#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_match_norm_validation_allele1	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_tumor_sample
TAS1R3	83756	broad.mit.edu	37	1	1268918	1268918	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:1268918G>T	ENST00000339381.5	+	6	1665	c.1633G>T	c.(1633-1635)Gag>Tag	p.E545*		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	545	Required for brazzein responsiveness.				detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		TGGCCAGGATGAGTGGTCCCC	0.637																																						uc010nyk.1		NaN																	0					0						c.(1633-1635)GAG>TAG		taste receptor, type 1, member 3 precursor	Aspartame(DB00168)						49.0	56.0	54.0					1																	1268918		2203	4299	6502	SO:0001587	stop_gained	83756				detection of chemical stimulus involved in sensory perception of sweet taste|sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity	g.chr1:1268918G>T	AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.1633G>T	1.37:g.1268918G>T	ENSP00000344411:p.Glu545*						p.E545*	NM_152228	NP_689414	Q7RTX0	TS1R3_HUMAN		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)	6	1633	+	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)	545			Extracellular (Potential).|Required for brazzein responsiveness.		Q5TA49|Q8NGW9	Nonsense_Mutation	SNP	ENST00000339381.5	37	c.1633G>T	CCDS30556.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.317643	0.60524	.	.	ENSG00000169962	ENST00000339381	.	.	.	4.16	-0.0922	0.13658	.	0.221317	0.39407	N	0.001367	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	11.2973	0.49286	0.1236:0.499:0.3774:0.0	.	.	.	.	X	545	.	ENSP00000344411:E545X	E	+	1	0	TAS1R3	1258781	0.158000	0.22850	0.130000	0.21974	0.030000	0.12068	0.662000	0.25038	-0.178000	0.10672	-0.485000	0.04761	GAG		0.637	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008493.1				22	60	1	0	1.88708e-17	0.008361	2.09522e-17	22	60		
CD164L2	388611	broad.mit.edu	37	1	27706644	27706644	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:27706644C>T	ENST00000374030.1	-	5	555	c.415G>A	c.(415-417)Ggg>Agg	p.G139R	CD164L2_ENST00000374027.3_Missense_Mutation_p.G139R			Q6UWJ8	C16L2_HUMAN	CD164 sialomucin-like 2	139						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		AAGCTGGCCCCGTCAAATCCA	0.617																																						uc001boc.2		NaN																	0					0						c.(415-417)GGG>AGG		CD164 sialomucin-like 2							131.0	113.0	119.0					1																	27706644		2203	4300	6503	SO:0001583	missense	388611					integral to membrane		g.chr1:27706644C>T	AY358761	CCDS302.1	1p36.11	2008-02-05			ENSG00000174950	ENSG00000174950			32043	protein-coding gene	gene with protein product							Standard	XM_005245868		Approved		uc001boc.3	Q6UWJ8	OTTHUMG00000003395	ENST00000374030.1:c.415G>A	1.37:g.27706644C>T	ENSP00000363142:p.Gly139Arg						p.G139R	NM_207397	NP_997280	Q6UWJ8	C16L2_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)	5	491	-		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)	139			Extracellular (Potential).		B2RPJ0|Q5JXD6	Missense_Mutation	SNP	ENST00000374030.1	37	c.415G>A		.	.	.	.	.	.	.	.	.	.	C	17.45	3.393916	0.62066	.	.	ENSG00000174950	ENST00000374030;ENST00000374027	T;T	0.48522	0.81;0.81	5.79	4.88	0.63580	.	0.318884	0.23157	N	0.051292	T	0.53077	0.1774	L	0.41824	1.3	0.58432	D	0.999999	D	0.69078	0.997	D	0.63113	0.911	T	0.53830	-0.8383	10	0.54805	T	0.06	-20.4219	7.5125	0.27581	0.1647:0.752:0.0:0.0833	.	139	Q6UWJ8	C16L2_HUMAN	R	139	ENSP00000363142:G139R;ENSP00000363139:G139R	ENSP00000363139:G139R	G	-	1	0	CD164L2	27579231	0.029000	0.19370	0.737000	0.30932	0.677000	0.39632	0.876000	0.28092	1.447000	0.47661	0.655000	0.94253	GGG		0.617	CD164L2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000009518.1		NM_207397		5	93	0	0	0	0.00308	0	5	93		
FOXD2	2306	broad.mit.edu	37	1	47904409	47904409	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:47904409G>A	ENST00000334793.5	+	1	2721	c.602G>A	c.(601-603)tGg>tAg	p.W201*		NM_004474.3	NP_004465.3	O60548	FOXD2_HUMAN	forkhead box D2	201					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4				READ - Rectum adenocarcinoma(2;0.0908)		GGCAACTACTGGACGCTGGAC	0.672																																						uc001crm.2		NaN																	0					0						c.(601-603)TGG>TAG		forkhead box D2							55.0	67.0	63.0					1																	47904409		2203	4300	6503	SO:0001587	stop_gained	2306				axon extension involved in axon guidance|cartilage development|dichotomous subdivision of terminal units involved in ureteric bud branching|embryo development|enteric nervous system development|iridophore differentiation|lateral line nerve glial cell development|melanocyte differentiation|neural crest cell migration|pattern specification process|peripheral nervous system development|positive regulation of BMP signaling pathway|positive regulation of kidney development|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|sympathetic nervous system development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding	g.chr1:47904409G>A	AF042832	CCDS30708.1	1p34-p32	2008-02-05			ENSG00000186564	ENSG00000186564		"""Forkhead boxes"""	3803	protein-coding gene	gene with protein product		602211		FKHL17		9403061, 12621056	Standard	NM_004474		Approved	FREAC9	uc001crm.3	O60548	OTTHUMG00000007950	ENST00000334793.5:c.602G>A	1.37:g.47904409G>A	ENSP00000335493:p.Trp201*						p.W201*	NM_004474	NP_004465	O60548	FOXD2_HUMAN		READ - Rectum adenocarcinoma(2;0.0908)	1	2721	+			201			Fork-head.		Q5SVZ3	Nonsense_Mutation	SNP	ENST00000334793.5	37	c.602G>A	CCDS30708.1	.	.	.	.	.	.	.	.	.	.	G	52	20.021551	0.99926	.	.	ENSG00000186564	ENST00000334793	.	.	.	4.2	3.28	0.37604	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.7043	0.45946	0.0976:0.0:0.9024:0.0	.	.	.	.	X	201	.	ENSP00000335493:W201X	W	+	2	0	FOXD2	47676996	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.101000	0.94219	0.733000	0.32492	0.436000	0.28706	TGG		0.672	FOXD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021831.1		NM_004474		53	131	0	0	0	0.01441	0	53	131		
CRNN	49860	broad.mit.edu	37	1	152382699	152382700	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:152382699_152382700CA>TG	ENST00000271835.3	-	3	920_921	c.858_859TG>CA	c.(856-861)caTGct>caCAct	p.A287T	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	287	Gln-rich.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)	p.H286H(1)		breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTATCTGAGCATGTCCTCCTG	0.614																																						uc001ezx.2		NaN																	1	Substitution - coding silent(1)		endometrium(1)	ovary(2)|skin(1)	3						c.(856-861)CATGCT>CACACT		cornulin																																				SO:0001583	missense	49860				cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding	g.chr1:152382699_152382700CA>TG	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.858_859delinsTG	1.37:g.152382699_152382700delinsTG	ENSP00000271835:p.Ala287Thr						p.A287T	NM_016190	NP_057274	Q9UBG3	CRNN_HUMAN	LUSC - Lung squamous cell carcinoma(543;0.206)		3	932_933	-	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		287			Gln-rich.		B2RE60|Q8N613	Missense_Mutation	DNP	ENST00000271835.3	37	c.858_859TG>CA	CCDS1010.1																																																																																				0.614	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1		NM_016190		7	508	0	0	0	0.004672	0	7	508		
PYGO2	90780	broad.mit.edu	37	1	154933468	154933468	+	Missense_Mutation	SNP	C	C	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:154933468C>A	ENST00000368457.2	-	2	309	c.138G>T	c.(136-138)agG>agT	p.R46S	PYGO2_ENST00000483463.1_5'UTR|SHC1_ENST00000490667.1_5'Flank|RP11-307C12.12_ENST00000605085.1_RNA|PYGO2_ENST00000368456.1_Missense_Mutation_p.R9S	NM_138300.3	NP_612157.1	Q9BRQ0	PYGO2_HUMAN	pygopus family PHD finger 2	46	Pro-rich.				brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|developmental growth (GO:0048589)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mammary gland development (GO:0030879)|palate development (GO:0060021)|positive regulation of chromatin binding (GO:0035563)|post-embryonic development (GO:0009791)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|spermatid nucleus differentiation (GO:0007289)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone acetyltransferase regulator activity (GO:0035034)|zinc ion binding (GO:0008270)	p.R46S(1)		endometrium(2)|large_intestine(2)|lung(3)|skin(2)|urinary_tract(1)	10	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TATTTGACTTCCTTCGCTTCT	0.502																																					NSCLC(87;357 1460 1955 21029 23522)	uc001fft.2		NaN																	1	Substitution - Missense(1)		lung(1)	skin(1)	1						c.(136-138)AGG>AGT		pygopus homolog 2							334.0	329.0	331.0					1																	154933468		2203	4300	6503	SO:0001583	missense	90780				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding	g.chr1:154933468C>A	BC006132	CCDS1075.1	1q22	2013-10-09	2013-10-09		ENSG00000163348	ENSG00000163348		"""Zinc fingers, PHD-type"""	30257	protein-coding gene	gene with protein product		606903	"""pygopus homolog 2 (Drosophila)"""			11988739	Standard	NM_138300		Approved		uc001fft.3	Q9BRQ0	OTTHUMG00000037370	ENST00000368457.2:c.138G>T	1.37:g.154933468C>A	ENSP00000357442:p.Arg46Ser						p.R46S	NM_138300	NP_612157	Q9BRQ0	PYGO2_HUMAN	BRCA - Breast invasive adenocarcinoma(34;0.00034)		2	344	-	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		46			Nuclear localization signal (Potential).|Pro-rich.		Q8WYZ4|Q96CY2	Missense_Mutation	SNP	ENST00000368457.2	37	c.138G>T	CCDS1075.1	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226379	0.58668	.	.	ENSG00000163348	ENST00000368457;ENST00000368456	T;T	0.62941	-0.01;0.04	4.57	-4.51	0.03483	.	0.061001	0.64402	D	0.000012	T	0.45054	0.1323	L	0.34521	1.04	0.26314	N	0.977777	P	0.51653	0.947	D	0.67231	0.95	T	0.50259	-0.8849	10	0.72032	D	0.01	-8.035	6.2615	0.20903	0.0:0.2169:0.3177:0.4654	.	46	Q9BRQ0	PYGO2_HUMAN	S	46;9	ENSP00000357442:R46S;ENSP00000357441:R9S	ENSP00000357441:R9S	R	-	3	2	PYGO2	153200092	0.822000	0.29219	0.936000	0.37596	0.906000	0.53458	-0.163000	0.09997	-0.684000	0.05183	-0.678000	0.03780	AGG		0.502	PYGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090949.1		NM_138300		8	436	1	0	6.40141e-05	0.010729	6.80713e-05	8	436		
PIGC	5279	broad.mit.edu	37	1	172410941	172410941	+	Silent	SNP	A	A	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:172410941A>G	ENST00000367728.1	-	1	2285	c.822T>C	c.(820-822)ctT>ctC	p.L274L	PIGC_ENST00000484368.1_Intron|C1orf105_ENST00000367727.4_Intron|PIGC_ENST00000258324.1_Silent_p.L274L|PIGC_ENST00000344529.4_Silent_p.L274L			Q92535	PIGC_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class C	274					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			breast(1)|endometrium(1)|kidney(1)|lung(1)	4						TTTCTTTAAAAAGCTGCAAGC	0.438																																						uc001gil.2		NaN																	0				lung(1)	1						c.(820-822)CTT>CTC		phosphatidylinositol glycan, class C							97.0	100.0	99.0					1																	172410941		2203	4300	6503	SO:0001819	synonymous_variant	5279				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex|integral to membrane	phosphatidylinositol N-acetylglucosaminyltransferase activity	g.chr1:172410941A>G	BC006539	CCDS1302.1	1q23-q25	2013-02-26	2006-06-28		ENSG00000135845	ENSG00000135845	2.4.1.198	"""Phosphatidylinositol glycan anchor biosynthesis"""	8960	protein-coding gene	gene with protein product	"""phosphatidylinositol N-acetylglucosaminyltransferase"""	601730	"""phosphatidylinositol glycan, class C"""			8806613, 9325057	Standard	NM_153747		Approved		uc001gio.3	Q92535	OTTHUMG00000034751	ENST00000367728.1:c.822T>C	1.37:g.172410941A>G						PIGC_uc001gii.1_Intron|PIGC_uc001gij.1_Intron|C1orf105_uc001gik.2_Intron|PIGC_uc001gin.2_Silent_p.L274L|PIGC_uc001gio.2_Silent_p.L274L	p.L274L	NM_153747	NP_714969	Q92535	PIGC_HUMAN			2	1103	-			274					O14491	Silent	SNP	ENST00000367728.1	37	c.822T>C	CCDS1302.1																																																																																				0.438	PIGC-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084068.1		NM_153747		17	57	0	0	0	0.006122	0	17	57		
ASPM	259266	broad.mit.edu	37	1	197059202	197059202	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:197059202C>T	ENST00000367409.4	-	25	10098	c.9842G>A	c.(9841-9843)aGa>aAa	p.R3281K	ASPM_ENST00000367408.1_Missense_Mutation_p.R946K|ASPM_ENST00000294732.7_Missense_Mutation_p.R1696K	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3281					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TGGAGACAATCTAGTAACTAC	0.333																																						uc001gtu.2		NaN																	0				ovary(4)|central_nervous_system(2)	6						c.(9841-9843)AGA>AAA		asp (abnormal spindle)-like, microcephaly							63.0	68.0	66.0					1																	197059202		2203	4300	6503	SO:0001583	missense	259266				mitosis	cytoplasm|nucleus	calmodulin binding	g.chr1:197059202C>T	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9842G>A	1.37:g.197059202C>T	ENSP00000356379:p.Arg3281Lys					ASPM_uc001gtv.2_Missense_Mutation_p.R1696K|ASPM_uc001gtw.3_Missense_Mutation_p.R1129K	p.R3281K	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN			25	10099	-			3281					Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	ENST00000367409.4	37	c.9842G>A	CCDS1389.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.302817	0.81136	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.45668	0.89;0.89;0.89	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.58075	0.2097	L	0.56396	1.775	0.27112	N	0.962358	D;P;D	0.65815	0.995;0.952;0.984	P;P;P	0.57468	0.787;0.607;0.821	T	0.53114	-0.8484	10	0.44086	T	0.13	.	19.7217	0.96145	0.0:1.0:0.0:0.0	.	1267;1696;3281	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	K	3281;1696;946;1267	ENSP00000356379:R3281K;ENSP00000294732:R1696K;ENSP00000356378:R946K	ENSP00000294732:R1696K	R	-	2	0	ASPM	195325825	1.000000	0.71417	0.408000	0.26446	0.977000	0.68977	7.178000	0.77657	2.659000	0.90383	0.591000	0.81541	AGA		0.333	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1		NM_018136		14	37	0	0	0	0.006122	0	14	37		
PPFIA4	8497	broad.mit.edu	37	1	203025554	203025554	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:203025554G>A	ENST00000447715.2	+	23	2533	c.2092G>A	c.(2092-2094)Gag>Aag	p.E698K	PPFIA4_ENST00000295706.4_Missense_Mutation_p.E214K|PPFIA4_ENST00000599966.1_Missense_Mutation_p.E214K|PPFIA4_ENST00000272198.6_Missense_Mutation_p.E214K|PPFIA4_ENST00000367240.2_Missense_Mutation_p.E699K|PPFIA4_ENST00000414050.2_Missense_Mutation_p.E427K			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	698					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						CATAAAATGTGAGACTTCTCC	0.577																																						uc001gyz.2		NaN																	0				ovary(4)|skin(1)	5						c.(640-642)GAG>AAG		protein tyrosine phosphatase, receptor type, f							57.0	63.0	61.0					1																	203025554		2015	4165	6180	SO:0001583	missense	8497				cell communication	cell surface|cytoplasm	protein binding	g.chr1:203025554G>A	AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.2092G>A	1.37:g.203025554G>A	ENSP00000402576:p.Glu698Lys					PPFIA4_uc009xaj.2_Missense_Mutation_p.E845K|PPFIA4_uc010pqf.1_Missense_Mutation_p.E427K|PPFIA4_uc001gza.2_Missense_Mutation_p.E214K|PPFIA4_uc001gzb.1_5'Flank	p.E214K	NM_015053	NP_055868	O75335	LIPA4_HUMAN			5	1233	+			214					A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Missense_Mutation	SNP	ENST00000447715.2	37	c.640G>A		.	.	.	.	.	.	.	.	.	.	g	36	5.601851	0.96614	.	.	ENSG00000143847	ENST00000367240;ENST00000447715;ENST00000295706;ENST00000414050;ENST00000272198	T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71	4.78	4.78	0.61160	.	0.000000	0.45867	D	0.000330	T	0.52773	0.1755	M	0.76328	2.33	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.999;0.998	D;D;D;D	0.81914	0.99;0.928;0.995;0.989	T	0.57705	-0.7765	10	0.72032	D	0.01	-30.3338	18.0072	0.89213	0.0:0.0:1.0:0.0	.	427;698;214;214	B4DIS5;B1N949;O75335-2;O75335	.;.;.;LIPA4_HUMAN	K	699;698;214;427;214	ENSP00000356209:E699K;ENSP00000402576:E698K;ENSP00000295706:E214K;ENSP00000400379:E427K;ENSP00000272198:E214K	ENSP00000272198:E214K	E	+	1	0	PPFIA4	201292177	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.578000	0.98200	2.489000	0.83994	0.457000	0.33378	GAG		0.577	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1		NM_015053		9	51	0	0	0	0.010729	0	9	51		
NFASC	23114	broad.mit.edu	37	1	204951129	204951129	+	Silent	SNP	C	C	T	rs576309017		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr1:204951129C>T	ENST00000401399.1	+	20	2650	c.2451C>T	c.(2449-2451)atC>atT	p.I817I	NFASC_ENST00000360049.4_Silent_p.I813I|NFASC_ENST00000367170.4_Silent_p.I817I|NFASC_ENST00000513543.1_Silent_p.I813I|NFASC_ENST00000404907.1_Silent_p.I813I|NFASC_ENST00000367172.4_Silent_p.I817I|NFASC_ENST00000367169.4_Silent_p.I817I|NFASC_ENST00000404076.1_Silent_p.I796I|NFASC_ENST00000338586.6_Silent_p.I817I|NFASC_ENST00000367171.4_Silent_p.I802I|NFASC_ENST00000539706.1_Silent_p.I813I|NFASC_ENST00000339876.6_Silent_p.I817I|NFASC_ENST00000338515.6_Silent_p.I817I			O94856	NFASC_HUMAN	neurofascin	817	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGTCCGTCATCGGTTACTCCG	0.607													c|||	1	0.000199681	0.0	0.0	5008	,	,		18391	0.0		0.001	False		,,,				2504	0.0					uc001hbj.2		NaN																	0				ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						c.(2449-2451)ATC>ATT		neurofascin isoform 1 precursor							55.0	52.0	53.0					1																	204951129		2203	4300	6503	SO:0001819	synonymous_variant	23114				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding	g.chr1:204951129C>T	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2451C>T	1.37:g.204951129C>T						NFASC_uc010pra.1_Silent_p.I813I|NFASC_uc001hbi.2_Silent_p.I813I|NFASC_uc010prb.1_Silent_p.I828I|NFASC_uc010prc.1_Silent_p.I384I|NFASC_uc001hbk.1_Silent_p.I623I|NFASC_uc001hbl.1_Silent_p.I67I	p.I817I	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)		21	2779	+	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		817			Extracellular (Potential).|Fibronectin type-III 2.		B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Silent	SNP	ENST00000401399.1	37	c.2451C>T	CCDS53460.1	.	.	.	.	.	.	.	.	.	.	c	2.141	-0.396835	0.04899	.	.	ENSG00000163531	ENST00000367173;ENST00000425360	.	.	.	5.55	-1.19	0.09585	.	.	.	.	.	T	0.58481	0.2125	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56001	-0.8051	4	.	.	.	.	11.7971	0.52106	0.0:0.4303:0.0:0.5697	.	.	.	.	L	787;49	.	.	S	+	2	0	NFASC	203217752	0.827000	0.29292	0.995000	0.50966	0.235000	0.25334	-0.069000	0.11542	-0.099000	0.12263	-1.309000	0.01313	TCG		0.607	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1		NM_001005388		9	19	0	0	0	0.016723	0	9	19		
ANKRD30A	91074	broad.mit.edu	37	10	37431050	37431050	+	Missense_Mutation	SNP	G	G	C	rs201391167		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr10:37431050G>C	ENST00000602533.1	+	7	1156	c.1057G>C	c.(1057-1059)Gca>Cca	p.A353P	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.A353P|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.A353P			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	409					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A353P(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ATTTACGTGGGCAGCAAAAGG	0.408																																						uc001iza.1		NaN																	1	Substitution - Missense(1)		lung(1)	ovary(7)|breast(1)|skin(1)	9						c.(1057-1059)GCA>CCA		ankyrin repeat domain 30A							102.0	102.0	102.0					10																	37431050		1853	4086	5939	SO:0001583	missense	91074					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity	g.chr10:37431050G>C	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1057G>C	10.37:g.37431050G>C	ENSP00000473551:p.Ala353Pro						p.A353P	NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN			7	1156	+			409					Q5W025	Missense_Mutation	SNP	ENST00000602533.1	37	c.1057G>C		.	.	.	.	.	.	.	.	.	.	.	2.178	-0.388156	0.04932	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.39592	1.19;1.07	.	.	.	.	.	.	.	.	T	0.28300	0.0699	N	0.08118	0	0.09310	N	1	P	0.48350	0.909	P	0.51297	0.665	T	0.16188	-1.0411	7	0.33141	T	0.24	.	.	.	.	.	409	Q9BXX3	AN30A_HUMAN	P	353	ENSP00000354432:A353P;ENSP00000363792:A353P	ENSP00000354432:A353P	A	+	1	0	ANKRD30A	37471056	0.782000	0.28689	0.179000	0.23059	0.179000	0.23085	-0.616000	0.05591	0.088000	0.17205	0.089000	0.15464	GCA		0.408	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2		NM_052997		4	61	0	0	0	0.009096	0	4	61		
ZNF248	57209	broad.mit.edu	37	10	38121105	38121105	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr10:38121105G>C	ENST00000395867.3	-	6	1728	c.1178C>G	c.(1177-1179)tCa>tGa	p.S393*	AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000374648.3_Intron|ZNF248_ENST00000494133.1_Intron|ZNF248_ENST00000357328.4_Nonsense_Mutation_p.S393*	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						AGTGAGGTTTGACTTCTCCCA	0.453																																						uc001izd.1		NaN																	0				ovary(1)	1						c.(1177-1179)TCA>TGA		zinc finger protein 248							98.0	98.0	98.0					10																	38121105		2203	4299	6502	SO:0001587	stop_gained	57209				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr10:38121105G>C	AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.1178C>G	10.37:g.38121105G>C	ENSP00000379208:p.Ser393*					ZNF248_uc009xmc.2_Intron|ZNF248_uc001izb.2_Intron|ZNF248_uc001izc.2_Intron|ZNF248_uc010qeu.1_Nonsense_Mutation_p.S393*	p.S393*	NM_021045	NP_066383	Q8NDW4	ZN248_HUMAN			6	1677	-			393			C2H2-type 2.		Q8NDV8|Q9UMP3	Nonsense_Mutation	SNP	ENST00000395867.3	37	c.1178C>G	CCDS7194.1	.	.	.	.	.	.	.	.	.	.	G	37	6.236061	0.97399	.	.	ENSG00000198105	ENST00000395867;ENST00000357328	.	.	.	4.6	4.6	0.57074	.	0.000000	0.40469	N	0.001095	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.2871	0.73835	0.0:0.0:1.0:0.0	.	.	.	.	X	393	.	ENSP00000349882:S393X	S	-	2	0	ZNF248	38161111	0.083000	0.21467	1.000000	0.80357	0.991000	0.79684	1.381000	0.34362	2.550000	0.86006	0.557000	0.71058	TCA		0.453	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047609.1		NM_021045		23	70	0	0	0	0.016522	0	23	70		
EGR2	1959	broad.mit.edu	37	10	64575663	64575663	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr10:64575663C>G	ENST00000242480.3	-	1	452	c.127G>C	c.(127-129)Gaa>Caa	p.E43Q	EGR2_ENST00000493899.2_5'UTR|EGR2_ENST00000411732.1_5'UTR|EGR2_ENST00000439032.1_Missense_Mutation_p.E43Q	NM_000399.3|NM_001136177.1	NP_000390.2|NP_001129649.1	P11161	EGR2_HUMAN	early growth response 2	43					brain development (GO:0007420)|brain segmentation (GO:0035284)|cell death (GO:0008219)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|facial nerve structural organization (GO:0021612)|fat cell differentiation (GO:0045444)|learning or memory (GO:0007611)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein sumoylation (GO:0016925)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ossification (GO:0030278)|response to insulin (GO:0032868)|rhombomere 3 formation (GO:0021660)|rhombomere 5 formation (GO:0021666)|rhythmic behavior (GO:0007622)|Schwann cell differentiation (GO:0014037)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	36	Prostate(12;0.0297)|all_hematologic(501;0.228)					CCTCCCAGTTCGGCATTGGGA	0.622																																						uc010qim.1		NaN																	0				ovary(2)	2						c.(127-129)GAA>CAA		early growth response 2 protein isoform a							109.0	103.0	105.0					10																	64575663		2203	4300	6503	SO:0001583	missense	1959				fat cell differentiation|protein export from nucleus|transcription from RNA polymerase II promoter	cytoplasm|nucleus	chromatin binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|ubiquitin protein ligase binding|zinc ion binding	g.chr10:64575663C>G	BC035625	CCDS7267.1, CCDS44409.1	10q21.1	2014-09-17	2009-04-23		ENSG00000122877	ENSG00000122877		"""Zinc fingers, C2H2-type"""	3239	protein-coding gene	gene with protein product	"""Krox-20 homolog, Drosophila"""	129010	"""early growth response 2 (Krox-20 homolog, Drosophila)"""	KROX20			Standard	NM_000399		Approved		uc001jmi.3	P11161	OTTHUMG00000018308	ENST00000242480.3:c.127G>C	10.37:g.64575663C>G	ENSP00000242480:p.Glu43Gln					EGR2_uc010qin.1_5'UTR|EGR2_uc001jmi.2_Missense_Mutation_p.E43Q|EGR2_uc010qio.1_Missense_Mutation_p.E56Q|EGR2_uc009xph.2_Missense_Mutation_p.E43Q	p.E43Q	NM_001136177	NP_001129649	P11161	EGR2_HUMAN			2	281	-	Prostate(12;0.0297)|all_hematologic(501;0.228)		43					B2R724|B3KRD7|Q68CZ5|Q8IV26|Q9UNA6	Missense_Mutation	SNP	ENST00000242480.3	37	c.127G>C	CCDS7267.1	.	.	.	.	.	.	.	.	.	.	C	18.45	3.626920	0.66901	.	.	ENSG00000122877	ENST00000242480;ENST00000439032;ENST00000432380	T;T	0.14391	2.51;2.51	5.1	5.1	0.69264	.	0.054626	0.64402	D	0.000001	T	0.09730	0.0239	N	0.14661	0.345	0.80722	D	1	P	0.43578	0.811	B	0.36567	0.228	T	0.12837	-1.0532	10	0.62326	D	0.03	-12.6597	17.7043	0.88304	0.0:1.0:0.0:0.0	.	43	P11161	EGR2_HUMAN	Q	43;43;56	ENSP00000242480:E43Q;ENSP00000402040:E43Q	ENSP00000242480:E43Q	E	-	1	0	EGR2	64245669	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	5.190000	0.65104	2.548000	0.85928	0.556000	0.70494	GAA		0.622	EGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048245.2		NM_000399		4	140	0	0	0	0.009096	0	4	140		
PANK1	53354	broad.mit.edu	37	10	91353589	91353589	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr10:91353589C>T	ENST00000307534.4	-	4	1623	c.1468G>A	c.(1468-1470)Gga>Aga	p.G490R	PANK1_ENST00000342512.3_Missense_Mutation_p.G265R|PANK1_ENST00000371774.2_Missense_Mutation_p.G292R|PANK1_ENST00000322191.6_Intron|MIR107_ENST00000362127.1_RNA	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	490					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						ACAGCAGATCCTTGAAGGCCA	0.448																																						uc001kgp.1		NaN																	0					0						c.(1468-1470)GGA>AGA		pantothenate kinase 1 isoform alpha	Bezafibrate(DB01393)						222.0	193.0	203.0					10																	91353589		2203	4300	6503	SO:0001583	missense	53354				coenzyme A biosynthetic process|pantothenate metabolic process	cytosol|nucleus	ATP binding|pantothenate kinase activity	g.chr10:91353589C>T	AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.1468G>A	10.37:g.91353589C>T	ENSP00000302108:p.Gly490Arg					PANK1_uc001kgn.1_Missense_Mutation_p.G265R|PANK1_uc001kgo.1_Intron|PANK1_uc009xtu.1_Missense_Mutation_p.G292R|uc001kgq.1_5'Flank|MIR107_hsa-mir-107|MI0000114_5'Flank	p.G490R	NM_148977	NP_683878	Q8TE04	PANK1_HUMAN			4	1624	-			490					A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	ENST00000307534.4	37	c.1468G>A	CCDS31244.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692844	0.88735	.	.	ENSG00000152782	ENST00000342512;ENST00000371774;ENST00000307534;ENST00000371775	D;D;D	0.99637	-6.29;-6.29;-6.29	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.99739	0.9897	M	0.90870	3.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.995;1.0;0.995	D	0.97938	1.0324	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	292;490;265	Q8TE04-4;Q8TE04;Q8TE04-2	.;PANK1_HUMAN;.	R	265;292;490;353	ENSP00000345118:G265R;ENSP00000360839:G292R;ENSP00000302108:G490R	ENSP00000302108:G490R	G	-	1	0	PANK1	91343569	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.760000	0.85248	2.941000	0.99782	0.655000	0.94253	GGA		0.448	PANK1-201	KNOWN	basic|CCDS	protein_coding	protein_coding					7	155	0	0	0	0.008291	0	7	155		
CFAP43	80217	broad.mit.edu	37	10	105948076	105948076	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr10:105948076C>T	ENST00000278064.2	-	13	1757	c.1432G>A	c.(1432-1434)Ggg>Agg	p.G478R	WDR96_ENST00000428666.1_Missense_Mutation_p.G548R|WDR96_ENST00000357060.3_Missense_Mutation_p.G547R																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTGCTTCTCCCTGCTTCTGGA	0.463																																						uc001kxw.2		NaN																	0					0						c.(1639-1641)GGG>AGG		hypothetical protein LOC80217							176.0	142.0	154.0					10																	105948076		2203	4300	6503	SO:0001583	missense	80217							g.chr10:105948076C>T																												ENST00000278064.2:c.1432G>A	10.37:g.105948076C>T	ENSP00000278064:p.Gly478Arg					C10orf79_uc009xxq.2_5'Flank|C10orf79_uc001kxx.3_Missense_Mutation_p.G548R	p.G547R	NM_025145	NP_079421	Q8NDM7	WDR96_HUMAN		Epithelial(162;4.83e-10)|all cancers(201;2.26e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0194)	13	1755	-		Colorectal(252;0.178)	547						Missense_Mutation	SNP	ENST00000278064.2	37	c.1639G>A		.	.	.	.	.	.	.	.	.	.	C	2.941	-0.218893	0.06101	.	.	ENSG00000197748	ENST00000357060;ENST00000428666;ENST00000278064	T;T;T	0.13778	2.59;2.58;2.56	5.67	2.82	0.32997	WD40 repeat-like-containing domain (1);	1.101830	0.07033	N	0.828807	T	0.10766	0.0263	L	0.32530	0.975	0.09310	N	1	B;B	0.14438	0.01;0.003	B;B	0.11329	0.006;0.006	T	0.41106	-0.9527	10	0.12103	T	0.63	.	8.1928	0.31379	0.0:0.7453:0.0:0.2547	.	548;547	B4DHB6;Q8NDM7	.;WDR96_HUMAN	R	547;548;478	ENSP00000349568:G547R;ENSP00000400289:G548R;ENSP00000278064:G478R	ENSP00000278064:G478R	G	-	1	0	WDR96	105938066	0.000000	0.05858	0.002000	0.10522	0.078000	0.17371	0.585000	0.23879	0.761000	0.33130	0.561000	0.74099	GGG		0.463	WDR96-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050200.1				3	46	0	0	0	0.004672	0	3	46		
ACADSB	36	broad.mit.edu	37	10	124793889	124793889	+	Silent	SNP	G	G	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr10:124793889G>T	ENST00000358776.4	+	2	74	c.60G>T	c.(58-60)ctG>ctT	p.L20L	ACADSB_ENST00000496730.2_3'UTR|ACADSB_ENST00000368869.4_5'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	20					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	GAAATTTCCTGACTTGTTTGT	0.353																																						uc001lhb.2		NaN																	0				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						c.(58-60)CTG>CTT		acyl-Coenzyme A dehydrogenase, short/branched	L-Isoleucine(DB00167)						145.0	143.0	144.0					10																	124793889		2203	4300	6503	SO:0001819	synonymous_variant	36				branched chain family amino acid catabolic process|fatty acid metabolic process	mitochondrial matrix	flavin adenine dinucleotide binding	g.chr10:124793889G>T	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.60G>T	10.37:g.124793889G>T						ACADSB_uc010qub.1_5'UTR	p.L20L	NM_001609	NP_001600	P45954	ACDSB_HUMAN		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	2	177	+		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)	20					B4DQ51|Q5SQN6|Q96CX7	Silent	SNP	ENST00000358776.4	37	c.60G>T	CCDS7634.1	.	.	.	.	.	.	.	.	.	.	G	0.540	-0.854041	0.02630	.	.	ENSG00000196177	ENST00000411816	.	.	.	5.0	-10.0	0.00425	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8148	0.40846	0.3347:0.1858:0.4795:0.0	.	.	.	.	L	26	.	.	X	+	2	2	ACADSB	124783879	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	-0.202000	0.09451	-2.005000	0.00959	-1.130000	0.01982	TGA		0.353	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050843.1		NM_001609		15	22	1	0	1.37522e-17	0.007413	1.53821e-17	15	22		
KLC2	64837	broad.mit.edu	37	11	66033397	66033397	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr11:66033397C>T	ENST00000417856.1	+	13	1759	c.1516C>T	c.(1516-1518)Cgc>Tgc	p.R506C	RP11-867G23.1_ENST00000530805.1_RNA|KLC2_ENST00000421552.1_Missense_Mutation_p.R429C|KLC2_ENST00000394067.2_Missense_Mutation_p.R506C|RAB1B_ENST00000527397.1_5'Flank|KLC2_ENST00000394066.2_Missense_Mutation_p.R429C|RP11-867G23.2_ENST00000533287.1_RNA|KLC2_ENST00000394078.1_Intron|RAB1B_ENST00000311481.6_5'Flank|KLC2_ENST00000394065.2_Missense_Mutation_p.R367C|KLC2_ENST00000316924.5_Missense_Mutation_p.R506C	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	506					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						GGGAGACCGCCGCAGCAGCCG	0.667																																						uc010rov.1		NaN																	0					0						c.(1516-1518)CGC>TGC		kinesin light chain 2 isoform 1							23.0	30.0	28.0					11																	66033397		2182	4269	6451	SO:0001583	missense	64837				blood coagulation	cytosol|kinesin complex|microtubule	microtubule motor activity|protein binding	g.chr11:66033397C>T	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.1516C>T	11.37:g.66033397C>T	ENSP00000399403:p.Arg506Cys					KLC2_uc010row.1_Missense_Mutation_p.R506C|KLC2_uc009yra.2_Intron|KLC2_uc001ohb.2_Missense_Mutation_p.R506C|KLC2_uc010rox.1_Missense_Mutation_p.R429C|KLC2_uc001ohc.2_Missense_Mutation_p.R506C|KLC2_uc001ohd.2_Missense_Mutation_p.R429C|KLC2_uc001ohe.1_Missense_Mutation_p.R367C|RAB1B_uc001ohf.2_5'Flank	p.R506C	NM_001134775	NP_001128247	Q9H0B6	KLC2_HUMAN			13	1759	+			506					A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Missense_Mutation	SNP	ENST00000417856.1	37	c.1516C>T	CCDS8130.1	.	.	.	.	.	.	.	.	.	.	C	17.11	3.306782	0.60305	.	.	ENSG00000174996	ENST00000417856;ENST00000394067;ENST00000316924;ENST00000421552;ENST00000394066;ENST00000394065	T;T;T;T;T;D	0.84589	-1.24;-1.24;-1.24;-1.22;-1.22;-1.87	3.71	3.71	0.42584	.	0.000000	0.64402	D	0.000005	D	0.86665	0.5987	L	0.48642	1.525	0.58432	D	0.999993	D;D;D	0.71674	0.997;0.993;0.998	P;B;P	0.61275	0.649;0.446;0.886	D	0.86757	0.1964	10	0.66056	D	0.02	-8.0662	8.9942	0.36041	0.0:0.8891:0.0:0.1109	.	367;429;506	A8MZ87;A8MXL7;Q9H0B6	.;.;KLC2_HUMAN	C	506;506;506;429;429;367	ENSP00000399403:R506C;ENSP00000377631:R506C;ENSP00000314837:R506C;ENSP00000408484:R429C;ENSP00000377630:R429C;ENSP00000377629:R367C	ENSP00000314837:R506C	R	+	1	0	KLC2	65789973	0.965000	0.33210	0.994000	0.49952	0.619000	0.37552	0.591000	0.23969	1.901000	0.55032	0.491000	0.48974	CGC		0.667	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258200.1		NM_022822		4	67	0	0	0	0.001168	0	4	67		
TENM4	26011	broad.mit.edu	37	11	78419499	78419499	+	Missense_Mutation	SNP	G	G	C	rs370684363		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr11:78419499G>C	ENST00000278550.7	-	27	4578	c.4116C>G	c.(4114-4116)atC>atG	p.I1372M		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1372					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CATTCTGATCGATGCGTCTGA	0.507																																						uc001ozl.3		NaN																	0				ovary(2)|pancreas(2)	4						c.(4114-4116)ATC>ATG		odz, odd Oz/ten-m homolog 4							107.0	105.0	106.0					11																	78419499		2070	4213	6283	SO:0001583	missense	26011				signal transduction	integral to membrane		g.chr11:78419499G>C	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.4116C>G	11.37:g.78419499G>C	ENSP00000278550:p.Ile1372Met						p.I1372M	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN			27	4579	-			1372			Extracellular (Potential).|NHL 3.		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	37	c.4116C>G	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	G	17.35	3.366427	0.61513	.	.	ENSG00000149256	ENST00000278550	D	0.91068	-2.78	5.52	-0.701	0.11269	Six-bladed beta-propeller, TolB-like (1);	0.104389	0.64402	D	0.000004	D	0.93808	0.8020	M	0.85099	2.735	0.44635	D	0.997614	D	0.76494	0.999	D	0.81914	0.995	D	0.90860	0.4738	9	.	.	.	.	7.4215	0.27075	0.4893:0.0:0.402:0.1086	.	1372	Q6N022	TEN4_HUMAN	M	1372	ENSP00000278550:I1372M	.	I	-	3	3	ODZ4	78097147	0.189000	0.23263	0.988000	0.46212	0.992000	0.81027	-0.236000	0.09003	-0.271000	0.09272	-0.312000	0.09012	ATC		0.507	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2				37	20	0	0	0	0.00623	0	37	20		
SYTL2	54843	broad.mit.edu	37	11	85420380	85420380	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr11:85420380G>C	ENST00000528231.1	-	12	2271	c.1994C>G	c.(1993-1995)tCa>tGa	p.S665*	SYTL2_ENST00000529581.1_Nonsense_Mutation_p.S107*|SYTL2_ENST00000533892.1_Nonsense_Mutation_p.S67*|SYTL2_ENST00000389960.4_Nonsense_Mutation_p.S641*|SYTL2_ENST00000527523.1_Nonsense_Mutation_p.S633*|SYTL2_ENST00000359152.5_Nonsense_Mutation_p.S1511*|SYTL2_ENST00000525423.1_Nonsense_Mutation_p.S987*|SYTL2_ENST00000316356.4_Nonsense_Mutation_p.S666*|SYTL2_ENST00000524452.1_Nonsense_Mutation_p.S641*|SYTL2_ENST00000525702.1_Nonsense_Mutation_p.S107*|SYTL2_ENST00000389958.3_Nonsense_Mutation_p.S96*|SYTL2_ENST00000354566.3_Nonsense_Mutation_p.S1003*	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	665	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TTACGGGTCTGAACGCTGTTT	0.413																																						uc010rth.1		NaN																	0				ovary(2)|large_intestine(1)	3						c.(1993-1995)TCA>TGA		synaptotagmin-like 2 isoform g							124.0	127.0	126.0					11																	85420380		2203	4299	6502	SO:0001587	stop_gained	54843				intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding	g.chr11:85420380G>C	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1994C>G	11.37:g.85420380G>C	ENSP00000431701:p.Ser665*					SYTL2_uc010rtg.1_Nonsense_Mutation_p.S666*|SYTL2_uc010rti.1_Nonsense_Mutation_p.S641*|SYTL2_uc010rtj.1_Nonsense_Mutation_p.S633*|SYTL2_uc001pav.2_Nonsense_Mutation_p.S107*|SYTL2_uc010rte.1_Nonsense_Mutation_p.S67*|SYTL2_uc001pax.2_Nonsense_Mutation_p.S107*|SYTL2_uc001paz.2_5'UTR|SYTL2_uc001pba.2_Nonsense_Mutation_p.S50*|SYTL2_uc001pay.2_Nonsense_Mutation_p.S96*|SYTL2_uc001paw.2_Nonsense_Mutation_p.S67*|SYTL2_uc009yvj.2_RNA|SYTL2_uc001pbd.2_Nonsense_Mutation_p.S963*|SYTL2_uc001pbb.2_Nonsense_Mutation_p.S1003*|SYTL2_uc001pbc.2_Nonsense_Mutation_p.S987*|SYTL2_uc010rtf.1_Nonsense_Mutation_p.S483*	p.S665*	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)	12	2270	-		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)	665			C2 1.		B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Nonsense_Mutation	SNP	ENST00000528231.1	37	c.1994C>G	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	G	34	5.378016	0.95945	.	.	ENSG00000137501	ENST00000389960;ENST00000359152;ENST00000354566;ENST00000316356;ENST00000525702;ENST00000525423;ENST00000529581;ENST00000389958;ENST00000530351;ENST00000528231;ENST00000533892;ENST00000527523;ENST00000524452;ENST00000533057;ENST00000527794;ENST00000529534	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.587	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	641;1511;1003;666;107;987;107;96;382;665;67;633;641;31;67;107	.	.	S	-	2	0	SYTL2	85098028	1.000000	0.71417	0.973000	0.42090	0.934000	0.57294	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	TCA		0.413	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1		NM_206927		40	49	0	0	0	0.01441	0	40	49		
PRB2	653247	broad.mit.edu	37	12	11546868	11546868	+	Silent	SNP	T	T	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:11546868T>C	ENST00000389362.4	-	3	179	c.144A>G	c.(142-144)caA>caG	p.Q48Q	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	48						extracellular region (GO:0005576)		p.?(1)|p.A39_G59delAPPQGGNKPQGPPSPPGKPQG(1)		NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			ATGGGGGACCTTGAGGTTTGT	0.547																																						uc010shk.1		NaN																	2	Unknown(1)|Deletion - In frame(1)		stomach(2)		0						c.(142-144)CAA>CAG		proline-rich protein BstNI subfamily 2							128.0	144.0	139.0					12																	11546868		2157	4279	6436	SO:0001819	synonymous_variant	653247							g.chr12:11546868T>C	K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.144A>G	12.37:g.11546868T>C							p.Q48Q	NM_006248	NP_006239			OV - Ovarian serous cystadenocarcinoma(49;0.185)		3	179	-		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)						O00599|P02811|P04281	Silent	SNP	ENST00000389362.4	37	c.144A>G	CCDS41757.2																																																																																				0.547	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346925.2		NM_006248		5	217	0	0	0	0.00308	0	5	217		
KRT73	319101	broad.mit.edu	37	12	53007514	53007514	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:53007514G>A	ENST00000305748.3	-	5	976	c.942C>T	c.(940-942)gcC>gcT	p.A314A	RP11-641A6.2_ENST00000549180.1_RNA|RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	314	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGCTCTTCCGGGCGATCTCCT	0.587																																						uc001sas.2		NaN																	0				large_intestine(2)|ovary(2)|skin(2)	6						c.(940-942)GCC>GCT		keratin 73							115.0	99.0	105.0					12																	53007514		2203	4300	6503	SO:0001819	synonymous_variant	319101					keratin filament	structural molecule activity	g.chr12:53007514G>A	AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.942C>T	12.37:g.53007514G>A							p.A314A	NM_175068	NP_778238	Q86Y46	K2C73_HUMAN		BRCA - Breast invasive adenocarcinoma(357;0.189)	5	977	-			314			Rod.|Coil 2.		Q32MB2	Silent	SNP	ENST00000305748.3	37	c.942C>T	CCDS8834.1																																																																																				0.587	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405700.1		NM_175068		19	71	0	0	0	0.012319	0	19	71		
HOXC4	3221	broad.mit.edu	37	12	54448079	54448079	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:54448079C>T	ENST00000430889.2	+	1	419	c.373C>T	c.(373-375)Ccc>Tcc	p.P125S	HOXC4_ENST00000303406.4_Missense_Mutation_p.P125S|HOXC4_ENST00000609810.1_Missense_Mutation_p.P125S	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	125					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						CCCCGACCATCCCTCCAGCGC	0.637																																						uc001seu.2		NaN																	0				ovary(1)	1						c.(373-375)CCC>TCC		homeobox C4							21.0	21.0	21.0					12																	54448079		2201	4299	6500	SO:0001583	missense	3221					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chr12:54448079C>T		CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.373C>T	12.37:g.54448079C>T	ENSP00000399808:p.Pro125Ser					HOXC4_uc001sex.2_Missense_Mutation_p.P125S	p.P125S	NM_014620	NP_055435	P09017	HXC4_HUMAN			3	1053	+			125						Missense_Mutation	SNP	ENST00000430889.2	37	c.373C>T	CCDS8873.1	.	.	.	.	.	.	.	.	.	.	C	11.70	1.717949	0.30413	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	D;D	0.90563	-2.69;-2.69	4.26	4.26	0.50523	.	0.282787	0.32836	N	0.005593	D	0.87281	0.6138	L	0.51853	1.615	0.58432	D	0.999991	B	0.26744	0.158	B	0.19946	0.027	D	0.85154	0.0988	10	0.36615	T	0.2	.	15.9728	0.80034	0.0:1.0:0.0:0.0	.	125	P09017	HXC4_HUMAN	S	125	ENSP00000305973:P125S;ENSP00000399808:P125S	ENSP00000305973:P125S	P	+	1	0	HOXC4	52734346	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.473000	0.60196	2.367000	0.80283	0.462000	0.41574	CCC		0.637	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358963.1				6	27	0	0	0	0.00308	0	6	27		
TMEM5	10329	broad.mit.edu	37	12	64196067	64196067	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:64196067G>C	ENST00000261234.6	+	4	783	c.625G>C	c.(625-627)Gag>Cag	p.E209Q	TMEM5_ENST00000537373.1_5'UTR	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	209						integral component of plasma membrane (GO:0005887)				breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		TTGTGATAATGAGTGGATAAA	0.393																																						uc001srq.1		NaN																	0					0						c.(625-627)GAG>CAG		transmembrane protein 5							83.0	80.0	81.0					12																	64196067		2203	4300	6503	SO:0001583	missense	10329					integral to plasma membrane		g.chr12:64196067G>C	AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.625G>C	12.37:g.64196067G>C	ENSP00000261234:p.Glu209Gln					TMEM5_uc001srr.1_Missense_Mutation_p.E106Q|TMEM5_uc001srs.1_5'UTR	p.E209Q	NM_014254	NP_055069	Q9Y2B1	TMEM5_HUMAN	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)	4	729	+		Myeloproliferative disorder(1001;0.0255)	209			Extracellular (Potential).		A8K017|Q6PKD6	Missense_Mutation	SNP	ENST00000261234.6	37	c.625G>C	CCDS8966.1	.	.	.	.	.	.	.	.	.	.	G	7.867	0.727332	0.15439	.	.	ENSG00000118600	ENST00000261234	.	.	.	4.93	4.03	0.46877	.	0.342434	0.34700	N	0.003750	T	0.45915	0.1366	L	0.38531	1.155	0.80722	D	1	P	0.34757	0.467	B	0.32864	0.154	T	0.38329	-0.9666	8	.	.	.	-14.9176	14.2039	0.65721	0.074:0.0:0.926:0.0	.	209	Q9Y2B1	TMEM5_HUMAN	Q	209	.	.	E	+	1	0	TMEM5	62482334	1.000000	0.71417	0.960000	0.40013	0.018000	0.09664	4.271000	0.58902	1.383000	0.46405	0.591000	0.81541	GAG		0.393	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400821.1		NM_014254		8	36	0	0	0	0.006214	0	8	36		
XPOT	11260	broad.mit.edu	37	12	64812728	64812728	+	Missense_Mutation	SNP	A	A	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:64812728A>G	ENST00000332707.5	+	6	872	c.343A>G	c.(343-345)Aca>Gca	p.T115A		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	115	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.T115A(2)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		GCTTTTTGTTACAGAGTATCT	0.433																																						uc001ssb.2		NaN																	2	Substitution - Missense(2)		kidney(2)	ovary(2)	2						c.(343-345)ACA>GCA		tRNA exportin							108.0	103.0	105.0					12																	64812728		2203	4300	6503	SO:0001583	missense	11260				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding	g.chr12:64812728A>G	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.343A>G	12.37:g.64812728A>G	ENSP00000327821:p.Thr115Ala					XPOT_uc009zqm.1_Missense_Mutation_p.T25A	p.T115A	NM_007235	NP_009166	O43592	XPOT_HUMAN		GBM - Glioblastoma multiforme(28;0.0404)	6	769	+			115			Necessary for interaction with Ran, nuclear localization and nuclear import.		A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	37	c.343A>G	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	A	7.950	0.744725	0.15710	.	.	ENSG00000184575	ENST00000332707;ENST00000400935	T;T	0.39406	1.08;1.08	4.78	4.78	0.61160	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.149484	0.64402	D	0.000017	T	0.19046	0.0457	N	0.02296	-0.605	0.46356	D	0.999	B	0.18610	0.029	B	0.14578	0.011	T	0.09596	-1.0667	9	.	.	.	.	14.633	0.68671	1.0:0.0:0.0:0.0	.	115	O43592	XPOT_HUMAN	A	115	ENSP00000327821:T115A;ENSP00000383722:T115A	.	T	+	1	0	XPOT	63098995	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.253000	0.78320	1.918000	0.55548	0.455000	0.32223	ACA		0.433	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1		NM_007235		5	42	0	0	0	0.001168	0	5	42		
XPOT	11260	broad.mit.edu	37	12	64812733	64812733	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:64812733G>A	ENST00000332707.5	+	6	877	c.348G>A	c.(346-348)gaG>gaA	p.E116E		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	116	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.E116E(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		TTGTTACAGAGTATCTCACTA	0.438																																						uc001ssb.2		NaN																	1	Substitution - coding silent(1)		kidney(1)	ovary(2)	2						c.(346-348)GAG>GAA		tRNA exportin							113.0	107.0	109.0					12																	64812733		2203	4300	6503	SO:0001819	synonymous_variant	11260				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding	g.chr12:64812733G>A	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.348G>A	12.37:g.64812733G>A						XPOT_uc009zqm.1_Silent_p.E26E	p.E116E	NM_007235	NP_009166	O43592	XPOT_HUMAN		GBM - Glioblastoma multiforme(28;0.0404)	6	774	+			116			Necessary for interaction with Ran, nuclear localization and nuclear import.		A6NLH1|O43784|Q8WUG2|Q9BVS7	Silent	SNP	ENST00000332707.5	37	c.348G>A	CCDS31852.1																																																																																				0.438	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1		NM_007235		5	42	0	0	0	0.001168	0	5	42		
XPOT	11260	broad.mit.edu	37	12	64812808	64812808	+	Silent	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:64812808C>G	ENST00000332707.5	+	6	952	c.423C>G	c.(421-423)ctC>ctG	p.L141L		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	141	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.L141L(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		GAGTAGATCTCTACCTGCGAA	0.398																																						uc001ssb.2		NaN																	1	Substitution - coding silent(1)		kidney(1)	ovary(2)	2						c.(421-423)CTC>CTG		tRNA exportin							129.0	128.0	128.0					12																	64812808		2203	4300	6503	SO:0001819	synonymous_variant	11260				intracellular protein transport|tRNA export from nucleus	cytoplasm|nucleoplasm	protein transporter activity|tRNA binding	g.chr12:64812808C>G	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.423C>G	12.37:g.64812808C>G						XPOT_uc009zqm.1_Silent_p.L51L	p.L141L	NM_007235	NP_009166	O43592	XPOT_HUMAN		GBM - Glioblastoma multiforme(28;0.0404)	6	849	+			141			Necessary for interaction with Ran, nuclear localization and nuclear import.		A6NLH1|O43784|Q8WUG2|Q9BVS7	Silent	SNP	ENST00000332707.5	37	c.423C>G	CCDS31852.1																																																																																				0.398	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1		NM_007235		9	98	0	0	0	0.006214	0	9	98		
OSBPL8	114882	broad.mit.edu	37	12	76763454	76763454	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:76763454C>G	ENST00000261183.3	-	20	2682	c.2203G>C	c.(2203-2205)Gat>Cat	p.D735H	OSBPL8_ENST00000393250.4_Missense_Mutation_p.D693H|OSBPL8_ENST00000393249.2_Missense_Mutation_p.D693H	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	735					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						GTGAGTGGATCAAGTTCAAAT	0.358																																						uc001sye.1		NaN																	0				ovary(1)	1						c.(2203-2205)GAT>CAT		oxysterol-binding protein-like protein 8 isoform							153.0	126.0	135.0					12																	76763454		2202	4299	6501	SO:0001583	missense	114882				lipid transport		lipid binding	g.chr12:76763454C>G	AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.2203G>C	12.37:g.76763454C>G	ENSP00000261183:p.Asp735His					OSBPL8_uc001syf.1_Missense_Mutation_p.D693H|OSBPL8_uc001syg.1_Missense_Mutation_p.D693H|OSBPL8_uc001syh.1_Missense_Mutation_p.D710H	p.D735H	NM_020841	NP_065892	Q9BZF1	OSBL8_HUMAN			20	2683	-			735					A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	ENST00000261183.3	37	c.2203G>C	CCDS31862.1	.	.	.	.	.	.	.	.	.	.	C	29.5	5.014556	0.93404	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250	T;T;T	0.30448	1.53;1.53;1.53	5.33	5.33	0.75918	.	0.049694	0.85682	D	0.000000	T	0.63686	0.2532	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69978	-0.4998	10	0.87932	D	0	-12.1233	19.3691	0.94477	0.0:1.0:0.0:0.0	.	735	Q9BZF1	OSBL8_HUMAN	H	693;735;720;693	ENSP00000376939:D693H;ENSP00000261183:D735H;ENSP00000376940:D693H	ENSP00000261183:D735H	D	-	1	0	OSBPL8	75287585	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.994000	0.70623	2.644000	0.89710	0.655000	0.94253	GAT		0.358	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406357.1		NM_020841		17	56	0	0	0	0.012319	0	17	56		
SDSL	113675	broad.mit.edu	37	12	113873341	113873341	+	Silent	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:113873341C>G	ENST00000403593.4	+	6	913	c.651C>G	c.(649-651)gtC>gtG	p.V217V	SDSL_ENST00000345635.4_Silent_p.V217V			Q96GA7	SDSL_HUMAN	serine dehydratase-like	217					cellular amino acid metabolic process (GO:0006520)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|pyridoxal phosphate binding (GO:0030170)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	15						GCAAGCTGGTCACACTTCCAG	0.622																																						uc001tvi.2		NaN																	0					0						c.(649-651)GTC>GTG		serine dehydratase-like	Pyridoxal Phosphate(DB00114)						82.0	79.0	80.0					12																	113873341		2203	4300	6503	SO:0001819	synonymous_variant	113675				cellular amino acid metabolic process		L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|pyridoxal phosphate binding	g.chr12:113873341C>G	AF134473	CCDS9170.1	12q24.21	2014-06-24				ENSG00000139410			30404	protein-coding gene	gene with protein product						16580895	Standard	NM_138432		Approved	SDS-RS1, cSDH	uc001tvi.3	Q96GA7		ENST00000403593.4:c.651C>G	12.37:g.113873341C>G						SDSL_uc009zwh.2_Silent_p.V217V	p.V217V	NM_138432	NP_612441	Q96GA7	SDSL_HUMAN			7	861	+			217						Silent	SNP	ENST00000403593.4	37	c.651C>G	CCDS9170.1	.	.	.	.	.	.	.	.	.	.	C	0.098	-1.156564	0.01686	.	.	ENSG00000139410	ENST00000546672	.	.	.	4.44	0.428	0.16499	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-37.7971	7.3806	0.26854	0.0:0.5793:0.2711:0.1495	.	.	.	.	X	113	.	.	S	+	2	0	SDSL	112357724	1.000000	0.71417	0.043000	0.18650	0.004000	0.04260	1.260000	0.32968	-0.129000	0.11620	-1.520000	0.00934	TCA		0.622	SDSL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404782.1		NM_138432		35	180	0	0	0	0.009718	0	35	180		
DNAH10	196385	broad.mit.edu	37	12	124345688	124345688	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr12:124345688C>G	ENST00000409039.3	+	38	6550	c.6525C>G	c.(6523-6525)atC>atG	p.I2175M		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2175	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TCAGGGAAATCAACAAGCCAA	0.463																																						uc001uft.3		NaN																	0				ovary(3)|skin(2)|central_nervous_system(1)	6						c.(6523-6525)ATC>ATG		dynein, axonemal, heavy chain 10							59.0	56.0	57.0					12																	124345688		1882	4119	6001	SO:0001583	missense	196385				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr12:124345688C>G	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6525C>G	12.37:g.124345688C>G	ENSP00000386770:p.Ile2175Met						p.I2175M	NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN		OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)	38	6550	+	all_neural(191;0.101)|Medulloblastoma(191;0.163)		2175			AAA 2 (By similarity).		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	37	c.6525C>G	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	C	11.13	1.546774	0.27652	.	.	ENSG00000197653	ENST00000409039	T	0.39592	1.07	5.7	5.7	0.88788	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.349857	0.25258	U	0.031963	T	0.37404	0.1002	N	0.21142	0.635	0.51482	D	0.999927	B	0.33171	0.4	B	0.41946	0.371	T	0.12785	-1.0534	10	0.25106	T	0.35	.	15.4445	0.75220	0.1394:0.8606:0.0:0.0	.	2175	Q8IVF4	DYH10_HUMAN	M	2175	ENSP00000386770:I2175M	ENSP00000386770:I2175M	I	+	3	3	DNAH10	122911641	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.492000	0.45311	2.701000	0.92244	0.655000	0.94253	ATC		0.463	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3				7	30	0	0	0	0.004482	0	7	30		
TUBA3C	7278	broad.mit.edu	37	13	19751303	19751303	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr13:19751303G>A	ENST00000400113.3	-	4	924	c.820C>T	c.(820-822)Ccg>Tcg	p.P274S		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	274					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GAGATGACCGGGGCGTAGGTG	0.607																																						uc009zzj.2		NaN																	0				ovary(3)|skin(2)	5						c.(820-822)CCG>TCG		tubulin, alpha 3c							124.0	114.0	117.0					13																	19751303		2203	4300	6503	SO:0001583	missense	7278				'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity	g.chr13:19751303G>A	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.820C>T	13.37:g.19751303G>A	ENSP00000382982:p.Pro274Ser						p.P274S	NM_006001	NP_005992	Q13748	TBA3C_HUMAN		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)	4	869	-		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)	274					A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000400113.3	37	c.820C>T	CCDS9284.1	.	.	.	.	.	.	.	.	.	.	g	12.11	1.839110	0.32513	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	D	0.97811	-4.55	1.19	1.19	0.21007	.	0.000000	0.47455	U	0.000221	D	0.97288	0.9113	.	.	.	0.40487	D	0.980504	.	.	.	.	.	.	D	0.96501	0.9371	7	0.87932	D	0	.	8.3297	0.32178	0.0:0.0:1.0:0.0	.	.	.	.	S	274	ENSP00000382982:P274S	ENSP00000354037:P274S	P	-	1	0	TUBA3C	18649303	1.000000	0.71417	0.987000	0.45799	0.504000	0.33889	7.884000	0.87274	0.972000	0.38314	0.175000	0.17021	CCG		0.607	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2		NM_006001		49	173	0	0	0	0.01441	0	49	173		
RB1	5925	broad.mit.edu	37	13	48947629	48947629	+	Splice_Site	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08			G	A	G	G		Valid	Somatic	Phase_I	WXS	Fluidigm			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr13:48947629G>A	ENST00000267163.4	+	12	1353		c.e12+1			NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.?(23)|p.0?(15)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CTATTTTAACGTAAGCCATAT	0.279		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												uc001vcb.2		6	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	D|Mis|N|F|S	retinoblastoma gene			"""L, E, M, O"""		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung		38	Unknown(23)|Whole gene deletion(15)	p.?(14)	bone(12)|eye(6)|urinary_tract(5)|breast(5)|endometrium(3)|central_nervous_system(2)|lung(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)	lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358	GRCh37	CS890133|CS982341	RB1	S		c.e12+1		retinoblastoma 1	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)						80.0	87.0	84.0					13																	48947629		2202	4287	6489	SO:0001630	splice_region_variant	5925	Hereditary_Retinoblastoma	Familial Cancer Database		androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	g.chr13:48947629G>A	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1215+1G>A	13.37:g.48947629G>A		TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)				RB1_uc010act.1_Splice_Site_p.N106_splice	p.N405_splice	NM_000321	NP_000312	P06400	RB_HUMAN		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	12	1381	+		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)						A8K5E3|P78499|Q5VW46|Q8IZL4	Splice_Site	SNP	ENST00000267163.4	37	c.1215_splice	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681750	0.68042	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0805	0.93179	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RB1	47845630	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	7.247000	0.78257	2.510000	0.84645	0.563000	0.77884	.		0.279	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1			Intron	17	29	0	0	0	0.00499	0	17	29		
POTEG	404785	broad.mit.edu	37	14	19553680	19553680	+	Silent	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr14:19553680C>T	ENST00000409832.3	+	1	316	c.264C>T	c.(262-264)gaC>gaT	p.D88D		NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	88										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						ACCACGACGACTCTGCTATGA	0.617																																						uc001vuz.1		NaN																	0				ovary(1)	1						c.(262-264)GAC>GAT		POTE ankyrin domain family, member G							67.0	87.0	80.0					14																	19553680		1966	4009	5975	SO:0001819	synonymous_variant	404785							g.chr14:19553680C>T		CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.264C>T	14.37:g.19553680C>T						POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	p.D88D	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN			1	316	+			88					A1L153|A6NMI9|Q6S5H6|Q6S8J2	Silent	SNP	ENST00000409832.3	37	c.264C>T	CCDS32018.1																																																																																				0.617	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408579.1		NM_001005356		6	393	0	0	0	0.001984	0	6	393		
MDGA2	161357	broad.mit.edu	37	14	47530528	47530528	+	Silent	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr14:47530528C>T	ENST00000399232.2	-	7	1606	c.1242G>A	c.(1240-1242)acG>acA	p.T414T	MDGA2_ENST00000426342.1_Silent_p.T185T|MDGA2_ENST00000357362.3_Silent_p.T185T|MDGA2_ENST00000439988.3_Silent_p.T483T	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	414	Ig-like 4.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CACATGTGTACGTCCCAAAAT	0.408																																						uc001wwj.3		NaN																	0				ovary(4)|large_intestine(1)|pancreas(1)	6						c.(1240-1242)ACG>ACA		MAM domain containing 1 isoform 1							156.0	143.0	147.0					14																	47530528		1894	4116	6010	SO:0001819	synonymous_variant	161357				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane		g.chr14:47530528C>T	AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.1242G>A	14.37:g.47530528C>T						MDGA2_uc001wwi.3_Silent_p.T185T|MDGA2_uc010ani.2_5'UTR	p.T414T	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN			7	1438	-			414			Ig-like 4.		F6W3S7|J3KPX6	Silent	SNP	ENST00000399232.2	37	c.1242G>A		.	.	.	.	.	.	.	.	.	.	C	8.451	0.853138	0.17106	.	.	ENSG00000139915	ENST00000554762	.	.	.	5.63	-1.99	0.07457	.	.	.	.	.	T	0.42787	0.1218	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31806	-0.9930	4	.	.	.	.	3.8472	0.08940	0.4233:0.3044:0.0:0.2723	.	.	.	.	I	189	.	.	V	-	1	0	MDGA2	46600278	0.000000	0.05858	0.997000	0.53966	0.984000	0.73092	-2.631000	0.00871	-0.177000	0.10690	-0.300000	0.09419	GTA		0.408	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000073352.5		NM_182830		36	120	0	0	0	0.01441	0	36	120		
OTX2	5015	broad.mit.edu	37	14	57268797	57268797	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr14:57268797G>A	ENST00000555006.1	-	4	934	c.526C>T	c.(526-528)Ccc>Tcc	p.P176S	OTX2_ENST00000408990.3_Missense_Mutation_p.P176S|OTX2_ENST00000554559.1_3'UTR|RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000554788.1_3'UTR|OTX2_ENST00000339475.5_Missense_Mutation_p.P184S			P32243	OTX2_HUMAN	orthodenticle homeobox 2	176					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					TAGGTCATGGGATAGGACCTC	0.522																																						uc001xcp.2		NaN																	0				ovary(1)	1						c.(526-528)CCC>TCC		orthodenticle homeobox 2 isoform b							125.0	114.0	118.0					14																	57268797		2203	4300	6503	SO:0001583	missense	5015				axon guidance|forebrain development|midbrain development|positive regulation of embryonic development|positive regulation of gastrulation|primitive streak formation|protein complex assembly|regulation of fibroblast growth factor receptor signaling pathway|regulation of smoothened signaling pathway	growth cone|nucleus|protein complex	eukaryotic initiation factor 4E binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding	g.chr14:57268797G>A	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.526C>T	14.37:g.57268797G>A	ENSP00000452336:p.Pro176Ser					OTX2_uc010aou.2_Missense_Mutation_p.P176S|OTX2_uc001xcq.2_Missense_Mutation_p.P184S	p.P176S	NM_172337	NP_758840	P32243	OTX2_HUMAN			3	697	-	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)		176					B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	37	c.526C>T	CCDS41960.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495577	0.64186	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006;ENST00000554845	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	6.06	6.06	0.98353	Transcription factor Otx, C-terminal (1);	0.000000	0.46442	D	0.000294	D	0.87653	0.6231	M	0.64404	1.975	0.80722	D	1	B;B	0.22983	0.078;0.044	B;B	0.31390	0.068;0.129	T	0.82368	-0.0492	10	0.32370	T	0.25	.	19.1989	0.93701	0.0:0.0:1.0:0.0	.	184;176	F1T0D1;P32243	.;OTX2_HUMAN	S	184;176;176;184	ENSP00000343819:P184S;ENSP00000386185:P176S;ENSP00000452336:P176S;ENSP00000451357:P184S	ENSP00000343819:P184S	P	-	1	0	OTX2	56338550	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.876000	0.87215	2.882000	0.98803	0.655000	0.94253	CCC		0.522	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1		NM_021728.		13	42	0	0	0	0.006122	0	13	42		
CHAC1	79094	broad.mit.edu	37	15	41245807	41245807	+	Missense_Mutation	SNP	A	A	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr15:41245807A>T	ENST00000446533.3	+	1	461	c.152A>T	c.(151-153)aAc>aTc	p.N51I	CHAC1_ENST00000487220.1_5'Flank|CHAC1_ENST00000444189.2_Missense_Mutation_p.N51I	NM_001142776.1|NM_024111.3	NP_001136248.1|NP_077016.2	Q9BUX1	CHAC1_HUMAN	ChaC, cation transport regulator homolog 1 (E. coli)	51					intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein processing (GO:0010955)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|trans-Golgi network (GO:0005802)	Notch binding (GO:0005112)			endometrium(1)|large_intestine(1)|skin(1)	3		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.66e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.163)		GCAGCCCCGAACACCCCGCCC	0.687																																						uc001znh.2		NaN																	0					0						c.(151-153)AAC>ATC		ChaC, cation transport regulator-like 1 isoform							37.0	39.0	38.0					15																	41245807		2203	4300	6503	SO:0001583	missense	79094				apoptosis in response to endoplasmic reticulum stress|response to unfolded protein	cytosol	protein binding	g.chr15:41245807A>T	BC019625	CCDS10070.2, CCDS45233.1	15q15.1	2013-09-12	2006-09-12		ENSG00000128965	ENSG00000128965			28680	protein-coding gene	gene with protein product	"""gamma-GCT acting on glutathione homolog 1"""	614587	"""ChaC, cation transport regulator-like 1 (E. coli)"""			23070364	Standard	NM_024111		Approved	MGC4504	uc001znh.2	Q9BUX1	OTTHUMG00000130208	ENST00000446533.3:c.152A>T	15.37:g.41245807A>T	ENSP00000398105:p.Asn51Ile					CHAC1_uc010uct.1_Missense_Mutation_p.N51I	p.N51I	NM_024111	NP_077016	Q9BUX1	CHAC1_HUMAN		GBM - Glioblastoma multiforme(113;2.66e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.163)	1	172	+		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)	51					Q0VIA0	Missense_Mutation	SNP	ENST00000446533.3	37	c.152A>T	CCDS10070.2	.	.	.	.	.	.	.	.	.	.	A	11.02	1.515468	0.27123	.	.	ENSG00000128965	ENST00000446533;ENST00000444189	T	0.45276	0.9	5.07	-1.32	0.09201	.	1.331440	0.04559	N	0.391264	T	0.23965	0.0580	N	0.08118	0	0.18873	N	0.999989	B;B	0.19583	0.037;0.022	B;B	0.23150	0.044;0.02	T	0.23904	-1.0175	10	0.36615	T	0.2	-2.354	7.6834	0.28526	0.2798:0.1437:0.5765:0.0	.	51;51	Q9BUX1-2;Q9BUX1	.;CHAC1_HUMAN	I	51	ENSP00000398105:N51I	ENSP00000395466:N51I	N	+	2	0	CHAC1	39033099	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	0.481000	0.22260	-0.388000	0.07797	0.402000	0.26972	AAC		0.687	CHAC1-001	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252526.3		NM_024111		13	60	0	0	0	0.010504	0	13	60		
KIF23	9493	broad.mit.edu	37	15	69709843	69709843	+	Missense_Mutation	SNP	A	A	G	rs187707408	byFrequency	TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr15:69709843A>G	ENST00000260363.4	+	3	320	c.203A>G	c.(202-204)tAt>tGt	p.Y68C	RP11-253M7.1_ENST00000558617.1_RNA|RP11-253M7.1_ENST00000560539.1_RNA|KIF23_ENST00000559279.1_Missense_Mutation_p.Y68C|KIF23_ENST00000352331.4_Missense_Mutation_p.Y68C|KIF23_ENST00000395392.2_Missense_Mutation_p.Y68C	NM_138555.2	NP_612565.1	Q02241	KIF23_HUMAN	kinesin family member 23	68	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle elongation (GO:0000022)|positive regulation of cytokinesis (GO:0032467)|spindle midzone assembly involved in mitosis (GO:0051256)	centralspindlin complex (GO:0097149)|centrosome (GO:0005813)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercellular bridge (GO:0045171)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(6)|prostate(2)|skin(1)	21						AATGGAGACTATAAGGAGGTA	0.378													A|||	3	0.000599042	0.0	0.0043	5008	,	,		18396	0.0		0.0	False		,,,				2504	0.0					uc002asb.2		NaN																	0					0						c.(202-204)TAT>TGT		kinesin family member 23 isoform 1							116.0	110.0	112.0					15																	69709843		2199	4298	6497	SO:0001583	missense	9493				blood coagulation|cytokinesis|microtubule-based movement|mitosis|mitotic spindle elongation	cytosol|kinesin complex|microtubule|midbody|nucleoplasm|spindle	ATP binding|microtubule motor activity|protein binding	g.chr15:69709843A>G	X67155	CCDS32278.1, CCDS32279.1	15q23	2008-03-03	2003-01-13	2003-01-17		ENSG00000137807		"""Kinesins"""	6392	protein-coding gene	gene with protein product		605064	"""kinesin-like 5 (mitotic kinesin-like protein 1)"""	KNSL5		1406973	Standard	NM_138555		Approved	MKLP1, MKLP-1	uc002asb.3	Q02241		ENST00000260363.4:c.203A>G	15.37:g.69709843A>G	ENSP00000260363:p.Tyr68Cys					KIF23_uc002asc.2_Missense_Mutation_p.Y68C|KIF23_uc010bii.2_Missense_Mutation_p.I4V|KIF23_uc010bih.1_RNA	p.Y68C	NM_138555	NP_612565	Q02241	KIF23_HUMAN			3	320	+			68			Kinesin-motor.		Q8WVP0	Missense_Mutation	SNP	ENST00000260363.4	37	c.203A>G	CCDS32278.1	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	16.58	3.162523	0.57368	.	.	ENSG00000137807	ENST00000260363;ENST00000352331;ENST00000395392	T;T;T	0.74947	-0.89;-0.89;-0.89	4.75	3.53	0.40419	Kinesin, motor domain (4);	0.207169	0.42682	D	0.000671	T	0.70193	0.3196	N	0.13198	0.31	0.80722	D	1	D;D	0.67145	0.996;0.986	P;P	0.62813	0.794;0.907	T	0.71842	-0.4470	10	0.51188	T	0.08	.	9.5259	0.39165	0.8423:0.0:0.0:0.1576	.	68;68	Q02241-2;Q02241	.;KIF23_HUMAN	C	68	ENSP00000260363:Y68C;ENSP00000304978:Y68C;ENSP00000378790:Y68C	ENSP00000260363:Y68C	Y	+	2	0	KIF23	67496897	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.676000	0.54612	1.892000	0.54788	0.459000	0.35465	TAT		0.378	KIF23-201	KNOWN	basic|CCDS	protein_coding	protein_coding					33	75	0	0	0	0.007835	0	33	75		
CSK	1445	broad.mit.edu	37	15	75094356	75094356	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr15:75094356G>A	ENST00000220003.9	+	12	1831	c.1102G>A	c.(1102-1104)Gac>Aac	p.D368N	CSK_ENST00000439220.2_Missense_Mutation_p.D368N|CSK_ENST00000309470.9_Missense_Mutation_p.D368N|CSK_ENST00000567571.1_Missense_Mutation_p.D368N	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	368	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						CACTAAGTCTGACGTGTGGAG	0.532																																						uc010bkb.1		NaN																	0				lung(2)|central_nervous_system(1)	3						c.(1102-1104)GAC>AAC		c-src tyrosine kinase							107.0	108.0	108.0					15																	75094356		2197	4296	6493	SO:0001583	missense	1445				blood coagulation|epidermal growth factor receptor signaling pathway|T cell costimulation|T cell receptor signaling pathway	centrosome|cytosol|Golgi apparatus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein C-terminus binding	g.chr15:75094356G>A		CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.1102G>A	15.37:g.75094356G>A	ENSP00000220003:p.Asp368Asn					CSK_uc002ays.2_Missense_Mutation_p.D368N|CSK_uc010bkc.1_Missense_Mutation_p.D177N	p.D368N	NM_001127190	NP_001120662	P41240	CSK_HUMAN			13	1285	+			368			Protein kinase.		Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	ENST00000220003.9	37	c.1102G>A	CCDS10269.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497364	0.85069	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	T;T;T	0.74842	-0.88;-0.88;-0.88	4.29	4.29	0.51040	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91310	0.7260	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94758	0.7933	10	0.87932	D	0	-26.1048	16.5386	0.84378	0.0:0.0:1.0:0.0	.	368	P41240	CSK_HUMAN	N	368;368;317;368	ENSP00000220003:D368N;ENSP00000414764:D368N;ENSP00000438808:D368N	ENSP00000220003:D368N	D	+	1	0	CSK	72881409	1.000000	0.71417	0.961000	0.40146	0.993000	0.82548	9.433000	0.97501	2.220000	0.72140	0.561000	0.74099	GAC		0.532	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2		NM_004383		26	52	0	0	0	0.015359	0	26	52		
CSK	1445	broad.mit.edu	37	15	75094364	75094364	+	Missense_Mutation	SNP	G	G	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr15:75094364G>T	ENST00000220003.9	+	12	1839	c.1110G>T	c.(1108-1110)tgG>tgT	p.W370C	CSK_ENST00000439220.2_Missense_Mutation_p.W370C|CSK_ENST00000309470.9_Missense_Mutation_p.W370C|CSK_ENST00000567571.1_Missense_Mutation_p.W370C	NM_004383.2	NP_004374.1	P41240	CSK_HUMAN	c-src tyrosine kinase	370	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adherens junction organization (GO:0034332)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cellular response to peptide hormone stimulus (GO:0071375)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of bone resorption (GO:0045779)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of kinase activity (GO:0033673)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of phagocytosis (GO:0050765)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein C-terminus binding (GO:0008022)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|lung(2)	3						CTGACGTGTGGAGTTTCGGAA	0.537																																						uc010bkb.1		NaN																	0				lung(2)|central_nervous_system(1)	3						c.(1108-1110)TGG>TGT		c-src tyrosine kinase							115.0	116.0	115.0					15																	75094364		2197	4296	6493	SO:0001583	missense	1445				blood coagulation|epidermal growth factor receptor signaling pathway|T cell costimulation|T cell receptor signaling pathway	centrosome|cytosol|Golgi apparatus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein C-terminus binding	g.chr15:75094364G>T		CCDS10269.1	15q24.1	2013-02-14			ENSG00000103653	ENSG00000103653	2.7.10.1	"""SH2 domain containing"""	2444	protein-coding gene	gene with protein product		124095				1377109	Standard	NM_004383		Approved		uc010bka.3	P41240	OTTHUMG00000142814	ENST00000220003.9:c.1110G>T	15.37:g.75094364G>T	ENSP00000220003:p.Trp370Cys					CSK_uc002ays.2_Missense_Mutation_p.W370C|CSK_uc010bkc.1_Missense_Mutation_p.W179C	p.W370C	NM_001127190	NP_001120662	P41240	CSK_HUMAN			13	1293	+			370			Protein kinase.		Q2M3N2|Q6FGZ6	Missense_Mutation	SNP	ENST00000220003.9	37	c.1110G>T	CCDS10269.1	.	.	.	.	.	.	.	.	.	.	G	18.35	3.605332	0.66445	.	.	ENSG00000103653	ENST00000220003;ENST00000439220;ENST00000451345;ENST00000309470	T;T;T	0.56103	0.48;0.48;0.48	4.29	4.29	0.51040	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.82167	0.4978	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89318	0.3638	10	0.87932	D	0	-11.7271	16.5386	0.84378	0.0:0.0:1.0:0.0	.	370	P41240	CSK_HUMAN	C	370;370;319;370	ENSP00000220003:W370C;ENSP00000414764:W370C;ENSP00000438808:W370C	ENSP00000220003:W370C	W	+	3	0	CSK	72881417	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.602000	0.82796	2.220000	0.72140	0.561000	0.74099	TGG		0.537	CSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286398.2		NM_004383		27	52	1	0	2.87052e-16	0.005524	3.16386e-16	27	52		
MSLNL	401827	broad.mit.edu	37	16	830490	830490	+	Intron	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr16:830490G>A	ENST00000442466.1	-	2	37				MSLNL_ENST00000293892.3_Missense_Mutation_p.R171C			Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.R171S(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GGATGCGTGCGGGCACGCATG	0.547																																						uc002cjz.1		NaN																	1	Substitution - Missense(1)		lung(1)	breast(3)|ovary(1)	4						c.(511-513)CGC>TGC		mesothelin-like							263.0	230.0	241.0					16																	830490		2177	4262	6439	SO:0001627	intron_variant	401827				cell adhesion	integral to membrane		g.chr16:830490G>A			16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.38-328C>T	16.37:g.830490G>A							p.R171C	NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN			3	511	-			Error:Variant_position_missing_in_Q96KJ4_after_alignment						Missense_Mutation	SNP	ENST00000442466.1	37	c.511C>T		.	.	.	.	.	.	.	.	.	.	A	1.635	-0.518078	0.04171	.	.	ENSG00000162006	ENST00000293892	T	0.19394	2.15	1.02	-2.05	0.07321	.	.	.	.	.	T	0.12944	0.0314	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22277	-1.0221	5	.	.	.	.	4.7727	0.13164	0.2679:0.208:0.5241:0.0	.	.	.	.	C	171	ENSP00000293892:R171C	.	R	-	1	0	MSLNL	770491	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.299000	0.02754	-2.502000	0.00509	-1.668000	0.00747	CGC		0.547	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding			NM_001025190		5	190	0	0	0	0.001168	0	5	190		
PDILT	204474	broad.mit.edu	37	16	20370721	20370721	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr16:20370721C>T	ENST00000302451.4	-	12	1923	c.1675G>A	c.(1675-1677)Gag>Aag	p.E559K		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	559					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						ACCACCTCCTCAGATGTTTTC	0.493																																						uc002dhc.1		NaN																	0				large_intestine(1)	1						c.(1675-1677)GAG>AAG		protein disulfide isomerase-like, testis							197.0	185.0	189.0					16																	20370721		2203	4300	6503	SO:0001583	missense	204474				cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity	g.chr16:20370721C>T		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.1675G>A	16.37:g.20370721C>T	ENSP00000305465:p.Glu559Lys						p.E559K	NM_174924	NP_777584	Q8N807	PDILT_HUMAN			12	1898	-			559					Q8IVQ5	Missense_Mutation	SNP	ENST00000302451.4	37	c.1675G>A	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	c	10.47	1.358124	0.24598	.	.	ENSG00000169340	ENST00000302451	T	0.03553	3.89	3.26	-2.27	0.06846	.	2.354250	0.01826	N	0.034374	T	0.02888	0.0086	N	0.24115	0.695	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.42682	-0.9437	10	0.24483	T	0.36	.	4.1161	0.10083	0.0:0.3802:0.1775:0.4422	.	559	Q8N807	PDILT_HUMAN	K	559	ENSP00000305465:E559K	ENSP00000305465:E559K	E	-	1	0	PDILT	20278222	0.000000	0.05858	0.008000	0.14137	0.065000	0.16274	-0.586000	0.05787	-0.422000	0.07405	-0.225000	0.12378	GAG		0.493	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1		NM_174924		50	282	0	0	0	0.01441	0	50	282		
SMTNL2	342527	broad.mit.edu	37	17	4496232	4496232	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr17:4496232G>A	ENST00000389313.4	+	3	563	c.496G>A	c.(496-498)Gat>Aat	p.D166N	SMTNL2_ENST00000338859.4_Missense_Mutation_p.D22N	NM_001114974.1	NP_001108446.1	Q2TAL5	SMTL2_HUMAN	smoothelin-like 2	166										breast(1)|endometrium(9)|kidney(1)|lung(1)|skin(1)	13				READ - Rectum adenocarcinoma(115;0.0325)		AGGTCCAGGCGATGGACCCCC	0.662																																						uc002fyf.1		NaN																	0					0						c.(496-498)GAT>AAT		smoothelin-like 2 isoform 1							72.0	72.0	72.0					17																	4496232		2203	4300	6503	SO:0001583	missense	342527							g.chr17:4496232G>A	AK124452	CCDS11048.1, CCDS45583.1	17p13.2	2006-04-26			ENSG00000188176	ENSG00000188176			24764	protein-coding gene	gene with protein product							Standard	NM_001114974		Approved	FLJ42461	uc002fyf.1	Q2TAL5	OTTHUMG00000132938	ENST00000389313.4:c.496G>A	17.37:g.4496232G>A	ENSP00000373964:p.Asp166Asn					SMTNL2_uc002fye.2_Missense_Mutation_p.D22N	p.D166N	NM_001114974	NP_001108446	Q2TAL5	SMTL2_HUMAN		READ - Rectum adenocarcinoma(115;0.0325)	3	563	+			166					Q6ZVK6	Missense_Mutation	SNP	ENST00000389313.4	37	c.496G>A	CCDS45583.1	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398707	0.25205	.	.	ENSG00000188176	ENST00000338859;ENST00000389313	T;T	0.80909	-1.43;-1.43	5.36	-0.474	0.12108	.	.	.	.	.	T	0.63721	0.2535	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.43925	-0.9361	9	0.18276	T	0.48	-7.5306	4.6213	0.12450	0.3482:0.0:0.5075:0.1443	.	166	Q2TAL5	SMTL2_HUMAN	N	22;166	ENSP00000345143:D22N;ENSP00000373964:D166N	ENSP00000345143:D22N	D	+	1	0	SMTNL2	4442981	0.000000	0.05858	0.014000	0.15608	0.024000	0.10985	-0.314000	0.08092	0.077000	0.16863	-0.143000	0.13931	GAT		0.662	SMTNL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439129.1		NM_198501		31	19	0	0	0	0.006999	0	31	19		
TP53	7157	broad.mit.edu	37	17	7577085	7577085	+	Missense_Mutation	SNP	C	C	T	rs112431538		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08			C	T	C	C		Valid	Somatic	Phase_I	WXS	Fluidigm;RNASeq			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr17:7577085C>T	ENST00000269305.4	-	8	1042	c.853G>A	c.(853-855)Gag>Aag	p.E285K	TP53_ENST00000455263.2_Missense_Mutation_p.E285K|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.E285K|TP53_ENST00000445888.2_Missense_Mutation_p.E285K|TP53_ENST00000359597.4_Missense_Mutation_p.E285K|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	285	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726, ECO:0000269|PubMed:1694291}.|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E285K(111)|p.E285*(24)|p.0?(8)|p.E285Q(4)|p.?(2)|p.R283fs*16(2)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.G279fs*59(1)|p.R283fs*56(1)|p.E285fs*20(1)|p.E285fs*13(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTCTTCCTCTGTGCGCCGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	uc002gim.2		111	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	Mis|N|F	tumor protein p53			"""L, E, M, O"""		breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types	breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types		165	Substitution - Missense(115)|Substitution - Nonsense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	p.E285K(95)|p.E285*(16)|p.E285V(13)|p.0?(7)|p.E285Q(4)|p.E285E(3)|p.E285G(3)|p.E285A(2)|p.?(2)|p.R283fs*16(2)|p.E285_N288delEEEN(1)|p.R282_E287delRRTEEE(1)|p.T284_G293del10(1)|p.G279fs*59(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.R283fs*56(1)|p.V272_K292del21(1)|p.R283fs*59(1)|p.C275fs*20(1)|p.E285_L289delEEENL(1)|p.E285fs*60(1)|p.E285fs*20(1)	urinary_tract(53)|breast(18)|large_intestine(15)|lung(11)|upper_aerodigestive_tract(10)|stomach(8)|haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(6)|oesophagus(6)|liver(6)|skin(5)|prostate(4)|bone(4)|biliary_tract(3)|ovary(3)|adrenal_gland(1)|soft_tissue(1)|eye(1)|pancreas(1)|thyroid(1)	large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245	GRCh37	CM995136	TP53	M	rs112431538	c.(853-855)GAG>AAG	Other_conserved_DNA_damage_response_genes	tumor protein p53 isoform a							91.0	78.0	82.0					17																	7577085		2203	4300	6503	SO:0001583	missense	7157	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	g.chr17:7577085C>T	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.853G>A	17.37:g.7577085C>T	ENSP00000269305:p.Glu285Lys	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)				TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E285K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E153K|TP53_uc010cng.1_Missense_Mutation_p.E153K|TP53_uc002gii.1_Missense_Mutation_p.E153K|TP53_uc010cnh.1_Missense_Mutation_p.E285K|TP53_uc010cni.1_Missense_Mutation_p.E285K|TP53_uc002gij.2_Missense_Mutation_p.E285K	p.E285K	NM_001126112	NP_001119584	P04637	P53_HUMAN		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	8	1047	-		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)	285		E -> K (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).|E -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	37	c.853G>A	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703759	0.88924	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99816	-6.91;-6.91;-6.91;-6.91;-6.91;-6.91	4.99	4.99	0.66335	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.89904	3.07	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.87578	0.994;0.983;0.994;0.998	D	0.96661	0.9489	10	0.87932	D	0	-38.0538	15.807	0.78520	0.0:1.0:0.0:0.0	.	285;285;285;285	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	285;285;285;285;285;274;153	ENSP00000352610:E285K;ENSP00000269305:E285K;ENSP00000398846:E285K;ENSP00000391127:E285K;ENSP00000391478:E285K;ENSP00000425104:E153K	ENSP00000269305:E285K	E	-	1	0	TP53	7517810	1.000000	0.71417	0.900000	0.35374	0.716000	0.41182	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAG		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1		NM_000546		18	23	0	0	0	0.007413	0	18	23		
EFCAB5	374786	broad.mit.edu	37	17	28380460	28380460	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr17:28380460G>A	ENST00000394835.3	+	10	1680	c.1488G>A	c.(1486-1488)caG>caA	p.Q496Q	EFCAB5_ENST00000541045.1_Silent_p.Q153Q|EFCAB5_ENST00000378738.3_Silent_p.Q496Q|EFCAB5_ENST00000394832.2_Silent_p.Q496Q|EFCAB5_ENST00000536908.2_Silent_p.Q440Q|EFCAB5_ENST00000320856.5_Silent_p.Q496Q	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	496							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TTAACGAACAGAGAACATCAA	0.393																																						uc002het.2		NaN																	0				ovary(1)|skin(1)	2						c.(1486-1488)CAG>CAA		EF-hand calcium binding domain 5 isoform a							121.0	121.0	121.0					17																	28380460		1940	4133	6073	SO:0001819	synonymous_variant	374786						calcium ion binding	g.chr17:28380460G>A	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.1488G>A	17.37:g.28380460G>A						EFCAB5_uc010wbi.1_Silent_p.Q239Q|EFCAB5_uc010wbj.1_Silent_p.Q440Q|EFCAB5_uc010wbk.1_Silent_p.Q153Q|EFCAB5_uc010csd.2_RNA|EFCAB5_uc010cse.2_Silent_p.Q375Q|EFCAB5_uc010csf.2_Silent_p.Q375Q	p.Q496Q	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN			10	1680	+			496					B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Silent	SNP	ENST00000394835.3	37	c.1488G>A	CCDS11254.2																																																																																				0.393	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4		NM_198529		12	41	0	0	0	0.020292	0	12	41		
ZNF652	22834	broad.mit.edu	37	17	47395037	47395037	+	Silent	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr17:47395037C>T	ENST00000362063.2	-	2	369	c.51G>A	c.(49-51)gtG>gtA	p.V17V	ZNF652_ENST00000430262.2_Silent_p.V17V	NM_014897.2	NP_055712.1	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	17					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	20	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			CTGCTACATGCACAGCACAGT	0.448																																						uc002iov.3		NaN																	0				ovary(1)	1						c.(49-51)GTG>GTA		zinc finger protein 652							56.0	49.0	52.0					17																	47395037		2203	4300	6503	SO:0001819	synonymous_variant	22834				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding	g.chr17:47395037C>T	AB023141	CCDS32677.1	17q21.32	2013-01-08				ENSG00000198740		"""Zinc fingers, C2H2-type"""	29147	protein-coding gene	gene with protein product		613907				10231032	Standard	NM_014897		Approved	KIAA0924	uc002iow.3	Q9Y2D9		ENST00000362063.2:c.51G>A	17.37:g.47395037C>T						ZNF652_uc002iow.2_Silent_p.V17V|ZNF652_uc002iou.3_RNA	p.V17V	NM_001145365	NP_001138837	Q9Y2D9	ZN652_HUMAN	BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)		2	515	-	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		17					A4QPD9|Q5H9Q0	Silent	SNP	ENST00000362063.2	37	c.51G>A	CCDS32677.1																																																																																				0.448	ZNF652-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364524.1		NM_014897		5	38	0	0	0	0.00308	0	5	38		
MED13	9969	broad.mit.edu	37	17	60028189	60028189	+	Silent	SNP	A	A	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr17:60028189A>G	ENST00000397786.2	-	28	6364	c.6288T>C	c.(6286-6288)ctT>ctC	p.L2096L		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2096					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GCAATACCTTAAGAAAAAGGG	0.413																																						uc002izo.2		NaN																	0				large_intestine(1)|ovary(1)	2						c.(6286-6288)CTT>CTC		mediator complex subunit 13							127.0	116.0	119.0					17																	60028189		1898	4136	6034	SO:0001819	synonymous_variant	9969				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding	g.chr17:60028189A>G	AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.6288T>C	17.37:g.60028189A>G							p.L2096L	NM_005121	NP_005112	Q9UHV7	MED13_HUMAN			28	6365	-			2096					B2RU05|O60334	Silent	SNP	ENST00000397786.2	37	c.6288T>C	CCDS42366.1																																																																																				0.413	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445461.1		NM_005121		39	81	0	0	0	0.01441	0	39	81		
ITGB4	3691	broad.mit.edu	37	17	73723498	73723498	+	Missense_Mutation	SNP	G	G	A	rs201532846	byFrequency	TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr17:73723498G>A	ENST00000200181.3	+	4	363	c.176G>A	c.(175-177)cGg>cAg	p.R59Q	ITGB4_ENST00000450894.3_Missense_Mutation_p.R59Q|ITGB4_ENST00000339591.3_Missense_Mutation_p.R59Q|ITGB4_ENST00000579662.1_Missense_Mutation_p.R59Q|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000449880.2_Missense_Mutation_p.R59Q	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	59	PSI.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTCAGGGACCGGCGCTGCAAC	0.637													G|||	2	0.000399361	0.0008	0.0	5008	,	,		15263	0.0		0.0	False		,,,				2504	0.001					uc002jpg.2		NaN																	0				lung(4)	4						c.(175-177)CGG>CAG		integrin beta 4 isoform 1 precursor							23.0	28.0	26.0					17																	73723498		2203	4300	6503	SO:0001583	missense	3691				cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity	g.chr17:73723498G>A		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.176G>A	17.37:g.73723498G>A	ENSP00000200181:p.Arg59Gln					ITGB4_uc002jph.2_Missense_Mutation_p.R59Q|ITGB4_uc010dgo.2_Missense_Mutation_p.R59Q|ITGB4_uc002jpi.3_Missense_Mutation_p.R59Q|ITGB4_uc010dgp.1_Missense_Mutation_p.R59Q|ITGB4_uc002jpj.2_Missense_Mutation_p.R59Q	p.R59Q	NM_000213	NP_000204	P16144	ITB4_HUMAN	all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)		4	363	+	all_cancers(13;1.5e-07)		59			PSI.|Extracellular (Potential).		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	c.176G>A	CCDS11727.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	12.60	1.987734	0.35036	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.92397	-3.03;-3.03;-3.03	5.46	3.45	0.39498	Integrin beta subunit, N-terminal (2);	0.338573	0.27912	N	0.017345	D	0.89086	0.6615	L	0.35723	1.085	0.09310	N	0.999997	B;D;D;D	0.61080	0.174;0.987;0.989;0.989	B;P;P;P	0.53185	0.068;0.598;0.72;0.72	T	0.79732	-0.1680	10	0.19590	T	0.45	.	7.6216	0.28189	0.0865:0.3475:0.5659:0.0	.	59;59;59;59	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	Q	59	ENSP00000200181:R59Q;ENSP00000344079:R59Q;ENSP00000400217:R59Q	ENSP00000200181:R59Q	R	+	2	0	ITGB4	71235093	0.002000	0.14202	0.873000	0.34254	0.843000	0.47879	0.570000	0.23653	1.288000	0.44600	0.655000	0.94253	CGG		0.637	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1				10	41	0	0	0	0.016723	0	10	41		
GAREM	64762	broad.mit.edu	37	18	29848220	29848220	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr18:29848220C>T	ENST00000269209.6	-	6	2248	c.2245G>A	c.(2245-2247)Gat>Aat	p.D749N	GAREM_ENST00000399218.4_Missense_Mutation_p.D748N			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	749					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										TCAGCACCATCAATTTTCAGA	0.522																																						uc002kxl.2		NaN																	0				ovary(1)|skin(1)	2						c.(2245-2247)GAT>AAT		family with sequence similarity 59, member A							84.0	83.0	83.0					18																	29848220		2203	4300	6503	SO:0001583	missense	64762							g.chr18:29848220C>T	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.2245G>A	18.37:g.29848220C>T	ENSP00000269209:p.Asp749Asn					FAM59A_uc002kxk.1_Missense_Mutation_p.D748N	p.D749N	NM_022751	NP_073588	Q9H706	FA59A_HUMAN			6	2301	-			749					Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	37	c.2245G>A	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127711	0.77549	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.14516	2.5;2.5	5.56	5.56	0.83823	.	0.151564	0.56097	D	0.000027	T	0.12475	0.0303	N	0.08118	0	0.58432	D	0.999993	D;P	0.63880	0.993;0.902	P;B	0.50109	0.631;0.442	T	0.33085	-0.9882	10	0.18276	T	0.48	-19.5575	19.5724	0.95427	0.0:1.0:0.0:0.0	.	749;748	Q9H706;Q9H706-3	FA59A_HUMAN;.	N	748;749	ENSP00000382165:D748N;ENSP00000269209:D749N	ENSP00000269209:D749N	D	-	1	0	FAM59A	28102218	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.020000	0.64066	2.602000	0.87976	0.650000	0.86243	GAT		0.522	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1		NM_022751		23	56	0	0	0	0.004656	0	23	56		
FEM1A	55527	broad.mit.edu	37	19	4792857	4792857	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:4792857C>T	ENST00000269856.3	+	1	1130	c.991C>T	c.(991-993)Cag>Tag	p.Q331*	AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000596170.1_RNA|AC005523.2_ENST00000601192.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	331					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		GCTGCGTCACCAGGGGGGCGA	0.602																																						uc002mbf.2		NaN																	0					0						c.(991-993)CAG>TAG		fem-1 homolog a							39.0	43.0	42.0					19																	4792857		2202	4299	6501	SO:0001587	stop_gained	55527				regulation of ubiquitin-protein ligase activity	cytoplasm	binding|ubiquitin-protein ligase activity	g.chr19:4792857C>T	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.991C>T	19.37:g.4792857C>T	ENSP00000269856:p.Gln331*					uc002mbg.1_RNA	p.Q331*	NM_018708	NP_061178	Q9BSK4	FEM1A_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)	1	1130	+		Hepatocellular(1079;0.137)	331			TPR 1.		B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Nonsense_Mutation	SNP	ENST00000269856.3	37	c.991C>T	CCDS12135.1	.	.	.	.	.	.	.	.	.	.	C	37	6.144031	0.97320	.	.	ENSG00000141965	ENST00000269856	.	.	.	4.73	4.73	0.59995	.	0.494593	0.19651	U	0.109203	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-15.54	8.3155	0.32097	0.0:0.7415:0.1714:0.0871	.	.	.	.	X	331	.	ENSP00000269856:Q331X	Q	+	1	0	FEM1A	4743857	0.702000	0.27816	0.998000	0.56505	0.917000	0.54804	1.132000	0.31418	2.178000	0.69098	0.491000	0.48974	CAG		0.602	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1				22	40	0	0	0	0.005443	0	22	40		
MUC16	94025	broad.mit.edu	37	19	9048764	9048764	+	Missense_Mutation	SNP	A	A	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:9048764A>G	ENST00000397910.4	-	5	33070	c.32867T>C	c.(32866-32868)cTt>cCt	p.L10956P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10958	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGTTCACCAAGAGAAAAAGT	0.498																																						uc002mkp.2		NaN																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(32866-32868)CTT>CCT		mucin 16							142.0	130.0	134.0					19																	9048764		1914	4126	6040	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9048764A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32867T>C	19.37:g.9048764A>G	ENSP00000381008:p.Leu10956Pro						p.L10956P	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			5	33071	-			10958			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.32867T>C	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	4.983	0.182587	0.09495	.	.	ENSG00000181143	ENST00000397910	T	0.03272	3.99	3.5	-4.88	0.03113	.	.	.	.	.	T	0.00998	0.0033	N	0.00436	-1.5	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.47886	-0.9082	8	0.87932	D	0	.	3.317	0.07036	0.2894:0.0:0.2736:0.437	.	10956	B5ME49	.	P	10956	ENSP00000381008:L10956P	ENSP00000381008:L10956P	L	-	2	0	MUC16	8909764	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.450000	0.00466	-0.791000	0.04486	-1.210000	0.01631	CTT		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690		4	86	0	0	0	0.00308	0	4	86		
MUC16	94025	broad.mit.edu	37	19	9048771	9048771	+	Missense_Mutation	SNP	A	A	G	rs565447432		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:9048771A>G	ENST00000397910.4	-	5	33063	c.32860T>C	c.(32860-32862)Ttt>Ctt	p.F10954L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10956	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCAAGAGAAAAAGTCAGAATT	0.483													A|||	1	0.000199681	0.0008	0.0	5008	,	,		23799	0.0		0.0	False		,,,				2504	0.0					uc002mkp.2		NaN																	0				lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						c.(32860-32862)TTT>CTT		mucin 16							142.0	131.0	134.0					19																	9048771		1916	4124	6040	SO:0001583	missense	94025				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding	g.chr19:9048771A>G	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32860T>C	19.37:g.9048771A>G	ENSP00000381008:p.Phe10954Leu						p.F10954L	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN			5	33064	-			10956			Thr-rich.|Extracellular (Potential).		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	37	c.32860T>C	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	7.080	0.570084	0.13560	.	.	ENSG00000181143	ENST00000397910	T	0.02446	4.29	3.5	-7.0	0.01599	.	.	.	.	.	T	0.00784	0.0026	N	0.00538	-1.39	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.51140	-0.8743	8	0.87932	D	0	.	1.3695	0.02207	0.2002:0.1222:0.3337:0.344	.	10954	B5ME49	.	L	10954	ENSP00000381008:F10954L	ENSP00000381008:F10954L	F	-	1	0	MUC16	8909771	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.389000	0.00126	-2.474000	0.00527	-1.535000	0.00915	TTT		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1		NM_024690		4	90	0	0	0	0.00308	0	4	90		
ZNF878	729747	broad.mit.edu	37	19	12155757	12155757	+	Missense_Mutation	SNP	C	C	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:12155757C>A	ENST00000547628.1	-	4	596	c.459G>T	c.(457-459)agG>agT	p.R153S	CTD-2006C1.2_ENST00000591898.1_RNA|ZNF878_ENST00000602107.1_Missense_Mutation_p.R200S|CTD-2006C1.2_ENST00000591838.1_RNA|CTD-2006C1.10_ENST00000547473.1_Intron|CTD-2006C1.2_ENST00000476474.1_RNA	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						AACTGGGAAACCTGAATGCTT	0.423																																						uc002mta.1		NaN																	0					0						c.(598-600)AGG>AGT		zinc finger protein 878							139.0	150.0	146.0					19																	12155757		2165	4283	6448	SO:0001583	missense	729747				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding	g.chr19:12155757C>A		CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.459G>T	19.37:g.12155757C>A	ENSP00000447931:p.Arg153Ser						p.R200S	NM_001080404	NP_001073873	C9JN71	ZN878_HUMAN			5	600	-			153			C2H2-type 2.			Missense_Mutation	SNP	ENST00000547628.1	37	c.600G>T	CCDS45984.2	.	.	.	.	.	.	.	.	.	.	c	0.119	-1.128634	0.01756	.	.	ENSG00000257446;ENSG00000232371	ENST00000547628;ENST00000440730	T	0.13901	2.55	1.25	-2.51	0.06365	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04588	0.0125	N	0.11427	0.14	0.09310	N	1	B	0.15141	0.012	B	0.18871	0.023	T	0.39840	-0.9594	9	0.02654	T	1	.	3.7988	0.08750	0.3827:0.4258:0.0:0.1915	.	153	C9JN71	ZN878_HUMAN	S	153;200	ENSP00000447931:R153S	ENSP00000447931:R153S	R	-	3	2	AC022415.4;ZNF878	12016757	0.000000	0.05858	0.001000	0.08648	0.669000	0.39330	-2.636000	0.00867	-1.408000	0.02040	0.299000	0.19835	AGG		0.423	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403723.1		NM_001080404		7	94	1	0	5.18039e-06	0.00308	5.5478e-06	7	94		
ZNF799	90576	broad.mit.edu	37	19	12501446	12501446	+	Missense_Mutation	SNP	T	T	C	rs201078380		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:12501446T>C	ENST00000430385.3	-	4	1966	c.1766A>G	c.(1765-1767)gAa>gGa	p.E589G	ZNF799_ENST00000419318.1_Missense_Mutation_p.E557G|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TTCCTTACATTCATACGGGTT	0.413													T|||	1	0.000199681	0.0	0.0	5008	,	,		22235	0.0		0.0	False		,,,				2504	0.001					uc010dyt.2		NaN																	0				breast(3)|ovary(2)|skin(1)	6						c.(1765-1767)GAA>GGA		zinc finger protein 799							71.0	74.0	73.0					19																	12501446		2202	4278	6480	SO:0001583	missense	90576				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12501446T>C	BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1766A>G	19.37:g.12501446T>C	ENSP00000411084:p.Glu589Gly					ZNF799_uc002mts.3_Intron	p.E589G	NM_001080821	NP_001074290	Q96GE5	ZN799_HUMAN			4	1916	-			589			C2H2-type 17.			Missense_Mutation	SNP	ENST00000430385.3	37	c.1766A>G	CCDS45989.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.326777	0.24080	.	.	ENSG00000196466	ENST00000419318;ENST00000430385	T;T	0.22743	1.94;1.94	1.27	1.27	0.21489	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26629	0.0651	L	0.45228	1.405	0.09310	N	1	P	0.42692	0.787	P	0.53760	0.734	T	0.11446	-1.0587	9	0.49607	T	0.09	.	5.3684	0.16127	0.0:0.0:0.2914:0.7086	.	589	Q96GE5	ZN799_HUMAN	G	557;589	ENSP00000415278:E557G;ENSP00000411084:E589G	ENSP00000415278:E557G	E	-	2	0	ZNF799	12362446	0.000000	0.05858	0.018000	0.16275	0.046000	0.14306	-0.655000	0.05348	0.842000	0.35045	0.347000	0.21830	GAA		0.413	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344099.2		NM_001080821		3	36	0	0	0	0.004672	0	3	36		
ZNF564	163050	broad.mit.edu	37	19	12637723	12637723	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:12637723C>T	ENST00000339282.7	-	4	1395	c.1199G>A	c.(1198-1200)aGa>aAa	p.R400K	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.20_ENST00000593682.1_3'UTR|CTD-2192J16.21_ENST00000601420.1_RNA	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						GTCAAAGGCTCTACCACATAC	0.433																																						uc002mty.2		NaN																	0				ovary(1)	1						c.(1198-1200)AGA>AAA		zinc finger protein 564							140.0	144.0	143.0					19																	12637723		2203	4300	6503	SO:0001583	missense	163050				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:12637723C>T	BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.1199G>A	19.37:g.12637723C>T	ENSP00000340004:p.Arg400Lys					ZNF709_uc002mtx.3_Intron	p.R400K	NM_144976	NP_659413	Q8TBZ8	ZN564_HUMAN			4	1409	-			400			C2H2-type 11.		B9EGT4|Q6P1K6	Missense_Mutation	SNP	ENST00000339282.7	37	c.1199G>A	CCDS42505.1	.	.	.	.	.	.	.	.	.	.	C	7.051	0.564517	0.13498	.	.	ENSG00000249709	ENST00000339282	T	0.07114	3.22	1.56	0.263	0.15602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01661	0.0053	N	0.00605	-1.335	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.46414	-0.9193	9	0.02654	T	1	.	5.0091	0.14302	0.0:0.2327:0.0:0.7673	.	400	Q8TBZ8	ZN564_HUMAN	K	400	ENSP00000340004:R400K	ENSP00000340004:R400K	R	-	2	0	ZNF564	12498723	0.565000	0.26610	0.010000	0.14722	0.890000	0.51754	0.515000	0.22801	0.050000	0.15949	0.643000	0.83706	AGA		0.433	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344120.2		NM_144976		5	118	0	0	0	0.001168	0	5	118		
ZNF493	284443	broad.mit.edu	37	19	21606712	21606712	+	Silent	SNP	T	T	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:21606712T>C	ENST00000355504.4	+	2	1133	c.867T>C	c.(865-867)tcT>tcC	p.S289S	ZNF493_ENST00000392288.2_Silent_p.S417S|CTD-2561J22.3_ENST00000600810.1_Intron	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						ATAAGGAGTCTTCACACCTTA	0.348																																						uc002npx.2		NaN																	0				ovary(1)	1						c.(865-867)TCT>TCC		zinc finger protein 493 isoform 1							34.0	37.0	36.0					19																	21606712		2198	4293	6491	SO:0001819	synonymous_variant	284443				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:21606712T>C	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.867T>C	19.37:g.21606712T>C						ZNF493_uc002npw.2_Silent_p.S417S|ZNF493_uc002npy.2_Silent_p.S289S	p.S289S	NM_175910	NP_787106	Q6ZR52	ZN493_HUMAN			2	1147	+			289			C2H2-type 10.		G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Silent	SNP	ENST00000355504.4	37	c.867T>C	CCDS12412.1																																																																																				0.348	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1		NM_175910		4	35	0	0	0	0.014758	0	4	35		
ZNF208	7757	broad.mit.edu	37	19	22156621	22156621	+	Silent	SNP	A	A	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:22156621A>G	ENST00000397126.4	-	4	1363	c.1215T>C	c.(1213-1215)ggT>ggC	p.G405G	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACATACTAAAACCTTTGCCAC	0.393																																						uc002nqp.2		NaN																	0				ovary(5)|skin(2)	7						c.(1213-1215)GGT>GGC		zinc finger protein 208							46.0	52.0	50.0					19																	22156621		1995	4209	6204	SO:0001819	synonymous_variant	7757							g.chr19:22156621A>G	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1215T>C	19.37:g.22156621A>G						ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	p.G405G	NM_007153	NP_009084					4	1364	-		all_lung(12;0.0961)|Lung NSC(12;0.103)							Silent	SNP	ENST00000397126.4	37	c.1215T>C	CCDS54240.1																																																																																				0.393	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1		NM_007153		3	62	0	0	0	0.004672	0	3	62		
ZNF91	7644	broad.mit.edu	37	19	23544783	23544783	+	Missense_Mutation	SNP	C	C	T	rs410211		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:23544783C>T	ENST00000300619.7	-	4	1203	c.998G>A	c.(997-999)cGt>cAt	p.R333H	ZNF91_ENST00000397082.2_Missense_Mutation_p.R301H|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	333				R -> H (in Ref. 1; AAA59469). {ECO:0000305}.	transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R333H(1)					all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GGTTGAAGAACGGCTAAAAGC	0.393																																						uc002nre.2		NaN																	1	Substitution - Missense(1)		large_intestine(1)		0						c.(997-999)CGT>CAT		zinc finger protein 91							72.0	76.0	75.0					19																	23544783		2120	4254	6374	SO:0001583	missense	7644					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	g.chr19:23544783C>T	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.998G>A	19.37:g.23544783C>T	ENSP00000300619:p.Arg333His					ZNF91_uc010xrj.1_Missense_Mutation_p.R301H	p.R333H	NM_003430	NP_003421	Q05481	ZNF91_HUMAN			4	1111	-		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)	333	R -> H (in Ref. 1; AAA59469).		C2H2-type 7.		A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	37	c.998G>A	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	C	4.408	0.075438	0.08485	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.17854	2.25;2.25	1.97	-3.94	0.04130	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07279	0.0184	N	0.20845	0.615	0.09310	N	1	P;D	0.61080	0.566;0.989	B;B	0.41988	0.043;0.372	T	0.25257	-1.0137	9	0.14252	T	0.57	.	3.5074	0.07696	0.1773:0.4543:0.0:0.3684	rs410211	301;333	Q05481-2;Q05481	.;ZNF91_HUMAN	H	333;301	ENSP00000300619:R333H;ENSP00000380272:R301H	ENSP00000300619:R333H	R	-	2	0	ZNF91	23336623	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.698000	0.01908	-0.928000	0.03761	0.162000	0.16502	CGT		0.393	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1		NM_003430		6	94	0	0	0	0.001984	0	6	94		
ZNF681	148213	broad.mit.edu	37	19	23927146	23927146	+	Silent	SNP	A	A	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:23927146A>G	ENST00000402377.3	-	4	1347	c.1206T>C	c.(1204-1206)gcT>gcC	p.A402A	ZNF681_ENST00000395385.3_Silent_p.A333A	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ACTTGTTAAAAGCTTTGCCAC	0.398																																						uc002nrk.3		NaN																	0					0						c.(1204-1206)GCT>GCC		zinc finger protein 681							69.0	74.0	72.0					19																	23927146		2203	4300	6503	SO:0001819	synonymous_variant	148213				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:23927146A>G	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1206T>C	19.37:g.23927146A>G						ZNF681_uc002nrl.3_Silent_p.A333A|ZNF681_uc002nrj.3_Silent_p.A333A	p.A402A	NM_138286	NP_612143	Q96N22	ZN681_HUMAN			4	1348	-		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)	402			C2H2-type 9.		B3KVF7	Silent	SNP	ENST00000402377.3	37	c.1206T>C	CCDS12414.2																																																																																				0.398	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2		NM_138286		3	66	0	0	0	0.001984	0	3	66		
ZNF599	148103	broad.mit.edu	37	19	35251038	35251038	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:35251038C>G	ENST00000329285.8	-	4	1041	c.668G>C	c.(667-669)gGa>gCa	p.G223A		NM_001007248.2	NP_001007249.1	Q96NL3	ZN599_HUMAN	zinc finger protein 599	223					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|skin(1)	24	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			GGGCTTCACTCCAGCATGAAT	0.473																																						uc010edn.1		NaN																	0				ovary(1)|skin(1)	2						c.(667-669)GGA>GCA		zinc finger protein 599							189.0	185.0	186.0					19																	35251038		2203	4300	6503	SO:0001583	missense	148103				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:35251038C>G	AK055225	CCDS32991.1	19q13.13	2013-01-08				ENSG00000153896		"""Zinc fingers, C2H2-type"", ""-"""	26408	protein-coding gene	gene with protein product							Standard	NM_001007248		Approved	FLJ30663	uc010edn.1	Q96NL3		ENST00000329285.8:c.668G>C	19.37:g.35251038C>G	ENSP00000333802:p.Gly223Ala					ZNF599_uc010edm.1_Missense_Mutation_p.G186A	p.G223A	NM_001007248	NP_001007249	Q96NL3	ZN599_HUMAN	LUSC - Lung squamous cell carcinoma(66;0.138)		4	1056	-	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		223					Q569K0|Q5PRG1	Missense_Mutation	SNP	ENST00000329285.8	37	c.668G>C	CCDS32991.1	.	.	.	.	.	.	.	.	.	.	C	9.117	1.008035	0.19199	.	.	ENSG00000153896	ENST00000392231;ENST00000329285;ENST00000392229	T	0.26373	1.74	2.26	-0.0401	0.13873	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25531	0.0621	M	0.77486	2.375	0.80722	D	1	B	0.24882	0.113	B	0.20767	0.031	T	0.10132	-1.0643	9	0.87932	D	0	.	4.9968	0.14243	0.0:0.6402:0.2185:0.1413	.	223	Q96NL3	ZN599_HUMAN	A	222;223;25	ENSP00000333802:G223A	ENSP00000333802:G223A	G	-	2	0	ZNF599	39942878	0.003000	0.15002	0.788000	0.31933	0.799000	0.45148	1.069000	0.30641	0.069000	0.16605	0.313000	0.20887	GGA		0.473	ZNF599-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460648.2		XM_086046		6	204	0	0	0	0.004482	0	6	204		
SIPA1L3	23094	broad.mit.edu	37	19	38579389	38579389	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:38579389G>A	ENST00000222345.6	+	4	2072	c.1563G>A	c.(1561-1563)gaG>gaA	p.E521E		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	521					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			GCGTGGATGAGAAGCTGGGGC	0.587																																						uc002ohk.2		NaN																	0				ovary(1)|central_nervous_system(1)	2						c.(1561-1563)GAG>GAA		signal-induced proliferation-associated 1 like							93.0	76.0	82.0					19																	38579389		2203	4300	6503	SO:0001819	synonymous_variant	23094				regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity	g.chr19:38579389G>A	AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.1563G>A	19.37:g.38579389G>A							p.E521E	NM_015073	NP_055888	O60292	SI1L3_HUMAN	Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)		4	2072	+			521					Q2TV87	Silent	SNP	ENST00000222345.6	37	c.1563G>A	CCDS33007.1																																																																																				0.587	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156294.2		XM_032278		15	33	0	0	0	0.020292	0	15	33		
LIPE	3991	broad.mit.edu	37	19	42931254	42931254	+	Silent	SNP	T	T	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:42931254T>C	ENST00000244289.4	-	1	324	c.48A>G	c.(46-48)gaA>gaG	p.E16E	LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000593740.2_RNA|LIPE-AS1_ENST00000594688.1_RNA|CTB-50E14.4_ENST00000596781.1_RNA|LIPE-AS1_ENST00000457234.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	16					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				TCTGGTGTGGTTCAGGTTGCC	0.517																																						uc002otr.2		NaN																	0				ovary(1)|breast(1)	2						c.(46-48)GAA>GAG		hormone-sensitive lipase							84.0	80.0	82.0					19																	42931254		2203	4300	6503	SO:0001819	synonymous_variant	3991				cholesterol metabolic process|protein phosphorylation|triglyceride catabolic process	caveola|cytosol	hormone-sensitive lipase activity|protein binding	g.chr19:42931254T>C	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.48A>G	19.37:g.42931254T>C						uc010eif.1_Intron|uc002ott.1_Intron|uc010eig.1_Intron|uc010eih.1_Intron|LIPE_uc002ots.1_5'Flank	p.E16E	NM_005357	NP_005348	Q05469	LIPS_HUMAN			1	325	-		Prostate(69;0.00682)	16					Q3LRT2|Q6NSL7	Silent	SNP	ENST00000244289.4	37	c.48A>G	CCDS12607.1																																																																																				0.517	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463861.1		NM_005357		7	28	0	0	0	0.006214	0	7	28		
ZNF229	7772	broad.mit.edu	37	19	44933766	44933766	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:44933766C>T	ENST00000588931.1	-	6	1623	c.1190G>A	c.(1189-1191)aGg>aAg	p.R397K	ZNF229_ENST00000591289.1_Intron|CTC-512J12.4_ENST00000588655.1_RNA|ZNF229_ENST00000291187.4_Missense_Mutation_p.R391K	NM_014518.2	NP_055333.2	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	397					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|central_nervous_system(2)|endometrium(6)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	45		Prostate(69;0.0352)				AGTGTGGACCCTCTGATGGAC	0.502																																						uc002oze.1		NaN																	0				skin(2)|ovary(1)|pancreas(1)	4						c.(1189-1191)AGG>AAG		zinc finger protein 229							96.0	106.0	102.0					19																	44933766		2203	4300	6503	SO:0001583	missense	7772				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:44933766C>T	AF192979	CCDS42574.1, CCDS62706.1	19q13.2	2013-01-08				ENSG00000278318		"""Zinc fingers, C2H2-type"", ""-"""	13022	protein-coding gene	gene with protein product							Standard	XM_006723372		Approved		uc002oze.1	Q9UJW7		ENST00000588931.1:c.1190G>A	19.37:g.44933766C>T	ENSP00000466519:p.Arg397Lys					ZNF229_uc010ejk.1_Missense_Mutation_p.R51K|ZNF229_uc010ejl.1_Missense_Mutation_p.R391K	p.R397K	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN			6	1624	-		Prostate(69;0.0352)	397			C2H2-type 3.		B2RWN3|Q59FV2|Q86WL9	Missense_Mutation	SNP	ENST00000588931.1	37	c.1190G>A	CCDS42574.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708869	0.68615	.	.	ENSG00000167383	ENST00000291187	.	.	.	3.86	1.63	0.23807	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18257	0.0438	N	0.11106	0.095	0.09310	N	1	B	0.22746	0.074	B	0.21917	0.037	T	0.20306	-1.0279	8	0.38643	T	0.18	.	5.8681	0.18789	0.0:0.6464:0.1573:0.1964	.	397	Q9UJW7	ZN229_HUMAN	K	397	.	ENSP00000291187:R397K	R	-	2	0	ZNF229	49625606	0.000000	0.05858	0.036000	0.18154	0.979000	0.70002	0.153000	0.16323	0.603000	0.29913	0.609000	0.83330	AGG		0.502	ZNF229-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460833.1		NM_014518		32	51	0	0	0	0.013726	0	32	51		
ZNF577	84765	broad.mit.edu	37	19	52376698	52376698	+	Missense_Mutation	SNP	C	C	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:52376698C>A	ENST00000301399.5	-	7	910	c.545G>T	c.(544-546)gGa>gTa	p.G182V	ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000420592.1_Missense_Mutation_p.G123V|ZNF577_ENST00000451628.2_Missense_Mutation_p.G123V	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		GGGTTTCTCTCCTCTTTCAGT	0.468																																						uc010yde.1		NaN																	0				ovary(1)	1						c.(544-546)GGA>GTA		zinc finger protein 577 isoform a							125.0	117.0	120.0					19																	52376698		2203	4300	6503	SO:0001583	missense	84765				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:52376698C>A	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.545G>T	19.37:g.52376698C>A	ENSP00000301399:p.Gly182Val					ZNF577_uc010ydd.1_Intron|ZNF577_uc002pxx.3_Missense_Mutation_p.G123V|ZNF577_uc002pxv.2_Missense_Mutation_p.G175V|ZNF577_uc002pxw.2_Missense_Mutation_p.G116V	p.G182V	NM_032679	NP_116068	Q9BSK1	ZN577_HUMAN		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)	7	936	-		all_neural(266;0.0602)	182					A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	37	c.545G>T	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	9.304	1.053788	0.19907	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T	0.36520	2.01;1.25;1.25;2.01	3.1	2.05	0.26809	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50446	0.1616	M	0.74389	2.26	0.44871	D	0.99788	D;D	0.63046	0.992;0.988	P;P	0.57846	0.828;0.782	T	0.52548	-0.8561	9	0.72032	D	0.01	.	9.2368	0.37470	0.0:0.8866:0.0:0.1134	.	182;123	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	V	182;123;123;182	ENSP00000301399:G182V;ENSP00000413476:G123V;ENSP00000389652:G123V;ENSP00000404509:G182V	ENSP00000301399:G182V	G	-	2	0	ZNF577	57068510	0.311000	0.24536	0.143000	0.22291	0.076000	0.17211	2.921000	0.48852	0.615000	0.30124	0.655000	0.94253	GGA		0.468	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1		NM_032679		4	88	1	0	0.000602214	0.014758	0.000627134	4	88		
ZNF611	81856	broad.mit.edu	37	19	53209409	53209409	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:53209409G>T	ENST00000319783.1	-	7	1215	c.899C>A	c.(898-900)tCa>tAa	p.S300*	ZNF611_ENST00000595798.1_Nonsense_Mutation_p.S231*|ZNF611_ENST00000602046.1_5'Flank|ZNF611_ENST00000602162.1_Nonsense_Mutation_p.S231*|ZNF611_ENST00000540744.1_Nonsense_Mutation_p.S300*|ZNF611_ENST00000453741.2_Nonsense_Mutation_p.S231*|ZNF611_ENST00000543227.1_Nonsense_Mutation_p.S300*	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	300					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		GGTAAGGGATGACTCCTGACT	0.413																																						uc002pzz.2		NaN																	0				ovary(1)	1						c.(898-900)TCA>TAA		zinc finger protein 611 isoform a							177.0	163.0	168.0					19																	53209409		2203	4300	6503	SO:0001587	stop_gained	81856				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53209409G>T	AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.899C>A	19.37:g.53209409G>T	ENSP00000322427:p.Ser300*					ZNF611_uc010eqc.2_Nonsense_Mutation_p.S230*|ZNF611_uc010ydo.1_Nonsense_Mutation_p.S230*|ZNF611_uc010ydr.1_Nonsense_Mutation_p.S231*|ZNF611_uc010ydp.1_Nonsense_Mutation_p.S300*|ZNF611_uc010ydq.1_Nonsense_Mutation_p.S300*|ZNF611_uc002qaa.3_Nonsense_Mutation_p.S230*	p.S300*	NM_030972	NP_112234	Q8N823	ZN611_HUMAN		OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)	7	1216	-			300			C2H2-type 3.		B3KRD5|Q69YG9	Nonsense_Mutation	SNP	ENST00000319783.1	37	c.899C>A	CCDS12855.1	.	.	.	.	.	.	.	.	.	.	.	26.3	4.722886	0.89298	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	.	.	.	1.66	1.66	0.24008	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3001	0.43648	0.0:0.0:1.0:0.0	.	.	.	.	X	300;300;231;300	.	ENSP00000322427:S300X	S	-	2	0	ZNF611	57901221	0.000000	0.05858	0.005000	0.12908	0.047000	0.14425	0.059000	0.14322	0.910000	0.36722	0.194000	0.17425	TCA		0.413	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337612.1		NM_030972		27	192	1	0	7.38237e-10	0.00632	7.96241e-10	27	192		
ZNF347	84671	broad.mit.edu	37	19	53644362	53644362	+	Silent	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:53644362C>T	ENST00000334197.7	-	5	1787	c.1719G>A	c.(1717-1719)gaG>gaA	p.E573E	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000452676.2_Silent_p.E574E|ZNF347_ENST00000601469.2_Silent_p.E574E	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	573					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		CCTTGCCACACTCATTACATT	0.408																																					Melanoma(64;205 1597 17324 45721)	uc002qbb.1		NaN																	0					0						c.(1717-1719)GAG>GAA		zinc finger protein 347							153.0	145.0	148.0					19																	53644362		2203	4298	6501	SO:0001819	synonymous_variant	84671				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr19:53644362C>T	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.1719G>A	19.37:g.53644362C>T						ZNF347_uc010eql.1_Silent_p.E574E|ZNF347_uc002qbc.1_Silent_p.E574E	p.E573E	NM_032584	NP_115973	Q96SE7	ZN347_HUMAN		GBM - Glioblastoma multiforme(134;0.0179)	5	1788	-			573			C2H2-type 12.		B3KU77|B9EG59|G5E9N4|Q8TCN1	Silent	SNP	ENST00000334197.7	37	c.1719G>A	CCDS33097.1																																																																																				0.408	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1		NM_032584		5	247	0	0	0	0.00308	0	5	247		
ZNF628	89887	broad.mit.edu	37	19	55993619	55993619	+	Silent	SNP	G	G	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr19:55993619G>T	ENST00000598519.1	+	3	1612	c.1059G>T	c.(1057-1059)gcG>gcT	p.A353A	NAT14_ENST00000591590.1_5'Flank|NAT14_ENST00000205194.4_5'Flank|ZNF628_ENST00000391718.2_Silent_p.A349A|NAT14_ENST00000587400.1_5'Flank			Q5EBL2	ZN628_HUMAN	zinc finger protein 628	353	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|lung(2)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)		CCGCCCCCGCGCCTGGCTTTG	0.771																																						uc002qld.2		NaN																	0					0						c.(1045-1047)GCG>GCT		zinc finger protein 628							1.0	2.0	2.0					19																	55993619		1100	2380	3480	SO:0001819	synonymous_variant	89887					nucleus	DNA binding|zinc ion binding	g.chr19:55993619G>T	AF367249	CCDS33116.3	19q13.43	2013-01-08			ENSG00000197483	ENSG00000197483		"""Zinc fingers, C2H2-type"""	28054	protein-coding gene	gene with protein product	"""Zinc finger expressed in Embryonal cells and Certain adult organs"""	610671					Standard	NM_033113		Approved	ZEC, Zfp628	uc002qld.3	Q5EBL2	OTTHUMG00000150396	ENST00000598519.1:c.1059G>T	19.37:g.55993619G>T						NAT14_uc002qle.1_5'Flank	p.A349A	NM_033113	NP_149104	Q5EBL2	ZN628_HUMAN	BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0531)	3	1612	+	Breast(117;0.155)		349			Pro-rich.		Q86X34	Silent	SNP	ENST00000598519.1	37	c.1047G>T	CCDS33116.3																																																																																				0.771	ZNF628-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317934.2		XM_058964		10	6	1	0	2.61681e-11	0.020292	2.84273e-11	10	6		
LRRTM1	347730	broad.mit.edu	37	2	80530714	80530714	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr2:80530714G>A	ENST00000295057.3	-	2	887	c.231C>T	c.(229-231)ctC>ctT	p.L77L	CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000541047.1_Intron|LRRTM1_ENST00000409148.1_Silent_p.L77L|CTNNA2_ENST00000402739.4_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	77					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						GCAGCTCCGAGAGGCTGTTGT	0.647										HNSCC(69;0.2)																												uc002sok.1		NaN																	0				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						c.(229-231)CTC>CTT		leucine rich repeat transmembrane neuronal 1							63.0	66.0	65.0					2																	80530714		2203	4300	6503	SO:0001819	synonymous_variant	347730					axon|endoplasmic reticulum membrane|growth cone|integral to membrane		g.chr2:80530714G>A	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.231C>T	2.37:g.80530714G>A		HNSCC(69;0.2)				CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	p.L77L	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN			2	501	-			77			Lumenal (Potential).		A8K397|D6W5K1|Q96DN1	Silent	SNP	ENST00000295057.3	37	c.231C>T	CCDS1966.1																																																																																				0.647	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1		NM_178839		4	63	0	0	0	0.009096	0	4	63		
NEB	4703	broad.mit.edu	37	2	152484126	152484126	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr2:152484126C>T	ENST00000172853.10	-	65	9472	c.9325G>A	c.(9325-9327)Gac>Aac	p.D3109N	NEB_ENST00000397345.3_Missense_Mutation_p.D3352N|NEB_ENST00000604864.1_Missense_Mutation_p.D3352N|NEB_ENST00000427231.2_Missense_Mutation_p.D3352N|NEB_ENST00000603639.1_Missense_Mutation_p.D3352N|NEB_ENST00000409198.1_Missense_Mutation_p.D3109N			P20929	NEBU_HUMAN	nebulin	3109					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCTTGTAGTCCACATCGCTG	0.522																																						uc010fnx.2		NaN																	0				ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20						c.(9325-9327)GAC>AAC		nebulin isoform 3							310.0	306.0	307.0					2																	152484126		2127	4223	6350	SO:0001583	missense	4703				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle	g.chr2:152484126C>T	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.9325G>A	2.37:g.152484126C>T	ENSP00000172853:p.Asp3109Asn						p.D3109N	NM_004543	NP_004534	P20929	NEBU_HUMAN		BRCA - Breast invasive adenocarcinoma(221;0.219)	65	9516	-			3109			Nebulin 84.		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	37	c.9325G>A		.	.	.	.	.	.	.	.	.	.	C	21.2	4.111196	0.77210	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.58	5.58	0.84498	.	0.046057	0.85682	D	0.000000	T	0.44138	0.1279	L	0.58583	1.82	0.80722	D	1	B	0.30033	0.266	B	0.32533	0.147	T	0.27706	-1.0066	10	0.19147	T	0.46	.	19.5796	0.95461	0.0:1.0:0.0:0.0	.	3109	P20929	NEBU_HUMAN	N	3109;3352;3352;3109	ENSP00000386259:D3109N;ENSP00000380505:D3352N;ENSP00000416578:D3352N;ENSP00000172853:D3109N	ENSP00000172853:D3109N	D	-	1	0	NEB	152192372	1.000000	0.71417	0.957000	0.39632	0.884000	0.51177	3.958000	0.56737	2.624000	0.88883	0.655000	0.94253	GAC		0.522	NEB-201	KNOWN	basic	protein_coding	protein_coding			NM_004543		8	250	0	0	0	0.004482	0	8	250		
TTN	7273	broad.mit.edu	37	2	179613777	179613777	+	Intron	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr2:179613777G>C	ENST00000591111.1	-	45	10585				TTN_ENST00000360870.5_Missense_Mutation_p.H4450Q|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000578746.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCCCGGGTAGTGTATCTCTT	0.333																																						uc002unb.2		NaN																	0				ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153						c.(13348-13350)CAC>CAG		titin isoform novex-3							62.0	65.0	64.0					2																	179613777		2200	4294	6494	SO:0001627	intron_variant	7273						ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	g.chr2:179613777G>C	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+4073C>G	2.37:g.179613777G>C						TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	p.H4450Q	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		46	13574	-			Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37	c.13350C>G		.	.	.	.	.	.	.	.	.	.	G	5.029	0.191105	0.09547	.	.	ENSG00000155657	ENST00000360870	T	0.55930	0.49	5.95	-2.35	0.06684	.	.	.	.	.	T	0.22820	0.0551	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14727	-1.0462	9	0.25106	T	0.35	.	0.6668	0.00852	0.2794:0.2001:0.3171:0.2035	.	4450	Q8WZ42-6	.	Q	4450	ENSP00000354117:H4450Q	ENSP00000354117:H4450Q	H	-	3	2	TTN	179322022	0.000000	0.05858	0.002000	0.10522	0.058000	0.15608	-0.568000	0.05909	-0.104000	0.12154	0.563000	0.77884	CAC		0.333	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1		NM_133378		4	35	0	0	0	0.014758	0	4	35		
NBEAL1	65065	broad.mit.edu	37	2	204058632	204058632	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr2:204058632G>C	ENST00000449802.1	+	46	7282	c.6949G>C	c.(6949-6951)Gag>Cag	p.E2317Q		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2317										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ATTTTTTATAGAGGTAATATC	0.308																																						uc002uzt.3		NaN																	0				ovary(1)|skin(1)	2						c.(6949-6951)GAG>CAG		neurobeachin-like 1 isoform 3							118.0	117.0	117.0					2																	204058632		1825	4074	5899	SO:0001583	missense	65065						binding	g.chr2:204058632G>C	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6949G>C	2.37:g.204058632G>C	ENSP00000399903:p.Glu2317Gln					NBEAL1_uc002uzs.3_Intron	p.E2317Q	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN			46	7282	+			2317					A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	37	c.6949G>C	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822681	0.90873	.	.	ENSG00000144426	ENST00000449802;ENST00000414576	T;T	0.41758	0.99;0.99	5.27	5.27	0.74061	.	0.000000	0.85682	U	0.000000	T	0.66713	0.2817	M	0.81341	2.54	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.66106	-0.6006	10	0.34782	T	0.22	.	18.4707	0.90773	0.0:0.0:1.0:0.0	.	2317	Q6ZS30	NBEL1_HUMAN	Q	2317;332	ENSP00000399903:E2317Q;ENSP00000388466:E332Q	ENSP00000388466:E332Q	E	+	1	0	NBEAL1	203766877	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.028000	0.93712	2.467000	0.83353	0.650000	0.86243	GAG		0.308	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4				3	36	0	0	0	0.014758	0	3	36		
SMARCAL1	50485	broad.mit.edu	37	2	217342939	217342939	+	Missense_Mutation	SNP	G	G	C	rs119473033		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr2:217342939G>C	ENST00000357276.4	+	17	2872	c.2542G>C	c.(2542-2544)Gag>Cag	p.E848Q	AC098820.3_ENST00000453157.1_RNA|SMARCAL1_ENST00000358207.5_Missense_Mutation_p.E848Q	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	848	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CCTGATTCAAGAGAAGATTAA	0.458									Schimke Immuno-Osseous Dysplasia																													uc002vgc.3		NaN																	0				ovary(3)|breast(3)|skin(1)	7	GRCh37	CM020320	SMARCAL1	M	rs119473033	c.(2542-2544)GAG>CAG		SWI/SNF-related matrix-associated							90.0	101.0	98.0					2																	217342939		2203	4300	6503	SO:0001583	missense	50485	Schimke_Immuno-Osseous_Dysplasia	Familial Cancer Database	SIOD	chromatin modification|DNA metabolic process|regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity	g.chr2:217342939G>C	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2542G>C	2.37:g.217342939G>C	ENSP00000349823:p.Glu848Gln					SMARCAL1_uc010fvf.2_RNA|SMARCAL1_uc002vgd.3_Missense_Mutation_p.E848Q|SMARCAL1_uc010fvg.2_Missense_Mutation_p.E826Q	p.E848Q	NM_014140	NP_054859	Q9NZC9	SMAL1_HUMAN		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)	17	2872	+		Renal(323;0.0458)	848			Helicase C-terminal.		A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	ENST00000357276.4	37	c.2542G>C	CCDS2403.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424817	0.62733	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;T	0.92348	-3.02;-3.02;-0.97	5.23	5.23	0.72850	Helicase, C-terminal (1);	0.049784	0.85682	D	0.000000	D	0.87426	0.6174	N	0.25789	0.76	0.58432	D	0.999991	B	0.30542	0.284	B	0.28011	0.085	D	0.85594	0.1248	10	0.48119	T	0.1	-32.897	17.9715	0.89115	0.0:0.0:1.0:0.0	.	848	Q9NZC9	SMAL1_HUMAN	Q	848;848;690	ENSP00000349823:E848Q;ENSP00000350940:E848Q;ENSP00000375974:E690Q	ENSP00000349823:E848Q	E	+	1	0	SMARCAL1	217051184	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.176000	0.71955	2.716000	0.92895	0.655000	0.94253	GAG		0.458	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256671.2				33	51	0	0	0	0.007835	0	33	51		
DOCK10	55619	broad.mit.edu	37	2	225651829	225651829	+	Silent	SNP	G	G	A	rs377144071		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr2:225651829G>A	ENST00000258390.7	-	50	5632	c.5565C>T	c.(5563-5565)gaC>gaT	p.D1855D	DOCK10_ENST00000409592.3_Silent_p.D1849D	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1855	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ACCGATGAATGTCGTAGTAGA	0.403																																						uc010fwz.1		NaN																	0				ovary(2)	2						c.(5563-5565)GAC>GAT		dedicator of cytokinesis 10		G		0,3744		0,0,1872	128.0	121.0	123.0		5565	3.2	1.0	2		123	2,8226		0,2,4112	no	coding-synonymous	DOCK10	NM_014689.2		0,2,5984	AA,AG,GG		0.0243,0.0,0.0167		1855/2187	225651829	2,11970	1872	4114	5986	SO:0001819	synonymous_variant	55619						GTP binding	g.chr2:225651829G>A	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5565C>T	2.37:g.225651829G>A						DOCK10_uc002vob.2_Silent_p.D1849D|DOCK10_uc002voa.2_Silent_p.D511D|DOCK10_uc002voc.2_Silent_p.D676D	p.D1855D	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)	50	5804	-		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)	1855			DHR-2.		B3FL70|O75178|Q9NW06|Q9NXI8	Silent	SNP	ENST00000258390.7	37	c.5565C>T	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	G	9.787	1.176777	0.21704	0.0	2.43E-4	ENSG00000135905	ENST00000535663	.	.	.	5.99	3.23	0.37069	.	.	.	.	.	T	0.61961	0.2389	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56763	-0.7925	4	.	.	.	.	11.6095	0.51052	0.1915:0.0:0.8085:0.0	.	.	.	.	Y	3	.	.	H	-	1	0	DOCK10	225360073	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	3.844000	0.55873	0.423000	0.26033	0.655000	0.94253	CAT		0.403	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1				5	69	0	0	0	0.001168	0	5	69		
SLC16A14	151473	broad.mit.edu	37	2	230911105	230911105	+	Missense_Mutation	SNP	G	G	C	rs111627569		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr2:230911105G>C	ENST00000295190.4	-	4	1195	c.737C>G	c.(736-738)aCa>aGa	p.T246R		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		CTTCTCTTCTGTTCTTCCCTG	0.582																																						uc002vqd.1		NaN																	0				ovary(4)|skin(2)	6						c.(736-738)ACA>AGA		solute carrier family 16 (monocarboxylic acid							108.0	114.0	112.0					2																	230911105		2203	4300	6503	SO:0001583	missense	151473					integral to membrane|plasma membrane	symporter activity	g.chr2:230911105G>C	BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.737C>G	2.37:g.230911105G>C	ENSP00000295190:p.Thr246Arg					FBXO36_uc010fxi.1_Intron|SLC16A14_uc002vqe.2_Missense_Mutation_p.T246R|SLC16A14_uc002vqf.2_Missense_Mutation_p.T246R	p.T246R	NM_152527	NP_689740	Q7RTX9	MOT14_HUMAN		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)	4	1100	-		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)	246			Extracellular (Potential).		A8KA08|Q53R92|Q96NI7	Missense_Mutation	SNP	ENST00000295190.4	37	c.737C>G	CCDS2473.1	.	.	.	.	.	.	.	.	.	.	G	0.238	-1.015512	0.02078	.	.	ENSG00000163053	ENST00000295190;ENST00000457406;ENST00000412034	T;T;T	0.08282	3.11;3.12;3.12	4.49	2.69	0.31865	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	3.519580	0.00659	N	0.000585	T	0.11410	0.0278	L	0.42245	1.32	0.09310	N	1	B;B	0.26147	0.018;0.143	B;B	0.36567	0.044;0.228	T	0.39375	-0.9617	10	0.20519	T	0.43	.	4.5174	0.11943	0.1851:0.0:0.5219:0.2929	.	246;246	E7EMG7;Q7RTX9	.;MOT14_HUMAN	R	246	ENSP00000295190:T246R;ENSP00000400352:T246R;ENSP00000395775:T246R	ENSP00000295190:T246R	T	-	2	0	SLC16A14	230619349	0.044000	0.20184	0.000000	0.03702	0.136000	0.21042	1.893000	0.39758	0.520000	0.28426	0.561000	0.74099	ACA		0.582	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2		NM_152527		5	106	0	0	0	0.001984	0	5	106		
SRC	6714	broad.mit.edu	37	20	36012632	36012632	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr20:36012632G>A	ENST00000373578.2	+	4	425	c.76G>A	c.(76-78)Ggc>Agc	p.G26S	SRC_ENST00000360723.4_Missense_Mutation_p.G26S|SRC_ENST00000358208.4_Missense_Mutation_p.G26S|SRC_ENST00000373567.2_Missense_Mutation_p.G26S|SRC_ENST00000445403.1_Missense_Mutation_p.G26S|SRC_ENST00000373558.2_Missense_Mutation_p.G26S	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	26					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	GAACGTGCACGGCGCTGGCGG	0.741																																						uc002xgx.2		NaN																	0				large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13						c.(76-78)GGC>AGC		proto-oncogene tyrosine-protein kinase SRC	Dasatinib(DB01254)						10.0	14.0	12.0					20																	36012632		1923	4015	5938	SO:0001583	missense	6714				axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity	g.chr20:36012632G>A	AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.76G>A	20.37:g.36012632G>A	ENSP00000362680:p.Gly26Ser					SRC_uc002xgy.2_Missense_Mutation_p.G26S	p.G26S	NM_005417	NP_005408	P12931	SRC_HUMAN			4	525	+		Myeloproliferative disorder(115;0.00878)	26					E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	37	c.76G>A	CCDS13294.1	.	.	.	.	.	.	.	.	.	.	G	4.212	0.038217	0.08148	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	T;T;T;T;T;T	0.74106	-0.77;-0.77;-0.81;-0.77;-0.77;-0.81	4.14	2.05	0.26809	.	1.260090	0.05256	N	0.514939	T	0.51686	0.1689	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.10450	0.005	T	0.41893	-0.9483	10	0.13108	T	0.6	.	5.5362	0.17013	0.1215:0.3348:0.5436:0.0	.	26	P12931	SRC_HUMAN	S	26	ENSP00000408503:G26S;ENSP00000362680:G26S;ENSP00000353950:G26S;ENSP00000350941:G26S;ENSP00000362668:G26S;ENSP00000362659:G26S	ENSP00000350941:G26S	G	+	1	0	SRC	35446046	0.000000	0.05858	0.007000	0.13788	0.003000	0.03518	-0.040000	0.12104	0.956000	0.37904	0.561000	0.74099	GGC		0.741	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1		NM_005417		4	31	0	0	0	0.004482	0	4	31		
KCNQ2	3785	broad.mit.edu	37	20	62044922	62044922	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr20:62044922G>A	ENST00000359125.2	-	15	1818	c.1644C>T	c.(1642-1644)ttC>ttT	p.F548F	KCNQ2_ENST00000360480.3_Silent_p.F520F|KCNQ2_ENST00000354587.3_Silent_p.F520F|KCNQ2_ENST00000370224.1_Silent_p.F520F|KCNQ2_ENST00000344462.4_Silent_p.F517F|KCNQ2_ENST00000359689.1_Silent_p.F548F|KCNQ2_ENST00000357249.2_Silent_p.F530F	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	548					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TGGACACCAGGAACCGCATGA	0.647																																						uc002yey.1		NaN																	0				upper_aerodigestive_tract(1)|ovary(1)	2						c.(1642-1644)TTC>TTT		potassium voltage-gated channel KQT-like protein	Amitriptyline(DB00321)						89.0	88.0	89.0					20																	62044922		2203	4300	6503	SO:0001819	synonymous_variant	3785				axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr20:62044922G>A	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1644C>T	20.37:g.62044922G>A						KCNQ2_uc002yez.1_Silent_p.F517F|KCNQ2_uc002yfa.1_Silent_p.F530F|KCNQ2_uc002yfb.1_Silent_p.F520F	p.F548F	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		15	1821	-	all_cancers(38;1.24e-11)		548			Cytoplasmic (Potential).		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Silent	SNP	ENST00000359125.2	37	c.1644C>T	CCDS13520.1																																																																																				0.647	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080353.1		NM_172109		30	85	0	0	0	0.013726	0	30	85		
BCL2L13	23786	broad.mit.edu	37	22	18210132	18210132	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr22:18210132G>A	ENST00000317582.5	+	7	1637	c.1290G>A	c.(1288-1290)gaG>gaA	p.E430E	BCL2L13_ENST00000485631.1_3'UTR|BCL2L13_ENST00000543133.1_Silent_p.E268E|BCL2L13_ENST00000418951.2_3'UTR|BCL2L13_ENST00000337612.5_Silent_p.E268E|BCL2L13_ENST00000538149.1_Silent_p.E306E|BCL2L13_ENST00000355028.3_3'UTR	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	430					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		CTGCCAGCGAGAAGAAGCCCG	0.592																																						uc002zmw.2		NaN																	0				ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4						c.(1288-1290)GAG>GAA		BCL2-like 13 (apoptosis facilitator)							70.0	70.0	70.0					22																	18210132		2203	4300	6503	SO:0001819	synonymous_variant	23786				induction of apoptosis	integral to membrane|mitochondrial membrane|nucleus	caspase activator activity	g.chr22:18210132G>A	AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.1290G>A	22.37:g.18210132G>A						BCL2L13_uc002zmx.2_Silent_p.E268E|BCL2L13_uc002zmy.2_3'UTR|BCL2L13_uc010gqy.2_Silent_p.E268E|BCL2L13_uc011agk.1_Silent_p.E306E|BCL2L13_uc010gqz.2_Silent_p.E150E|BCL2L13_uc002zmz.2_Silent_p.E268E|BCL2L13_uc002zna.2_Silent_p.E150E	p.E430E	NM_015367	NP_056182	Q9BXK5	B2L13_HUMAN		Lung(27;0.199)	7	1508	+		all_epithelial(15;0.123)	430			B.		B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Silent	SNP	ENST00000317582.5	37	c.1290G>A	CCDS13746.1																																																																																				0.592	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316184.1		NM_015367		12	29	0	0	0	0.016723	0	12	29		
GNAZ	2781	broad.mit.edu	37	22	23438065	23438065	+	Silent	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr22:23438065C>T	ENST00000248996.4	+	2	849	c.183C>T	c.(181-183)ttC>ttT	p.F61F	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	61					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		GCGGCGGCTTCAACCTGGAGG	0.597																																						uc002zwu.1		NaN																	0				kidney(1)|skin(1)	2						c.(181-183)TTC>TTT		guanine nucleotide binding protein, alpha z							137.0	141.0	140.0					22																	23438065		2203	4300	6503	SO:0001819	synonymous_variant	2781					endoplasmic reticulum|heterotrimeric G-protein complex|nuclear envelope	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|metabotropic serotonin receptor binding|receptor signaling protein activity	g.chr22:23438065C>T		CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.183C>T	22.37:g.23438065C>T						RTDR1_uc002zwt.2_Intron	p.F61F	NM_002073	NP_002064	P19086	GNAZ_HUMAN		READ - Rectum adenocarcinoma(21;0.166)	2	720	+	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)		61					B2R6C1|Q4QRJ6	Silent	SNP	ENST00000248996.4	37	c.183C>T	CCDS13804.1																																																																																				0.597	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319073.1		NM_002073		56	98	0	0	0	0.01441	0	56	98		
NDUFA6	4700	broad.mit.edu	37	22	42486786	42486786	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr22:42486786C>G	ENST00000498737.2	-	1	173	c.41G>C	c.(40-42)tGc>tCc	p.C14S	NDUFA6-AS1_ENST00000595777.1_RNA|NDUFA6-AS1_ENST00000434834.1_RNA|NDUFA6-AS1_ENST00000600968.1_RNA|NDUFA6_ENST00000602404.1_5'Flank|NDUFA6-AS1_ENST00000608974.1_RNA|NDUFA6-AS1_ENST00000416037.2_RNA|NDUFA6-AS1_ENST00000417327.1_RNA|NDUFA6-AS1_ENST00000439129.1_RNA|NDUFA6-AS1_ENST00000536447.2_RNA|RP1-257I20.14_ENST00000602718.1_RNA	NM_002490.3	NP_002481.2	P56556	NDUA6_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa	14					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			kidney(1)|lung(3)|upper_aerodigestive_tract(1)	5						CACCCCTTTGCAAGCAGCGCG	0.622											OREG0026602	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc003bcb.2		NaN																	0					0						c.(40-42)TGC>TCC		NADH dehydrogenase (ubiquinone) 1 alpha	NADH(DB00157)						95.0	103.0	100.0					22																	42486786		2203	4300	6503	SO:0001583	missense	4700				mitochondrial electron transport, NADH to ubiquinone|response to oxidative stress|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity	g.chr22:42486786C>G	AF047182	CCDS33656.1	22q13.2	2010-05-07	2002-08-29		ENSG00000184983	ENSG00000184983		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7690	protein-coding gene	gene with protein product	"""complex I B14 subunit"""	602138	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6 (14kD, B14)"""			9763676, 9425316	Standard	NM_002490		Approved	B14, LYRM6, CI-B14, NADHB14	uc003bcb.3	P56556	OTTHUMG00000151287	ENST00000498737.2:c.41G>C	22.37:g.42486786C>G	ENSP00000418842:p.Cys14Ser		OREG0026602	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	909	uc003bcc.1_5'Flank|uc003bcd.1_5'Flank	p.C14S	NM_002490	NP_002481	P56556	NDUA6_HUMAN			1	103	-			14					B2RE54|O43675|Q6FGW0|Q6IBT8|Q6IC39	Missense_Mutation	SNP	ENST00000498737.2	37	c.41G>C	CCDS33656.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780502	0.31502	.	.	ENSG00000184983	ENST00000498737	T	0.66638	-0.22	2.74	1.69	0.24217	.	18.143700	0.00166	N	0.000002	T	0.45458	0.1343	N	0.03608	-0.345	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.38478	-0.9659	10	0.42905	T	0.14	.	6.8139	0.23819	0.0:0.8542:0.0:0.1458	.	14	P56556	NDUA6_HUMAN	S	14	ENSP00000418842:C14S	ENSP00000418842:C14S	C	-	2	0	NDUFA6	40816732	0.000000	0.05858	0.006000	0.13384	0.010000	0.07245	0.107000	0.15375	0.448000	0.26722	0.655000	0.94253	TGC		0.622	NDUFA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000322089.4		NM_002490		6	212	0	0	0	0.00308	0	6	212		
FANCD2	2177	broad.mit.edu	37	3	10107166	10107166	+	Missense_Mutation	SNP	G	G	A	rs150217066		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr3:10107166G>A	ENST00000419585.1	+	24	2418	c.2257G>A	c.(2257-2259)Gat>Aat	p.D753N	FANCD2_ENST00000287647.3_Missense_Mutation_p.D753N|FANCD2_ENST00000383807.1_Missense_Mutation_p.D753N|FANCD2_ENST00000383806.1_Missense_Mutation_p.D753N			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	753					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GGAGGAGATTGATGGTCTACT	0.448			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													uc003buw.2		NaN	yes	Rec		Fanconi anaemia D2	3	3p26	2177	D|Mis|N|F	"""Fanconi anemia, complementation group D2"""			L		AML|leukemia			0				central_nervous_system(2)|ovary(1)|skin(1)	4						c.(2257-2259)GAT>AAT	Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi anemia complementation group D2 isoform		G	ASN/ASP,ASN/ASP	0,4406		0,0,2203	168.0	166.0	167.0		2257,2257	4.4	1.0	3	dbSNP_134	167	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	FANCD2	NM_001018115.1,NM_033084.3	23,23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	753/1452,753/1472	10107166	1,13005	2203	4300	6503	SO:0001583	missense	2177	Fanconi_Anemia	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding	g.chr3:10107166G>A	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.2257G>A	3.37:g.10107166G>A	ENSP00000398754:p.Asp753Asn					FANCD2_uc003bux.1_Missense_Mutation_p.D753N|FANCD2_uc003buy.1_Missense_Mutation_p.D753N|FANCD2_uc010hcw.1_RNA	p.D753N	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN		OV - Ovarian serous cystadenocarcinoma(96;0.148)	24	2335	+			753					Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	37	c.2257G>A	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851722	0.91355	0.0	1.16E-4	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.29	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.71204	0.3312	M	0.75447	2.3	0.42632	D	0.993381	D;D	0.71674	0.998;0.998	P;P	0.61874	0.895;0.895	T	0.74012	-0.3801	10	0.54805	T	0.06	.	11.7128	0.51635	0.0861:0.0:0.9139:0.0	.	753;753	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	N	753	ENSP00000287647:D753N;ENSP00000373318:D753N;ENSP00000373317:D753N;ENSP00000398754:D753N	ENSP00000287647:D753N	D	+	1	0	FANCD2	10082166	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.152000	0.94680	1.260000	0.44134	0.585000	0.79938	GAT		0.448	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1				28	57	0	0	0	0.013726	0	28	57		
NUP210	23225	broad.mit.edu	37	3	13367407	13367407	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr3:13367407G>A	ENST00000254508.5	-	33	4614	c.4532C>T	c.(4531-4533)tCg>tTg	p.S1511L		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1511					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GCTGTTGGCCGAGGAGCTCCA	0.622																																						uc003bxv.1		NaN																	0				ovary(3)|large_intestine(3)|skin(3)|pancreas(1)|liver(1)	11						c.(4531-4533)TCA>TTA		nucleoporin 210 precursor							97.0	91.0	93.0					3																	13367407		2203	4300	6503	SO:0001583	missense	23225				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	endoplasmic reticulum membrane|nuclear membrane|nuclear pore		g.chr3:13367407G>A	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.4532C>T	3.37:g.13367407G>A	ENSP00000254508:p.Ser1511Leu						p.S1511L	NM_024923	NP_079199	Q8TEM1	PO210_HUMAN			33	4615	-	all_neural(104;0.187)		1511			Lumenal (Probable).		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	c.4532C>T	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228959	0.58777	.	.	ENSG00000132182	ENST00000254508	T	0.08193	3.12	4.63	4.63	0.57726	.	0.091683	0.46758	D	0.000263	T	0.15089	0.0364	M	0.73962	2.25	0.80722	D	1	P	0.50710	0.938	B	0.41466	0.358	T	0.07121	-1.0789	10	0.72032	D	0.01	.	17.4894	0.87699	0.0:0.0:1.0:0.0	.	1511	Q8TEM1	PO210_HUMAN	L	1511	ENSP00000254508:S1511L	ENSP00000254508:S1511L	S	-	2	0	NUP210	13342407	1.000000	0.71417	0.950000	0.38849	0.171000	0.22731	9.686000	0.98664	2.128000	0.65567	0.467000	0.42956	TCG		0.622	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340085.1		NM_024923		14	76	0	0	0	0.010504	0	14	76		
STAB1	23166	broad.mit.edu	37	3	52552854	52552854	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr3:52552854C>G	ENST00000321725.6	+	48	5079	c.5003C>G	c.(5002-5004)tCa>tGa	p.S1668*		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1668	FAS1 5. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		ACGGCCCTCTCAGGGCACCCA	0.721																																						uc003dej.2		NaN																	0				large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9						c.(5002-5004)TCA>TGA		stabilin 1 precursor							18.0	22.0	21.0					3																	52552854		2197	4298	6495	SO:0001587	stop_gained	23166				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity	g.chr3:52552854C>G	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5003C>G	3.37:g.52552854C>G	ENSP00000312946:p.Ser1668*					STAB1_uc003dek.1_5'UTR|STAB1_uc003del.2_5'Flank	p.S1668*	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN		BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)	48	5077	+			1668			Extracellular (Potential).|FAS1 5.		A7E297|Q8IUH0|Q8IUH1|Q93072	Nonsense_Mutation	SNP	ENST00000321725.6	37	c.5003C>G	CCDS33768.1	.	.	.	.	.	.	.	.	.	.	C	43	10.361177	0.99391	.	.	ENSG00000010327	ENST00000321725	.	.	.	5.26	5.26	0.73747	.	0.155750	0.44285	D	0.000480	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.0578	0.86539	0.0:1.0:0.0:0.0	.	.	.	.	X	1668	.	ENSP00000312946:S1668X	S	+	2	0	STAB1	52527894	0.999000	0.42202	0.237000	0.24090	0.042000	0.13812	5.506000	0.66993	2.458000	0.83093	0.655000	0.94253	TCA		0.721	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351380.2		NM_015136		4	27	0	0	0	0.009096	0	4	27		
DCBLD2	131566	broad.mit.edu	37	3	98531284	98531284	+	Missense_Mutation	SNP	T	T	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr3:98531284T>C	ENST00000326840.6	-	10	1617	c.1255A>G	c.(1255-1257)Aac>Gac	p.N419D	DCBLD2_ENST00000326857.9_Missense_Mutation_p.N419D	NM_080927.3	NP_563615.3	Q96PD2	DCBD2_HUMAN	discoidin, CUB and LCCL domain containing 2	419	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell growth (GO:0030308)|wound healing (GO:0042060)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)				breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|stomach(2)	25						GGCAAAAAGTTATTACGCACA	0.348																																						uc003dtd.2		NaN																	0				ovary(2)|central_nervous_system(1)	3						c.(1255-1257)AAC>GAC		discoidin, CUB and LCCL domain containing 2							96.0	89.0	91.0					3																	98531284		1853	4107	5960	SO:0001583	missense	131566				cell adhesion|intracellular receptor mediated signaling pathway|negative regulation of cell growth|wound healing	cell surface|integral to plasma membrane		g.chr3:98531284T>C		CCDS46878.1	3q12.2	2006-04-12			ENSG00000057019	ENSG00000057019			24627	protein-coding gene	gene with protein product		608698				11447234	Standard	NM_080927		Approved	CLCP1, ESDN	uc003dtd.3	Q96PD2	OTTHUMG00000151985	ENST00000326840.6:c.1255A>G	3.37:g.98531284T>C	ENSP00000321573:p.Asn419Asp					DCBLD2_uc003dte.2_Missense_Mutation_p.N419D	p.N419D	NM_080927	NP_563615	Q96PD2	DCBD2_HUMAN			10	1618	-			419			Extracellular (Potential).|F5/8 type C.		B7WNL1|D3DN41|Q8N6M4|Q8TDX2	Missense_Mutation	SNP	ENST00000326840.6	37	c.1255A>G	CCDS46878.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.762812	0.89932	.	.	ENSG00000057019	ENST00000326840;ENST00000404023;ENST00000326857	D;D	0.82344	-1.6;-1.6	5.88	5.88	0.94601	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.86410	0.5926	L	0.32530	0.975	0.80722	D	1	P;D	0.76494	0.896;0.999	P;D	0.83275	0.706;0.996	D	0.87035	0.2137	10	0.52906	T	0.07	-27.0467	14.2535	0.66035	0.0:0.0:0.0:1.0	.	419;419	Q96PD2-2;Q96PD2	.;DCBD2_HUMAN	D	419;368;419	ENSP00000321573:N419D;ENSP00000321646:N419D	ENSP00000321573:N419D	N	-	1	0	DCBLD2	100013974	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.436000	0.80404	2.239000	0.73571	0.533000	0.62120	AAC		0.348	DCBLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324675.2		NM_080927		12	31	0	0	0	0.010729	0	12	31		
TFG	10342	broad.mit.edu	37	3	100463681	100463681	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr3:100463681G>C	ENST00000240851.4	+	7	1066	c.726G>C	c.(724-726)caG>caC	p.Q242H	TFG_ENST00000418917.2_Missense_Mutation_p.Q238H|TFG_ENST00000481203.1_3'UTR|TFG_ENST00000476228.1_Missense_Mutation_p.Q238H|TFG_ENST00000490574.1_Missense_Mutation_p.Q242H	NM_001195478.1|NM_001195479.1|NM_006070.5	NP_001182407.1|NP_001182408.1|NP_006061.2	Q92734	TFG_HUMAN	TRK-fused gene	242					cell death (GO:0008219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	signal transducer activity (GO:0004871)		TFG/NR4A3(2)|TFG/NTRK1_ENST00000392302(5)|TFG/ALK(9)	large_intestine(4)|lung(2)|prostate(1)|stomach(1)	8						TTTCAGGTCAGATGTACCAAC	0.458			T	"""NTRK1, ALK"""	"""papillary thyroid, ALCL, NSCLC"""																																	uc003due.2		NaN		Dom	yes		3	3q11-q12	10342	T	TRK-fused gene			"""E, L"""	NTRK1|ALK		papillary thyroid|ALCL|NSCLC	TFG/ALK(7)	0				haematopoietic_and_lymphoid_tissue(7)|lung(2)|large_intestine(1)|prostate(1)	11						c.(724-726)CAG>CAC		TRK-fused							104.0	106.0	105.0					3																	100463681		2203	4300	6503	SO:0001583	missense	10342				positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm	signal transducer activity	g.chr3:100463681G>C	BC009241	CCDS2939.1, CCDS56266.1	3q12.2	2013-03-13	2001-12-04		ENSG00000114354	ENSG00000114354			11758	protein-coding gene	gene with protein product		602498				9169129, 23479643	Standard	NM_001007565		Approved	TF6, FLJ36137, SPG57	uc003dui.3	Q92734	OTTHUMG00000159085	ENST00000240851.4:c.726G>C	3.37:g.100463681G>C	ENSP00000240851:p.Gln242His					TFG_uc003duf.2_Missense_Mutation_p.Q242H|TFG_uc003dug.2_Missense_Mutation_p.Q238H|TFG_uc003duh.2_Missense_Mutation_p.Q238H|TFG_uc003dui.2_Missense_Mutation_p.Q242H	p.Q242H	NM_006070	NP_006061	Q92734	TFG_HUMAN			7	1175	+			242					D3DN49|G5E9V1|Q15656|Q969I2	Missense_Mutation	SNP	ENST00000240851.4	37	c.726G>C	CCDS2939.1	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464942	0.43839	.	.	ENSG00000114354	ENST00000418917;ENST00000490574;ENST00000240851;ENST00000476228;ENST00000443578	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	5.91	4.13	0.48395	.	0.000000	0.85682	D	0.000000	T	0.66036	0.2749	L	0.59436	1.845	0.58432	D	0.999991	D;D	0.67145	0.994;0.996	D;D	0.78314	0.991;0.986	T	0.66023	-0.6026	10	0.59425	D	0.04	-2.9946	10.6421	0.45598	0.2037:0.0:0.7963:0.0	.	238;242	G5E9V1;Q92734	.;TFG_HUMAN	H	238;242;242;238;238	ENSP00000397182:Q238H;ENSP00000419960:Q242H;ENSP00000240851:Q242H;ENSP00000417952:Q238H	ENSP00000240851:Q242H	Q	+	3	2	TFG	101946371	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.253000	0.43205	0.845000	0.35118	0.655000	0.94253	CAG		0.458	TFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353242.1		NM_006070		45	102	0	0	0	0.01441	0	45	102		
GRAMD1C	54762	broad.mit.edu	37	3	113619898	113619898	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr3:113619898C>G	ENST00000358160.4	+	7	1053	c.561C>G	c.(559-561)ttC>ttG	p.F187L	GRAMD1C_ENST00000472026.1_Missense_Mutation_p.F20L|GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000440446.2_5'UTR|GRAMD1C_ENST00000452134.2_5'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	187						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						GACAGGAATTCTGGCAACTGC	0.393																																						uc003eaq.3		NaN																	0				ovary(2)|skin(1)	3						c.(559-561)TTC>TTG		GRAM domain containing 1C							97.0	94.0	95.0					3																	113619898		2203	4300	6503	SO:0001583	missense	54762					integral to membrane		g.chr3:113619898C>G		CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.561C>G	3.37:g.113619898C>G	ENSP00000350881:p.Phe187Leu					GRAMD1C_uc011bil.1_RNA|GRAMD1C_uc011bim.1_RNA|GRAMD1C_uc003ear.2_Missense_Mutation_p.F20L|GRAMD1C_uc003eas.2_5'UTR	p.F187L	NM_017577	NP_060047	Q8IYS0	GRM1C_HUMAN			7	637	+			187					A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	ENST00000358160.4	37	c.561C>G	CCDS33826.1	.	.	.	.	.	.	.	.	.	.	C	4.682	0.126726	0.08931	.	.	ENSG00000178075	ENST00000358160;ENST00000472026	T;T	0.24723	1.91;1.84	6.06	4.3	0.51218	.	0.060966	0.64402	D	0.000004	T	0.07503	0.0189	N	0.03268	-0.37	0.80722	D	1	P;P	0.41393	0.487;0.748	B;B	0.31614	0.122;0.133	T	0.26573	-1.0099	10	0.02654	T	1	.	9.8001	0.40759	0.0:0.78:0.0:0.22	.	20;187	E9PHT3;Q8IYS0	.;GRM1C_HUMAN	L	187;20	ENSP00000350881:F187L;ENSP00000419132:F20L	ENSP00000350881:F187L	F	+	3	2	GRAMD1C	115102588	1.000000	0.71417	1.000000	0.80357	0.172000	0.22775	1.080000	0.30779	0.911000	0.36747	0.650000	0.86243	TTC		0.393	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1		NM_017577		20	48	0	0	0	0.01892	0	20	48		
RBP1	5947	broad.mit.edu	37	3	139236517	139236517	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr3:139236517C>T	ENST00000232219.2	-	4	656	c.546G>A	c.(544-546)atG>atA	p.M182I	RP11-319G6.1_ENST00000515247.1_RNA	NM_002899.3	NP_002890.2	P09455	RET1_HUMAN	retinol binding protein 1, cellular	120					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	5					Acitretin(DB00459)|Vitamin A(DB00162)	CTTCCACTCTCATCTCCTGAA	0.488																																						uc003eti.2		NaN																	0					0						c.(544-546)ATG>ATA		retinol binding protein 1, cellular isoform a	Vitamin A(DB00162)						199.0	162.0	175.0					3																	139236517		2203	4300	6503	SO:0001583	missense	5947					cytoplasm	retinal binding|retinol binding|transporter activity	g.chr3:139236517C>T		CCDS3110.2, CCDS46925.1, CCDS46926.1	3q21-q23	2013-03-01	2001-11-28		ENSG00000114115	ENSG00000114115		"""Fatty acid binding protein family"""	9919	protein-coding gene	gene with protein product		180260	"""retinol-binding protein 1, cellular"""			1654334, 9858824	Standard	NM_002899		Approved	CRABP-I, CRBP1, CRBP, RBPC, CRBPI	uc003eti.2	P09455	OTTHUMG00000155751	ENST00000232219.2:c.546G>A	3.37:g.139236517C>T	ENSP00000232219:p.Met182Ile						p.M182I	NM_002899	NP_002890	P09455	RET1_HUMAN			4	657	-			120					A8K2Q0|B7Z7A0|E7EWV0|F2Z2F2|Q6FGX8	Missense_Mutation	SNP	ENST00000232219.2	37	c.546G>A	CCDS3110.2	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555581	0.65425	.	.	ENSG00000114115	ENST00000232219	T	0.06608	3.28	5.77	5.77	0.91146	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.047210	0.85682	D	0.000000	T	0.09423	0.0232	L	0.42581	1.335	0.80722	D	1	B	0.11235	0.004	B	0.24155	0.051	T	0.10823	-1.0613	10	0.46703	T	0.11	.	17.4774	0.87662	0.0:1.0:0.0:0.0	.	120	P09455	RET1_HUMAN	I	182	ENSP00000232219:M182I	ENSP00000232219:M182I	M	-	3	0	RBP1	140719207	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.664000	0.46783	2.726000	0.93360	0.655000	0.94253	ATG		0.488	RBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341495.1		NM_002899		34	92	0	0	0	0.00623	0	34	92		
ZNF732	654254	broad.mit.edu	37	4	265271	265272	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr4:265271_265272CA>TG	ENST00000419098.1	-	4	1384_1385	c.1374_1375TG>CA	c.(1372-1377)tcTGca>tcCAca	p.A459T		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	459					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						CTCAGGTATGCAGACCATCCAA	0.391																																						uc011buu.1		NaN																	0					0						c.(1369-1374)TCTGCA>TCCACA		zinc finger protein 732																																				SO:0001583	missense	654254				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr4:265271_265272CA>TG	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.1374_1375delinsTG	4.37:g.265271_265272delinsTG	ENSP00000415774:p.Ala459Thr					ZNF732_uc010ibb.1_Intron	p.A458T	NM_001137608	NP_001131080	B4DXR9	ZN732_HUMAN			3	1385_1386	-			459			C2H2-type 12.			Missense_Mutation	DNP	ENST00000419098.1	37	c.1371_1372TG>CA	CCDS46990.1																																																																																				0.391	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2		NM_001137608		3	8	0	0	0	0.004672	0	3	8		
UGT2B28	54490	broad.mit.edu	37	4	70160324	70160324	+	Missense_Mutation	SNP	T	T	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr4:70160324T>A	ENST00000335568.5	+	6	1389	c.1387T>A	c.(1387-1389)Tgg>Agg	p.W463R	UGT2B28_ENST00000511240.1_3'UTR	NM_053039.1	NP_444267.1	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B28	463					metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(16)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31						AGCAGTCTTCTGGATTGAATT	0.413																																						uc003hej.2		NaN																	0				skin(1)	1						c.(1387-1389)TGG>AGG		UDP glucuronosyltransferase 2 family,	Flunitrazepam(DB01544)						65.0	74.0	71.0					4																	70160324		2029	4232	6261	SO:0001583	missense	54490				xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity	g.chr4:70160324T>A	AF177272	CCDS3528.1, CCDS56330.1	4q13.3	2011-02-09	2005-07-20		ENSG00000135226	ENSG00000135226		"""UDP glucuronosyltransferases"""	13479	protein-coding gene	gene with protein product		606497	"""UDP glycosyltransferase 2 family, polypeptide B28"""			11300766	Standard	NM_053039		Approved		uc003hej.3	Q9BY64	OTTHUMG00000129401	ENST00000335568.5:c.1387T>A	4.37:g.70160324T>A	ENSP00000334276:p.Trp463Arg					UGT2B28_uc010ihr.2_3'UTR	p.W463R	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN			6	1389	+			463					B5BUM0|Q9BY62|Q9BY63	Missense_Mutation	SNP	ENST00000335568.5	37	c.1387T>A	CCDS3528.1	.	.	.	.	.	.	.	.	.	.	-	11.34	1.611021	0.28712	.	.	ENSG00000135226	ENST00000335568	T	0.75367	-0.93	1.85	1.85	0.25348	.	0.000000	0.64402	U	0.000004	D	0.89132	0.6628	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88142	0.2845	10	0.87932	D	0	.	7.3524	0.26700	0.0:0.0:0.0:1.0	.	463	Q9BY64	UDB28_HUMAN	R	463	ENSP00000334276:W463R	ENSP00000334276:W463R	W	+	1	0	UGT2B28	70194913	1.000000	0.71417	0.999000	0.59377	0.094000	0.18550	6.841000	0.75374	0.846000	0.35142	0.155000	0.16302	TGG		0.413	UGT2B28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251557.2		NM_053039		33	79	0	0	0	0.00874	0	33	79		
CCRN4L	25819	broad.mit.edu	37	4	139966392	139966392	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr4:139966392G>C	ENST00000280614.2	+	3	1253	c.1060G>C	c.(1060-1062)Gat>Cat	p.D354H	ELF2_ENST00000515489.1_Intron	NM_012118.2	NP_036250.2	Q9UK39	NOCT_HUMAN	CCR4 carbon catabolite repression 4-like (S. cerevisiae)	354					circadian regulation of gene expression (GO:0032922)|cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|regulation of circadian rhythm (GO:0042752)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|response to extracellular stimulus (GO:0009991)|response to lipopolysaccharide (GO:0032496)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A)-specific ribonuclease activity (GO:0004535)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(2)|large_intestine(3)|lung(3)|ovary(1)	9	all_hematologic(180;0.162)					GCTGAGTGCTGATGGGCAGTC	0.517																																					Ovarian(144;566 1842 19130 21379 22209)	uc003ihl.2		NaN																	0				ovary(1)	1						c.(1060-1062)GAT>CAT		CCR4 carbon catabolite repression 4-like							85.0	79.0	81.0					4																	139966392		2203	4300	6503	SO:0001583	missense	25819				rhythmic process|transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity	g.chr4:139966392G>C	AF183961	CCDS3743.1	4q31.1	2014-06-18	2001-11-28		ENSG00000151014	ENSG00000151014			14254	protein-coding gene	gene with protein product		608468	"""CCR4-like (carbon catabolite repression 4, S.cerevisiae)"""			10521507	Standard	NM_012118		Approved	CCR4L, Ccr4c	uc003ihl.3	Q9UK39	OTTHUMG00000161271	ENST00000280614.2:c.1060G>C	4.37:g.139966392G>C	ENSP00000280614:p.Asp354His						p.D354H	NM_012118	NP_036250	Q9UK39	NOCT_HUMAN			3	1253	+	all_hematologic(180;0.162)		354					D3DNY5|Q14D51|Q9HD93|Q9HD94|Q9HD95	Missense_Mutation	SNP	ENST00000280614.2	37	c.1060G>C	CCDS3743.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.526858	0.85706	.	.	ENSG00000151014	ENST00000280614	T	0.31510	1.49	5.48	5.48	0.80851	Endonuclease/exonuclease/phosphatase (2);	0.047164	0.85682	D	0.000000	T	0.52306	0.1726	L	0.53561	1.675	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.41770	-0.9490	9	.	.	.	-25.5782	19.3328	0.94299	0.0:0.0:1.0:0.0	.	354	Q9UK39	NOCT_HUMAN	H	354	ENSP00000280614:D354H	.	D	+	1	0	CCRN4L	140185842	1.000000	0.71417	0.635000	0.29338	0.991000	0.79684	9.778000	0.99011	2.589000	0.87451	0.484000	0.47621	GAT		0.517	CCRN4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257231.3		NM_012118		15	47	0	0	0	0.00499	0	15	47		
HAND2	9464	broad.mit.edu	37	4	174450071	174450071	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr4:174450071C>G	ENST00000359562.4	-	1	1309	c.370G>C	c.(370-372)Gag>Cag	p.E124Q	HAND2-AS1_ENST00000505817.1_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000505621.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000509866.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	124	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		GGGATGCACTCGCGCAGTTCG	0.667																																						uc003ith.1		NaN																	0				skin(1)	1						c.(370-372)GAG>CAG		basic helix-loop-helix transcription factor							152.0	144.0	146.0					4																	174450071		2203	4300	6503	SO:0001583	missense	9464				adult heart development|angiogenesis|apoptosis|cardiac neural crest cell development involved in outflow tract morphogenesis|heart looping|in utero embryonic development|negative regulation of cardiac muscle cell apoptosis|noradrenergic neuron differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|regulation of secondary heart field cardioblast proliferation|thymus development	nuclear chromatin|transcription factor complex	activating transcription factor binding|protein homodimerization activity|RNA polymerase II regulatory region sequence-specific DNA binding|transcription coactivator activity	g.chr4:174450071C>G	AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.370G>C	4.37:g.174450071C>G	ENSP00000352565:p.Glu124Gln					NBLA00301_uc011ckd.1_5'Flank|NBLA00301_uc003itl.3_5'Flank|NBLA00301_uc003itj.2_5'Flank|NBLA00301_uc010irf.2_5'Flank|NBLA00301_uc010irg.2_5'Flank|NBLA00301_uc010irh.2_5'Flank|NBLA00301_uc010iri.2_5'Flank|NBLA00301_uc010irj.2_5'Flank|NBLA00301_uc010irk.2_5'Flank|NBLA00301_uc010irl.2_5'Flank|NBLA00301_uc010irm.2_5'Flank|NBLA00301_uc010irn.2_5'Flank|NBLA00301_uc003itk.2_5'Flank|HAND2_uc003itg.1_Missense_Mutation_p.R89P|HAND2_uc010ire.1_Missense_Mutation_p.E124Q	p.E124Q	NM_021973	NP_068808	P61296	HAND2_HUMAN		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)	1	1308	-		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)	124			Helix-loop-helix motif.		B6ECG9|O95300|O95301|P97833|Q494T1	Missense_Mutation	SNP	ENST00000359562.4	37	c.370G>C	CCDS3819.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772957	0.90108	.	.	ENSG00000164107	ENST00000359562;ENST00000393686;ENST00000535864	D	0.97976	-4.64	4.51	4.51	0.55191	Helix-loop-helix DNA-binding (5);	0.051540	0.85682	D	0.000000	D	0.95921	0.8672	N	0.04994	-0.135	0.80722	D	1	P;P	0.47962	0.903;0.903	P;P	0.58620	0.842;0.842	D	0.96314	0.9231	10	0.38643	T	0.18	-24.5032	17.4344	0.87547	0.0:1.0:0.0:0.0	.	124;124	B6ECG9;P61296	.;HAND2_HUMAN	Q	124;93;72	ENSP00000352565:E124Q	ENSP00000352565:E124Q	E	-	1	0	HAND2	174686646	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	4.817000	0.62650	2.326000	0.78906	0.561000	0.74099	GAG		0.667	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362241.3				44	131	0	0	0	0.01441	0	44	131		
CCDC110	256309	broad.mit.edu	37	4	186379933	186379933	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr4:186379933C>T	ENST00000307588.3	-	6	1883	c.1808G>A	c.(1807-1809)gGa>gAa	p.G603E	CCDC110_ENST00000510617.1_Missense_Mutation_p.G603E|CCDC110_ENST00000393540.3_Missense_Mutation_p.G566E|CCDC110_ENST00000507501.1_5'Flank	NM_152775.3	NP_689988.1	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110	603						nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(9)	30		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TAGTTCATTTCCAAGTGAGCT	0.323																																						uc003ixu.3		NaN																	0				central_nervous_system(1)	1						c.(1807-1809)GGA>GAA		coiled-coil domain containing 110 isoform a							62.0	67.0	65.0					4																	186379933		2192	4293	6485	SO:0001583	missense	256309					nucleus		g.chr4:186379933C>T	AB080722	CCDS3843.1, CCDS47170.1	4q35.1	2010-12-24			ENSG00000168491	ENSG00000168491			28504	protein-coding gene	gene with protein product	"""cancer/testis antigen 52"""	609488				18160854	Standard	NM_152775		Approved	KM-HN-1, MGC33607, CT52	uc003ixu.4	Q8TBZ0	OTTHUMG00000160415	ENST00000307588.3:c.1808G>A	4.37:g.186379933C>T	ENSP00000306776:p.Gly603Glu					CCDC110_uc003ixv.3_Missense_Mutation_p.G566E|CCDC110_uc011ckt.1_Missense_Mutation_p.G603E	p.G603E	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)	6	1884	-		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)	603			Potential.		Q86YI9|Q8N7W0	Missense_Mutation	SNP	ENST00000307588.3	37	c.1808G>A	CCDS3843.1	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.738110	0.00681	.	.	ENSG00000168491	ENST00000393540;ENST00000307588;ENST00000510617	T;T;T	0.28666	1.6;1.6;1.6	5.55	4.36	0.52297	.	0.231906	0.29715	N	0.011395	T	0.05960	0.0155	N	0.00138	-2.015	0.20926	N	0.999828	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.34329	-0.9833	10	0.02654	T	1	-12.7505	10.0057	0.41955	0.0:0.0781:0.0:0.9219	.	603;566;603	B4DZA2;Q8TBZ0-2;Q8TBZ0	.;.;CC110_HUMAN	E	566;603;603	ENSP00000377172:G566E;ENSP00000306776:G603E;ENSP00000427246:G603E	ENSP00000306776:G603E	G	-	2	0	CCDC110	186616927	1.000000	0.71417	0.951000	0.38953	0.513000	0.34164	3.729000	0.54999	1.040000	0.40099	-0.238000	0.12139	GGA		0.323	CCDC110-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360519.2		NM_152775		11	21	0	0	0	0.016723	0	11	21		
CDH10	1008	broad.mit.edu	37	5	24491853	24491853	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr5:24491853C>G	ENST00000264463.4	-	11	2215	c.1708G>C	c.(1708-1710)Gac>Cac	p.D570H	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	570	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TAATCATTGTCTGATATCACC	0.413										HNSCC(23;0.051)																												uc003jgr.1		NaN																	0				ovary(6)|pancreas(4)|breast(2)	12						c.(1708-1710)GAC>CAC		cadherin 10, type 2 preproprotein							140.0	119.0	126.0					5																	24491853		2203	4300	6503	SO:0001583	missense	1008				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding	g.chr5:24491853C>G	AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1708G>C	5.37:g.24491853C>G	ENSP00000264463:p.Asp570His	HNSCC(23;0.051)				CDH10_uc011cnu.1_RNA	p.D570H	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN		STAD - Stomach adenocarcinoma(35;0.0556)	11	2040	-			570			Cadherin 5.|Extracellular (Potential).		Q9ULB3	Missense_Mutation	SNP	ENST00000264463.4	37	c.1708G>C	CCDS3892.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531921	0.85706	.	.	ENSG00000040731	ENST00000264463	T	0.68903	-0.36	5.87	5.87	0.94306	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.89076	0.6612	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92266	0.5821	10	0.87932	D	0	.	19.2127	0.93763	0.0:1.0:0.0:0.0	.	570	Q9Y6N8	CAD10_HUMAN	H	570	ENSP00000264463:D570H	ENSP00000264463:D570H	D	-	1	0	CDH10	24527610	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	7.773000	0.85462	2.770000	0.95276	0.650000	0.86243	GAC		0.413	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207345.2		NM_006727		3	45	0	0	0	0.004672	0	3	45		
PDZD2	23037	broad.mit.edu	37	5	32074304	32074304	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr5:32074304C>T	ENST00000438447.1	+	18	3480	c.3092C>T	c.(3091-3093)tCg>tTg	p.S1031L	PDZD2_ENST00000282493.3_Missense_Mutation_p.S1031L			O15018	PDZD2_HUMAN	PDZ domain containing 2	1031					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AAGGCCATCTCGGCACCTCTT	0.567																																						uc003jhl.2		NaN																	0				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						c.(3091-3093)TCG>TTG		PDZ domain containing 2							77.0	74.0	75.0					5																	32074304		2203	4300	6503	SO:0001583	missense	23037				cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus		g.chr5:32074304C>T	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3092C>T	5.37:g.32074304C>T	ENSP00000402033:p.Ser1031Leu					PDZD2_uc003jhm.2_Missense_Mutation_p.S1031L|PDZD2_uc011cnx.1_Missense_Mutation_p.S857L	p.S1031L	NM_178140	NP_835260	O15018	PDZD2_HUMAN			18	3480	+			1031					Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	c.3092C>T	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445937	0.43429	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.08896	3.04;3.04	5.67	4.62	0.57501	.	0.000000	0.42294	D	0.000730	T	0.11367	0.0277	M	0.69823	2.125	0.09310	N	1	D;P	0.54047	0.964;0.643	B;B	0.39027	0.288;0.106	T	0.26916	-1.0089	10	0.66056	D	0.02	.	12.7746	0.57439	0.0:0.9074:0.0:0.0926	.	857;1031	B4E3P2;O15018	.;PDZD2_HUMAN	L	1031;833;1031	ENSP00000402033:S1031L;ENSP00000282493:S1031L	ENSP00000282493:S1031L	S	+	2	0	PDZD2	32110061	0.062000	0.20869	0.226000	0.23910	0.003000	0.03518	2.058000	0.41374	2.667000	0.90743	0.563000	0.77884	TCG		0.567	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1				54	28	0	0	0	0.01441	0	54	28		
DHX29	54505	broad.mit.edu	37	5	54586091	54586091	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr5:54586091G>C	ENST00000251636.5	-	7	1010	c.862C>G	c.(862-864)Caa>Gaa	p.Q288E	RP11-506H20.1_ENST00000506435.1_RNA	NM_019030.2	NP_061903.2	Q7Z478	DHX29_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 29	288						eukaryotic 43S preinitiation complex (GO:0016282)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation initiation factor activity (GO:0003743)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|lung(6)|ovary(4)|prostate(1)|skin(3)|urinary_tract(2)	46		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)				TTTTGGCCTTGCTTGTTTTTT	0.328																																						uc003jpx.2		NaN																	0				ovary(2)|central_nervous_system(1)|skin(1)	4						c.(862-864)CAA>GAA		DEAH (Asp-Glu-Ala-His) box polypeptide 29							111.0	109.0	110.0					5																	54586091		2203	4300	6503	SO:0001583	missense	54505						ATP binding|ATP-dependent helicase activity|translation initiation factor activity	g.chr5:54586091G>C	AY036974	CCDS34158.1	5q11.2	2008-02-05	2003-06-13	2003-06-20	ENSG00000067248	ENSG00000067248		"""DEAH-boxes"""	15815	protein-coding gene	gene with protein product		612720	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 29"""	DDX29			Standard	XM_005248544		Approved		uc003jpx.3	Q7Z478	OTTHUMG00000162313	ENST00000251636.5:c.862C>G	5.37:g.54586091G>C	ENSP00000251636:p.Gln288Glu					DHX29_uc010ivw.2_RNA	p.Q288E	NM_019030	NP_061903	Q7Z478	DHX29_HUMAN			7	982	-		Lung NSC(810;4.08e-05)|Breast(144;0.0544)|Prostate(74;0.183)	288			Potential.		O75549|Q63HN0|Q63HN3|Q8IWW2|Q8N3A1|Q9UMH2	Missense_Mutation	SNP	ENST00000251636.5	37	c.862C>G	CCDS34158.1	.	.	.	.	.	.	.	.	.	.	G	14.14	2.445864	0.43429	.	.	ENSG00000067248	ENST00000251636	T	0.42513	0.97	5.41	4.52	0.55395	.	0.442010	0.28612	N	0.014723	T	0.36358	0.0964	L	0.47716	1.5	0.28961	N	0.889816	B	0.29716	0.255	B	0.22152	0.038	T	0.31586	-0.9938	10	0.46703	T	0.11	.	14.5921	0.68373	0.0:0.1459:0.8541:0.0	.	288	Q7Z478	DHX29_HUMAN	E	288	ENSP00000251636:Q288E	ENSP00000251636:Q288E	Q	-	1	0	DHX29	54621848	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	2.234000	0.43035	1.369000	0.46134	0.650000	0.86243	CAA		0.328	DHX29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368532.1		NM_019030		3	8	0	0	0	0.004672	0	3	8		
DEPDC1B	55789	broad.mit.edu	37	5	59893730	59893730	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr5:59893730G>A	ENST00000265036.5	-	11	1507	c.1440C>T	c.(1438-1440)tcC>tcT	p.S480S	DEPDC1B_ENST00000545085.1_Silent_p.S391S|DEPDC1B_ENST00000453022.2_Silent_p.S418S	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	480					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				CTTCAGGATAGGATTTCTGAA	0.383																																						uc003jsh.2		NaN																	0				ovary(1)	1						c.(1438-1440)TCC>TCT		DEP domain containing 1B isoform 1							80.0	80.0	80.0					5																	59893730		2203	4300	6503	SO:0001819	synonymous_variant	55789				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity	g.chr5:59893730G>A	AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.1440C>T	5.37:g.59893730G>A						DEPDC1B_uc011cqm.1_Silent_p.S418S|DEPDC1B_uc011cqn.1_Silent_p.S391S	p.S480S	NM_018369	NP_060839	Q8WUY9	DEP1B_HUMAN			11	1513	-		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)	480					A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Silent	SNP	ENST00000265036.5	37	c.1440C>T	CCDS3977.1																																																																																				0.383	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1		NM_018369		4	11	0	0	0	0.009096	0	4	11		
GCNT4	51301	broad.mit.edu	37	5	74324587	74324587	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr5:74324587C>G	ENST00000322348.4	-	1	2137	c.1276G>C	c.(1276-1278)Gaa>Caa	p.E426Q		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	426					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		TCAAGCTTTTCTGCCAAGCAT	0.373																																						uc003kdn.2		NaN																	0				ovary(2)|skin(1)	3						c.(1276-1278)GAA>CAA		core 2 beta-1,6-N-acetylglucosaminyltransferase							110.0	111.0	111.0					5																	74324587		2203	4300	6503	SO:0001583	missense	51301				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity	g.chr5:74324587C>G	AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.1276G>C	5.37:g.74324587C>G	ENSP00000317027:p.Glu426Gln						p.E426Q	NM_016591	NP_057675	Q9P109	GCNT4_HUMAN		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)	1	2138	-		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)	426			Lumenal (Potential).			Missense_Mutation	SNP	ENST00000322348.4	37	c.1276G>C	CCDS4026.1	.	.	.	.	.	.	.	.	.	.	.	24.1	4.494798	0.85069	.	.	ENSG00000176928	ENST00000322348	T	0.11604	2.76	5.96	5.96	0.96718	.	0.102120	0.64402	D	0.000003	T	0.24353	0.0590	M	0.69248	2.105	0.58432	D	0.999992	D	0.59357	0.985	P	0.49528	0.614	T	0.00153	-1.1982	10	0.62326	D	0.03	-13.9125	20.4043	0.99006	0.0:1.0:0.0:0.0	.	426	Q9P109	GCNT4_HUMAN	Q	426	ENSP00000317027:E426Q	ENSP00000317027:E426Q	E	-	1	0	GCNT4	74360343	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.807000	0.86032	2.823000	0.97156	0.650000	0.86243	GAA		0.373	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254040.1		NM_016591		13	25	0	0	0	0.003163	0	13	25		
ANKRD32	84250	broad.mit.edu	37	5	94027275	94027275	+	Missense_Mutation	SNP	C	C	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr5:94027275C>A	ENST00000265140.5	+	19	2845	c.2426C>A	c.(2425-2427)aCa>aAa	p.T809K		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	809						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		GCAGGAGAAACAGCCCTGCAT	0.353																																						uc003kkr.3		NaN																	0				ovary(2)	2						c.(2425-2427)ACA>AAA		ankyrin repeat domain 32							37.0	39.0	38.0					5																	94027275		2202	4298	6500	SO:0001583	missense	84250							g.chr5:94027275C>A	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.2426C>A	5.37:g.94027275C>A	ENSP00000265140:p.Thr809Lys					ANKRD32_uc003kks.2_Missense_Mutation_p.T173K	p.T809K	NM_032290	NP_115666	Q9BQI6	ANR32_HUMAN		all cancers(79;3.88e-18)	19	2506	+		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)	809			ANK 1.		B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	37	c.2426C>A	CCDS4071.2	.	.	.	.	.	.	.	.	.	.	C	19.86	3.904919	0.72868	.	.	ENSG00000133302	ENST00000265140	T	0.77358	-1.09	5.36	5.36	0.76844	Ankyrin repeat-containing domain (4);	0.118020	0.56097	D	0.000034	D	0.91294	0.7255	M	0.92833	3.35	0.53005	D	0.999962	D	0.89917	1.0	D	0.91635	0.999	D	0.92954	0.6383	10	0.87932	D	0	.	19.4551	0.94884	0.0:1.0:0.0:0.0	.	809	Q9BQI6	ANR32_HUMAN	K	809	ENSP00000265140:T809K	ENSP00000265140:T809K	T	+	2	0	ANKRD32	94053031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.100000	0.76989	2.662000	0.90505	0.650000	0.86243	ACA		0.353	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1		NM_032290		7	22	1	0	0.00621372	0.006214	0.00642651	7	22		
KCTD16	57528	broad.mit.edu	37	5	143587001	143587001	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr5:143587001G>A	ENST00000507359.3	+	2	1815	c.724G>A	c.(724-726)Gag>Aag	p.E242K	KCTD16_ENST00000512467.1_Missense_Mutation_p.E242K	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	242					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TATGTTGTCAGAGTGTGGATT	0.428																																						uc003lnm.1		NaN																	0				large_intestine(2)|ovary(1)|skin(1)	4						c.(724-726)GAG>AAG		potassium channel tetramerisation domain							85.0	85.0	85.0					5																	143587001		2203	4300	6503	SO:0001583	missense	57528					cell junction|postsynaptic membrane|presynaptic membrane|voltage-gated potassium channel complex	voltage-gated potassium channel activity	g.chr5:143587001G>A	AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.724G>A	5.37:g.143587001G>A	ENSP00000426548:p.Glu242Lys					KCTD16_uc003lnn.1_Missense_Mutation_p.E242K	p.E242K	NM_020768	NP_065819	Q68DU8	KCD16_HUMAN	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		3	1353	+		all_hematologic(541;0.118)	242					Q9P2M9	Missense_Mutation	SNP	ENST00000507359.3	37	c.724G>A	CCDS34260.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315365	0.81358	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.54071	0.59;0.59	5.69	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.73721	0.3623	M	0.83483	2.645	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	T	0.78529	-0.2169	10	0.72032	D	0.01	.	14.5094	0.67774	0.07:0.0:0.93:0.0	.	242	Q68DU8	KCD16_HUMAN	K	242	ENSP00000424151:E242K;ENSP00000426548:E242K	ENSP00000426548:E242K	E	+	1	0	KCTD16	143567194	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	9.807000	0.99171	1.427000	0.47276	0.561000	0.74099	GAG		0.428	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371898.3		XM_098368		26	66	0	0	0	0.012213	0	26	66		
SCGN	10590	broad.mit.edu	37	6	25665182	25665182	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:25665182G>A	ENST00000377961.2	+	4	426	c.258G>A	c.(256-258)atG>atA	p.M86I	SCGN_ENST00000334979.6_3'UTR	NM_006998.3	NP_008929.2	O76038	SEGN_HUMAN	secretagogin, EF-hand calcium binding protein	86	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						TTGCTGGTATGTTCTTATCTG	0.478																																						uc003nfb.2		NaN																	0				ovary(2)|pancreas(1)	3						c.(256-258)ATG>ATA		secretagogin precursor							157.0	135.0	142.0					6																	25665182		2203	4300	6503	SO:0001583	missense	10590					extracellular region|transport vesicle membrane	calcium ion binding	g.chr6:25665182G>A	BC000336	CCDS4561.1	6p22.3-p22.1	2013-01-10			ENSG00000079689	ENSG00000079689		"""EF-hand domain containing"""	16941	protein-coding gene	gene with protein product	"""calbindin-like"""	609202				10811645	Standard	NM_006998		Approved	SECRET, DJ501N12.8, SEGN, CALBL	uc003nfb.3	O76038	OTTHUMG00000014409	ENST00000377961.2:c.258G>A	6.37:g.25665182G>A	ENSP00000367197:p.Met86Ile					SCGN_uc010jpz.2_5'UTR	p.M86I	NM_006998	NP_008929	O76038	SEGN_HUMAN			4	461	+			86			EF-hand 2.		A8K0B2|Q5VV44|Q96QV7|Q9UJF6	Missense_Mutation	SNP	ENST00000377961.2	37	c.258G>A	CCDS4561.1	.	.	.	.	.	.	.	.	.	.	G	3.431	-0.116046	0.06881	.	.	ENSG00000079689	ENST00000377961	D	0.84730	-1.89	5.19	3.29	0.37713	EF-hand-like domain (1);	0.108729	0.85682	D	0.000000	T	0.54078	0.1836	N	0.20881	0.62	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.52388	-0.8582	10	0.02654	T	1	.	10.5011	0.44806	0.0795:0.1372:0.7833:0.0	.	86	O76038	SEGN_HUMAN	I	86	ENSP00000367197:M86I	ENSP00000367197:M86I	M	+	3	0	SCGN	25773161	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.132000	0.42083	2.391000	0.81399	0.650000	0.86243	ATG		0.478	SCGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040067.1				15	38	0	0	0	0.010504	0	15	38		
HIST1H2BO	8348	broad.mit.edu	37	6	27861555	27861555	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:27861555G>A	ENST00000303806.4	+	1	353	c.315G>A	c.(313-315)ggG>ggA	p.G105G	HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank|HIST1H3J_ENST00000479986.1_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	105					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										TGCTGCCCGGGGAGCTGGCCA	0.642																																						uc003nkc.1		NaN																	0					0						c.(313-315)GGG>GGA		histone cluster 1, H2bo							47.0	52.0	50.0					6																	27861555		2203	4298	6501	SO:0001819	synonymous_variant	8348				nucleosome assembly	nucleosome|nucleus	DNA binding	g.chr6:27861555G>A	X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.315G>A	6.37:g.27861555G>A						HIST1H3J_uc003nka.2_5'Flank|HIST1H2AM_uc003nkb.1_5'Flank	p.G105G	NM_003527	NP_003518	P23527	H2B1O_HUMAN			1	353	+			105					Q3KPI7|Q8TCV6	Silent	SNP	ENST00000303806.4	37	c.315G>A	CCDS4640.1																																																																																				0.642	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040161.1		NM_003527		4	114	0	0	0	0.001984	0	4	114		
IER3	8870	broad.mit.edu	37	6	30712140	30712140	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:30712140G>A	ENST00000259874.5	-	1	191	c.156C>T	c.(154-156)ccC>ccT	p.P52P	IER3_ENST00000376377.2_Silent_p.P52P|FLOT1_ENST00000470643.1_5'Flank|XXbac-BPG252P9.10_ENST00000607333.1_RNA|FLOT1_ENST00000376389.3_5'Flank|FLOT1_ENST00000456573.2_5'Flank	NM_003897.3	NP_003888.2	P46695	IEX1_HUMAN	immediate early response 3	52					anatomical structure morphogenesis (GO:0009653)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glycolytic process (GO:0045820)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|negative regulation of systemic arterial blood pressure (GO:0003085)|positive regulation of protein catabolic process (GO:0045732)|regulation of DNA repair (GO:0006282)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of response to DNA damage stimulus (GO:2001020)|response to protozoan (GO:0001562)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				NS(1)	1						GAGAGGCGCTGGGGCGCCCGG	0.731																																						uc003nrn.2		NaN																	0					0						c.(154-156)CCC>CCT		immediate early response 3							9.0	13.0	12.0					6																	30712140		1223	2523	3746	SO:0001819	synonymous_variant	8870				anatomical structure morphogenesis|anti-apoptosis|apoptosis	integral to membrane	protein binding	g.chr6:30712140G>A	AF083421	CCDS4689.1	6p21.3	2010-02-17			ENSG00000137331	ENSG00000137331			5392	protein-coding gene	gene with protein product		602996				8603392, 9703517	Standard	NM_003897		Approved	IEX-1, DIF-2, PRG1, IEX-1L	uc003nrn.3	P46695	OTTHUMG00000031265	ENST00000259874.5:c.156C>T	6.37:g.30712140G>A						FLOT1_uc003nrm.2_5'Flank|FLOT1_uc011dmr.1_5'Flank	p.P52P	NM_003897	NP_003888	P46695	IEX1_HUMAN			1	188	-			52			Cytoplasmic (Potential).		Q5SU30|Q92691|Q93044	Silent	SNP	ENST00000259874.5	37	c.156C>T	CCDS4689.1																																																																																				0.731	IER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076578.2				3	7	0	0	0	0.004672	0	3	7		
PBX2	5089	broad.mit.edu	37	6	32155525	32155525	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:32155525C>T	ENST00000375050.4	-	5	1039	c.769G>A	c.(769-771)Gag>Aag	p.E257K	XXbac-BPG300A18.13_ENST00000559458.1_RNA	NM_002586.4	NP_002577.2	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	257					embryonic limb morphogenesis (GO:0030326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(9)|ovary(1)|prostate(2)	14						TTTAGGACCTCAGTGGCCTGT	0.527																																						uc003oav.1		NaN																	0				ovary(1)	1						c.(769-771)GAG>AAG		pre-B-cell leukemia homeobox 2							54.0	39.0	44.0					6																	32155525		1511	2709	4220	SO:0001583	missense	5089						transcription factor binding	g.chr6:32155525C>T		CCDS4748.1	6p21.32	2011-06-20	2007-01-30		ENSG00000204304	ENSG00000204304		"""Homeoboxes / TALE class"""	8633	protein-coding gene	gene with protein product		176311	"""pre-B-cell leukemia transcription factor 2"""			7835890	Standard	NM_002586		Approved	G17, HOX12, PBX2MHC	uc003oav.1	P40425	OTTHUMG00000031116	ENST00000375050.4:c.769G>A	6.37:g.32155525C>T	ENSP00000364190:p.Glu257Lys					PBX2_uc003oaw.2_Missense_Mutation_p.E257K	p.E257K	NM_002586	NP_002577	P40425	PBX2_HUMAN			5	1040	-			257			Homeobox; TALE-type.		A2BFJ2	Missense_Mutation	SNP	ENST00000375050.4	37	c.769G>A	CCDS4748.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977593	0.92982	.	.	ENSG00000204304	ENST00000375050	D	0.96396	-4.0	4.73	4.73	0.59995	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.184670	0.36409	N	0.002609	D	0.95236	0.8455	N	0.21240	0.645	0.80722	D	1	B;D	0.59357	0.413;0.985	B;D	0.69307	0.223;0.963	D	0.95747	0.8788	10	0.51188	T	0.08	-3.7259	15.2404	0.73465	0.0:1.0:0.0:0.0	.	257;257	Q7KZE5;P40425	.;PBX2_HUMAN	K	257	ENSP00000364190:E257K	ENSP00000364190:E257K	E	-	1	0	PBX2	32263503	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.288000	0.78691	2.456000	0.83038	0.561000	0.74099	GAG		0.527	PBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076194.4				7	19	0	0	0	0.00308	0	7	19		
TFAP2B	7021	broad.mit.edu	37	6	50791308	50791308	+	Silent	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:50791308C>T	ENST00000393655.3	+	2	439	c.270C>T	c.(268-270)aaC>aaT	p.N90N	TFAP2B_ENST00000489228.1_3'UTR|TFAP2B_ENST00000263046.4_Silent_p.N99N	NM_003221.3	NP_003212.2	Q92481	AP2B_HUMAN	transcription factor AP-2 beta (activating enhancer binding protein 2 beta)	90	Gln/Pro-rich (transactivation domain).				aorta morphogenesis (GO:0035909)|calcium ion homeostasis (GO:0055074)|cellular ammonia homeostasis (GO:0097275)|cellular creatinine homeostasis (GO:0097276)|cellular urea homeostasis (GO:0097277)|collecting duct development (GO:0072044)|distal tubule development (GO:0072017)|ductus arteriosus closure (GO:0097070)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hindlimb morphogenesis (GO:0035137)|kidney development (GO:0001822)|magnesium ion homeostasis (GO:0010960)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphate ion homeostasis (GO:0055062)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of urine volume (GO:0035810)|potassium ion homeostasis (GO:0055075)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell differentiation (GO:0045595)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|renal water homeostasis (GO:0003091)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|retina layer formation (GO:0010842)|skin development (GO:0043588)|sodium ion homeostasis (GO:0055078)|sympathetic nervous system development (GO:0048485)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)	40	Lung NSC(77;0.156)					CCCACGTCAACGACCCCTACT	0.672																																					Pancreas(116;1373 2332 5475 10752)	uc003pag.2		NaN																	0					0						c.(268-270)AAC>AAT		transcription factor AP-2 beta							67.0	71.0	70.0					6																	50791308		2203	4300	6503	SO:0001819	synonymous_variant	7021				nervous system development|positive regulation of transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity	g.chr6:50791308C>T	X95694	CCDS4934.2	6p12	2008-02-05	2001-11-28		ENSG00000008196	ENSG00000008196			11743	protein-coding gene	gene with protein product		601601	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)"""			7555706, 8661133	Standard	NM_003221		Approved	AP2-B	uc003pag.3	Q92481	OTTHUMG00000014836	ENST00000393655.3:c.270C>T	6.37:g.50791308C>T							p.N90N	NM_003221	NP_003212	Q92481	AP2B_HUMAN			2	436	+	Lung NSC(77;0.156)		90			Gln/Pro-rich (transactivation domain).		Q5JYX6|Q9NQ63|Q9NU99|Q9UJI7|Q9Y214|Q9Y3K3	Silent	SNP	ENST00000393655.3	37	c.270C>T	CCDS4934.2																																																																																				0.672	TFAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040886.3		NM_003221		26	59	0	0	0	0.012213	0	26	59		
HMGCLL1	54511	broad.mit.edu	37	6	55360317	55360317	+	Missense_Mutation	SNP	A	A	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:55360317A>T	ENST00000398661.2	-	8	916	c.785T>A	c.(784-786)aTg>aAg	p.M262K	HMGCLL1_ENST00000274901.4_Missense_Mutation_p.M232K|HMGCLL1_ENST00000508459.1_Intron|HMGCLL1_ENST00000308161.4_Missense_Mutation_p.M200K|HMGCLL1_ENST00000370850.2_Missense_Mutation_p.M129K	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	262					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			ACTTTCCAACATTCTTTTCAT	0.443																																					Ovarian(35;840 893 7837 15538 42887)	uc003pcn.2		NaN																	0				skin(2)|ovary(1)|pancreas(1)	4						c.(784-786)ATG>AAG		3-hydroxymethyl-3-methylglutaryl-Coenzyme A							136.0	126.0	129.0					6																	55360317		1887	4120	6007	SO:0001583	missense	54511						hydroxymethylglutaryl-CoA lyase activity|metal ion binding	g.chr6:55360317A>T	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.785T>A	6.37:g.55360317A>T	ENSP00000381654:p.Met262Lys					HMGCLL1_uc003pco.2_Missense_Mutation_p.M232K|HMGCLL1_uc010jzx.2_Missense_Mutation_p.M133K|HMGCLL1_uc011dxc.1_Missense_Mutation_p.M200K|HMGCLL1_uc011dxd.1_Missense_Mutation_p.M129K|HMGCLL1_uc011dxe.1_Intron	p.M262K	NM_019036	NP_061909	Q8TB92	HMGC2_HUMAN	LUSC - Lung squamous cell carcinoma(124;0.23)		8	944	-	Lung NSC(77;0.0875)		262					B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	ENST00000398661.2	37	c.785T>A	CCDS43475.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.453198	0.84209	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000370850;ENST00000308161	D;D;D;D	0.98192	-4.78;-4.78;-4.63;-4.78	5.62	5.62	0.85841	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.035675	0.85682	D	0.000000	D	0.99111	0.9694	M	0.90870	3.155	0.80722	D	1	D;D;D;D	0.89917	0.996;0.999;1.0;0.999	D;D;D;D	0.91635	0.915;0.991;0.999;0.993	D	0.99548	1.0965	10	0.87932	D	0	-17.801	15.8303	0.78745	1.0:0.0:0.0:0.0	.	129;200;232;262	B7Z212;F8W793;Q8TB92-2;Q8TB92	.;.;.;HMGC2_HUMAN	K	232;262;129;200	ENSP00000274901:M232K;ENSP00000381654:M262K;ENSP00000359887:M129K;ENSP00000309737:M200K	ENSP00000274901:M232K	M	-	2	0	HMGCLL1	55468276	1.000000	0.71417	0.483000	0.27378	0.930000	0.56654	9.339000	0.96797	2.133000	0.65898	0.533000	0.62120	ATG		0.443	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000360290.1		XM_166383		17	44	0	0	0	0.007413	0	17	44		
GABRR2	2570	broad.mit.edu	37	6	90024839	90024839	+	Missense_Mutation	SNP	C	C	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:90024839C>A	ENST00000402938.3	-	1	179	c.46G>T	c.(46-48)Gtt>Ttt	p.V16F	GABRR2_ENST00000602399.1_Missense_Mutation_p.V41F|GABRR2_ENST00000602808.1_5'UTR	NM_002043.3	NP_002034.3	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 2	16					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(10)|prostate(2)|urinary_tract(1)	21		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	TCCACGAGAACCATCAAGCAA	0.473																																						uc003pnb.2		NaN																	0					0						c.(121-123)GTT>TTT		gamma-aminobutyric acid (GABA) receptor, rho 2							236.0	239.0	238.0					6																	90024839		2203	4300	6503	SO:0001583	missense	2570				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity	g.chr6:90024839C>A		CCDS5020.2, CCDS5020.3	6q15	2012-06-22	2012-02-03		ENSG00000111886	ENSG00000111886		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4091	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 2"""	137162	"""gamma-aminobutyric acid (GABA) receptor, rho 2"""			1315307	Standard	NM_002043		Approved		uc003pnb.3	P28476	OTTHUMG00000015198	ENST00000402938.3:c.46G>T	6.37:g.90024839C>A	ENSP00000386029:p.Val16Phe						p.V41F	NM_002043	NP_002034	P28476	GBRR2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0158)	1	129	-		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)	41					A2BDE4|Q9H153	Missense_Mutation	SNP	ENST00000402938.3	37	c.121G>T	CCDS5020.3	.	.	.	.	.	.	.	.	.	.	C	14.37	2.513980	0.44763	.	.	ENSG00000111886	ENST00000402938	.	.	.	5.52	-1.54	0.08584	.	0.594172	0.16097	N	0.229774	T	0.09423	0.0232	L	0.34521	1.04	0.25225	N	0.989873	B	0.20671	0.047	B	0.17979	0.02	T	0.29458	-1.0011	8	.	.	.	.	4.9025	0.13782	0.1017:0.2205:0.5189:0.1589	.	41	P28476	GBRR2_HUMAN	F	41	.	.	V	-	1	0	GABRR2	90081558	1.000000	0.71417	0.983000	0.44433	0.979000	0.70002	1.119000	0.31258	0.009000	0.14813	0.655000	0.94253	GTT		0.473	GABRR2-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041482.3				54	143	1	0	9.53978e-28	0.01441	1.07501e-27	54	143		
MCHR2	84539	broad.mit.edu	37	6	100395738	100395738	+	Missense_Mutation	SNP	C	C	G	rs199634770		TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:100395738C>G	ENST00000281806.2	-	3	606	c.292G>C	c.(292-294)Gag>Cag	p.E98Q	MCHR2_ENST00000369212.2_Missense_Mutation_p.E98Q	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		AACACCCACTCTCCCCCTCGG	0.493																																						uc003pqh.1		NaN																	0				lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	8						c.(292-294)GAG>CAG		melanin-concentrating hormone receptor 2							107.0	110.0	109.0					6																	100395738		2203	4300	6503	SO:0001583	missense	84539					integral to membrane|plasma membrane	G-protein coupled receptor activity	g.chr6:100395738C>G	AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.292G>C	6.37:g.100395738C>G	ENSP00000281806:p.Glu98Gln					MCHR2_uc003pqi.1_Missense_Mutation_p.E98Q	p.E98Q	NM_001040179	NP_001035269	Q969V1	MCHR2_HUMAN		BRCA - Breast invasive adenocarcinoma(108;0.0429)	3	607	-		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)	98			Extracellular (Potential).		B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Missense_Mutation	SNP	ENST00000281806.2	37	c.292G>C	CCDS5044.1	.	.	.	.	.	.	.	.	.	.	C	7.758	0.704882	0.15172	.	.	ENSG00000152034	ENST00000445970;ENST00000281806;ENST00000369212	T;T;T	0.72942	-0.7;-0.7;-0.7	4.57	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.276082	0.29730	N	0.011352	T	0.30262	0.0759	N	0.16201	0.385	0.29887	N	0.825548	B	0.14012	0.009	B	0.11329	0.006	T	0.10042	-1.0647	10	0.16420	T	0.52	.	12.4217	0.55524	0.0:0.8162:0.1838:0.0	.	98	Q969V1	MCHR2_HUMAN	Q	98	ENSP00000403490:E98Q;ENSP00000281806:E98Q;ENSP00000358214:E98Q	ENSP00000281806:E98Q	E	-	1	0	MCHR2	100502459	0.844000	0.29557	1.000000	0.80357	0.854000	0.48673	0.735000	0.26115	0.887000	0.36136	0.650000	0.86243	GAG		0.493	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041620.2		NM_032503		4	130	0	0	0	0.009096	0	4	130		
TSPYL1	7259	broad.mit.edu	37	6	116600209	116600209	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:116600209C>G	ENST00000368608.3	-	1	857	c.785G>C	c.(784-786)cGa>cCa	p.R262P	RP1-93H18.1_ENST00000449314.1_lincRNA|DSE_ENST00000540275.1_Intron|DSE_ENST00000452085.3_5'Flank	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	262					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		CAGGTAGTGTCGACGCATCCG	0.567																																						uc003pwp.3		NaN																	0					0						c.(784-786)CGA>CCA		TSPY-like 1							119.0	113.0	115.0					6																	116600209		2203	4300	6503	SO:0001583	missense	7259				nucleosome assembly	nucleolus		g.chr6:116600209C>G	AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.785G>C	6.37:g.116600209C>G	ENSP00000357597:p.Arg262Pro					DSE_uc011ebf.1_Intron|DSE_uc003pwq.1_5'Flank|DSE_uc003pwr.2_5'Flank|DSE_uc003pws.2_5'Flank	p.R262P	NM_003309	NP_003300	Q9H0U9	TSYL1_HUMAN		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)	1	1072	-		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)	262					O75885|Q5TFE6	Missense_Mutation	SNP	ENST00000368608.3	37	c.785G>C	CCDS34518.1	.	.	.	.	.	.	.	.	.	.	C	19.29	3.798242	0.70567	.	.	ENSG00000189241	ENST00000368608	T	0.27104	1.69	4.21	4.21	0.49690	.	0.339085	0.16662	N	0.204724	T	0.37919	0.1021	M	0.68593	2.085	0.43054	D	0.994669	D	0.67145	0.996	D	0.68483	0.958	T	0.10753	-1.0616	10	0.62326	D	0.03	-3.4107	12.3564	0.55178	0.0:1.0:0.0:0.0	.	262	Q9H0U9	TSYL1_HUMAN	P	262	ENSP00000357597:R262P	ENSP00000357597:R262P	R	-	2	0	TSPYL1	116706902	0.234000	0.23783	0.684000	0.30055	0.996000	0.88848	1.293000	0.33353	2.631000	0.89168	0.462000	0.41574	CGA		0.567	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041929.1				29	110	0	0	0	0.015359	0	29	110		
AKAP7	9465	broad.mit.edu	37	6	131490373	131490373	+	Silent	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:131490373G>A	ENST00000431975.2	+	5	647	c.549G>A	c.(547-549)ctG>ctA	p.L183L	AKAP7_ENST00000368123.4_Silent_p.L161L|AKAP7_ENST00000366358.2_Intron|AKAP7_ENST00000541650.1_Silent_p.L182L	NM_016377.3	NP_057461.2	Q9P0M2	AKA7G_HUMAN	A kinase (PRKA) anchor protein 7	183						cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|nucleotide binding (GO:0000166)|protein kinase A binding (GO:0051018)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|stomach(1)	13	Breast(56;0.152)			GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)		TTGTGAAGCTGGCAGAAGGAG	0.378																																						uc003qck.2		NaN																	0				ovary(2)	2						c.(547-549)CTG>CTA		A-kinase anchor protein 7 isoform gamma							148.0	151.0	150.0					6																	131490373		2203	4300	6503	SO:0001819	synonymous_variant	9465				intracellular signal transduction|ion transport	apical plasma membrane|intracellular|lateral plasma membrane	protein kinase A binding	g.chr6:131490373G>A	AF047715	CCDS5142.1, CCDS5143.1, CCDS5144.1, CCDS5142.2	6q23.2	2012-10-24			ENSG00000118507	ENSG00000118507		"""A-kinase anchor proteins"""	377	protein-coding gene	gene with protein product		604693				9545239	Standard	NM_016377		Approved	AKAP18, AKAP15	uc003qck.4	O43687	OTTHUMG00000015563	ENST00000431975.2:c.549G>A	6.37:g.131490373G>A						AKAP7_uc011ebz.1_Silent_p.L161L|AKAP7_uc003qcl.1_Silent_p.L64L	p.L183L	NM_016377	NP_057461	O43687	AKA7A_HUMAN		GBM - Glioblastoma multiforme(226;0.0184)|OV - Ovarian serous cystadenocarcinoma(155;0.0345)	5	582	+	Breast(56;0.152)		Error:Variant_position_missing_in_O43687_after_alignment					B4DUC3|Q9HCZ8	Silent	SNP	ENST00000431975.2	37	c.549G>A	CCDS5142.2																																																																																				0.378	AKAP7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042209.2		NM_004842		34	102	0	0	0	0.007835	0	34	102		
TCP10L2	401285	broad.mit.edu	37	6	167590518	167590518	+	Silent	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr6:167590518C>T	ENST00000366832.2	+	4	525	c.394C>T	c.(394-396)Ctg>Ttg	p.L132L		NM_001145121.1	NP_001138593.1	B9ZVM9	TCP2L_HUMAN	t-complex 10-like 2	132										endometrium(1)|kidney(2)|lung(3)	6						AATTTCACCTCTGTCAGCTGA	0.418																																						uc010kkp.2		NaN																	0					0						c.(394-396)CTG>TTG		t-complex 10-like 2							119.0	77.0	90.0					6																	167590518		692	1591	2283	SO:0001819	synonymous_variant	401285							g.chr6:167590518C>T		CCDS47514.1	6q27	2012-09-20	2012-09-20		ENSG00000166984	ENSG00000166984			21254	protein-coding gene	gene with protein product			"""t-complex 10-like 2 (mouse)"""				Standard	NM_001145121		Approved	bA517H2.3	uc010kkp.3	B9ZVM9	OTTHUMG00000016014	ENST00000366832.2:c.394C>T	6.37:g.167590518C>T							p.L132L	NM_001145121	NP_001138593	B9ZVM9	B9ZVM9_HUMAN			4	525	+			132						Silent	SNP	ENST00000366832.2	37	c.394C>T	CCDS47514.1																																																																																				0.418	TCP10L2-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043112.5		XR_040749		12	43	0	0	0	0.008871	0	12	43		
DNAH11	8701	broad.mit.edu	37	7	21695538	21695538	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr7:21695538G>C	ENST00000409508.3	+	29	5064	c.5033G>C	c.(5032-5034)gGa>gCa	p.G1678A	DNAH11_ENST00000328843.6_Missense_Mutation_p.G1683A	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1683	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AGGGCAGTTGGAATGTACAGC	0.428									Kartagener syndrome																													uc003svc.2		NaN																	0				ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						c.(5047-5049)GGA>GCA		dynein, axonemal, heavy chain 11							98.0	98.0	98.0					7																	21695538		1928	4139	6067	SO:0001583	missense	8701	Kartagener_syndrome	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity	g.chr7:21695538G>C	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5033G>C	7.37:g.21695538G>C	ENSP00000475939:p.Gly1678Ala						p.G1683A	NM_003777	NP_003768	Q96DT5	DYH11_HUMAN			29	5079	+			1683			Stem (By similarity).		Q9UJ82	Missense_Mutation	SNP	ENST00000409508.3	37	c.5048G>C		.	.	.	.	.	.	.	.	.	.	G	23.5	4.420034	0.83559	.	.	ENSG00000105877	ENST00000328843	T	0.61158	0.13	5.95	5.07	0.68467	Dynein heavy chain, domain-2 (1);	0.111905	0.64402	D	0.000011	T	0.63628	0.2527	.	.	.	0.58432	D	0.999991	P	0.47604	0.898	P	0.53185	0.72	T	0.59847	-0.7377	9	0.22109	T	0.4	.	14.759	0.69590	0.0697:0.0:0.9303:0.0	.	1683	Q96DT5	DYH11_HUMAN	A	1683	ENSP00000330671:G1683A	ENSP00000330671:G1683A	G	+	2	0	DNAH11	21662063	1.000000	0.71417	0.977000	0.42913	0.995000	0.86356	8.752000	0.91632	1.525000	0.49052	0.650000	0.86243	GGA		0.428	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000326582.6		NM_003777		4	35	0	0	0	0.009096	0	4	35		
PKD1L1	168507	broad.mit.edu	37	7	47832313	47832313	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr7:47832313G>C	ENST00000289672.2	-	56	8488	c.8438C>G	c.(8437-8439)cCc>cGc	p.P2813R	C7orf69_ENST00000258776.4_5'Flank|C7orf69_ENST00000418326.2_5'Flank	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2813					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TTCCAGAAGGGGGAGTTGTAG	0.428																																						uc003tny.1		NaN																	0				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						c.(8437-8439)CCC>CGC		polycystin-1L1							176.0	154.0	162.0					7																	47832313		2203	4300	6503	SO:0001583	missense	168507				cell-cell adhesion	integral to membrane		g.chr7:47832313G>C	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.8438C>G	7.37:g.47832313G>C	ENSP00000289672:p.Pro2813Arg					C7orf69_uc003tnz.3_5'Flank|C7orf69_uc003toa.1_5'Flank	p.P2813R	NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN			56	8438	-			2813			Cytoplasmic (Potential).		Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	c.8438C>G	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265187	0.80358	.	.	ENSG00000158683	ENST00000289672	T	0.25414	1.8	4.95	4.95	0.65309	.	0.553826	0.15184	N	0.275949	T	0.31420	0.0796	N	0.14661	0.345	0.09310	N	1	D	0.64830	0.994	P	0.61874	0.895	T	0.16512	-1.0400	10	0.66056	D	0.02	-11.5238	13.5564	0.61761	0.0:0.0:1.0:0.0	.	2813	Q8TDX9	PK1L1_HUMAN	R	2813	ENSP00000289672:P2813R	ENSP00000289672:P2813R	P	-	2	0	PKD1L1	47798838	0.089000	0.21612	0.058000	0.19502	0.796000	0.44982	3.791000	0.55469	2.580000	0.87095	0.655000	0.94253	CCC		0.428	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1		NM_138295		27	64	0	0	0	0.008361	0	27	64		
Unknown	0	broad.mit.edu	37	7	75130883	75130883	+	IGR	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr7:75130883G>A								POM121C (15335 upstream) : PMS2P3 (6191 downstream)																							CAGTTAGGCCGTTCCATGAAC	0.592																																						uc011kfy.1		NaN																	0					0						c.(757-759)CGT>CAT		speedy homolog E5							104.0	124.0	117.0					7																	75130883		1508	2705	4213	SO:0001628	intergenic_variant	442590							g.chr7:75130883G>A																													7.37:g.75130883G>A							p.R253H	NM_001099435	NP_001092905	A6NIY4	SPDE5_HUMAN			6	894	+			253			Arg-rich.			Missense_Mutation	SNP		37	c.758G>A																																																																																				0	0.592										6	239	0	0	0	0.004482	0	6	239		
CROT	54677	broad.mit.edu	37	7	87011302	87011302	+	Missense_Mutation	SNP	G	G	C			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr7:87011302G>C	ENST00000331536.3	+	11	1240	c.1055G>C	c.(1054-1056)aGa>aCa	p.R352T	CROT_ENST00000419147.2_Missense_Mutation_p.R380T|CROT_ENST00000442291.1_Missense_Mutation_p.R352T	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	352					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	AATGAAGGAAGATGGAAGGTA	0.303																																						uc003uit.2		NaN																	0				ovary(2)|lung(1)	3						c.(1054-1056)AGA>ACA		peroxisomal carnitine O-octanoyltransferase	L-Carnitine(DB00583)						98.0	96.0	96.0					7																	87011302		2203	4297	6500	SO:0001583	missense	54677				fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity	g.chr7:87011302G>C		CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1055G>C	7.37:g.87011302G>C	ENSP00000331981:p.Arg352Thr					CROT_uc003uiu.2_Missense_Mutation_p.R380T	p.R352T	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN			11	1300	+	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)		352					A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	ENST00000331536.3	37	c.1055G>C	CCDS5604.1	.	.	.	.	.	.	.	.	.	.	G	9.470	1.095344	0.20471	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	D;D;D	0.89196	-2.48;-2.48;-2.48	5.35	2.33	0.28932	.	0.307790	0.39146	N	0.001450	T	0.79730	0.4496	L	0.33485	1.01	0.32523	N	0.535996	B;B	0.19073	0.033;0.01	B;B	0.17979	0.02;0.007	T	0.69647	-0.5089	10	0.14252	T	0.57	-15.8982	8.6299	0.33913	0.4116:0.0:0.5884:0.0	.	380;352	E7EQF2;Q9UKG9	.;OCTC_HUMAN	T	380;352;352	ENSP00000413575:R380T;ENSP00000331981:R352T;ENSP00000411983:R352T	ENSP00000331981:R352T	R	+	2	0	CROT	86849238	0.998000	0.40836	0.968000	0.41197	0.841000	0.47740	1.540000	0.36115	0.249000	0.21456	0.467000	0.42956	AGA		0.303	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253485.1		NM_021151		4	31	0	0	0	0.009096	0	4	31		
CASD1	64921	broad.mit.edu	37	7	94164632	94164632	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr7:94164632G>A	ENST00000297273.4	+	8	927	c.640G>A	c.(640-642)Gaa>Aaa	p.E214K		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	214						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TCCTGTTTATGAAGATCTATT	0.328																																						uc003uni.3		NaN																	0				ovary(2)	2						c.(640-642)GAA>AAA		CAS1 domain containing 1 precursor							87.0	89.0	89.0					7																	94164632		2203	4300	6503	SO:0001583	missense	64921					integral to membrane		g.chr7:94164632G>A	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.640G>A	7.37:g.94164632G>A	ENSP00000297273:p.Glu214Lys					CASD1_uc003unh.2_Intron|CASD1_uc003unj.3_Missense_Mutation_p.E214K	p.E214K	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	STAD - Stomach adenocarcinoma(171;0.0031)		8	867	+	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		214					B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	37	c.640G>A	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.623630	0.87460	.	.	ENSG00000127995	ENST00000297273	T	0.19250	2.16	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.44582	0.1300	L	0.57536	1.79	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.09271	-1.0682	10	0.33940	T	0.23	.	19.2438	0.93893	0.0:0.0:1.0:0.0	.	214;214	Q8WZ77;Q96PB1	.;CASD1_HUMAN	K	214	ENSP00000297273:E214K	ENSP00000297273:E214K	E	+	1	0	CASD1	94002568	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.889000	0.87307	2.630000	0.89119	0.591000	0.81541	GAA		0.328	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1		NM_022900		14	42	0	0	0	0.004007	0	14	42		
TAF6	6878	broad.mit.edu	37	7	99709745	99709745	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr7:99709745C>T	ENST00000344095.4	-	7	1231	c.706G>A	c.(706-708)Gag>Aag	p.E236K	TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000452041.1_Missense_Mutation_p.E236K|TAF6_ENST00000418432.2_Missense_Mutation_p.E160K|TAF6_ENST00000437822.2_Missense_Mutation_p.E273K|TAF6_ENST00000472509.1_Missense_Mutation_p.E293K|TAF6_ENST00000453269.2_Missense_Mutation_p.E236K	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	236					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTCTTGGCCTCGCAGGAGCCC	0.672																																						uc003uti.2		NaN																	0				ovary(1)|central_nervous_system(1)	2						c.(706-708)GAG>AAG		TBP-associated factor 6 isoform alpha							21.0	25.0	24.0					7																	99709745		2203	4300	6503	SO:0001583	missense	6878				negative regulation of cell cycle|negative regulation of cell proliferation|regulation of sequence-specific DNA binding transcription factor activity|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity	g.chr7:99709745C>T		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.706G>A	7.37:g.99709745C>T	ENSP00000344537:p.Glu236Lys					TAF6_uc003utg.2_Missense_Mutation_p.E158K|TAF6_uc003uth.2_Missense_Mutation_p.E293K|TAF6_uc003utk.2_Missense_Mutation_p.E236K|TAF6_uc011kji.1_Missense_Mutation_p.E273K|TAF6_uc003utj.2_Missense_Mutation_p.E226K|TAF6_uc003utl.2_Missense_Mutation_p.E236K|TAF6_uc003utm.2_Missense_Mutation_p.E236K|TAF6_uc003utn.1_RNA	p.E236K	NM_139315	NP_647476	P49848	TAF6_HUMAN			7	787	-	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		236					A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Missense_Mutation	SNP	ENST00000344095.4	37	c.706G>A	CCDS5686.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785400	0.90282	.	.	ENSG00000106290	ENST00000453269;ENST00000472509;ENST00000452041;ENST00000344095;ENST00000418432;ENST00000437822;ENST00000493322;ENST00000440225	T;T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;0.82;0.8	5.52	4.64	0.57946	.	0.049668	0.85682	D	0.000000	T	0.70439	0.3224	M	0.69823	2.125	0.80722	D	1	D;D;D;P;B;D	0.61697	0.983;0.99;0.983;0.787;0.146;0.983	B;P;B;B;B;P	0.48952	0.391;0.596;0.391;0.09;0.046;0.521	T	0.72147	-0.4378	10	0.44086	T	0.13	-31.5707	12.3315	0.55041	0.0:0.9176:0.0:0.0824	.	273;236;226;236;236;160	B4DT11;P49848-2;A4D299;P49848;C9JTY6;B3KUR4	.;.;.;TAF6_HUMAN;.;.	K	236;293;236;236;160;273;236;217	ENSP00000389575:E236K;ENSP00000419760:E293K;ENSP00000416396:E236K;ENSP00000344537:E236K;ENSP00000407980:E160K;ENSP00000399982:E273K;ENSP00000419555:E236K;ENSP00000410012:E217K	ENSP00000344537:E236K	E	-	1	0	TAF6	99547681	1.000000	0.71417	0.949000	0.38748	0.931000	0.56810	5.581000	0.67471	1.327000	0.45338	0.563000	0.77884	GAG		0.672	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2		NM_005641		7	12	0	0	0	0.00308	0	7	12		
ZNF282	8427	broad.mit.edu	37	7	148895819	148895819	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr7:148895819C>T	ENST00000262085.3	+	2	665	c.560C>T	c.(559-561)cCg>cTg	p.P187L	ZNF282_ENST00000479907.1_Missense_Mutation_p.P187L	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	187					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CGGCTGCCCCCGGGCAGCAAG	0.597																																						uc003wfm.2		NaN																	0					0						c.(559-561)CCG>CTG		zinc finger protein 282							38.0	49.0	45.0					7																	148895819		2183	4269	6452	SO:0001583	missense	8427				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	g.chr7:148895819C>T	D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.560C>T	7.37:g.148895819C>T	ENSP00000262085:p.Pro187Leu					ZNF282_uc011kun.1_Missense_Mutation_p.P187L|ZNF282_uc003wfn.2_Missense_Mutation_p.P127L|ZNF282_uc003wfo.2_Missense_Mutation_p.P127L	p.P187L	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)	2	665	+	Melanoma(164;0.15)		187					B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	ENST00000262085.3	37	c.560C>T	CCDS5895.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715975	0.68844	.	.	ENSG00000170265	ENST00000430197;ENST00000262085;ENST00000479907	T;T	0.07908	3.15;4.92	4.11	4.11	0.48088	.	0.000000	0.42294	D	0.000725	T	0.23289	0.0563	L	0.60012	1.86	0.50632	D	0.999882	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.998	T	0.00498	-1.1704	10	0.59425	D	0.04	-21.2229	12.1774	0.54194	0.0:1.0:0.0:0.0	.	187;138;159;187	B4DRI5;Q86YG2;Q7Z2V4;Q9UDV7	.;.;.;ZN282_HUMAN	L	102;187;187	ENSP00000262085:P187L;ENSP00000418840:P187L	ENSP00000262085:P187L	P	+	2	0	ZNF282	148526752	0.989000	0.36119	0.957000	0.39632	0.979000	0.70002	2.989000	0.49393	2.017000	0.59298	0.313000	0.20887	CCG		0.597	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352746.1		NM_003575		10	64	0	0	0	0.016723	0	10	64		
DOCK5	80005	broad.mit.edu	37	8	25174557	25174557	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr8:25174557C>G	ENST00000276440.7	+	14	1397	c.1353C>G	c.(1351-1353)atC>atG	p.I451M		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	451	DHR-1.				positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		TCACCCTGATCCACGGTGAGT	0.478																																					Pancreas(145;34 1887 3271 10937 30165)	uc003xeg.2		NaN																	0				ovary(3)	3						c.(1351-1353)ATC>ATG		dedicator of cytokinesis 5							176.0	140.0	152.0					8																	25174557		2203	4300	6503	SO:0001583	missense	80005					cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity	g.chr8:25174557C>G		CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.1353C>G	8.37:g.25174557C>G	ENSP00000276440:p.Ile451Met					DOCK5_uc010luf.1_RNA|DOCK5_uc003xeh.1_Missense_Mutation_p.I165M|DOCK5_uc003xei.2_Missense_Mutation_p.I21M	p.I451M	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)	14	1490	+		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)	451			DHR-1.		B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	ENST00000276440.7	37	c.1353C>G	CCDS6047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.48|14.48	2.549011|2.549011	0.45383|0.45383	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000276440|ENST00000444569	T|.	0.13901|.	2.55|.	5.49|5.49	2.72|2.72	0.32119|0.32119	.|.	0.188022|.	0.47852|.	D|.	0.000209|.	T|T	0.56863|0.56863	0.2014|0.2014	L|L	0.55481|0.55481	1.735|1.735	0.38746|0.38746	D|D	0.954007|0.954007	B;B;B|.	0.32302|.	0.363;0.146;0.363|.	B;B;B|.	0.38921|.	0.285;0.158;0.285|.	T|T	0.52653|0.52653	-0.8547|-0.8547	10|5	0.49607|.	T|.	0.09|.	.|.	7.2774|7.2774	0.26292|0.26292	0.0:0.6723:0.1222:0.2055|0.0:0.6723:0.1222:0.2055	.|.	441;226;451|.	D3DSS6;Q68DL4;Q9H7D0|.	.;.;DOCK5_HUMAN|.	M|A	451|223	ENSP00000276440:I451M|.	ENSP00000276440:I451M|.	I|P	+|+	3|1	3|0	DOCK5|DOCK5	25230474|25230474	0.265000|0.265000	0.24102|0.24102	0.995000|0.995000	0.50966|0.50966	0.989000|0.989000	0.77384|0.77384	-0.433000|-0.433000	0.06948|0.06948	0.292000|0.292000	0.22492|0.22492	0.650000|0.650000	0.86243|0.86243	ATC|CCA		0.478	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254955.2		NM_024940		3	53	0	0	0	0.004672	0	3	53		
CER1	9350	broad.mit.edu	37	9	14720234	14720234	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr9:14720234G>A	ENST00000380911.3	-	2	702	c.658C>T	c.(658-660)Cca>Tca	p.P220S		NM_005454.2	NP_005445.1	O95813	CER1_HUMAN	cerberus 1, DAN family BMP antagonist	220	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|bone mineralization (GO:0030282)|cell migration involved in gastrulation (GO:0042074)|cellular response to BMP stimulus (GO:0071773)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|growth plate cartilage chondrocyte proliferation (GO:0003419)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mesoderm development (GO:2000381)|nervous system development (GO:0007399)|sequestering of BMP in extracellular matrix (GO:0035582)|signal transduction involved in regulation of gene expression (GO:0023019)|ureteric bud development (GO:0001657)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(3)|lung(6)	11				GBM - Glioblastoma multiforme(50;3.16e-06)		CAGTTCAGTGGCAAGTGCATC	0.542																																						uc003zlj.2		NaN																	0					0						c.(658-660)CCA>TCA		cerberus 1 precursor							146.0	117.0	127.0					9																	14720234		2203	4300	6503	SO:0001583	missense	9350				BMP signaling pathway	extracellular space	cytokine activity	g.chr9:14720234G>A	AF090189	CCDS6476.1	9p23-p22	2013-02-26	2013-02-26		ENSG00000147869	ENSG00000147869			1862	protein-coding gene	gene with protein product		603777	"""cerberus 1 (Xenopus laevis) homolog (cysteine knot superfamily)"", ""cerberus 1, cysteine knot superfamily, homolog (Xenopus laevis)"""			10049596	Standard	NM_005454		Approved	DAND4	uc003zlj.3	O95813	OTTHUMG00000021022	ENST00000380911.3:c.658C>T	9.37:g.14720234G>A	ENSP00000370297:p.Pro220Ser						p.P220S	NM_005454	NP_005445	O95813	CER1_HUMAN		GBM - Glioblastoma multiforme(50;3.16e-06)	2	703	-			220			CTCK.		Q6ISJ1|Q6ISJ6|Q6ISQ2|Q6ISS1	Missense_Mutation	SNP	ENST00000380911.3	37	c.658C>T	CCDS6476.1	.	.	.	.	.	.	.	.	.	.	G	3.516	-0.098709	0.07010	.	.	ENSG00000147869	ENST00000380911	T	0.28895	1.59	5.5	-0.304	0.12788	DAN (1);Cystine knot, C-terminal (2);	1.900700	0.02253	N	0.066846	T	0.17238	0.0414	N	0.17082	0.46	0.18873	N	0.999985	B	0.15719	0.014	B	0.13407	0.009	T	0.12142	-1.0559	10	0.10902	T	0.67	0.9081	4.4491	0.11612	0.0773:0.4109:0.303:0.2087	.	220	O95813	CER1_HUMAN	S	220	ENSP00000370297:P220S	ENSP00000370297:P220S	P	-	1	0	CER1	14710234	0.004000	0.15560	0.064000	0.19789	0.632000	0.37999	-0.156000	0.10100	0.041000	0.15688	0.643000	0.83706	CCA		0.542	CER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055453.1		NM_005454		5	134	0	0	0	0.00308	0	5	134		
C9orf64	84267	broad.mit.edu	37	9	86571110	86571110	+	Silent	SNP	C	C	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr9:86571110C>A	ENST00000376344.3	-	1	522	c.306G>T	c.(304-306)ctG>ctT	p.L102L	C9orf64_ENST00000376340.2_5'UTR|C9orf64_ENST00000314700.1_5'UTR	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	102										central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						CGGCGGCGCACAGGGACCAGT	0.552																																						uc004anb.2		NaN																	0					0						c.(304-306)CTG>CTT		hypothetical protein LOC84267							130.0	129.0	129.0					9																	86571110		2069	4206	6275	SO:0001819	synonymous_variant	84267							g.chr9:86571110C>A	AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.306G>T	9.37:g.86571110C>A						C9orf64_uc004anc.2_5'UTR	p.L102L	NM_032307	NP_115683	Q5T6V5	CI064_HUMAN			1	554	-			102					B2RPI6|Q8N2B1|Q9BT18	Silent	SNP	ENST00000376344.3	37	c.306G>T	CCDS6666.2																																																																																				0.552	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052865.1		NM_032307		30	137	1	0	3.66854e-30	0.007835	4.19659e-30	30	137		
IKBKAP	8518	broad.mit.edu	37	9	111663910	111663910	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr9:111663910C>T	ENST00000374647.5	-	17	2213	c.1906G>A	c.(1906-1908)Gag>Aag	p.E636K	IKBKAP_ENST00000537196.1_Missense_Mutation_p.E287K	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	636					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CTTGATACCTCAATGTCATTG	0.433																																						uc004bdm.3		NaN																	0				ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7						c.(1906-1908)GAG>AAG		inhibitor of kappa light polypeptide gene							162.0	142.0	149.0					9																	111663910		2203	4300	6503	SO:0001583	missense	8518				immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity	g.chr9:111663910C>T	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1906G>A	9.37:g.111663910C>T	ENSP00000363779:p.Glu636Lys					IKBKAP_uc004bdl.2_Missense_Mutation_p.E287K|IKBKAP_uc011lwc.1_Missense_Mutation_p.E522K|IKBKAP_uc010mtq.2_Missense_Mutation_p.E287K	p.E636K	NM_003640	NP_003631	O95163	ELP1_HUMAN			17	2426	-			636					Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	ENST00000374647.5	37	c.1906G>A	CCDS6773.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.526902	0.85706	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.26957	1.7;1.7	5.65	5.65	0.86999	.	0.241665	0.41500	D	0.000875	T	0.41766	0.1173	M	0.67569	2.06	0.35357	D	0.787859	D	0.60160	0.987	P	0.61328	0.887	T	0.39663	-0.9603	10	0.06891	T	0.86	-22.892	15.2131	0.73241	0.0:1.0:0.0:0.0	.	636	O95163	ELP1_HUMAN	K	636;287	ENSP00000363779:E636K;ENSP00000439367:E287K	ENSP00000363779:E636K	E	-	1	0	IKBKAP	110703731	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.777000	0.62361	2.648000	0.89879	0.650000	0.86243	GAG		0.433	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053574.1				16	51	0	0	0	0.007413	0	16	51		
SHOX	6473	broad.mit.edu	37	X	591697	591697	+	Missense_Mutation	SNP	G	G	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:591697G>A	ENST00000554971.1	+	1	156	c.65G>A	c.(64-66)gGa>gAa	p.G22E	SHOX_ENST00000381578.1_Missense_Mutation_p.G22E|SHOX_ENST00000334060.3_Missense_Mutation_p.G22E|SHOX_ENST00000381575.1_Missense_Mutation_p.G22E			O15266	SHOX_HUMAN	short stature homeobox	22	Poly-Gly.				skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGTAACGGCGGAGGCGGAGGC	0.627																																					Ovarian(95;18 1419 12424 14056 28266)	uc004cph.1		NaN																	0					0						c.(64-66)GGA>GAA		short stature homeobox isoform SHOXa							124.0	154.0	144.0					X																	591697		2203	4296	6499	SO:0001583	missense	6473				skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity	g.chrX:591697G>A	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.65G>A	X.37:g.591697G>A	ENSP00000452016:p.Gly22Glu					SHOX_uc004cpi.2_Missense_Mutation_p.G22E	p.G22E	NM_000451	NP_000442	O15266	SHOX_HUMAN			2	756	+		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)	22			Poly-Gly.		O00412|O00413|O15267	Missense_Mutation	SNP	ENST00000554971.1	37	c.65G>A	CCDS14107.1	.	.	.	.	.	.	.	.	.	.	G	5.299	0.240534	0.10023	.	.	ENSG00000185960	ENST00000334060;ENST00000381578;ENST00000554971;ENST00000381575	D;D;D;D	0.96300	-3.97;-3.74;-3.74;-3.97	1.86	0.907	0.19321	.	1.353190	0.06087	N	0.663041	D	0.92001	0.7466	L	0.44542	1.39	0.09310	N	1	P;B	0.41131	0.739;0.029	B;B	0.34873	0.191;0.058	T	0.82557	-0.0398	10	0.16896	T	0.51	.	7.2762	0.26286	0.0:0.0:0.7364:0.2636	.	22;22	O15266-2;O15266	.;SHOX_HUMAN	E	22	ENSP00000335505:G22E;ENSP00000370990:G22E;ENSP00000452016:G22E;ENSP00000370987:G22E	ENSP00000335505:G22E	G	+	2	0	SHOX	511697	1.000000	0.71417	0.289000	0.24876	0.028000	0.11728	2.505000	0.45424	-0.033000	0.13736	0.422000	0.28245	GGA		0.627	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411999.3		NM_000451		5	220	0	0	0	0.014758	0	5	220		
IRS4	8471	broad.mit.edu	37	X	107977994	107977994	+	Missense_Mutation	SNP	C	C	A			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:107977994C>A	ENST00000372129.2	-	1	1657	c.1581G>T	c.(1579-1581)caG>caT	p.Q527H	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	527					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CTCGGGATCCCTGTCCCTCGC	0.632																																						uc004eoc.2		NaN																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1579-1581)CAG>CAT		insulin receptor substrate 4							140.0	140.0	140.0					X																	107977994		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107977994C>A	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1581G>T	X.37:g.107977994C>A	ENSP00000361202:p.Gln527His						p.Q527H	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1614	-			527						Missense_Mutation	SNP	ENST00000372129.2	37	c.1581G>T	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	5.295	0.239817	0.10023	.	.	ENSG00000133124	ENST00000372129	T	0.35605	1.3	4.01	3.13	0.36017	.	0.288469	0.25347	N	0.031336	T	0.19366	0.0465	N	0.12182	0.205	0.24104	N	0.995864	B	0.06786	0.001	B	0.06405	0.002	T	0.14868	-1.0457	10	0.49607	T	0.09	-0.0027	7.9263	0.29876	0.2445:0.7555:0.0:0.0	.	527	O14654	IRS4_HUMAN	H	527	ENSP00000361202:Q527H	ENSP00000361202:Q527H	Q	-	3	2	IRS4	107864650	0.013000	0.17824	0.974000	0.42286	0.444000	0.32077	-0.155000	0.10115	1.016000	0.39470	0.600000	0.82982	CAG		0.632	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1		NM_003604		17	133	1	0	1.10513e-12	0.014323	1.20924e-12	17	133		
IRS4	8471	broad.mit.edu	37	X	107977998	107977998	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:107977998C>T	ENST00000372129.2	-	1	1653	c.1577G>A	c.(1576-1578)gGa>gAa	p.G526E	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	526					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GGATCCCTGTCCCTCGCCTGA	0.632																																						uc004eoc.2		NaN																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1576-1578)GGA>GAA		insulin receptor substrate 4							138.0	138.0	138.0					X																	107977998		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107977998C>T	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1577G>A	X.37:g.107977998C>T	ENSP00000361202:p.Gly526Glu						p.G526E	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1610	-			526						Missense_Mutation	SNP	ENST00000372129.2	37	c.1577G>A	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	5.293	0.239483	0.10023	.	.	ENSG00000133124	ENST00000372129	T	0.38560	1.13	4.25	3.38	0.38709	.	0.689207	0.13315	N	0.397203	T	0.23611	0.0571	L	0.27053	0.805	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.29912	-0.9996	10	0.02654	T	1	-0.7703	7.3298	0.26575	0.0:0.8783:0.0:0.1217	.	526	O14654	IRS4_HUMAN	E	526	ENSP00000361202:G526E	ENSP00000361202:G526E	G	-	2	0	IRS4	107864654	0.000000	0.05858	0.071000	0.20095	0.430000	0.31655	0.545000	0.23268	1.116000	0.41820	0.600000	0.82982	GGA		0.632	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1		NM_003604		16	130	0	0	0	0.012319	0	16	130		
IRS4	8471	broad.mit.edu	37	X	107978050	107978050	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:107978050C>T	ENST00000372129.2	-	1	1601	c.1525G>A	c.(1525-1527)Ggc>Agc	p.G509S	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	509					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GAGCCTTGGCCATTTGAGCCC	0.597																																						uc004eoc.2		NaN																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1525-1527)GGC>AGC		insulin receptor substrate 4							111.0	109.0	110.0					X																	107978050		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107978050C>T	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1525G>A	X.37:g.107978050C>T	ENSP00000361202:p.Gly509Ser						p.G509S	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1558	-			509						Missense_Mutation	SNP	ENST00000372129.2	37	c.1525G>A	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	6.527	0.465388	0.12402	.	.	ENSG00000133124	ENST00000372129	T	0.35048	1.33	4.21	4.21	0.49690	.	0.141462	0.50627	D	0.000120	T	0.33731	0.0873	L	0.27053	0.805	0.32068	N	0.59478	D	0.76494	0.999	P	0.57502	0.822	T	0.08106	-1.0738	10	0.07482	T	0.82	-15.6002	10.8858	0.46965	0.0:1.0:0.0:0.0	.	509	O14654	IRS4_HUMAN	S	509	ENSP00000361202:G509S	ENSP00000361202:G509S	G	-	1	0	IRS4	107864706	0.029000	0.19370	0.880000	0.34516	0.600000	0.36913	0.751000	0.26348	2.333000	0.79357	0.600000	0.82982	GGC		0.597	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1		NM_003604		10	93	0	0	0	0.020292	0	10	93		
IRS4	8471	broad.mit.edu	37	X	107978105	107978105	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:107978105C>G	ENST00000372129.2	-	1	1546	c.1470G>C	c.(1468-1470)atG>atC	p.M490I	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	490					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CCCAATTGTTCATAGGCATGT	0.562																																						uc004eoc.2		NaN																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1468-1470)ATG>ATC		insulin receptor substrate 4							131.0	121.0	125.0					X																	107978105		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107978105C>G	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1470G>C	X.37:g.107978105C>G	ENSP00000361202:p.Met490Ile						p.M490I	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1503	-			490			YXXM motif 1.			Missense_Mutation	SNP	ENST00000372129.2	37	c.1470G>C	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995311	0.35226	.	.	ENSG00000133124	ENST00000372129	T	0.34859	1.34	4.2	3.34	0.38264	.	0.396931	0.27384	N	0.019618	T	0.22975	0.0555	L	0.27053	0.805	0.26939	N	0.966297	B	0.25235	0.121	B	0.17722	0.019	T	0.12604	-1.0541	10	0.16896	T	0.51	-11.6333	12.2675	0.54686	0.0:0.9131:0.0:0.0869	.	490	O14654	IRS4_HUMAN	I	490	ENSP00000361202:M490I	ENSP00000361202:M490I	M	-	3	0	IRS4	107864761	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.607000	0.54102	1.133000	0.42147	0.596000	0.82720	ATG		0.562	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1		NM_003604		9	82	0	0	0	0.016723	0	9	82		
IRS4	8471	broad.mit.edu	37	X	107978119	107978119	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:107978119C>T	ENST00000372129.2	-	1	1532	c.1456G>A	c.(1456-1458)Gac>Aac	p.D486N	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	486					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GGCATGTAGTCACCTCCGCTT	0.577																																						uc004eoc.2		NaN																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1456-1458)GAC>AAC		insulin receptor substrate 4							137.0	124.0	128.0					X																	107978119		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107978119C>T	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1456G>A	X.37:g.107978119C>T	ENSP00000361202:p.Asp486Asn						p.D486N	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1489	-			486						Missense_Mutation	SNP	ENST00000372129.2	37	c.1456G>A	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104456	0.37145	.	.	ENSG00000133124	ENST00000372129	T	0.35973	1.28	3.94	3.94	0.45596	.	0.601209	0.14055	N	0.344492	T	0.29093	0.0723	L	0.27053	0.805	0.27559	N	0.950248	B	0.28082	0.2	B	0.28385	0.089	T	0.14980	-1.0453	10	0.34782	T	0.22	-21.3941	16.2626	0.82553	0.0:1.0:0.0:0.0	.	486	O14654	IRS4_HUMAN	N	486	ENSP00000361202:D486N	ENSP00000361202:D486N	D	-	1	0	IRS4	107864775	0.958000	0.32768	0.888000	0.34837	0.680000	0.39746	2.118000	0.41949	2.217000	0.71921	0.596000	0.82720	GAC		0.577	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1		NM_003604		7	78	0	0	0	0.004482	0	7	78		
IRS4	8471	broad.mit.edu	37	X	107978140	107978140	+	Missense_Mutation	SNP	C	C	G			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:107978140C>G	ENST00000372129.2	-	1	1511	c.1435G>C	c.(1435-1437)Gat>Cat	p.D479H	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	479					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						CCTTCCTGATCTTCTTTGCCC	0.577																																						uc004eoc.2		NaN																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1435-1437)GAT>CAT		insulin receptor substrate 4							122.0	111.0	115.0					X																	107978140		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107978140C>G	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1435G>C	X.37:g.107978140C>G	ENSP00000361202:p.Asp479His						p.D479H	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1468	-			479						Missense_Mutation	SNP	ENST00000372129.2	37	c.1435G>C	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	1.234	-0.623351	0.03636	.	.	ENSG00000133124	ENST00000372129	T	0.34667	1.35	4.19	-1.87	0.07737	.	1.694980	0.03477	N	0.214512	T	0.20414	0.0491	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.25813	-1.0121	10	0.46703	T	0.11	2.3577	7.9989	0.30284	0.1279:0.191:0.0:0.6811	.	479	O14654	IRS4_HUMAN	H	479	ENSP00000361202:D479H	ENSP00000361202:D479H	D	-	1	0	IRS4	107864796	0.000000	0.05858	0.000000	0.03702	0.141000	0.21300	-1.072000	0.03434	-0.540000	0.06265	-0.197000	0.12766	GAT		0.577	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1		NM_003604		9	64	0	0	0	0.010729	0	9	64		
IRS4	8471	broad.mit.edu	37	X	107978233	107978233	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:107978233C>T	ENST00000372129.2	-	1	1418	c.1342G>A	c.(1342-1344)Gaa>Aaa	p.E448K	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	448					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						TTCGGGGCTTCTGCAGGGTGC	0.612																																						uc004eoc.2		NaN																	0				ovary(4)|large_intestine(2)|lung(1)|breast(1)|skin(1)|pancreas(1)	10						c.(1342-1344)GAA>AAA		insulin receptor substrate 4							69.0	68.0	68.0					X																	107978233		2203	4300	6503	SO:0001583	missense	8471					plasma membrane	insulin receptor binding|SH3/SH2 adaptor activity|signal transducer activity	g.chrX:107978233C>T	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1342G>A	X.37:g.107978233C>T	ENSP00000361202:p.Glu448Lys						p.E448K	NM_003604	NP_003595	O14654	IRS4_HUMAN			1	1375	-			448						Missense_Mutation	SNP	ENST00000372129.2	37	c.1342G>A	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	C	7.986	0.752173	0.15778	.	.	ENSG00000133124	ENST00000372129	T	0.35236	1.32	4.03	3.17	0.36434	.	1.479720	0.04117	N	0.315631	T	0.26666	0.0652	N	0.24115	0.695	0.20196	N	0.99993	B	0.02656	0.0	B	0.04013	0.001	T	0.14924	-1.0455	10	0.07325	T	0.83	-1.0536	12.0959	0.53755	0.0:0.9119:0.0:0.0881	.	448	O14654	IRS4_HUMAN	K	448	ENSP00000361202:E448K	ENSP00000361202:E448K	E	-	1	0	IRS4	107864889	0.954000	0.32549	0.073000	0.20177	0.106000	0.19336	2.833000	0.48159	1.078000	0.41014	-0.195000	0.12781	GAA		0.612	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1		NM_003604		6	59	0	0	0	0.001168	0	6	59		
GDI1	2664	broad.mit.edu	37	X	153668396	153668396	+	Missense_Mutation	SNP	C	C	T			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chrX:153668396C>T	ENST00000447750.2	+	5	832	c.497C>T	c.(496-498)aCc>aTc	p.T166I		NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	166					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCCAGACTACCAGCATGCGT	0.552																																						uc004fli.3		NaN																	0					0						c.(496-498)ACC>ATC		GDP dissociation inhibitor 1							325.0	298.0	307.0					X																	153668396		2203	4300	6503	SO:0001583	missense	2664				protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding	g.chrX:153668396C>T	X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.497C>T	X.37:g.153668396C>T	ENSP00000394071:p.Thr166Ile					GDI1_uc011mzo.1_Missense_Mutation_p.T166I|GDI1_uc004flj.2_5'Flank	p.T166I	NM_001493	NP_001484	P31150	GDIA_HUMAN			5	839	+	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)		166					P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Missense_Mutation	SNP	ENST00000447750.2	37	c.497C>T	CCDS35452.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427459	0.62733	.	.	ENSG00000203879	ENST00000447750;ENST00000369741	T	0.58652	0.32	4.78	4.78	0.61160	.	0.096944	0.64402	D	0.000001	T	0.59555	0.2202	L	0.48986	1.54	0.80722	D	1	B;B	0.31817	0.341;0.043	B;B	0.42522	0.39;0.242	T	0.58907	-0.7553	10	0.35671	T	0.21	-10.0428	14.161	0.65446	0.0:1.0:0.0:0.0	.	166;166	B4DH24;P31150	.;GDIA_HUMAN	I	166;150	ENSP00000394071:T166I	ENSP00000358756:T150I	T	+	2	0	GDI1	153321590	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	5.891000	0.69782	2.212000	0.71576	0.529000	0.55759	ACC		0.552	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081649.2		NM_001493		6	290	0	0	0	0.004482	0	6	290		
CRACR2B	283229	broad.mit.edu	37	11	831640	831642	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr11:831640_831642delCTG	ENST00000525077.1	+	9	1232_1234	c.1131_1133delCTG	c.(1129-1134)acctgc>acc	p.C383del	AP006621.8_ENST00000532946.1_RNA|CD151_ENST00000397420.3_5'Flank|CD151_ENST00000322008.4_5'Flank|CD151_ENST00000397421.1_5'Flank|EFCAB4A_ENST00000528542.2_3'UTR|EFCAB4A_ENST00000450448.1_3'UTR			Q8N4Y2	EFC4A_HUMAN		383	Cys-rich.				cellular protein localization (GO:0034613)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGGGCCCACCTGCTGCTGCTGC	0.695																																						uc001lrv.2		NaN																	0					0						c.(1129-1134)ACCTGC>ACC		RecName: Full=EF-hand calcium-binding domain-containing protein 4A;																																				SO:0001651	inframe_deletion	283229				store-operated calcium entry		calcium ion binding	g.chr11:831640_831642delCTG																												ENST00000525077.1:c.1131_1133delCTG	11.37:g.831649_831651delCTG	ENSP00000435299:p.Cys383del					EFCAB4A_uc009ycm.1_3'UTR|EFCAB4A_uc001lrw.2_In_Frame_Del_p.C448del|CD151_uc001lrx.2_5'Flank|CD151_uc001lry.2_5'Flank|CD151_uc001lrz.2_5'Flank|CD151_uc001lsa.2_5'Flank|CD151_uc001lsb.2_5'Flank	p.C383del			Q8N4Y2	EFC4A_HUMAN		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	9	1509_1511	+		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)	383			Cys-rich.		D5LPR2|Q8NBW8	In_Frame_Del	DEL	ENST00000525077.1	37	c.1131_1133delCTG																																																																																					0.695	EFCAB4A-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000383097.1				3	5	NaN	NaN	NaN	NaN	NaN	3	5	---	---
ADAMTS2	9509	broad.mit.edu	37	5	178772259	178772260	+	In_Frame_Ins	INS	-	-	GCA	rs568040559|rs372468383|rs193247334	byFrequency	TCGA-DK-A3IV-01A-22D-A21A-08	TCGA-DK-A3IV-10A-01D-A21A-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7cecfbbc-5fe4-4413-95fd-07533aacbb73	e7fdb6f5-7d5a-4f7f-b1bb-48481bfca5a2	g.chr5:178772259_178772260insGCA	ENST00000251582.7	-	1	171_172	c.70_71insTGC	c.(70-72)ccg>cTGCcg	p.23_24insL	ADAMTS2_ENST00000274609.5_In_Frame_Ins_p.23_24insL	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	23					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		gagcggcggcggcagcagcagc	0.812														904	0.180511	0.1135	0.1354	5008	,	,		3151	0.2718		0.1382	False		,,,				2504	0.2526					uc003mjw.2		NaN																	0				large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						c.(70-72)CCG>CTGCCG		ADAM metallopeptidase with thrombospondin type 1																																				SO:0001652	inframe_insertion	9509				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding	g.chr5:178772259_178772260insGCA	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.68_70dupTGC	5.37:g.178772266_178772268dupGCA	ENSP00000251582:p.Leu23_Leu23dup					ADAMTS2_uc011dgm.1_In_Frame_Ins_p.23_24insL	p.23_24insL	NM_014244	NP_055059	O95450	ATS2_HUMAN	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)	1	70_71	-	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	23_24						In_Frame_Ins	INS	ENST00000251582.7	37	c.70_71insTGC	CCDS4444.1																																																																																				0.812	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1		NM_014244		5	4	NaN	NaN	NaN	NaN	NaN	5	4	---	---
