#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_Trna_alt1	i_Trna_alt2	i_Trna_ref	i_Trna_tot	i_Trna_var	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VWA5B1	127731	broad.mit.edu	37	1	20671961	20671961	+	Missense_Mutation	SNP	G	G	A	rs11582960	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr1:20671961G>A	ENST00000375079.2	+	17	2835	c.2639G>A	c.(2638-2640)cGc>cAc	p.R880H	VWA5B1_ENST00000289815.8_Missense_Mutation_p.R880H|VWA5B1_ENST00000375083.4_Missense_Mutation_p.R880H|VWA5B1_ENST00000525343.1_3'UTR	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	880				R -> H (in Ref. 3; AAI01381). {ECO:0000305}.		extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						TCCAACCGCCGCTACCAAGTG	0.557													G|||	1511	0.301717	0.2443	0.3458	5008	,	,		16591	0.3532		0.3181	False		,,,				2504	0.2781				p.R880H		.											.	.	0			c.G2639A						.	G	HIS/ARG	342,1042		37,268,387	34.0	29.0	30.0		2639	5.3	1.0	1	dbSNP_120	30	1056,2126		168,720,703	yes	missense	VWA5B1	NM_001039500.2	29	205,988,1090	AA,AG,GG		33.1867,24.711,30.6176	probably-damaging	880/1216	20671961	1398,3168	692	1591	2283	SO:0001583	missense	127731	exon17			ACCGCCGCTACCA	AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2639G>A	1.37:g.20671961G>A	ENSP00000364220:p.Arg880His	532	0		327	10	NM_001039500	0	0	0	0	0	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	ENST00000375079.2	37		693	0.3173076923076923	101	0.20528455284552846	125	0.3453038674033149	238	0.4160839160839161	229	0.3021108179419525	G	20.2	3.952435	0.73787	0.24711	0.331867	ENSG00000158816	ENST00000375089;ENST00000289815;ENST00000375083;ENST00000375079	T;T;T	0.12774	3.01;2.65;3.01	5.28	5.28	0.74379	.	0.070917	0.56097	D	0.000025	T	0.00012	0.0000	L	0.47716	1.5	0.09310	P	0.9999999999999946	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.991;0.999;0.983	T	0.48864	-0.8997	9	0.87932	D	0	-10.357	16.3895	0.83528	0.0:0.0:1.0:0.0	rs11582960;rs52789768;rs11582960	880;880;880	Q5TIE3;Q5TIE3-5;Q5TIE3-2	VW5B1_HUMAN;.;.	H	880	ENSP00000289815:R880H;ENSP00000364224:R880H;ENSP00000364220:R880H	ENSP00000289815:R880H	R	+	2	0	VWA5B1	20544548	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	5.758000	0.68776	2.470000	0.83445	0.573000	0.79308	CGC	G|0.696;A|0.304		0.557	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000007945.4	XM_001722222	
ZC3H12A	80149	broad.mit.edu	37	1	37941415	37941415	+	Silent	SNP	C	C	G			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr1:37941415C>G	ENST00000373087.6	+	2	434	c.318C>G	c.(316-318)ctC>ctG	p.L106L	RP11-422J8.1_ENST00000424989.1_RNA	NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCCCTCAGCTCCCTCTAGTCC	0.662																																					p.L106L		.											.	ZC3H12A-92	0			c.C318G						.						26.0	27.0	27.0					1																	37941415		2202	4300	6502	SO:0001819	synonymous_variant	80149	exon2			TCAGCTCCCTCTA		CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.318C>G	1.37:g.37941415C>G		130	0		72	3	NM_025079	0	0	3	3	0		Silent	SNP	ENST00000373087.6	37	CCDS417.1																																																																																			.		0.662	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012154.2	NM_025079	
STIL	6491	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47746485	47746485	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr1:47746485C>T	ENST00000360380.3	-	13	2008	c.1645G>A	c.(1645-1647)Gaa>Aaa	p.E549K	STIL_ENST00000396221.2_Missense_Mutation_p.E549K|STIL_ENST00000243182.6_Missense_Mutation_p.E549K|STIL_ENST00000337817.5_Missense_Mutation_p.E549K|STIL_ENST00000371877.3_Missense_Mutation_p.E549K	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	549					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.E549K(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				GGATACTCTTCGTTTTGTACA	0.423																																					p.E549K		.											.	STIL-659	1	Substitution - Missense(1)	large_intestine(1)	c.G1645A						.						125.0	136.0	132.0					1																	47746485		2203	4300	6503	SO:0001583	missense	6491	exon12			ACTCTTCGTTTTG	M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1645G>A	1.37:g.47746485C>T	ENSP00000353544:p.Glu549Lys	103	0		44	14	NM_003035	0	0	1	1	0	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	37	CCDS548.1	.	.	.	.	.	.	.	.	.	.	C	7.347	0.621994	0.14193	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.48201	2.17;2.17;2.17;2.16;2.17;0.82	5.1	3.21	0.36854	.	0.485105	0.22993	N	0.053171	T	0.31575	0.0801	L	0.29908	0.895	0.33186	D	0.5502	B;B;B;B;B	0.13145	0.002;0.007;0.002;0.007;0.007	B;B;B;B;B	0.06405	0.002;0.002;0.002;0.002;0.002	T	0.33828	-0.9853	10	0.13108	T	0.6	-11.92	10.5952	0.45333	0.0:0.7947:0.1329:0.0724	.	549;502;549;549;549	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	K	549;549;549;549;549;502	ENSP00000353544:E549K;ENSP00000337367:E549K;ENSP00000360944:E549K;ENSP00000379523:E549K;ENSP00000243182:E549K;ENSP00000411664:E502K	ENSP00000243182:E549K	E	-	1	0	STIL	47519072	1.000000	0.71417	0.826000	0.32828	0.098000	0.18820	2.775000	0.47702	0.538000	0.28769	-0.137000	0.14449	GAA	.		0.423	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
ODF2L	57489	ucsc.edu	37	1	86836714	86836714	+	Missense_Mutation	SNP	T	T	C			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr1:86836714T>C	ENST00000359242.3	-	10	1324	c.1043A>G	c.(1042-1044)aAt>aGt	p.N348S	ODF2L_ENST00000370566.3_Missense_Mutation_p.N348S|ODF2L_ENST00000317336.7_Missense_Mutation_p.N348S|ODF2L_ENST00000294678.2_Missense_Mutation_p.N348S|ODF2L_ENST00000394731.1_Missense_Mutation_p.N217S|ODF2L_ENST00000370567.1_Missense_Mutation_p.N348S|ODF2L_ENST00000524695.1_5'UTR	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	348						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		TAATTTTGTATTCTCAAGATT	0.308																																					p.N348S		.											.	ODF2L-69	0			c.A1043G						.						90.0	96.0	94.0					1																	86836714		2201	4295	6496	SO:0001583	missense	57489	exon10			TTTGTATTCTCAA		CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.1043A>G	1.37:g.86836714T>C	ENSP00000359600:p.Asn348Ser	64	0		38	4	NM_001007022	0	0	0	0	0	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	ENST00000359242.3	37	CCDS41354.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.6|20.6	4.018224|4.018224	0.75275|0.75275	.|.	.|.	ENSG00000122417|ENSG00000122417	ENST00000459999|ENST00000441121;ENST00000370566;ENST00000359242;ENST00000460698;ENST00000317336;ENST00000370567;ENST00000394731;ENST00000294678;ENST00000479890	.|T;T;T;T;T;T;T;T	.|0.76968	.|1.3;1.09;-1.06;1.16;1.47;1.54;-1.06;0.97	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.088332	.|0.85682	.|D	.|0.000000	T|T	0.80019|0.80019	0.4547|0.4547	M|M	0.68952|0.68952	2.095|2.095	0.43787|0.43787	D|D	0.99632|0.99632	.|D;D;D;D;D;D	.|0.89917	.|0.999;0.998;1.0;1.0;0.998;1.0	.|D;D;D;D;D;D	.|0.91635	.|0.996;0.994;0.999;0.998;0.994;0.998	T|T	0.78048|0.78048	-0.2356|-0.2356	5|10	.|0.10377	.|T	.|0.69	-20.8247|-20.8247	14.0682|14.0682	0.64844|0.64844	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|348;348;348;348;348;348	.|B4E037;B4DZ83;Q9ULJ1-2;Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1	.|.;.;.;.;.;ODF2L_HUMAN	V|S	197|348;348;348;224;348;348;217;348;178	.|ENSP00000359597:N348S;ENSP00000359600:N348S;ENSP00000433092:N224S;ENSP00000320165:N348S;ENSP00000359598:N348S;ENSP00000378219:N217S;ENSP00000294678:N348S;ENSP00000432834:N178S	.|ENSP00000294678:N348S	I|N	-|-	1|2	0|0	ODF2L|ODF2L	86609302|86609302	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	5.031000|5.031000	0.64134|0.64134	2.254000|2.254000	0.74563|0.74563	0.528000|0.528000	0.53228|0.53228	ATA|AAT	.		0.308	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
PLEKHO1	51177	ucsc.edu	37	1	150131221	150131221	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr1:150131221G>A	ENST00000369124.4	+	6	1011	c.733G>A	c.(733-735)Gaa>Aaa	p.E245K	PLEKHO1_ENST00000025469.6_Missense_Mutation_p.E211K|PLEKHO1_ENST00000479194.1_3'UTR|PLEKHO1_ENST00000369126.1_Missense_Mutation_p.E62K	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	245	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCGACCTTGGGAAAAAACAGA	0.637																																					p.E245K		.											.	PLEKHO1-226	0			c.G733A						.						36.0	43.0	41.0					1																	150131221		2203	4300	6503	SO:0001583	missense	51177	exon6			CCTTGGGAAAAAA	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.733G>A	1.37:g.150131221G>A	ENSP00000358120:p.Glu245Lys	202	0		104	2	NM_016274	0	0	18	24	6	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	37	CCDS945.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182749	0.78677	.	.	ENSG00000023902	ENST00000369126;ENST00000025469;ENST00000369124;ENST00000441340	T;T	0.49139	0.79;0.82	4.97	4.05	0.47172	.	0.359070	0.31963	N	0.006788	T	0.23410	0.0566	L	0.50333	1.59	0.38303	D	0.943042	B	0.32245	0.361	B	0.21708	0.036	T	0.06625	-1.0816	10	0.27785	T	0.31	-10.5391	14.501	0.67722	0.0:0.1477:0.8523:0.0	.	245	Q53GL0	PKHO1_HUMAN	K	62;211;245;125	ENSP00000025469:E211K;ENSP00000358120:E245K	ENSP00000025469:E211K	E	+	1	0	PLEKHO1	148397845	1.000000	0.71417	0.984000	0.44739	0.804000	0.45430	2.060000	0.41394	1.287000	0.44583	0.655000	0.94253	GAA	.		0.637	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
LMNA	4000	bcgsc.ca	37	1	156105772	156105772	+	Silent	SNP	G	G	A	rs17847242	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr1:156105772G>A	ENST00000368300.4	+	6	1229	c.1017G>A	c.(1015-1017)gcG>gcA	p.A339A	LMNA_ENST00000448611.2_Silent_p.A227A|LMNA_ENST00000347559.2_Silent_p.A339A|LMNA_ENST00000361308.4_Silent_p.A339A|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000368299.3_Silent_p.A339A|LMNA_ENST00000473598.2_Silent_p.A240A|LMNA_ENST00000392353.3_Silent_p.A258A|LMNA_ENST00000368297.1_Silent_p.A258A|LMNA_ENST00000368301.2_Silent_p.A339A	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	339	Coil 2.|Rod.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					GGCTGCTGGCGGAAAAGGAGC	0.652									Werner syndrome;Hutchinson-Gilford Progeria Syndrome				G|||	5	0.000998403	0.0	0.0	5008	,	,		17844	0.004		0.0	False		,,,				2504	0.001				p.A339A		.											.	LMNA-228	0			c.G1017A						.						33.0	40.0	38.0					1																	156105772		2203	4300	6503	SO:0001819	synonymous_variant	4000	exon6	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	GCTGGCGGAAAAG	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.1017G>A	1.37:g.156105772G>A		177	1		88	4	NM_005572	0	0	195	195	0	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	37	CCDS1129.1																																																																																			G|0.999;A|0.001		0.652	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
MROH9	80133	bcgsc.ca	37	1	170928671	170928671	+	Missense_Mutation	SNP	T	T	C	rs2294740	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr1:170928671T>C	ENST00000367758.3	+	5	320	c.221T>C	c.(220-222)gTt>gCt	p.V74A	MROH9_ENST00000367759.4_Missense_Mutation_p.V74A	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	74			V -> A (in dbSNP:rs2294740).														GGAATGCTAGTTGTCATGCCA	0.358													T|||	1253	0.2502	0.0772	0.2176	5008	,	,		16820	0.4554		0.1312	False		,,,				2504	0.4182				p.V74A		.											.	.	0			c.T221C						.	T	ALA/VAL,ALA/VAL	376,3338		14,348,1495	122.0	114.0	116.0		221,221	3.2	0.0	1	dbSNP_100	116	1340,6888		108,1124,2882	yes	missense,missense	C1orf129	NM_001163629.1,NM_025063.2	64,64	122,1472,4377	CC,CT,TT		16.2859,10.1239,14.3695	possibly-damaging,possibly-damaging	74/862,74/574	170928671	1716,10226	1857	4114	5971	SO:0001583	missense	80133	exon5			TGCTAGTTGTCAT	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.221T>C	1.37:g.170928671T>C	ENSP00000356732:p.Val74Ala	58	0		60	4	NM_025063	0	0	0	0	0	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	37	CCDS41436.1	471	0.21565934065934067	23	0.046747967479674794	69	0.19060773480662985	279	0.48776223776223776	100	0.13192612137203166	T	11.48	1.651528	0.29336	0.101239	0.162859	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.14893	4.08;2.47	5.61	3.24	0.37175	.	0.745582	0.12304	N	0.480857	T	0.04770	0.0129	N	0.22421	0.69	0.80722	P	0.0	P;P	0.38370	0.628;0.628	B;B	0.40066	0.318;0.236	T	0.31916	-0.9926	9	0.59425	D	0.04	-2.4411	5.6673	0.17702	0.0:0.0872:0.1718:0.741	rs2294740;rs52803659;rs2294740	74;74	F5GWX6;Q5TGP6	.;CA129_HUMAN	A	74	ENSP00000356733:V74A;ENSP00000356732:V74A	ENSP00000356732:V74A	V	+	2	0	C1orf129	169195295	0.010000	0.17322	0.001000	0.08648	0.075000	0.17131	1.328000	0.33758	0.469000	0.27268	0.533000	0.62120	GTT	T|0.784;C|0.216		0.358	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063	
LGR6	59352	bcgsc.ca	37	1	202287754	202287754	+	Missense_Mutation	SNP	G	G	A	rs75658797	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr1:202287754G>A	ENST00000367278.3	+	18	2412	c.2323G>A	c.(2323-2325)Gtg>Atg	p.V775M	LGR6_ENST00000255432.7_Missense_Mutation_p.V723M|LGR6_ENST00000439764.2_Missense_Mutation_p.V636M	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	775					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						GGTGAGGCACGTGGCCTGGCT	0.637													G|||	411	0.0820687	0.059	0.1037	5008	,	,		17778	0.0526		0.1113	False		,,,				2504	0.0982				p.V775M		.											.	LGR6-160	0			c.G2323A						.	G	MET/VAL,MET/VAL,MET/VAL	235,4171	138.4+/-174.2	8,219,1976	100.0	79.0	86.0		2323,1906,2167	2.6	1.0	1	dbSNP_131	86	1129,7471	234.6+/-267.5	79,971,3250	yes	missense,missense,missense	LGR6	NM_001017403.1,NM_001017404.1,NM_021636.2	21,21,21	87,1190,5226	AA,AG,GG		13.1279,5.3336,10.4875	benign,benign,benign	775/968,636/829,723/916	202287754	1364,11642	2203	4300	6503	SO:0001583	missense	59352	exon18			AGGCACGTGGCCT	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.2323G>A	1.37:g.202287754G>A	ENSP00000356247:p.Val775Met	145	0		95	5	NM_001017403	0	0	0	0	0	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	37	CCDS30971.1	190	0.08699633699633699	38	0.07723577235772358	42	0.11602209944751381	32	0.055944055944055944	78	0.10290237467018469	G	13.00	2.107063	0.37145	0.053336	0.131279	ENSG00000133067	ENST00000367278;ENST00000255432;ENST00000439764	T;T;T	0.40225	1.04;1.04;1.04	4.49	2.58	0.30949	.	0.137493	0.48767	N	0.000170	T	0.00271	0.0008	N	0.20530	0.585	0.25761	P	0.9849419	D;P;P	0.54047	0.964;0.941;0.793	B;P;B	0.45881	0.244;0.496;0.409	T	0.06481	-1.0824	9	0.11794	T	0.64	.	6.5745	0.22557	0.1589:0.1488:0.6924:0.0	.	636;723;775	Q9HBX8-1;Q9HBX8-2;Q9HBX8	.;.;LGR6_HUMAN	M	775;723;636	ENSP00000356247:V775M;ENSP00000255432:V723M;ENSP00000387869:V636M	ENSP00000255432:V723M	V	+	1	0	LGR6	200554377	1.000000	0.71417	0.986000	0.45419	0.985000	0.73830	3.339000	0.52135	0.626000	0.30322	0.485000	0.47835	GTG	G|0.899;A|0.101		0.637	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
SVIL	6840	bcgsc.ca	37	10	29839864	29839864	+	Silent	SNP	A	A	C	rs1270874	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr10:29839864A>C	ENST00000355867.4	-	6	1241	c.489T>G	c.(487-489)gcT>gcG	p.A163A	SVIL_ENST00000375400.3_Silent_p.A163A|SVIL_ENST00000375398.2_Silent_p.A163A	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	163	Interaction with MYLK. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				ACAGAGAACTAGCATCTCTGC	0.567													C|||	3645	0.727835	0.6324	0.7075	5008	,	,		19018	0.8224		0.7286	False		,,,				2504	0.773				p.A163A		.											.	SVIL-96	0			c.T489G						.	C	,	2923,1483	476.4+/-357.6	965,993,245	79.0	79.0	79.0		489,489	-7.9	0.0	10	dbSNP_87	79	6230,2370	395.7+/-345.2	2262,1706,332	no	coding-synonymous,coding-synonymous	SVIL	NM_003174.3,NM_021738.2	,	3227,2699,577	CC,CA,AA		27.5581,33.6586,29.6248	,	163/1789,163/2215	29839864	9153,3853	2203	4300	6503	SO:0001819	synonymous_variant	6840	exon8			AGAACTAGCATCT	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.489T>G	10.37:g.29839864A>C		205	2		121	6	NM_003174	0	0	0	0	0	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	37	CCDS7164.1																																																																																			A|0.289;C|0.711		0.567	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
MAT1A	4143	ucsc.edu;bcgsc.ca	37	10	82034842	82034842	+	Silent	SNP	A	A	G	rs10887711	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr10:82034842A>G	ENST00000372213.3	-	7	1142	c.882T>C	c.(880-882)gcT>gcC	p.A294A	MAT1A_ENST00000485270.1_5'UTR	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	294					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CAGCATATGCAGCTGAGCGGT	0.607													G|||	4209	0.840455	0.9266	0.7781	5008	,	,		16178	0.9712		0.6412	False		,,,				2504	0.8384				p.A294A		.											.	MAT1A-90	0			c.T882C						.	G		3831,573		1675,481,46	33.0	34.0	34.0		882	-10.0	0.0	10	dbSNP_120	34	5359,3235		1696,1967,634	no	coding-synonymous	MAT1A	NM_000429.2		3371,2448,680	GG,GA,AA		37.6425,13.0109,29.2968		294/396	82034842	9190,3808	2202	4297	6499	SO:0001819	synonymous_variant	4143	exon7			ATATGCAGCTGAG		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.882T>C	10.37:g.82034842A>G		79	0		40	5	NM_000429	0	0	5	5	0	D3DWD5|Q5QP09	Silent	SNP	ENST00000372213.3	37	CCDS7365.1																																																																																			A|0.230;G|0.770		0.607	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
MAT1A	4143	ucsc.edu;bcgsc.ca	37	10	82034854	82034854	+	Silent	SNP	T	T	C	rs10788546	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr10:82034854T>C	ENST00000372213.3	-	7	1130	c.870A>G	c.(868-870)gtA>gtG	p.V290V	MAT1A_ENST00000485270.1_5'UTR	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	290					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CTGAGCGGTCTACCTTGGTGT	0.617													C|||	4211	0.840855	0.9266	0.7781	5008	,	,		15774	0.9712		0.6412	False		,,,				2504	0.8405				p.V290V		.											.	MAT1A-90	0			c.A870G						.	C		3841,561		1681,479,41	39.0	39.0	39.0		870	4.1	1.0	10	dbSNP_120	39	5379,3217		1700,1979,619	no	coding-synonymous	MAT1A	NM_000429.2		3381,2458,660	CC,CT,TT		37.4244,12.7442,29.066		290/396	82034854	9220,3778	2201	4298	6499	SO:0001819	synonymous_variant	4143	exon7			GCGGTCTACCTTG		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.870A>G	10.37:g.82034854T>C		77	0		43	5	NM_000429	0	0	2	2	0	D3DWD5|Q5QP09	Silent	SNP	ENST00000372213.3	37	CCDS7365.1																																																																																			T|0.236;C|0.764		0.617	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
LRIT1	26103	broad.mit.edu;bcgsc.ca	37	10	85992141	85992141	+	Silent	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr10:85992141G>T	ENST00000372105.3	-	4	1435	c.1414C>A	c.(1414-1416)Cgg>Agg	p.R472R		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	472	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						ATCACCCGCCGCATGCTGTGC	0.592																																					p.R472R		.											.	LRIT1-90	0			c.C1414A						.						64.0	51.0	55.0					10																	85992141		2203	4300	6503	SO:0001819	synonymous_variant	26103	exon4			CCCGCCGCATGCT	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.1414C>A	10.37:g.85992141G>T		210	0		129	6	NM_015613	0	0	0	0	0	Q0QD41|Q9Y4N7	Silent	SNP	ENST00000372105.3	37	CCDS7373.1																																																																																			.		0.592	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
C10orf95	79946	hgsc.bcm.edu	37	10	104210735	104210735	+	Missense_Mutation	SNP	C	C	A	rs2281878	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr10:104210735C>A	ENST00000239125.1	-	2	327	c.253G>T	c.(253-255)Gct>Tct	p.A85S	RP11-18I14.10_ENST00000492465.2_RNA|RP11-18I14.10_ENST00000494270.2_RNA|RP11-18I14.10_ENST00000596366.1_RNA|RP11-18I14.10_ENST00000596045.1_RNA|RP11-18I14.10_ENST00000473970.2_RNA|RP11-18I14.10_ENST00000594818.1_RNA	NM_024886.1	NP_079162.1	Q9H7T3	CJ095_HUMAN	chromosome 10 open reading frame 95	85	Arg/Pro-rich.									liver(1)	1		Colorectal(252;0.207)		Epithelial(162;8.34e-09)|all cancers(201;1.95e-07)|BRCA - Breast invasive adenocarcinoma(275;0.213)		GCTGCGGAAGCTGTGGGCCTG	0.766													C|||	1422	0.283946	0.2481	0.2147	5008	,	,		8527	0.3661		0.2107	False		,,,				2504	0.3722				p.A85S		.											.	C10orf95-91	0			c.G253T						.	C	SER/ALA	686,2688		69,548,1070	4.0	6.0	5.0		253	0.9	1.0	10	dbSNP_100	5	1301,5815		124,1053,2381	yes	missense	C10orf95	NM_024886.1	99	193,1601,3451	AA,AC,CC		18.2827,20.332,18.9418	possibly-damaging	85/258	104210735	1987,8503	1687	3558	5245	SO:0001583	missense	79946	exon2			CGGAAGCTGTGGG	AK024342	CCDS7534.1	10q24.32	2014-02-19	2014-02-19	2014-02-19	ENSG00000120055	ENSG00000120055			25880	protein-coding gene	gene with protein product							Standard	NM_024886		Approved	FLJ14280	uc001kvo.1	Q9H7T3	OTTHUMG00000018959	ENST00000239125.1:c.253G>T	10.37:g.104210735C>A	ENSP00000239125:p.Ala85Ser	2	0		5	5	NM_024886	0	0	0	0	0	A0AVQ7	Missense_Mutation	SNP	ENST00000239125.1	37	CCDS7534.1	525	0.2403846153846154	101	0.20528455284552846	71	0.19613259668508287	200	0.34965034965034963	153	0.20184696569920843	C	12.47	1.948662	0.34377	0.20332	0.182827	ENSG00000120055	ENST00000239125	.	.	.	4.68	0.951	0.19579	.	0.773948	0.10608	N	0.654824	T	0.00012	0.0000	N	0.08118	0	0.53688	P	2.5000000000052758E-5	B	0.33807	0.426	B	0.32090	0.14	T	0.45891	-0.9230	8	0.33940	T	0.23	-38.6243	6.6233	0.22816	0.0:0.3488:0.0:0.6512	rs2281878	85	Q9H7T3	CJ095_HUMAN	S	85	.	ENSP00000239125:A85S	A	-	1	0	C10orf95	104200725	0.997000	0.39634	0.987000	0.45799	0.038000	0.13279	0.038000	0.13862	0.047000	0.15862	-0.350000	0.07774	GCT	C|0.759;A|0.241		0.766	C10orf95-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050065.1	NM_024886	
ADD3	120	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	111879036	111879036	+	Missense_Mutation	SNP	A	A	G			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr10:111879036A>G	ENST00000356080.4	+	7	1152	c.785A>G	c.(784-786)tAt>tGt	p.Y262C	ADD3_ENST00000277900.8_Missense_Mutation_p.Y262C|ADD3_ENST00000360162.3_Missense_Mutation_p.Y262C	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	262						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		GATGTTGCCTATTATGACTAC	0.428																																					p.Y262C		.											.	ADD3-157	0			c.A785G						.						86.0	82.0	84.0					10																	111879036		2203	4300	6503	SO:0001583	missense	120	exon7			TTGCCTATTATGA	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.785A>G	10.37:g.111879036A>G	ENSP00000348381:p.Tyr262Cys	157	0		93	34	NM_001121	0	0	1	2	1	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	37	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.028056	0.54790	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.22743	1.94;1.94;1.94	6.17	6.17	0.99709	Class II aldolase/adducin, N-terminal (3);	0.051757	0.85682	D	0.000000	T	0.42494	0.1205	M	0.91510	3.215	0.58432	D	0.999999	B;B	0.31241	0.235;0.315	B;B	0.37888	0.26;0.233	T	0.46843	-0.9162	10	0.66056	D	0.02	-14.6662	16.8222	0.85835	1.0:0.0:0.0:0.0	.	262;262	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	C	262	ENSP00000353286:Y262C;ENSP00000348381:Y262C;ENSP00000277900:Y262C	ENSP00000277900:Y262C	Y	+	2	0	ADD3	111869026	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.363000	0.59473	2.371000	0.80710	0.533000	0.62120	TAT	.		0.428	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	
MUC2	4583	hgsc.bcm.edu	37	11	1092602	1092619	+	In_Frame_Del	DEL	CCACCACTCCCAGCCCTC	CCACCACTCCCAGCCCTC	-	rs201595190|rs201608750|rs547682241	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	CCACCACTCCCAGCCCTC	CCACCACTCCCAGCCCTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr11:1092602_1092619delCCACCACTCCCAGCCCTC	ENST00000441003.2	+	30	4448_4465	c.4421_4438delCCACCACTCCCAGCCCTC	c.(4420-4440)accaccactcccagccctcca>aca	p.TTPSPP1475del	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_In_Frame_Del_p.TTPSPP1476del|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4210	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	agccctccaaccaccactcccagccctccaaccaccac	0.628																																					p.1474_1480del		.											.	MUC2-90	0			c.4421_4438del						.			764,1992		44,676,658						-2.6	0.0		dbSNP_134	244	1546,3660		46,1454,1103	no	coding	MUC2	NM_002457.2		90,2130,1761	A1A1,A1R,RR		29.6965,27.7213,29.0128				2310,5652				SO:0001651	inframe_deletion	4583	exon30			CTCCAACCACCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4421_4438delCCACCACTCCCAGCCCTC	11.37:g.1092602_1092619delCCACCACTCCCAGCCCTC	ENSP00000415183:p.Thr1475_Pro1480del	258	0		163	25	NM_002457	0	0	0	0	0	Q14878	In_Frame_Del	DEL	ENST00000441003.2	37																																																																																				.		0.628	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MUC5B	727897	bcgsc.ca	37	11	1250488	1250488	+	Silent	SNP	C	C	T	rs2075859	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr11:1250488C>T	ENST00000529681.1	+	9	1123	c.1065C>T	c.(1063-1065)tgC>tgT	p.C355C	MUC5B_ENST00000531082.1_3'UTR|MUC5B_ENST00000447027.1_Silent_p.C355C	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	355	TIL 1.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGCAGCTCTGCGAGGACCACT	0.682													c|||	1967	0.392772	0.2814	0.4366	5008	,	,		14317	0.6052		0.34	False		,,,				2504	0.3476				p.C355C		.											.	.	0			c.C1065T						.	C		1063,3051		143,777,1137	22.0	28.0	26.0		1065	-0.9	0.8	11	dbSNP_96	26	2915,5479		531,1853,1813	no	coding-synonymous	MUC5B	NM_002458.2		674,2630,2950	TT,TC,CC		34.7272,25.8386,31.8036		355/5763	1250488	3978,8530	2057	4197	6254	SO:0001819	synonymous_variant	727897	exon9			GCTCTGCGAGGAC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.1065C>T	11.37:g.1250488C>T		155	0		88	5	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	37	CCDS44515.2																																																																																			C|0.605;T|0.395		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
MUC5B	727897	bcgsc.ca	37	11	1271429	1271429	+	Missense_Mutation	SNP	C	C	T	rs2943516	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr11:1271429C>T	ENST00000529681.1	+	31	13377	c.13319C>T	c.(13318-13320)cCg>cTg	p.P4440L	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.P4443L	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4440	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		P -> L (in dbSNP:rs2943516). {ECO:0000269|PubMed:9013550}.		cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACGGCCACCCCGTCCTCCACC	0.682													-|||	2339	0.467053	0.3222	0.5476	5008	,	,		18729	0.6518		0.4423	False		,,,				2504	0.4407				p.P4440L		.											.	.	0			c.C13319T						.	C	LEU/PRO	1253,2885		195,863,1011	105.0	124.0	118.0		13319	-0.1	0.0	11	dbSNP_101	118	3605,4779		799,2007,1386	no	missense	MUC5B	NM_002458.2	98	994,2870,2397	TT,TC,CC		42.9986,30.2803,38.7957	benign	4440/5763	1271429	4858,7664	2069	4192	6261	SO:0001583	missense	727897	exon31			CCACCCCGTCCTC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13319C>T	11.37:g.1271429C>T	ENSP00000436812:p.Pro4440Leu	980	9		563	15	NM_002458	0	0	0	0	0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	1045	0.4784798534798535	151	0.30691056910569103	181	0.5	386	0.6748251748251748	327	0.4313984168865435	-	5.129	0.209405	0.09757	0.302803	0.429986	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000535652	T;T	0.17854	2.25;2.44	2.45	-0.0467	0.13846	.	.	.	.	.	T	0.00012	0.0000	L	0.34521	1.04	0.80722	P	0.0	B;B	0.31931	0.347;0.347	B;B	0.13407	0.005;0.009	T	0.29336	-1.0015	8	0.87932	D	0	.	4.2572	0.10722	0.0:0.5967:0.2354:0.1679	rs2943516	4913;4443	A7Y9J9;E9PBJ0	.;.	L	4440;4443;4384;4290;219	ENSP00000436812:P4440L;ENSP00000415793:P4443L	ENSP00000343037:P4384L	P	+	2	0	MUC5B	1228005	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.119000	0.15626	0.155000	0.19261	0.298000	0.19748	CCG	C|0.522;T|0.479		0.682	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
CAPRIN1	4076	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	34104425	34104425	+	Splice_Site	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr11:34104425G>T	ENST00000341394.4	+	8	1068		c.e8+1		CAPRIN1_ENST00000389645.3_Splice_Site|CAPRIN1_ENST00000532820.1_Splice_Site|CAPRIN1_ENST00000529307.1_Splice_Site|CAPRIN1_ENST00000530820.1_Splice_Site	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1						negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				ATCAACAGAGGTATGATTTTA	0.358																																					.		.											.	CAPRIN1-91	0			c.879+1G>T						.						114.0	114.0	114.0					11																	34104425		2202	4298	6500	SO:0001630	splice_region_variant	4076	exon8			ACAGAGGTATGAT	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.879+1G>T	11.37:g.34104425G>T		151	0		51	21	NM_203364	0	0	0	1	1	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Splice_Site	SNP	ENST00000341394.4	37	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731380	0.89390	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6574	0.95849	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CAPRIN1	34061001	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.164000	0.94755	2.667000	0.90743	0.561000	0.74099	.	.		0.358	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	Intron
OR4C3	256144	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	11	48347234	48347234	+	Missense_Mutation	SNP	T	T	C	rs539868535	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr11:48347234T>C	ENST00000319856.4	+	1	763	c.742T>C	c.(742-744)Tac>Cac	p.Y248H		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						TGTCATCCTGTACTCCTTGAG	0.498													T|||	2	0.000399361	0.0	0.0	5008	,	,		21283	0.0		0.0	False		,,,				2504	0.002				p.Y248H		.											.	OR4C3-69	0			c.T742C						.						265.0	189.0	215.0					11																	48347234		2201	4298	6499	SO:0001583	missense	256144	exon1			ATCCTGTACTCCT	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.742T>C	11.37:g.48347234T>C	ENSP00000321419:p.Tyr248His	357	0		222	13	NM_001004702	0	0	0	0	0	B2RNF2|Q6IFB3	Missense_Mutation	SNP	ENST00000319856.4	37	CCDS31489.1	.	.	.	.	.	.	.	.	.	.	T	0.020	-1.445232	0.01089	.	.	ENSG00000176547	ENST00000319856;ENST00000395239	T	0.37584	1.19	5.87	0.636	0.17729	GPCR, rhodopsin-like superfamily (1);	1.422780	0.04244	N	0.337508	T	0.15609	0.0376	N	0.04880	-0.145	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.16217	-1.0410	10	0.09590	T	0.72	.	2.7646	0.05316	0.1267:0.5318:0.1229:0.2186	.	221	Q8NH37	OR4C3_HUMAN	H	248;111	ENSP00000321419:Y248H	ENSP00000321419:Y248H	Y	+	1	0	OR4C3	48303810	0.000000	0.05858	0.446000	0.26920	0.130000	0.20726	-5.923000	0.00090	-0.109000	0.12044	-1.364000	0.01208	TAC	.		0.498	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390557.1	NM_001004702	
PDE3A	5139	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	20766633	20766633	+	Splice_Site	SNP	A	A	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr12:20766633A>T	ENST00000359062.3	+	3	1308	c.1268A>T	c.(1267-1269)aAg>aTg	p.K423M	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	423					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	GCTATTCCAAAGGTAGGTAGT	0.408																																					p.K423M		.											.	PDE3A-94	0			c.A1268T						.						56.0	57.0	56.0					12																	20766633		2203	4300	6503	SO:0001630	splice_region_variant	5139	exon3			TTCCAAAGGTAGG		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.1269+1A>T	12.37:g.20766633A>T		88	0		70	33	NM_000921	0	0	0	0	0	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	ENST00000359062.3	37	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	A	15.26	2.779572	0.49891	.	.	ENSG00000172572	ENST00000359062	T	0.53857	0.6	5.56	4.41	0.53225	.	2.520710	0.00669	N	0.000627	T	0.73071	0.3540	M	0.71206	2.165	0.54753	D	0.999989	D	0.65815	0.995	P	0.61397	0.888	T	0.48927	-0.8991	10	0.87932	D	0	.	11.5171	0.50529	0.9297:0.0:0.0703:0.0	.	423	Q14432	PDE3A_HUMAN	M	423	ENSP00000351957:K423M	ENSP00000351957:K423M	K	+	2	0	PDE3A	20657900	1.000000	0.71417	1.000000	0.80357	0.223000	0.24884	6.588000	0.74076	1.040000	0.40099	0.533000	0.62120	AAG	.		0.408	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		Missense_Mutation
ASB8	140461	hgsc.bcm.edu;bcgsc.ca	37	12	48543591	48543603	+	Frame_Shift_Del	DEL	GCCCCGCTCTCTA	GCCCCGCTCTCTA	-			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	GCCCCGCTCTCTA	GCCCCGCTCTCTA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr12:48543591_48543603delGCCCCGCTCTCTA	ENST00000317697.3	-	4	582_594	c.413_425delTAGAGAGCGGGGC	c.(412-426)ctagagagcggggccfs	p.LESGA138fs	ASB8_ENST00000536549.1_Frame_Shift_Del_p.LESGA138fs|ASB8_ENST00000539528.1_3'UTR|ASB8_ENST00000536953.1_3'UTR|ASB8_ENST00000535055.1_3'UTR|ASB8_ENST00000537754.1_5'UTR	NM_024095.3	NP_077000.1	Q9H765	ASB8_HUMAN	ankyrin repeat and SOCS box containing 8	138					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|kidney(2)|large_intestine(2)|lung(5)|soft_tissue(1)	11						ATTGACAGAGGCCCCGCTCTCTAGGAGAGCCCG	0.521																																					p.138_142del		.											.	ASB8-226	0			c.413_425del						.																																			SO:0001589	frameshift_variant	140461	exon4			ACAGAGGCCCCGC	AK024908	CCDS8761.1	12q13.12	2013-01-10	2011-01-25			ENSG00000177981		"""Ankyrin repeat domain containing"""	17183	protein-coding gene	gene with protein product		615053	"""ankyrin repeat and SOCS box-containing 8"""			12076535	Standard	NM_024095		Approved	MGC5540, FLJ21255	uc001rrh.3	Q9H765		ENST00000317697.3:c.413_425delTAGAGAGCGGGGC	12.37:g.48543591_48543603delGCCCCGCTCTCTA	ENSP00000320893:p.Leu138fs	128	1		111	41	NM_024095	0	0	0	0	0	A8K1P2|Q547Q2	Frame_Shift_Del	DEL	ENST00000317697.3	37	CCDS8761.1																																																																																			.		0.521	ASB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396497.1		
KRT1	3848	hgsc.bcm.edu	37	12	53069243	53069243	+	Missense_Mutation	SNP	T	T	C	rs77846840|rs540699806|rs267607656	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr12:53069243T>C	ENST00000252244.3	-	9	1727	c.1669A>G	c.(1669-1671)Agc>Ggc	p.S557G		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	557	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.S557_G563delSSYGSGG(3)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						ccgtagctgctacctccggag	0.682																																					p.S557G		.											.	KRT1-92	3	Deletion - In frame(3)	prostate(2)|central_nervous_system(1)	c.A1669G						.						4.0	4.0	4.0					12																	53069243		1805	3566	5371	SO:0001583	missense	3848	exon9			AGCTGCTACCTCC	X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1669A>G	12.37:g.53069243T>C	ENSP00000252244:p.Ser557Gly	36	0		45	11	NM_006121	0	0	0	0	0	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	ENST00000252244.3	37	CCDS8836.1	.	.	.	.	.	.	.	.	.	.	t	12.77	2.037794	0.35989	.	.	ENSG00000167768	ENST00000252244	T	0.81247	-1.47	3.63	0.628	0.17681	.	.	.	.	.	T	0.54711	0.1875	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.48490	-0.9031	8	0.07644	T	0.81	.	5.639	0.17552	0.0:0.6406:0.1602:0.1993	.	557	P04264	K2C1_HUMAN	G	557	ENSP00000252244:S557G	ENSP00000252244:S557G	S	-	1	0	KRT1	51355510	0.000000	0.05858	0.034000	0.17996	0.201000	0.24016	-0.192000	0.09587	-0.104000	0.12154	-1.598000	0.00824	AGC	T|0.500;C|0.500		0.682	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405706.1	NM_006121	
NUAK1	9891	bcgsc.ca	37	12	106460938	106460938	+	Missense_Mutation	SNP	G	G	C	rs3741883	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr12:106460938G>C	ENST00000261402.2	-	7	3007	c.1628C>G	c.(1627-1629)cCt>cGt	p.P543R		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	543			P -> R (in dbSNP:rs3741883). {ECO:0000269|PubMed:17344846}.		cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)	p.P543R(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						GGGCATTTCAGGGCTGACCAG	0.622													G|||	1109	0.221446	0.0408	0.2133	5008	,	,		15631	0.4177		0.2207	False		,,,				2504	0.2699				p.P543R		.											.	NUAK1-359	2	Substitution - Missense(2)	stomach(2)	c.C1628G						.	G	ARG/PRO	306,4100	162.2+/-194.2	11,284,1908	60.0	67.0	65.0		1628	5.5	1.0	12	dbSNP_107	65	1961,6639	342.1+/-324.3	237,1487,2576	yes	missense	NUAK1	NM_014840.2	103	248,1771,4484	CC,CG,GG		22.8023,6.9451,17.4304	possibly-damaging	543/662	106460938	2267,10739	2203	4300	6503	SO:0001583	missense	9891	exon7			ATTTCAGGGCTGA	AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.1628C>G	12.37:g.106460938G>C	ENSP00000261402:p.Pro543Arg	190	2		203	7	NM_014840	0	0	4	4	0	A7MD39|Q96KA8	Missense_Mutation	SNP	ENST00000261402.2	37	CCDS31892.1	504	0.23076923076923078	21	0.042682926829268296	76	0.20994475138121546	243	0.42482517482517484	164	0.21635883905013192	G	9.640	1.138832	0.21123	0.069451	0.228023	ENSG00000074590	ENST00000261402	T	0.73575	-0.76	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000012	T	0.00012	0.0000	N	0.08118	0	0.26688	P	0.9714141	P	0.49961	0.93	B	0.42319	0.383	T	0.30937	-0.9961	9	0.27082	T	0.32	.	12.7544	0.57325	0.0749:0.0:0.9251:0.0	rs3741883;rs3741883	543	O60285	NUAK1_HUMAN	R	543	ENSP00000261402:P543R	ENSP00000261402:P543R	P	-	2	0	NUAK1	104985068	1.000000	0.71417	0.994000	0.49952	0.204000	0.24138	3.525000	0.53502	2.596000	0.87737	0.462000	0.41574	CCT	G|0.795;C|0.205		0.622	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405767.2	NM_014840	
SUDS3	64426	hgsc.bcm.edu;bcgsc.ca	37	12	118852225	118852225	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr12:118852225G>T	ENST00000543473.1	+	12	1286	c.974G>T	c.(973-975)cGc>cTc	p.R325L	SUDS3_ENST00000397564.2_Missense_Mutation_p.R326L	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)	325					apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATCCGCCGGCGCTCAGCTGCT	0.488																																					p.R325L		.											.	SUDS3-90	0			c.G974T						.						27.0	26.0	26.0					12																	118852225		1873	4101	5974	SO:0001583	missense	64426	exon12			GCCGGCGCTCAGC	AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.974G>T	12.37:g.118852225G>T	ENSP00000443988:p.Arg325Leu	52	0		53	4	NM_022491	0	0	23	23	0	Q4KMQ5|Q8N6H0|Q9H8D2	Missense_Mutation	SNP	ENST00000543473.1	37	CCDS44993.1	.	.	.	.	.	.	.	.	.	.	G	33	5.265617	0.95399	.	.	ENSG00000111707	ENST00000543473;ENST00000397564	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.79015	0.4375	M	0.71036	2.16	0.80722	D	1	D	0.60160	0.987	D	0.67725	0.953	T	0.80291	-0.1444	9	0.87932	D	0	-10.1404	19.4422	0.94825	0.0:0.0:1.0:0.0	.	325	Q9H7L9	SDS3_HUMAN	L	325;326	.	ENSP00000380695:R326L	R	+	2	0	SUDS3	117336608	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	9.168000	0.94781	2.688000	0.91661	0.655000	0.94253	CGC	.		0.488	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401504.1	NM_022491	
GJB2	2706	bcgsc.ca	37	13	20763642	20763642	+	Missense_Mutation	SNP	C	C	T	rs2274084	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr13:20763642C>T	ENST00000382844.1	-	1	277	c.79G>A	c.(79-81)Gtc>Atc	p.V27I	GJB2_ENST00000382848.4_Missense_Mutation_p.V27I			P29033	CXB2_HUMAN	gap junction protein, beta 2, 26kDa	27			V -> I (in dbSNP:rs2274084). {ECO:0000269|PubMed:10607953, ECO:0000269|PubMed:12560944, ECO:0000269|PubMed:12746422, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:15666300, ECO:0000269|PubMed:19416251, ECO:0000269|PubMed:9529365}.		cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|sensory perception of sound (GO:0007605)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7		all_cancers(29;3.95e-22)|all_epithelial(30;2.36e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000435)|Epithelial(112;0.000722)|OV - Ovarian serous cystadenocarcinoma(117;0.0096)|Lung(94;0.0236)|LUSC - Lung squamous cell carcinoma(192;0.0738)		ATGAAGAGGACGGTGAGCCAG	0.552									Keratitis, Ichthyosis and Deafness syndrome		OREG0022282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	360	0.071885	0.003	0.1354	5008	,	,		21571	0.256		0.0	False		,,,				2504	0.0041				p.V27I		.											.	GJB2-90	0			c.G79A	GRCh37	CM013720	GJB2	M	rs2274084	.	C	ILE/VAL	15,4391	22.3+/-47.3	0,15,2188	146.0	120.0	129.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	79	5.2	1.0	13	dbSNP_100	129	18,8582	14.6+/-50.1	0,18,4282	yes	missense	GJB2	NM_004004.5	29	0,33,6470	TT,TC,CC		0.2093,0.3404,0.2537	probably-damaging	27/227	20763642	33,12973	2203	4300	6503	SO:0001583	missense	2706	exon2	Familial Cancer Database	KID syndrome	AGAGGACGGTGAG	M86849	CCDS9290.1	13q11-q12	2010-01-06	2007-01-16		ENSG00000165474	ENSG00000165474		"""Ion channels / Gap junction proteins (connexins)"""	4284	protein-coding gene	gene with protein product	"""connexin 26"""	121011	"""gap junction protein, beta 2, 26kD (connexin 26)"", ""gap junction protein, beta 2, 26kDa (connexin 26)"""	DFNB1, DFNA3		9139825	Standard	NM_004004		Approved	CX26, NSRD1	uc001umy.3	P29033	OTTHUMG00000016513	ENST00000382844.1:c.79G>A	13.37:g.20763642C>T	ENSP00000372295:p.Val27Ile	421	6	743	267	8	NM_004004	0	0	2	2	0	Q508A5|Q508A6|Q5YLL0|Q5YLL1|Q5YLL4|Q6IPV5|Q86U88|Q96AK0|Q9H536|Q9NNY4	Missense_Mutation	SNP	ENST00000382844.1	37	CCDS9290.1	226	0.10347985347985347	3	0.006097560975609756	29	0.08011049723756906	194	0.33916083916083917	0	0.0	C	16.83	3.231666	0.58777	0.003404	0.002093	ENSG00000165474	ENST00000382848;ENST00000382844	D;D	0.99226	-5.59;-5.59	5.21	5.21	0.72293	Connexin, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.00109	0.0003	M	0.64170	1.965	0.09310	P	0.99999999762751	D	0.89917	1.0	D	0.87578	0.998	T	0.00000	-1.7935	9	0.35671	T	0.21	.	19.1211	0.93364	0.0:1.0:0.0:0.0	rs2274084;rs2274084	27	P29033	CXB2_HUMAN	I	27	ENSP00000372299:V27I;ENSP00000372295:V27I	ENSP00000372295:V27I	V	-	1	0	GJB2	19661642	1.000000	0.71417	0.954000	0.39281	0.125000	0.20455	5.995000	0.70631	2.571000	0.86741	0.655000	0.94253	GTC	C|0.947;T|0.053		0.552	GJB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044064.1		
ERICH6B	220081	ucsc.edu	37	13	46170726	46170726	+	Missense_Mutation	SNP	A	A	G	rs28548352|rs142875900|rs375947127	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr13:46170726A>G	ENST00000298738.2	-	3	579	c.415T>C	c.(415-417)Tat>Cat	p.Y139H		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		139	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TTCCCCAGATActcttcctcc	0.488																																					p.Y139H		.											.	FAM194B-68	0			c.T415C						.						134.0	79.0	95.0					13																	46170726		692	1566	2258	SO:0001583	missense	220081	exon3			CCAGATACTCTTC																												ENST00000298738.2:c.415T>C	13.37:g.46170726A>G	ENSP00000298738:p.Tyr139His	68	0		21	9	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	A	3.562	-0.089484	0.07053	.	.	ENSG00000165837	ENST00000298738	T	0.06294	3.32	2.4	-0.599	0.11645	.	.	.	.	.	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B;B	0.27594	0.182;0.071	B;B	0.26310	0.068;0.009	T	0.43925	-0.9361	9	0.87932	D	0	0.4727	0.1132	0.00058	0.3431:0.2385:0.1823:0.236	rs28548352	139;139	A2VDI6;Q5W0A0	.;F194B_HUMAN	H	139	ENSP00000298738:Y139H	ENSP00000298738:Y139H	Y	-	1	0	FAM194B	45068727	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-6.553000	0.00061	0.160000	0.19432	0.358000	0.22013	TAT	.		0.488	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	ucsc.edu	37	13	46170735	46170735	+	Missense_Mutation	SNP	C	C	T	rs142875900|rs28460344|rs375947127	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr13:46170735C>T	ENST00000298738.2	-	3	570	c.406G>A	c.(406-408)Gag>Aag	p.E136K		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		136	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						TActcttcctcctccagatgc	0.483													C|||	1385	0.276558	0.1362	0.4308	5008	,	,		19628	0.1627		0.494	False		,,,				2504	0.2505				p.E136K		.											.	FAM194B-68	0			c.G406A						.						134.0	78.0	95.0					13																	46170735		692	1565	2257	SO:0001583	missense	220081	exon3			CTTCCTCCTCCAG																												ENST00000298738.2:c.406G>A	13.37:g.46170735C>T	ENSP00000298738:p.Glu136Lys	71	1		25	14	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	C	8.526	0.869929	0.17322	.	.	ENSG00000165837	ENST00000298738	T	0.06142	3.34	2.1	0.141	0.14811	.	.	.	.	.	T	0.02571	0.0078	N	0.02539	-0.55	0.09310	N	1	B;B	0.09022	0.0;0.002	B;B	0.06405	0.002;0.001	T	0.43015	-0.9417	9	0.87932	D	0	-1.9096	5.6342	0.17528	0.0:0.5396:0.0:0.4604	rs28460344	136;136	A2VDI6;Q5W0A0	.;F194B_HUMAN	K	136	ENSP00000298738:E136K	ENSP00000298738:E136K	E	-	1	0	FAM194B	45068736	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.079000	0.14782	-0.180000	0.10637	-1.380000	0.01176	GAG	.		0.483	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
ERICH6B	220081	hgsc.bcm.edu;ucsc.edu	37	13	46170737	46170737	+	Missense_Mutation	SNP	T	T	C	rs142875900|rs375947127|rs117004691	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr13:46170737T>C	ENST00000298738.2	-	3	568	c.404A>G	c.(403-405)gAg>gGg	p.E135G		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		135	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						ctcttcctcctccagatgctc	0.493													T|||	1383	0.276158	0.1362	0.4308	5008	,	,		19669	0.1607		0.494	False		,,,				2504	0.2505				p.E135G		.											.	FAM194B-68	0			c.A404G						.						133.0	77.0	94.0					13																	46170737		692	1565	2257	SO:0001583	missense	220081	exon3			TCCTCCTCCAGAT																												ENST00000298738.2:c.404A>G	13.37:g.46170737T>C	ENSP00000298738:p.Glu135Gly	73	0		25	14	NM_182542	0	0	0	0	0	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	37	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	T	8.448	0.852491	0.17106	.	.	ENSG00000165837	ENST00000298738	T	0.06608	3.28	2.24	-2.01	0.07410	.	.	.	.	.	T	0.04137	0.0115	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40534	-0.9558	9	0.87932	D	0	-2.345	6.5075	0.22204	0.0:0.4358:0.0:0.5642	.	135;135	A2VDI6;Q5W0A0	.;F194B_HUMAN	G	135	ENSP00000298738:E135G	ENSP00000298738:E135G	E	-	2	0	FAM194B	45068738	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.707000	0.05041	-0.286000	0.09076	-1.636000	0.00776	GAG	.		0.493	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
EBPL	84650	broad.mit.edu	37	13	50235160	50235160	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr13:50235160G>C	ENST00000242827.6	-	4	615	c.565C>G	c.(565-567)Cta>Gta	p.L189V	EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378270.5_3'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000378284.2_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	189					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.L189V(9)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		TTGAGTTCTAGCCATGACTGC	0.418																																					p.L189V	NSCLC(39;857 1083 36109 42364 51411)	.											.	EBPL-90	9	Substitution - Missense(9)	endometrium(6)|kidney(3)	c.C565G						.						67.0	67.0	67.0					13																	50235160		2203	4300	6503	SO:0001583	missense	84650	exon4			GTTCTAGCCATGA	AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.565C>G	13.37:g.50235160G>C	ENSP00000242827:p.Leu189Val	153	0		87	3	NM_032565	0	0	87	87	0	A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	ENST00000242827.6	37	CCDS9420.1	.	.	.	.	.	.	.	.	.	.	C	3.076	-0.189988	0.06299	.	.	ENSG00000123179	ENST00000242827	D	0.97850	-4.57	5.61	2.84	0.33178	.	0.689671	0.14945	N	0.289287	D	0.88179	0.6367	N	0.00621	-1.32	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.79482	-0.1785	10	0.25751	T	0.34	-0.2032	8.3049	0.32036	0.0:0.4998:0.3595:0.1406	.	189	Q9BY08	EBPL_HUMAN	V	189	ENSP00000242827:L189V	ENSP00000242827:L189V	L	-	1	2	EBPL	49133161	0.000000	0.05858	0.303000	0.25071	0.899000	0.52679	-1.071000	0.03437	0.397000	0.25310	-0.127000	0.14921	CTA	.		0.418	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044932.2	NM_032565	
ARHGEF7	8874	bcgsc.ca	37	13	111870037	111870037	+	Silent	SNP	T	T	C	rs2296354	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr13:111870037T>C	ENST00000375741.2	+	6	793	c.543T>C	c.(541-543)gaT>gaC	p.D181D	ARHGEF7_ENST00000544132.1_5'UTR|ARHGEF7_ENST00000218789.5_Silent_p.D3D|ARHGEF7_ENST00000426073.2_Silent_p.D3D|ARHGEF7_ENST00000375739.2_Silent_p.D131D|ARHGEF7_ENST00000370623.3_Silent_p.D88D|ARHGEF7_ENST00000317133.5_Silent_p.D160D|ARHGEF7_ENST00000375736.4_Silent_p.D3D|ARHGEF7_ENST00000375737.5_Silent_p.D78D|ARHGEF7_ENST00000375723.1_Silent_p.D3D	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	181					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			ACATGACCGATAATAGCAACA	0.388													T|||	1246	0.248802	0.025	0.1225	5008	,	,		18731	0.6825		0.174	False		,,,				2504	0.271				p.D181D		.											.	ARHGEF7-232	0			c.T543C						.	T	,,,,	223,4183	134.5+/-170.7	3,217,1983	115.0	109.0	111.0		543,393,9,9,480	-3.1	0.4	13	dbSNP_100	111	1437,7163	276.7+/-292.4	115,1207,2978	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	ARHGEF7	NM_001113511.1,NM_001113512.1,NM_001113513.1,NM_003899.3,NM_145735.2	,,,,	118,1424,4961	CC,CT,TT		16.7093,5.0613,12.7633	,,,,	181/804,131/754,3/647,3/647,160/783	111870037	1660,11346	2203	4300	6503	SO:0001819	synonymous_variant	8874	exon6			GACCGATAATAGC	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.543T>C	13.37:g.111870037T>C		304	1		195	6	NM_001113511	0	0	0	0	0	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	ENST00000375741.2	37	CCDS45068.1																																																																																			T|0.807;C|0.193		0.388	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
UNC13C	440279	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	15	54307147	54307147	+	Missense_Mutation	SNP	C	C	G	rs376158849		TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr15:54307147C>G	ENST00000260323.11	+	1	2047	c.2047C>G	c.(2047-2049)Ctt>Gtt	p.L683V	UNC13C_ENST00000537900.1_Missense_Mutation_p.L683V|UNC13C_ENST00000545554.1_Missense_Mutation_p.L683V	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	683					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AACAAACAGTCTTTTTGACCA	0.398																																					p.L683V		.											.	UNC13C-51	0			c.C2047G						.						75.0	71.0	73.0					15																	54307147		1852	4107	5959	SO:0001583	missense	440279	exon1			AACAGTCTTTTTG	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2047C>G	15.37:g.54307147C>G	ENSP00000260323:p.Leu683Val	128	0		83	10	NM_001080534	0	0	0	0	0	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	37	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	1.227	-0.625118	0.03610	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.79033	-1.23;-1.23;-1.23	5.18	0.0773	0.14407	.	.	.	.	.	T	0.57198	0.2037	N	0.19112	0.55	0.24783	N	0.992809	B	0.34015	0.435	B	0.29598	0.104	T	0.38693	-0.9649	9	0.15499	T	0.54	.	9.1662	0.37052	0.0:0.6279:0.0:0.3721	.	683	Q8NB66	UN13C_HUMAN	V	683	ENSP00000260323:L683V;ENSP00000438156:L683V;ENSP00000442569:L683V	ENSP00000260323:L683V	L	+	1	0	UNC13C	52094439	0.988000	0.35896	0.421000	0.26609	0.104000	0.19210	1.127000	0.31357	-0.128000	0.11641	-0.143000	0.13931	CTT	.		0.398	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
MYO15A	51168	bcgsc.ca	37	17	18041507	18041507	+	Silent	SNP	C	C	T	rs2280777	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr17:18041507C>T	ENST00000205890.5	+	17	5292	c.4954C>T	c.(4954-4956)Ctg>Ttg	p.L1652L		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1652	Myosin motor.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CCTCATCTCACTGAAGCCTTA	0.562													C|||	2397	0.478634	0.4047	0.5735	5008	,	,		15838	0.5933		0.5209	False		,,,				2504	0.3497				p.L1652L		.											.	MYO15A-97	0			c.C4954T						.	C		1901,2475	491.5+/-362.1	428,1045,715	109.0	111.0	111.0		4954	2.5	0.7	17	dbSNP_100	111	4595,3985	580.7+/-391.1	1247,2101,942	yes	coding-synonymous	MYO15A	NM_016239.3		1675,3146,1657	TT,TC,CC		46.4452,43.4415,49.8611		1652/3531	18041507	6496,6460	2188	4290	6478	SO:0001819	synonymous_variant	51168	exon16			ATCTCACTGAAGC	AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.4954C>T	17.37:g.18041507C>T		129	1		82	5	NM_016239	0	0	0	0	0	B4DFC7	Silent	SNP	ENST00000205890.5	37	CCDS42271.1																																																																																			C|0.501;N|0.000		0.562	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132048.1	NM_016239	
CCL4L2	388372	broad.mit.edu	37	17	34641466	34641466	+	Missense_Mutation	SNP	G	G	A	rs148287175	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr17:34641466G>A	ENST00000394465.2	+	3	525	c.208G>A	c.(208-210)Ggc>Agc	p.G70S	TBC1D3C_ENST00000451448.2_Intron|TBC1D3H_ENST00000400684.4_Intron|CCL4L2_ENST00000482104.1_3'UTR|CCL4L2_ENST00000339270.6_Silent_p.E31E|TBC1D3H_ENST00000535446.1_Intron|TBC1D3C_ENST00000308078.7_Intron			Q8NHW4	CC4L_HUMAN	chemokine (C-C motif) ligand 4-like 2	70					cell chemotaxis (GO:0060326)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)	1		Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AACCAAAAGAGGCAAGCAAGT	0.512													g|||	15	0.00299521	0.0	0.0029	5008	,	,		21349	0.004		0.003	False		,,,				2504	0.0061				p.G70S		.											.	CCL4L2-46	0			c.G208A						.	G	SER/GLY	10,4292		2,6,2143	182.0	128.0	147.0		208	3.1	1.0	17	dbSNP_134	147	47,8123		9,29,4047	no	missense	CCL4L2	NM_207007.2	56	11,35,6190	AA,AG,GG		0.5753,0.2325,0.457	probably-damaging	70/93	34641466	57,12415	2151	4085	6236	SO:0001583	missense	388372	exon3			AAAAGAGGCAAGC			17q12	2005-08-09			ENSG00000197262			"""Chemokine ligands"""	24066	protein-coding gene	gene with protein product		603782				15028295	Standard	NM_001291468		Approved		uc010cuj.3	Q8NHW4	OTTHUMG00000133066	ENST00000394465.2:c.208G>A	17.37:g.34641466G>A	ENSP00000377978:p.Gly70Ser	529	0		159	4	NM_207007	0	0	60	60	0	B2RUZ3|B7ZMA8|Q50EM1|Q50EM2|Q50EM3|Q50EM4|Q50EM5|Q50EM6|Q50EM7|Q50EM8|Q569J2|Q6NSB0	Missense_Mutation	SNP	ENST00000394465.2	37	CCDS11311.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670233	0.47677	0.002325	0.005753	ENSG00000197262	ENST00000394465	T	0.08193	3.12	3.1	3.1	0.35709	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.094754	0.41500	N	0.000865	T	0.14098	0.0341	.	.	.	0.80722	D	1	D	0.56521	0.976	P	0.59546	0.859	T	0.00492	-1.1707	9	0.49607	T	0.09	.	9.7923	0.40713	0.0:0.0:1.0:0.0	.	70	Q8NHW4	CC4L_HUMAN	S	70	ENSP00000377978:G70S	ENSP00000377978:G70S	G	+	1	0	CCL4L2	31665579	1.000000	0.71417	0.987000	0.45799	0.432000	0.31715	5.027000	0.64109	1.306000	0.44926	0.420000	0.28162	GGC	G|0.997;A|0.003		0.512	CCL4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256699.1	NM_207007	
EPN3	55040	bcgsc.ca	37	17	48614119	48614119	+	Missense_Mutation	SNP	G	G	T	rs564194484		TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr17:48614119G>T	ENST00000268933.3	+	2	781	c.202G>T	c.(202-204)Ggc>Tgc	p.G68C	EPN3_ENST00000541226.1_Missense_Mutation_p.G12C|RP11-94C24.8_ENST00000513017.1_RNA|EPN3_ENST00000537145.1_Missense_Mutation_p.G123C	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	68	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.					clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			CAATGACAGCGGCAAGAACTG	0.607																																					p.G68C		.											.	EPN3-91	0			c.G202T						.						89.0	85.0	86.0					17																	48614119		2203	4300	6503	SO:0001583	missense	55040	exon2			GACAGCGGCAAGA	AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.202G>T	17.37:g.48614119G>T	ENSP00000268933:p.Gly68Cys	233	0		131	5	NM_017957	0	0	0	0	0	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Missense_Mutation	SNP	ENST00000268933.3	37	CCDS11570.1	.	.	.	.	.	.	.	.	.	.	G	29.6	5.017021	0.93404	.	.	ENSG00000049283	ENST00000268933;ENST00000503246;ENST00000442715;ENST00000537145;ENST00000541226;ENST00000515126;ENST00000507467;ENST00000411703	T;T;T;T;T;T	0.49432	0.78;0.78;0.8;0.8;0.78;0.78	5.28	5.28	0.74379	Epsin domain, N-terminal (1);ENTH/VHS (2);Epsin-like, N-terminal (2);	0.054286	0.64402	D	0.000001	T	0.80336	0.4604	H	0.97158	3.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87324	0.2320	10	0.87932	D	0	-29.1592	18.5277	0.90978	0.0:0.0:1.0:0.0	.	123;123;68	B4DK18;F6QWW5;Q9H201	.;.;EPN3_HUMAN	C	68;68;123;123;12;68;68;68	ENSP00000268933:G68C;ENSP00000426762:G68C;ENSP00000439512:G123C;ENSP00000440540:G12C;ENSP00000422601:G68C;ENSP00000421515:G68C	ENSP00000268933:G68C	G	+	1	0	EPN3	45969118	1.000000	0.71417	0.987000	0.45799	0.982000	0.71751	9.838000	0.99474	2.468000	0.83385	0.561000	0.74099	GGC	.		0.607	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367573.1	NM_017957	
UNK	85451	broad.mit.edu;bcgsc.ca	37	17	73806016	73806016	+	Missense_Mutation	SNP	G	G	A			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr17:73806016G>A	ENST00000589666.1	+	2	390	c.280G>A	c.(280-282)Gac>Aac	p.D94N	UNK_ENST00000293218.3_Missense_Mutation_p.D170N	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	94							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CACCAAGTACGACGAGGCTAC	0.642																																					p.D94N		.											.	UNK-68	0			c.G280A						.						47.0	52.0	51.0					17																	73806016		2128	4250	6378	SO:0001583	missense	85451	exon2			AAGTACGACGAGG	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.280G>A	17.37:g.73806016G>A	ENSP00000464893:p.Asp94Asn	301	0		202	8	NM_001080419	0	0	2	2	0		Missense_Mutation	SNP	ENST00000589666.1	37	CCDS45778.2	.	.	.	.	.	.	.	.	.	.	G	35	5.518646	0.96416	.	.	ENSG00000132478	ENST00000293218	.	.	.	5.22	5.22	0.72569	Zinc finger, CCCH-type (2);	0.047724	0.85682	D	0.000000	T	0.65749	0.2721	L	0.55481	1.735	0.80722	D	1	D	0.69078	0.997	P	0.53224	0.721	T	0.64740	-0.6336	9	0.37606	T	0.19	-11.2012	18.7781	0.91920	0.0:0.0:1.0:0.0	.	94	Q9C0B0	UNK_HUMAN	N	170	.	ENSP00000293218:D170N	D	+	1	0	UNK	71317611	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.852000	0.99516	2.434000	0.82447	0.561000	0.74099	GAC	.		0.642	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1	NM_001080419	
DSG3	1830	hgsc.bcm.edu	37	18	29049127	29049127	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr18:29049127G>T	ENST00000257189.4	+	12	1795	c.1712G>T	c.(1711-1713)aGt>aTt	p.S571I		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	571					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CTTACAGACAGTCAGAACAAT	0.512																																					p.S571I		.											.	DSG3-98	0			c.G1712T						.						155.0	142.0	146.0					18																	29049127		2203	4300	6503	SO:0001583	missense	1830	exon12			CAGACAGTCAGAA	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.1712G>T	18.37:g.29049127G>T	ENSP00000257189:p.Ser571Ile	150	0		80	4	NM_001944	0	0	0	0	0	A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	37	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.425896	0.25726	.	.	ENSG00000134757	ENST00000257189	T	0.61510	0.1	5.95	0.859	0.19036	.	1.306660	0.05230	N	0.510130	T	0.51686	0.1689	L	0.55990	1.75	0.09310	N	1	B	0.25563	0.129	B	0.25884	0.064	T	0.41016	-0.9532	10	0.54805	T	0.06	.	5.1527	0.15019	0.4648:0.1465:0.3887:0.0	.	571	P32926	DSG3_HUMAN	I	571	ENSP00000257189:S571I	ENSP00000257189:S571I	S	+	2	0	DSG3	27303125	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.678000	0.25277	-0.122000	0.11766	-1.567000	0.00876	AGT	.		0.512	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944	
FZR1	51343	broad.mit.edu;ucsc.edu;bcgsc.ca	37	19	3527019	3527019	+	Silent	SNP	C	C	T	rs138835338	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr19:3527019C>T	ENST00000395095.3	+	5	429	c.429C>T	c.(427-429)aaC>aaT	p.N143N	FZR1_ENST00000313639.8_Intron|FZR1_ENST00000441788.2_Silent_p.N143N	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	143					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGACGGCAACGATGTGTCTC	0.647													C|||	13	0.00259585	0.0	0.0014	5008	,	,		15526	0.0		0.004	False		,,,				2504	0.0082				p.N143N		.											.	FZR1-227	0			c.C429T						.	C	,,	11,4395	17.9+/-39.9	0,11,2192	207.0	138.0	161.0		,429,429	-7.4	0.7	19	dbSNP_134	161	55,8541	35.3+/-89.8	0,55,4243	no	intron,coding-synonymous,coding-synonymous	FZR1	NM_001136197.1,NM_001136198.1,NM_016263.3	,,	0,66,6435	TT,TC,CC		0.6398,0.2497,0.5076	,,	,143/497,143/494	3527019	66,12936	2203	4298	6501	SO:0001819	synonymous_variant	51343	exon5			CGGCAACGATGTG	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.429C>T	19.37:g.3527019C>T		200	1		257	114	NM_001136198	0	0	29	50	21	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Silent	SNP	ENST00000395095.3	37	CCDS45916.1																																																																																			C|0.996;T|0.004		0.647	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
CATSPERD	257062	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	5744509	5744509	+	Silent	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr19:5744509G>T	ENST00000381624.3	+	8	706	c.645G>T	c.(643-645)gtG>gtT	p.V215V	CATSPERD_ENST00000381614.2_5'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	215					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											TGCTTGTAGTGAATCAAGGGA	0.403																																					p.V215V		.											.	.	0			c.G645T						.						166.0	145.0	151.0					19																	5744509		1839	4097	5936	SO:0001819	synonymous_variant	257062	exon8			TGTAGTGAATCAA	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.645G>T	19.37:g.5744509G>T		103	0		82	5	NM_152784	0	0	0	0	0	Q6ZRP1	Silent	SNP	ENST00000381624.3	37	CCDS12149.2																																																																																			.		0.403	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
ZNF546	339327	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	40520583	40520583	+	Missense_Mutation	SNP	A	A	G			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr19:40520583A>G	ENST00000347077.4	+	7	1622	c.1406A>G	c.(1405-1407)tAt>tGt	p.Y469C	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.Y443C	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GAGAAACCCTATGAATGTAAG	0.408																																					p.Y469C		.											.	ZNF546-155	0			c.A1406G						.						73.0	75.0	74.0					19																	40520583		2203	4300	6503	SO:0001583	missense	339327	exon7			AACCCTATGAATG	BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.1406A>G	19.37:g.40520583A>G	ENSP00000339823:p.Tyr469Cys	54	0		57	25	NM_178544	0	1	24	25	0	A8K913	Missense_Mutation	SNP	ENST00000347077.4	37	CCDS12548.1	.	.	.	.	.	.	.	.	.	.	a	13.73	2.325685	0.41197	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	T	0.25414	1.8	2.9	2.9	0.33743	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.52773	0.1755	M	0.87180	2.865	0.27541	N	0.950785	D	0.89917	1.0	D	0.78314	0.991	T	0.42015	-0.9476	9	0.87932	D	0	.	9.5585	0.39355	1.0:0.0:0.0:0.0	.	469	Q86UE3	ZN546_HUMAN	C	469;106	ENSP00000339823:Y469C	ENSP00000339823:Y469C	Y	+	2	0	ZNF546	45212423	0.000000	0.05858	0.998000	0.56505	0.994000	0.84299	0.012000	0.13287	1.564000	0.49628	0.533000	0.62120	TAT	.		0.408	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462495.2	NM_178544	
HRC	3270	hgsc.bcm.edu	37	19	49657754	49657754	+	Silent	SNP	G	G	A	rs567490515	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr19:49657754G>A	ENST00000252825.4	-	1	927	c.741C>T	c.(739-741)gaC>gaT	p.D247D	HRC_ENST00000595625.1_Silent_p.D247D	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	247	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Asp-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		catcatcatcgtcatcttctt	0.507													G|||	238	0.047524	0.053	0.0476	5008	,	,		25432	0.0169		0.0417	False		,,,				2504	0.0777				p.D247D	Melanoma(37;75 1097 24567 25669 30645)	.											.	HRC-91	0			c.C741T						.						127.0	92.0	104.0					19																	49657754		2203	4300	6503	SO:0001819	synonymous_variant	3270	exon1			ATCATCGTCATCT		CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.741C>T	19.37:g.49657754G>A		102	0		83	7	NM_002152	0	0	0	0	0	Q504Y6	Silent	SNP	ENST00000252825.4	37	CCDS12759.1																																																																																			G|0.998;A|0.002		0.507	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465649.1	NM_002152	
CTU1	90353	hgsc.bcm.edu	37	19	51602298	51602298	+	Missense_Mutation	SNP	C	C	G	rs12983578	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr19:51602298C>G	ENST00000421832.2	-	3	651	c.607G>C	c.(607-609)Gag>Cag	p.E203Q		NM_145232.3	NP_660275.2			cytosolic thiouridylase subunit 1											large_intestine(2)|lung(1)|urinary_tract(1)	4						gcgcccccctcgccgggagag	0.726													C|||	357	0.0712859	0.0129	0.0663	5008	,	,		5363	0.0625		0.166	False		,,,				2504	0.0654				p.E203Q		.											.	CTU1-68	0			c.G607C						.	C	GLN/GLU	80,3254		0,80,1587	2.0	3.0	3.0		607	3.7	1.0	19	dbSNP_121	3	703,5807		27,649,2579	no	missense	CTU1	NM_145232.3	29	27,729,4166	GG,GC,CC		10.7988,2.3995,7.9541	probably-damaging	203/349	51602298	783,9061	1667	3255	4922	SO:0001583	missense	90353	exon3			CCCCCTCGCCGGG		CCDS12824.1	19q13.41	2013-05-31	2013-05-31	2009-08-19		ENSG00000142544			29590	protein-coding gene	gene with protein product		612694	"""ATP binding domain 3"", ""cytosolic thiouridylase subunit 1 homolog (S. pombe)"""	ATPBD3		19017811	Standard	NM_145232		Approved	MGC17332, NCS6	uc010eop.3	Q7Z7A3		ENST00000421832.2:c.607G>C	19.37:g.51602298C>G	ENSP00000390011:p.Glu203Gln	1	0		5	4	NM_145232	0	0	0	1	1		Missense_Mutation	SNP	ENST00000421832.2	37	CCDS12824.1	217	0.09935897435897435	20	0.04065040650406504	27	0.07458563535911603	34	0.05944055944055944	136	0.17941952506596306	.	17.62	3.434094	0.62955	0.023995	0.107988	ENSG00000142544	ENST00000421832	T	0.43294	0.95	3.66	3.66	0.41972	Rossmann-like alpha/beta/alpha sandwich fold (1);tRNA(Ile)-lysidine/2-thiocytidine synthase (1);	0.000000	0.85682	D	0.000000	T	0.00178	0.0005	M	0.69523	2.12	0.23991	P	0.99624278	D	0.69078	0.997	D	0.66084	0.941	T	0.09574	-1.0668	9	0.46703	T	0.11	-14.0205	7.3785	0.26841	0.0:0.873:0.0:0.127	rs12983578	203	Q7Z7A3	CTU1_HUMAN	Q	203	ENSP00000390011:E203Q	ENSP00000390011:E203Q	E	-	1	0	CTU1	56294110	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	3.267000	0.51577	1.733000	0.51620	0.505000	0.49811	GAG	C|0.900;G|0.100		0.726	CTU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464292.1	NM_145232	
SSC5D	284297	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	56012011	56012011	+	Silent	SNP	G	G	A			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr19:56012011G>A	ENST00000389623.6	+	11	2480	c.2457G>A	c.(2455-2457)cgG>cgA	p.R819R	SSC5D_ENST00000587166.1_Silent_p.R819R	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	819	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						GAAAGGTCCGGCCTCGAGTAG	0.627																																					p.R819R		.											.	.	0			c.G2457A						.						87.0	87.0	87.0					19																	56012011		692	1591	2283	SO:0001819	synonymous_variant	284297	exon11			GGTCCGGCCTCGA		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2457G>A	19.37:g.56012011G>A		178	0		176	11	NM_001195267	0	0	1	1	0	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Silent	SNP	ENST00000389623.6	37	CCDS46196.1																																																																																			.		0.627	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
ZFP28	140612	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	57051018	57051018	+	Missense_Mutation	SNP	T	T	C			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr19:57051018T>C	ENST00000301318.3	+	2	304	c.233T>C	c.(232-234)cTt>cCt	p.L78P	ZFP28_ENST00000591844.1_Missense_Mutation_p.L78P|ZFP28_ENST00000594386.1_3'UTR|AC005498.3_ENST00000593218.1_lincRNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	78					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GACACTGCTCTTCCCCAGGAG	0.507																																					p.L78P	Ovarian(124;554 1662 19430 21141 52494)	.											.	ZFP28-91	0			c.T233C						.						117.0	114.0	115.0					19																	57051018		2203	4300	6503	SO:0001583	missense	140612	exon2			CTGCTCTTCCCCA		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.233T>C	19.37:g.57051018T>C	ENSP00000301318:p.Leu78Pro	88	0		129	66	NM_020828	0	0	0	2	2	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	37	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	T	4.309	0.056578	0.08291	.	.	ENSG00000196867	ENST00000301318	T	0.07567	3.18	3.8	-0.848	0.10727	.	1.143450	0.06877	N	0.801790	T	0.05318	0.0141	N	0.14661	0.345	0.09310	N	0.999999	B;B	0.15719	0.001;0.014	B;B	0.12156	0.002;0.007	T	0.44667	-0.9313	10	0.36615	T	0.2	.	7.5096	0.27566	0.0:0.4264:0.0:0.5736	.	78;78	Q8NHY6;A8K0L8	ZFP28_HUMAN;.	P	78	ENSP00000301318:L78P	ENSP00000301318:L78P	L	+	2	0	ZFP28	61742830	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	0.068000	0.14531	-0.393000	0.07739	-0.464000	0.05259	CTT	.		0.507	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
ZNF814	730051	ucsc.edu	37	19	58384712	58384712	+	Silent	SNP	A	A	G			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr19:58384712A>G	ENST00000435989.2	-	3	2280	c.2046T>C	c.(2044-2046)caT>caC	p.H682H	ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000596604.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	682					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TTTCTCCAGTATGGCCATGCT	0.408																																					p.H682H		.											.	.	0			c.T2046C						.						68.0	57.0	60.0					19																	58384712		692	1591	2283	SO:0001819	synonymous_variant	730051	exon3			TCCAGTATGGCCA		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2046T>C	19.37:g.58384712A>G		194	0		233	1	NM_001144989	0	0	2	3	1	A6NF35	Silent	SNP	ENST00000435989.2	37	CCDS46212.1																																																																																			.		0.408	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466976.1	XM_001725708	
PDE1A	5136	broad.mit.edu	37	2	183291349	183291349	+	Intron	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr2:183291349G>T	ENST00000410103.1	-	2	185				PDE1A_ENST00000331935.6_Intron|PDE1A_ENST00000358139.2_Intron|PDE1A_ENST00000435564.1_Intron|PDE1A_ENST00000409365.1_Missense_Mutation_p.D3E|PDE1A_ENST00000351439.5_Missense_Mutation_p.D3E|PDE1A_ENST00000456212.1_Intron|PDE1A_ENST00000536095.1_Intron	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TTGTGACATGGTCATCCATTT	0.438																																					p.D3E		.											.	PDE1A-93	0			c.C9A						.						131.0	124.0	126.0					2																	183291349		876	1991	2867	SO:0001627	intron_variant	5136	exon1			GACATGGTCATCC		CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.101+95653C>A	2.37:g.183291349G>T		164	0		103	3	NM_001258313	0	0	0	0	0	D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	Missense_Mutation	SNP	ENST00000410103.1	37	CCDS33344.1	.	.	.	.	.	.	.	.	.	.	G	6.132	0.392649	0.11638	.	.	ENSG00000115252	ENST00000409365;ENST00000351439	T;T	0.70749	-0.51;-0.5	5.94	4.09	0.47781	.	.	.	.	.	T	0.45696	0.1355	.	.	.	0.80722	D	1	B	0.10296	0.003	B	0.14023	0.01	T	0.22173	-1.0224	8	0.07325	T	0.83	.	5.7002	0.17877	0.0792:0.1457:0.6336:0.1415	.	3	P54750-2	.	E	3	ENSP00000386767:D3E;ENSP00000309269:D3E	ENSP00000309269:D3E	D	-	3	2	PDE1A	182999594	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.882000	0.39648	0.792000	0.33850	0.643000	0.83706	GAC	.		0.438	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000334356.1		
ITGAV	3685	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	187521095	187521095	+	Silent	SNP	G	G	A			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr2:187521095G>A	ENST00000261023.3	+	17	1960	c.1686G>A	c.(1684-1686)ctG>ctA	p.L562L	AC017101.10_ENST00000453665.1_RNA|ITGAV_ENST00000433736.2_Silent_p.L516L|ITGAV_ENST00000374907.3_Silent_p.L526L	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	562					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	GGGGGGGACTGATGCAGTGTG	0.418																																					p.L562L	Melanoma(58;108 1995 6081)	.											.	ITGAV-653	0			c.G1686A						.						273.0	254.0	260.0					2																	187521095		2203	4300	6503	SO:0001819	synonymous_variant	3685	exon17			GGGACTGATGCAG		CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.1686G>A	2.37:g.187521095G>A		167	1		80	32	NM_002210	0	0	0	1	1	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Silent	SNP	ENST00000261023.3	37	CCDS2292.1																																																																																			.		0.418	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255882.2	NM_002210	
METTL21A	151194	broad.mit.edu	37	2	208478027	208478027	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr2:208478027G>T	ENST00000411432.1	-	4	616	c.400C>A	c.(400-402)Cct>Act	p.P134T	METTL21A_ENST00000448823.2_3'UTR|METTL21A_ENST00000442521.1_Missense_Mutation_p.P134T|METTL21A_ENST00000432416.1_Intron|METTL21A_ENST00000477919.1_5'Flank|METTL21A_ENST00000272839.3_Missense_Mutation_p.P152T|METTL21A_ENST00000458426.1_Intron|METTL21A_ENST00000425132.1_Intron|METTL21A_ENST00000406927.2_Missense_Mutation_p.P134T|METTL21A_ENST00000426075.1_Missense_Mutation_p.P134T|METTL21A_ENST00000448007.2_Missense_Mutation_p.P134T	NM_001127395.1	NP_001120867.1	Q8WXB1	MT21A_HUMAN	methyltransferase like 21A	134					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	cytoplasm (GO:0005737)	ATPase binding (GO:0051117)|Hsp70 protein binding (GO:0030544)|protein-lysine N-methyltransferase activity (GO:0016279)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|stomach(1)	10						AATTCTCCAGGAGAAAAACTC	0.378																																					p.P134T		.											.	METTL21A-69	0			c.C400A						.						85.0	88.0	87.0					2																	208478027		2203	4300	6503	SO:0001583	missense	151194	exon4			CTCCAGGAGAAAA	AK093812, AF455817	CCDS2376.1	2q33.3	2013-09-30	2011-03-03	2011-03-03	ENSG00000144401	ENSG00000144401			30476	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 557b"", ""heat shock protein 70kDa lysine (K) methyltransferase"""	615257	"""family with sequence similarity 119, member A"""	FAM119A		23921388	Standard	NM_145280		Approved	LOC151194, HCA557b, HSPA-KMT	uc010fuk.1	Q8WXB1	OTTHUMG00000132934	ENST00000411432.1:c.400C>A	2.37:g.208478027G>T	ENSP00000415115:p.Pro134Thr	69	0		35	3	NM_145280	0	0	5	5	0	Q53RV0|Q8N1Z9|Q96GH6	Missense_Mutation	SNP	ENST00000411432.1	37	CCDS2376.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.442541	0.43326	.	.	ENSG00000144401	ENST00000411432;ENST00000448007;ENST00000272839;ENST00000406927;ENST00000426075;ENST00000442521	T;T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27;2.27	5.51	4.64	0.57946	.	0.214735	0.49916	D	0.000124	T	0.12433	0.0302	N	0.20766	0.605	0.48975	D	0.999737	B	0.12630	0.006	B	0.15870	0.014	T	0.07121	-1.0789	10	0.32370	T	0.25	-13.1472	14.4963	0.67691	0.0698:0.0:0.9302:0.0	.	134	Q8WXB1	MT21A_HUMAN	T	134;134;152;134;134;134	ENSP00000415115:P134T;ENSP00000407622:P134T;ENSP00000272839:P152T;ENSP00000385481:P134T;ENSP00000403317:P134T;ENSP00000392062:P134T	ENSP00000272839:P152T	P	-	1	0	METTL21A	208186272	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.048000	0.41278	1.578000	0.49821	0.561000	0.74099	CCT	.		0.378	METTL21A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337044.1	NM_145280	
CRYGB	1419	bcgsc.ca	37	2	209007559	209007559	+	Missense_Mutation	SNP	T	T	G	rs796287	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr2:209007559T>G	ENST00000260988.4	-	3	378	c.331A>C	c.(331-333)Atc>Ctc	p.I111L		NM_005210.3	NP_005201.2	P07316	CRGB_HUMAN	crystallin, gamma B	111	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.		I -> L (in dbSNP:rs796287). {ECO:0000269|PubMed:12011157, ECO:0000269|PubMed:12676897, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2777080, ECO:0000269|PubMed:4065573}.		lens fiber cell morphogenesis (GO:0070309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)	14				Epithelial(149;0.0641)|LUSC - Lung squamous cell carcinoma(261;0.0703)|Lung(261;0.132)		TGAACAGAGATACAGTCGTCT	0.517													G|||	3228	0.644569	0.6203	0.5447	5008	,	,		17939	0.5952		0.7326	False		,,,				2504	0.7086				p.I111L		.											.	CRYGB-90	0			c.A331C						.	G	LEU/ILE	2978,1428	465.9+/-354.3	1033,912,258	145.0	145.0	145.0		331	0.5	0.1	2	dbSNP_86	145	6334,2266	384.1+/-341.0	2333,1668,299	yes	missense	CRYGB	NM_005210.3	5	3366,2580,557	GG,GT,TT		26.3488,32.4103,28.4023	benign	111/176	209007559	9312,3694	2203	4300	6503	SO:0001583	missense	1419	exon3			CAGAGATACAGTC		CCDS2380.1	2q34	2013-02-14			ENSG00000182187	ENSG00000182187			2409	protein-coding gene	gene with protein product		123670	"""crystallin, gamma 1-2"""	CRYG2			Standard	NM_005210		Approved		uc002vcp.4	P07316	OTTHUMG00000132941	ENST00000260988.4:c.331A>C	2.37:g.209007559T>G	ENSP00000260988:p.Ile111Leu	306	2		204	8	NM_005210	0	0	0	0	0	Q17RB5|Q53ST2	Missense_Mutation	SNP	ENST00000260988.4	37	CCDS2380.1	1385	0.6341575091575091	319	0.6483739837398373	206	0.569060773480663	315	0.5506993006993007	545	0.7189973614775725	G	10.87	1.474126	0.26423	0.675897	0.736512	ENSG00000182187	ENST00000260988	T	0.75589	-0.95	4.64	0.468	0.16732	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.463806	0.25377	N	0.031104	T	0.00012	0.0000	N	0.01668	-0.77	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.44559	-0.9320	9	0.54805	T	0.06	.	9.4649	0.38806	0.0:0.128:0.3464:0.5255	rs796287;rs17641392;rs58328262;rs796287	111	P07316	CRGB_HUMAN	L	111	ENSP00000260988:I111L	ENSP00000260988:I111L	I	-	1	0	CRYGB	208715804	0.005000	0.15991	0.102000	0.21198	0.613000	0.37349	0.827000	0.27421	-0.247000	0.09597	-0.217000	0.12591	ATC	G|0.655;N|0.000		0.517	CRYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256473.2	NM_005210	
IGFBP5	3488	bcgsc.ca	37	2	217559484	217559484	+	Silent	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr2:217559484G>T	ENST00000233813.4	-	1	764	c.15C>A	c.(13-15)acC>acA	p.T5T	AC007563.5_ENST00000447289.1_RNA	NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	5					cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)			endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGAGGACCGCGGTGAGCAACA	0.662																																					p.T5T		.											.	IGFBP5-522	0			c.C15A						.						4.0	5.0	4.0					2																	217559484		1923	3966	5889	SO:0001819	synonymous_variant	3488	exon1			GACCGCGGTGAGC		CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.15C>A	2.37:g.217559484G>T		41	0		20	3	NM_000599	0	0	3	3	0	Q5U0A3	Silent	SNP	ENST00000233813.4	37	CCDS2405.1																																																																																			.		0.662	IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256674.2	NM_000599	
FARP2	9855	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	242396172	242396172	+	Silent	SNP	G	G	C	rs375721515		TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr2:242396172G>C	ENST00000264042.3	+	14	1592	c.1422G>C	c.(1420-1422)acG>acC	p.T474T	FARP2_ENST00000373287.4_Silent_p.T474T|FARP2_ENST00000545004.1_Silent_p.T474T	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	474	Pro-rich.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GCCTTTCCACGAAGAGTCCTC	0.587																																					p.T474T		.											.	FARP2-93	0			c.G1422C						.						110.0	108.0	109.0					2																	242396172		2203	4300	6503	SO:0001819	synonymous_variant	9855	exon14			TTCCACGAAGAGT	AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.1422G>C	2.37:g.242396172G>C		238	1		197	181	NM_014808	0	0	0	0	0	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Silent	SNP	ENST00000264042.3	37	CCDS33424.1																																																																																			.		0.587	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323153.1		
TGM6	343641	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	2384245	2384245	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr20:2384245C>T	ENST00000202625.2	+	9	1173	c.1112C>T	c.(1111-1113)cCa>cTa	p.P371L	TGM6_ENST00000381423.1_Missense_Mutation_p.P371L	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	371					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	CGGTGCGGCCCAGCCTCAGTC	0.622																																					p.P371L		.											.	TGM6-94	0			c.C1112T						.						92.0	83.0	86.0					20																	2384245		2203	4300	6503	SO:0001583	missense	343641	exon9			GCGGCCCAGCCTC	AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1112C>T	20.37:g.2384245C>T	ENSP00000202625:p.Pro371Leu	100	0		136	32	NM_198994	0	0	0	0	0	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Missense_Mutation	SNP	ENST00000202625.2	37	CCDS13025.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.605102	0.66445	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	D;D	0.95980	-3.87;-3.87	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.97383	0.9144	M	0.75085	2.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97720	1.0196	10	0.87932	D	0	-18.0498	16.0187	0.80464	0.0:1.0:0.0:0.0	.	371;371	O95932-2;O95932	.;TGM3L_HUMAN	L	371	ENSP00000202625:P371L;ENSP00000370831:P371L	ENSP00000202625:P371L	P	+	2	0	TGM6	2332245	1.000000	0.71417	0.970000	0.41538	0.275000	0.26752	7.607000	0.82883	2.735000	0.93741	0.549000	0.68633	CCA	.		0.622	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077581.2	NM_198994	
GGTLC2	91227	bcgsc.ca	37	22	22986764	22986764	+	5'Flank	SNP	G	G	C	rs62228122	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr22:22986764G>C	ENST00000480559.1	+	0	0				POM121L1P_ENST00000402027.1_RNA|GGTLC2_ENST00000448514.1_5'Flank	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2						glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		GCCACTCAGTGCACGGGCAGG	0.582													.|||	3567	0.71226	0.6717	0.6585	5008	,	,		904	0.9504		0.4891	False		,,,				2504	0.7894				.		.											.	.	0			.						.																																			SO:0001631	upstream_gene_variant	25812	.			CTCAGTGCACGGG	X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177		22.37:g.22986764G>C	Exception_encountered	310	13		29	13	.	0	0	0	0	0	A1A516|A2VCM9|Q5NV76|Q6ISH0	RNA	SNP	ENST00000480559.1	37	CCDS13802.2																																																																																			G|0.445;C|0.555		0.582	GGTLC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321662.1	NM_199127	
CRYBB2	1415	bcgsc.ca	37	22	25627604	25627604	+	Silent	SNP	G	G	A	rs8140949	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr22:25627604G>A	ENST00000398215.2	+	6	654	c.483G>A	c.(481-483)ggG>ggA	p.G161G		NM_000496.2	NP_000487.1	P43320	CRBB2_HUMAN	crystallin, beta B2	161	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		identical protein binding (GO:0042802)|structural constituent of eye lens (GO:0005212)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	10						GCTACCGTGGGCTGCAGTACC	0.632													G|||	1654	0.330272	0.2784	0.2839	5008	,	,		17136	0.4325		0.2058	False		,,,				2504	0.456				p.G161G		.											.	CRYBB2-90	0			c.G483A						.	G		1214,3192	421.5+/-339.4	180,854,1169	98.0	91.0	94.0		483	0.6	1.0	22	dbSNP_116	94	1820,6780	326.6+/-317.4	202,1416,2682	no	coding-synonymous	CRYBB2	NM_000496.2		382,2270,3851	AA,AG,GG		21.1628,27.5533,23.3277		161/206	25627604	3034,9972	2203	4300	6503	SO:0001819	synonymous_variant	1415	exon6			CCGTGGGCTGCAG		CCDS13831.1	22q11.23	2008-06-10			ENSG00000244752	ENSG00000244752			2398	protein-coding gene	gene with protein product		123620		CCA2, CRYB2A, CRYB2		9158139, 8224918	Standard	XM_006724141		Approved		uc003abp.1	P43320	OTTHUMG00000150905	ENST00000398215.2:c.483G>A	22.37:g.25627604G>A		489	3		169	8	NM_000496	0	0	0	0	0	Q9UCM8	Silent	SNP	ENST00000398215.2	37	CCDS13831.1																																																																																			G|0.755;A|0.245		0.632	CRYBB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320350.1	NM_000496	
GAL3ST1	9514	bcgsc.ca	37	22	30953295	30953295	+	Missense_Mutation	SNP	C	C	T	rs2267161	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr22:30953295C>T	ENST00000402321.1	-	2	402	c.85G>A	c.(85-87)Gtg>Atg	p.V29M	GAL3ST1_ENST00000406955.1_Missense_Mutation_p.V29M|GAL3ST1_ENST00000406361.1_Missense_Mutation_p.V29M|GAL3ST1_ENST00000443111.2_Missense_Mutation_p.V29M|GAL3ST1_ENST00000338911.5_Missense_Mutation_p.V29M|GAL3ST1_ENST00000402369.1_Missense_Mutation_p.V29M|GAL3ST1_ENST00000401975.1_Missense_Mutation_p.V29M			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	29			V -> M (in dbSNP:rs2267161). {ECO:0000269|PubMed:15461802, ECO:0000269|PubMed:15489334}.		galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						TAGGAGTACACCAGCAGCAGG	0.652													C|||	1552	0.309904	0.3646	0.2536	5008	,	,		17788	0.3502		0.326	False		,,,				2504	0.2178				p.V29M		.											.	GAL3ST1-90	0			c.G85A						.	C	MET/VAL	1647,2759	502.0+/-365.1	326,995,882	89.0	91.0	91.0		85	1.1	0.9	22	dbSNP_100	91	2732,5868	436.8+/-358.4	420,1892,1988	yes	missense	GAL3ST1	NM_004861.1	21	746,2887,2870	TT,TC,CC		31.7674,37.3808,33.6691	benign	29/424	30953295	4379,8627	2203	4300	6503	SO:0001583	missense	9514	exon3			AGTACACCAGCAG	D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.85G>A	22.37:g.30953295C>T	ENSP00000385735:p.Val29Met	669	5		237	8	NM_004861	0	0	0	0	0	Q96C63	Missense_Mutation	SNP	ENST00000402321.1	37	CCDS13879.1	691	0.3163919413919414	167	0.3394308943089431	90	0.24861878453038674	197	0.34440559440559443	237	0.31266490765171506	C	13.74	2.327313	0.41197	0.373808	0.317674	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111;ENST00000441967;ENST00000431313;ENST00000452827;ENST00000437282;ENST00000416358;ENST00000427899;ENST00000423299;ENST00000443136;ENST00000423371;ENST00000428682;ENST00000453479;ENST00000426220;ENST00000447224;ENST00000411821;ENST00000445645;ENST00000448604	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18	5.58	1.09	0.20402	.	0.269973	0.36268	N	0.002686	T	0.00012	0.0000	N	0.14661	0.345	0.09310	P	0.9999999999999958	B	0.25904	0.137	B	0.29716	0.106	T	0.49495	-0.8934	9	0.33141	T	0.24	-10.4855	7.6791	0.28502	0.2039:0.1191:0.677:0.0	rs2267161;rs17845430;rs17856591;rs17858302;rs61593263;rs2267161	29	Q99999	G3ST1_HUMAN	M	29	ENSP00000385825:V29M;ENSP00000385735:V29M;ENSP00000384122:V29M;ENSP00000384388:V29M;ENSP00000343234:V29M;ENSP00000385207:V29M;ENSP00000402587:V29M;ENSP00000390545:V29M;ENSP00000395080:V29M;ENSP00000405017:V29M;ENSP00000401426:V29M;ENSP00000391485:V29M;ENSP00000397092:V29M;ENSP00000391996:V29M;ENSP00000405381:V29M;ENSP00000401074:V29M;ENSP00000389876:V29M;ENSP00000398380:V29M;ENSP00000414542:V29M;ENSP00000412995:V29M;ENSP00000394912:V29M;ENSP00000399649:V29M;ENSP00000390068:V29M	ENSP00000343234:V29M	V	-	1	0	GAL3ST1	29283295	1.000000	0.71417	0.931000	0.37212	0.726000	0.41606	1.007000	0.29860	0.316000	0.23135	-0.147000	0.13772	GTG	C|0.672;T|0.328		0.652	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321745.1	NM_004861	
XIRP1	165904	bcgsc.ca	37	3	39230610	39230610	+	Silent	SNP	G	G	A	rs80147433	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr3:39230610G>A	ENST00000340369.3	-	2	555	c.327C>T	c.(325-327)caC>caT	p.H109H	XIRP1_ENST00000396251.1_Silent_p.H109H|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	109					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CTGGCCTCTCGTGTTCTCCAA	0.597													G|||	151	0.0301518	0.0038	0.0288	5008	,	,		17880	0.0813		0.0119	False		,,,				2504	0.0327				p.H109H		.											.	XIRP1-158	0			c.C327T						.	G	,	22,4384	29.0+/-57.7	0,22,2181	71.0	71.0	71.0		327,327	-7.6	0.0	3	dbSNP_132	71	95,8505	54.0+/-114.7	0,95,4205	no	coding-synonymous,coding-synonymous	XIRP1	NM_001198621.1,NM_194293.2	,	0,117,6386	AA,AG,GG		1.1047,0.4993,0.8996	,	109/1122,109/1844	39230610	117,12889	2203	4300	6503	SO:0001819	synonymous_variant	165904	exon2			CCTCTCGTGTTCT	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.327C>T	3.37:g.39230610G>A		221	0		157	6	NM_001198621	0	0	0	0	0	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Silent	SNP	ENST00000340369.3	37	CCDS2683.1																																																																																			G|0.986;A|0.014		0.597	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
TMEM115	11070	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	50392898	50392900	+	In_Frame_Del	DEL	TCA	TCA	-			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	TCA	TCA	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr3:50392898_50392900delTCA	ENST00000266025.3	-	2	1476_1478	c.930_932delTGA	c.(928-933)gatgaa>gaa	p.D310del	XXcos-LUCA11.5_ENST00000606589.1_Intron	NM_007024.4	NP_008955.1	Q12893	TM115_HUMAN	transmembrane protein 115	310					negative regulation of cell proliferation (GO:0008285)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)|prostate(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AGACTCCTCTTCATCATCATCCA	0.601																																					p.310_311del		.											.	TMEM115-278	0			c.930_932del						.																																			SO:0001651	inframe_deletion	11070	exon2			TCCTCTTCATCAT	BC011948	CCDS2828.1	3p21.31	2008-11-04			ENSG00000126062	ENSG00000126062			30055	protein-coding gene	gene with protein product	"""placental protein 6"""	607069				11085536	Standard	NM_007024		Approved	PL6	uc003dan.1	Q12893	OTTHUMG00000044212	ENST00000266025.3:c.930_932delTGA	3.37:g.50392904_50392906delTCA	ENSP00000266025:p.Asp310del	171	0		100	28	NM_007024	0	0	0	0	0	A2IDB7|O14568|Q6IAY4|Q9UIX3	In_Frame_Del	DEL	ENST00000266025.3	37	CCDS2828.1																																																																																			.		0.601	TMEM115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102784.3	NM_007024	
ACAD9	28976	bcgsc.ca	37	3	128614185	128614185	+	Silent	SNP	A	A	C	rs1680778	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr3:128614185A>C	ENST00000308982.7	+	4	460	c.379A>C	c.(379-381)Aga>Cga	p.R127R		NM_014049.4	NP_054768.2	Q9H845	ACAD9_HUMAN	acyl-CoA dehydrogenase family, member 9	127						dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	30						CATGTACTCAAGACTAGGGGA	0.552													C|||	2721	0.543331	0.851	0.428	5008	,	,		19128	0.623		0.2932	False		,,,				2504	0.3845				p.R127R		.											.	ACAD9-92	0			c.A379C						.	C		3267,1139	401.0+/-331.8	1218,831,154	107.0	88.0	94.0		379	5.5	0.0	3	dbSNP_89	94	2589,6011	683.9+/-403.9	399,1791,2110	no	coding-synonymous	ACAD9	NM_014049.4		1617,2622,2264	CC,CA,AA		30.1047,25.8511,45.0254		127/622	128614185	5856,7150	2203	4300	6503	SO:0001819	synonymous_variant	28976	exon4			TACTCAAGACTAG	AF078854	CCDS3053.1	3q21.3	2013-05-24	2010-04-30		ENSG00000177646	ENSG00000177646		"""Mitochondrial respiratory chain complex assembly factors"""	21497	protein-coding gene	gene with protein product		611103	"""acyl-Coenzyme A dehydrogenase family, member 9"""			12359260, 21057504, 20816094	Standard	NM_014049		Approved	NPD002, MGC14452	uc003ela.4	Q9H845	OTTHUMG00000159942	ENST00000308982.7:c.379A>C	3.37:g.128614185A>C		211	0		123	6	NM_014049	0	0	13	13	0	D3DNB8|Q8WXX3	Silent	SNP	ENST00000308982.7	37	CCDS3053.1																																																																																			A|0.502;C|0.498		0.552	ACAD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358405.1	NM_014049	
FGFBP2	83888	bcgsc.ca	37	4	15964670	15964670	+	Missense_Mutation	SNP	C	C	T	rs35496730	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr4:15964670C>T	ENST00000259989.6	-	1	189	c.83G>A	c.(82-84)aGc>aAc	p.S28N	FGFBP2_ENST00000509331.1_Intron	NM_031950.3	NP_114156.1	Q9BYJ0	FGFP2_HUMAN	fibroblast growth factor binding protein 2	28			S -> N (in dbSNP:rs35496730).			extracellular region (GO:0005576)				central_nervous_system(1)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	9						CTCCCCAGTGCTTCCTTGCTT	0.577													C|||	606	0.121006	0.0794	0.1297	5008	,	,		20896	0.0853		0.1541	False		,,,				2504	0.1738				p.S28N		.											.	FGFBP2-22	0			c.G83A						.	C	ASN/SER	425,3981	206.5+/-228.1	21,383,1799	71.0	62.0	65.0		83	-2.1	0.0	4	dbSNP_126	65	1325,7275	259.8+/-282.9	112,1101,3087	yes	missense	FGFBP2	NM_031950.3	46	133,1484,4886	TT,TC,CC		15.407,9.6459,13.4553	benign	28/224	15964670	1750,11256	2203	4300	6503	SO:0001583	missense	83888	exon1			CCAGTGCTTCCTT	AB021123	CCDS3419.1	4p15.32	2008-07-16			ENSG00000137441	ENSG00000137441			29451	protein-coding gene	gene with protein product	"""killer-specific secretory protein of 37 kDa"""	607713				11342666, 12322897	Standard	NM_031950		Approved	KSP37	uc003gon.3	Q9BYJ0	OTTHUMG00000128513	ENST00000259989.6:c.83G>A	4.37:g.15964670C>T	ENSP00000259989:p.Ser28Asn	160	0		89	6	NM_031950	0	0	0	0	0		Missense_Mutation	SNP	ENST00000259989.6	37	CCDS3419.1	255	0.11675824175824176	39	0.07926829268292683	52	0.143646408839779	47	0.08216783216783216	117	0.15435356200527706	C	3.733	-0.055220	0.07362	0.096459	0.15407	ENSG00000137441	ENST00000259989	T	0.16073	2.37	2.98	-2.08	0.07254	.	1.294600	0.05643	U	0.583857	T	0.00039	0.0001	N	0.19112	0.55	0.80722	P	0.0	B	0.06786	0.001	B	0.11329	0.006	T	0.39542	-0.9609	9	0.18276	T	0.48	0.8044	3.5788	0.07945	0.1651:0.4992:0.0:0.3357	rs35496730	28	Q9BYJ0	FGFP2_HUMAN	N	28	ENSP00000259989:S28N	ENSP00000259989:S28N	S	-	2	0	FGFBP2	15573768	0.044000	0.20184	0.000000	0.03702	0.002000	0.02628	-0.015000	0.12634	-0.762000	0.04664	-0.896000	0.02909	AGC	C|0.872;T|0.128		0.577	FGFBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250324.1	NM_031950	
PTPN13	5783	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	87643581	87643581	+	Missense_Mutation	SNP	A	A	C			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	A	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr4:87643581A>C	ENST00000411767.2	+	10	1665	c.1602A>C	c.(1600-1602)aaA>aaC	p.K534N	PTPN13_ENST00000436978.1_Missense_Mutation_p.K534N|PTPN13_ENST00000427191.2_Missense_Mutation_p.K534N|PTPN13_ENST00000316707.6_Missense_Mutation_p.K534N|PTPN13_ENST00000511467.1_Missense_Mutation_p.K534N			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	534					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CTCAAAGAAAACTGAGGGTAA	0.428																																					p.K534N		.											.	PTPN13-230	0			c.A1602C						.						100.0	96.0	97.0					4																	87643581		1886	4114	6000	SO:0001583	missense	5783	exon10			AAGAAAACTGAGG		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1602A>C	4.37:g.87643581A>C	ENSP00000407249:p.Lys534Asn	287	0		341	147	NM_006264	0	0	0	0	0	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	ENST00000411767.2	37	CCDS47094.1	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360289	0.41801	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	4.92	0.888	0.19206	.	0.000000	0.49305	D	0.000156	T	0.36880	0.0983	L	0.49640	1.575	0.53688	D	0.999973	P;P;P;P	0.44044	0.712;0.825;0.732;0.825	P;B;B;B	0.51550	0.673;0.394;0.221;0.394	T	0.09530	-1.0670	10	0.48119	T	0.1	.	4.2347	0.10620	0.6104:0.0:0.248:0.1416	.	534;534;534;534	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	N	534;534;534;534;534;502	ENSP00000408368:K534N;ENSP00000394794:K534N;ENSP00000322675:K534N;ENSP00000407249:K534N;ENSP00000426626:K534N	ENSP00000322675:K534N	K	+	3	2	PTPN13	87862605	1.000000	0.71417	0.989000	0.46669	0.965000	0.64279	0.970000	0.29383	-0.023000	0.13963	0.533000	0.62120	AAA	.		0.428	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
COL25A1	84570	hgsc.bcm.edu;broad.mit.edu	37	4	109861707	109861707	+	Missense_Mutation	SNP	C	C	A			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr4:109861707C>A	ENST00000399132.1	-	10	1190	c.660G>T	c.(658-660)atG>atT	p.M220I	COL25A1_ENST00000399127.1_Missense_Mutation_p.M216I|COL25A1_ENST00000399126.1_Missense_Mutation_p.M220I	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		GTACTCCTGGCATTCCACGGG	0.597																																					p.M220I		.											.	COL25A1-92	0			c.G660T						.						102.0	101.0	101.0					4																	109861707		1892	4118	6010	SO:0001583	missense	84570	exon9			TCCTGGCATTCCA	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.660G>T	4.37:g.109861707C>A	ENSP00000382083:p.Met220Ile	78	0		58	4	NM_198721	0	0	0	0	0		Missense_Mutation	SNP	ENST00000399132.1	37	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	C	7.032	0.560825	0.13498	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126	D;D;D	0.94092	-3.35;-3.35;-3.35	5.47	5.47	0.80525	.	0.503801	0.24160	N	0.040993	D	0.85531	0.5718	N	0.05280	-0.08	0.34605	D	0.71694	B;B	0.19706	0.038;0.004	B;B	0.15484	0.013;0.003	T	0.82408	-0.0472	9	.	.	.	-2.6884	19.3339	0.94307	0.0:1.0:0.0:0.0	.	220;220	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	I	220;222;216;216;220	ENSP00000382083:M220I;ENSP00000382078:M216I;ENSP00000382077:M220I	.	M	-	3	0	COL25A1	110081156	1.000000	0.71417	1.000000	0.80357	0.359000	0.29487	2.591000	0.46163	2.557000	0.86248	0.555000	0.69702	ATG	.		0.597	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	
FRG1	2483	bcgsc.ca	37	4	190878589	190878589	+	Missense_Mutation	SNP	A	A	G	rs561930100	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr4:190878589A>G	ENST00000226798.4	+	6	691	c.469A>G	c.(469-471)Att>Gtt	p.I157V	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	157					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		TAGCTGCTTTATTAGATGCAA	0.363													.|||	11	0.00219649	0.0015	0.0058	5008	,	,		28209	0.001		0.004	False		,,,				2504	0.0				p.I157V		.											.	FRG1-90	0			c.A469G						.						15.0	18.0	17.0					4																	190878589		2157	4266	6423	SO:0001583	missense	2483	exon6			TGCTTTATTAGAT	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.469A>G	4.37:g.190878589A>G	ENSP00000226798:p.Ile157Val	407	11		284	12	NM_004477	0	0	64	64	0	A8K775	Missense_Mutation	SNP	ENST00000226798.4	37	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	10.14	1.269261	0.23221	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.42900	2.02;0.96	4.19	4.19	0.49359	Actin cross-linking (1);	0.049103	0.85682	D	0.000000	T	0.25938	0.0632	L	0.28014	0.82	0.48696	D	0.999699	B	0.09022	0.002	B	0.18871	0.023	T	0.08086	-1.0739	10	0.20519	T	0.43	-23.3336	6.6273	0.22837	0.8897:0.0:0.1103:0.0	.	157	Q14331	FRG1_HUMAN	V	157;29;94	ENSP00000226798:I157V;ENSP00000435943:I94V	ENSP00000226798:I157V	I	+	1	0	FRG1	191115583	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	5.196000	0.65136	1.677000	0.50941	0.373000	0.22412	ATT	.		0.363	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
SRD5A1	6715	hgsc.bcm.edu	37	5	6633779	6633779	+	Silent	SNP	C	C	G	rs248793	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr5:6633779C>G	ENST00000274192.5	+	1	324	c.90C>G	c.(88-90)cgC>cgG	p.R30R	NSUN2_ENST00000539938.1_5'Flank|SRD5A1_ENST00000538824.1_Missense_Mutation_p.A39G|SRD5A1_ENST00000504286.1_3'UTR|NSUN2_ENST00000506139.1_5'Flank|SRD5A1_ENST00000537411.1_Missense_Mutation_p.A39G|NSUN2_ENST00000264670.6_5'Flank	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	30				Missing (in Ref. 4; AAF14869). {ECO:0000305}.	androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	TCTTCGCGCGCAATCGTCAGA	0.746													G|||	2833	0.565695	0.6936	0.6816	5008	,	,		9293	0.3899		0.5537	False		,,,				2504	0.5041				p.R30R		.											.	SRD5A1-90	0			c.C90G						.	G		2367,1089		855,657,216	5.0	6.0	5.0		90	0.8	0.0	5	dbSNP_79	5	4176,3144		1277,1622,761	no	coding-synonymous	SRD5A1	NM_001047.2		2132,2279,977	GG,GC,CC		42.9508,31.5104,39.2817		30/260	6633779	6543,4233	1728	3660	5388	SO:0001819	synonymous_variant	6715	exon1			CGCGCGCAATCGT	M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.90C>G	5.37:g.6633779C>G		3	0		6	5	NM_001047	0	0	0	0	0	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Silent	SNP	ENST00000274192.5	37	CCDS3870.1	1204	0.5512820512820513	332	0.6747967479674797	242	0.6685082872928176	214	0.3741258741258741	416	0.5488126649076517	G	11.09	1.537057	0.27475	0.684896	0.570492	ENSG00000145545	ENST00000537411;ENST00000538824	T	0.23552	1.9	3.76	0.815	0.18763	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.28073	-1.0055	7	0.87932	D	0	-7.7997	5.3187	0.15870	0.1814:0.3179:0.5008:0.0	rs248793;rs1691051;rs17850143;rs17850363;rs57936391	39	F5GXK9	.	G	39	ENSP00000440186:A39G	ENSP00000446275:A39G	A	+	2	0	SRD5A1	6686779	0.019000	0.18553	0.000000	0.03702	0.000000	0.00434	1.407000	0.34657	-0.193000	0.10415	-0.132000	0.14878	GCA	C|0.454;G|0.546		0.746	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206903.1	NM_001047	
ARL10	285598	hgsc.bcm.edu	37	5	175792605	175792605	+	Silent	SNP	G	G	C	rs2303667	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr5:175792605G>C	ENST00000310389.5	+	1	135	c.39G>C	c.(37-39)ctG>ctC	p.L13L	MIR1271_ENST00000408537.1_RNA	NM_173664.4	NP_775935.1	Q8N8L6	ARL10_HUMAN	ADP-ribosylation factor-like 10	13					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(2)|lung(1)|ovary(1)	4	all_cancers(89;0.0064)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.0965)		TGCTGGCGCTGGGCGGCGCCG	0.756													G|||	2787	0.55651	0.5938	0.4928	5008	,	,		9772	0.5556		0.6093	False		,,,				2504	0.498				p.L13L		.											.	ARL10-91	0			c.G39C						.	G		1858,1528		603,652,438	3.0	4.0	3.0		39	3.2	0.8	5	dbSNP_100	3	4085,2705		1416,1253,726	no	coding-synonymous	ARL10	NM_173664.4		2019,1905,1164	CC,CG,GG		39.838,45.127,41.5979		13/245	175792605	5943,4233	1693	3395	5088	SO:0001819	synonymous_variant	285598	exon1			GGCGCTGGGCGGC	BK001673	CCDS4400.1	5q35.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000175414	ENSG00000175414		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	22042	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 10A"""	ARL10A			Standard	NM_173664		Approved		uc003mec.1	Q8N8L6	OTTHUMG00000130655	ENST00000310389.5:c.39G>C	5.37:g.175792605G>C		1	0		4	4	NM_173664	0	0	0	0	0		Silent	SNP	ENST00000310389.5	37	CCDS4400.1																																																																																			G|0.585;C|0.415		0.756	ARL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253145.2	NM_173664	
CNOT6	57472	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	179994980	179994980	+	Missense_Mutation	SNP	G	G	A	rs143354534		TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr5:179994980G>A	ENST00000393356.1	+	11	1428	c.1004G>A	c.(1003-1005)cGg>cAg	p.R335Q	CNOT6_ENST00000261951.4_Missense_Mutation_p.R335Q			Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	335	Nuclease domain. {ECO:0000250}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of ligand-dependent nuclear receptor transcription coactivator activity (GO:2000327)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	exoribonuclease activity (GO:0004532)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|skin(1)	23	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		CTAGAACTTCGGAAGGAATCG	0.413																																					p.R335Q		.											.	CNOT6-90	0			c.G1004A						.						147.0	133.0	138.0					5																	179994980		2203	4300	6503	SO:0001583	missense	57472	exon9			AACTTCGGAAGGA	AB033020	CCDS4455.1	5q35.3	2014-06-17			ENSG00000113300	ENSG00000113300			14099	protein-coding gene	gene with protein product		608951				11889047	Standard	XM_005265953		Approved	CCR4, KIAA1194, Ccr4a	uc003mlx.3	Q9ULM6	OTTHUMG00000130935	ENST00000393356.1:c.1004G>A	5.37:g.179994980G>A	ENSP00000377024:p.Arg335Gln	105	0		120	18	NM_015455	0	0	5	5	0	A7MD46|D3DWR0	Missense_Mutation	SNP	ENST00000393356.1	37	CCDS4455.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.282051	0.80692	.	.	ENSG00000113300	ENST00000261951;ENST00000393356	T;T	0.33865	1.39;1.39	5.49	5.49	0.81192	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	T	0.25975	0.0633	L	0.35723	1.085	0.80722	D	1	P	0.41159	0.74	B	0.33568	0.166	T	0.03103	-1.1072	9	.	.	.	-6.2753	13.0155	0.58754	0.0738:0.0:0.9262:0.0	.	335	Q9ULM6	CNOT6_HUMAN	Q	335	ENSP00000261951:R335Q;ENSP00000377024:R335Q	.	R	+	2	0	CNOT6	179927586	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.453000	0.66645	2.733000	0.93635	0.655000	0.94253	CGG	G|1.000;T|0.000		0.413	CNOT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253532.1	NM_015455	
C6orf222	389384	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	36298263	36298263	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr6:36298263G>T	ENST00000437635.2	-	2	382	c.205C>A	c.(205-207)Cac>Aac	p.H69N		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	69										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						GTGGTGCAGTGAGCCTCTGCA	0.627																																					p.H69N		.											.	C6orf222-93	0			c.C205A						.						47.0	50.0	49.0					6																	36298263		2203	4300	6503	SO:0001583	missense	389384	exon2			TGCAGTGAGCCTC		CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.205C>A	6.37:g.36298263G>T	ENSP00000418983:p.His69Asn	70	0		68	18	NM_001010903	0	0	0	0	0	B2RTY8	Missense_Mutation	SNP	ENST00000437635.2	37	CCDS34439.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.568893	0.28003	.	.	ENSG00000189325	ENST00000437635	T	0.41758	0.99	4.46	3.53	0.40419	.	0.701268	0.11822	N	0.526145	T	0.11580	0.0282	N	0.14661	0.345	0.09310	N	1	B	0.15930	0.015	B	0.14023	0.01	T	0.15464	-1.0436	10	0.33141	T	0.24	-6.8391	10.199	0.43071	0.0:0.0:0.8022:0.1978	.	69	P0C671	CF222_HUMAN	N	69	ENSP00000418983:H69N	ENSP00000418983:H69N	H	-	1	0	C6orf222	36406241	0.002000	0.14202	0.004000	0.12327	0.018000	0.09664	0.994000	0.29693	2.191000	0.70037	0.471000	0.43371	CAC	.		0.627	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040338.2	NM_001010903	
COL21A1	81578	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	55990909	55990909	+	Silent	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr6:55990909G>T	ENST00000244728.5	-	13	1978	c.1581C>A	c.(1579-1581)ggC>ggA	p.G527G	COL21A1_ENST00000370819.1_Silent_p.G524G|COL21A1_ENST00000535941.1_Silent_p.G527G	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	527	Collagen-like 2.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ATCCTGGCATGCCATGAAGCC	0.303																																					p.G527G		.											.	COL21A1-24	0			c.C1581A						.						20.0	21.0	21.0					6																	55990909		1785	3938	5723	SO:0001819	synonymous_variant	81578	exon13			TGGCATGCCATGA	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1581C>A	6.37:g.55990909G>T		185	0		135	28	NM_030820	0	0	0	0	0	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Silent	SNP	ENST00000244728.5	37	CCDS55025.1	.	.	.	.	.	.	.	.	.	.	G	7.986	0.752235	0.15778	.	.	ENSG00000124749	ENST00000456983	.	.	.	5.08	-2.84	0.05751	.	.	.	.	.	T	0.33760	0.0874	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38045	-0.9679	4	.	.	.	.	6.5619	0.22491	0.0:0.2064:0.1481:0.6456	.	.	.	.	E	91	.	.	A	-	2	0	COL21A1	56098868	0.826000	0.29277	0.758000	0.31321	0.927000	0.56198	-0.602000	0.05680	-0.621000	0.05633	-0.171000	0.13296	GCA	.		0.303	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041004.2		
CD109	135228	bcgsc.ca	37	6	74468692	74468692	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr6:74468692G>T	ENST00000287097.5	+	7	811	c.699G>T	c.(697-699)ttG>ttT	p.L233F	CD109_ENST00000422508.2_Missense_Mutation_p.L156F|CD109_ENST00000437994.2_Missense_Mutation_p.L233F			Q6YHK3	CD109_HUMAN	CD109 molecule	233					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AAGTGACTTTGCAGACACCAT	0.308																																					p.L233F		.											.	CD109-155	0			c.G699T						.						77.0	74.0	75.0					6																	74468692		2203	4296	6499	SO:0001583	missense	135228	exon7			GACTTTGCAGACA	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.699G>T	6.37:g.74468692G>T	ENSP00000287097:p.Leu233Phe	82	0		65	4	NM_133493	0	0	0	0	0	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	37	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	G	11.45	1.643507	0.29246	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.26810	1.71;2.0;1.72	5.16	3.31	0.37934	.	0.455812	0.21654	N	0.071134	T	0.09598	0.0236	L	0.47190	1.495	0.29243	N	0.872516	P;P;B;B	0.43024	0.798;0.493;0.058;0.077	B;B;B;B	0.38264	0.269;0.255;0.06;0.064	T	0.07654	-1.0761	10	0.72032	D	0.01	.	7.0469	0.25050	0.1719:0.1568:0.6713:0.0	.	156;233;233;233	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	F	233;156;233	ENSP00000388062:L233F;ENSP00000404475:L156F;ENSP00000287097:L233F	ENSP00000287097:L233F	L	+	3	2	CD109	74525413	1.000000	0.71417	0.968000	0.41197	0.528000	0.34623	0.827000	0.27421	1.419000	0.47118	0.462000	0.41574	TTG	.		0.308	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
TIAM2	26230	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	6	155469331	155469337	+	Frame_Shift_Del	DEL	GACACGC	GACACGC	-	rs200977411|rs146947115	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	GACACGC	GACACGC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr6:155469331_155469337delGACACGC	ENST00000461783.3	+	9	3164_3170	c.1891_1897delGACACGC	c.(1891-1899)gacacgctgfs	p.DTL631fs	TIAM2_ENST00000360366.4_Frame_Shift_Del_p.DTL631fs|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000529824.2_Frame_Shift_Del_p.DTL631fs|TIAM2_ENST00000456144.1_Frame_Shift_Del_p.DTL631fs|TIAM2_ENST00000528391.2_5'Flank|TIAM2_ENST00000456877.2_5'Flank|TIAM2_ENST00000318981.5_Frame_Shift_Del_p.DTL631fs			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	631					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TGGGAAAGAGGACACGCTGCGGCTGCT	0.517																																					p.631_633del		.											.	TIAM2-93	0			c.1891_1897del						.																																			SO:0001589	frameshift_variant	26230	exon6			AAAGAGGACACGC		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1891_1897delGACACGC	6.37:g.155469331_155469337delGACACGC	ENSP00000437188:p.Asp631fs	385	0		287	0	NM_012454	0	0	0	0	0	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Frame_Shift_Del	DEL	ENST00000461783.3	37	CCDS34558.1																																																																																			.		0.517	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
ANKIB1	54467	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	92027761	92027761	+	Missense_Mutation	SNP	T	T	G			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr7:92027761T>G	ENST00000265742.3	+	20	3144	c.2768T>G	c.(2767-2769)aTg>aGg	p.M923R		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	923							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GACAGCCTCATGAGACTAGGA	0.502																																					p.M923R		.											.	ANKIB1-432	0			c.T2768G						.						84.0	79.0	81.0					7																	92027761		1956	4158	6114	SO:0001583	missense	54467	exon20			GCCTCATGAGACT	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2768T>G	7.37:g.92027761T>G	ENSP00000265742:p.Met923Arg	163	0		189	95	NM_019004	0	0	6	7	1	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	ENST00000265742.3	37	CCDS47639.1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.534889	0.27475	.	.	ENSG00000001629	ENST00000265742	T	0.10192	2.9	5.61	1.69	0.24217	.	0.665097	0.17230	N	0.181978	T	0.05593	0.0147	N	0.12182	0.205	0.29461	N	0.857731	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.24333	-1.0163	10	0.37606	T	0.19	.	7.3873	0.26891	0.0:0.1316:0.1207:0.7477	.	275;923	Q4VBX8;Q9P2G1	.;AKIB1_HUMAN	R	923	ENSP00000265742:M923R	ENSP00000265742:M923R	M	+	2	0	ANKIB1	91865697	1.000000	0.71417	0.985000	0.45067	0.991000	0.79684	1.917000	0.39996	0.491000	0.27793	-0.261000	0.10672	ATG	.		0.502	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
THAP5	168451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	7	108205172	108205172	+	Silent	SNP	T	T	C	rs142576735		TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	T	T	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr7:108205172T>C	ENST00000415914.3	-	3	804	c.651A>G	c.(649-651)caA>caG	p.Q217Q	THAP5_ENST00000493722.1_5'UTR|THAP5_ENST00000313516.5_Silent_p.Q175Q|THAP5_ENST00000438865.1_3'UTR	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	217					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						TTTCCAAAGATTGATGAATAC	0.328													T|||	1	0.000199681	0.0	0.0	5008	,	,		18588	0.0		0.001	False		,,,				2504	0.0				p.Q217Q		.											.	THAP5-68	0			c.A651G						.	T	,	1,4403	2.1+/-5.4	0,1,2201	51.0	52.0	51.0		651,525	-4.0	0.0	7	dbSNP_134	51	0,8592		0,0,4296	no	coding-synonymous,coding-synonymous	THAP5	NM_001130475.1,NM_182529.2	,	0,1,6497	CC,CT,TT		0.0,0.0227,0.0077	,	217/396,175/354	108205172	1,12995	2202	4296	6498	SO:0001819	synonymous_variant	168451	exon3			CAAAGATTGATGA	AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.651A>G	7.37:g.108205172T>C		72	0		88	15	NM_001130475	0	0	5	5	0		Silent	SNP	ENST00000415914.3	37	CCDS47687.1																																																																																			T|1.000;C|0.000		0.328	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337777.2	NM_182529	
PCMTD1	115294	bcgsc.ca	37	8	52733110	52733110	+	Missense_Mutation	SNP	C	C	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr8:52733110C>T	ENST00000360540.5	-	7	1281	c.875G>A	c.(874-876)gGt>gAt	p.G292D	PCMTD1_ENST00000522514.1_Missense_Mutation_p.G292D|PCMTD1_ENST00000544451.1_Missense_Mutation_p.G216D|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	292						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				AAGCTGATTACCCACAAATAC	0.398																																					p.G292D		.											.	PCMTD1-68	0			c.G875A						.						192.0	187.0	189.0					8																	52733110		2203	4300	6503	SO:0001583	missense	115294	exon6			TGATTACCCACAA		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.875G>A	8.37:g.52733110C>T	ENSP00000353739:p.Gly292Asp	218	4		178	8	NM_052937	0	0	17	17	0	Q96FK9	Missense_Mutation	SNP	ENST00000360540.5	37	CCDS6148.1	.	.	.	.	.	.	.	.	.	.	C	17.90	3.501676	0.64298	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.44482	0.92;0.92;0.92	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.51193	0.1660	N	0.25485	0.75	0.80722	D	1	D;D;B	0.89917	0.976;1.0;0.004	P;D;B	0.97110	0.661;1.0;0.006	T	0.26258	-1.0108	10	0.08381	T	0.77	-32.1559	20.4239	0.99064	0.0:1.0:0.0:0.0	.	162;216;292	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	D	292;216;292	ENSP00000353739:G292D;ENSP00000444026:G216D;ENSP00000428099:G292D	ENSP00000353739:G292D	G	-	2	0	PCMTD1	52895663	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.046000	0.76592	2.828000	0.97474	0.655000	0.94253	GGT	.		0.398	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377909.2	NM_052937	
RIPK2	8767	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	90777603	90777603	+	Missense_Mutation	SNP	G	G	C			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr8:90777603G>C	ENST00000220751.4	+	3	676	c.362G>C	c.(361-363)aGa>aCa	p.R121T	RIPK2_ENST00000540020.1_5'UTR	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	121	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			TGGCCATTGAGATTTCGCATC	0.343																																					p.R121T		.											.	RIPK2-523	0			c.G362C						.						144.0	138.0	140.0					8																	90777603		2203	4300	6503	SO:0001583	missense	8767	exon3			CATTGAGATTTCG	AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.362G>C	8.37:g.90777603G>C	ENSP00000220751:p.Arg121Thr	62	0		100	54	NM_003821	0	0	0	1	1	B7Z748|Q6UWF0	Missense_Mutation	SNP	ENST00000220751.4	37	CCDS6247.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.296000	0.81025	.	.	ENSG00000104312	ENST00000220751	T	0.64438	-0.1	5.19	5.19	0.71726	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42172	D	0.000753	T	0.75057	0.3798	L	0.57130	1.785	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.77531	-0.2553	10	0.87932	D	0	-17.7169	14.3507	0.66699	0.0:0.1479:0.8521:0.0	.	121	O43353	RIPK2_HUMAN	T	121	ENSP00000220751:R121T	ENSP00000220751:R121T	R	+	2	0	RIPK2	90846740	1.000000	0.71417	0.994000	0.49952	0.985000	0.73830	7.870000	0.87175	2.422000	0.82143	0.655000	0.94253	AGA	.		0.343	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375686.1		
EXT1	2131	hgsc.bcm.edu;bcgsc.ca	37	8	118817057	118817057	+	Silent	SNP	C	C	T	rs142710059	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	C	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr8:118817057C>T	ENST00000378204.2	-	10	2765	c.1959G>A	c.(1957-1959)gaG>gaA	p.E653E		NM_000127.2	NP_000118.2	Q16394	EXT1_HUMAN	exostosin glycosyltransferase 1	653	Substrate binding. {ECO:0000250|UniProtKB:Q9ES89}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular polysaccharide biosynthetic process (GO:0033692)|embryonic skeletal joint development (GO:0072498)|endoderm development (GO:0007492)|gastrulation (GO:0007369)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm development (GO:0007498)|olfactory bulb development (GO:0021772)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(7)|kidney(1)|large_intestine(12)|lung(10)|ovary(3)|prostate(1)|stomach(1)|urinary_tract(2)	38	all_cancers(13;2.36e-26)|Lung NSC(37;5.02e-07)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.012)			TGAGAATGTCCTCACAATTGG	0.433			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Langer-Giedion syndrome;Hereditary Multiple Exostoses				C|||	25	0.00499201	0.0182	0.0014	5008	,	,		22060	0.0		0.0	False		,,,				2504	0.0				p.E653E		.	yes	Rec		Multiple Exostoses Type 1	8	8q24.11-q24.13	2131	multiple exostoses type 1 gene		M	.	EXT1-660	0			c.G1959A						.	C		64,4342	61.1+/-98.1	0,64,2139	199.0	184.0	189.0		1959	4.8	1.0	8	dbSNP_134	189	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	EXT1	NM_000127.2		0,66,6437	TT,TC,CC		0.0233,1.4526,0.5075		653/747	118817057	66,12940	2203	4300	6503	SO:0001819	synonymous_variant	2131	exon10	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II;HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	AATGTCCTCACAA	S79639	CCDS6324.1	8q24.11	2014-09-17	2013-03-01		ENSG00000182197	ENSG00000182197	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3512	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608177	"""Langer-Giedion syndrome chromosome region"", ""exostoses (multiple) 1"", ""exostosin 1"""	LGCR, LGS			Standard	NM_000127		Approved	ttv	uc003yok.1	Q16394	OTTHUMG00000059718	ENST00000378204.2:c.1959G>A	8.37:g.118817057C>T		284	0		286	19	NM_000127	0	0	30	31	1	B2R7V2|Q9BVI9	Silent	SNP	ENST00000378204.2	37	CCDS6324.1																																																																																			C|0.994;T|0.006		0.433	EXT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132768.3	NM_000127	
PRUNE2	158471	ucsc.edu	37	9	79318585	79318585	+	Silent	SNP	G	G	C	rs17180718	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	G	G	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr9:79318585G>C	ENST00000376718.3	-	9	8067	c.7944C>G	c.(7942-7944)gcC>gcG	p.A2648A	PRUNE2_ENST00000428286.1_Silent_p.A2289A	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2648					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CTGAGTCCCTGGCATCCAGTG	0.532													G|||	151	0.0301518	0.0	0.0	5008	,	,		17443	0.0933		0.0119	False		,,,				2504	0.046				p.A2648A		.											.	PRUNE2-157	0			c.C7944G						.	G		8,3128		0,8,1560	49.0	46.0	47.0		7944	-3.3	0.0	9	dbSNP_123	47	88,7076		0,88,3494	no	coding-synonymous	PRUNE2	NM_015225.2		0,96,5054	CC,CG,GG		1.2284,0.2551,0.932		2648/3089	79318585	96,10204	1568	3582	5150	SO:0001819	synonymous_variant	158471	exon9			GTCCCTGGCATCC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7944C>G	9.37:g.79318585G>C		52	0		37	4	NM_015225	0	0	0	0	0	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	37	CCDS47982.1	57	0.0260989010989011	0	0.0	0	0.0	48	0.08391608391608392	9	0.011873350923482849	G	5.383	0.255973	0.10185	0.002551	0.012284	ENSG00000106772	ENST00000426088	.	.	.	5.62	-3.28	0.05033	.	.	.	.	.	T	0.00845	0.0028	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	T	0.21381	-1.0247	4	.	.	.	-0.2289	0.992	0.01459	0.417:0.1771:0.2262:0.1797	rs17180718;rs17180718	.	.	.	E	1970	.	.	Q	-	1	0	PRUNE2	78508405	0.000000	0.05858	0.001000	0.08648	0.067000	0.16453	-0.564000	0.05936	-0.225000	0.09913	0.579000	0.79373	CAG	G|0.976;C|0.024		0.532	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
INVS	27130	broad.mit.edu;ucsc.edu;bcgsc.ca	37	9	103008983	103008983	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr9:103008983G>T	ENST00000262457.2	+	8	1177	c.992G>T	c.(991-993)gGc>gTc	p.G331V	INVS_ENST00000541287.1_Missense_Mutation_p.G235V|INVS_ENST00000262456.2_Missense_Mutation_p.G331V	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	331					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				TGGGCAGCTGGCAAAGGCAGT	0.408																																					p.G331V		.											.	INVS-92	0			c.G992T						.						124.0	112.0	116.0					9																	103008983		2203	4300	6503	SO:0001583	missense	27130	exon8			CAGCTGGCAAAGG	AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.992G>T	9.37:g.103008983G>T	ENSP00000262457:p.Gly331Val	405	1		250	27	NM_183245	0	0	0	0	0	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Missense_Mutation	SNP	ENST00000262457.2	37	CCDS6746.1	.	.	.	.	.	.	.	.	.	.	G	33	5.194233	0.94960	.	.	ENSG00000119509	ENST00000262457;ENST00000541287;ENST00000262456	T;T;T	0.63913	-0.07;-0.07;-0.07	5.81	5.81	0.92471	Ankyrin repeat-containing domain (4);	0.045672	0.85682	D	0.000000	T	0.73202	0.3557	L	0.59436	1.845	0.80722	D	1	P;P;P	0.52316	0.868;0.952;0.868	P;P;P	0.58130	0.804;0.833;0.589	T	0.66077	-0.6013	10	0.22109	T	0.4	.	20.0758	0.97742	0.0:0.0:1.0:0.0	.	235;331;331	F5GZH2;Q9Y283;Q9Y283-2	.;INVS_HUMAN;.	V	331;235;331	ENSP00000262457:G331V;ENSP00000444454:G235V;ENSP00000262456:G331V	ENSP00000262456:G331V	G	+	2	0	INVS	102048804	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	9.860000	0.99555	2.763000	0.94921	0.650000	0.86243	GGC	.		0.408	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053407.1	NM_014425	
OR1L8	138881	bcgsc.ca	37	9	125330325	125330325	+	Silent	SNP	C	C	G	rs10985703	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	C	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr9:125330325C>G	ENST00000304865.2	-	1	513	c.432G>C	c.(430-432)ctG>ctC	p.L144L		NM_001004454.1	NP_001004454.1	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L, member 8	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						AGGCCACCAGCAGGACACAGT	0.547													G|||	2119	0.423123	0.3283	0.389	5008	,	,		21856	0.8006		0.2555	False		,,,				2504	0.3589				p.L144L		.											.	OR1L8-70	0			c.G432C						.	G		1441,2965	683.9+/-404.3	239,963,1001	117.0	87.0	97.0		432	-0.9	0.0	9	dbSNP_120	97	2239,6361	708.8+/-405.7	293,1653,2354	no	coding-synonymous	OR1L8	NM_001004454.1		532,2616,3355	GG,GC,CC		26.0349,32.7054,28.2946		144/310	125330325	3680,9326	2203	4300	6503	SO:0001819	synonymous_variant	138881	exon1			CACCAGCAGGACA		CCDS35124.1	9q33.2	2013-09-20			ENSG00000171496	ENSG00000171496		"""GPCR / Class A : Olfactory receptors"""	15110	protein-coding gene	gene with protein product							Standard	NM_001004454		Approved		uc004bmp.1	Q8NGR8	OTTHUMG00000020609	ENST00000304865.2:c.432G>C	9.37:g.125330325C>G		309	1		220	7	NM_001004454	0	0	0	0	0	A3KFM3|B9EIR6|Q6IF15|Q96R79	Silent	SNP	ENST00000304865.2	37	CCDS35124.1																																																																																			C|0.662;G|0.338		0.547	OR1L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053939.1		
NOTCH1	4851	bcgsc.ca	37	9	139407932	139407932	+	Silent	SNP	A	A	G	rs2229971|rs587778559	byFrequency	TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	A	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr9:139407932A>G	ENST00000277541.6	-	14	2340	c.2265T>C	c.(2263-2265)aaT>aaC	p.N755N		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	755	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		ATTCACACTCATTGTTGTTGA	0.602			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)			G|||	2643	0.527756	0.6997	0.4784	5008	,	,		19531	0.7768		0.335	False		,,,				2504	0.272				p.N755N		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.T2265C						.	G		2695,1683		864,967,358	109.0	123.0	118.0		2265	-2.3	0.0	9	dbSNP_98	118	2445,6109		358,1729,2190	no	coding-synonymous	NOTCH1	NM_017617.3		1222,2696,2548	GG,GA,AA		28.5831,38.4422,39.7464		755/2556	139407932	5140,7792	2189	4277	6466	SO:0001819	synonymous_variant	4851	exon14			ACACTCATTGTTG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2265T>C	9.37:g.139407932A>G		206	2		111	7	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Silent	SNP	ENST00000277541.6	37	CCDS43905.1																																																																																			A|0.484;G|0.516		0.602	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
NOTCH1	4851	broad.mit.edu	37	9	139411769	139411769	+	Missense_Mutation	SNP	G	G	T			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr9:139411769G>T	ENST00000277541.6	-	9	1585	c.1510C>A	c.(1510-1512)Cgc>Agc	p.R504S	MIR4673_ENST00000584777.1_RNA	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	504	EGF-like 13; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TCCAGGCAGCGGCCATTGTGC	0.682			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.R504S		.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1-5459	0			c.C1510A						.						28.0	36.0	34.0					9																	139411769		2096	4230	6326	SO:0001583	missense	4851	exon9			GGCAGCGGCCATT	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1510C>A	9.37:g.139411769G>T	ENSP00000277541:p.Arg504Ser	181	1		90	3	NM_017617	0	0	0	0	0	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518457	0.27211	.	.	ENSG00000148400	ENST00000277541	D	0.86865	-2.18	4.55	2.5	0.30297	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.514261	0.20982	N	0.082198	T	0.67543	0.2904	N	0.02854	-0.475	0.28981	N	0.888665	B	0.17852	0.024	B	0.30401	0.115	T	0.58228	-0.7673	10	0.12430	T	0.62	.	6.2555	0.20872	0.0:0.1396:0.4699:0.3904	.	504	P46531	NOTC1_HUMAN	S	504	ENSP00000277541:R504S	ENSP00000277541:R504S	R	-	1	0	NOTCH1	138531590	1.000000	0.71417	0.999000	0.59377	0.899000	0.52679	2.328000	0.43867	2.067000	0.61834	0.563000	0.77884	CGC	.		0.682	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
FOXO4	4303	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	X	70321291	70321294	+	Frame_Shift_Del	DEL	CCTC	CCTC	-			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	CCTC	CCTC	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chrX:70321291_70321294delCCTC	ENST00000374259.3	+	2	1543_1546	c.1211_1214delCCTC	c.(1210-1215)tcctccfs	p.SS404fs	FOXO4_ENST00000341558.3_Frame_Shift_Del_p.SS349fs	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	404					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					GGGCTTCCTTCCTCCAGTAAGCTG	0.618																																					p.404_405del		.											.	FOXO4-986	0			c.1211_1214del						.																																			SO:0001589	frameshift_variant	4303	exon2			TTCCTTCCTCCAG		CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.1211_1214delCCTC	X.37:g.70321291_70321294delCCTC	ENSP00000363377:p.Ser404fs	70	0		74	33	NM_005938	0	0	0	0	0	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Frame_Shift_Del	DEL	ENST00000374259.3	37	CCDS43969.1																																																																																			.		0.618	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057115.1	NM_005938	
CYLC1	1538	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	83128178	83128178	+	Silent	SNP	A	A	G			TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10			-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chrX:83128178A>G	ENST00000329312.4	+	4	499	c.462A>G	c.(460-462)agA>agG	p.R154R		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	154					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						AAACTAAAAGACAAAATGAGG	0.333																																					p.R154R		.											.	CYLC1-112	0			c.A462G						.						22.0	20.0	21.0					X																	83128178		2194	4275	6469	SO:0001819	synonymous_variant	1538	exon4			TAAAAGACAAAAT	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.462A>G	X.37:g.83128178A>G		82	1		81	79	NM_021118	0	0	0	0	0	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	37	CCDS35341.1																																																																																			.		0.333	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
NUP188	23511	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	9	131719265	131719266	+	Frame_Shift_Ins	INS	-	-	GT	rs373820270		TCGA-PK-A5H8-01A-11D-A29I-10	TCGA-PK-A5H8-10A-01D-A29L-10	-	-	-	-	-	-	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina GAIIx	59162a9b-9c64-4525-80ea-143fd766b6b2	cf83fa12-254e-4252-8a99-ac629bc5118b	g.chr9:131719265_131719266insGT	ENST00000372577.2	+	5	302_303	c.281_282insGT	c.(280-285)cagtgtfs	p.QC94fs	NUP188_ENST00000550219.1_3'UTR|RP11-101E3.5_ENST00000482796.1_Frame_Shift_Ins_p.S115fs	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	94					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						CAGTTACTCCAGTGTTACCTGC	0.436																																					p.Q94fs		.											.	NUP188-207	0			c.281_282insGT						.																																			SO:0001589	frameshift_variant	23511	exon5			TACTCCAGTGTTA	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.284_285dupGT	9.37:g.131719268_131719269dupGT	ENSP00000361658:p.Gln94fs	206	0		118	48	NM_015354	0	0	0	0	0	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Frame_Shift_Ins	INS	ENST00000372577.2	37	CCDS35156.1																																																																																			.		0.436	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
