	2.56	1.47	0.22746	.	.	.	.	.	D	0.90655	0.7069	M	0.87381	2.88	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80216	-0.1474	9	0.87932	D	0	.	9.2945	0.37806	0.0:0.7769:0.2231:0.0	.	402	Q7RTR0	NALP9_HUMAN	E	402	ENSP00000331857:G402E	ENSP00000331857:G402E	G	-	2	0	NLRP9	60935804	0.363000	0.24989	0.078000	0.20375	0.032000	0.12392	3.066000	0.50002	0.637000	0.30526	0.644000	0.83932	GGA	.		0.468	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453653.1	NM_176820	
ZNF772	400720	bcgsc.ca	37	19	57985460	57985460	+	Missense_Mutation	SNP	T	T	A	rs2074059	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:57985460T>A	ENST00000343280.4	-	5	912	c.652A>T	c.(652-654)Atg>Ttg	p.M218L	ZNF772_ENST00000601768.1_Intron|ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000356584.3_Missense_Mutation_p.M177L|AC004076.9_ENST00000596831.1_Intron|ZNF772_ENST00000425074.3_3'UTR|ZNF772_ENST00000427512.2_Missense_Mutation_p.M106L|AC004076.9_ENST00000415705.3_Intron	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	218			M -> L (in dbSNP:rs2074059). {ECO:0000269|PubMed:17974005}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		GACATCTCCATTGATTGCACA	0.498													A|||	3388	0.676518	0.6127	0.7176	5008	,	,		20866	0.7014		0.6392	False		,,,				2504	0.7464				p.M218L	Melanoma(5;289 436 14293 15924 30817)	.											.	ZNF772-90	0			c.A652T						.	A	LEU/MET,LEU/MET	2725,1681	507.3+/-366.6	849,1027,327	86.0	77.0	80.0		652,529	1.6	0.0	19	dbSNP_96	80	5448,3152	479.4+/-370.1	1680,2088,532	yes	missense,missense	ZNF772	NM_001024596.2,NM_001144068.1	15,15	2529,3115,859	AA,AT,TT		36.6512,38.1525,37.1598	benign,benign	218/490,177/449	57985460	8173,4833	2203	4300	6503	SO:0001583	missense	400720	exon5			TCTCCATTGATTG	BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.652A>T	19.37:g.57985460T>A	ENSP00000341165:p.Met218Leu	149	1		215	7	NM_001024596	0	0	3	3	0	A6NJK9|B4DH56|B4DYS0	Missense_Mutation	SNP	ENST00000343280.4	37	CCDS33133.1	1451	0.6643772893772893	302	0.6138211382113821	254	0.7016574585635359	411	0.7185314685314685	484	0.6385224274406333	A	9.582	1.123935	0.20959	0.618475	0.633488	ENSG00000197128	ENST00000343280;ENST00000427512;ENST00000319969;ENST00000356584;ENST00000291809	T;T;T	0.05382	3.58;3.45;3.54	3.79	1.63	0.23807	.	.	.	.	.	T	0.00012	0.0000	N	0.02158	-0.66	0.80722	P	0.0	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.16719	-1.0393	8	0.66056	D	0.02	.	0.4889	0.00560	0.439:0.1827:0.2022:0.1761	rs2074059;rs59319118;rs2074059	106;177;218	Q68DY9-2;A6NJK9;Q68DY9	.;.;ZN772_HUMAN	L	218;106;164;177;143	ENSP00000341165:M218L;ENSP00000395967:M106L;ENSP00000348992:M177L	ENSP00000291809:M143L	M	-	1	0	ZNF772	62677272	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.073000	0.14640	-0.101000	0.12219	-0.496000	0.04628	ATG	T|0.353;A|0.647		0.498	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397447.1	NM_001024596	
NCK2	8440	broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	106471685	106471685	+	Missense_Mutation	SNP	G	G	A			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr2:106471685G>A	ENST00000233154.4	+	3	608	c.166G>A	c.(166-168)Gtg>Atg	p.V56M	NCK2_ENST00000393349.2_Missense_Mutation_p.V56M|AC009505.2_ENST00000598281.1_RNA|AC009505.2_ENST00000596418.1_RNA|AC009505.2_ENST00000427050.2_RNA|NCK2_ENST00000451463.2_Missense_Mutation_p.V56M|NCK2_ENST00000522586.1_Missense_Mutation_p.V56M	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	56	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						GTCCAACTACGTGGAGCGGAA	0.567																																					p.V56M		.											.	NCK2-415	0			c.G166A						.						89.0	73.0	78.0					2																	106471685		2203	4300	6503	SO:0001583	missense	8440	exon2			AACTACGTGGAGC	AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.166G>A	2.37:g.106471685G>A	ENSP00000233154:p.Val56Met	209	2		146	110	NM_001004720	0	0	4	14	10	D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	ENST00000233154.4	37	CCDS33266.1	.	.	.	.	.	.	.	.	.	.	G	33	5.212375	0.95069	.	.	ENSG00000071051	ENST00000233154;ENST00000451463;ENST00000393348;ENST00000522586;ENST00000425756;ENST00000393349	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	5.84	5.84	0.93424	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.81640	0.4865	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	0.976;1.0	P;D	0.80764	0.701;0.994	D	0.85954	0.1466	10	0.87932	D	0	.	20.1381	0.98040	0.0:0.0:1.0:0.0	.	56;56	E7ERP6;O43639	.;NCK2_HUMAN	M	56	ENSP00000233154:V56M;ENSP00000410428:V56M;ENSP00000377017:V56M;ENSP00000431109:V56M;ENSP00000408040:V56M;ENSP00000377018:V56M	ENSP00000233154:V56M	V	+	1	0	NCK2	105838117	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.433000	0.97501	2.763000	0.94921	0.650000	0.86243	GTG	.		0.567	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329634.1	NM_003581	
STK39	27347	broad.mit.edu;bcgsc.ca	37	2	169023910	169023910	+	Missense_Mutation	SNP	A	A	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr2:169023910A>T	ENST00000355999.4	-	3	1034	c.329T>A	c.(328-330)aTt>aAt	p.I110N		NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39	110	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						CATGGCTTGAATTTCTTTCTA	0.403																																					p.I110N		.											.	STK39-546	0			c.T329A						.						86.0	81.0	83.0					2																	169023910		1975	4185	6160	SO:0001583	missense	27347	exon3			GCTTGAATTTCTT	AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.329T>A	2.37:g.169023910A>T	ENSP00000348278:p.Ile110Asn	139	0		96	6	NM_013233	0	0	0	0	0	O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	Missense_Mutation	SNP	ENST00000355999.4	37	CCDS42770.1	.	.	.	.	.	.	.	.	.	.	A	25.7	4.663167	0.88251	.	.	ENSG00000198648	ENST00000355999	T	0.26518	1.73	5.82	5.82	0.92795	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.54935	0.1889	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.60469	-0.7257	10	0.87932	D	0	-20.3239	16.1729	0.81831	1.0:0.0:0.0:0.0	.	110	Q9UEW8	STK39_HUMAN	N	110	ENSP00000348278:I110N	ENSP00000348278:I110N	I	-	2	0	STK39	168732156	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.957000	0.93082	2.214000	0.71695	0.533000	0.62120	ATT	.		0.403	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258112.2	NM_013233	
SP5	389058	hgsc.bcm.edu	37	2	171573185	171573185	+	Silent	SNP	G	G	T	rs1134626	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr2:171573185G>T	ENST00000375281.3	+	2	630	c.468G>T	c.(466-468)ccG>ccT	p.P156P	AC007405.2_ENST00000409786.1_5'Flank	NM_001003845.2	NP_001003845.1	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	156					bone morphogenesis (GO:0060349)|post-anal tail morphogenesis (GO:0036342)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.P156P(1)		NS(1)|endometrium(2)|lung(1)|prostate(1)	5						CCGCGCTGCCGCCAGGCTACT	0.751													G|||	1034	0.20647	0.0242	0.2017	5008	,	,		6711	0.1815		0.3579	False		,,,				2504	0.3262				p.P156P		.											.	SP5-90	1	Substitution - coding silent(1)	NS(1)	c.G468T						.	G		219,2535		16,187,1174	5.0	6.0	6.0		468	-7.5	0.4	2	dbSNP_86	6	2090,4520		318,1454,1533	no	coding-synonymous	SP5	NM_001003845.2		334,1641,2707	TT,TG,GG		31.6188,7.9521,24.6583		156/399	171573185	2309,7055	1377	3305	4682	SO:0001819	synonymous_variant	389058	exon2			GCTGCCGCCAGGC		CCDS33322.1	2q31	2013-01-08			ENSG00000204335	ENSG00000204335		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14529	protein-coding gene	gene with protein product		609391					Standard	NM_001003845		Approved		uc002uge.3	Q6BEB4	OTTHUMG00000154053	ENST00000375281.3:c.468G>T	2.37:g.171573185G>T		0	0		4	4	NM_001003845	0	0	0	0	0		Silent	SNP	ENST00000375281.3	37	CCDS33322.1																																																																																			G|0.766;T|0.234		0.751	SP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333670.1	XM_371581	
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179427229	179427229	+	Missense_Mutation	SNP	C	C	T	rs371345921		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr2:179427229C>T	ENST00000591111.1	-	276	78931	c.78707G>A	c.(78706-78708)cGt>cAt	p.R26236H	TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R27877H|TTN_ENST00000342992.6_Missense_Mutation_p.R25309H|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R18937H|TTN_ENST00000342175.6_Missense_Mutation_p.R19004H|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R18812H|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26236	Fibronectin type-III 91. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTGTATTACGGGTCACATC	0.438													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21061	0.0		0.0	False		,,,				2504	0.0				p.R27877H		.											.	TTN-636	0			c.G83630A						.						69.0	67.0	68.0					2																	179427229		1893	4126	6019	SO:0001583	missense	7273	exon326			GTATTACGGGTCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78707G>A	2.37:g.179427229C>T	ENSP00000465570:p.Arg26236His	138	0		81	54	NM_001267550	0	0	0	0	0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	11.07	1.531025	0.27387	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	5.67	3.89	0.44902	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51805	0.1696	L	0.55743	1.74	0.39326	D	0.96533	D;D;D;D	0.57257	0.979;0.979;0.979;0.979	B;B;B;P	0.45099	0.345;0.345;0.345;0.469	T	0.58956	-0.7544	9	0.87932	D	0	.	13.388	0.60807	0.0:0.8898:0.0:0.1102	.	18812;18937;19004;26236	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	25309;18812;19004;18937;18810	ENSP00000343764:R25309H;ENSP00000434586:R18812H;ENSP00000340554:R19004H;ENSP00000352154:R18937H	ENSP00000340554:R19004H	R	-	2	0	TTN	179135475	0.996000	0.38824	0.900000	0.35374	0.898000	0.52572	3.323000	0.52014	0.765000	0.33221	-1.066000	0.02275	CGT	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
GPR55	9290	bcgsc.ca	37	2	231774844	231774844	+	Silent	SNP	G	G	A	rs2396777	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr2:231774844G>A	ENST00000392040.1	-	2	1026	c.834C>T	c.(832-834)aaC>aaT	p.N278N	GPR55_ENST00000392039.2_Silent_p.N278N|AC012507.4_ENST00000454890.1_RNA	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	278					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)	p.N278N(1)		endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		AGCAGTTGACGTTGGAGAAAC	0.507													G|||	1731	0.345647	0.6815	0.1686	5008	,	,		23399	0.2331		0.1471	False		,,,				2504	0.3374				p.N278N		.											.	GPR55-91	1	Substitution - coding silent(1)	stomach(1)	c.C834T						.	G		2555,1851	633.8+/-396.1	754,1047,402	107.0	105.0	106.0		834	0.4	0.4	2	dbSNP_100	106	1442,7158	275.3+/-291.7	135,1172,2993	no	coding-synonymous	GPR55	NM_005683.3		889,2219,3395	AA,AG,GG		16.7674,42.0109,30.732		278/320	231774844	3997,9009	2203	4300	6503	SO:0001819	synonymous_variant	9290	exon2			GTTGACGTTGGAG	AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.834C>T	2.37:g.231774844G>A		185	1		142	5	NM_005683	0	0	0	0	0	Q8N580	Silent	SNP	ENST00000392040.1	37	CCDS2480.1																																																																																			G|0.690;N|0.000		0.507	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332618.1	NM_005683	
SIRPA	140885	bcgsc.ca	37	20	1895984	1895984	+	Missense_Mutation	SNP	C	C	A	rs17855615	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr20:1895984C>A	ENST00000358771.4	+	2	471	c.319C>A	c.(319-321)Cgc>Agc	p.R107S	SIRPA_ENST00000400068.3_Missense_Mutation_p.R107S|SIRPA_ENST00000356025.3_Missense_Mutation_p.R107S	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	107	Ig-like V-type.		R -> S (in dbSNP:rs17855615). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9062191, ECO:0000269|PubMed:9070220}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CTTTTCCATCCGCATCGGTAA	0.512																																					p.R107S	GBM(155;1668 1920 5945 42733 48121)	.											.	SIRPA-227	0			c.C319A						.						138.0	115.0	123.0					20																	1895984		2203	4294	6497	SO:0001583	missense	140885	exon3			TCCATCCGCATCG	D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.319C>A	20.37:g.1895984C>A	ENSP00000351621:p.Arg107Ser	195	3		47	12	NM_001040022	0	0	0	0	0	A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	ENST00000358771.4	37	CCDS13022.1	.	.	.	.	.	.	.	.	.	.	C	15.32	2.798885	0.50208	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.65364	-0.15;-0.15;-0.15	5.11	3.0	0.34707	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.200680	0.35805	N	0.002964	T	0.56277	0.1974	L	0.41632	1.29	0.28588	P	0.9097832	D;P;P	0.54047	0.964;0.761;0.851	P;B;P	0.51055	0.657;0.077;0.539	T	0.64689	-0.6348	9	0.44086	T	0.13	.	5.8595	0.18738	0.2003:0.7011:0.0:0.0986	rs17855615	87;107;107	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	S	107	ENSP00000382941:R107S;ENSP00000348307:R107S;ENSP00000351621:R107S	ENSP00000348307:R107S	R	+	1	0	SIRPA	1843984	0.671000	0.27521	1.000000	0.80357	0.663000	0.39108	0.167000	0.16602	1.377000	0.46286	0.555000	0.69702	CGC	C|0.700;A|0.300		0.512	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077568.2	NM_080792	
PANK2	80025	hgsc.bcm.edu	37	20	3870124	3870124	+	Missense_Mutation	SNP	G	G	C	rs3737084	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr20:3870124G>C	ENST00000316562.4	+	1	383	c.377G>C	c.(376-378)gGg>gCg	p.G126A	PANK2_ENST00000497424.1_Intron|RP11-119B16.2_ENST00000451507.1_RNA|PANK2_ENST00000610179.1_Missense_Mutation_p.G3A	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	126			G -> A (in dbSNP:rs3737084). {ECO:0000269|PubMed:11479594, ECO:0000269|PubMed:12554685, ECO:0000269|Ref.3}.		aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						CGGATGGGAGGGGGCCGGCTC	0.766													C|||	4403	0.879193	0.9939	0.9323	5008	,	,		9294	0.7946		0.8757	False		,,,				2504	0.7771				p.G126A		.											.	PANK2-115	0			c.G377C						.		,ALA/GLY	3009,53		1478,53,0	2.0	3.0	3.0		,377	4.7	1.0	20	dbSNP_107	3	6120,564		2797,526,19	no	intron,missense	PANK2	NM_024960.4,NM_153638.2	,60	4275,579,19	CC,CG,GG		8.4381,1.7309,6.3308	,benign	,126/571	3870124	9129,617	1531	3342	4873	SO:0001583	missense	80025	exon1			TGGGAGGGGGCCG	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.377G>C	20.37:g.3870124G>C	ENSP00000313377:p.Gly126Ala	0	0		4	4	NM_153638	0	0	0	0	0	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Missense_Mutation	SNP	ENST00000316562.4	37	CCDS13071.2	1920	0.8791208791208791	489	0.9939024390243902	334	0.9226519337016574	438	0.7657342657342657	659	0.8693931398416886	C	8.681	0.905209	0.17760	0.982691	0.915619	ENSG00000125779	ENST00000316562	D	0.96265	-3.96	4.73	4.73	0.59995	.	0.504726	0.16798	N	0.199120	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.41574	-0.9501	9	0.02654	T	1	.	11.198	0.48724	0.0:0.8144:0.1856:0.0	rs3737084	126	Q9BZ23	PANK2_HUMAN	A	126	ENSP00000313377:G126A	ENSP00000313377:G126A	G	+	2	0	PANK2	3818124	0.994000	0.37717	0.990000	0.47175	0.991000	0.79684	1.019000	0.30014	1.369000	0.46134	-0.164000	0.13417	GGG	G|0.122;C|0.878		0.766	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
LRRN4	164312	hgsc.bcm.edu	37	20	6033033	6033033	+	Missense_Mutation	SNP	G	G	A	rs6107751	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr20:6033033G>A	ENST00000378858.4	-	2	637	c.413C>T	c.(412-414)cCg>cTg	p.P138L		NM_152611.4	NP_689824.2	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4	138			P -> L (in dbSNP:rs6107751). {ECO:0000269|PubMed:15489334}.		long-term memory (GO:0007616)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	27						GGTGCACGGCGGCAGAGCGGC	0.781													G|||	565	0.112819	0.053	0.1844	5008	,	,		11700	0.0972		0.173	False		,,,				2504	0.0971				p.P138L		.											.	LRRN4-93	0			c.C413T						.	G	LEU/PRO	120,2142		3,114,1014	2.0	2.0	2.0		413	4.2	0.8	20	dbSNP_114	2	724,4820		32,660,2080	no	missense	LRRN4	NM_152611.3	98	35,774,3094	AA,AG,GG		13.0592,5.305,10.8122	possibly-damaging	138/741	6033033	844,6962	1131	2772	3903	SO:0001583	missense	164312	exon2			CACGGCGGCAGAG	AL118505	CCDS13097.1	20p12.3	2013-02-11	2008-05-20	2008-05-20	ENSG00000125872	ENSG00000125872		"""Fibronectin type III domain containing"""	16208	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 75"""	C20orf75		15870286	Standard	NM_152611		Approved	dJ1056H1.1, NLRR4	uc002wmo.3	Q8WUT4	OTTHUMG00000031825	ENST00000378858.4:c.413C>T	20.37:g.6033033G>A	ENSP00000368135:p.Pro138Leu	0	0		4	4	NM_152611	0	0	0	0	0	A8K258|Q5JWV6|Q9H419	Missense_Mutation	SNP	ENST00000378858.4	37	CCDS13097.1	295	0.13507326007326007	29	0.05894308943089431	65	0.17955801104972377	62	0.10839160839160839	139	0.18337730870712401	G	16.04	3.009170	0.54361	0.05305	0.130592	ENSG00000125872	ENST00000378858	T	0.09073	3.02	5.09	4.15	0.48705	.	0.091120	0.46758	D	0.000263	T	0.00039	0.0001	M	0.76328	2.33	0.22762	P	0.99876042	D;P	0.59767	0.986;0.809	P;P	0.57960	0.83;0.787	T	0.04915	-1.0918	9	0.87932	D	0	-27.3795	13.7965	0.63175	0.0747:0.0:0.9253:0.0	rs6107751;rs17852455	138;138	Q6ZMD1;Q8WUT4	.;LRRN4_HUMAN	L	138	ENSP00000368135:P138L	ENSP00000368135:P138L	P	-	2	0	LRRN4	5981033	0.997000	0.39634	0.763000	0.31416	0.008000	0.06430	2.667000	0.46808	1.278000	0.44430	0.491000	0.48974	CCG	G|0.864;A|0.136		0.781	LRRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077907.2	NM_152611	
PLCB1	23236	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	8782728	8782728	+	Intron	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr20:8782728C>T	ENST00000338037.6	+	31	3450				PLCB1_ENST00000378637.2_Missense_Mutation_p.S1150L|PLCB1_ENST00000378641.3_Missense_Mutation_p.S1150L	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)						activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)	p.S1150L(1)		NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TCATTCTTGTCGGAAACTTGC	0.493																																					p.Y1150F		.											.	PLCB1-297	1	Substitution - Missense(1)	large_intestine(1)	c.A3449T						.						110.0	92.0	98.0					20																	8782728		2203	4300	6503	SO:0001627	intron_variant	23236	exon32			TCTTGTCGGAAAC	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.3423+11820C>T	20.37:g.8782728C>T		91	1		93	23	NM_182734	0	0	0	0	0	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	ENST00000338037.6	37	CCDS13102.1	.	.	.	.	.	.	.	.	.	.	C	17.39	3.378016	0.61735	.	.	ENSG00000182621	ENST00000378641;ENST00000378637;ENST00000535719	T;T	0.19394	2.15;2.15	5.87	5.87	0.94306	.	.	.	.	.	T	0.31167	0.0788	L	0.29908	0.895	0.28165	N	0.928804	D	0.53619	0.961	P	0.58820	0.846	T	0.07290	-1.0780	9	0.29301	T	0.29	.	16.0731	0.80948	0.0:1.0:0.0:0.0	.	1150	Q9NQ66-2	.	L	1150;1150;1070	ENSP00000367908:S1150L;ENSP00000367904:S1150L	ENSP00000367904:S1150L	S	+	2	0	PLCB1	8730728	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.128000	0.42045	2.941000	0.99782	0.655000	0.94253	TCG	.		0.493	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077938.3		
CST1	1469	broad.mit.edu	37	20	23728528	23728528	+	Silent	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr20:23728528C>T	ENST00000304749.2	-	3	421	c.351G>A	c.(349-351)ttG>ttA	p.L117L	CST1_ENST00000398402.1_Silent_p.L117L	NM_001898.2	NP_001889.2	P01037	CYTN_HUMAN	cystatin SN	117					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.L117L(1)		kidney(1)|large_intestine(1)|lung(8)|ovary(1)|stomach(1)|urinary_tract(1)	13	Lung NSC(19;0.0676)|all_lung(19;0.148)					CGAAAGAGCACAACTGTTTCT	0.527																																					p.L117L		.											.	CST1-91	1	Substitution - coding silent(1)	lung(1)	c.G351A						.						93.0	81.0	85.0					20																	23728528		2203	4300	6503	SO:0001819	synonymous_variant	1469	exon3			AGAGCACAACTGT	M19169	CCDS13160.1	20p11.2	2008-04-15			ENSG00000170373	ENSG00000170373			2473	protein-coding gene	gene with protein product		123855					Standard	NM_001898		Approved		uc002wtp.3	P01037	OTTHUMG00000032085	ENST00000304749.2:c.351G>A	20.37:g.23728528C>T		125	0		215	11	NM_001898	0	0	0	0	0	Q96LE6|Q9UCQ6	Silent	SNP	ENST00000304749.2	37	CCDS13160.1																																																																																			.		0.527	CST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078351.2	NM_001898	
RBM39	9584	hgsc.bcm.edu;broad.mit.edu	37	20	34292408	34292408	+	Silent	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr20:34292408G>T	ENST00000253363.6	-	17	1611	c.1588C>A	c.(1588-1590)Cga>Aga	p.R530R	RBM39_ENST00000528062.3_Silent_p.R508R|RBM39_ENST00000361162.6_Silent_p.R524R|RBM39_ENST00000407261.4_Silent_p.R373R			Q14498	RBM39_HUMAN	RNA binding motif protein 39	530	Interaction with NCOA6. {ECO:0000250}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TTCCTTCATCGTCTACTTGGA	0.343																																					p.R530R		.											.	RBM39-91	0			c.C1588A						.						153.0	136.0	142.0					20																	34292408		2203	4300	6503	SO:0001819	synonymous_variant	9584	exon17			TTCATCGTCTACT	L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1588C>A	20.37:g.34292408G>T		70	0		95	5	NM_184234	0	0	130	130	0	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Silent	SNP	ENST00000253363.6	37	CCDS13266.1																																																																																			.		0.343	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2	NM_184237	
KIAA1755	85449	hgsc.bcm.edu	37	20	36868106	36868106	+	Missense_Mutation	SNP	G	G	A	rs11699859	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr20:36868106G>A	ENST00000279024.4	-	4	1842	c.1571C>T	c.(1570-1572)aCa>aTa	p.T524I		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	524										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				TGGGCCAGATGTTTTGGTCTG	0.537													G|||	12	0.00239617	0.0008	0.0043	5008	,	,		18449	0.0		0.005	False		,,,				2504	0.0031				p.T524I		.											.	KIAA1755-95	0			c.C1571T						.	G	ILE/THR	10,4396	15.5+/-35.6	0,10,2193	38.0	41.0	40.0		1571	3.5	1.0	20	dbSNP_120	40	68,8532	41.2+/-98.3	0,68,4232	yes	missense	KIAA1755	NM_001029864.1	89	0,78,6425	AA,AG,GG		0.7907,0.227,0.5997	benign	524/1201	36868106	78,12928	2203	4300	6503	SO:0001583	missense	85449	exon4			CCAGATGTTTTGG	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1571C>T	20.37:g.36868106G>A	ENSP00000279024:p.Thr524Ile	4	0		17	7	NM_001029864	0	0	0	0	0	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	37	CCDS33467.1	6	0.0027472527472527475	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	4	0.005277044854881266	G	8.426	0.847418	0.17034	0.00227	0.007907	ENSG00000149633	ENST00000279024;ENST00000373398	T	0.05925	3.37	4.43	3.48	0.39840	.	0.252227	0.28317	N	0.015797	T	0.10078	0.0247	L	0.55103	1.725	0.30892	N	0.730195	D	0.71674	0.998	D	0.80764	0.994	T	0.01988	-1.1234	10	0.15952	T	0.53	.	7.6616	0.28407	0.1125:0.0:0.8875:0.0	rs11699859;rs11699859	524	Q5JYT7	K1755_HUMAN	I	524;71	ENSP00000279024:T524I	ENSP00000279024:T524I	T	-	2	0	KIAA1755	36301520	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	2.983000	0.49345	2.466000	0.83321	0.456000	0.33151	ACA	G|0.994;A|0.006		0.537	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
ACTR5	79913	hgsc.bcm.edu	37	20	37377139	37377139	+	Silent	SNP	C	C	T	rs2254105	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr20:37377139C>T	ENST00000243903.4	+	1	55	c.18C>T	c.(16-18)ttC>ttT	p.F6F		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	6					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				CGAACGTGTTCCCGTTCCGCG	0.756													C|||	1227	0.245008	0.205	0.2334	5008	,	,		10427	0.2679		0.2565	False		,,,				2504	0.272				p.F6F		.											.	ACTR5-90	0			c.C18T						.						3.0	4.0	4.0					20																	37377139		1470	2633	4103	SO:0001819	synonymous_variant	79913	exon1			CGTGTTCCCGTTC	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.18C>T	20.37:g.37377139C>T		0	0		33	17	NM_024855	0	0	0	0	0	Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Silent	SNP	ENST00000243903.4	37	CCDS13308.1																																																																																			C|0.769;T|0.231		0.756	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079205.2	NM_024855	
PRODH	5625	bcgsc.ca	37	22	18912678	18912678	+	Missense_Mutation	SNP	A	A	G	rs386819653|rs4819756	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr22:18912678A>G	ENST00000357068.6	-	4	818	c.553T>C	c.(553-555)Tgg>Cgg	p.W185R	PRODH_ENST00000334029.2_Missense_Mutation_p.W77R|PRODH_ENST00000420436.1_Missense_Mutation_p.W77R	NM_016335.4	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase (oxidase) 1	185			R -> Q (no effect on enzymatic activity).|R -> W (moderate reduction of enzymatic activity; dbSNP:rs4819756).		4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)	FAD binding (GO:0071949)|proline dehydrogenase activity (GO:0004657)			breast(1)|endometrium(3)|lung(4)|upper_aerodigestive_tract(1)	9					L-Proline(DB00172)	CCGAAGGCCCAGTGGGCCTGG	0.592													.|||	3911	0.78095	0.916	0.6715	5008	,	,		18594	0.9712		0.5567	False		,,,				2504	0.7106				p.W185R		.											.	PRODH-289	0			c.T553C	GRCh37	CM057554	PRODH	M	rs4819756	.		ARG/TRP,ARG/TRP	3798,608		1646,506,51	104.0	104.0	104.0		229,553	2.9	0.2	22	dbSNP_111	104	4967,3633		1455,2057,788	yes	missense,missense	PRODH	NM_001195226.1,NM_016335.4	101,101	3101,2563,839	GG,GA,AA		42.2442,13.7994,32.608	probably-damaging,probably-damaging	77/493,185/601	18912678	8765,4241	2203	4300	6503	SO:0001583	missense	5625	exon5			AGGCCCAGTGGGC	AF010310	CCDS13754.1, CCDS56223.1	22q11.2	2014-07-10	2001-12-05		ENSG00000100033	ENSG00000100033	1.5.5.2		9453	protein-coding gene	gene with protein product		606810	"""proline dehydrogenase (proline oxidase )"""			9385373, 10192398	Standard	NM_001195226		Approved	HSPOX2, PRODH1, PIG6, PRODH2, TP53I6	uc002zok.4	O43272	OTTHUMG00000150163	ENST00000357068.6:c.553T>C	22.37:g.18912678A>G	ENSP00000349577:p.Trp185Arg	204	0		121	6	NM_016335	0	0	2	2	0	A6NF53|O14680|Q0P507|Q147W8|Q504W1|Q59FI8|Q6NV86|Q9UF13	Missense_Mutation	SNP	ENST00000357068.6	37	CCDS13754.1	1621|1621	0.7422161172161172|0.7422161172161172	429|429	0.8719512195121951|0.8719512195121951	235|235	0.649171270718232|0.649171270718232	552|552	0.965034965034965|0.965034965034965	405|405	0.5343007915567283|0.5343007915567283	.|.	0.065|0.065	-1.215883|-1.215883	0.01542|0.01542	0.862006|0.862006	0.577558|0.577558	ENSG00000100033|ENSG00000100033	ENST00000457083|ENST00000357068;ENST00000438924;ENST00000450579	.|T;T	.|0.75260	.|-0.92;-0.92	5.03|5.03	2.88|2.88	0.33553|0.33553	.|.	.|0.520350	.|0.20347	.|N	.|0.094139	T|T	0.00012|0.00012	0.0000|0.0000	.|.	.|.	.|.	0.47476|0.47476	P|P	5.610000000000337E-4|5.610000000000337E-4	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.32402|0.32402	-0.9908|-0.9908	3|8	.|0.15952	.|T	.|0.53	0.0658|0.0658	6.4381|6.4381	0.21835|0.21835	0.1618:0.0:0.6925:0.1458|0.1618:0.0:0.6925:0.1458	rs4819756;rs58835750;rs4819756|rs4819756;rs58835750;rs4819756	.|77	.|E7EQL6	.|.	P|R	108|185;67;26	.|ENSP00000349577:W185R;ENSP00000396806:W26R	.|ENSP00000334726:W77R	L|W	-|-	2|1	0|0	PRODH|PRODH	17292678|17292678	0.975000|0.975000	0.34042|0.34042	0.234000|0.234000	0.24042|0.24042	0.007000|0.007000	0.05969|0.05969	3.683000|3.683000	0.54663|0.54663	0.250000|0.250000	0.21479|0.21479	-1.516000|-1.516000	0.00938|0.00938	CTG|TGG	A|0.284;G|0.716		0.592	PRODH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316637.2	NM_016335	
MN1	4330	hgsc.bcm.edu	37	22	28195386	28195386	+	Missense_Mutation	SNP	C	C	A	rs45589338	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr22:28195386C>A	ENST00000302326.4	-	1	2100	c.1146G>T	c.(1144-1146)caG>caT	p.Q382H		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	382			Q -> H (in dbSNP:rs45589338).		intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						CCTCGCCCTGCTGGGGCCGAG	0.726			T	ETV6	"""AML, meningioma"""								C|||	74	0.0147764	0.0023	0.0202	5008	,	,		9892	0.0		0.0427	False		,,,				2504	0.0143				p.Q382H		.		Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	MN1-993	0			c.G1146T						.	C	HIS/GLN	22,3204		0,22,1591	5.0	6.0	6.0		1146	4.2	1.0	22	dbSNP_127	6	230,7036		1,228,3404	yes	missense	MN1	NM_002430.2	24	1,250,4995	AA,AC,CC		3.1654,0.682,2.4018	possibly-damaging	382/1321	28195386	252,10240	1613	3633	5246	SO:0001583	missense	4330	exon1			GCCCTGCTGGGGC	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1146G>T	22.37:g.28195386C>A	ENSP00000304956:p.Gln382His	0	0		15	15	NM_002430	0	0	0	0	0	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	26	0.011904761904761904	1	0.0020325203252032522	5	0.013812154696132596	0	0.0	20	0.026385224274406333	C	12.59	1.982741	0.34942	0.00682	0.031654	ENSG00000169184	ENST00000302326	T	0.46819	0.86	5.29	4.19	0.49359	.	0.530958	0.19784	N	0.106150	T	0.16981	0.0408	N	0.08118	0	0.36398	D	0.862938	D	0.53151	0.958	P	0.51135	0.66	T	0.41413	-0.9510	10	0.36615	T	0.2	-1.5205	16.6783	0.85285	0.0:0.8592:0.1408:0.0	rs45589338	382	Q10571	MN1_HUMAN	H	382	ENSP00000304956:Q382H	ENSP00000304956:Q382H	Q	-	3	2	MN1	26525386	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.165000	0.31822	2.473000	0.83533	0.484000	0.47621	CAG	C|0.986;A|0.014		0.726	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320737.1	NM_002430	
NEFH	4744	hgsc.bcm.edu;ucsc.edu	37	22	29885594	29885594	+	Silent	SNP	A	A	T	rs79235463|rs200984527|rs267607533	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr22:29885594A>T	ENST00000310624.6	+	4	1998	c.1965A>T	c.(1963-1965)ccA>ccT	p.P655P		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						CCAAGTCCCCAGAGAAGGAAG	0.552																																					p.P655P		.											.	NEFH-90	0			c.A1965T						.						83.0	92.0	89.0					22																	29885594		2203	4300	6503	SO:0001819	synonymous_variant	4744	exon4			GTCCCCAGAGAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1965A>T	22.37:g.29885594A>T		316	0		209	60	NM_021076	0	0	3	3	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	37	CCDS13858.1																																																																																			A|0.500;T|0.500		0.552	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	broad.mit.edu	37	22	29885599	29885604	+	In_Frame_Del	DEL	AGGAAG	AGGAAG	-	rs267607534|rs373980795|rs267607533|rs149571560|rs200984527|rs370803228		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr22:29885599_29885604delAGGAAG	ENST00000310624.6	+	4	2003_2008	c.1970_1975delAGGAAG	c.(1969-1977)aaggaagag>aag	p.EE658del		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	664	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TCCCCAGAGAAGGAAGAGGCCAAGTC	0.558																																					p.657_659del		.											.	NEFH-90	0			c.1970_1975del						.																																			SO:0001651	inframe_deletion	4744	exon4			CAGAGAAGGAAGA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1970_1975delAGGAAG	22.37:g.29885599_29885604delAGGAAG	ENSP00000311997:p.Glu658_Glu659del	336	0		213	22	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Del	DEL	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.558	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TRIM71	131405	broad.mit.edu	37	3	32932887	32932887	+	Missense_Mutation	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr3:32932887G>T	ENST00000383763.5	+	4	2254	c.2191G>T	c.(2191-2193)Ggt>Tgt	p.G731C		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	731					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGGGCCTGATGGTGTCTTCCT	0.567																																					p.G731C		.											.	TRIM71-92	0			c.G2191T						.						42.0	47.0	45.0					3																	32932887		2004	4166	6170	SO:0001583	missense	131405	exon4			CCTGATGGTGTCT		CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.2191G>T	3.37:g.32932887G>T	ENSP00000373272:p.Gly731Cys	177	1		95	4	NM_001039111	0	0	0	0	0		Missense_Mutation	SNP	ENST00000383763.5	37	CCDS43060.1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477522	0.44044	.	.	ENSG00000206557	ENST00000383763	D	0.93133	-3.17	5.96	5.08	0.68730	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.97820	0.9284	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99000	1.0811	10	0.72032	D	0.01	-33.2263	16.0175	0.80455	0.0:0.1347:0.8653:0.0	.	731	Q2Q1W2	LIN41_HUMAN	C	731	ENSP00000373272:G731C	ENSP00000373272:G731C	G	+	1	0	TRIM71	32907891	1.000000	0.71417	0.072000	0.20136	0.579000	0.36224	9.866000	0.99616	1.516000	0.48900	0.655000	0.94253	GGT	.		0.567	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341565.3	NM_001039111	
ARHGEF3	50650	bcgsc.ca	37	3	56835761	56835761	+	Silent	SNP	G	G	A	rs3732508	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr3:56835761G>A	ENST00000296315.3	-	1	234	c.66C>T	c.(64-66)ccC>ccT	p.P22P	ARHGEF3_ENST00000496106.1_Intron|ARHGEF3_ENST00000338458.4_Intron|ARHGEF3_ENST00000498517.1_Intron|ARHGEF3_ENST00000495373.1_Silent_p.P22P	NM_019555.2	NP_062455.1	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor (GEF) 3	22					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	25				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		CGCTGGCCGGGGGTAGCTCCA	0.652													G|||	1609	0.321286	0.0227	0.487	5008	,	,		16762	0.1944		0.5716	False		,,,				2504	0.4806				p.P22P		.											.	ARHGEF3-228	0			c.C66T						.	G	,	492,3902		44,404,1749	35.0	31.0	33.0		,66	4.0	1.0	3	dbSNP_107	33	4617,3949		1292,2033,958	no	intron,coding-synonymous	ARHGEF3	NM_001128615.1,NM_019555.2	,	1336,2437,2707	AA,AG,GG		46.1009,11.1971,39.4213	,	,22/527	56835761	5109,7851	2197	4283	6480	SO:0001819	synonymous_variant	50650	exon1			GGCCGGGGGTAGC	AB209661	CCDS2878.1, CCDS46854.1, CCDS46855.1, CCDS74948.1	3p14.3	2012-09-20			ENSG00000163947	ENSG00000163947		"""Rho guanine nucleotide exchange factors"""	683	protein-coding gene	gene with protein product	"""exchange factor found in platelets and leukemic and neuronal tissues, XPLN"", ""RhoGEF protein"""	612115				10873612	Standard	NM_019555		Approved	STA3, XPLN, GEF3, DKFZP434F2429	uc003dih.2	Q9NR81	OTTHUMG00000158857	ENST00000296315.3:c.66C>T	3.37:g.56835761G>A		166	1		173	6	NM_019555	0	0	36	36	0	A8K5U7|Q4FZB6|Q4QQI5|Q4QQQ0|Q59F00|Q6NUN3|Q7Z4U2|Q7Z5T2|Q9H7T4	Silent	SNP	ENST00000296315.3	37	CCDS2878.1																																																																																			G|0.677;A|0.323		0.652	ARHGEF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352431.2	NM_019555	
PXK	54899	bcgsc.ca	37	3	58382846	58382846	+	Silent	SNP	C	C	T	rs3191903	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr3:58382846C>T	ENST00000356151.2	+	10	1012	c.903C>T	c.(901-903)tgC>tgT	p.C301C	PXK_ENST00000479241.1_Silent_p.C284C|PXK_ENST00000302779.5_Silent_p.C284C|PXK_ENST00000484288.1_Silent_p.C301C|PXK_ENST00000383715.4_Silent_p.C284C|PXK_ENST00000536660.1_Silent_p.C164C|PXK_ENST00000383716.3_Silent_p.C268C|PXK_ENST00000463280.1_Silent_p.C268C	NM_017771.3	NP_060241.2			PX domain containing serine/threonine kinase											cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		GGGACACTTGCCGGCTGCTGG	0.433													C|||	1005	0.200679	0.1959	0.2839	5008	,	,		18767	0.001		0.3777	False		,,,				2504	0.1718				p.C301C		.											.	PXK-334	0			c.C903T						.	C		907,3499	350.8+/-311.0	89,729,1385	162.0	170.0	167.0		903	5.5	1.0	3	dbSNP_105	167	3210,5390	484.3+/-371.4	617,1976,1707	no	coding-synonymous	PXK	NM_017771.3		706,2705,3092	TT,TC,CC		37.3256,20.5856,31.6546		301/579	58382846	4117,8889	2203	4300	6503	SO:0001819	synonymous_variant	54899	exon10			CACTTGCCGGCTG	AY274811	CCDS2889.1, CCDS74952.1, CCDS74954.1, CCDS74955.1	3p21.2	2008-02-05			ENSG00000168297	ENSG00000168297			23326	protein-coding gene	gene with protein product		611450					Standard	XM_005265255		Approved	FLJ20335	uc003djz.1	Q7Z7A4	OTTHUMG00000159149	ENST00000356151.2:c.903C>T	3.37:g.58382846C>T		94	0		57	4	NM_017771	0	0	6	6	0		Silent	SNP	ENST00000356151.2	37	CCDS2889.1	493	0.22573260073260074	110	0.22357723577235772	110	0.30386740331491713	0	0.0	273	0.36015831134564646	C	10.37	1.332515	0.24167	0.205856	0.373256	ENSG00000168297	ENST00000479134	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	1.0	.	.	.	.	.	.	T	0.01452	-1.1351	3	.	.	.	-12.8138	19.5916	0.95514	0.0:1.0:0.0:0.0	rs3191903;rs17845192;rs17858004;rs17858288;rs3191903	.	.	.	V	56	.	.	A	+	2	0	PXK	58357886	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.606000	0.36826	2.861000	0.98227	0.655000	0.94253	GCC	C|0.701;T|0.299		0.433	PXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353499.1	NM_017771	
LRIG1	26018	hgsc.bcm.edu	37	3	66550756	66550756	+	Missense_Mutation	SNP	G	G	C	rs1403625	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr3:66550756G>C	ENST00000273261.3	-	1	600	c.76C>G	c.(76-78)Ctt>Gtt	p.L26V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L26V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	26				LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCCAGCCGAAGCAAAAGCAGC	0.761													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8093	0.8284		0.9732	False		,,,				2504	0.9601				p.L26V		.											.	LRIG1-230	0			c.C76G						.		VAL/LEU	1298,1386		255,788,299	3.0	4.0	4.0		76	2.9	0.5	3	dbSNP_88	4	5191,89		2555,81,4	yes	missense	LRIG1	NM_015541.2	32	2810,869,303	CC,CG,GG		1.6856,48.3607,18.5208	benign	26/1094	66550756	6489,1475	1342	2640	3982	SO:0001583	missense	26018	exon1			GCCGAAGCAAAAG	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.76C>G	3.37:g.66550756G>C	ENSP00000273261:p.Leu26Val	0	0		10	10	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1666	0.7628205128205128	118	0.23983739837398374	325	0.8977900552486188	489	0.8548951048951049	734	0.9683377308707124	g	6.572	0.473779	0.12521	0.483607	0.983144	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.67345	-0.26;-0.13	3.84	2.93	0.34026	.	0.847359	0.09512	U	0.792175	T	0.00012	0.0000	N	0.19112	0.55	0.80722	P	0.0	P;P	0.44139	0.827;0.484	B;B	0.37731	0.257;0.096	T	0.48854	-0.8998	9	0.23302	T	0.38	.	8.6883	0.34251	0.1185:0.0:0.8815:0.0	rs1403625;rs13083628	26;26	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	26	ENSP00000273261:L26V;ENSP00000373208:L26V	ENSP00000273261:L26V	L	-	1	0	LRIG1	66633446	.	.	0.520000	0.27837	0.020000	0.10135	.	.	1.845000	0.53610	0.472000	0.43445	CTT	G|0.237;C|0.763		0.761	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
LRIG1	26018	hgsc.bcm.edu	37	3	66550762	66550762	+	Missense_Mutation	SNP	G	G	C	rs1403626	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr3:66550762G>C	ENST00000273261.3	-	1	594	c.70C>G	c.(70-72)Ctt>Gtt	p.L24V	LRIG1_ENST00000383703.3_Missense_Mutation_p.L24V	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	24			L -> V (in dbSNP:rs1403626).	LLL -> VLV (in Ref. 1; AAK62357 and 3; AAH71561). {ECO:0000305}.	innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		CGAAGCAAAAGCAGCCAGAGA	0.766													g|||	3605	0.719848	0.1808	0.8833	5008	,	,		8368	0.8284		0.9732	False		,,,				2504	0.9601				p.L24V		.											.	LRIG1-230	0			c.C70G						.		VAL/LEU	1309,1447		265,779,334	3.0	4.0	4.0		70	3.1	0.5	3	dbSNP_88	4	5325,93		2620,85,4	no	missense	LRIG1	NM_015541.2	32	2885,864,338	CC,CG,GG		1.7165,47.4964,18.8402	benign	24/1094	66550762	6634,1540	1378	2709	4087	SO:0001583	missense	26018	exon1			GCAAAAGCAGCCA	AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.70C>G	3.37:g.66550762G>C	ENSP00000273261:p.Leu24Val	0	0		12	12	NM_015541	0	0	0	0	0	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Missense_Mutation	SNP	ENST00000273261.3	37	CCDS33783.1	1670	0.7646520146520146	119	0.241869918699187	326	0.9005524861878453	488	0.8531468531468531	737	0.9722955145118733	g	9.592	1.126319	0.20959	0.474964	0.982835	ENSG00000144749	ENST00000273261;ENST00000383703	T;T	0.68765	-0.35;-0.2	3.11	3.11	0.35812	.	0.429988	0.15146	U	0.278020	T	0.00012	0.0000	N	0.19112	0.55	0.39998	P	0.024872000000000005	P;B	0.36282	0.546;0.282	B;B	0.32465	0.146;0.069	T	0.40572	-0.9556	9	0.23891	T	0.37	.	12.0321	0.53403	0.0:0.0:1.0:0.0	rs1403626;rs13083630;rs1403626	24;24	Q96JA1-2;Q96JA1	.;LRIG1_HUMAN	V	24	ENSP00000273261:L24V;ENSP00000373208:L24V	ENSP00000273261:L24V	L	-	1	0	LRIG1	66633452	.	.	0.546000	0.28166	0.017000	0.09413	.	.	1.734000	0.51633	0.472000	0.43445	CTT	G|0.252;C|0.748		0.766	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351930.1	NM_015541	
EEFSEC	60678	hgsc.bcm.edu	37	3	127872602	127872602	+	Silent	SNP	A	A	G	rs11719546	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr3:127872602A>G	ENST00000254730.6	+	1	306	c.252A>G	c.(250-252)ccA>ccG	p.P84P	EEFSEC_ENST00000483457.1_Silent_p.P84P|RUVBL1_ENST00000464873.1_5'UTR	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	84	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						CCGGCGAGCCACTGCTTCAGG	0.741													A|||	685	0.136781	0.2337	0.134	5008	,	,		10616	0.0069		0.1143	False		,,,				2504	0.1646				p.P84P		.											.	EEFSEC-91	0			c.A252G						.	A		592,3228		50,492,1368	3.0	5.0	5.0		252	2.2	1.0	3	dbSNP_120	5	763,7091		37,689,3201	no	coding-synonymous	EEFSEC	NM_021937.3		87,1181,4569	GG,GA,AA		9.7148,15.4974,11.607		84/597	127872602	1355,10319	1910	3927	5837	SO:0001819	synonymous_variant	60678	exon1			CGAGCCACTGCTT		CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.252A>G	3.37:g.127872602A>G		2	0		21	7	NM_021937	0	0	6	7	1	Q96HZ6	Silent	SNP	ENST00000254730.6	37	CCDS33849.1																																																																																			A|0.881;G|0.119		0.741	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356738.2	NM_021937	
UBA5	79876	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132387706	132387706	+	Silent	SNP	T	T	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr3:132387706T>C	ENST00000356232.4	+	4	1414	c.342T>C	c.(340-342)aaT>aaC	p.N114N	UBA5_ENST00000473651.1_Silent_p.N114N|UBA5_ENST00000494238.2_Silent_p.N58N|UBA5_ENST00000493720.2_Silent_p.N114N|UBA5_ENST00000264991.4_Silent_p.N58N	NM_024818.3	NP_079094.1	Q9GZZ9	UBA5_HUMAN	ubiquitin-like modifier activating enzyme 5	114					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|UFM1 activating enzyme activity (GO:0071566)			breast(2)|endometrium(4)|kidney(4)|large_intestine(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CCAATATGAATAGACTTTTCT	0.338																																					p.N114N		.											.	UBA5-226	0			c.T342C						.						132.0	130.0	131.0					3																	132387706		2203	4298	6501	SO:0001819	synonymous_variant	79876	exon4			TATGAATAGACTT	AY253672	CCDS3076.1, CCDS3077.1	3q22	2007-11-30	2007-11-30	2007-11-30	ENSG00000081307	ENSG00000081307		"""Ubiquitin-like modifier activating enzymes"""	23230	protein-coding gene	gene with protein product	"""UBA5, ubiquitin-activating enzyme E1 homolog (yeast)"""	610552	"""ubiquitin-activating enzyme E1-domain containing 1"""	UBE1DC1		11230166, 15071506	Standard	NM_198329		Approved	FLJ23251	uc003epa.4	Q9GZZ9	OTTHUMG00000159759	ENST00000356232.4:c.342T>C	3.37:g.132387706T>C		72	0		100	48	NM_024818	0	0	12	31	19	A6NJL3|D3DNC8|Q96ST1	Silent	SNP	ENST00000356232.4	37	CCDS3076.1																																																																																			.		0.338	UBA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357187.2	NM_024818	
CRIPAK	285464	hgsc.bcm.edu	37	4	1388974	1388974	+	Silent	SNP	T	T	C	rs71614969	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:1388974T>C	ENST00000324803.4	+	1	3635	c.675T>C	c.(673-675)gaT>gaC	p.D225D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	225					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACGTGCCGATGCGGAGTGCC	0.667													N|||	706	0.140974	0.087	0.1888	5008	,	,		14021	0.0268		0.2326	False		,,,				2504	0.2035				p.D225D		.											.	CRIPAK-90	0			c.T675C						.						177.0	128.0	145.0					4																	1388974		2168	4272	6440	SO:0001819	synonymous_variant	285464	exon1			TGCCGATGCGGAG	AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.675T>C	4.37:g.1388974T>C		9	0		21	17	NM_175918	0	0	8	12	4	Q8NB03	Silent	SNP	ENST00000324803.4	37	CCDS3349.1																																																																																			C|1.000;|0.000		0.667	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241607.2	NM_175918	
OTOP1	133060	broad.mit.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																					p.104_106del		.											.	OTOP1-92	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)	c.310_318del						.																																			SO:0001651	inframe_deletion	133060	exon1			CAGCATCCACAGC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	16	0		81	8	NM_177998	0	0	0	0	0	A1L476	In_Frame_Del	DEL	ENST00000296358.4	37	CCDS3372.1																																																																																			.		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206661.2	NM_177998	
DRD5	1816	broad.mit.edu	37	4	9784478	9784478	+	Missense_Mutation	SNP	C	C	A	rs201762034		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:9784478C>A	ENST00000304374.2	+	1	1221	c.825C>A	c.(823-825)agC>agA	p.S275R		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	275					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.S275R(2)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GCCGGAGCAGCGCAGCCTGCG	0.637																																					p.S275R		.											.	DRD5-91	2	Substitution - Missense(2)	prostate(1)|lung(1)	c.C825A						.						24.0	23.0	23.0					4																	9784478		2200	4286	6486	SO:0001583	missense	1816	exon1			GAGCAGCGCAGCC	X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.825C>A	4.37:g.9784478C>A	ENSP00000306129:p.Ser275Arg	42	1		93	6	NM_000798	0	0	0	0	0	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	ENST00000304374.2	37	CCDS3405.1	.	.	.	.	.	.	.	.	.	.	c	3.108	-0.183303	0.06340	.	.	ENSG00000169676	ENST00000304374	T	0.68624	-0.34	4.6	-3.74	0.04385	GPCR, rhodopsin-like superfamily (1);	2.577270	0.01820	N	0.034008	T	0.47637	0.1456	L	0.33137	0.985	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.08597	-1.0714	10	0.18710	T	0.47	.	0.5996	0.00742	0.329:0.2707:0.11:0.2903	.	275	P21918	DRD5_HUMAN	R	275	ENSP00000306129:S275R	ENSP00000306129:S275R	S	+	3	2	DRD5	9393576	0.000000	0.05858	0.001000	0.08648	0.730000	0.41778	-0.494000	0.06451	-0.695000	0.05105	0.305000	0.20034	AGC	.		0.637	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250293.1		
RBM47	54502	hgsc.bcm.edu	37	4	40440854	40440854	+	Silent	SNP	G	G	C	rs1052153	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:40440854G>C	ENST00000381793.2	-	3	453	c.57C>G	c.(55-57)tcC>tcG	p.S19S	RBM47_ENST00000319592.4_Silent_p.S19S|RBM47_ENST00000295971.7_Silent_p.S19S|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000514014.1_Intron|RBM47_ENST00000381795.6_Silent_p.S19S			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	19					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GCACCTTGGCGGAGGACCCGG	0.662													C|||	4016	0.801917	0.6808	0.8588	5008	,	,		14653	0.7679		0.8837	False		,,,				2504	0.8763				p.S19S		.											.	RBM47-25	0			c.C57G						.	C	,	3111,1133		1151,809,162	8.0	9.0	9.0		57,57	-7.6	0.0	4	dbSNP_86	9	7487,919		3358,771,74	no	coding-synonymous,coding-synonymous	RBM47	NM_001098634.1,NM_019027.3	,	4509,1580,236	CC,CG,GG		10.9327,26.6965,16.2213	,	19/594,19/525	40440854	10598,2052	2122	4203	6325	SO:0001819	synonymous_variant	54502	exon4			CTTGGCGGAGGAC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.57C>G	4.37:g.40440854G>C		0	0		4	4	NM_001098634	0	0	0	1	1	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	ENST00000381793.2	37	CCDS43223.1																																																																																			G|0.794;C|0.206		0.662	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250456.2	NM_019027	
NMU	10874	hgsc.bcm.edu	37	4	56502304	56502304	+	Missense_Mutation	SNP	G	G	T	rs35771241	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:56502304G>T	ENST00000264218.3	-	1	161	c.56C>A	c.(55-57)gCg>gAg	p.A19E	NMU_ENST00000507338.1_Missense_Mutation_p.A19E|NMU_ENST00000515325.1_Intron|NMU_ENST00000511469.1_Missense_Mutation_p.A19E|NMU_ENST00000505262.1_Missense_Mutation_p.A19E	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	19					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		gagcGGGGACGCCGCGGCCAC	0.761													G|||	88	0.0175719	0.0038	0.0245	5008	,	,		10083	0.0		0.0577	False		,,,				2504	0.0082				p.A19E		.											.	NMU-650	0			c.C56A	GRCh37	CM066152	NMU	M	rs35771241	.	G	GLU/ALA	34,3224		0,34,1595	5.0	7.0	6.0		56	1.1	0.0	4	dbSNP_126	6	262,5824		1,260,2782	no	missense	NMU	NM_006681.2	107	1,294,4377	TT,TG,GG		4.305,1.0436,3.1678	benign	19/175	56502304	296,9048	1629	3043	4672	SO:0001583	missense	10874	exon1			GGGGACGCCGCGG	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.56C>A	4.37:g.56502304G>T	ENSP00000264218:p.Ala19Glu	0	0		24	13	NM_006681	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	64	0.029304029304029304	6	0.012195121951219513	16	0.04419889502762431	0	0.0	42	0.055408970976253295	G	14.57	2.576146	0.45902	0.010436	0.04305	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.38887	1.11;1.25;1.19;1.18	2.89	1.06	0.20224	.	0.337479	0.19087	U	0.123078	T	0.03959	0.0111	L	0.44542	1.39	0.09310	N	1	D	0.54397	0.966	P	0.45195	0.473	T	0.03784	-1.1004	10	0.52906	T	0.07	-8.0688	3.8411	0.08914	0.1476:0.2562:0.5962:0.0	rs35771241	19	P48645	NMU_HUMAN	E	19	ENSP00000422399:A19E;ENSP00000264218:A19E;ENSP00000424246:A19E;ENSP00000422870:A19E	ENSP00000264218:A19E	A	-	2	0	NMU	56197061	0.000000	0.05858	0.001000	0.08648	0.273000	0.26683	-0.032000	0.12266	0.255000	0.21593	0.195000	0.17529	GCG	G|0.970;T|0.030		0.761	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
FAM47E	100129583	hgsc.bcm.edu;broad.mit.edu	37	4	77189842	77189842	+	Missense_Mutation	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:77189842G>T	ENST00000424749.2	+	4	596	c.590G>T	c.(589-591)gGc>gTc	p.G197V	FAM47E-STBD1_ENST00000539752.1_5'UTR|FAM47E_ENST00000339906.6_Missense_Mutation_p.G84V|FAM47E_ENST00000515604.1_Missense_Mutation_p.G197V|FAM47E_ENST00000510197.1_Missense_Mutation_p.G84V	NM_001136570.2	NP_001130042.1	Q6ZV65	FA47E_HUMAN	family with sequence similarity 47, member E	197																	TCAAACGCAGGCCAATGGCTT	0.368																																					p.G197V		.											.	.	0			c.G590T						.						150.0	131.0	137.0					4																	77189842		692	1591	2283	SO:0001583	missense	0	exon4			ACGCAGGCCAATG	AC034139, AK124936, CR591456, CR627383	CCDS47081.1, CCDS58907.1	4q21.1	2013-04-23			ENSG00000189157	ENSG00000189157			34343	protein-coding gene	gene with protein product	"""similar to genethonin 1"""						Standard	NM_001136570		Approved	FLJ42946, LOC100129583	uc003hjx.3	Q6ZV65	OTTHUMG00000185390	ENST00000424749.2:c.590G>T	4.37:g.77189842G>T	ENSP00000409423:p.Gly197Val	61	0		86	5	NM_001242939	0	0	0	0	0	D6R8Y4	Missense_Mutation	SNP	ENST00000424749.2	37	CCDS47081.1	.	.	.	.	.	.	.	.	.	.	G	8.340	0.828386	0.16749	.	.	ENSG00000189157	ENST00000510197;ENST00000512895;ENST00000339906;ENST00000515604;ENST00000509377;ENST00000424749	T;T;T;T	0.46451	0.87;0.87;1.42;1.43	5.06	2.39	0.29439	.	2.695610	0.01325	N	0.011048	T	0.46795	0.1411	L	0.32530	0.975	0.09310	N	0.999993	D;D;B;P;P;P	0.56035	0.96;0.974;0.178;0.527;0.527;0.919	P;P;B;B;B;P	0.55965	0.788;0.719;0.101;0.286;0.286;0.51	T	0.30822	-0.9965	10	0.26408	T	0.33	0.7519	6.3448	0.21343	0.2978:0.0:0.7022:0.0	.	29;107;197;197;197;84	D6RCS4;D6RBT2;Q6ZV65-1;Q6ZV65;C9JTC9;Q6ZV65-2	.;.;.;FA47E_HUMAN;.;.	V	84;107;84;197;29;197	ENSP00000422262:G84V;ENSP00000340401:G84V;ENSP00000422067:G197V;ENSP00000409423:G197V	ENSP00000340401:G84V	G	+	2	0	FAM47E	77408866	0.000000	0.05858	0.035000	0.18076	0.042000	0.13812	0.225000	0.17757	0.794000	0.33899	-0.216000	0.12614	GGC	.		0.368	FAM47E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362528.2	NM_001136570	
DSPP	1834	bcgsc.ca	37	4	88536953	88536953	+	Missense_Mutation	SNP	G	G	A	rs200486992		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:88536953G>A	ENST00000282478.7	+	4	3172	c.3139G>A	c.(3139-3141)Gat>Aat	p.D1047N	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.D1047N			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1047	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgacagcagcgatagcagtga	0.527																																					p.D1047N		.											.	DSPP-90	0			c.G3139A						.						46.0	57.0	53.0					4																	88536953		1537	2773	4310	SO:0001583	missense	1834	exon5			AGCAGCGATAGCA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3139G>A	4.37:g.88536953G>A	ENSP00000282478:p.Asp1047Asn	606	8		932	40	NM_014208	0	0	0	0	0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	g	3.566	-0.088574	0.07097	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88201	-2.35;-2.35	1.51	-1.84	0.07809	.	.	.	.	.	T	0.78355	0.4270	L	0.34521	1.04	0.09310	N	1	B	0.26708	0.157	B	0.08055	0.003	T	0.61637	-0.7022	9	0.38643	T	0.18	.	5.2365	0.15448	0.5606:0.0:0.4394:0.0	.	1047	Q9NZW4	DSPP_HUMAN	N	1047	ENSP00000382213:D1047N;ENSP00000282478:D1047N	ENSP00000282478:D1047N	D	+	1	0	DSPP	88755977	0.032000	0.19561	0.079000	0.20413	0.006000	0.05464	0.451000	0.21779	-0.607000	0.05738	-0.791000	0.03333	GAT	.		0.527	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
FAT4	79633	broad.mit.edu	37	4	126408693	126408693	+	Missense_Mutation	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:126408693G>T	ENST00000394329.3	+	16	13023	c.13010G>T	c.(13009-13011)gGc>gTc	p.G4337V	FAT4_ENST00000335110.5_Missense_Mutation_p.G2578V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4337	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GACTTCGGTGGCCTTGATGTG	0.413																																					p.G4337V		.											.	FAT4-108	0			c.G13010T						.						74.0	72.0	73.0					4																	126408693		2203	4300	6503	SO:0001583	missense	79633	exon16			TCGGTGGCCTTGA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.13010G>T	4.37:g.126408693G>T	ENSP00000377862:p.Gly4337Val	85	1		102	3	NM_024582	0	0	0	0	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	14.60	2.583443	0.46006	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.77620	-1.11;-1.11	5.41	5.41	0.78517	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.34828	U	0.003642	D	0.87164	0.6109	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;0.977;1.0	D;P;D	0.97110	1.0;0.867;1.0	D	0.86710	0.1935	10	0.46703	T	0.11	.	18.1995	0.89833	0.0:0.0:1.0:0.0	.	2578;4337;4337	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	V	4337;2578	ENSP00000377862:G4337V;ENSP00000335169:G2578V	ENSP00000335169:G2578V	G	+	2	0	FAT4	126628143	1.000000	0.71417	0.972000	0.41901	0.094000	0.18550	8.746000	0.91604	2.532000	0.85374	0.650000	0.86243	GGC	.		0.413	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
INPP4B	8821	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	143324112	143324112	+	Silent	SNP	G	G	A			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr4:143324112G>A	ENST00000513000.1	-	8	784	c.351C>T	c.(349-351)gtC>gtT	p.V117V	INPP4B_ENST00000508116.1_Silent_p.V117V|INPP4B_ENST00000308502.4_Silent_p.V117V|INPP4B_ENST00000506217.1_Silent_p.V117V|INPP4B_ENST00000262992.4_Silent_p.V117V|INPP4B_ENST00000509777.1_Silent_p.V117V	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	117	C2.				cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					ACTTATCCTTGACATCATAGA	0.393																																					p.V117V		.											.	INPP4B-228	0			c.C351T						.						182.0	143.0	156.0					4																	143324112		2203	4300	6503	SO:0001819	synonymous_variant	8821	exon8			ATCCTTGACATCA	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.351C>T	4.37:g.143324112G>A		114	1		157	45	NM_003866	0	0	2	8	6	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Silent	SNP	ENST00000513000.1	37	CCDS3757.1																																																																																			.		0.393	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
SNX18	112574	hgsc.bcm.edu	37	5	53814052	53814052	+	Silent	SNP	T	T	C	rs2548615	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr5:53814052T>C	ENST00000326277.3	+	1	460	c.270T>C	c.(268-270)ccT>ccC	p.P90P	SNX18_ENST00000343017.6_Silent_p.P90P|SNX18_ENST00000381410.4_Silent_p.P90P	NM_052870.2	NP_443102.2	Q96RF0	SNX18_HUMAN	sorting nexin 18	90					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				AGCCCCTGCCTGTCGCGCCCC	0.791													N|||	4953	0.989018	0.9728	0.9942	5008	,	,		9287	1.0		0.9901	False		,,,				2504	0.9949				p.P90P		.											.	SNX18-226	0			c.T270C						.	C	,,	1635,19		808,19,0	1.0	2.0	2.0		270,270,270	-2.1	0.2	5	dbSNP_100	2	4035,67		1984,67,0	no	coding-synonymous,coding-synonymous,coding-synonymous	SNX18	NM_001102575.1,NM_001145427.1,NM_052870.2	,,	2792,86,0	CC,CT,TT		1.6333,1.1487,1.4941	,,	90/625,90/592,90/629	53814052	5670,86	827	2051	2878	SO:0001819	synonymous_variant	112574	exon1			CCTGCCTGTCGCG	AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000326277.3:c.270T>C	5.37:g.53814052T>C		0	0		4	4	NM_052870	0	0	0	1	1	B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	ENST00000326277.3	37	CCDS3962.1																																																																																			G|0.979;C|0.003		0.791	SNX18-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214072.2		
ZNF474	133923	broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	121488085	121488085	+	Missense_Mutation	SNP	C	C	A			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr5:121488085C>A	ENST00000296600.4	+	2	783	c.400C>A	c.(400-402)Cca>Aca	p.P134T	ZNF474_ENST00000514925.1_Intron|CTC-441N14.2_ENST00000504829.1_RNA|CTC-441N14.1_ENST00000505209.1_RNA	NM_207317.1	NP_997200.1	Q6S9Z5	ZN474_HUMAN	zinc finger protein 474	134							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|stomach(1)	21		all_cancers(142;0.229)|Prostate(80;0.0387)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000197)|Epithelial(69;0.00029)|all cancers(49;0.00415)		TTTGAGGAGGCCAGAACCCTC	0.532																																					p.P134T		.											.	ZNF474-90	0			c.C400A						.						80.0	71.0	74.0					5																	121488085		2203	4300	6503	SO:0001583	missense	133923	exon2			AGGAGGCCAGAAC	AK057483	CCDS4130.1	5q23.2	2008-02-05			ENSG00000164185	ENSG00000164185		"""Zinc fingers, C2H2-type"""	23245	protein-coding gene	gene with protein product							Standard	NM_207317		Approved	4933409D10Rik, FLJ32921	uc003ksv.3	Q6S9Z5	OTTHUMG00000128911	ENST00000296600.4:c.400C>A	5.37:g.121488085C>A	ENSP00000296600:p.Pro134Thr	73	1		157	50	NM_207317	0	0	0	0	0	A8K4M0|Q96M07	Missense_Mutation	SNP	ENST00000296600.4	37	CCDS4130.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320717	0.60634	.	.	ENSG00000164185	ENST00000296600	T	0.55413	0.52	5.28	5.28	0.74379	.	0.237912	0.37261	N	0.002176	T	0.59609	0.2206	M	0.68317	2.08	0.36364	D	0.860919	P	0.45283	0.855	P	0.48334	0.574	T	0.67142	-0.5745	10	0.40728	T	0.16	-6.468	14.8443	0.70249	0.0:0.8566:0.1434:0.0	.	134	Q6S9Z5	ZN474_HUMAN	T	134	ENSP00000296600:P134T	ENSP00000296600:P134T	P	+	1	0	ZNF474	121515984	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	1.424000	0.34848	2.624000	0.88883	0.655000	0.94253	CCA	.		0.532	ZNF474-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250883.2	NM_207317	
LMNB1	4001	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	126113295	126113297	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	AGA	AGA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr5:126113295_126113297delAGA	ENST00000261366.5	+	1	456_458	c.95_97delAGA	c.(94-99)gagaag>gag	p.K33del	LMNB1_ENST00000460265.1_3'UTR|RP11-434D11.4_ENST00000509185.2_lincRNA|LMNB1_ENST00000395354.1_In_Frame_Del_p.K33del	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	33	Head.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		CGGCTCCAGGAGAAGGAGGAGCT	0.724																																					p.32_33del		.											.	LMNB1-226	0			c.95_97del						.																																			SO:0001651	inframe_deletion	4001	exon1			TCCAGGAGAAGGA	L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.95_97delAGA	5.37:g.126113295_126113297delAGA	ENSP00000261366:p.Lys33del	59	0		260	61	NM_005573	0	0	0	0	0	B2R6J6|Q3SYN7|Q96EI6	In_Frame_Del	DEL	ENST00000261366.5	37	CCDS4140.1																																																																																			.		0.724	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250956.2	NM_005573	
SOWAHA	134548	hgsc.bcm.edu	37	5	132149684	132149684	+	Missense_Mutation	SNP	G	G	C	rs40274	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr5:132149684G>C	ENST00000378693.2	+	1	652	c.371G>C	c.(370-372)cGg>cCg	p.R124P		NM_175873.4	NP_787069.3	Q2M3V2	SWAHA_HUMAN	sosondowah ankyrin repeat domain family member A	124	Pro-rich.		R -> P (in dbSNP:rs40274).														CCCTTGGTCCGGGTGCCGCGG	0.776																																					p.R124P		.											.	.	0			c.G371C						.	C	PRO/ARG	2599,13		1293,13,0	2.0	3.0	3.0		371	-0.3	0.0	5	dbSNP_76	3	6177,193		2993,191,1	no	missense	ANKRD43	NM_175873.4	103	4286,204,1	CC,CG,GG		3.0298,0.4977,2.2935	benign	124/550	132149684	8776,206	1306	3185	4491	SO:0001583	missense	134548	exon1			TGGTCCGGGTGCC	AK090823	CCDS43361.1	5q23.3	2013-01-10	2012-01-12	2012-01-12	ENSG00000198944	ENSG00000198944		"""Ankyrin repeat domain containing"""	27033	protein-coding gene	gene with protein product			"""ankyrin repeat domain 43"""	ANKRD43		22234889	Standard	NM_175873		Approved		uc003kxw.3	Q2M3V2	OTTHUMG00000059844	ENST00000378693.2:c.371G>C	5.37:g.132149684G>C	ENSP00000367965:p.Arg124Pro	0	0		8	8	NM_175873	0	0	0	0	0	Q8NAE7	Missense_Mutation	SNP	ENST00000378693.2	37	CCDS43361.1	2142	0.9807692307692307	482	0.9796747967479674	357	0.9861878453038674	562	0.9825174825174825	741	0.9775725593667546	c	9.833	1.188835	0.21954	0.995023	0.969702	ENSG00000198944	ENST00000378693	T	0.38077	1.16	4.27	-0.265	0.12946	.	2.345400	0.02245	N	0.066177	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.36261	-0.9755	9	0.30078	T	0.28	-5.2019	3.6102	0.08057	0.2245:0.4439:0.2467:0.085	rs40274	124	Q2M3V2	ANR43_HUMAN	P	124	ENSP00000367965:R124P	ENSP00000367965:R124P	R	+	2	0	ANKRD43	132177583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.768000	0.01794	-0.003000	0.14444	-3.153000	0.00058	CGG	G|0.980;C|0.020		0.776	SOWAHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133062.1	NM_175873	
RANBP17	64901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	170640671	170640671	+	Silent	SNP	T	T	A			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr5:170640671T>A	ENST00000523189.1	+	21	2432	c.2268T>A	c.(2266-2268)gtT>gtA	p.V756V	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	756					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGAATGCTGTTGAACGGTGGT	0.403			T	TRD@	ALL																																p.V756V		.		Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	RANBP17-524	0			c.T2268A						.						194.0	182.0	186.0					5																	170640671		2203	4300	6503	SO:0001819	synonymous_variant	64901	exon21			TGCTGTTGAACGG	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2268T>A	5.37:g.170640671T>A		101	0		234	65	NM_022897	0	0	6	6	0	Q8IU74	Silent	SNP	ENST00000523189.1	37	CCDS34287.1																																																																																			.		0.403	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000372036.1	NM_022897	
TMEM14B	81853	ucsc.edu	37	6	10756712	10756712	+	Silent	SNP	C	C	T	rs143087269	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr6:10756712C>T	ENST00000379542.5	+	6	473	c.306C>T	c.(304-306)gcC>gcT	p.A102A	RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000481240.1_Intron|TMEM14B_ENST00000473276.1_Missense_Mutation_p.R43C|SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000467317.1_Intron|TMEM14B_ENST00000379530.3_Silent_p.A68A|TMEM14B_ENST00000491103.1_3'UTR	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B	102						integral component of membrane (GO:0016021)		p.A102A(2)		NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TGCTGATGGCCGCCAAAGTTG	0.383																																					p.A102A		.											.	TMEM14B-90	2	Substitution - coding silent(2)	prostate(1)|central_nervous_system(1)	c.C306T						.						153.0	131.0	138.0					6																	10756712		2203	4300	6503	SO:0001819	synonymous_variant	81853	exon6			GATGGCCGCCAAA	AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.306C>T	6.37:g.10756712C>T		140	11		101	22	NM_030969	0	0	47	47	0	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	Silent	SNP	ENST00000379542.5	37	CCDS4515.1	.	.	.	.	.	.	.	.	.	.	C	9.245	1.039323	0.19669	.	.	ENSG00000137210	ENST00000473276	T	0.59083	0.29	3.75	-2.69	0.06022	.	.	.	.	.	T	0.50599	0.1625	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61763	-0.6996	6	0.87932	D	0	.	10.1452	0.42760	0.0:0.2374:0.0:0.7626	.	.	.	.	C	43	ENSP00000420580:R43C	ENSP00000420580:R43C	R	+	1	0	TMEM14B	10864698	0.990000	0.36364	0.985000	0.45067	0.897000	0.52465	-0.257000	0.08745	-0.525000	0.06391	-0.312000	0.09012	CGC	C|0.996;T|0.004		0.383	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039836.1	NM_030969	
KCNK17	89822	hgsc.bcm.edu	37	6	39282036	39282036	+	Missense_Mutation	SNP	T	T	C	rs10947804	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr6:39282036T>C	ENST00000373231.4	-	1	293	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	KCNK17_ENST00000453413.2_Missense_Mutation_p.S21G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	21			S -> G (in dbSNP:rs10947804). {ECO:0000269|PubMed:11248242, ECO:0000269|PubMed:15489334}.		potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGCACGGTGCTGGGCACCGCG	0.761													T|||	2917	0.582468	0.8858	0.4553	5008	,	,		12417	0.4673		0.4851	False		,,,				2504	0.4816				p.S21G		.											.	KCNK17-227	0			c.A61G						.	T	GLY/SER,GLY/SER	3100,536		1364,372,82	3.0	4.0	3.0		61,61	2.1	0.0	6	dbSNP_120	3	4061,3263		1251,1559,852	yes	missense,missense	KCNK17	NM_001135111.1,NM_031460.3	56,56	2615,1931,934	CC,CT,TT		44.5522,14.7415,34.6624	benign,benign	21/272,21/333	39282036	7161,3799	1818	3662	5480	SO:0001583	missense	89822	exon1			CGGTGCTGGGCAC	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.61A>G	6.37:g.39282036T>C	ENSP00000362328:p.Ser21Gly	2	0		19	15	NM_001135111	0	0	0	0	0	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Missense_Mutation	SNP	ENST00000373231.4	37	CCDS4842.1	1214	0.5558608058608059	431	0.8760162601626016	173	0.47790055248618785	244	0.42657342657342656	366	0.48284960422163586	T	8.033	0.762256	0.15914	0.852585	0.554478	ENSG00000124780	ENST00000373231;ENST00000453413	T;T	0.56776	0.44;0.44	4.06	2.09	0.27110	.	1.425750	0.04586	N	0.395947	T	0.14184	0.0343	N	0.17082	0.46	0.80722	P	0.0	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.09122	-1.0689	9	0.21014	T	0.42	.	5.3388	0.15973	0.0:0.5516:0.0:0.4484	rs10947804;rs17845776;rs17858736;rs60349641	21;21	E9PB46;Q96T54	.;KCNKH_HUMAN	G	21	ENSP00000362328:S21G;ENSP00000401271:S21G	ENSP00000362328:S21G	S	-	1	0	KCNK17	39390014	0.000000	0.05858	0.003000	0.11579	0.032000	0.12392	-0.229000	0.09098	0.383000	0.24910	0.459000	0.35465	AGC	T|0.441;C|0.559		0.761	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
PEX6	5190	hgsc.bcm.edu	37	6	42946490	42946490	+	Silent	SNP	C	C	A	rs9462858	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr6:42946490C>A	ENST00000304611.8	-	1	468	c.399G>T	c.(397-399)gtG>gtT	p.V133V	PEX6_ENST00000244546.4_Silent_p.V133V	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	133					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GCGGTCCGGGCACTGGGAGGG	0.746													C|||	1662	0.331869	0.3691	0.3516	5008	,	,		10923	0.1002		0.4612	False		,,,				2504	0.3732				p.V133V		.											.	PEX6-91	0			c.G399T						.	C		1002,2080		214,574,753	2.0	3.0	3.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	399	2.1	0.9	6	dbSNP_119	3	2653,4001		636,1381,1310	no	coding-synonymous	PEX6	NM_000287.3		850,1955,2063	AA,AC,CC		39.8708,32.5114,37.5411		133/981	42946490	3655,6081	1541	3327	4868	SO:0001819	synonymous_variant	5190	exon1			TCCGGGCACTGGG	U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.399G>T	6.37:g.42946490C>A		0	0		8	7	NM_000287	0	0	0	2	2	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Silent	SNP	ENST00000304611.8	37	CCDS4877.1																																																																																			C|0.673;A|0.327		0.746	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040569.1	NM_000287	
HOXA9	3205	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	27203337	27203337	+	Missense_Mutation	SNP	C	C	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr7:27203337C>G	ENST00000343483.6	-	2	776	c.704G>C	c.(703-705)cGc>cCc	p.R235P	RP1-170O19.20_ENST00000465941.1_5'UTR|HOXA9_ENST00000396345.1_3'UTR|HOXA9_ENST00000497089.1_5'UTR|RP1-170O19.20_ENST00000470747.4_Missense_Mutation_p.R75P	NM_152739.3	NP_689952.1	P31269	HXA9_HUMAN	homeobox A9	235					endothelial cell activation (GO:0042118)|multicellular organismal development (GO:0007275)|negative regulation of myeloid cell differentiation (GO:0045638)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(1)|lung(5)|prostate(1)	8						CTCGTACCTGCGGTCCCTGGT	0.522			T	"""NUP98, MSI2"""	AML*																																p.R235P		.		Dom	yes		7	7p15-p14.2	3205	homeo box A9		L	.	HOXA9-1082	0			c.G704C						.						154.0	143.0	147.0					7																	27203337		2203	4300	6503	SO:0001583	missense	3205	exon2			TACCTGCGGTCCC		CCDS5409.1	7p15.2	2011-06-20	2005-12-22		ENSG00000078399	ENSG00000078399		"""Homeoboxes / ANTP class : HOXL subclass"""	5109	protein-coding gene	gene with protein product		142956	"""homeo box A9"""	HOX1G, HOX1		1973146, 1358459	Standard	NM_152739		Approved		uc003syt.3	P31269	OTTHUMG00000023220	ENST00000343483.6:c.704G>C	7.37:g.27203337C>G	ENSP00000343619:p.Arg235Pro	119	0		143	56	NM_152739	0	0	0	1	1	O43369|O43429|Q99820	Missense_Mutation	SNP	ENST00000343483.6	37	CCDS5409.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.600404	0.87055	.	.	ENSG00000078399;ENSG00000078399;ENSG00000078399;ENSG00000257184	ENST00000343483;ENST00000354032;ENST00000242050;ENST00000470747	D;D	0.96168	-3.93;-3.93	5.21	5.21	0.72293	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000007	D	0.98295	0.9435	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99293	1.0899	10	0.87932	D	0	.	18.1323	0.89605	0.0:1.0:0.0:0.0	.	235	P31269	HXA9_HUMAN	P	235;159;226;75	ENSP00000343619:R235P;ENSP00000421799:R75P	ENSP00000242050:R226P	R	-	2	0	RP1-170O19.20;HOXA9	27169862	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.623000	0.88846	0.561000	0.74099	CGC	.		0.522	HOXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358706.2		
GARS	2617	hgsc.bcm.edu	37	7	30634630	30634630	+	Silent	SNP	G	G	C	rs2529438	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr7:30634630G>C	ENST00000389266.3	+	1	334	c.93G>C	c.(91-93)ctG>ctC	p.L31L	AC005154.6_ENST00000581665.1_RNA|AC005154.6_ENST00000584199.1_RNA|AC005154.6_ENST00000580440.1_RNA|AC005154.6_ENST00000579174.1_RNA|AC005154.6_ENST00000583664.1_RNA|AC005154.6_ENST00000584372.1_RNA|AC005154.6_ENST00000578994.1_RNA|AC005154.6_ENST00000582549.1_RNA	NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	31					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	CCTCGCTCCTGCTCCGCCGGT	0.741													G|||	705	0.140775	0.1218	0.0994	5008	,	,		12290	0.1776		0.0726	False		,,,				2504	0.228				p.L31L		.											.	GARS-91	0			c.G93C						.	G		360,3594		14,332,1631	6.0	8.0	7.0		93	2.7	0.0	7	dbSNP_100	7	669,7413		24,621,3396	no	coding-synonymous	GARS	NM_002047.2		38,953,5027	CC,CG,GG		8.2777,9.1047,8.5494		31/740	30634630	1029,11007	1977	4041	6018	SO:0001819	synonymous_variant	2617	exon1			GCTCCTGCTCCGC	AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.93G>C	7.37:g.30634630G>C		1	0		35	20	NM_002047	0	0	11	24	13	B3KQA2|B4DIA0|Q969Y1	Silent	SNP	ENST00000389266.3	37	CCDS43564.1																																																																																			G|0.889;C|0.111		0.741	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327735.1	NM_002047	
GSAP	54103	bcgsc.ca	37	7	76950699	76950699	+	Missense_Mutation	SNP	C	C	T	rs17151692	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr7:76950699C>T	ENST00000257626.7	-	25	2023	c.1945G>A	c.(1945-1947)Gta>Ata	p.V649I	GSAP_ENST00000441833.2_Intron|GSAP_ENST00000440473.1_5'UTR	NM_017439.3	NP_059135.2	A4D1B5	GSAP_HUMAN	gamma-secretase activating protein	649			V -> I (in dbSNP:rs17151692).		positive regulation of beta-amyloid formation (GO:1902004)|regulation of proteolysis (GO:0030162)	trans-Golgi network (GO:0005802)	beta-amyloid binding (GO:0001540)										TTGGTTTCTACGATGTGGCAA	0.463													C|||	403	0.0804712	0.1611	0.0447	5008	,	,		21096	0.0089		0.0845	False		,,,				2504	0.0665				p.V649I		.											.	PION-514	0			c.G1945A						.	C	ILE/VAL	555,3389		36,483,1453	119.0	117.0	117.0		1945	-0.9	0.1	7	dbSNP_123	117	755,7579		28,699,3440	yes	missense	PION	NM_017439.3	29	64,1182,4893	TT,TC,CC		9.0593,14.072,10.6695	benign	649/855	76950699	1310,10968	1972	4167	6139	SO:0001583	missense	54103	exon25			TTTCTACGATGTG		CCDS34672.2	7q11.23	2013-04-05	2013-04-05	2013-04-05	ENSG00000186088	ENSG00000186088			28042	protein-coding gene	gene with protein product		613552	"""pigeon homolog (Drosophila)"""	PION		20811458	Standard	NM_017439		Approved	LOC54103	uc003ugf.3	A4D1B5	OTTHUMG00000150504	ENST00000257626.7:c.1945G>A	7.37:g.76950699C>T	ENSP00000257626:p.Val649Ile	163	0		236	7	NM_017439	0	0	3	3	0	A4D1B6|Q3MJC0|Q8ND73|Q9UMH3|Q9Y4L9	Missense_Mutation	SNP	ENST00000257626.7	37	CCDS34672.2	185	0.08470695970695971	88	0.17886178861788618	23	0.06353591160220995	6	0.01048951048951049	68	0.08970976253298153	C	7.281	0.609096	0.14066	0.14072	0.090593	ENSG00000186088	ENST00000257626;ENST00000415112	T;T	0.30182	1.54;1.54	5.56	-0.929	0.10444	.	0.537583	0.18979	N	0.125926	T	0.00039	0.0001	N	0.14661	0.345	0.21897	P	0.999484972	B	0.19445	0.036	B	0.09377	0.004	T	0.20009	-1.0288	9	0.54805	T	0.06	.	4.3285	0.11051	0.07:0.3403:0.2441:0.3456	rs17151692;rs56813531;rs17151692	649	A4D1B5	GSAP_HUMAN	I	649;102	ENSP00000257626:V649I;ENSP00000396230:V102I	ENSP00000257626:V649I	V	-	1	0	PION	76788635	0.208000	0.23494	0.059000	0.19551	0.047000	0.14425	-0.038000	0.12144	-0.084000	0.12595	-0.891000	0.02926	GTA	C|0.907;T|0.093		0.463	GSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318672.2	NM_017439	
PODXL	5420	hgsc.bcm.edu	37	7	131241030	131241035	+	In_Frame_Del	DEL	GGCGAC	GGCGAC	-	rs11277659|rs547816245|rs532078953	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	GGCGAC	GGCGAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr7:131241030_131241035delGGCGAC	ENST00000378555.3	-	1	331_336	c.84_89delGTCGCC	c.(82-90)ccgtcgccc>ccc	p.28_30PSP>P	PODXL_ENST00000537928.1_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000322985.9_In_Frame_Del_p.28_30PSP>P|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_In_Frame_Del_p.28_30PSP>P			O00592	PODXL_HUMAN	podocalyxin-like	28					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)		p.P30_S31delPS(2)		NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ATTCTGGGAGggcgacggcgacggcg	0.748																																					p.28_30del		.											.	PODXL-136	2	Deletion - In frame(2)	prostate(2)	c.84_89del						.																																			SO:0001651	inframe_deletion	5420	exon1			TGGGAGGGCGACG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.84_89delGTCGCC	7.37:g.131241036_131241041delGGCGAC	ENSP00000367817:p.Pro30_Ser31del	1	0		38	19	NM_001018111	0	0	0	0	0	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Del	DEL	ENST00000378555.3	37	CCDS34755.1																																																																																			.		0.748	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
CNTNAP2	26047	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	146805372	146805372	+	Silent	SNP	A	A	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr7:146805372A>G	ENST00000361727.3	+	5	1200	c.684A>G	c.(682-684)ggA>ggG	p.G228G		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	228	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TCCTGCACGGAGAAGGACAGC	0.388										HNSCC(39;0.1)																											p.G228G		.											.	CNTNAP2-100	0			c.A684G						.						129.0	118.0	122.0					7																	146805372		2203	4300	6503	SO:0001819	synonymous_variant	26047	exon5			GCACGGAGAAGGA	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.684A>G	7.37:g.146805372A>G		114	0		153	67	NM_014141	0	0	0	0	0	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	ENST00000361727.3	37	CCDS5889.1																																																																																			.		0.388	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
KRBA1	84626	broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	149427272	149427272	+	Missense_Mutation	SNP	G	G	C			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr7:149427272G>C	ENST00000485033.2	+	12	1663	c.1663G>C	c.(1663-1665)Gag>Cag	p.E555Q	KRBA1_ENST00000255992.10_Missense_Mutation_p.E615Q|KRBA1_ENST00000479560.1_3'UTR|KRBA1_ENST00000319551.8_Missense_Mutation_p.E555Q			A5PL33	KRBA1_HUMAN	KRAB-A domain containing 1	616										breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(17)|ovary(1)|prostate(1)	27	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCACTGCCTGGAGAGCGCCCT	0.677																																					.		.											.	KRBA1-91	0			.						.						7.0	9.0	8.0					7																	149427272		1898	4097	5995	SO:0001583	missense	84626	.			TGCCTGGAGAGCG	AB058765	CCDS75674.1	7q36	2014-02-12	2006-08-15		ENSG00000133619	ENSG00000133619		"""-"""	22228	protein-coding gene	gene with protein product			"""KRAB A domain containing 1"""				Standard	NM_001290187		Approved	KIAA1862	uc003wfz.3	A5PL33	OTTHUMG00000157886	ENST00000485033.2:c.1663G>C	7.37:g.149427272G>C	ENSP00000420112:p.Glu555Gln	87	1		150	51	.	0	0	0	1	1	A7E2F5|E7ENE9|Q8N4X0|Q96JG5	Missense_Mutation	SNP	ENST00000485033.2	37		.	.	.	.	.	.	.	.	.	.	G	17.49	3.403389	0.62288	.	.	ENSG00000133619	ENST00000255992;ENST00000319551;ENST00000485033	T;T;T	0.54279	0.58;1.3;1.3	5.57	5.57	0.84162	.	0.000000	0.48286	D	0.000185	T	0.68650	0.3024	.	.	.	0.27817	N	0.94194	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.62558	-0.6829	9	0.33141	T	0.24	-26.7015	15.047	0.71835	0.0:0.0:1.0:0.0	.	555;616	E7ENE9;A5PL33	.;KRBA1_HUMAN	Q	615;555;555	ENSP00000255992:E615Q;ENSP00000317165:E555Q;ENSP00000420112:E555Q	ENSP00000255992:E615Q	E	+	1	0	KRBA1	149058205	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	2.884000	0.48562	2.619000	0.88677	0.561000	0.74099	GAG	.		0.677	KRBA1-004	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000349841.3	NM_032534	
ABCB8	11194	ucsc.edu;bcgsc.ca;mdanderson.org	37	7	150731630	150731630	+	Silent	SNP	C	C	T	rs114212581	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr7:150731630C>T	ENST00000297504.6	+	5	720	c.654C>T	c.(652-654)caC>caT	p.H218H	ABCB8_ENST00000498578.1_Silent_p.H201H|ABCB8_ENST00000477719.1_Silent_p.H201H|ABCB8_ENST00000542328.1_Silent_p.H113H|ABCB8_ENST00000356058.4_Silent_p.H238H|ABCB8_ENST00000493338.1_3'UTR|ABCB8_ENST00000358849.4_Silent_p.H201H|ABCB8_ENST00000477092.1_Silent_p.H201H			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	218	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	TGCTGTCCCACGTTGGCGAGC	0.672													c|||	55	0.0109824	0.0378	0.0058	5008	,	,		18771	0.001		0.0	False		,,,				2504	0.0				p.H201H		.											.	ABCB8-108	0			c.C603T						.	T		151,4255	106.0+/-144.5	5,141,2057	90.0	88.0	89.0		603	-0.2	0.9	7	dbSNP_132	89	2,8598		0,2,4298	no	coding-synonymous	ABCB8	NM_007188.3		5,143,6355	TT,TC,CC		0.0233,3.4271,1.1764		201/719	150731630	153,12853	2203	4300	6503	SO:0001819	synonymous_variant	11194	exon4			GTCCCACGTTGGC	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.654C>T	7.37:g.150731630C>T		63	1		86	40	NM_007188	0	0	27	70	43	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Silent	SNP	ENST00000297504.6	37																																																																																				C|0.989;T|0.011		0.672	ABCB8-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351733.2	NM_007188	
REEP4	80346	broad.mit.edu	37	8	21996554	21996554	+	Silent	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr8:21996554G>T	ENST00000306306.3	-	6	906	c.438C>A	c.(436-438)ggC>ggA	p.G146G	REEP4_ENST00000523293.1_Silent_p.G146G|REEP4_ENST00000334530.5_Intron	NM_025232.2	NP_079508.2	Q9H6H4	REEP4_HUMAN	receptor accessory protein 4	146					mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|nuclear envelope organization (GO:0006998)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)	microtubule binding (GO:0008017)			kidney(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	7				Colorectal(74;0.00187)|COAD - Colon adenocarcinoma(73;0.061)|READ - Rectum adenocarcinoma(644;0.0993)		TCCGCAGCCTGCCGGCCAGCG	0.662																																					p.G146G		.											.	REEP4-91	0			c.C438A						.																																			SO:0001819	synonymous_variant	80346	exon6			CAGCCTGCCGGCC	BC013048	CCDS6024.1	8p21.3	2008-05-02	2006-02-07	2006-02-07	ENSG00000168476	ENSG00000168476		"""Receptor accessory proteins"""	26176	protein-coding gene	gene with protein product		609349	"""chromosome 8 open reading frame 20"""	C8orf20		16271481, 15550249	Standard	NM_025232		Approved	FLJ22246, FLJ22277, PP432	uc003xau.1	Q9H6H4	OTTHUMG00000131491	ENST00000306306.3:c.438C>A	8.37:g.21996554G>T		40	0		29	5	NM_025232	0	0	24	25	1	D3DSQ9|Q86VL1|Q9H6I5|Q9HBP4	Silent	SNP	ENST00000306306.3	37	CCDS6024.1																																																																																			.		0.662	REEP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254337.2	NM_025232	
ADAM7	8756	bcgsc.ca	37	8	24342791	24342791	+	Splice_Site	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr8:24342791G>T	ENST00000175238.6	+	10	960	c.877G>T	c.(877-879)Ggg>Tgg	p.G293W	ADAM7_ENST00000380789.1_Splice_Site_p.G293W|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM7_ENST00000520720.1_Splice_Site_p.G65W	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	293	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TTTTCATAGTGGGAAGTGGCT	0.398																																					p.G293W		.											.	ADAM7-230	0			c.G877T						.						144.0	137.0	139.0					8																	24342791		2203	4300	6503	SO:0001630	splice_region_variant	8756	exon10			CATAGTGGGAAGT	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.876-1G>T	8.37:g.24342791G>T		72	0		58	4	NM_003817	0	0	0	0	0	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	37	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.947835	0.53186	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	T;T;T	0.34667	1.35;1.35;1.35	5.44	5.44	0.79542	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.56097	D	0.000034	T	0.70211	0.3198	H	0.94222	3.51	0.41734	D	0.989579	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79305	-0.1858	10	0.87932	D	0	.	14.8368	0.70190	0.0:0.0:1.0:0.0	.	65;293	E5RK87;Q9H2U9	.;ADAM7_HUMAN	W	293;293;65;108	ENSP00000175238:G293W;ENSP00000370166:G293W;ENSP00000430400:G65W	ENSP00000175238:G293W	G	+	1	0	ADAM7	24398681	1.000000	0.71417	1.000000	0.80357	0.437000	0.31866	4.449000	0.60034	2.569000	0.86673	0.644000	0.83932	GGG	.		0.398	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	Missense_Mutation
PABPC1	26986	bcgsc.ca	37	8	101730010	101730010	+	Missense_Mutation	SNP	T	T	C	rs201501488	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr8:101730010T>C	ENST00000318607.5	-	3	1622	c.494A>G	c.(493-495)gAt>gGt	p.D165G	PABPC1_ENST00000519596.1_5'Flank|PABPC1_ENST00000522387.1_Missense_Mutation_p.D133G|PABPC1_ENST00000519004.1_Missense_Mutation_p.D120G	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	165	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CACTTTGCGATCATTTAGGAG	0.318																																					p.D165G		.											.	PABPC1-68	0			c.A494G						.						61.0	57.0	58.0					8																	101730010		2203	4299	6502	SO:0001583	missense	26986	exon3			TTGCGATCATTTA	Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.494A>G	8.37:g.101730010T>C	ENSP00000313007:p.Asp165Gly	159	2		106	11	NM_002568	0	0	0	0	0	Q15097|Q93004	Missense_Mutation	SNP	ENST00000318607.5	37	CCDS6289.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	13.86|13.86|13.86	2.362843|2.362843|2.362843	0.41902|0.41902|0.41902	.|.|.	.|.|.	ENSG00000070756|ENSG00000070756|ENSG00000070756	ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387|ENST00000519100|ENST00000523555	T;T;T|.|.	0.70164|.|.	-0.46;-0.46;3.8|.|.	5.06|5.06|5.06	5.06|5.06|5.06	0.68205|0.68205|0.68205	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.|.	0.000000|.|.	0.64402|.|.	D|.|.	0.000006|.|.	T|T|.	0.14570|0.14570|.	0.0352|0.0352|.	N|N|N	0.00185|0.00185|0.00185	-1.9|-1.9|-1.9	0.80722|0.80722|0.80722	D|D|D	1|1|1	B;B;B|.|.	0.17852|.|.	0.024;0.002;0.01|.|.	B;B;B|.|.	0.22753|.|.	0.041;0.033;0.03|.|.	T|T|.	0.30621|0.30621|.	-0.9972|-0.9972|.	10|5|.	0.20046|.|.	T|.|.	0.44|.|.	.|.|.	15.1001|15.1001|15.1001	0.72269|0.72269|0.72269	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.|.	133;165;165|.|.	E7ERJ7;B3KT93;P11940|.|.	.;.;PABP1_HUMAN|.|.	G|V|W	165;165;120;133|37|111	ENSP00000313007:D165G;ENSP00000429594:D120G;ENSP00000429395:D133G|.|.	ENSP00000313007:D165G|.|.	D|I|X	-|-|-	2|1|3	0|0|0	PABPC1|PABPC1|PABPC1	101799186|101799186|101799186	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.969000|0.969000|0.969000	0.65631|0.65631|0.65631	8.020000|8.020000|8.020000	0.88740|0.88740|0.88740	2.032000|2.032000|2.032000	0.59987|0.59987|0.59987	0.455000|0.455000|0.455000	0.32223|0.32223|0.32223	GAT|ATC|TGA	T|0.984;C|0.016		0.318	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380217.1	NM_002568	
MAL2	114569	hgsc.bcm.edu	37	8	120220776	120220776	+	Splice_Site	DEL	G	G	-	rs398009582|rs71302978		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr8:120220776delG	ENST00000276681.6	+	1	167	c.65delG	c.(64-66)cgg>cg	p.R22fs	MAL2_ENST00000521748.1_3'UTR	NM_052886.2	NP_443118.1	Q969L2	MAL2_HUMAN	mal, T-cell differentiation protein 2 (gene/pseudogene)	22						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)						all_cancers(13;1.91e-26)|Lung NSC(37;8.61e-08)|Ovarian(258;0.018)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000967)			CCGCCGCCCCGGGGTCACCCT	0.771													GGG|GGGG|GGG|insertion	5008	1.0	1.0	1.0	5008	,	,		6681	1.0		1.0	False		,,,				2504	1.0				.		.											.	.	0			c.64+1G>-						.			1571,11		785,1,5	1.0	1.0	1.0			0.7	0.8	8	dbSNP_130	1	4116,22		2057,2,10	no	frameshift	MAL2	NM_052886.2		2842,3,15	A1A1,A1R,RR		0.5317,0.6953,0.5769			120220776	5687,33	184	483	667	SO:0001630	splice_region_variant	114569	exon1			CGCCCCGGGGTCA	AL117612	CCDS75780.1	8q23	2011-01-26	2011-01-26			ENSG00000147676			13634	protein-coding gene	gene with protein product	"""MAL proteolipid protein 2"""	609684				11549320	Standard	NM_052886		Approved		uc003yop.3	Q969L2		ENST00000276681.6:c.66+1G>-	8.37:g.120220776delG		0	0		14	14	NM_052886	0	0	0	0	0	B2R520|Q6ZMD9	Splice_Site	DEL	ENST00000276681.6	37																																																																																				.		0.771	MAL2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052886	Frame_Shift_Del
ZNF696	79943	hgsc.bcm.edu	37	8	144378868	144378868	+	Silent	SNP	A	A	G	rs7386259	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr8:144378868A>G	ENST00000330143.3	+	3	1432	c.1023A>G	c.(1021-1023)cgA>cgG	p.R341R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GGCACCAGCGACTCCACACGG	0.726													G|||	4505	0.899561	0.9425	0.9179	5008	,	,		11520	0.8403		0.8608	False		,,,				2504	0.9294				p.R341R		.											.	ZNF696-90	0			c.A1023G						.	G		3773,275		1771,231,22	5.0	5.0	5.0		1023	-0.3	0.0	8	dbSNP_116	5	6735,1261		2843,1049,106	no	coding-synonymous	ZNF696	NM_030895.2		4614,1280,128	GG,GA,AA		15.7704,6.7935,12.7532		341/375	144378868	10508,1536	2024	3998	6022	SO:0001819	synonymous_variant	79943	exon3			CCAGCGACTCCAC	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.1023A>G	8.37:g.144378868A>G		0	0		8	7	NM_030895	0	0	0	0	0	A0AVE2	Silent	SNP	ENST00000330143.3	37	CCDS6399.1																																																																																			A|0.118;G|0.882		0.726	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
EPPK1	83481	bcgsc.ca	37	8	144941419	144941419	+	Silent	SNP	C	C	T	rs12681478	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr8:144941419C>T	ENST00000525985.1	-	2	6074	c.6003G>A	c.(6001-6003)gcG>gcA	p.A2001A				P58107	EPIPL_HUMAN	epiplakin 1	2001						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCAGTGCCTCCGCCTTCTCGA	0.642													C|||	1066	0.212859	0.0113	0.33	5008	,	,		18060	0.1399		0.3708	False		,,,				2504	0.3149				p.A2001A		.											.	EPPK1-25	0			c.G6003A						.	C		369,3945		22,325,1810	35.0	39.0	37.0		6003	-3.7	0.0	8	dbSNP_120	37	3411,5111		676,2059,1526	no	coding-synonymous	EPPK1	NM_031308.1		698,2384,3336	TT,TC,CC		40.0258,8.5535,29.4484		2001/2420	144941419	3780,9056	2157	4261	6418	SO:0001819	synonymous_variant	83481	exon1			TGCCTCCGCCTTC	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6003G>A	8.37:g.144941419C>T		151	1		114	6	NM_031308	0	0	0	0	0	Q76E58|Q9NSU9	Silent	SNP	ENST00000525985.1	37																																																																																				C|0.740;T|0.260		0.642	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
ZNF517	340385	hgsc.bcm.edu	37	8	146033347	146033347	+	Missense_Mutation	SNP	T	T	C	rs2976653	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr8:146033347T>C	ENST00000531720.1	+	4	1091	c.1046T>C	c.(1045-1047)gTg>gCg	p.V349A	ZNF517_ENST00000359971.3_Missense_Mutation_p.V349A|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000526178.1_Intron			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	349				V -> A (in Ref. 1; BAD18586). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GACGGCGGCGTGGGGCAGGGC	0.746													C|||	4981	0.994609	1.0	1.0	5008	,	,		12856	1.0		0.994	False		,,,				2504	0.9785				p.V349A		.											.	ZNF517-90	0			c.T1046C						.	C	ALA/VAL	3411,3		1704,3,0	3.0	5.0	4.0		1046	-0.8	0.0	8	dbSNP_101	4	7050,46		3502,46,0	no	missense	ZNF517	NM_213605.2	64	5206,49,0	CC,CT,TT		0.6483,0.0879,0.4662	benign	349/493	146033347	10461,49	1707	3548	5255	SO:0001583	missense	340385	exon5			GCGGCGTGGGGCA	AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.1046T>C	8.37:g.146033347T>C	ENSP00000436103:p.Val349Ala	0	0		10	10	NM_213605	0	0	0	1	1		Missense_Mutation	SNP	ENST00000531720.1	37	CCDS6434.1	2179|2179	0.9977106227106227|0.9977106227106227	492|492	1.0|1.0	362|362	1.0|1.0	572|572	1.0|1.0	753|753	0.9934036939313984|0.9934036939313984	C|C	0.021|0.021	-1.418607|-1.418607	0.01136|0.01136	0.999121|0.999121	0.993517|0.993517	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.05319|.	3.46;3.46|.	2.17|2.17	-0.838|-0.838	0.10762|0.10762	.|.	.|.	.|.	.|.	.|.	T|T	0.00012|0.00012	0.0000|0.0000	L|L	0.35644|0.35644	1.08|1.08	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.21449|0.21449	-1.0245|-1.0245	8|4	0.59425|.	D|.	0.04|.	.|.	0.241|0.241	0.00192|0.00192	0.362:0.2246:0.2135:0.1999|0.362:0.2246:0.2135:0.1999	rs2976653;rs59817342|rs2976653;rs59817342	349|.	Q6ZMY9|.	ZN517_HUMAN|.	A|R	349|316	ENSP00000353058:V349A;ENSP00000436103:V349A|.	ENSP00000353058:V349A|.	V|W	+|+	2|1	0|0	ZNF517|ZNF517	146004151|146004151	0.001000|0.001000	0.12720|0.12720	0.002000|0.002000	0.10522|0.10522	0.004000|0.004000	0.04260|0.04260	-0.400000|-0.400000	0.07241|0.07241	-0.612000|-0.612000	0.05701|0.05701	-1.157000|-1.157000	0.01802|0.01802	GTG|TGG	G|0.992;C|0.006		0.746	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382642.1	XM_291261	
DMRT2	10655	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	1056586	1056586	+	Silent	SNP	A	A	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr9:1056586A>G	ENST00000358146.2	+	3	999	c.999A>G	c.(997-999)agA>agG	p.R333R	DMRT2_ENST00000382255.3_3'UTR|DMRT2_ENST00000302441.6_Silent_p.R333R|DMRT2_ENST00000382251.3_Silent_p.R333R|DMRT2_ENST00000259622.6_3'UTR			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	333					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		CAACTTATAGACAGTATCCCT	0.463																																					p.R333R		.											.	DMRT2-514	0			c.A999G						.						97.0	101.0	100.0					9																	1056586		2203	4300	6503	SO:0001819	synonymous_variant	10655	exon4			TTATAGACAGTAT	AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.999A>G	9.37:g.1056586A>G		103	0		152	58	NM_181872	0	0	0	0	0	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Silent	SNP	ENST00000358146.2	37	CCDS6444.1																																																																																			.		0.463	DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051492.1	NM_006557	
ERMP1	79956	hgsc.bcm.edu	37	9	5832728	5832728	+	Silent	SNP	G	G	C	rs1131727	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr9:5832728G>C	ENST00000339450.5	-	1	389	c.300C>G	c.(298-300)gcC>gcG	p.A100A	ERMP1_ENST00000381506.3_5'Flank|ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1	100						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		GGTGTCCAGCGGCCCCGCGTA	0.741													G|||	2021	0.403554	0.1309	0.428	5008	,	,		3601	0.7093		0.34	False		,,,				2504	0.5051				p.A100A		.											.	ERMP1-69	0			c.C300G						.						4.0	3.0	3.0					9																	5832728		1620	3326	4946	SO:0001819	synonymous_variant	79956	exon1			TCCAGCGGCCCCG	AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.300C>G	9.37:g.5832728G>C		2	0		38	23	NM_024896	0	0	1	3	2	B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	Silent	SNP	ENST00000339450.5	37	CCDS34983.1																																																																																			G|0.572;C|0.428		0.741	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354877.1	NM_024896	
OR13J1	392309	broad.mit.edu	37	9	35869801	35869801	+	Silent	SNP	G	G	A	rs150584050	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr9:35869801G>A	ENST00000377981.2	-	1	660	c.598C>T	c.(598-600)Ctg>Ttg	p.L200L		NM_001004487.1	NP_001004487.1	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J, member 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			GAGCCCGCCAGCAGGAAGTCT	0.627													G|||	6	0.00119808	0.0	0.0029	5008	,	,		21907	0.0		0.004	False		,,,				2504	0.0				p.L200L		.											.	OR13J1-68	0			c.C598T						.	G		5,4401	9.9+/-24.2	0,5,2198	57.0	46.0	50.0		598	0.8	0.7	9	dbSNP_134	50	50,8550	31.7+/-84.0	0,50,4250	no	coding-synonymous	OR13J1	NM_001004487.1		0,55,6448	AA,AG,GG		0.5814,0.1135,0.4229		200/313	35869801	55,12951	2203	4300	6503	SO:0001819	synonymous_variant	392309	exon1			CCGCCAGCAGGAA		CCDS35011.1	9p13.3	2013-09-24			ENSG00000168828	ENSG00000168828		"""GPCR / Class A : Olfactory receptors"""	15108	protein-coding gene	gene with protein product							Standard	NM_001004487		Approved		uc011lph.2	Q8NGT2	OTTHUMG00000019879	ENST00000377981.2:c.598C>T	9.37:g.35869801G>A		124	1		152	4	NM_001004487	0	0	0	0	0	B2RN66|Q6IF20|Q96R40	Silent	SNP	ENST00000377981.2	37	CCDS35011.1																																																																																			G|0.996;A|0.004		0.627	OR13J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052381.1		
BICD2	23299	broad.mit.edu	37	9	95526977	95526977	+	Missense_Mutation	SNP	G	G	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr9:95526977G>T	ENST00000375512.3	-	1	117	c.50C>A	c.(49-51)gCg>gAg	p.A17E	BICD2_ENST00000356884.6_Missense_Mutation_p.A17E	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	17					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTCCGGCTGCGCCTCCATCAC	0.731																																					p.A17E		.											.	BICD2-226	0			c.C50A						.						9.0	10.0	9.0					9																	95526977		2068	4116	6184	SO:0001583	missense	23299	exon1			GGCTGCGCCTCCA	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.50C>A	9.37:g.95526977G>T	ENSP00000364662:p.Ala17Glu	14	1		86	11	NM_001003800	0	0	8	9	1	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	37	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	.	16.77	3.215213	0.58452	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.44881	0.91;0.92	4.35	4.35	0.52113	.	0.211686	0.38548	N	0.001654	T	0.42539	0.1207	L	0.34521	1.04	0.43512	D	0.995772	D;P	0.55800	0.973;0.954	P;P	0.53360	0.724;0.534	T	0.10660	-1.0620	10	0.17832	T	0.49	-38.5328	15.1518	0.72706	0.0:0.0:1.0:0.0	.	17;17	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	E	17	ENSP00000349351:A17E;ENSP00000364662:A17E	ENSP00000349351:A17E	A	-	2	0	BICD2	94566798	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	8.700000	0.91322	2.349000	0.79799	0.195000	0.17529	GCG	.		0.731	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250	
PHF2	5253	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	96435947	96435954	+	Frame_Shift_Del	DEL	GCCTGCAG	GCCTGCAG	-			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	GCCTGCAG	GCCTGCAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr9:96435947_96435954delGCCTGCAG	ENST00000359246.4	+	18	2796_2803	c.2429_2436delGCCTGCAG	c.(2428-2436)tgcctgcagfs	p.CLQ810fs	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	810					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		TCCGACTCCTGCCTGCAGACCACGTGGG	0.663																																					p.810_812del		.											.	PHF2-91	0			c.2429_2436del						.																																			SO:0001589	frameshift_variant	5253	exon18			ACTCCTGCCTGCA	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.2429_2436delGCCTGCAG	9.37:g.96435947_96435954delGCCTGCAG	ENSP00000352185:p.Cys810fs	187	0		215	74	NM_005392	0	0	0	0	0	Q4VXG0|Q8N3K2|Q9Y6N4	Frame_Shift_Del	DEL	ENST00000359246.4	37	CCDS35069.1																																																																																			.		0.663	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
SVEP1	79987	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	113168503	113168503	+	Missense_Mutation	SNP	G	G	A	rs376942718		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr9:113168503G>A	ENST00000401783.2	-	38	9713	c.9377C>T	c.(9376-9378)cCg>cTg	p.P3126L	SVEP1_ENST00000297826.5_Missense_Mutation_p.P1052L|SVEP1_ENST00000374469.1_Missense_Mutation_p.P3103L	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3126	Sushi 29. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GGCGACAGACGGTGGGGACCC	0.527																																					p.P3126L		.											.	SVEP1-75	0			c.C9377T						.	G	LEU/PRO	0,3986		0,0,1993	117.0	123.0	121.0		9377	5.7	1.0	9		121	1,8333		0,1,4166	no	missense	SVEP1	NM_153366.3	98	0,1,6159	AA,AG,GG		0.012,0.0,0.0081	probably-damaging	3126/3572	113168503	1,12319	1993	4167	6160	SO:0001583	missense	79987	exon38			ACAGACGGTGGGG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.9377C>T	9.37:g.113168503G>A	ENSP00000384917:p.Pro3126Leu	154	0		255	124	NM_153366	0	0	8	8	0	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	37	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787899	0.70337	0.0	1.2E-4	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.67865	-0.29;-0.29;-0.29	5.69	5.69	0.88448	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.85745	0.5768	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86116	0.1565	10	0.44086	T	0.13	.	19.812	0.96551	0.0:0.0:1.0:0.0	.	3126	Q4LDE5	SVEP1_HUMAN	L	3126;3103;1052	ENSP00000384917:P3126L;ENSP00000363593:P3103L;ENSP00000297826:P1052L	ENSP00000297826:P1052L	P	-	2	0	SVEP1	112208324	1.000000	0.71417	0.962000	0.40283	0.347000	0.29111	9.622000	0.98378	2.685000	0.91497	0.655000	0.94253	CCG	.		0.527	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
FPGS	2356	hgsc.bcm.edu	37	9	130565267	130565267	+	Missense_Mutation	SNP	A	A	G	rs11554717|rs10760502	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr9:130565267A>G	ENST00000373247.2	+	1	114	c.64A>G	c.(64-66)Ata>Gta	p.I22V	FPGS_ENST00000373225.3_5'Flank|FPGS_ENST00000393706.2_Missense_Mutation_p.I22V|FPGS_ENST00000373245.1_Missense_Mutation_p.I22V|FPGS_ENST00000460181.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	22			I -> V (in dbSNP:rs10760502). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7721888}.		brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	TGCGCGCGGCATAACGACCCA	0.761													g|||	3912	0.78115	0.8956	0.6153	5008	,	,		6680	0.9583		0.6352	False		,,,				2504	0.7117				p.I22V		.											.	FPGS-90	0			c.A64G						.		VAL/ILE	2249,281		997,255,13	1.0	3.0	2.0		64	1.8	0.0	9	dbSNP_120	2	3848,1396		1394,1060,168	no	missense	FPGS	NM_004957.4	29	2391,1315,181	GG,GA,AA		26.6209,11.1067,21.5719	benign	22/588	130565267	6097,1677	1265	2622	3887	SO:0001583	missense	2356	exon1			CGCGGCATAACGA		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.64A>G	9.37:g.130565267A>G	ENSP00000362344:p.Ile22Val	0	0		5	5	NM_004957	0	0	0	1	1	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	ENST00000373247.2	37	CCDS35148.1	1668	0.7637362637362637	432	0.8780487804878049	215	0.5939226519337016	545	0.9527972027972028	476	0.6279683377308707	g	3.002	-0.205821	0.06180	0.888933	0.733791	ENSG00000136877	ENST00000373247;ENST00000373245;ENST00000393706;ENST00000373228	T;T;T;T	0.29655	3.02;1.56;3.03;1.56	4.93	1.83	0.25207	.	0.868559	0.09918	N	0.738853	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.37361	-0.9709	9	0.02654	T	1	-12.2003	6.0757	0.19913	0.2469:0.2097:0.5434:0.0	rs10760502;rs17855899;rs56845445	22;22	Q05932-4;Q05932	.;FOLC_HUMAN	V	22	ENSP00000362344:I22V;ENSP00000362342:I22V;ENSP00000377309:I22V;ENSP00000362325:I22V	ENSP00000362325:I22V	I	+	1	0	FPGS	129605088	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.242000	0.18087	0.210000	0.20664	-0.258000	0.10820	ATA	A|0.235;G|0.765		0.761	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054251.1		
ATXN3L	92552	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	13337648	13337648	+	Missense_Mutation	SNP	G	G	A			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chrX:13337648G>A	ENST00000380622.2	-	1	870	c.406C>T	c.(406-408)Ctc>Ttc	p.L136F	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	136	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.				protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						CCCGCCAAGAGAGAATTCAAG	0.333																																					p.L136F		.											.	ATXN3L-542	0			c.C406T						.						64.0	63.0	63.0					X																	13337648		1568	3582	5150	SO:0001583	missense	92552	exon1			CCAAGAGAGAATT		CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.406C>T	X.37:g.13337648G>A	ENSP00000369996:p.Leu136Phe	102	1		100	28	NM_001135995	0	0	0	0	0	B2RNY8	Missense_Mutation	SNP	ENST00000380622.2	37	CCDS48080.1	.	.	.	.	.	.	.	.	.	.	G	7.345	0.621650	0.14193	.	.	ENSG00000123594	ENST00000380622	T	0.47528	0.84	0.661	-0.537	0.11872	.	0.000000	0.85682	D	0.000000	T	0.34948	0.0915	L	0.39467	1.215	0.45087	D	0.998108	B	0.31968	0.349	B	0.35688	0.208	T	0.08411	-1.0723	10	0.87932	D	0	.	6.0402	0.19730	0.0:0.3209:0.6791:0.0	.	136	Q9H3M9	ATX3L_HUMAN	F	136	ENSP00000369996:L136F	ENSP00000369996:L136F	L	-	1	0	ATXN3L	13247569	1.000000	0.71417	0.003000	0.11579	0.002000	0.02628	4.207000	0.58480	-0.287000	0.09064	-0.558000	0.04189	CTC	.		0.333	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055785.2	NM_001135995	
ZRSR2	8233	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	15821812	15821812	+	Splice_Site	SNP	C	C	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chrX:15821812C>G	ENST00000307771.7	+	4	229	c.205C>G	c.(205-207)Caa>Gaa	p.Q69E	ZRSR2_ENST00000468028.1_3'UTR	NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	69					mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					TACTGATAGGCAAAGATTACA	0.383			"""F, S, Mis"""		"""MDS, CLL"""																																p.Q69E	NSCLC(197;1631 3042 5741 31152)	.		Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	.	ZRSR2-133	0			c.C205G						.						58.0	48.0	51.0					X																	15821812		2202	4298	6500	SO:0001630	splice_region_variant	8233	exon4			GATAGGCAAAGAT	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.204-1C>G	X.37:g.15821812C>G		370	0		417	147	NM_005089	0	0	0	0	0	Q14D69	Missense_Mutation	SNP	ENST00000307771.7	37	CCDS14172.1	.	.	.	.	.	.	.	.	.	.	C	9.242	1.038423	0.19669	.	.	ENSG00000169249	ENST00000307771	D	0.85556	-2.0	5.14	5.14	0.70334	.	0.124573	0.56097	D	0.000035	D	0.83774	0.5327	M	0.64567	1.98	0.80722	D	1	B	0.26081	0.141	B	0.22386	0.039	T	0.81337	-0.0978	10	0.40728	T	0.16	.	17.6129	0.88059	0.0:1.0:0.0:0.0	.	69	Q15696	U2AFM_HUMAN	E	69	ENSP00000303015:Q69E	ENSP00000303015:Q69E	Q	+	1	0	ZRSR2	15731733	1.000000	0.71417	0.998000	0.56505	0.450000	0.32258	2.288000	0.43514	2.276000	0.75962	0.594000	0.82650	CAA	.		0.383	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055889.1	NM_005089	Missense_Mutation
PCDH11X	27328	bcgsc.ca	37	X	91642748	91642748	+	Silent	SNP	C	C	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chrX:91642748C>T	ENST00000373094.1	+	5	4004	c.3159C>T	c.(3157-3159)gtC>gtT	p.V1053V	PCDH11X_ENST00000504220.2_Intron|PCDH11X_ENST00000373097.1_Silent_p.V1043V|PCDH11X_ENST00000361655.2_Silent_p.V1043V|PCDH11X_ENST00000298274.8_Silent_p.V1016V|PCDH11X_ENST00000406881.1_Silent_p.V1053V|PCDH11X_ENST00000373088.1_Silent_p.V1016V	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1053					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						AGCGGCGTGTCACATTTCACC	0.478																																					p.V1053V	NSCLC(38;925 1092 2571 38200 45895)	.											.	PCDH11X-193	0			c.C3159T						.						51.0	48.0	49.0					X																	91642748		2201	4295	6496	SO:0001819	synonymous_variant	27328	exon5			GCGTGTCACATTT	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3159C>T	X.37:g.91642748C>T		734	6		959	373	NM_001168360	0	0	0	0	0	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Silent	SNP	ENST00000373094.1	37	CCDS14461.1																																																																																			.		0.478	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
ARHGAP36	158763	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	130218194	130218194	+	Silent	SNP	A	A	T			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chrX:130218194A>T	ENST00000276211.5	+	5	906	c.561A>T	c.(559-561)gcA>gcT	p.A187A	ARHGAP36_ENST00000370921.1_Silent_p.A51A|ARHGAP36_ENST00000370922.1_Silent_p.A175A	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	187					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CACAGGGTGCAGTGTCTGTGG	0.458																																					p.A187A		.											.	ARHGAP36-133	0			c.A561T						.						30.0	30.0	30.0					X																	130218194		2203	4299	6502	SO:0001819	synonymous_variant	158763	exon5			GGGTGCAGTGTCT		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.561A>T	X.37:g.130218194A>T		121	0		130	54	NM_144967	0	0	0	0	0	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	ENST00000276211.5	37	CCDS14628.1																																																																																			.		0.458	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
ZNF185	7739	hgsc.bcm.edu	37	X	152087570	152087572	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	GAG	GAG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chrX:152087570_152087572delGAG	ENST00000370268.4	+	7	512_514	c.475_477delGAG	c.(475-477)gagdel	p.E165del	ZNF185_ENST00000370270.2_In_Frame_Del_p.E165del|ZNF185_ENST00000318529.8_In_Frame_Del_p.E30del|ZNF185_ENST00000324823.6_In_Frame_Del_p.E30del|ZNF185_ENST00000539731.1_In_Frame_Del_p.E165del|ZNF185_ENST00000535861.1_In_Frame_Del_p.E165del|ZNF185_ENST00000318504.7_In_Frame_Del_p.E165del|ZNF185_ENST00000449285.2_In_Frame_Del_p.E165del			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	165	Poly-Glu.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGACACCgaggaggaggagg	0.596																																					p.159_159del		.											.	ZNF185-133	0			c.475_477del						.		,,,,,,	160,3115		6,91,57,1273,478					,,,,,,	-7.0	0.0			54	367,5848		0,178,189,2088,1494	no	coding,coding,coding,coding,coding,coding,coding	ZNF185	NM_007150.3,NM_001178113.1,NM_001178110.1,NM_001178109.1,NM_001178108.1,NM_001178107.1,NM_001178106.1	,,,,,,	6,269,246,3361,1972	A1A1,A1R,A1,RR,R		5.9051,4.8855,5.5532	,,,,,,	,,,,,,		527,8963				SO:0001651	inframe_deletion	7739	exon7			GACACCGAGGAGG	AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.475_477delGAG	X.37:g.152087579_152087581delGAG	ENSP00000359291:p.Glu165del	162	2		265	13	NM_001178109	0	0	0	0	0	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	In_Frame_Del	DEL	ENST00000370268.4	37	CCDS48184.1																																																																																			.		0.596	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000377480.1	NM_007150	
MPP1	4354	broad.mit.edu;bcgsc.ca	37	X	154014564	154014564	+	Missense_Mutation	SNP	C	C	G			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chrX:154014564C>G	ENST00000369534.3	-	6	739	c.592G>C	c.(592-594)Gat>Cat	p.D198H	MPP1_ENST00000393531.1_Missense_Mutation_p.D178H|MPP1_ENST00000462825.1_5'UTR|MPP1_ENST00000413259.3_Missense_Mutation_p.D168H	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	198	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TTGCTGTCATCCTTGTTGATA	0.507																																					p.D198H		.											.	MPP1-132	0			c.G592C						.						299.0	269.0	279.0					X																	154014564		2203	4300	6503	SO:0001583	missense	4354	exon6			TGTCATCCTTGTT		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.592G>C	X.37:g.154014564C>G	ENSP00000358547:p.Asp198His	301	0		404	11	NM_002436	0	0	38	40	2	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	ENST00000369534.3	37	CCDS14762.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694217	0.68386	.	.	ENSG00000130830	ENST00000369534;ENST00000413259;ENST00000393531;ENST00000453245;ENST00000393529;ENST00000428488	T;T;T;T;T;T	0.50813	2.92;2.92;0.73;2.92;2.92;2.92	5.3	5.3	0.74995	Src homology-3 domain (3);Variant SH3 (1);	0.155058	0.56097	D	0.000021	T	0.65933	0.2739	M	0.85859	2.78	0.53005	D	0.999968	B;P;B;P;P	0.36944	0.096;0.574;0.036;0.519;0.574	B;P;B;B;B	0.48141	0.054;0.568;0.054;0.432;0.429	T	0.71024	-0.4712	10	0.66056	D	0.02	.	16.4752	0.84130	0.0:1.0:0.0:0.0	.	181;168;72;178;198	B4E325;B4DZV5;C9J9J4;G3XAI1;Q00013	.;.;.;.;EM55_HUMAN	H	198;168;178;72;152;95	ENSP00000358547:D198H;ENSP00000400155:D168H;ENSP00000377165:D178H;ENSP00000410888:D72H;ENSP00000377163:D152H;ENSP00000391701:D95H	ENSP00000358547:D198H	D	-	1	0	MPP1	153667758	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.024000	0.57218	2.195000	0.70347	0.513000	0.50165	GAT	.		0.507	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	
OR2T27	403239	bcgsc.ca	37	1	248813733	248813734	+	Frame_Shift_Ins	INS	-	-	C	rs200669807	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr1:248813733_248813734insC	ENST00000344889.3	-	1	451_452	c.452_453insG	c.(451-453)ggafs	p.G151fs		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CGATAGACCCTCCCAGCCAGGC	0.569													CCC|CCC|CCCC|insertion	124	0.0247604	0.062	0.0303	5008	,	,		20740	0.0		0.0169	False		,,,				2504	0.0041				p.G151fs		.											.	OR2T27-47	0			c.453_454insG						.			286,3746		15,256,1745						-0.9	0.5			22	137,6167		11,115,3026	no	frameshift	OR2T27	NM_001001824.1		26,371,4771	A1A1,A1R,RR		2.1732,7.0933,4.0925				423,9913				SO:0001589	frameshift_variant	403239	exon1			AGACCCTCCCAGC		CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.453dupG	1.37:g.248813736_248813736dupC	ENSP00000342008:p.Gly151fs	320	1		86	4	NM_001001824	0	0	0	0	0		Frame_Shift_Ins	INS	ENST00000344889.3	37	CCDS31124.1																																																																																			-|0.977;C|0.023		0.569	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097124.1	NM_001001824	
KRTAP5-5	439915	hgsc.bcm.edu	37	11	1651199	1651200	+	In_Frame_Ins	INS	-	-	GGCTGTGGCTCC	rs71025763|rs144216147	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr11:1651199_1651200insGGCTGTGGCTCC	ENST00000399676.2	+	1	167_168	c.129_130insGGCTGTGGCTCC	c.(130-132)ggc>GGCTGTGGCTCCggc	p.44_44G>GCGSG		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	44						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtggaggctgtggggg	0.713																																					p.G43delinsGGCGS		.											.	KRTAP5-5-23	0			c.129_130insGGCTGTGGCTCC						.																																			SO:0001652	inframe_insertion	439915	exon1			CTGTGGAGGCTGT	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	Exception_encountered	11.37:g.1651199_1651200insGGCTGTGGCTCC	Exception_encountered	33	0		61	31	NM_001001480	0	0	0	0	0	A8MWN2	In_Frame_Ins	INS	ENST00000399676.2	37	CCDS41592.1																																																																																			.		0.713	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127919.1		
NEFH	4744	broad.mit.edu	37	22	29885622	29885623	+	In_Frame_Ins	INS	-	-	AGGAAG	rs267607534|rs267607535		TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr22:29885622_29885623insAGGAAG	ENST00000310624.6	+	4	2026_2027	c.1993_1994insAGGAAG	c.(1993-1995)aag>aAGGAAGag	p.665_666insEE		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	671	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						GTCCCCTGAGAAGGCCAAGTCC	0.579																																					p.K665delinsKEE		.											.	NEFH-90	0			c.1993_1994insAGGAAG						.																																			SO:0001652	inframe_insertion	4744	exon4			CCTGAGAAGGCCA		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	Exception_encountered	22.37:g.29885622_29885623insAGGAAG	ENSP00000311997:p.Lys665_Ala666insGluGlu	438	0		267	7	NM_021076	0	0	0	0	0	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	37	CCDS13858.1																																																																																			.		0.579	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
MCC	4163	broad.mit.edu	37	5	112824048	112824049	+	In_Frame_Ins	INS	-	-	GCC	rs35336557|rs531679771|rs370593160	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr5:112824048_112824049insGCC	ENST00000408903.3	-	1	478_479	c.63_64insGGC	c.(61-66)ggcagc>ggcGGCagc	p.21_22insG		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ctgctgccgctgccgccgccgc	0.738														1663	0.332069	0.0227	0.3487	5008	,	,		8489	0.5208		0.3668	False		,,,				2504	0.5082				p.S22delinsGS		.											.	MCC-69	0			c.64_65insGGC						.																																			SO:0001652	inframe_insertion	4163	exon1			TGCCGCTGCCGCC		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.61_63dupGGC	5.37:g.112824055_112824057dupGCC	ENSP00000386227:p.Gly22_Gly23dup	16	0		53	8	NM_001085377	0	0	0	0	0	D3DT05|Q6ZR04	In_Frame_Ins	INS	ENST00000408903.3	37	CCDS43351.1																																																																																			.		0.738	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
HNRNPA0	10949	hgsc.bcm.edu	37	5	137089075	137089076	+	In_Frame_Ins	INS	-	-	CCG			TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr5:137089075_137089076insCCG	ENST00000314940.4	-	1	963_964	c.680_681insCGG	c.(679-681)gga>ggCGGa	p.227_227G>GG		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	227	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			agccgccgcctccgccgccgcc	0.723																																					p.G227delinsGG		.											.	HNRNPA0-68	0			c.681_682insCGG						.			19,2353		7,5,1174						-4.0	0.0			5	59,5139		13,33,2553	no	coding	HNRNPA0	NM_006805.3		20,38,3727	A1A1,A1R,RR		1.1351,0.801,1.0304				78,7492				SO:0001652	inframe_insertion	10949	exon1			GCCGCCTCCGCCG	U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.678_680dupCGG	5.37:g.137089082_137089084dupCCG	ENSP00000316042:p.Gly230dup	28	2		156	33	NM_006805	0	0	0	0	0	Q6IB18	In_Frame_Ins	INS	ENST00000314940.4	37	CCDS4193.1																																																																																			.		0.723	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251221.1	NM_006805	
TTLL11	158135	hgsc.bcm.edu	37	9	124855330	124855331	+	In_Frame_Ins	INS	-	-	TGGCCT	rs3833704|rs201653732	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr9:124855330_124855331insTGGCCT	ENST00000373776.3	-	1	554_555	c.367_368insAGGCCA	c.(367-369)aca>aAGGCCAca	p.122_123insKA	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_In_Frame_Ins_p.122_123insKA	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	122					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						cgtctccgctgtggcctcggcc	0.762														678	0.135383	0.1044	0.1254	5008	,	,		10384	0.0367		0.2773	False		,,,				2504	0.1401				p.T123delinsKAT		.											.	TTLL11-112	0			c.368_369insAGGCCA						.		,	363,1875		124,115,880					,	-4.8	0.0		dbSNP_107	2	1330,3776		463,404,1686	no	coding,coding	TTLL11	NM_194252.2,NM_001139442.1	,	587,519,2566	A1A1,A1R,RR		26.0478,16.2198,23.0528	,	,		1693,5651				SO:0001652	inframe_insertion	158135	exon1			TCCGCTGTGGCCT	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.362_367dupAGGCCA	9.37:g.124855331_124855336dupTGGCCT	ENSP00000362881:p.Ala122_Thr123insLysAla	0	0		23	10	NM_001139442	0	0	0	0	0		In_Frame_Ins	INS	ENST00000373776.3	37	CCDS6834.2																																																																																			-|0.843;TGGCCT|0.157		0.762	TTLL11-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053907.1	XM_088486	
LILRB1	10859	bcgsc.ca	37	19	55147987	55147988	+	Missense_Mutation	DNP	GA	GA	CC	rs202204734|rs41308744	byFrequency	TCGA-OU-A5PI-01A-12D-A29I-10	TCGA-OU-A5PI-10A-01D-A29L-10	GA	GA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	7b715e15-2bab-4f72-99f7-d12edf469822	2425af3c-c748-4bca-a898-cf31a8a91682	g.chr19:55147987_55147988GA>CC	ENST00000396331.1	+	15	2047_2048	c.1690_1691GA>CC	c.(1690-1692)GAg>CCg	p.E564P	AC009892.10_ENST00000456337.1_Intron|LILRB1_ENST00000396332.4_Missense_Mutation_p.E565P|LILRB1_ENST00000396321.2_Missense_Mutation_p.E564P|LILRB1_ENST00000434867.2_Missense_Mutation_p.E564P|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396327.3_Missense_Mutation_p.E565P|LILRB1_ENST00000418536.2_Missense_Mutation_p.E548P|LILRB1_ENST00000427581.2_Missense_Mutation_p.E615P|LILRB1_ENST00000396317.1_Missense_Mutation_p.E548P|LILRB1_ENST00000396315.1_Missense_Mutation_p.E566P|LILRB1_ENST00000324602.7_Missense_Mutation_p.E566P|LILRB1_ENST00000448689.1_3'UTR	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	564					cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)	p.E564>?(2)|p.E564Q(2)|p.E564K(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GACGTATGCCGAGGTGAAACAC	0.579										HNSCC(37;0.09)																											p.E615P		.											.	LILRB1-137	5	Substitution - Missense(3)|Complex(2)	NS(2)|prostate(2)|skin(1)	c.A1697C						.																																			SO:0001583	missense	10859	exon14			ATGCCGAGGTGAA	AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		Exception_encountered	19.37:g.55147987_55147988delinsCC	ENSP00000379622:p.Glu564Pro	305	0		397	1	NM_001081637	0	0	0	0	0	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	DNP	ENST00000396331.1	37	CCDS42617.1																																																																																			.		0.579	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000140796.4		
