#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
IPP	3652	bcgsc.ca	37	1	46195375	46195375	+	Missense_Mutation	SNP	T	T	C	rs28375469	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr1:46195375T>C	ENST00000396478.3	-	4	893	c.791A>G	c.(790-792)aAa>aGa	p.K264R		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	264			K -> R (in dbSNP:rs28375469). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.4}.			actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)	p.K264R(1)		central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TTTGGGAGATTTGCATACTTC	0.373													T|||	1577	0.314896	0.2504	0.3473	5008	,	,		15649	0.3135		0.2833	False		,,,				2504	0.4131				p.K264R		.											.	IPP-91	1	Substitution - Missense(1)	stomach(1)	c.A791G						.	T	ARG/LYS,ARG/LYS	1088,3318	393.7+/-329.0	138,812,1253	110.0	112.0	111.0		791,791	5.8	1.0	1	dbSNP_125	111	2546,6054	415.3+/-351.7	384,1778,2138	yes	missense,missense	IPP	NM_001145349.1,NM_005897.2	26,26	522,2590,3391	CC,CT,TT		29.6047,24.6936,27.941	benign,benign	264/583,264/585	46195375	3634,9372	2203	4300	6503	SO:0001583	missense	3652	exon4			GGAGATTTGCATA	BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.791A>G	1.37:g.46195375T>C	ENSP00000379739:p.Lys264Arg	114	0		57	4	NM_001145349	0	0	2	2	0	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	ENST00000396478.3	37	CCDS30702.1	649	0.29716117216117216	130	0.26422764227642276	114	0.3149171270718232	182	0.3181818181818182	223	0.2941952506596306	T	16.43	3.121918	0.56613	0.246936	0.296047	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.74106	-0.63;-0.81	5.81	5.81	0.92471	.	0.197772	0.52532	D	0.000068	T	0.00012	0.0000	N	0.08118	0	0.20873	P	0.999833586	B;B	0.12630	0.003;0.006	B;B	0.10450	0.002;0.005	T	0.05354	-1.0890	9	0.59425	D	0.04	.	16.1671	0.81777	0.0:0.0:0.0:1.0	rs28375469;rs28375469	264;264	Q9Y573;A2A6V3	IPP_HUMAN;.	R	264	ENSP00000353024:K264R;ENSP00000379739:K264R	ENSP00000353024:K264R	K	-	2	0	IPP	45967962	1.000000	0.71417	0.994000	0.49952	0.629000	0.37895	7.623000	0.83113	2.226000	0.72624	0.459000	0.35465	AAA	T|0.709;C|0.291		0.373	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021974.3	NM_005897	
FLG	2312	bcgsc.ca	37	1	152281479	152281479	+	Missense_Mutation	SNP	G	G	T	rs3126079	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr1:152281479G>T	ENST00000368799.1	-	3	5918	c.5883C>A	c.(5881-5883)caC>caA	p.H1961Q	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1961	Ser-rich.		H -> Q (in dbSNP:rs3126079).		establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTGTCTTCGTGATGGGACC	0.572									Ichthyosis				-|||	2695	0.538139	0.7897	0.4683	5008	,	,		26201	0.6607		0.1759	False		,,,				2504	0.4939				p.H1961Q		.											.	FLG-106	0			c.C5883A						.	T	GLN/HIS	3032,1374	454.4+/-350.6	1056,920,227	293.0	278.0	283.0		5883	-4.8	0.0	1	dbSNP_103	283	1480,7120	749.5+/-407.4	129,1222,2949	no	missense	FLG	NM_002016.1	24	1185,2142,3176	TT,TG,GG		17.2093,31.1847,34.6917	benign	1961/4062	152281479	4512,8494	2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GTCTTCGTGATGG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5883C>A	1.37:g.152281479G>T	ENSP00000357789:p.His1961Gln	409	4		246	7	NM_002016	0	0	0	0	0	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	1005	0.46016483516483514	366	0.7439024390243902	142	0.39226519337016574	362	0.6328671328671329	135	0.17810026385224276	t	0.268	-0.994755	0.02145	0.688153	0.172093	ENSG00000143631	ENST00000368799	T	0.00949	5.51	2.37	-4.75	0.03239	.	.	.	.	.	T	0.00144	0.0004	N	0.12746	0.255	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.40757	-0.9546	8	0.13470	T	0.59	-0.1204	2.7757	0.05347	0.1149:0.1132:0.4273:0.3447	rs3126079;rs28567722;rs35290811	1961	P20930	FILA_HUMAN	Q	1961	ENSP00000357789:H1961Q	ENSP00000357789:H1961Q	H	-	3	2	FLG	150548103	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.708000	0.00196	-3.868000	0.00097	-4.206000	0.00009	CAC	A|0.000;G|0.622;T|0.378		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
TOR3A	64222	hgsc.bcm.edu	37	1	179051300	179051300	+	Missense_Mutation	SNP	T	T	C	rs2296377	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr1:179051300T>C	ENST00000367627.3	+	1	789	c.37T>C	c.(37-39)Ttc>Ctc	p.F13L	TOR3A_ENST00000352445.6_Missense_Mutation_p.F13L	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	13			F -> L (in dbSNP:rs2296377). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						TTGGCTCTTTTTCCTGCTGCT	0.751													C|||	3842	0.767173	0.9879	0.6441	5008	,	,		12722	0.6677		0.7117	False		,,,				2504	0.7157				p.F13L		.											.	TOR3A-90	0			c.T37C						.	C	LEU/PHE	3262,174		1547,168,3	2.0	3.0	3.0		37	-0.8	0.0	1	dbSNP_100	3	5365,1739		2051,1263,238	yes	missense	TOR3A	NM_022371.3	22	3598,1431,241	CC,CT,TT		24.4792,5.064,18.1499	benign	13/398	179051300	8627,1913	1718	3552	5270	SO:0001583	missense	64222	exon1			CTCTTTTTCCTGC	BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.37T>C	1.37:g.179051300T>C	ENSP00000356599:p.Phe13Leu	0	0		5	5	NM_022371	0	0	0	1	1	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	ENST00000367627.3	37	CCDS1329.1	1679	0.7687728937728938	484	0.983739837398374	250	0.6906077348066298	393	0.6870629370629371	552	0.7282321899736148	C	0.033	-1.323382	0.01309	0.94936	0.755208	ENSG00000186283	ENST00000367627;ENST00000367625;ENST00000352445	T;T;T	0.35421	1.31;1.4;1.63	0.427	-0.794	0.10918	.	1.274350	0.05916	N	0.632520	T	0.00012	0.0000	N	0.00368	-1.59	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45906	-0.9229	8	0.02654	T	1	-1.1524	.	.	.	rs2296377;rs17844883;rs17856371;rs17857600;rs17857917;rs17858479;rs59034332;rs2296377	13	Q9H497	TOR3A_HUMAN	L	13	ENSP00000356599:F13L;ENSP00000356597:F13L;ENSP00000335351:F13L	ENSP00000335351:F13L	F	+	1	0	TOR3A	177317923	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-1.490000	0.02304	-1.608000	0.01587	-1.610000	0.00802	TTC	T|0.229;C|0.771		0.751	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084927.1	NM_022371	
MAP3K8	1326	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	30740635	30740635	+	Missense_Mutation	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr10:30740635G>A	ENST00000263056.1	+	6	1531	c.835G>A	c.(835-837)Gaa>Aaa	p.E279K	MAP3K8_ENST00000542547.1_Missense_Mutation_p.E279K|MAP3K8_ENST00000375321.1_Missense_Mutation_p.E279K	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	279	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				TCAAATGACCGAAGATGTCTA	0.323																																					p.E279K		.											.	MAP3K8-981	0			c.G835A						.						81.0	82.0	82.0					10																	30740635		2203	4300	6503	SO:0001583	missense	1326	exon5			ATGACCGAAGATG	D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.835G>A	10.37:g.30740635G>A	ENSP00000263056:p.Glu279Lys	95	0		79	7	NM_001244134	0	0	2	2	0	A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Missense_Mutation	SNP	ENST00000263056.1	37	CCDS7166.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962937	0.74016	.	.	ENSG00000107968	ENST00000375328;ENST00000263056;ENST00000542547;ENST00000375321	T;T;T	0.64618	-0.11;-0.11;-0.11	5.57	5.57	0.84162	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.094359	0.64402	D	0.000001	T	0.60392	0.2265	L	0.33293	1	0.58432	D	0.999998	D	0.56035	0.974	P	0.46389	0.515	T	0.63545	-0.6613	10	0.54805	T	0.06	.	19.538	0.95262	0.0:0.0:1.0:0.0	.	279	P41279	M3K8_HUMAN	K	279	ENSP00000263056:E279K;ENSP00000443610:E279K;ENSP00000364470:E279K	ENSP00000263056:E279K	E	+	1	0	MAP3K8	30780641	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	9.074000	0.93998	2.596000	0.87737	0.467000	0.42956	GAA	.		0.323	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047416.2	NM_005204	
WDFY4	57705	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	10	49951215	49951229	+	In_Frame_Del	DEL	GGGACCCTGTCAATG	GGGACCCTGTCAATG	-			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	GGGACCCTGTCAATG	GGGACCCTGTCAATG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr10:49951215_49951229delGGGACCCTGTCAATG	ENST00000325239.5	+	11	2108_2122	c.2081_2095delGGGACCCTGTCAATG	c.(2080-2097)tgggaccctgtcaatggc>tgc	p.694_699WDPVNG>C	WDFY4_ENST00000413659.2_In_Frame_Del_p.694_699WDPVNG>C	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	694						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GCGCTGCACTGGGACCCTGTCAATGGCTACTTCTT	0.614																																					p.694_699del		.											.	WDFY4-22	0			c.2081_2095del						.																																			SO:0001651	inframe_deletion	57705	exon12			TGCACTGGGACCC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2081_2095delGGGACCCTGTCAATG	10.37:g.49951215_49951229delGGGACCCTGTCAATG	ENSP00000320563:p.Trp694_Gly699delinsCys	194	0		121	29	NM_020945	0	0	0	0	0	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	In_Frame_Del	DEL	ENST00000325239.5	37	CCDS44385.1																																																																																			.		0.614	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	
ZCCHC24	219654	hgsc.bcm.edu	37	10	81205023	81205023	+	Silent	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr10:81205023G>A	ENST00000372336.3	-	1	360	c.174C>T	c.(172-174)ggC>ggT	p.G58G	ZCCHC24_ENST00000372333.3_5'Flank	NM_153367.3	NP_699198.2	Q8N2G6	ZCH24_HUMAN	zinc finger, CCHC domain containing 24	58							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)	9						GCTCGGGGCGGCCCTTGCCGA	0.736																																					p.G58G		.											.	ZCCHC24-153	0			c.C174T						.						3.0	4.0	3.0					10																	81205023		1694	3361	5055	SO:0001819	synonymous_variant	219654	exon1			GGGGCGGCCCTTG	AK075279	CCDS7359.1	10q22.3	2014-02-20	2008-06-23	2008-06-23	ENSG00000165424	ENSG00000165424		"""Zinc fingers, CCHC domain containing"""	26911	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 8"""		"""chromosome 10 open reading frame 56"""	C10orf56		12477932	Standard	NM_153367		Approved	FLJ90798, Z3CXXC8	uc010qlr.2	Q8N2G6	OTTHUMG00000018561	ENST00000372336.3:c.174C>T	10.37:g.81205023G>A		3	0		18	12	NM_153367	0	0	6	6	0	Q5U5T9|Q8TAG0	Silent	SNP	ENST00000372336.3	37	CCDS7359.1																																																																																			.		0.736	ZCCHC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048947.1	NM_153367	
KRTAP5-3	387266	bcgsc.ca	37	11	1628992	1628992	+	Silent	SNP	G	G	A	rs60210378	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr11:1628992G>A	ENST00000399685.1	-	1	701	c.624C>T	c.(622-624)ggC>ggT	p.G208G		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	208	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		atgacccacagcctgaggagc	0.617													g|||	2309	0.461062	0.4939	0.4467	5008	,	,		17035	0.3879		0.5239	False		,,,				2504	0.4376				p.G208G		.											.	KRTAP5-3-92	0			c.C624T						.						111.0	121.0	118.0					11																	1628992		2201	4295	6496	SO:0001819	synonymous_variant	387266	exon1			CCCACAGCCTGAG	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.624C>T	11.37:g.1628992G>A		212	2		130	6	NM_001012708	0	0	0	0	0	Q6PL44|Q701N3	Silent	SNP	ENST00000399685.1	37	CCDS41591.1																																																																																			G|0.562;A|0.438		0.617	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127924.1		
NRXN2	9379	hgsc.bcm.edu	37	11	64480641	64480641	+	Silent	SNP	G	G	A	rs2518907	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr11:64480641G>A	ENST00000377551.1	-	1	742	c.531C>T	c.(529-531)ggC>ggT	p.G177G	NRXN2_ENST00000265459.6_Silent_p.G177G|NRXN2_ENST00000409571.1_Silent_p.G177G|NRXN2_ENST00000377559.3_Silent_p.G177G			Q9P2S2	NRX2A_HUMAN	neurexin 2	177	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TGGCCAAGAGGCCGCGGAAGG	0.756													G|||	2672	0.533546	0.2216	0.5403	5008	,	,		8112	0.5407		0.7604	False		,,,				2504	0.7096				p.G177G		.											.	NRXN2-232	0			c.C531T						.	G	,	1316,1684		331,654,515	2.0	2.0	2.0		531,531	1.3	1.0	11	dbSNP_100	2	4949,1205		2080,789,208	no	coding-synonymous,coding-synonymous	NRXN2	NM_015080.3,NM_138732.2	,	2411,1443,723	AA,AG,GG		19.5808,43.8667,31.56	,	177/1713,177/1643	64480641	6265,2889	1500	3077	4577	SO:0001819	synonymous_variant	9379	exon2			CAAGAGGCCGCGG		CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.531C>T	11.37:g.64480641G>A		0	0		5	5	NM_138732	0	0	0	0	0	A7E2C1|Q9Y2D6	Silent	SNP	ENST00000377551.1	37	CCDS8077.1																																																																																			G|0.449;A|0.551		0.756	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104967.3	NM_015080	
MEN1	4221	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64574681	64574681	+	Nonsense_Mutation	SNP	C	C	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr11:64574681C>T	ENST00000337652.1	-	5	1312	c.809G>A	c.(808-810)tGg>tAg	p.W270*	MEN1_ENST00000443283.1_Nonsense_Mutation_p.W270*|MEN1_ENST00000315422.4_Nonsense_Mutation_p.W265*|MEN1_ENST00000377321.1_Nonsense_Mutation_p.W230*|MEN1_ENST00000394376.1_Nonsense_Mutation_p.W270*|MEN1_ENST00000478548.1_5'Flank|MEN1_ENST00000377316.2_Nonsense_Mutation_p.W265*|MEN1_ENST00000377326.3_Nonsense_Mutation_p.W265*|MEN1_ENST00000394374.2_Nonsense_Mutation_p.W270*|MEN1_ENST00000377313.1_Nonsense_Mutation_p.W270*|MEN1_ENST00000312049.6_Nonsense_Mutation_p.W265*	NM_130803.2	NP_570715	O00255	MEN1_HUMAN	multiple endocrine neoplasia I	270	Interaction with FANCD2.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)	p.K262_Y268del(1)|p.W265fs*16(1)|p.W265_L267del(1)		NS(7)|adrenal_gland(5)|breast(2)|central_nervous_system(5)|endometrium(1)|gastrointestinal_tract_(site_indeterminate)(15)|large_intestine(2)|lung(21)|ovary(1)|pancreas(64)|parathyroid(181)|pituitary(7)|prostate(4)|retroperitoneum(1)|skin(1)|small_intestine(13)|soft_tissue(4)|stomach(1)|thymus(2)	337						ATAGAGCAGCCAGAGCAGCTT	0.597			"""D, Mis, N, F, S"""		"""parathyroid tumors, Pancreatic neuroendocrine tumors"""	"""parathyroid adenoma, pituitary adenoma, pancreatic islet cell, carcinoid"""			Multiple Endocrine Neoplasia, type 1;Hyperparathyroidism, Familial Isolated																												p.W270X	Esophageal Squamous(1;83 158 15500 18603 18803 29295)	.	yes	Rec	yes	Multiple Endocrine Neoplasia Type 1	11	11q13	4221	multiple endocrine neoplasia type 1 gene		E	.	MEN1-3017	3	Deletion - In frame(2)|Deletion - Frameshift(1)	parathyroid(2)|gastrointestinal_tract_(site_indeterminate)(1)	c.G809A	GRCh37	CM970930	MEN1	M		.						39.0	43.0	42.0					11																	64574681		2201	4297	6498	SO:0001587	stop_gained	4221	exon5	Familial Cancer Database	MEN1, Wermer disease;FIHP, FIHPT, HRPT1, Familial Isolated Primary Hyperparathyroidism	AGCAGCCAGAGCA	U93236	CCDS8083.1, CCDS31600.1	11q13	2014-09-17			ENSG00000133895	ENSG00000133895			7010	protein-coding gene	gene with protein product	"""menin"""	613733					Standard	NM_130799		Approved		uc001obn.3	O00255	OTTHUMG00000045366	ENST00000337652.1:c.809G>A	11.37:g.64574681C>T	ENSP00000337088:p.Trp270*	45	0		23	14	NM_130800	0	0	0	0	0	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Nonsense_Mutation	SNP	ENST00000337652.1	37	CCDS8083.1	.	.	.	.	.	.	.	.	.	.	C	37	5.982488	0.97173	.	.	ENSG00000133895	ENST00000377316;ENST00000377321;ENST00000377326;ENST00000312049;ENST00000315422;ENST00000337652;ENST00000394376;ENST00000394374;ENST00000443283;ENST00000377313;ENST00000440873;ENST00000450708	.	.	.	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.3926	14.8396	0.70214	0.0:1.0:0.0:0.0	.	.	.	.	X	265;230;265;265;265;270;270;270;270;270;265;265	.	ENSP00000308975:W265X	W	-	2	0	MEN1	64331257	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.579000	0.60936	2.158000	0.67659	0.462000	0.41574	TGG	.		0.597	MEN1-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000143881.1		
DNAJB13	374407	bcgsc.ca	37	11	73681135	73681135	+	Missense_Mutation	SNP	G	G	A	rs72982975	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr11:73681135G>A	ENST00000339764.1	+	8	1678	c.927G>A	c.(925-927)atG>atA	p.M309I	DNAJB13_ENST00000537753.1_Missense_Mutation_p.M134I|RP11-167N4.2_ENST00000537019.1_RNA|DNAJB13_ENST00000543947.1_Missense_Mutation_p.M134I	NM_153614.2	NP_705842.2	P59910	DJB13_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 13	309					protein folding (GO:0006457)					large_intestine(3)|lung(2)	5	Breast(11;7.42e-05)					AGAAGCAGATGCTGCGCCAGG	0.622													g|||	1119	0.223442	0.1929	0.3473	5008	,	,		18231	0.1637		0.2575	False		,,,				2504	0.2035				p.M309I		.											.	DNAJB13-90	0			c.G927A						.	G	ILE/MET	879,3521	342.8+/-307.3	76,727,1397	117.0	108.0	111.0		927	4.6	1.0	11	dbSNP_130	111	2234,6352	378.8+/-339.0	280,1674,2339	yes	missense	DNAJB13	NM_153614.2	10	356,2401,3736	AA,AG,GG		26.0191,19.9773,23.972	benign	309/317	73681135	3113,9873	2200	4293	6493	SO:0001583	missense	374407	exon8			GCAGATGCTGCGC	AF516185	CCDS8227.1	11q13.3	2011-09-02	2010-04-21		ENSG00000187726	ENSG00000187726		"""Heat shock proteins / DNAJ (HSP40)"""	30718	protein-coding gene	gene with protein product	"""radial spoke 16 homolog A (Chlamydomonas)"""	610263	"""DnaJ (Hsp40) related, subfamily B, member 13"""				Standard	NM_153614		Approved	TSARG6, RSPH16A	uc001ouo.3	P59910	OTTHUMG00000168093	ENST00000339764.1:c.927G>A	11.37:g.73681135G>A	ENSP00000344431:p.Met309Ile	108	0		57	5	NM_153614	0	0	0	0	0	B3LEP4|Q8IZW5	Missense_Mutation	SNP	ENST00000339764.1	37	CCDS8227.1	521|521	0.23855311355311357|0.23855311355311357	104|104	0.21138211382113822|0.21138211382113822	118|118	0.3259668508287293|0.3259668508287293	94|94	0.16433566433566432|0.16433566433566432	205|205	0.2704485488126649|0.2704485488126649	G|G	16.13|16.13	3.036820|3.036820	0.54896|0.54896	0.199773|0.199773	0.260191|0.260191	ENSG00000187726|ENSG00000187726	ENST00000542350|ENST00000339764;ENST00000537753;ENST00000543947	.|T;T;T	.|0.39229	.|1.09;1.09;1.09	5.54|5.54	4.59|4.59	0.56863|0.56863	.|HSP40/DnaJ peptide-binding (1);	.|0.115848	.|0.64402	.|D	.|0.000011	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.02708|0.02708	-0.52|-0.52	0.31243|0.31243	P|P	0.6949609999999999|0.6949609999999999	.|B	.|0.10296	.|0.003	.|B	.|0.16722	.|0.016	T|T	0.30851|0.30851	-0.9964|-0.9964	4|9	.|0.23891	.|T	.|0.37	.|.	13.1925|13.1925	0.59719|0.59719	0.0:0.2743:0.7257:0.0|0.0:0.2743:0.7257:0.0	.|.	.|309	.|P59910	.|DJB13_HUMAN	T|I	210|309;134;134	.|ENSP00000344431:M309I;ENSP00000439711:M134I;ENSP00000438576:M134I	.|ENSP00000344431:M309I	A|M	+|+	1|3	0|0	DNAJB13|DNAJB13	73358783|73358783	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	2.898000|2.898000	0.48672|0.48672	2.619000|2.619000	0.88677|0.88677	0.644000|0.644000	0.83932|0.83932	GCT|ATG	G|0.758;A|0.242		0.622	DNAJB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398100.1	NM_153614	
PHLDB1	23187	bcgsc.ca	37	11	118509668	118509668	+	Silent	SNP	A	A	G	rs483598	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr11:118509668A>G	ENST00000361417.2	+	12	3006	c.2595A>G	c.(2593-2595)gaA>gaG	p.E865E	PHLDB1_ENST00000524713.1_5'Flank|AP002954.3_ENST00000530198.1_RNA|PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000527898.1_5'UTR|PHLDB1_ENST00000356063.5_Silent_p.E865E	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	865										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCGTGCAGGAATCAGAACGCC	0.612													G|||	2868	0.572684	0.4773	0.7089	5008	,	,		18170	0.6558		0.5368	False		,,,				2504	0.5562				p.E865E		.											.	PHLDB1-90	0			c.A2595G						.	G	,,	2087,2311	593.3+/-388.0	490,1107,602	38.0	36.0	37.0		2595,2595,2595	-1.5	0.7	11	dbSNP_83	37	4742,3848	531.7+/-382.0	1319,2104,872	no	coding-synonymous,coding-synonymous,coding-synonymous	PHLDB1	NM_001144758.1,NM_001144759.1,NM_015157.2	,,	1809,3211,1474	GG,GA,AA		44.7963,47.4534,47.4207	,,	865/1378,865/1320,865/1378	118509668	6829,6159	2199	4295	6494	SO:0001819	synonymous_variant	23187	exon11			GCAGGAATCAGAA		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2595A>G	11.37:g.118509668A>G		194	0		127	5	NM_001144758	0	0	24	24	0	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Silent	SNP	ENST00000361417.2	37	CCDS8401.1																																																																																			A|0.454;G|0.546		0.612	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
HYLS1	219844	broad.mit.edu;bcgsc.ca	37	11	125770031	125770031	+	Silent	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr11:125770031G>A	ENST00000425380.2	+	3	1549	c.768G>A	c.(766-768)caG>caA	p.Q256Q	HYLS1_ENST00000526028.1_Silent_p.Q256Q|HYLS1_ENST00000356438.3_Silent_p.Q256Q|PUS3_ENST00000227474.3_Intron	NM_001134793.1	NP_001128265.1	Q96M11	HYLS1_HUMAN	hydrolethalus syndrome 1	256						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|skin(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		CCAAACCTCAGCATATATATG	0.463																																					p.Q256Q	Esophageal Squamous(172;2590 2636 8884 10471)	.											.	HYLS1-91	0			c.G768A						.						88.0	82.0	84.0					11																	125770031		2201	4299	6500	SO:0001819	synonymous_variant	219844	exon3			ACCTCAGCATATA	AK057477	CCDS8467.1	11q24	2014-06-18				ENSG00000198331			26558	protein-coding gene	gene with protein product		610693				15843405	Standard	NM_145014		Approved	FLJ32915	uc009zbv.3	Q96M11		ENST00000425380.2:c.768G>A	11.37:g.125770031G>A		170	0		103	5	NM_001134793	0	0	10	10	0	B3KXI8|Q96BX9	Silent	SNP	ENST00000425380.2	37	CCDS8467.1																																																																																			.		0.463	HYLS1-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386733.1	NM_145014	
BHLHE41	79365	broad.mit.edu	37	12	26275863	26275863	+	Silent	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr12:26275863G>A	ENST00000242728.4	-	5	932	c.585C>T	c.(583-585)gcC>gcT	p.A195A	RP11-283G6.3_ENST00000535914.1_RNA|RP11-283G6.3_ENST00000545819.1_RNA	NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	195					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						CGGACCCGGCGGCCGAGGGAG	0.711																																					p.A195A		.											.	BHLHE41-226	0			c.C585T						.						6.0	9.0	8.0					12																	26275863		2043	4068	6111	SO:0001819	synonymous_variant	79365	exon5			CCCGGCGGCCGAG	AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.585C>T	12.37:g.26275863G>A		49	2		40	4	NM_030762	0	0	12	13	1	A2I2N8	Silent	SNP	ENST00000242728.4	37	CCDS8706.1																																																																																			.		0.711	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402714.1	NM_030762	
KRT85	3891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52757872	52757872	+	Silent	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr12:52757872G>A	ENST00000257901.3	-	4	841	c.766C>T	c.(766-768)Ctg>Ttg	p.L256L	KRT85_ENST00000544265.1_Silent_p.L44L	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	256	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGCGCCTCAGGAAGCTAGAC	0.622																																					p.L256L		.											.	KRT85-91	0			c.C766T						.						103.0	105.0	104.0					12																	52757872		2203	4300	6503	SO:0001819	synonymous_variant	3891	exon4			GCCTCAGGAAGCT	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.766C>T	12.37:g.52757872G>A		194	0		157	26	NM_002283	0	0	0	0	0	Q9NSB1	Silent	SNP	ENST00000257901.3	37	CCDS8824.1																																																																																			.		0.622	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
CD63	967	broad.mit.edu;ucsc.edu;bcgsc.ca	37	12	56119366	56119366	+	Missense_Mutation	SNP	T	T	G			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr12:56119366T>G	ENST00000549117.1	-	8	1132	c.696A>C	c.(694-696)agA>agC	p.R232S	CD63_ENST00000552692.1_Missense_Mutation_p.R232S|CD63_ENST00000550776.1_Missense_Mutation_p.R150S|CD63_ENST00000257857.4_Missense_Mutation_p.R232S|CD63_ENST00000420846.3_Missense_Mutation_p.R230S|CD63_ENST00000548160.1_Missense_Mutation_p.R139S|CD63_ENST00000548898.1_Missense_Mutation_p.R139S|CD63_ENST00000552754.1_Missense_Mutation_p.R209S|CD63_ENST00000552067.1_Missense_Mutation_p.R139S|CD63_ENST00000546939.1_Missense_Mutation_p.R150S	NM_001257389.1	NP_001244318.1	P08962	CD63_HUMAN	CD63 molecule	232					blood coagulation (GO:0007596)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular protein localization (GO:0034613)|endosome to melanosome transport (GO:0035646)|pigment granule maturation (GO:0048757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of receptor internalization (GO:0002092)|protein transport (GO:0015031)|regulation of rubidium ion transport (GO:2000680)|regulation of vascular endothelial growth factor signaling pathway (GO:1900746)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|multivesicular body, internal vesicle (GO:0097487)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)				kidney(1)|large_intestine(3)|lung(2)|ovary(1)	7						CGTAGCCACTTCTGATACTCT	0.493																																					p.R232S	Pancreas(123;1459 1747 6717 18841 37380)	.											.	CD63-90	0			c.A696C						.						103.0	96.0	99.0					12																	56119366		2203	4300	6503	SO:0001583	missense	967	exon8			GCCACTTCTGATA	M58485	CCDS8890.1, CCDS58242.1, CCDS58243.1	12q12-q13	2013-02-14	2006-03-28					"""CD molecules"", ""Tetraspanins"""	1692	protein-coding gene	gene with protein product		155740	"""CD63 antigen (melanoma 1 antigen)"""	MLA1			Standard	NM_001780		Approved	ME491, TSPAN30	uc031qhv.1	P08962		ENST00000549117.1:c.696A>C	12.37:g.56119366T>G	ENSP00000447730:p.Arg232Ser	100	1		113	53	NM_001257390	1	1	1628	3231	1601	F8VZE2|Q5TZP3|Q8N6Z9|Q9UCG6	Missense_Mutation	SNP	ENST00000549117.1	37	CCDS8890.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133517	0.77662	.	.	ENSG00000135404	ENST00000548898;ENST00000552067;ENST00000420846;ENST00000548160;ENST00000546939;ENST00000552692;ENST00000549117;ENST00000257857;ENST00000552754;ENST00000550776	T;T;T;T;T;T;T;T;T;T	0.50548	0.85;0.85;1.09;0.85;0.74;1.08;1.08;1.08;0.83;0.74	5.29	1.29	0.21616	.	0.146852	0.44483	N	0.000455	T	0.51719	0.1691	L	0.54965	1.715	0.52501	D	0.999958	D;D;D	0.65815	0.995;0.975;0.981	P;P;P	0.59115	0.743;0.781;0.852	T	0.50030	-0.8875	10	0.72032	D	0.01	.	5.3332	0.15944	0.0:0.167:0.1497:0.6832	.	209;230;232	Q8N6Z9;C9JV86;P08962	.;.;CD63_HUMAN	S	139;139;230;139;150;232;232;232;209;150	ENSP00000447938:R139S;ENSP00000449684:R139S;ENSP00000393502:R230S;ENSP00000449654:R139S;ENSP00000447356:R150S;ENSP00000449337:R232S;ENSP00000447730:R232S;ENSP00000257857:R232S;ENSP00000446807:R209S;ENSP00000448091:R150S	ENSP00000257857:R232S	R	-	3	2	CD63	54405633	0.753000	0.28349	0.998000	0.56505	0.979000	0.70002	-0.565000	0.05929	0.391000	0.25143	0.533000	0.62120	AGA	.		0.493	CD63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409234.1		
USP15	9958	broad.mit.edu	37	12	62777929	62777929	+	Missense_Mutation	SNP	G	G	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr12:62777929G>T	ENST00000280377.5	+	11	1377	c.1319G>T	c.(1318-1320)gGc>gTc	p.G440V	USP15_ENST00000353364.3_Missense_Mutation_p.G411V|USP15_ENST00000393654.3_Missense_Mutation_p.G415V	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	440	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		ATATTTCATGGCCTTTTCAAA	0.343																																					p.G440V	Melanoma(181;615 2041 39364 49691 50001)	.											.	USP15-1084	0			c.G1319T						.						115.0	110.0	112.0					12																	62777929		2203	4299	6502	SO:0001583	missense	9958	exon11			TTCATGGCCTTTT	AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.1319G>T	12.37:g.62777929G>T	ENSP00000280377:p.Gly440Val	85	0		64	4	NM_001252078	0	0	20	20	0	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	ENST00000280377.5	37	CCDS58251.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631069	0.87660	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654	T;T;T	0.44881	3.54;3.54;0.91	5.16	5.16	0.70880	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.76104	0.3941	H	0.95260	3.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83710	0.0187	9	.	.	.	-7.2919	18.8461	0.92208	0.0:0.0:1.0:0.0	.	440;411	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	V	411;440;415	ENSP00000258123:G411V;ENSP00000280377:G440V;ENSP00000377264:G415V	.	G	+	2	0	USP15	61064196	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.690000	0.91761	0.655000	0.94253	GGC	.		0.343	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407831.2	NM_006313	
ABCB9	23457	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	123465730	123465730	+	5'UTR	SNP	G	G	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr12:123465730G>T	ENST00000542678.1	-	0	466				ARL6IP4_ENST00000543566.1_Missense_Mutation_p.R138L|RP11-197N18.2_ENST00000540866.2_RNA|ARL6IP4_ENST00000426960.2_Missense_Mutation_p.R15L|ARL6IP4_ENST00000357866.4_Missense_Mutation_p.R15L|ARL6IP4_ENST00000392435.2_Missense_Mutation_p.R138L|ARL6IP4_ENST00000315580.5_Missense_Mutation_p.R138L|ARL6IP4_ENST00000412505.2_Missense_Mutation_p.R15L|ARL6IP4_ENST00000439686.2_Missense_Mutation_p.R15L|ARL6IP4_ENST00000453766.2_Missense_Mutation_p.R138L|ARL6IP4_ENST00000454885.2_Missense_Mutation_p.R15L			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9						peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		AGTCGCAGCCGGTCCCGGGGA	0.672																																					p.R138L	Ovarian(49;786 1333 9175 38236)	.											.	ARL6IP4-90	0			c.G413T						.						22.0	23.0	23.0					12																	123465730		1857	3537	5394	SO:0001623	5_prime_UTR_variant	51329	exon2			GCAGCCGGTCCCG	U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.-2373C>A	12.37:g.123465730G>T		143	0		154	14	NM_018694	0	0	122	132	10	B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	ENST00000542678.1	37	CCDS9241.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035846	0.75617	.	.	ENSG00000182196	ENST00000544323;ENST00000543566;ENST00000315580;ENST00000542099;ENST00000392435;ENST00000413381;ENST00000426960;ENST00000453766;ENST00000454885;ENST00000412505;ENST00000439686;ENST00000456762;ENST00000357866	T;T;T;T;T;T;T;T;T;T;T;T;T	0.53857	1.1;0.87;1.5;0.87;0.87;0.87;0.87;0.87;0.87;0.66;0.87;0.87;0.6	5.11	2.26	0.28386	.	.	.	.	.	T	0.57417	0.2052	L	0.55481	1.735	0.24550	N	0.99403	B;B;D;D;D;D	0.56521	0.349;0.3;0.97;0.976;0.976;0.97	B;B;P;P;P;P	0.55055	0.158;0.151;0.655;0.767;0.652;0.655	T	0.47824	-0.9087	9	0.72032	D	0.01	.	7.4283	0.27113	0.3543:0.0:0.6457:0.0	.	15;138;138;138;138;138	B3V0L1;Q66PJ3-5;Q66PJ3-4;B3V0L0;Q66PJ3;Q66PJ3-2	.;.;.;.;AR6P4_HUMAN;.	L	138;138;138;138;138;15;15;138;15;15;15;16;15	ENSP00000445309:R138L;ENSP00000442718:R138L;ENSP00000313422:R138L;ENSP00000442200:R138L;ENSP00000376230:R138L;ENSP00000441406:R15L;ENSP00000406036:R15L;ENSP00000414847:R138L;ENSP00000396723:R15L;ENSP00000413132:R15L;ENSP00000396365:R15L;ENSP00000391598:R16L;ENSP00000350532:R15L	ENSP00000313422:R138L	R	+	2	0	ARL6IP4	122031683	0.028000	0.19301	0.257000	0.24404	0.948000	0.59901	0.581000	0.23819	0.265000	0.21872	0.549000	0.68633	CGG	.		0.672	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400956.1	NM_019624	
PXMP2	5827	hgsc.bcm.edu	37	12	133264332	133264332	+	Silent	SNP	C	C	T	rs11538534	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr12:133264332C>T	ENST00000317479.3	+	1	141	c.76C>T	c.(76-78)Ctg>Ttg	p.L26L	PXMP2_ENST00000428960.2_5'Flank|POLE_ENST00000535270.1_5'Flank|PXMP2_ENST00000545677.1_5'Flank|PXMP2_ENST00000539093.1_5'Flank|PXMP2_ENST00000543589.1_Silent_p.L26L|POLE_ENST00000320574.5_5'Flank|RP13-672B3.2_ENST00000537262.1_5'Flank	NM_018663.1	NP_061133.1	Q9NR77	PXMP2_HUMAN	peroxisomal membrane protein 2, 22kDa	26						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|protein complex (GO:0043234)				large_intestine(1)|liver(2)|lung(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.86e-08)|Epithelial(86;2.47e-07)|all cancers(50;6.85e-06)		CGCCCAGTACCTGCTCTTCCT	0.801													c|||	1952	0.389776	0.2231	0.464	5008	,	,		4712	0.3244		0.5706	False		,,,				2504	0.4438				p.L26L		.											.	PXMP2-90	0			c.C76T						.						1.0	1.0	1.0					12																	133264332		888	1858	2746	SO:0001819	synonymous_variant	5827	exon1			CAGTACCTGCTCT		CCDS9279.1	12q24	2010-08-18	2002-08-29		ENSG00000176894	ENSG00000176894			9716	protein-coding gene	gene with protein product			"""peroxisomal membrane protein 2 (22kD)"""			11590176	Standard	NM_018663		Approved	PMP22	uc001ukt.3	Q9NR77	OTTHUMG00000168019	ENST00000317479.3:c.76C>T	12.37:g.133264332C>T		0	0		9	5	NM_018663	0	0	5	5	0		Silent	SNP	ENST00000317479.3	37	CCDS9279.1																																																																																			C|0.572;T|0.428		0.801	PXMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397553.1	NM_018663	
VWA8	23078	broad.mit.edu	37	13	42189173	42189173	+	Missense_Mutation	SNP	G	G	T	rs527452350		TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr13:42189173G>T	ENST00000379310.3	-	38	4727	c.4659C>A	c.(4657-4659)caC>caA	p.H1553Q		NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	1553						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										CCTCCTTCCCGTGTTTGGGGG	0.502																																					p.H1553Q		.											.	.	0			c.C4659A						.						151.0	154.0	153.0					13																	42189173		1984	4160	6144	SO:0001583	missense	23078	exon38			CTTCCCGTGTTTG	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.4659C>A	13.37:g.42189173G>T	ENSP00000368612:p.His1553Gln	93	0		93	3	NM_015058	0	0	21	21	0	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	ENST00000379310.3	37	CCDS41881.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.702044	0.68501	.	.	ENSG00000102763	ENST00000251030;ENST00000379310	T	0.11495	2.77	5.93	-4.16	0.03869	.	0.000000	0.85682	D	0.000000	T	0.24470	0.0593	M	0.82823	2.61	0.80722	D	1	D	0.65815	0.995	P	0.56700	0.804	T	0.20107	-1.0285	10	0.62326	D	0.03	.	13.9302	0.63991	0.7826:0.0:0.2174:0.0	.	1553	A3KMH1	K0564_HUMAN	Q	1457;1553	ENSP00000368612:H1553Q	ENSP00000251030:H1457Q	H	-	3	2	KIAA0564	41087173	0.160000	0.22878	0.945000	0.38365	0.992000	0.81027	-0.314000	0.08092	-0.722000	0.04922	-0.136000	0.14681	CAC	.		0.502	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
ING1	3621	hgsc.bcm.edu	37	13	111368316	111368316	+	Silent	SNP	C	C	T	rs9555726	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr13:111368316C>T	ENST00000375774.3	+	1	988	c.526C>T	c.(526-528)Ctg>Ttg	p.L176L	CARS2_ENST00000535398.1_5'Flank|ING1_ENST00000464141.1_Intron|ING1_ENST00000338450.7_Intron|ING1_ENST00000333219.7_Intron|ING1_ENST00000375775.3_Intron	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	176					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GGCCGCATCTCTGCTGACCCG	0.706													C|||	2912	0.58147	0.23	0.6816	5008	,	,		11066	0.7252		0.6909	False		,,,				2504	0.7249				p.L176L		.											.	ING1-515	0			c.C526T						.	C	,,,	1347,2085		295,757,664	14.0	24.0	21.0		526,,,	-5.6	0.0	13	dbSNP_119	21	5238,1736		2020,1198,269	no	coding-synonymous,intron,intron,intron	ING1	NM_005537.3,NM_198217.1,NM_198218.1,NM_198219.1	,,,	2315,1955,933	TT,TC,CC		24.8925,39.2483,36.7192	,,,	176/423,,,	111368316	6585,3821	1716	3487	5203	SO:0001819	synonymous_variant	3621	exon1			GCATCTCTGCTGA		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.526C>T	13.37:g.111368316C>T		2	0		7	7	NM_005537	0	0	2	5	3	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	ENST00000375774.3	37	CCDS9517.1																																																																																			C|0.372;T|0.628		0.706	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
TDP1	55775	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	90450896	90450896	+	Silent	SNP	T	T	C			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr14:90450896T>C	ENST00000335725.4	+	9	1171	c.921T>C	c.(919-921)gaT>gaC	p.D307D	TDP1_ENST00000393454.2_Silent_p.D307D|TDP1_ENST00000357382.3_Silent_p.D68D|TDP1_ENST00000555880.1_Silent_p.D307D|TDP1_ENST00000393452.3_Silent_p.D307D	NM_018319.3	NP_060789.2	Q9NUW8	TYDP1_HUMAN	tyrosyl-DNA phosphodiesterase 1	307					cell death (GO:0008219)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	3'-tyrosyl-DNA phosphodiesterase activity (GO:0017005)|double-stranded DNA binding (GO:0003690)|exonuclease activity (GO:0004527)|single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|urinary_tract(1)	25		all_cancers(154;0.185)		COAD - Colon adenocarcinoma(157;0.23)		GAATTGCTGATGGAACCCACA	0.408								Repair of DNA-protein crosslinks																													p.D307D		.											.	TDP1-92	0			c.T921C						.						171.0	165.0	167.0					14																	90450896		2203	4300	6503	SO:0001819	synonymous_variant	55775	exon9			TGCTGATGGAACC	AF182002	CCDS9888.1	14q32.11	2008-08-11				ENSG00000042088			18884	protein-coding gene	gene with protein product		607198				11839309, 12244316	Standard	XM_005267847		Approved	FLJ11090, SCAN1	uc001xxz.3	Q9NUW8		ENST00000335725.4:c.921T>C	14.37:g.90450896T>C		58	0		44	24	NM_018319	0	0	2	8	6	Q2HXX4|Q86TV8|Q96BK7|Q9NZM7|Q9NZM8	Silent	SNP	ENST00000335725.4	37	CCDS9888.1																																																																																			.		0.408	TDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411239.1	NM_018319	
MGA	23269	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	15	42042367	42042367	+	Frame_Shift_Del	DEL	G	G	-			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr15:42042367delG	ENST00000570161.1	+	16	6562	c.6562delG	c.(6562-6564)ggafs	p.G2188fs	MGA_ENST00000545763.1_Frame_Shift_Del_p.G1979fs|MGA_ENST00000219905.7_Frame_Shift_Del_p.G2188fs|MGA_ENST00000566586.1_Frame_Shift_Del_p.G1979fs|MGA_ENST00000389936.4_Frame_Shift_Del_p.G2149fs			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAAATGTGTTGGAGCTTCACA	0.438																																					p.G2188fs		.											.	MGA-522	0			c.6562delG						.						102.0	101.0	101.0					15																	42042367		1879	4112	5991	SO:0001589	frameshift_variant	23269	exon17			TGTGTTGGAGCTT	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6562delG	15.37:g.42042367delG	ENSP00000457035:p.Gly2188fs	76	0		41	31	NM_001164273	0	0	0	0	0	Q0VAX6|Q75ME7|Q86UM5	Frame_Shift_Del	DEL	ENST00000570161.1	37	CCDS55959.1																																																																																			.		0.438	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MFAP1	4236	bcgsc.ca	37	15	44102010	44102010	+	Silent	SNP	A	A	C	rs2228368	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr15:44102010A>C	ENST00000267812.3	-	7	1222	c.990T>G	c.(988-990)gcT>gcG	p.A330A		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	330					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		TGCCCTTAACAGCTTTGTTGG	0.433													A|||	1015	0.202676	0.2935	0.1801	5008	,	,		19004	0.2599		0.0954	False		,,,				2504	0.1472				p.A330A		.											.	MFAP1-226	0			c.T990G						.	A		1052,3344	383.5+/-324.9	117,818,1263	252.0	231.0	238.0		990	3.3	1.0	15	dbSNP_98	238	824,7772	190.8+/-237.2	39,746,3513	no	coding-synonymous	MFAP1	NM_005926.2		156,1564,4776	CC,CA,AA		9.5859,23.9308,14.4397		330/440	44102010	1876,11116	2198	4298	6496	SO:0001819	synonymous_variant	4236	exon7			CTTAACAGCTTTG		CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.990T>G	15.37:g.44102010A>C		197	2		109	5	NM_005926	0	0	21	21	0	Q86TG6	Silent	SNP	ENST00000267812.3	37	CCDS10105.1																																																																																			T|0.304;G|0.088		0.433	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133491.2	NM_005926	
GOLGA6A	342096	bcgsc.ca	37	15	74364639	74364639	+	Missense_Mutation	SNP	G	G	C	rs200350318		TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr15:74364639G>C	ENST00000290438.3	-	14	1553	c.1513C>G	c.(1513-1515)Caa>Gaa	p.Q505E	RN7SL429P_ENST00000479090.2_RNA	NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	505						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						TCCAGATGTTGTCCTCCATCT	0.632																																					p.Q505E		.											.	GOLGA6A-44	0			c.C1513G						.	C	GLU/GLN	13,2839		0,13,1413	43.0	76.0	64.0		1513	-1.8	0.0	15		64	41,5189		0,41,2574	no	missense	GOLGA6A	NM_001038640.2	29	0,54,3987	CC,CG,GG		0.7839,0.4558,0.6682	benign	505/694	74364639	54,8028	1426	2615	4041	SO:0001583	missense	342096	exon14			GATGTTGTCCTCC	AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.1513C>G	15.37:g.74364639G>C	ENSP00000290438:p.Gln505Glu	88	1		32	6	NM_001038640	0	0	0	0	0	A8K959|Q9NYA7	Missense_Mutation	SNP	ENST00000290438.3	37	CCDS32290.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.871708	0.00062	0.004558	0.007839	ENSG00000159289	ENST00000290438	T	0.17213	2.29	0.887	-1.77	0.07982	.	.	.	.	.	T	0.02193	0.0068	N	0.00677	-1.265	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22068	-1.0227	9	0.02654	T	1	.	5.0871	0.14689	0.1703:0.3999:0.4298:0.0	.	505	Q9NYA3	GOG6A_HUMAN	E	505	ENSP00000290438:Q505E	ENSP00000290438:Q505E	Q	-	1	0	GOLGA6A	72151692	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.799000	0.00762	-2.200000	0.00747	-2.001000	0.00444	CAA	G|0.999;C|0.001		0.632	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421835.1	XM_292357	
E4F1	1877	broad.mit.edu	37	16	2282180	2282180	+	Missense_Mutation	SNP	C	C	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr16:2282180C>A	ENST00000301727.4	+	4	472	c.424C>A	c.(424-426)Cac>Aac	p.H142N	E4F1_ENST00000565090.1_Missense_Mutation_p.H142N|E4F1_ENST00000564139.1_Missense_Mutation_p.H142N	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	142					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						AGGTGGTGGGCACATCAAAGA	0.687																																					p.H142N		.											.	E4F1-187	0			c.C424A						.						62.0	74.0	70.0					16																	2282180		2196	4292	6488	SO:0001583	missense	1877	exon4			GGTGGGCACATCA	U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.424C>A	16.37:g.2282180C>A	ENSP00000301727:p.His142Asn	42	1		54	4	NM_004424	0	0	2	2	0	A8K2R4|O00146	Missense_Mutation	SNP	ENST00000301727.4	37	CCDS32370.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993031	0.35131	.	.	ENSG00000167967	ENST00000301727	T	0.06218	3.33	5.33	1.97	0.26223	.	0.446382	0.27705	N	0.018185	T	0.14098	0.0341	L	0.42245	1.32	0.40811	D	0.98342	B;B;D	0.63880	0.076;0.076;0.993	B;B;D	0.70227	0.041;0.021;0.968	T	0.01397	-1.1365	10	0.87932	D	0	-13.8253	8.2677	0.31824	0.3165:0.5301:0.1534:0.0	.	138;142;142	E9PFZ8;E7EMF7;Q66K89	.;.;E4F1_HUMAN	N	142	ENSP00000301727:H142N	ENSP00000301727:H142N	H	+	1	0	E4F1	2222181	1.000000	0.71417	0.983000	0.44433	0.868000	0.49771	1.279000	0.33191	0.569000	0.29329	0.561000	0.74099	CAC	.		0.687	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435225.1	NM_004424	
GLIS2	84662	broad.mit.edu	37	16	4386949	4386949	+	Silent	SNP	A	A	C			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr16:4386949A>C	ENST00000262366.3	+	8	1820	c.999A>C	c.(997-999)ccA>ccC	p.P333P	GLIS2_ENST00000433375.1_Silent_p.P333P|RP11-295D4.1_ENST00000574705.1_RNA|PAM16_ENST00000577031.1_Intron			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	333					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						AGCTGCGCCCACCCCCCAAGC	0.677																																					p.P333P		.											.	GLIS2-90	0			c.A999C						.						24.0	23.0	23.0					16																	4386949		2191	4296	6487	SO:0001819	synonymous_variant	84662	exon6			GCGCCCACCCCCC	AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.999A>C	16.37:g.4386949A>C		103	20		105	27	NM_032575	2	0	24	31	5	B3KX84	Silent	SNP	ENST00000262366.3	37	CCDS10511.1																																																																																			.		0.677	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251630.1	NM_032575	
NUDT16L1	84309	hgsc.bcm.edu	37	16	4744169	4744169	+	Missense_Mutation	SNP	G	G	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr16:4744169G>T	ENST00000304301.6	+	2	377	c.344G>T	c.(343-345)cGg>cTg	p.R115L	NUDT16L1_ENST00000586252.1_Missense_Mutation_p.R115L|NUDT16L1_ENST00000586536.1_Missense_Mutation_p.R115L|NUDT16L1_ENST00000405142.1_Missense_Mutation_p.R115L	NM_032349.3	NP_115725.1	Q9BRJ7	SDOS_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1	115						cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4						CTGTACGCGCGGCAGCTGACG	0.766																																					p.R115L		.											.	NUDT16L1-90	0			c.G344T						.						8.0	8.0	8.0					16																	4744169		2120	4211	6331	SO:0001583	missense	84309	exon2			ACGCGCGGCAGCT	BC006223	CCDS10519.1, CCDS59257.1	16p13.3	2008-02-05			ENSG00000168101	ENSG00000168101		"""Nudix motif containing"""	28154	protein-coding gene	gene with protein product						11805099	Standard	NM_032349		Approved	SDOS	uc002cxe.3	Q9BRJ7	OTTHUMG00000129471	ENST00000304301.6:c.344G>T	16.37:g.4744169G>T	ENSP00000306670:p.Arg115Leu	6	0		29	4	NM_032349	0	0	37	37	0	Q8NAI2	Missense_Mutation	SNP	ENST00000304301.6	37	CCDS10519.1	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734420	0.69189	.	.	ENSG00000168101	ENST00000304301;ENST00000405142	T	0.39997	1.05	4.13	4.13	0.48395	NUDIX hydrolase domain-like (1);	0.063272	0.64402	D	0.000009	T	0.39358	0.1075	N	0.11427	0.14	0.43647	D	0.996058	D;D	0.89917	1.0;0.98	D;P	0.66084	0.941;0.703	T	0.32877	-0.9890	10	0.46703	T	0.11	.	9.2625	0.37621	0.1025:0.0:0.8975:0.0	.	115;115	Q9BRJ7-2;Q9BRJ7	.;SDOS_HUMAN	L	115	ENSP00000306670:R115L	ENSP00000306670:R115L	R	+	2	0	NUDT16L1	4684170	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.000000	0.40816	2.015000	0.59207	0.650000	0.86243	CGG	.		0.766	NUDT16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251634.1	NM_032349	
USP31	57478	broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	23119496	23119496	+	Silent	SNP	C	C	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr16:23119496C>T	ENST00000219689.7	-	2	641	c.642G>A	c.(640-642)gtG>gtA	p.V214V		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	169	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CATTCTTTGACACAATAGTCT	0.423																																					p.V214V		.											.	USP31-663	0			c.G642A						.						82.0	82.0	82.0					16																	23119496		2197	4300	6497	SO:0001819	synonymous_variant	57478	exon2			CTTTGACACAATA	AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.642G>A	16.37:g.23119496C>T		126	2		116	52	NM_020718	0	0	0	0	0	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	ENST00000219689.7	37	CCDS10607.1																																																																																			.		0.423	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211607.1	NM_020718	
ZNF843	283933	broad.mit.edu	37	16	31448010	31448010	+	Missense_Mutation	SNP	A	A	C			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr16:31448010A>C	ENST00000315678.5	-	2	885	c.161T>G	c.(160-162)gTc>gGc	p.V54G	ZNF843_ENST00000564218.1_Missense_Mutation_p.V54G	NM_001136509.1	NP_001129981.1	Q8N446	ZN843_HUMAN	zinc finger protein 843	54							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|large_intestine(1)|prostate(1)	4						GTCGCTGTGGACCCGCCAGTG	0.647																																					p.V54G		.											.	ZNF843-68	0			c.T161G						.						23.0	29.0	27.0					16																	31448010		692	1591	2283	SO:0001583	missense	283933	exon2			CTGTGGACCCGCC	BC036762	CCDS45471.1	16p11.2	2013-01-11			ENSG00000176723	ENSG00000176723		"""Zinc fingers, C2H2-type"""	28710	protein-coding gene	gene with protein product						12477932	Standard	NM_001136509		Approved	MGC46336	uc010vfm.1	Q8N446		ENST00000315678.5:c.161T>G	16.37:g.31448010A>C	ENSP00000322899:p.Val54Gly	55	11		45	8	NM_001136509	0	0	1	1	0	A8K4U8	Missense_Mutation	SNP	ENST00000315678.5	37	CCDS45471.1	.	.	.	.	.	.	.	.	.	.	A	8.184	0.794387	0.16327	.	.	ENSG00000176723	ENST00000315678	T	0.01821	4.62	1.08	1.08	0.20341	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02193	0.0068	L	0.53249	1.67	0.30247	N	0.794489	B	0.23540	0.087	B	0.25614	0.062	T	0.26503	-1.0101	9	0.87932	D	0	.	2.9208	0.05768	0.7249:0.0:0.2751:0.0	.	54	Q8N446	ZN843_HUMAN	G	54	ENSP00000322899:V54G	ENSP00000322899:V54G	V	-	2	0	ZNF843	31355511	0.004000	0.15560	0.019000	0.16419	0.006000	0.05464	0.140000	0.16056	0.731000	0.32448	0.338000	0.21704	GTC	.		0.647	ZNF843-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432843.1	NM_001136509	
CNEP1R1	255919	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	16	50063678	50063678	+	Missense_Mutation	SNP	G	G	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr16:50063678G>T	ENST00000427478.2	+	3	194	c.140G>T	c.(139-141)tGg>tTg	p.W47L	CNEP1R1_ENST00000458059.3_Missense_Mutation_p.W64L|CNEP1R1_ENST00000565556.1_Missense_Mutation_p.W15L|CNEP1R1_ENST00000562576.1_Missense_Mutation_p.W47L	NM_001281789.1	NP_001268718.1	Q8N9A8	NEPR1_HUMAN	CTD nuclear envelope phosphatase 1 regulatory subunit 1	47					lipid metabolic process (GO:0006629)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of triglyceride biosynthetic process (GO:0010867)|protein localization to nucleus (GO:0034504)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|Nem1-Spo7 phosphatase complex (GO:0071595)|nuclear membrane (GO:0031965)											ACTGGTGCCTGGAACTGGTTA	0.318																																					p.W64L		.											.	.	0			c.G191T						.						183.0	165.0	171.0					16																	50063678		1863	4091	5954	SO:0001583	missense	255919	exon4			GTGCCTGGAACTG	AK095420	CCDS45480.1, CCDS61931.1	16q12.1	2012-02-01	2012-02-01	2012-02-01	ENSG00000205423	ENSG00000205423			26759	protein-coding gene	gene with protein product	"""nuclear envelope phosphatase 1-regulatory subunit 1"""		"""chromosome 16 open reading frame 69"", ""transmembrane protein 188"""	C16orf69, TMEM188		22134922	Standard	NM_153261		Approved	FLJ38101, NEP1-R1	uc002eft.3	Q8N9A8		ENST00000427478.2:c.140G>T	16.37:g.50063678G>T	ENSP00000394224:p.Trp47Leu	97	0		105	14	NM_153261	0	0	14	14	0	Q4G1A9|Q5H9V0|Q8NE06	Missense_Mutation	SNP	ENST00000427478.2	37		.	.	.	.	.	.	.	.	.	.	G	29.5	5.007830	0.93287	.	.	ENSG00000205423	ENST00000458059;ENST00000427478	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	T	0.63640	0.2528	L	0.55990	1.75	0.80722	D	1	P;P	0.51933	0.681;0.949	B;P	0.48189	0.437;0.57	T	0.62450	-0.6852	8	0.45353	T	0.12	-10.5676	20.3046	0.98621	0.0:0.0:1.0:0.0	.	47;64	Q8N9A8;Q8N9A8-2	TM188_HUMAN;.	L	64;47	.	ENSP00000394224:W47L	W	+	2	0	TMEM188	48621179	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.619000	0.90938	2.878000	0.98634	0.650000	0.86243	TGG	.		0.318	CNEP1R1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153261	
CCL11	6356	broad.mit.edu;ucsc.edu	37	17	32614690	32614690	+	Missense_Mutation	SNP	C	C	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr17:32614690C>A	ENST00000305869.3	+	3	416	c.275C>A	c.(274-276)tCt>tAt	p.S92Y		NM_002986.2	NP_002977.1	P51671	CCL11_HUMAN	chemokine (C-C motif) ligand 11	92					actin filament organization (GO:0007015)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|chronic inflammatory response (GO:0002544)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|ERK1 and ERK2 cascade (GO:0070371)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mammary duct terminal end bud growth (GO:0060763)|mast cell chemotaxis (GO:0002551)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of Rac GTPase activity (GO:0032855)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|response to interleukin-4 (GO:0070670)|response to radiation (GO:0009314)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			breast(1)|lung(1)|prostate(1)	3	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		GACCAAAAATCTCCAACTCCA	0.433																																					p.S92Y		.											.	CCL11-90	0			c.C275A						.						68.0	59.0	62.0					17																	32614690		2203	4300	6503	SO:0001583	missense	6356	exon3			AAAAATCTCCAAC	AB063614	CCDS11279.1	17q21.1-q21.2	2013-02-25	2002-08-22	2002-08-23	ENSG00000172156	ENSG00000172156		"""Chemokine ligands"", ""Endogenous ligands"""	10610	protein-coding gene	gene with protein product	"""eotaxin-1"""	601156	"""small inducible cytokine subfamily A (Cys-Cys), member 11 (eotaxin)"""	SCYA11		9169149	Standard	NM_002986		Approved	eotaxin, MGC22554	uc002hia.1	P51671	OTTHUMG00000132884	ENST00000305869.3:c.275C>A	17.37:g.32614690C>A	ENSP00000302234:p.Ser92Tyr	106	2		47	9	NM_002986	0	0	0	0	0	P50877|Q92490|Q92491	Missense_Mutation	SNP	ENST00000305869.3	37	CCDS11279.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992550	0.35131	.	.	ENSG00000172156	ENST00000305869	T	0.04049	3.72	4.47	-1.38	0.09027	Chemokine interleukin-8-like domain (1);	0.348748	0.18906	N	0.127906	T	0.05410	0.0143	.	.	.	0.09310	N	1	P	0.44659	0.84	P	0.45232	0.474	T	0.30679	-0.9970	9	0.42905	T	0.14	.	7.8473	0.29433	0.0:0.4569:0.0:0.5431	.	92	P51671	CCL11_HUMAN	Y	92	ENSP00000302234:S92Y	ENSP00000302234:S92Y	S	+	2	0	CCL11	29638803	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.625000	0.05534	-0.178000	0.10672	0.561000	0.74099	TCT	.		0.433	CCL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256377.2	NM_002986	
NT5C	30833	hgsc.bcm.edu	37	17	73127683	73127683	+	Silent	SNP	T	T	C	rs4788867	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr17:73127683T>C	ENST00000245552.2	-	1	207	c.120A>G	c.(118-120)caA>caG	p.Q40Q	NT5C_ENST00000582160.1_5'Flank|NT5C_ENST00000578337.1_5'Flank|NT5C_ENST00000579082.1_5'UTR|NT5C_ENST00000582170.1_Silent_p.Q40Q	NM_014595.2	NP_055410.1	Q8TCD5	NT5C_HUMAN	5', 3'-nucleotidase, cytosolic	40					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|pyrimidine nucleotide binding (GO:0019103)					all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Lamivudine(DB00709)	AGCCGCGGCGTTGCTCCAGCG	0.766													C|||	2491	0.497404	0.4372	0.5115	5008	,	,		10373	0.2817		0.66	False		,,,				2504	0.6237				p.Q40Q		.											.	NT5C-90	0			c.A120G						.						1.0	1.0	1.0					17																	73127683		1084	2247	3331	SO:0001819	synonymous_variant	30833	exon1			GCGGCGTTGCTCC	AF154829	CCDS11715.1	17q25	2011-03-29	2002-05-23		ENSG00000125458	ENSG00000125458	3.1.3.5		17144	protein-coding gene	gene with protein product		191720	"""5' nucleotidase, deoxy (pyrimidine), cytosolic type C"", ""uridine 5-prime monophosphate hydrolase 2"""	UMPH2		10899995	Standard	NM_014595		Approved	DNT1, DNT-1, PN-I, cdN, dNT-1	uc002jmx.3	Q8TCD5		ENST00000245552.2:c.120A>G	17.37:g.73127683T>C		0	0		4	4	NM_001252377	0	0	0	4	4	Q96HS6|Q9NP82	Silent	SNP	ENST00000245552.2	37	CCDS11715.1																																																																																			T|0.502;C|0.498		0.766	NT5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445853.1		
SEC14L1	6397	bcgsc.ca	37	17	75190962	75190962	+	Silent	SNP	C	C	T	rs674402	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr17:75190962C>T	ENST00000413679.2	+	7	981	c.678C>T	c.(676-678)agC>agT	p.S226S	SEC14L1_ENST00000431431.2_Silent_p.S192S|SEC14L1_ENST00000436233.4_Silent_p.S226S|SEC14L1_ENST00000443798.4_Silent_p.S226S|SEC14L1_ENST00000585618.1_Silent_p.S226S|SEC14L1_ENST00000430767.4_Silent_p.S226S|SEC14L1_ENST00000591437.1_Silent_p.S192S|SEC14L1_ENST00000392476.2_Silent_p.S226S	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	226					transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						GCAGCCCCAGCGCACCTGAGC	0.622													C|||	1794	0.358227	0.3064	0.3329	5008	,	,		15446	0.3433		0.3559	False		,,,				2504	0.4642				p.S226S		.											.	SEC14L1-92	0			c.C678T						.	C	,,,,,,	1390,3016	456.7+/-351.4	232,926,1045	65.0	64.0	64.0		678,678,678,576,678,678,678	-11.2	0.0	17	dbSNP_83	64	3214,5386	476.3+/-369.4	585,2044,1671	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEC14L1	NM_001039573.2,NM_001143998.1,NM_001143999.1,NM_001144001.1,NM_001204408.1,NM_001204410.1,NM_003003.3	,,,,,,	817,2970,2716	TT,TC,CC		37.3721,31.5479,35.399	,,,,,,	226/720,226/716,226/716,192/682,226/720,226/716,226/716	75190962	4604,8402	2203	4300	6503	SO:0001819	synonymous_variant	6397	exon9			CCCCAGCGCACCT	D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.678C>T	17.37:g.75190962C>T		198	2		124	5	NM_001204408	0	0	43	43	0	A8K4E8|B4DDI5|D5G3K1|Q99780	Silent	SNP	ENST00000413679.2	37	CCDS11752.1																																																																																			C|0.643;T|0.357		0.622	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000436240.1	NM_003003	
ASXL3	80816	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	31324560	31324560	+	Missense_Mutation	SNP	C	C	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr18:31324560C>T	ENST00000269197.5	+	12	4748	c.4748C>T	c.(4747-4749)gCa>gTa	p.A1583V		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1583					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GCTGAGCAGGCACGTGGCCCA	0.483											OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A1583V		.											.	ASXL3-49	0			c.C4748T						.						26.0	25.0	25.0					18																	31324560		1935	4158	6093	SO:0001583	missense	80816	exon12			AGCAGGCACGTGG	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.4748C>T	18.37:g.31324560C>T	ENSP00000269197:p.Ala1583Val	43	0	823	28	23	NM_030632	0	0	0	0	0	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	37	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	C	9.093	1.002195	0.19121	.	.	ENSG00000141431	ENST00000269197	T	0.13778	2.56	5.87	4.96	0.65561	.	.	.	.	.	T	0.08980	0.0222	N	0.24115	0.695	0.09310	N	0.999998	B	0.24483	0.104	B	0.19148	0.024	T	0.10428	-1.0630	9	0.44086	T	0.13	.	5.761	0.18201	0.0:0.65:0.1833:0.1667	.	1583	Q9C0F0	ASXL3_HUMAN	V	1583	ENSP00000269197:A1583V	ENSP00000269197:A1583V	A	+	2	0	ASXL3	29578558	0.369000	0.25039	0.965000	0.40720	0.626000	0.37791	2.392000	0.44433	2.941000	0.99782	0.655000	0.94253	GCA	.		0.483	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
ARID3A	1820	hgsc.bcm.edu	37	19	929753	929753	+	Silent	SNP	A	A	G	rs1799595	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:929753A>G	ENST00000263620.3	+	2	552	c.225A>G	c.(223-225)ccA>ccG	p.P75P	AC005391.2_ENST00000585647.1_RNA	NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	75						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGACACCCAGCCAGCCCCG	0.751													t|||	4428	0.884185	0.9062	0.804	5008	,	,		8534	0.998		0.836	False		,,,				2504	0.8436				p.P75P	Pancreas(29;54 1022 32760 50921)	.											.	ARID3A-90	0			c.A225G						.	G		3389,305		1555,279,13	4.0	5.0	5.0		225	-6.8	0.0	19	dbSNP_89	5	6619,1123		2834,951,86	no	coding-synonymous	ARID3A	NM_005224.2		4389,1230,99	GG,GA,AA		14.5053,8.2566,12.4869		75/594	929753	10008,1428	1847	3871	5718	SO:0001819	synonymous_variant	1820	exon2			ACACCCAGCCAGC	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.225A>G	19.37:g.929753A>G		0	0		7	7	NM_005224	0	0	0	1	1	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Silent	SNP	ENST00000263620.3	37	CCDS12050.1																																																																																			A|0.114;G|0.886		0.751	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
TCF3	6929	hgsc.bcm.edu	37	19	1619333	1619333	+	Silent	SNP	G	G	A	rs1140828	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:1619333G>A	ENST00000262965.5	-	15	1652	c.1308C>T	c.(1306-1308)ggC>ggT	p.G436G	TCF3_ENST00000588136.1_Silent_p.G436G|TCF3_ENST00000344749.5_Silent_p.G436G|TCF3_ENST00000395423.3_Silent_p.G385G|TCF3_ENST00000453954.2_Silent_p.G352G|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGCCGCCCGCCCAGTGACA	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								G|||	1179	0.235423	0.1702	0.2435	5008	,	,		13595	0.2897		0.3032	False		,,,				2504	0.1922				p.G436G		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.C1308T						.	G	,	770,3572		79,612,1480	11.0	14.0	13.0		1308,1308	-3.3	0.4	19	dbSNP_86	13	2644,5770		436,1772,1999	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	515,2384,3479	AA,AG,GG		31.4238,17.7338,26.7639	,	436/652,436/655	1619333	3414,9342	2171	4207	6378	SO:0001819	synonymous_variant	6929	exon15			CCGCCCGCCCAGT	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1308C>T	19.37:g.1619333G>A		0	0		12	6	NM_003200	0	0	12	12	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			G|0.749;A|0.251		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
TCF3	6929	hgsc.bcm.edu	37	19	1619339	1619339	+	Silent	SNP	T	T	C	rs8140	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:1619339T>C	ENST00000262965.5	-	15	1646	c.1302A>G	c.(1300-1302)tcA>tcG	p.S434S	TCF3_ENST00000588136.1_Silent_p.S434S|TCF3_ENST00000344749.5_Silent_p.S434S|TCF3_ENST00000395423.3_Silent_p.S383S|TCF3_ENST00000453954.2_Silent_p.S350S|RNU6-1223P_ENST00000517124.1_RNA	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCCGCCCAGTGACATGGGGC	0.746			T	"""PBX1, HLF, TFPT"""	pre B-ALL								C|||	3124	0.623802	0.7723	0.5187	5008	,	,		13680	0.8839		0.3658	False		,,,				2504	0.4949				p.S434S		.		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	.	TCF3-721	0			c.A1302G						.	C	,	3016,1346		1071,874,236	11.0	14.0	13.0		1302,1302	-7.1	0.0	19	dbSNP_52	13	3268,5190		653,1962,1614	no	coding-synonymous,coding-synonymous	TCF3	NM_001136139.2,NM_003200.3	,	1724,2836,1850	CC,CT,TT		38.638,30.8574,49.0172	,	434/652,434/655	1619339	6284,6536	2181	4229	6410	SO:0001819	synonymous_variant	6929	exon15			GCCCAGTGACATG	M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1302A>G	19.37:g.1619339T>C		0	0		13	7	NM_003200	0	0	14	14	0	Q53R97|Q6PD70|Q9NP00	Silent	SNP	ENST00000262965.5	37	CCDS12074.1																																																																																			T|0.403;C|0.597		0.746	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449367.1	NM_003200	
C19orf10	56005	hgsc.bcm.edu	37	19	4670313	4670313	+	Missense_Mutation	SNP	C	C	G	rs2270090	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:4670313C>G	ENST00000262947.3	-	1	69	c.34G>C	c.(34-36)Ggc>Cgc	p.G12R	C19orf10_ENST00000599630.1_Missense_Mutation_p.G12R	NM_019107.3	NP_061980.1	Q969H8	CS010_HUMAN	chromosome 19 open reading frame 10	12			G -> R (in dbSNP:rs2270090).		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		AAGCTCGCGCCGACGCCGTTC	0.756													c|||	1444	0.288339	0.6589	0.098	5008	,	,		7783	0.2411		0.1103	False		,,,				2504	0.1544				p.G12R		.											.	C19orf10-90	0			c.G34C						.	C	ARG/GLY	1761,2025		414,933,546	4.0	5.0	4.0		34	-4.8	0.0	19	dbSNP_100	4	578,6710		38,502,3104	yes	missense	C19orf10	NM_019107.3	125	452,1435,3650	GG,GC,CC		7.9308,46.5135,21.1215	benign	12/174	4670313	2339,8735	1893	3644	5537	SO:0001583	missense	56005	exon1			TCGCGCCGACGCC	AF282264	CCDS12133.1	19p13.3	2013-11-27	2003-06-25	2003-06-27	ENSG00000074842	ENSG00000074842			16948	protein-coding gene	gene with protein product		606746	"""interleukin 27 working designation"""	IL27, IL27w		17362502, 21128247	Standard	NM_019107		Approved	R33729_1, IL25, SF20, IL-25, IL-27	uc002may.3	Q969H8		ENST00000262947.3:c.34G>C	19.37:g.4670313C>G	ENSP00000262947:p.Gly12Arg	0	0		15	5	NM_019107	0	0	1	2	1	D6W628|O75256|O75272|Q9BTK7|Q9NP69	Missense_Mutation	SNP	ENST00000262947.3	37	CCDS12133.1	541	0.24771062271062272	295	0.5995934959349594	32	0.08839779005524862	134	0.23426573426573427	80	0.10554089709762533	C	13.04	2.119829	0.37436	0.465135	0.079308	ENSG00000074842	ENST00000262947	T	0.47177	0.85	3.82	-4.84	0.03151	.	1.090020	0.07201	U	0.857494	T	0.00012	0.0000	N	0.02011	-0.69	0.80722	P	0.0	B	0.09022	0.002	B	0.15052	0.012	T	0.44329	-0.9335	9	0.59425	D	0.04	-5.96	1.5568	0.02586	0.118:0.2656:0.2321:0.3842	rs2270090;rs60071392	12	Q969H8	CS010_HUMAN	R	12	ENSP00000262947:G12R	ENSP00000262947:G12R	G	-	1	0	C19orf10	4621313	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-2.427000	0.01026	-1.087000	0.03081	-0.513000	0.04457	GGC	C|0.752;G|0.248		0.756	C19orf10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458937.1	NM_019107	
CLPP	8192	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	6364521	6364521	+	Silent	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:6364521G>A	ENST00000245816.4	+	4	549	c.426G>A	c.(424-426)ccG>ccA	p.P142P	CLPP_ENST00000596149.1_Silent_p.P55P|CLPP_ENST00000596605.1_Intron|CTB-180A7.3_ENST00000595644.1_RNA	NM_006012.2	NP_006003.1	Q16740	CLPP_HUMAN	caseinolytic mitochondrial matrix peptidase proteolytic subunit	142					protein homooligomerization (GO:0051260)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|ovary(2)	6						TCCTCAACCCGATCTGCACCT	0.687																																					p.P142P		.											.	CLPP-91	0			c.G426A						.						36.0	33.0	34.0					19																	6364521		2201	4299	6500	SO:0001819	synonymous_variant	8192	exon4			CAACCCGATCTGC	Z50853	CCDS12162.1	19p13.3	2013-09-12	2013-09-12		ENSG00000125656	ENSG00000125656		"""ATPases / AAA-type"""	2084	protein-coding gene	gene with protein product	"""ATP-dependent protease ClpAP (E. coli), proteolytic subunit, human"""	601119	"""ClpP (caseinolytic protease, ATP-dependent, proteolytic subunit, E. coli) homolog"", ""ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli)"", ""ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)"""			8543061, 23360988	Standard	NM_006012		Approved		uc002mem.1	Q16740	OTTHUMG00000180779	ENST00000245816.4:c.426G>A	19.37:g.6364521G>A		138	0		186	12	NM_006012	0	0	140	144	4	B2R4W5	Silent	SNP	ENST00000245816.4	37	CCDS12162.1																																																																																			.		0.687	CLPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452984.1	NM_006012	
MCOLN1	57192	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	7589911	7589911	+	Silent	SNP	T	T	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:7589911T>A	ENST00000264079.6	+	2	221	c.96T>A	c.(94-96)ccT>ccA	p.P32P		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	32					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CACCGGCCCCTCCGACACCCC	0.632																																					p.P32P		.											.	MCOLN1-153	0			c.T96A						.						22.0	24.0	24.0					19																	7589911		2203	4300	6503	SO:0001819	synonymous_variant	57192	exon2			GGCCCCTCCGACA	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.96T>A	19.37:g.7589911T>A		71	1		67	26	NM_020533	2	0	49	79	28	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Silent	SNP	ENST00000264079.6	37	CCDS12180.1																																																																																			.		0.632	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458974.2	NM_020533	
MUC16	94025	bcgsc.ca	37	19	9075969	9075969	+	Missense_Mutation	SNP	C	C	T	rs2591593	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:9075969C>T	ENST00000397910.4	-	3	11680	c.11477G>A	c.(11476-11478)gGg>gAg	p.G3826E		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3827	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.G3826E(2)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GGGCACCTGCCCTGGATGTGC	0.507													C|||	1243	0.248203	0.2005	0.2118	5008	,	,		21707	0.249		0.3121	False		,,,				2504	0.272				p.G3826E		.											.	MUC16-566	2	Substitution - Missense(2)	stomach(2)	c.G11477A						.	C	GLU/GLY	852,3266		98,656,1305	209.0	197.0	201.0		11477	-0.6	0.0	19	dbSNP_100	201	2423,5995		347,1729,2133	yes	missense	MUC16	NM_024690.2	98	445,2385,3438	TT,TC,CC		28.7836,20.6897,26.1248	possibly-damaging	3826/14508	9075969	3275,9261	2059	4209	6268	SO:0001583	missense	94025	exon3			ACCTGCCCTGGAT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11477G>A	19.37:g.9075969C>T	ENSP00000381008:p.Gly3826Glu	224	2		260	8	NM_024690	0	0	0	0	0	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	CCDS54212.1	551	0.2522893772893773	109	0.22154471544715448	88	0.2430939226519337	122	0.21328671328671328	232	0.30606860158311344	c	4.377	0.069544	0.08436	0.206897	0.287836	ENSG00000181143	ENST00000397910	T	0.03553	3.89	1.67	-0.571	0.11749	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	.	.	.	P	0.38370	0.628	B	0.28232	0.087	T	0.49753	-0.8906	8	0.87932	D	0	.	4.0285	0.09698	0.0:0.5788:0.0:0.4212	rs2591593;rs17418331;rs52808109;rs60034029;rs2591593	3826	B5ME49	.	E	3826	ENSP00000381008:G3826E	ENSP00000381008:G3826E	G	-	2	0	MUC16	8936969	0.000000	0.05858	0.001000	0.08648	0.179000	0.23085	-0.107000	0.10873	-0.095000	0.12351	0.205000	0.17691	GGG	C|0.750;T|0.250		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
OCEL1	79629	hgsc.bcm.edu	37	19	17337555	17337555	+	Silent	SNP	C	C	A	rs3745163	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:17337555C>A	ENST00000215061.4	+	2	167	c.123C>A	c.(121-123)acC>acA	p.T41T	OCEL1_ENST00000601576.1_3'UTR|OCEL1_ENST00000597836.1_5'UTR|OCEL1_ENST00000601529.1_Silent_p.T41T	NM_024578.1	NP_078854.1	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	41	Pro-rich.									central_nervous_system(2)|endometrium(2)|kidney(1)|lung(2)	7						CCCGCAGGACCCGCCCATCAG	0.746													C|||	1146	0.228834	0.1702	0.2522	5008	,	,		10081	0.4018		0.2018	False		,,,				2504	0.1411				p.T41T		.											.	OCEL1-68	0			c.C123A						.	C		573,3093		51,471,1311	4.0	6.0	5.0		123	-3.2	0.0	19	dbSNP_107	5	1379,6017		128,1123,2447	no	coding-synonymous	OCEL1	NM_024578.1		179,1594,3758	AA,AC,CC		18.6452,15.6301,17.646		41/265	17337555	1952,9110	1833	3698	5531	SO:0001819	synonymous_variant	79629	exon2			CAGGACCCGCCCA	BC029361	CCDS12351.1	19p13.11	2008-02-05				ENSG00000099330			26221	protein-coding gene	gene with protein product						12477932	Standard	NM_024578		Approved	FLJ22709	uc002nfp.3	Q9H607		ENST00000215061.4:c.123C>A	19.37:g.17337555C>A		0	0		10	7	NM_024578	0	0	5	30	25		Silent	SNP	ENST00000215061.4	37	CCDS12351.1																																																																																			C|0.734;A|0.266		0.746	OCEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463307.1	NM_024578	
ZNF208	7757	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	22171652	22171652	+	Silent	SNP	C	C	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:22171652C>T	ENST00000397126.4	-	2	211	c.63G>A	c.(61-63)ctG>ctA	p.L21L	ZNF208_ENST00000599916.1_Silent_p.L21L|ZNF208_ENST00000601773.1_Silent_p.L21L|ZNF208_ENST00000597040.1_5'UTR	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	21	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GTGCAGTGTCCAGGCATTGCC	0.408																																					p.L21L		.											.	ZNF208-7	0			c.G63A						.						135.0	144.0	141.0					19																	22171652		2203	4299	6502	SO:0001819	synonymous_variant	7757	exon2			AGTGTCCAGGCAT	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.63G>A	19.37:g.22171652C>T		154	0		189	22	NM_007153	0	0	28	28	0		Silent	SNP	ENST00000397126.4	37	CCDS54240.1																																																																																			.		0.408	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704002	29704002	+	Silent	SNP	T	T	C	rs11666764	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:29704002T>C	ENST00000304863.4	-	1	446	c.24A>G	c.(22-24)tcA>tcG	p.S8S	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	8					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CGAACGGGCCTGAGCGGGATG	0.751													C|||	4781	0.954673	0.9433	0.9294	5008	,	,		9645	0.999		0.9195	False		,,,				2504	0.9785				p.S8S		.											.	UQCRFS1-226	0			c.A24G						.						1.0	2.0	2.0					19																	29704002		760	1811	2571	SO:0001819	synonymous_variant	7386	exon1			CGGGCCTGAGCGG	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.24A>G	19.37:g.29704002T>C		0	0		7	5	NM_006003	0	0	1	1	0	A8K519|Q6NVX5|Q9UPH2	Silent	SNP	ENST00000304863.4	37	CCDS12415.1																																																																																			T|0.072;C|0.928		0.751	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
UQCRFS1	7386	hgsc.bcm.edu	37	19	29704010	29704010	+	Missense_Mutation	SNP	A	A	C	rs8100724	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:29704010A>C	ENST00000304863.4	-	1	438	c.16T>G	c.(16-18)Tcc>Gcc	p.S6A	CTB-32O4.2_ENST00000587859.1_lincRNA	NM_006003.2	NP_005994.2	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1	6			S -> A (in dbSNP:rs8100724). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2158323, ECO:0000269|PubMed:7721092}.		cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			endometrium(4)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			CCTGAGCGGGATGCTACCGAC	0.746													C|||	4777	0.953874	0.944	0.9265	5008	,	,		9603	0.999		0.9165	False		,,,				2504	0.9785				p.S6A		.											.	UQCRFS1-226	0			c.T16G						.						1.0	2.0	2.0					19																	29704010		816	1888	2704	SO:0001583	missense	7386	exon1			AGCGGGATGCTAC	BC010035	CCDS12415.1	19q12	2011-07-04			ENSG00000169021	ENSG00000169021	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12587	protein-coding gene	gene with protein product	"""cytochrome b-c1 complex subunit 5"""	191327				8088805	Standard	NM_006003		Approved	RIS1, RIP1, UQCR5, RISP	uc002nsd.2	P47985		ENST00000304863.4:c.16T>G	19.37:g.29704010A>C	ENSP00000306397:p.Ser6Ala	0	0		7	5	NM_006003	0	0	1	1	0	A8K519|Q6NVX5|Q9UPH2	Missense_Mutation	SNP	ENST00000304863.4	37	CCDS12415.1	2044	0.9358974358974359	461	0.9369918699186992	326	0.9005524861878453	569	0.9947552447552448	688	0.9076517150395779	C	0.037	-1.301919	0.01353	.	.	ENSG00000169021	ENST00000304863	T	0.36520	1.25	4.42	-0.0799	0.13708	Ubiquinol-cytochrome c reductase 8kDa, N-terminal (1);Globular protein, non-globular alpha/beta subunit (1);	0.198900	0.43579	N	0.000544	T	0.00012	0.0000	N	0.00707	-1.245	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	9	0.02654	T	1	.	4.4059	0.11409	0.1479:0.436:0.0:0.4161	rs8100724;rs17856012;rs17856322;rs60176823;rs8100724	6	P47985	UCRI_HUMAN	A	6	ENSP00000306397:S6A	ENSP00000306397:S6A	S	-	1	0	UQCRFS1	34395850	0.363000	0.24989	0.510000	0.27712	0.005000	0.04900	0.594000	0.24014	-0.304000	0.08843	-1.900000	0.00529	TCC	A|0.065;C|0.935		0.746	UQCRFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458563.1	NM_006003	
PPP5C	5536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	46857169	46857169	+	Missense_Mutation	SNP	A	A	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:46857169A>T	ENST00000012443.4	+	2	389	c.286A>T	c.(286-288)Atc>Ttc	p.I96F	PPP5C_ENST00000391919.1_5'UTR	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	96					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CAAGAAGTACATCAAGGGTTA	0.632																																					p.I96F		.											.	PPP5C-227	0			c.A286T						.						38.0	28.0	32.0					19																	46857169		2202	4299	6501	SO:0001583	missense	5536	exon2			AAGTACATCAAGG		CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.286A>T	19.37:g.46857169A>T	ENSP00000012443:p.Ile96Phe	259	1		248	116	NM_006247	0	0	49	92	43	Q16722|Q53XV2	Missense_Mutation	SNP	ENST00000012443.4	37	CCDS12684.1	.	.	.	.	.	.	.	.	.	.	A	16.55	3.153725	0.57259	.	.	ENSG00000011485	ENST00000012443;ENST00000451918	T	0.29917	1.55	5.21	5.21	0.72293	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.060427	0.64402	D	0.000005	T	0.39708	0.1088	M	0.76838	2.35	0.80722	D	1	P;B	0.45348	0.856;0.11	B;B	0.43052	0.406;0.052	T	0.43909	-0.9362	10	0.56958	D	0.05	-19.2667	13.3443	0.60564	1.0:0.0:0.0:0.0	.	96;96	B2R6R6;P53041	.;PPP5_HUMAN	F	96;83	ENSP00000012443:I96F	ENSP00000012443:I96F	I	+	1	0	PPP5C	51549009	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.043000	0.57354	2.099000	0.63709	0.460000	0.39030	ATC	.		0.632	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258969.2	NM_006247	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48205288	48205288	+	Silent	SNP	G	G	A	rs8100472	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr19:48205288G>A	ENST00000396720.3	+	15	4493	c.4299G>A	c.(4297-4299)gcG>gcA	p.A1433A	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1433										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCGAGCTGGCGGCCGTGGAGG	0.771													G|||	514	0.102636	0.2519	0.0548	5008	,	,		5835	0.001		0.0577	False		,,,				2504	0.0859				p.A1433A		.											.	GLTSCR1-48	0			c.G4299A						.	G		266,1774		1,264,755	1.0	2.0	2.0		4299	-3.5	1.0	19	dbSNP_116	2	222,4724		0,222,2251	no	coding-synonymous	GLTSCR1	NM_015711.3		1,486,3006	AA,AG,GG		4.4885,13.0392,6.9854		1433/1561	48205288	488,6498	1020	2473	3493	SO:0001819	synonymous_variant	29998	exon15			GCTGGCGGCCGTG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.4299G>A	19.37:g.48205288G>A		2	0		11	5	NM_015711	0	0	0	0	0	A8MW01	Silent	SNP	ENST00000396720.3	37	CCDS46134.1																																																																																			G|0.917;A|0.083		0.771	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
THSD7B	80731	bcgsc.ca	37	2	137917922	137917922	+	Missense_Mutation	SNP	T	T	A	rs4954474	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr2:137917922T>A	ENST00000409968.1	+	6	1687	c.1509T>A	c.(1507-1509)gaT>gaA	p.D503E	THSD7B_ENST00000272643.3_Missense_Mutation_p.D503E|THSD7B_ENST00000413152.2_Missense_Mutation_p.D472E|THSD7B_ENST00000485379.1_3'UTR|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	503	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.			D -> E (in Ref. 2; BAB21770). {ECO:0000305}.		integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ACTGTCATGATCCTCAGGGGA	0.493													T|||	1413	0.282149	0.1437	0.3501	5008	,	,		20794	0.1419		0.4861	False		,,,				2504	0.3558				.		.											.	THSD7B-75	0			.						.	T	GLU/ASP	828,3282		98,632,1325	115.0	116.0	116.0		1416	2.2	0.9	2	dbSNP_111	116	4037,4371		975,2087,1142	yes	missense	THSD7B	NM_001080427.1	45	1073,2719,2467	AA,AT,TT		48.0138,20.146,38.864	benign	472/1578	137917922	4865,7653	2055	4204	6259	SO:0001583	missense	80731	.			TCATGATCCTCAG			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1509T>A	2.37:g.137917922T>A	ENSP00000387145:p.Asp503Glu	231	0		137	7	.	0	0	2	2	0		Missense_Mutation	SNP	ENST00000409968.1	37		618	0.28296703296703296	72	0.14634146341463414	122	0.3370165745856354	67	0.11713286713286714	357	0.470976253298153	T	11.18	1.561850	0.27915	0.20146	0.480138	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.61274	0.12;0.12;0.12	5.96	2.25	0.28309	.	0.229864	0.51477	N	0.000090	T	0.00012	0.0000	L	0.33245	0.995	0.09310	P	0.9999999999999558	B;B	0.10296	0.001;0.003	B;B	0.15870	0.014;0.008	T	0.47368	-0.9123	9	0.12766	T	0.61	.	5.4062	0.16323	0.0:0.2053:0.2566:0.538	rs4954474;rs17795328;rs52831925;rs4954474	503;472	Q9C0I4;C9JKN6	THS7B_HUMAN;.	E	503;503;472	ENSP00000387145:D503E;ENSP00000272643:D503E;ENSP00000413841:D472E	ENSP00000272643:D503E	D	+	3	2	THSD7B	137634392	1.000000	0.71417	0.948000	0.38648	0.552000	0.35366	1.121000	0.31283	0.147000	0.19030	0.528000	0.53228	GAT	T|0.686;A|0.314		0.493	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000331769.2	XM_046570.9	
SP140	11262	broad.mit.edu	37	2	231174695	231174695	+	Silent	SNP	C	C	T	rs186449912	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr2:231174695C>T	ENST00000392045.3	+	23	2229	c.2115C>T	c.(2113-2115)tgC>tgT	p.C705C	SP140_ENST00000486687.2_Silent_p.C629C|SP140_ENST00000417495.3_Silent_p.C591C|SP140_ENST00000350136.5_Silent_p.C574C|SP140_ENST00000420434.3_Silent_p.C678C|SP140_ENST00000343805.6_Silent_p.C645C	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	705					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.C705C(1)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TGTTCTGTTGCGACACTTGTT	0.512													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		21260	0.0		0.0	False		,,,				2504	0.0				p.C705C		.											.	SP140-90	1	Substitution - coding silent(1)	large_intestine(1)	c.C2115T						.	C		3,4367	4.2+/-10.8	0,3,2182	179.0	192.0	188.0		2115	-4.4	0.0	2		188	4,8584	3.7+/-12.6	0,4,4290	no	coding-synonymous	SP140	NM_007237.4		0,7,6472	TT,TC,CC		0.0466,0.0686,0.054		705/868	231174695	7,12951	2185	4294	6479	SO:0001819	synonymous_variant	11262	exon23			CTGTTGCGACACT	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.2115C>T	2.37:g.231174695C>T		381	0		193	5	NM_007237	0	0	11	11	0	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	ENST00000392045.3	37	CCDS42831.1																																																																																			C|0.999;T|0.001		0.512	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
PYGB	5834	bcgsc.ca	37	20	25276297	25276297	+	Silent	SNP	G	G	A	rs1130694	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr20:25276297G>A	ENST00000216962.4	+	19	2480	c.2370G>A	c.(2368-2370)caG>caA	p.Q790Q	PYGB_ENST00000471359.1_3'UTR|ABHD12_ENST00000376542.3_Intron	NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	790					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						AGGTGGACCAGCTGTACCGGG	0.582													G|||	2562	0.511581	0.3729	0.3314	5008	,	,		19374	0.9107		0.4264	False		,,,				2504	0.5031				p.Q790Q		.											.	PYGB-91	0			c.G2370A						.	G	,	1602,2804	494.6+/-363.0	289,1024,890	74.0	72.0	73.0		2370,	1.5	1.0	20	dbSNP_86	73	3660,4940	524.8+/-380.6	763,2134,1403	no	coding-synonymous,intron	PYGB,ABHD12	NM_002862.3,NM_015600.4	,	1052,3158,2293	AA,AG,GG		42.5581,36.3595,40.4583	,	790/844,	25276297	5262,7744	2203	4300	6503	SO:0001819	synonymous_variant	5834	exon19			GGACCAGCTGTAC		CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.2370G>A	20.37:g.25276297G>A		269	1		301	9	NM_002862	0	0	0	0	0	Q96AK1|Q9NPX8	Silent	SNP	ENST00000216962.4	37	CCDS13171.1	1160	0.5311355311355311	181	0.3678861788617886	123	0.3397790055248619	530	0.9265734265734266	326	0.43007915567282323	G	9.855	1.194604	0.22037	0.363595	0.425581	ENSG00000100994	ENST00000428458	.	.	.	4.64	1.51	0.23008	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.9999999999393846	.	.	.	.	.	.	T	0.16512	-1.0400	3	.	.	.	-24.2095	5.1835	0.15173	0.2442:0.0:0.6053:0.1505	rs1130694;rs1802895;rs2227893;rs2258727;rs3177790;rs3189839;rs11549035;rs1130694	.	.	.	N	209	.	.	S	+	2	0	PYGB	25224297	0.491000	0.26019	0.998000	0.56505	0.988000	0.76386	0.237000	0.17985	0.251000	0.21505	0.561000	0.74099	AGC	G|0.542;A|0.458		0.582	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078415.2	NM_002862	
LIME1	54923	bcgsc.ca	37	20	62368925	62368925	+	Missense_Mutation	SNP	C	C	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr20:62368925C>T	ENST00000309546.3	+	2	110	c.23C>T	c.(22-24)gCc>gTc	p.A8V	LIME1_ENST00000490824.1_3'UTR|RP4-583P15.15_ENST00000490623.2_3'UTR|SLC2A4RG_ENST00000266077.2_5'Flank|RP4-583P15.14_ENST00000467211.1_5'Flank	NM_017806.2	NP_060276.2	Q9H400	LIME1_HUMAN	Lck interacting transmembrane adaptor 1	8					B cell receptor signaling pathway (GO:0050853)|T cell receptor signaling pathway (GO:0050852)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|liver(1)	3	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GTGTCCTGGGCCCCTCCTGCC	0.701																																					p.A8V		.											.	LIME1-44	0			c.C23T						.						12.0	13.0	12.0					20																	62368925		2190	4297	6487	SO:0001583	missense	54923	exon2			CCTGGGCCCCTCC	AK000413	CCDS13536.1	20q13.33	2010-05-11			ENSG00000203896	ENSG00000203896			26016	protein-coding gene	gene with protein product		609809				12477932	Standard	NM_017806		Approved	FLJ20406, dJ583P15.4, LIME	uc002ygp.4	Q9H400	OTTHUMG00000032999	ENST00000309546.3:c.23C>T	20.37:g.62368925C>T	ENSP00000309521:p.Ala8Val	172	3		200	175	NM_017806	0	0	0	16	16	E1P5K5|E1P5K6|Q5JWJ2|Q6XYB3|Q9NX69	Missense_Mutation	SNP	ENST00000309546.3	37	CCDS13536.1	.	.	.	.	.	.	.	.	.	.	c	12.47	1.946771	0.34377	.	.	ENSG00000203896	ENST00000444951;ENST00000309546	T	0.57436	0.4	4.18	2.23	0.28157	.	.	.	.	.	T	0.30417	0.0764	N	0.12182	0.205	0.09310	N	1	B	0.30851	0.297	B	0.27170	0.077	T	0.13548	-1.0505	9	0.34782	T	0.22	.	7.4981	0.27500	0.0:0.7027:0.0:0.2973	.	8	Q9H400	LIME1_HUMAN	V	8	ENSP00000309521:A8V	ENSP00000309521:A8V	A	+	2	0	LIME1	61839369	0.000000	0.05858	0.000000	0.03702	0.193000	0.23685	-0.589000	0.05767	0.241000	0.21283	0.290000	0.19541	GCC	.		0.701	LIME1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080225.1	NM_017806	
KRTAP25-1	100131902	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	31661590	31661590	+	Missense_Mutation	SNP	G	G	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr21:31661590G>T	ENST00000416044.1	-	1	242	c.219C>A	c.(217-219)ttC>ttA	p.F73L		NM_001128598.1	NP_001122070.1	Q3LHN0	KR251_HUMAN	keratin associated protein 25-1	73						intermediate filament (GO:0005882)				breast(1)	1						AAATAGGTTGGAAACTATGAG	0.403																																					p.F73L		.											.	.	0			c.C219A						.						100.0	95.0	97.0					21																	31661590		692	1591	2283	SO:0001583	missense	100131902	exon1			AGGTTGGAAACTA		CCDS46640.1	21q22.1	2010-10-18	2008-02-26	2008-04-22	ENSG00000232263	ENSG00000232263		"""Keratin associated proteins"""	34003	protein-coding gene	gene with protein product							Standard	NM_001128598		Approved	KAP25.1	uc010glr.1	Q3LHN0	OTTHUMG00000125482	ENST00000416044.1:c.219C>A	21.37:g.31661590G>T	ENSP00000398619:p.Phe73Leu	279	0		220	102	NM_001128598	0	0	0	0	0		Missense_Mutation	SNP	ENST00000416044.1	37	CCDS46640.1	.	.	.	.	.	.	.	.	.	.	G	10.53	1.377329	0.24944	.	.	ENSG00000232263	ENST00000416044	T	0.03358	3.96	4.01	-2.7	0.06004	.	.	.	.	.	T	0.01156	0.0038	N	0.03608	-0.345	0.09310	N	1	P	0.36909	0.573	B	0.33521	0.165	T	0.37126	-0.9719	9	0.02654	T	1	.	4.0598	0.09832	0.4275:0.0:0.4041:0.1684	.	73	Q3LHN0	KR251_HUMAN	L	73	ENSP00000398619:F73L	ENSP00000398619:F73L	F	-	3	2	KRTAP25-1	30583461	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.871000	0.04223	-0.601000	0.05783	-0.514000	0.04452	TTC	.		0.403	KRTAP25-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246805.1	NM_001128598	
COL18A1	80781	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	21	46932128	46932128	+	Missense_Mutation	SNP	C	C	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr21:46932128C>T	ENST00000359759.4	+	41	5102	c.5081C>T	c.(5080-5082)tCg>tTg	p.S1694L	COL18A1_ENST00000400337.2_Missense_Mutation_p.S1279L|COL18A1_ENST00000355480.5_Missense_Mutation_p.S1459L|SLC19A1_ENST00000468508.1_5'Flank|SLC19A1_ENST00000567670.1_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1694	Nonhelical region 11 (NC11).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TGGCATGGCTCGGACCCCAAC	0.706																																					p.S1456L		.											.	COL18A1-90	0			c.C4367T						.						18.0	23.0	21.0					21																	46932128		2080	4198	6278	SO:0001583	missense	80781	exon42			ATGGCTCGGACCC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.5081C>T	21.37:g.46932128C>T	ENSP00000352798:p.Ser1694Leu	448	0		565	47	NM_030582	0	0	278	287	9	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.108263|4.108263	0.77096|0.77096	.|.	.|.	ENSG00000182871|ENSG00000182871	ENST00000423214|ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645;ENST00000342220	.|T;T;T;T	.|0.61392	.|0.11;0.11;0.11;0.11	4.07|4.07	4.07|4.07	0.47477|0.47477	.|Collagenase NC10/endostatin (1);C-type lectin fold (1);C-type lectin-like (1);	.|0.154454	.|0.45126	.|U	.|0.000382	T|T	0.79203|0.79203	0.4406|0.4406	M|M	0.88450|0.88450	2.955|2.955	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.999;0.997;0.998;0.998	D|D	0.84442|0.84442	0.0583|0.0583	5|10	.|0.87932	.|D	.|0	.|.	15.1994|15.1994	0.73122|0.73122	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1694;1276;1459;1279	.|P39060;D3DSM4;P39060-1;P39060-2	.|COIA1_HUMAN;.;.;.	W|L	264|1279;1279;1459;1694;1694;627	.|ENSP00000383191:S1279L;ENSP00000347665:S1459L;ENSP00000352798:S1694L;ENSP00000339118:S627L	.|ENSP00000339118:S627L	R|S	+|+	1|2	2|0	COL18A1|COL18A1	45756556|45756556	1.000000|1.000000	0.71417|0.71417	0.862000|0.862000	0.33874|0.33874	0.093000|0.093000	0.18481|0.18481	7.142000|7.142000	0.77339|0.77339	2.002000|2.002000	0.58637|0.58637	0.478000|0.478000	0.44815|0.44815	CGG|TCG	.		0.706	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206827.1		
TNRC6B	23112	broad.mit.edu;bcgsc.ca	37	22	40657974	40657974	+	Missense_Mutation	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr22:40657974G>A	ENST00000454349.2	+	4	465	c.254G>A	c.(253-255)cGc>cAc	p.R85H	TNRC6B_ENST00000301923.9_Missense_Mutation_p.R121H|TNRC6B_ENST00000335727.9_Missense_Mutation_p.R85H|TNRC6B_ENST00000402203.1_Missense_Mutation_p.R121H	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	85	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						AGCGCCGCCCGCTACATGCCT	0.627																																					p.R121H		.											.	TNRC6B-22	0			c.G362A						.						17.0	22.0	21.0					22																	40657974		2003	4168	6171	SO:0001583	missense	23112	exon7			CCGCCCGCTACAT	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.254G>A	22.37:g.40657974G>A	ENSP00000401946:p.Arg85His	371	1		217	9	NM_001024843	0	0	1	1	0	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	35	5.498438	0.96355	.	.	ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	T;T;T;T	0.36878	1.23;1.23;1.23;1.23	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	L	0.52011	1.625	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.994;0.997;0.994	T	0.56366	-0.7991	10	0.72032	D	0.01	-4.9617	20.3213	0.98679	0.0:0.0:1.0:0.0	.	85;85;121	Q9UPQ9;Q9UPQ9-1;Q9UPQ9-2	TNR6B_HUMAN;.;.	H	121;121;85;85;85	ENSP00000306759:R121H;ENSP00000384795:R121H;ENSP00000401946:R85H;ENSP00000338371:R85H	ENSP00000306759:R121H	R	+	2	0	TNRC6B	38987920	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.810000	0.96702	0.650000	0.86243	CGC	.		0.627	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
ZNF717	100131827	bcgsc.ca	37	3	75790860	75790860	+	De_novo_Start_InFrame	SNP	C	C	T	rs73117241		TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr3:75790860C>T	ENST00000478296.1	-	0	211				ZNF717_ENST00000477374.1_Missense_Mutation_p.V29M|ZNF717_ENST00000400845.3_Missense_Mutation_p.V22M|ZNF717_ENST00000491507.1_5'UTR|ZNF717_ENST00000422325.1_Missense_Mutation_p.V29M			Q9BY31	ZN717_HUMAN	zinc finger protein 717						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						GTGAAGTGCACAGCTACCTCC	0.547																																					p.V29M		.											.	.	0			c.G85A						.						12.0	12.0	12.0					3																	75790860		465	1266	1731			100131827	exon3			AGTGCACAGCTAC	AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965		3.37:g.75790860C>T		132	1		25	5	NM_001128223	0	0	13	13	0		Missense_Mutation	SNP	ENST00000478296.1	37		.	.	.	.	.	.	.	.	.	.	.	13.61	2.289768	0.40494	.	.	ENSG00000227124	ENST00000477374;ENST00000422325;ENST00000400845;ENST00000468296	T;T;T;T	0.04360	3.64;3.64;3.64;3.64	1.14	1.14	0.20703	.	.	.	.	.	T	0.20007	0.0481	M	0.87038	2.855	0.38421	P	0.053802000000000016	D	0.69078	0.997	D	0.74348	0.983	T	0.19192	-1.0313	8	0.62326	D	0.03	.	7.8879	0.29661	0.0:1.0:0.0:0.0	.	29	C9JSV9	.	M	29;29;22;29	ENSP00000417902:V29M;ENSP00000409514:V29M;ENSP00000383643:V22M;ENSP00000418187:V29M	ENSP00000383643:V22M	V	-	1	0	ZNF717	75873550	0.003000	0.15002	0.270000	0.24601	0.061000	0.15899	-0.124000	0.10595	0.607000	0.29982	0.388000	0.25769	GTG	C|0.500;T|0.500		0.547	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000352764.2	NM_001128223	
ARHGEF26	26084	bcgsc.ca	37	3	153839960	153839960	+	Missense_Mutation	SNP	T	T	C	rs386667246|rs12497267	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr3:153839960T>C	ENST00000356448.4	+	2	463	c.179T>C	c.(178-180)cTc>cCc	p.L60P	ARHGEF26-AS1_ENST00000467912.1_RNA|ARHGEF26-AS1_ENST00000480639.1_RNA|ARHGEF26-AS1_ENST00000491862.1_RNA|ARHGEF26_ENST00000465817.1_Missense_Mutation_p.L60P|ARHGEF26_ENST00000465093.1_Missense_Mutation_p.L60P|ARHGEF26-AS1_ENST00000479270.1_RNA	NM_001251962.1	NP_001238891.1	Q96DR7	ARHGQ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 26	60			L -> P (in dbSNP:rs12497267). {ECO:0000269|PubMed:15221005}.	L -> S (in Ref. 1; AAL27001, 2; AAS59842, 3; BAG53860 and 6; AAH78655). {ECO:0000305}.	endothelial cell morphogenesis (GO:0001886)|ruffle assembly (GO:0097178)	cell projection (GO:0042995)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	23						GGGACGCTCCTCGCAGCGCAG	0.667													C|||	4756	0.949681	0.9826	0.9308	5008	,	,		13135	0.9911		0.8648	False		,,,				2504	0.9632				p.L60P	GBM(163;191 2003 24758 29593 48540)|Ovarian(152;631 1885 20165 22910 51013)	.											.	ARHGEF26-47	0			c.T179C						.	C	PRO/LEU	3634,194		1775,84,55	14.0	17.0	16.0		179	3.6	0.0	3	dbSNP_120	16	6529,1735		3076,377,679	no	missense	ARHGEF26	NM_015595.3	98	4851,461,734	CC,CT,TT		20.9947,5.0679,15.9527	benign	60/872	153839960	10163,1929	1914	4132	6046	SO:0001583	missense	26084	exon2			CGCTCCTCGCAGC	BC016628	CCDS46938.1, CCDS58858.1	3q25.2	2013-01-10			ENSG00000114790	ENSG00000114790		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24490	protein-coding gene	gene with protein product	"""Src homology 3 domain-containing guanine nucleotide exchange factor"""					15133129, 12697679	Standard	NM_015595		Approved	DKFZP434D146, SGEF	uc021xgc.1	Q96DR7	OTTHUMG00000159098	ENST00000356448.4:c.179T>C	3.37:g.153839960T>C	ENSP00000348828:p.Leu60Pro	406	8		210	6	NM_001251962	0	0	1	1	0	B3KVP8|E9PBD0|Q68CL1|Q6AZ96|Q6Q8Q8|Q96AW8|Q96DR6|Q9H9D7|Q9H9R2|Q9UFW5	Missense_Mutation	SNP	ENST00000356448.4	37	CCDS46938.1	1871	0.8566849816849816	462	0.9390243902439024	309	0.8535911602209945	541	0.9458041958041958	559	0.737467018469657	C	0.005	-2.221097	0.00286	0.949321	0.790053	ENSG00000114790	ENST00000356448;ENST00000465093;ENST00000465817	T;T;T	0.55760	0.5;0.5;2.29	4.49	3.62	0.41486	.	0.550370	0.17209	N	0.182795	T	0.00012	0.0000	N	0.01576	-0.805	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32134	-0.9918	9	0.16420	T	0.52	-4.7085	10.2649	0.43449	0.0:0.8443:0.0:0.1557	rs12497267;rs60339993	60;60	E9PBD0;Q96DR7	.;ARHGQ_HUMAN	P	60	ENSP00000348828:L60P;ENSP00000423418:L60P;ENSP00000423295:L60P	ENSP00000348828:L60P	L	+	2	0	ARHGEF26	155322650	0.002000	0.14202	0.001000	0.08648	0.030000	0.12068	0.962000	0.29280	0.346000	0.23899	-0.930000	0.02707	CTC	T|0.139;C|0.861		0.667	ARHGEF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353287.3	NM_015595	
PLCH1	23007	broad.mit.edu	37	3	155199167	155199167	+	Missense_Mutation	SNP	A	A	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr3:155199167A>T	ENST00000340059.7	-	23	4671	c.4672T>A	c.(4672-4674)Tgc>Agc	p.C1558S	PLCH1_ENST00000414191.1_Missense_Mutation_p.C1520S|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.C1520S|PLCH1_ENST00000460012.1_Missense_Mutation_p.C1520S|PLCH1_ENST00000494598.1_Intron	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1558					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AGCACTTGGCAGTTGTCTTCC	0.512																																					p.C1558S		.											.	PLCH1-151	0			c.T4672A						.						76.0	79.0	78.0					3																	155199167		2203	4300	6503	SO:0001583	missense	23007	exon23			CTTGGCAGTTGTC	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4672T>A	3.37:g.155199167A>T	ENSP00000345988:p.Cys1558Ser	134	0		72	3	NM_001130960	0	0	0	0	0	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	37	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	A	0.559	-0.846071	0.02671	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	5.26	2.65	0.31530	.	0.861843	0.10735	N	0.640182	T	0.16171	0.0389	L	0.54323	1.7	0.09310	N	1	B;B	0.32467	0.372;0.255	B;B	0.27796	0.083;0.038	T	0.24333	-1.0163	10	0.26408	T	0.33	.	3.4868	0.07622	0.539:0.2641:0.0807:0.1163	.	1520;1558	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	S	1520;1558;1520;1520	ENSP00000417502:C1520S;ENSP00000345988:C1558S;ENSP00000335469:C1520S;ENSP00000412977:C1520S	ENSP00000335469:C1520S	C	-	1	0	PLCH1	156681861	0.000000	0.05858	0.606000	0.28943	0.043000	0.13939	-0.077000	0.11394	0.802000	0.34089	0.528000	0.53228	TGC	.		0.512	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
KNG1	3827	broad.mit.edu;bcgsc.ca	37	3	186460034	186460034	+	Missense_Mutation	SNP	C	C	T	rs201737072		TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr3:186460034C>T	ENST00000265023.4	+	10	2061	c.1849C>T	c.(1849-1851)Cgc>Tgc	p.R617C	RP11-573D15.8_ENST00000596632.1_RNA|RP11-573D15.8_ENST00000609652.1_RNA|RP11-573D15.8_ENST00000354642.2_RNA|RP11-573D15.8_ENST00000609726.1_RNA|RP11-573D15.8_ENST00000596329.1_RNA|KNG1_ENST00000287611.2_Intron|KNG1_ENST00000447445.1_Intron|RP11-573D15.8_ENST00000599314.1_RNA	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	617					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		ATGTCCTGGACGCCCCTGGAA	0.408													C|||	1	0.000199681	0.0	0.0	5008	,	,		21142	0.0		0.001	False		,,,				2504	0.0				p.R617C		.											.	KNG1-92	0			c.C1849T						.						108.0	103.0	105.0					3																	186460034		1837	4089	5926	SO:0001583	missense	3827	exon10			CCTGGACGCCCCT		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.1849C>T	3.37:g.186460034C>T	ENSP00000265023:p.Arg617Cys	91	0		51	5	NM_001102416	0	0	0	0	0	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	ENST00000265023.4	37	CCDS43183.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	20.4	3.983327	0.74474	.	.	ENSG00000113889	ENST00000265023	T	0.19394	2.15	5.28	5.28	0.74379	.	0.483186	0.18033	N	0.153878	T	0.37625	0.1010	L	0.52573	1.65	0.80722	D	1	D	0.89917	1.0	P	0.62014	0.897	T	0.01349	-1.1378	9	.	.	.	-10.2697	14.7871	0.69810	0.0:1.0:0.0:0.0	.	617	P01042	KNG1_HUMAN	C	617	ENSP00000265023:R617C	.	R	+	1	0	KNG1	187942728	0.518000	0.26234	0.991000	0.47740	0.874000	0.50279	0.709000	0.25734	2.652000	0.90054	0.563000	0.77884	CGC	C|0.999;T|0.000		0.408	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416	
HTT	3064	broad.mit.edu	37	4	3076604	3076609	+	In_Frame_Del	DEL	CAGCAG	CAGCAG	-	rs71180116|rs374076986	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr4:3076604_3076609delCAGCAG	ENST00000355072.5	+	1	197_202	c.52_57delCAGCAG	c.(52-57)cagcagdel	p.QQ36del	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	36	Poly-Gln.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CAAGTCCTTCcagcagcagcagcagc	0.704														1892	0.377796	0.0741	0.3343	5008	,	,		6929	0.7421		0.327	False		,,,				2504	0.4959				p.18_19del		.											.	HTT-281	0			c.52_57del						.			33,28,149		16,0,1,14,0,74						2.6	1.0		dbSNP_119	4	239,82,669		114,3,8,38,3,329	no	codingComplex	HTT	NM_002111.6		130,3,9,52,3,403	A1A1,A1A2,A1R,A2A2,A2R,RR		32.4242,29.0476,31.8333				272,110,818				SO:0001651	inframe_deletion	3064	exon1			TCCTTCCAGCAGC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.52_57delCAGCAG	4.37:g.3076610_3076615delCAGCAG	ENSP00000347184:p.Gln36_Gln37del	9	0		16	5	NM_002111	0	0	0	0	0	Q9UQB7	In_Frame_Del	DEL	ENST00000355072.5	37	CCDS43206.1																																																																																			.		0.704	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
NMU	10874	hgsc.bcm.edu	37	4	56502304	56502304	+	Missense_Mutation	SNP	G	G	T	rs35771241	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr4:56502304G>T	ENST00000264218.3	-	1	161	c.56C>A	c.(55-57)gCg>gAg	p.A19E	NMU_ENST00000507338.1_Missense_Mutation_p.A19E|NMU_ENST00000505262.1_Missense_Mutation_p.A19E|NMU_ENST00000511469.1_Missense_Mutation_p.A19E|NMU_ENST00000515325.1_Intron	NM_006681.2	NP_006672.1	P48645	NMU_HUMAN	neuromedin U	19					digestion (GO:0007586)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|neuropeptide signaling pathway (GO:0007218)|photoperiodism (GO:0009648)|positive regulation of hormone secretion (GO:0046887)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic transmission (GO:0050806)|regulation of smooth muscle contraction (GO:0006940)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|terminal bouton (GO:0043195)	receptor binding (GO:0005102)			lung(3)|ovary(1)|urinary_tract(1)	5	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		gagcGGGGACGCCGCGGCCAC	0.761													G|||	88	0.0175719	0.0038	0.0245	5008	,	,		10083	0.0		0.0577	False		,,,				2504	0.0082				p.A19E		.											.	NMU-650	0			c.C56A	GRCh37	CM066152	NMU	M	rs35771241	.	G	GLU/ALA	34,3224		0,34,1595	5.0	7.0	6.0		56	1.1	0.0	4	dbSNP_126	6	262,5824		1,260,2782	no	missense	NMU	NM_006681.2	107	1,294,4377	TT,TG,GG		4.305,1.0436,3.1678	benign	19/175	56502304	296,9048	1629	3043	4672	SO:0001583	missense	10874	exon1			GGGGACGCCGCGG	X76029	CCDS3501.1, CCDS75125.1	4q12	2013-02-26			ENSG00000109255	ENSG00000109255		"""Endogenous ligands"""	7859	protein-coding gene	gene with protein product	"""prepro-NMU"""	605103				7619205	Standard	XM_005265713		Approved		uc003hbc.3	P48645	OTTHUMG00000102161	ENST00000264218.3:c.56C>A	4.37:g.56502304G>T	ENSP00000264218:p.Ala19Glu	0	0		12	8	NM_006681	0	0	0	0	0		Missense_Mutation	SNP	ENST00000264218.3	37	CCDS3501.1	64	0.029304029304029304	6	0.012195121951219513	16	0.04419889502762431	0	0.0	42	0.055408970976253295	G	14.57	2.576146	0.45902	0.010436	0.04305	ENSG00000109255	ENST00000511469;ENST00000264218;ENST00000505262;ENST00000541393;ENST00000507338	T;T;T;T	0.38887	1.11;1.25;1.19;1.18	2.89	1.06	0.20224	.	0.337479	0.19087	U	0.123078	T	0.03959	0.0111	L	0.44542	1.39	0.09310	N	1	D	0.54397	0.966	P	0.45195	0.473	T	0.03784	-1.1004	10	0.52906	T	0.07	-8.0688	3.8411	0.08914	0.1476:0.2562:0.5962:0.0	rs35771241	19	P48645	NMU_HUMAN	E	19	ENSP00000422399:A19E;ENSP00000264218:A19E;ENSP00000424246:A19E;ENSP00000422870:A19E	ENSP00000264218:A19E	A	-	2	0	NMU	56197061	0.000000	0.05858	0.001000	0.08648	0.273000	0.26683	-0.032000	0.12266	0.255000	0.21593	0.195000	0.17529	GCG	G|0.970;T|0.030		0.761	NMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220006.2		
MAB21L2	10586	broad.mit.edu;bcgsc.ca	37	4	151504413	151504413	+	Missense_Mutation	SNP	C	C	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr4:151504413C>T	ENST00000317605.4	+	1	1337	c.232C>T	c.(232-234)Ctc>Ttc	p.L78F	LRBA_ENST00000510413.1_Intron|LRBA_ENST00000535741.1_Intron|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000503716.1_5'Flank|RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000357115.3_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	78					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		TGAGGTGGTGCTCTACCTAAA	0.607																																					p.L78F		.											.	MAB21L2-91	0			c.C232T						.						82.0	74.0	77.0					4																	151504413		2203	4300	6503	SO:0001583	missense	10586	exon1			GTGGTGCTCTACC	AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.232C>T	4.37:g.151504413C>T	ENSP00000324701:p.Leu78Phe	180	0		142	6	NM_006439	0	0	0	0	0	B3KP37|Q9HBA7	Missense_Mutation	SNP	ENST00000317605.4	37	CCDS3774.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.953194	0.73902	.	.	ENSG00000181541	ENST00000317605	T	0.07688	3.17	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000001	T	0.32912	0.0845	M	0.80982	2.52	0.58432	D	0.999999	D	0.67145	0.996	D	0.71870	0.975	T	0.00647	-1.1628	10	0.37606	T	0.19	-18.274	20.2985	0.98592	0.0:1.0:0.0:0.0	.	78	Q9Y586	MB212_HUMAN	F	78	ENSP00000324701:L78F	ENSP00000324701:L78F	L	+	1	0	MAB21L2	151723863	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.023000	0.70848	2.793000	0.96121	0.655000	0.94253	CTC	.		0.607	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364937.1	NM_006439	
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G|NSUN2_ENST00000264670.6_5'Flank|SRD5A1_ENST00000504286.1_3'UTR|NSUN2_ENST00000506139.1_5'Flank|NSUN2_ENST00000539938.1_5'Flank|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		0	0		8	8	NM_001047	0	0	0	4	4	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
PCDHAC1	56135	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140307778	140307778	+	Missense_Mutation	SNP	C	C	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr5:140307778C>T	ENST00000253807.2	+	1	1301	c.1301C>T	c.(1300-1302)tCa>tTa	p.S434L	PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.S434L|PCDHA13_ENST00000289272.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	434	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCACTGTGTCAGTTGCTGAT	0.542																																					p.S434L		.											.	PCDHAC1-28	0			c.C1301T						.						78.0	78.0	78.0					5																	140307778		2203	4300	6503	SO:0001583	missense	56135	exon1			CTGTGTCAGTTGC	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1301C>T	5.37:g.140307778C>T	ENSP00000253807:p.Ser434Leu	110	0		108	49	NM_031882	0	0	0	1	1	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	ENST00000253807.2	37	CCDS4241.1	.	.	.	.	.	.	.	.	.	.	C	9.394	1.076286	0.20227	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.01821	4.62;4.62	5.54	0.683	0.17998	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.01421	0.0046	N	0.20483	0.58	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.19148	0.024;0.003	T	0.47071	-0.9145	9	0.52906	T	0.07	.	4.588	0.12291	0.3078:0.4075:0.0:0.2847	.	434;434	Q9H158;Q9H158-2	PCDC1_HUMAN;.	L	434	ENSP00000386356:S434L;ENSP00000253807:S434L	ENSP00000253807:S434L	S	+	2	0	PCDHAC1	140287962	0.000000	0.05858	0.097000	0.21041	0.975000	0.68041	-0.746000	0.04829	0.006000	0.14734	0.462000	0.41574	TCA	.		0.542	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
HAVCR1	26762	broad.mit.edu	37	5	156482501	156482501	+	Silent	SNP	T	T	G			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr5:156482501T>G	ENST00000339252.3	-	2	622	c.90A>C	c.(88-90)ccA>ccC	p.P30P	HAVCR1_ENST00000523175.1_Silent_p.P30P|HAVCR1_ENST00000425854.1_Silent_p.P30P|HAVCR1_ENST00000544197.1_Silent_p.P30P|HAVCR1_ENST00000522693.1_Silent_p.P30P	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	Ig-like V-type.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)			endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTGTGACAGATGGACCTGCCT	0.473																																					p.P30P		.											.	HAVCR1-92	0			c.A90C						.						48.0	51.0	50.0					5																	156482501		1955	4153	6108	SO:0001819	synonymous_variant	26762	exon3			GACAGATGGACCT	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.90A>C	5.37:g.156482501T>G		254	4		234	8	NM_001099414	0	0	0	0	0	O43656	Silent	SNP	ENST00000339252.3	37	CCDS43392.1																																																																																			.		0.473	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
PHYKPL	85007	hgsc.bcm.edu	37	5	177659519	177659519	+	Silent	SNP	C	C	G	rs116735771	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr5:177659519C>G	ENST00000308158.5	-	1	267	c.33G>C	c.(31-33)acG>acC	p.T11T	PHYKPL_ENST00000476170.2_Silent_p.T11T|PHYKPL_ENST00000481811.1_5'Flank	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	11						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	TCAGGGCCAGCGTGTCGGCCT	0.776													G|||	765	0.152756	0.3419	0.0663	5008	,	,		8862	0.1052		0.0755	False		,,,				2504	0.0869				p.T11T		.											.	AGXT2L2-91	0			c.G33C						.	G		758,2778		67,624,1077	3.0	3.0	3.0		33	-4.8	0.9	5	dbSNP_132	3	393,6805		10,373,3216	no	coding-synonymous	AGXT2L2	NM_153373.2		77,997,4293	GG,GC,CC		5.4598,21.4367,10.7229		11/451	177659519	1151,9583	1768	3599	5367	SO:0001819	synonymous_variant	85007	exon1			GGCCAGCGTGTCG	BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.33G>C	5.37:g.177659519C>G		0	0		6	4	NM_153373	0	0	6	14	8	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Silent	SNP	ENST00000308158.5	37	CCDS4434.1																																																																																			C|0.854;G|0.146		0.776	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253477.1	NM_032921	
EEF1A1	1915	ucsc.edu;bcgsc.ca	37	6	74227940	74227940	+	Silent	SNP	A	A	C	rs11556677	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr6:74227940A>C	ENST00000316292.9	-	6	2068	c.1077T>G	c.(1075-1077)ccT>ccG	p.P359P	EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Silent_p.P359P|EEF1A1_ENST00000309268.6_Silent_p.P359P	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	359					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						AATCCAATACAGGGGCATAGC	0.448																																					p.P359P		.											.	EEF1A1-226	0			c.T1077G						.						36.0	40.0	38.0					6																	74227940		2195	4298	6493	SO:0001819	synonymous_variant	1915	exon7			CAATACAGGGGCA	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1077T>G	6.37:g.74227940A>C		208	4		134	14	NM_001402	6	4	14226	14240	4	P04719|P04720|Q6IQ15	Silent	SNP	ENST00000316292.9	37	CCDS4980.1																																																																																			C|1.000;|0.000		0.448	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
FOXO3	2309	bcgsc.ca	37	6	108985092	108985092	+	Silent	SNP	C	C	G	rs200866771		TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr6:108985092C>G	ENST00000343882.6	+	3	1360	c.1056C>G	c.(1054-1056)gcC>gcG	p.A352A	FOXO3_ENST00000540898.1_Silent_p.A132A|FOXO3_ENST00000406360.1_Silent_p.A352A	NM_201559.2	NP_963853.1	O43524	FOXO3_HUMAN	forkhead box O3	352				PMLYSSSASLSPSVSKP -> AHALQHVSQPVTFSKQA (in Ref. 6; CAA04860). {ECO:0000305}.	antral ovarian follicle growth (GO:0001547)|cellular response to oxidative stress (GO:0034599)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|initiation of primordial ovarian follicle growth (GO:0001544)|innate immune response (GO:0045087)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|ovulation from ovarian follicle (GO:0001542)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A352A(2)		central_nervous_system(5)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26		all_cancers(87;1.78e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;3.88e-05)|Colorectal(196;0.0294)|all_lung(197;0.0487)|Lung SC(18;0.152)		Epithelial(106;0.000759)|all cancers(137;0.00121)|BRCA - Breast invasive adenocarcinoma(108;0.00163)|OV - Ovarian serous cystadenocarcinoma(136;0.00718)		GCAGCTCAGCCAGCCTGTCAC	0.572																																					p.A352A		.											.	FOXO3-1295	2	Substitution - coding silent(2)	upper_aerodigestive_tract(1)|prostate(1)	c.C1056G						.						63.0	54.0	57.0					6																	108985092		2203	4300	6503	SO:0001819	synonymous_variant	2309	exon2			CTCAGCCAGCCTG	AF032886	CCDS5068.1	6q21	2008-09-08	2007-05-02	2007-05-02	ENSG00000118689	ENSG00000118689		"""Forkhead boxes"""	3821	protein-coding gene	gene with protein product		602681		FKHRL1, FOXO3A		9479491	Standard	NM_001455		Approved	AF6q21, FOXO2	uc003psm.2	O43524	OTTHUMG00000015327	ENST00000343882.6:c.1056C>G	6.37:g.108985092C>G		344	5		223	21	NM_001455	0	0	10	11	1	B4DVZ6|E1P5E6|O15171|Q5T2I7|Q9BZ04	Silent	SNP	ENST00000343882.6	37	CCDS5068.1																																																																																			C|0.999;G|0.001		0.572	FOXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041722.2		
SAMD5	389432	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	147830225	147830225	+	Missense_Mutation	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr6:147830225G>A	ENST00000367474.1	+	1	163	c.161G>A	c.(160-162)cGt>cAt	p.R54H		NM_001030060.2	NP_001025231.1	Q5TGI4	SAMD5_HUMAN	sterile alpha motif domain containing 5	54	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.												Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;9.55e-10)|GBM - Glioblastoma multiforme(68;0.112)		CACCGCCGCCGTATCCTGGAG	0.731																																					p.R54H		.											.	SAMD5-68	0			c.G161A						.						9.0	11.0	10.0					6																	147830225		2088	4119	6207	SO:0001583	missense	389432	exon1			GCCGCCGTATCCT	AL354880	CCDS34548.1	6q24.3	2013-01-10			ENSG00000203727	ENSG00000203727		"""Sterile alpha motif (SAM) domain containing"""	21180	protein-coding gene	gene with protein product							Standard	NM_001030060		Approved	dJ875H10.1	uc003qmc.2	Q5TGI4	OTTHUMG00000015767	ENST00000367474.1:c.161G>A	6.37:g.147830225G>A	ENSP00000356444:p.Arg54His	59	0		40	7	NM_001030060	0	0	0	0	0		Missense_Mutation	SNP	ENST00000367474.1	37	CCDS34548.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680166	0.88542	.	.	ENSG00000203727	ENST00000367474	T	0.55052	0.54	3.95	3.95	0.45737	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.061993	0.64402	D	0.000005	T	0.71978	0.3404	M	0.92604	3.325	0.37407	D	0.913108	D	0.89917	1.0	D	0.70935	0.971	T	0.81226	-0.1029	10	0.87932	D	0	-7.4586	13.7698	0.63018	0.0:0.0:1.0:0.0	.	54	Q5TGI4	SAMD5_HUMAN	H	54	ENSP00000356444:R54H	ENSP00000356444:R54H	R	+	2	0	SAMD5	147871918	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.038000	0.57318	1.739000	0.51704	0.460000	0.39030	CGT	.		0.731	SAMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042610.1	NM_001030060	
LRP11	84918	hgsc.bcm.edu	37	6	150184882	150184882	+	Missense_Mutation	SNP	G	G	C	rs9322225	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr6:150184882G>C	ENST00000239367.2	-	1	280	c.275C>G	c.(274-276)cCg>cGg	p.P92R	LRP11_ENST00000367368.2_Missense_Mutation_p.P92R|RP11-244K5.8_ENST00000596229.1_RNA|RP11-244K5.8_ENST00000606915.1_RNA|LRP11_ENST00000546019.1_Intron	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	92			P -> R (in dbSNP:rs9322225). {ECO:0000269|PubMed:15489334}.			integral component of membrane (GO:0016021)				cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GCCGCTGCCCGGGCCCGGGCA	0.756													g|||	2394	0.478035	0.3071	0.5101	5008	,	,		7691	0.8224		0.4165	False		,,,				2504	0.3947				p.P92R		.											.	LRP11-90	0			c.C275G						.	G	ARG/PRO	799,1991		151,497,747	2.0	2.0	2.0		275	3.0	0.3	6	dbSNP_119	2	2072,3740		444,1184,1278	yes	missense	LRP11	NM_032832.5	103	595,1681,2025	CC,CG,GG		35.6504,28.638,33.376	possibly-damaging	92/501	150184882	2871,5731	1395	2906	4301	SO:0001583	missense	84918	exon1			CTGCCCGGGCCCG	AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.275C>G	6.37:g.150184882G>C	ENSP00000239367:p.Pro92Arg	0	0		4	4	NM_032832	0	0	0	0	0	Q5VYC0|Q96SN6	Missense_Mutation	SNP	ENST00000239367.2	37	CCDS5220.1	1110	0.5082417582417582	147	0.29878048780487804	188	0.5193370165745856	465	0.8129370629370629	310	0.40897097625329815	G	12.02	1.812850	0.32053	0.28638	0.356504	ENSG00000120256	ENST00000239367;ENST00000367368	T;T	0.20463	2.07;2.07	3.91	2.96	0.34315	Seven cysteines, N-terminal (2);	1.059560	0.07539	N	0.913589	T	0.07279	0.0184	L	0.36672	1.1	0.51767	P	7.00000000000145E-5	B;B	0.25743	0.133;0.012	B;B	0.23150	0.044;0.025	T	0.19484	-1.0304	9	0.19590	T	0.45	-4.154	11.8365	0.52327	0.0:0.1787:0.8213:0.0	rs9322225;rs17846346;rs17859381	92;92	Q5VYB9;Q86VZ4	.;LRP11_HUMAN	R	92	ENSP00000239367:P92R;ENSP00000356338:P92R	ENSP00000239367:P92R	P	-	2	0	LRP11	150226575	0.132000	0.22450	0.342000	0.25602	0.428000	0.31595	0.489000	0.22387	1.900000	0.55004	0.484000	0.47621	CCG	G|0.492;C|0.508		0.756	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042664.1	NM_032832	
TWISTNB	221830	hgsc.bcm.edu	37	7	19748560	19748582	+	Frame_Shift_Del	DEL	GGCAGGACGCCAGCCTGCCCTAC	GGCAGGACGCCAGCCTGCCCTAC	-	rs150063001|rs140370583	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	GGCAGGACGCCAGCCTGCCCTAC	GGCAGGACGCCAGCCTGCCCTAC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr7:19748560_19748582delGGCAGGACGCCAGCCTGCCCTAC	ENST00000222567.5	-	1	128_150	c.58_80delGTAGGGCAGGCTGGCGTCCTGCC	c.(58-81)gtagggcaggctggcgtcctgcctfs	p.VGQAGVLP20fs		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	20					transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						CTCTAGGCAAGGCAGGACGCCAGCCTGCCCTACCAGAGACCCA	0.659											OREG0017879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.20_27del		.											.	TWISTNB-91	0			c.58_80del						.																																			SO:0001589	frameshift_variant	221830	exon1			AGGCAAGGCAGGA	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.58_80delGTAGGGCAGGCTGGCGTCCTGCC	7.37:g.19748560_19748582delGGCAGGACGCCAGCCTGCCCTAC	ENSP00000222567:p.Val20fs	106	0	735	74	0	NM_001002926	0	0	0	0	0	A0PJ45|B7Z724	Frame_Shift_Del	DEL	ENST00000222567.5	37	CCDS34606.1																																																																																			.		0.659	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1		
TWISTNB	221830	bcgsc.ca	37	7	19748562	19748582	+	In_Frame_Del	DEL	CAGGACGCCAGCCTGCCCTAC	CAGGACGCCAGCCTGCCCTAC	-	rs150063001|rs140370583	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	CAGGACGCCAGCCTGCCCTAC	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr7:19748562_19748582delCAGGACGCCAGCCTGCCCTAC	ENST00000222567.5	-	1	128_148	c.58_78delGTAGGGCAGGCTGGCGTCCTG	c.(58-78)gtagggcaggctggcgtcctgdel	p.VGQAGVL20del		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	20					transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						CTAGGCAAGGCAGGACGCCAGCCTGCCCTACCAGAGACCCA	0.656											OREG0017879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.20_26del		.											.	TWISTNB-91	0			c.58_78del						.																																			SO:0001651	inframe_deletion	221830	exon1			GCAAGGCAGGACG	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.58_78delGTAGGGCAGGCTGGCGTCCTG	7.37:g.19748562_19748582delCAGGACGCCAGCCTGCCCTAC	ENSP00000222567:p.Val20_Leu26del	104	0	735	72	4	NM_001002926	0	0	0	0	0	A0PJ45|B7Z724	In_Frame_Del	DEL	ENST00000222567.5	37	CCDS34606.1																																																																																			.		0.656	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1		
SP8	221833	hgsc.bcm.edu	37	7	20824941	20824943	+	In_Frame_Del	DEL	GCC	GCC	-	rs372591893	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	GCC	GCC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr7:20824941_20824943delGCC	ENST00000361443.4	-	3	676_678	c.439_441delGGC	c.(439-441)ggcdel	p.G147del	SP8_ENST00000418710.2_In_Frame_Del_p.G165del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	147					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G165delG(1)|p.G147delG(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						GCGCGGAGGAgccgccgccgccg	0.729														461	0.0920527	0.0098	0.1124	5008	,	,		5525	0.002		0.2664	False		,,,				2504	0.1022				p.165_165del		.											.	SP8-91	2	Deletion - In frame(2)	central_nervous_system(2)	c.493_495del						.		,	50,654		19,12,321					,	0.5	0.3			2	602,1424		217,168,628	no	coding,coding	SP8	NM_198956.2,NM_182700.4	,	236,180,949	A1A1,A1R,RR		29.7137,7.1023,23.8828	,	,		652,2078				SO:0001651	inframe_deletion	221833	exon2			GGAGGAGCCGCCG		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.439_441delGGC	7.37:g.20824950_20824952delGCC	ENSP00000354482:p.Gly147del	39	0		64	15	NM_182700	0	0	0	0	0	Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	ENST00000361443.4	37	CCDS5372.1																																																																																			.		0.729	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
GPR141	353345	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	37780431	37780431	+	Missense_Mutation	SNP	A	A	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr7:37780431A>T	ENST00000447769.1	+	4	725	c.436A>T	c.(436-438)Att>Ttt	p.I146F	EPDR1_ENST00000476620.1_Intron|GPR141_ENST00000461610.1_Intron|GPR141_ENST00000334425.1_Missense_Mutation_p.I146F			Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(13)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGTGATTGTCATTGTGGTACC	0.448																																					p.I146F		.											.	GPR141-93	0			c.A436T						.						153.0	147.0	149.0					7																	37780431		2203	4300	6503	SO:0001583	missense	353345	exon1			ATTGTCATTGTGG	AY288420	CCDS5451.1	7p14.1	2012-08-21			ENSG00000187037	ENSG00000187037		"""GPCR / Class A : Orphans"""	19997	protein-coding gene	gene with protein product		609045				12679517, 14623098	Standard	NM_181791		Approved	PGR13	uc003tfm.1	Q7Z602	OTTHUMG00000102105	ENST00000447769.1:c.436A>T	7.37:g.37780431A>T	ENSP00000390410:p.Ile146Phe	199	0		161	61	NM_181791	0	0	0	0	0	A4D1X7|Q0VAR5|Q86SP3	Missense_Mutation	SNP	ENST00000447769.1	37	CCDS5451.1	.	.	.	.	.	.	.	.	.	.	A	10.29	1.309230	0.23821	.	.	ENSG00000187037	ENST00000447769;ENST00000334425	T;T	0.73897	-0.79;-0.79	4.56	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.485095	0.20937	N	0.082994	T	0.61689	0.2367	L	0.45137	1.4	0.28487	N	0.914655	B	0.17038	0.02	B	0.19946	0.027	T	0.51513	-0.8696	10	0.30078	T	0.28	-14.5284	5.0929	0.14718	0.748:0.0:0.089:0.163	.	146	Q7Z602	GP141_HUMAN	F	146	ENSP00000390410:I146F;ENSP00000334540:I146F	ENSP00000334540:I146F	I	+	1	0	GPR141	37746956	0.474000	0.25886	0.736000	0.30914	0.711000	0.40976	1.117000	0.31234	0.849000	0.35215	0.533000	0.62120	ATT	.		0.448	GPR141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219943.2	NM_181791	
RAMP3	10268	hgsc.bcm.edu	37	7	45197433	45197433	+	Silent	SNP	G	G	A	rs67477213	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr7:45197433G>A	ENST00000242249.4	+	1	44	c.6G>A	c.(4-6)gaG>gaA	p.E2E	RAMP3_ENST00000481345.1_Silent_p.E2E|RAMP3_ENST00000496212.1_Silent_p.E2E	NM_005856.2	NP_005847.1	O60896	RAMP3_HUMAN	receptor (G protein-coupled) activity modifying protein 3	2					calcium ion transport (GO:0006816)|cellular response to estradiol stimulus (GO:0071392)|G-protein coupled receptor signaling pathway involved in heart process (GO:0086103)|intracellular protein transport (GO:0006886)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of receptor recycling (GO:0001921)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			breast(1)|endometrium(1)|large_intestine(4)|lung(4)|stomach(1)	11					Pramlintide(DB01278)	CAGCCATGGAGACTGGAGCGC	0.771													G|||	1244	0.248403	0.4947	0.1657	5008	,	,		7876	0.0159		0.2276	False		,,,				2504	0.2352				p.E2E		.											.	RAMP3-90	0			c.G6A						.	G		1194,2386		196,802,792	3.0	3.0	3.0		6	2.0	0.0	7	dbSNP_130	3	1312,6004		141,1030,2487	no	coding-synonymous	RAMP3	NM_005856.2		337,1832,3279	AA,AG,GG		17.9333,33.352,22.9993		2/149	45197433	2506,8390	1790	3658	5448	SO:0001819	synonymous_variant	10268	exon1			CATGGAGACTGGA	AJ001016	CCDS5503.1	7p13-p12	2006-11-21	2006-11-21		ENSG00000122679	ENSG00000122679		"""Receptor (G protein-coupled) activity modifying proteins"""	9845	protein-coding gene	gene with protein product		605155	"""receptor activity modifying protein 3"", ""receptor (calcitonin) activity modifying protein 3"""				Standard	NM_005856		Approved		uc003tnb.3	O60896	OTTHUMG00000023729	ENST00000242249.4:c.6G>A	7.37:g.45197433G>A		6	0		9	9	NM_005856	0	0	9	19	10	Q7Z2Y1	Silent	SNP	ENST00000242249.4	37	CCDS5503.1																																																																																			G|0.760;A|0.240		0.771	RAMP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251343.1	NM_005856	
CHD7	55636	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	61769317	61769317	+	Missense_Mutation	SNP	C	C	G			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr8:61769317C>G	ENST00000423902.2	+	34	7957	c.7478C>G	c.(7477-7479)cCc>cGc	p.P2493R	CHD7_ENST00000524602.1_Intron|CHD7_ENST00000529472.1_3'UTR	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2493					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TCGCGCACACCCACAAGGCAT	0.493																																					p.P2493R		.											.	CHD7-141	0			c.C7478G						.						143.0	140.0	141.0					8																	61769317		1950	4154	6104	SO:0001583	missense	55636	exon34			GCACACCCACAAG	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.7478C>G	8.37:g.61769317C>G	ENSP00000392028:p.Pro2493Arg	229	0		224	125	NM_017780	0	0	0	0	0	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	37	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432311	0.62844	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.81659	-1.52	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.72763	0.3501	L	0.29908	0.895	0.43924	D	0.99657	P	0.38978	0.652	B	0.35813	0.211	T	0.75494	-0.3298	10	0.49607	T	0.09	-13.9639	18.6309	0.91359	0.0:1.0:0.0:0.0	.	2493	Q9P2D1	CHD7_HUMAN	R	2493	ENSP00000392028:P2493R	ENSP00000307304:P2493R	P	+	2	0	CHD7	61931871	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.518000	0.73764	2.630000	0.89119	0.563000	0.77884	CCC	.		0.493	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
TSNARE1	203062	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	143427201	143427201	+	Silent	SNP	C	C	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr8:143427201C>A	ENST00000307180.3	-	3	258	c.141G>T	c.(139-141)tcG>tcT	p.S47S	TSNARE1_ENST00000520166.1_Silent_p.S47S|TSNARE1_ENST00000519651.1_Intron|TSNARE1_ENST00000524325.1_Silent_p.S47S	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	47					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGCTCTCTGGCGACGGGCAGG	0.607																																					p.S47S		.											.	TSNARE1-90	0			c.G141T						.						123.0	101.0	108.0					8																	143427201		2203	4300	6503	SO:0001819	synonymous_variant	203062	exon3			CTCTGGCGACGGG			8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.141G>T	8.37:g.143427201C>A		147	0		145	57	NM_145003	0	0	6	12	6	B7ZLB0|Q14D03	Silent	SNP	ENST00000307180.3	37	CCDS6384.1																																																																																			.		0.607	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_145003	
SCRIB	23513	hgsc.bcm.edu	37	8	144874554	144874554	+	Silent	SNP	T	T	C	rs6991873	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr8:144874554T>C	ENST00000320476.3	-	32	4356	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	RP11-429J17.8_ENST00000534089.1_RNA|SCRIB_ENST00000546337.1_5'Flank|SCRIB_ENST00000356994.2_Silent_p.P1450P|RP11-429J17.8_ENST00000532625.1_RNA|SCRIB_ENST00000377533.3_Silent_p.P1369P|RP11-429J17.8_ENST00000527139.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	1450					activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CTCCCAGGGGTGGGGGGGACG	0.751													T|||	4958	0.990016	0.9652	0.9971	5008	,	,		8428	1.0		0.998	False		,,,				2504	1.0				p.P1450P	Pancreas(51;966 1133 10533 14576 29674)	.											.	SCRIB-228	0			c.A4350G						.	T	,	3300,62		1619,62,0	3.0	4.0	4.0		4350,4350	-2.9	0.0	8	dbSNP_116	4	7076,4		3536,4,0	no	coding-synonymous,coding-synonymous	SCRIB	NM_015356.3,NM_182706.3	,	5155,66,0	CC,CT,TT		0.0565,1.8441,0.6321	,	1450/1631,1450/1656	144874554	10376,66	1681	3540	5221	SO:0001819	synonymous_variant	23513	exon32			CAGGGGTGGGGGG	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.4350A>G	8.37:g.144874554T>C		0	0		4	4	NM_015356	0	0	0	27	27	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Silent	SNP	ENST00000320476.3	37	CCDS6411.1	2162	0.98992673992674	472	0.959349593495935	361	0.9972375690607734	572	1.0	757	0.9986807387862797	T	5.986	0.365776	0.11352	0.981559	0.999435	ENSG00000180900	ENST00000526832	.	.	.	4.01	-2.89	0.05665	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.20773	-1.0265	3	.	.	.	.	6.6143	0.22769	0.0:0.6476:0.1513:0.201	rs6991873	.	.	.	A	470	.	.	T	-	1	0	SCRIB	144946542	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.411000	0.07142	-0.857000	0.04115	-0.386000	0.06593	ACC	T|0.010;C|0.990		0.751	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000382215.1	NM_015356	
SLC24A2	25769	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	19786455	19786455	+	Missense_Mutation	SNP	A	A	G			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr9:19786455A>G	ENST00000341998.2	-	1	471	c.410T>C	c.(409-411)cTg>cCg	p.L137P	SLC24A2_ENST00000286344.3_Missense_Mutation_p.L137P	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	137					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		AATGACATGCAGAATGATCGC	0.438																																					p.L137P		.											.	SLC24A2-517	0			c.T410C						.						104.0	98.0	100.0					9																	19786455		2203	4300	6503	SO:0001583	missense	25769	exon1			ACATGCAGAATGA	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.410T>C	9.37:g.19786455A>G	ENSP00000344801:p.Leu137Pro	55	0		53	9	NM_001193288	0	0	0	0	0	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	37	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781174	0.70222	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	D;T	0.81499	-1.5;-1.48	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.89469	0.6724	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	D	0.89774	0.3956	9	.	.	.	.	16.0738	0.80955	1.0:0.0:0.0:0.0	.	137;137	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	P	137	ENSP00000344801:L137P;ENSP00000286344:L137P	.	L	-	2	0	SLC24A2	19776455	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.335000	0.96500	2.192000	0.70111	0.533000	0.62120	CTG	.		0.438	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
CCDC107	203260	bcgsc.ca	37	9	35660990	35660990	+	Missense_Mutation	SNP	A	A	G	rs1339374	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr9:35660990A>G	ENST00000426546.2	+	5	724	c.658A>G	c.(658-660)Att>Gtt	p.I220V	CCDC107_ENST00000378407.3_3'UTR|RMRP_ENST00000602361.1_lincRNA|ARHGEF39_ENST00000490970.1_5'Flank|CCDC107_ENST00000378409.3_Missense_Mutation_p.I193V|CCDC107_ENST00000378406.1_3'UTR|ARHGEF39_ENST00000378395.2_3'UTR|CCDC107_ENST00000327351.2_3'UTR|ARHGEF39_ENST00000343259.3_3'UTR|CCDC107_ENST00000421582.2_3'UTR|ARHGEF39_ENST00000378387.3_3'UTR	NM_001195200.1|NM_001195201.1|NM_001195217.1|NM_174923.2	NP_001182129.1|NP_001182130.1|NP_001182146.1|NP_777583.2	Q8WV48	CC107_HUMAN	coiled-coil domain containing 107	220			I -> V (in dbSNP:rs1339374). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1, ECO:0000269|Ref.4}.			integral component of membrane (GO:0016021)				endometrium(1)|lung(3)|skin(1)	5	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CGAGGAGGAGATTGGTGACAG	0.552													G|||	4073	0.813299	0.5968	0.8703	5008	,	,		20167	0.9782		0.8181	False		,,,				2504	0.8906				p.I220V		.											.	CCDC107-90	0			c.A658G						.	G	VAL/ILE,,,,VAL/ILE	2784,1622	495.0+/-363.1	903,978,322	89.0	88.0	88.0		577,,,,658	1.2	0.4	9	dbSNP_88	88	6870,1730	313.7+/-311.4	2729,1412,159	yes	missense,utr-3,utr-3,utr-3,missense	C9orf100,CCDC107	NM_001195200.1,NM_001195201.1,NM_001195217.1,NM_032818.2,NM_174923.2	29,,,,29	3632,2390,481	GG,GA,AA		20.1163,36.8134,25.7727	benign,,,,benign	193/257,,,,220/284	35660990	9654,3352	2203	4300	6503	SO:0001583	missense	203260	exon5			GAGGAGATTGGTG	AK075523	CCDS6583.1, CCDS56573.1, CCDS56574.1, CCDS56575.1	9q13.3	2008-02-05			ENSG00000159884	ENSG00000159884			28465	protein-coding gene	gene with protein product						12477932	Standard	NM_174923		Approved	MGC31967	uc011lox.2	Q8WV48	OTTHUMG00000019868	ENST00000426546.2:c.658A>G	9.37:g.35660990A>G	ENSP00000414964:p.Ile220Val	138	1		128	5	NM_174923	0	0	215	215	0	A6XND6|Q5T4R5|Q5T4R8|Q5T4R9|Q86VB6|Q8N2E4	Missense_Mutation	SNP	ENST00000426546.2	37	CCDS6583.1	1809	0.8282967032967034	317	0.6443089430894309	308	0.850828729281768	566	0.9895104895104895	618	0.8153034300791556	G	0.008	-1.863490	0.00552	0.631866	0.798837	ENSG00000159884	ENST00000426546;ENST00000378409	T;T	0.30448	1.95;1.53	5.08	1.22	0.21188	.	0.730594	0.12230	N	0.487558	T	0.00012	0.0000	N	0.08118	0	0.58432	P	2.9999999999752447E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40232	-0.9574	9	0.02654	T	1	1.2077	7.7533	0.28909	0.4372:0.0:0.5628:0.0	rs1339374;rs17856574;rs52795236;rs59175010;rs1339374	193;220	F8W8S5;Q8WV48	.;CC107_HUMAN	V	220;193	ENSP00000414964:I220V;ENSP00000367665:I193V	ENSP00000367665:I193V	I	+	1	0	CCDC107	35650990	0.069000	0.21087	0.364000	0.25888	0.018000	0.09664	-0.106000	0.10890	-0.128000	0.11641	-1.201000	0.01664	ATT	A|0.226;G|0.774		0.552	CCDC107-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000052325.1	NM_174923	
BICD2	23299	broad.mit.edu	37	9	95526977	95526977	+	Missense_Mutation	SNP	G	G	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr9:95526977G>T	ENST00000375512.3	-	1	117	c.50C>A	c.(49-51)gCg>gAg	p.A17E	BICD2_ENST00000356884.6_Missense_Mutation_p.A17E	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	17					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTCCGGCTGCGCCTCCATCAC	0.731																																					p.A17E		.											.	BICD2-226	0			c.C50A						.						9.0	10.0	9.0					9																	95526977		2068	4116	6184	SO:0001583	missense	23299	exon1			GGCTGCGCCTCCA	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.50C>A	9.37:g.95526977G>T	ENSP00000364662:p.Ala17Glu	37	3		61	12	NM_001003800	0	0	19	20	1	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	37	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	.	16.77	3.215213	0.58452	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.44881	0.91;0.92	4.35	4.35	0.52113	.	0.211686	0.38548	N	0.001654	T	0.42539	0.1207	L	0.34521	1.04	0.43512	D	0.995772	D;P	0.55800	0.973;0.954	P;P	0.53360	0.724;0.534	T	0.10660	-1.0620	10	0.17832	T	0.49	-38.5328	15.1518	0.72706	0.0:0.0:1.0:0.0	.	17;17	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	E	17	ENSP00000349351:A17E;ENSP00000364662:A17E	ENSP00000349351:A17E	A	-	2	0	BICD2	94566798	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	8.700000	0.91322	2.349000	0.79799	0.195000	0.17529	GCG	.		0.731	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250	
TBL1X	6907	broad.mit.edu;bcgsc.ca	37	X	9656265	9656265	+	Missense_Mutation	SNP	A	A	G			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chrX:9656265A>G	ENST00000217964.7	+	7	1206	c.566A>G	c.(565-567)aAg>aGg	p.K189R	TBL1X_ENST00000407597.2_Missense_Mutation_p.K189R|TBL1X_ENST00000380961.1_Missense_Mutation_p.K138R|TBL1X_ENST00000424279.1_Missense_Mutation_p.K138R|TBL1X_ENST00000536365.1_Missense_Mutation_p.K138R	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	189					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				AATCCATCGAAGAACAGAGAG	0.627																																					p.K189R		.											.	TBL1X-131	0			c.A566G						.						33.0	26.0	28.0					X																	9656265		2201	4298	6499	SO:0001583	missense	6907	exon7			CATCGAAGAACAG	Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.566A>G	X.37:g.9656265A>G	ENSP00000217964:p.Lys189Arg	374	1		281	8	NM_001139466	0	0	2	2	0	A8K044|A8K4J7|Q86UY2	Missense_Mutation	SNP	ENST00000217964.7	37	CCDS14133.1	.	.	.	.	.	.	.	.	.	.	A	11.17	1.559872	0.27827	.	.	ENSG00000101849	ENST00000407597;ENST00000424279;ENST00000536365;ENST00000380961;ENST00000217964	T;T;T;T;T	0.56776	0.44;0.54;0.54;0.54;0.44	4.63	4.63	0.57726	.	0.247959	0.39687	N	0.001292	T	0.46229	0.1382	L	0.43923	1.385	0.42123	D	0.991431	B;B	0.27380	0.177;0.177	B;B	0.34489	0.066;0.184	T	0.33828	-0.9853	10	0.14656	T	0.56	.	13.3863	0.60797	1.0:0.0:0.0:0.0	.	152;189	Q59F53;O60907	.;TBL1X_HUMAN	R	189;138;138;138;189	ENSP00000385988:K189R;ENSP00000394097:K138R;ENSP00000445317:K138R;ENSP00000370348:K138R;ENSP00000217964:K189R	ENSP00000217964:K189R	K	+	2	0	TBL1X	9616265	1.000000	0.71417	0.796000	0.32109	0.031000	0.12232	6.446000	0.73460	1.531000	0.49152	0.417000	0.27973	AAG	.		0.627	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055709.1	NM_005647	
TCEAL6	158931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101395946	101395946	+	Missense_Mutation	SNP	C	C	T	rs376334850		TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chrX:101395946C>T	ENST00000372774.3	-	3	607	c.358G>A	c.(358-360)Gat>Aat	p.D120N	TCEAL6_ENST00000372773.1_Missense_Mutation_p.D120N	NM_001006938.2	NP_001006939.2	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.D120N(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	14						TTGGGGGAATCGTCCGTCCCC	0.577																																					p.D120N		.											.	TCEAL6-91	1	Substitution - Missense(1)	central_nervous_system(1)	c.G358A						.	C	ASN/ASP	0,3835		0,0,0,1632,571	100.0	93.0	95.0		358	0.9	0.0	X		95	1,6727		0,0,1,2428,1871	no	missense	TCEAL6	NM_001006938.2	23	0,0,1,4060,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095	possibly-damaging	120/184	101395946	1,10562	2203	4300	6503	SO:0001583	missense	158931	exon3			GGGAATCGTCCGT	BC071675	CCDS43978.1	Xq22.1	2014-03-21			ENSG00000204071	ENSG00000204071			24553	protein-coding gene	gene with protein product						16221301	Standard	NM_001006938		Approved	WEX2	uc004eiq.3	Q6IPX3	OTTHUMG00000022050	ENST00000372774.3:c.358G>A	X.37:g.101395946C>T	ENSP00000361860:p.Asp120Asn	307	0		170	39	NM_001006938	0	0	94	94	0	Q5H9J8	Missense_Mutation	SNP	ENST00000372774.3	37	CCDS43978.1	.	.	.	.	.	.	.	.	.	.	G	9.479	1.097651	0.20552	0.0	1.49E-4	ENSG00000204071	ENST00000372774;ENST00000372773;ENST00000536102	T;T	0.09911	2.93;2.93	2.75	0.888	0.19206	.	0.000000	0.39834	N	0.001248	T	0.23806	0.0576	M	0.63428	1.95	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.02751	-1.1115	10	0.45353	T	0.12	.	8.034	0.30482	0.0:0.5087:0.4913:0.0	.	120	Q6IPX3-2	.	N	120	ENSP00000361860:D120N;ENSP00000361859:D120N	ENSP00000361859:D120N	D	-	1	0	TCEAL6	101282602	0.000000	0.05858	0.001000	0.08648	0.172000	0.22775	-0.652000	0.05366	0.113000	0.18004	0.468000	0.43344	GAT	.		0.577	TCEAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057609.1	NM_001006938	
TCEAL3	85012	broad.mit.edu	37	X	102864350	102864350	+	Missense_Mutation	SNP	G	G	A			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chrX:102864350G>A	ENST00000372628.1	+	3	716	c.358G>A	c.(358-360)Gat>Aat	p.D120N	TCEAL3_ENST00000372627.5_Missense_Mutation_p.D120N|TCEAL3_ENST00000243286.3_Missense_Mutation_p.D120N|TCEAL3_ENST00000477014.1_Intron			Q969E4	TCAL3_HUMAN	transcription elongation factor A (SII)-like 3	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	16						GGGGACGGACGATTCCCCCAA	0.567																																					p.D120N		.											.	TCEAL3-90	0			c.G358A						.						131.0	119.0	123.0					X																	102864350		2203	4300	6503	SO:0001583	missense	85012	exon3			ACGGACGATTCCC	BC008703	CCDS14511.1	Xq22.2	2014-03-21			ENSG00000196507	ENSG00000196507			28247	protein-coding gene	gene with protein product						16221301	Standard	NM_032926		Approved	MGC15737, WEX8	uc004ekr.3	Q969E4	OTTHUMG00000022106	ENST00000372628.1:c.358G>A	X.37:g.102864350G>A	ENSP00000361711:p.Asp120Asn	476	0		292	10	NM_001006933	0	0	94	94	0	D3DXA4	Missense_Mutation	SNP	ENST00000372628.1	37	CCDS14511.1	.	.	.	.	.	.	.	.	.	.	G	16.74	3.205831	0.58234	.	.	ENSG00000196507	ENST00000372628;ENST00000372627;ENST00000243286	T;T;T	0.09911	2.93;2.93;2.93	4.59	4.59	0.56863	.	0.000000	0.40222	N	0.001147	T	0.26304	0.0642	L	0.57536	1.79	0.22581	N	0.998967	D	0.89917	1.0	D	0.91635	0.999	T	0.02491	-1.1151	10	0.37606	T	0.19	.	11.6175	0.51098	0.0:0.0:1.0:0.0	.	120	Q969E4	TCAL3_HUMAN	N	120	ENSP00000361711:D120N;ENSP00000361710:D120N;ENSP00000243286:D120N	ENSP00000243286:D120N	D	+	1	0	TCEAL3	102751006	0.991000	0.36638	0.383000	0.26132	0.681000	0.39784	3.500000	0.53318	2.516000	0.84829	0.538000	0.68166	GAT	.		0.567	TCEAL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057737.1	NM_032926	
IRS4	8471	broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	107979158	107979158	+	Silent	SNP	G	G	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chrX:107979158G>T	ENST00000372129.2	-	1	493	c.417C>A	c.(415-417)ccC>ccA	p.P139P	RP6-24A23.3_ENST00000608811.1_RNA|RP6-24A23.3_ENST00000436013.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	139	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GAATGAGCGGGGGGATCGCGG	0.642																																					p.P139P		.											.	IRS4-623	0			c.C417A						.						25.0	24.0	24.0					X																	107979158		2197	4288	6485	SO:0001819	synonymous_variant	8471	exon1			GAGCGGGGGGATC	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.417C>A	X.37:g.107979158G>T		99	0		47	17	NM_003604	0	0	0	0	0		Silent	SNP	ENST00000372129.2	37	CCDS14544.1																																																																																			.		0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
NDUFA1	4694	broad.mit.edu	37	X	119007288	119007288	+	Missense_Mutation	SNP	G	G	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chrX:119007288G>T	ENST00000371437.4	+	2	549	c.124G>T	c.(124-126)Ggg>Tgg	p.G42W	RNF113A_ENST00000371442.2_5'Flank	NM_004541.3	NP_004532.1	O15239	NDUA1_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa	42					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|large_intestine(2)|stomach(1)	5						TGCTCATTTTGGGTATCACTG	0.393																																					p.G42W		.											.	NDUFA1-193	0			c.G124T						.						162.0	142.0	149.0					X																	119007288		2203	4300	6503	SO:0001583	missense	4694	exon2			CATTTTGGGTATC		CCDS14590.1	Xq24	2011-07-04	2002-08-29		ENSG00000125356	ENSG00000125356		"""Mitochondrial respiratory chain complex / Complex I"""	7683	protein-coding gene	gene with protein product	"""NADH:ubiquinone oxidoreductase (complex 1)"", ""type I dehydrogenase"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"", ""complex I MWFE subunit"""	300078	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1 (7.5kD, MWFE)"""			8938439	Standard	NM_004541		Approved	MWFE, CI-MWFE	uc004esc.4	O15239	OTTHUMG00000022287	ENST00000371437.4:c.124G>T	X.37:g.119007288G>T	ENSP00000360492:p.Gly42Trp	170	0		99	4	NM_004541	0	0	627	627	0		Missense_Mutation	SNP	ENST00000371437.4	37	CCDS14590.1	.	.	.	.	.	.	.	.	.	.	G	2.227	-0.376972	0.05000	.	.	ENSG00000125356	ENST00000371437	T	0.72051	-0.62	4.88	-8.61	0.00885	.	1.740220	0.03102	N	0.161307	T	0.54464	0.1860	.	.	.	0.09310	N	1	P	0.42785	0.79	B	0.39660	0.306	T	0.60250	-0.7300	9	0.59425	D	0.04	20.8417	2.0644	0.03599	0.203:0.1786:0.4015:0.2169	.	42	O15239	NDUA1_HUMAN	W	42	ENSP00000360492:G42W	ENSP00000360492:G42W	G	+	1	0	NDUFA1	118891316	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.533000	0.02215	-3.116000	0.00240	-1.612000	0.00800	GGG	.		0.393	NDUFA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058080.1	NM_004541	
MAGEA3	4102	bcgsc.ca	37	X	151935712	151935712	+	Missense_Mutation	SNP	C	C	A	rs61744011	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chrX:151935712C>A	ENST00000393902.3	-	3	1022	c.455G>T	c.(454-456)aGc>aTc	p.S152I	MAGEA3_ENST00000370278.3_Missense_Mutation_p.S152I			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	152	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GGAAGCTTTGCTGAAGATCAC	0.537																																					p.S152I		.											.	MAGEA3-90	0			c.G455T						.						138.0	123.0	128.0					X																	151935712		2203	4293	6496	SO:0001583	missense	4102	exon3			GCTTTGCTGAAGA		CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.455G>T	X.37:g.151935712C>A	ENSP00000377480:p.Ser152Ile	674	17		378	28	NM_005362	0	0	0	0	0	Q6FHI6	Missense_Mutation	SNP	ENST00000393902.3	37	CCDS14715.1	.	.	.	.	.	.	.	.	.	.	c	5.545	0.285489	0.10513	.	.	ENSG00000221867	ENST00000370278;ENST00000393902;ENST00000417212	T;T;T	0.05081	3.5;3.5;3.5	1.42	-1.91	0.07641	.	1.536110	0.03025	N	0.151241	T	0.17831	0.0428	M	0.74881	2.28	0.09310	N	1	D	0.53619	0.961	P	0.57846	0.828	T	0.20405	-1.0276	10	0.41790	T	0.15	.	4.9877	0.14198	0.0:0.3789:0.0:0.6211	.	152	P43357	MAGA3_HUMAN	I	152	ENSP00000359301:S152I;ENSP00000377480:S152I;ENSP00000392758:S152I	ENSP00000359301:S152I	S	-	2	0	MAGEA3	151686368	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.557000	0.05985	-0.772000	0.04602	0.358000	0.22013	AGC	C|0.995;A|0.005		0.537	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058744.1	NM_005362	
EP400	57634	hgsc.bcm.edu	37	12	132547093	132547094	+	In_Frame_Ins	INS	-	-	CAGCAGCAG	rs10902490|rs113304321|rs528214697	byFrequency	TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr12:132547093_132547094insCAGCAGCAG	ENST00000333577.4	+	48	8398_8399	c.8289_8290insCAGCAGCAG	c.(8290-8292)cag>CAGCAGCAGcag	p.2764_2764Q>QQQQ	EP400_ENST00000330386.6_In_Frame_Ins_p.2647_2647Q>QQQQ|EP400_ENST00000389561.2_In_Frame_Ins_p.2728_2728Q>QQQQ|EP400_ENST00000332482.4_In_Frame_Ins_p.2691_2691Q>QQQQ|EP400_ENST00000389562.2_In_Frame_Ins_p.2727_2727Q>QQQQ			Q96L91	EP400_HUMAN	E1A binding protein p400	2764	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagca	0.564																																					p.Q2727delinsQQQQ		.											.	EP400-520	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)	c.8181_8182insCAGCAGCAG						.																																			SO:0001652	inframe_insertion	57634	exon47			GCAACAACAGCAG	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8317_8325dupCAGCAGCAG	12.37:g.132547094_132547102dupCAGCAGCAG	ENSP00000333602:p.GlnGlnGln2782dup	206	0		184	40	NM_015409	0	0	0	0	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	In_Frame_Ins	INS	ENST00000333577.4	37																																																																																				.		0.564	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
TWISTNB	221830	hgsc.bcm.edu;bcgsc.ca	37	7	19748559	19748560	+	Frame_Shift_Ins	INS	-	-	T			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr7:19748559_19748560insT	ENST00000222567.5	-	1	150_151	c.80_81insA	c.(79-81)cctfs	p.P27fs		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	27					transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						ACTCTAGGCAAGGCAGGACGCC	0.649											OREG0017879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P27fs		.											.	TWISTNB-91	0			c.81_82insA						.																																			SO:0001589	frameshift_variant	221830	exon1			TAGGCAAGGCAGG	AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.80_81insA	7.37:g.19748559_19748560insT	ENSP00000222567:p.Pro27fs	106	0	735	74	12	NM_001002926	0	0	0	0	0	A0PJ45|B7Z724	Frame_Shift_Ins	INS	ENST00000222567.5	37	CCDS34606.1																																																																																			.		0.649	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326463.1		
ZNRF3	84133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	29444479	29444480	+	Splice_Site	DNP	GG	GG	TT			TCGA-P6-A5OF-01A-11D-A29I-10	TCGA-P6-A5OF-10A-01D-A29L-10	GG	GG	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	8949a62c-41ca-4e16-94a2-348838d35055	29f21b2f-1b0d-47d0-b2c7-c423fb460fa1	g.chr22:29444479_29444480GG>TT	ENST00000544604.2	+	7	1190	c.1015_1015GG>TT	c.(1015-1017)GGga>TTgga	p.G339L	ZNRF3_ENST00000406323.3_Splice_Site_p.G239L|ZNRF3_ENST00000332811.4_Splice_Site_p.G239L|ZNRF3_ENST00000402174.1_Splice_Site_p.G239L	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	339					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						CAACATCATAGGTAACTGTCAC	0.589																																					.		.											.	ZNRF3-69	0			c.1015+1G>T						.																																			SO:0001630	splice_region_variant	84133	exon7			TCATAGGTAACTG	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	Exception_encountered	22.37:g.29444479_29444480delinsTT		217	0		112	40	NM_001206998	0	0	0	0	0	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Splice_Site	DNP	ENST00000544604.2	37	CCDS56225.1																																																																																			.		0.589	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	Missense_Mutation
