#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACRC	93953	genome.wustl.edu	37	X	70832365	70832365	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chrX:70832365G>C	ENST00000373695.1	+	11	2448	c.1911G>C	c.(1909-1911)aaG>aaC	p.K637N	ACRC_ENST00000373696.3_Missense_Mutation_p.K637N|ACRC_ENST00000471950.1_3'UTR			Q96QF7	ACRC_HUMAN	acidic repeat containing	637	SprT-like.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					ATAACTATAAGATTAACTACA	0.468																																						dbGAP											0													68.0	59.0	62.0					X																	70832365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.1911G>C	X.37:g.70832365G>C	ENSP00000362799:p.Lys637Asn		B9EG62	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain	p.K637N	ENST00000373695.1	37	c.1911	CCDS35326.1	X	.	.	.	.	.	.	.	.	.	.	G	12.73	2.026863	0.35797	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.42900	0.96;0.96	4.84	-0.102	0.13613	Domain of unknown function SprT-like (2);	.	.	.	.	T	0.42337	0.1198	L	0.47716	1.5	0.28734	N	0.902359	D	0.59357	0.985	P	0.54401	0.751	T	0.34428	-0.9829	9	0.33940	T	0.23	.	5.7997	0.18408	0.266:0.1532:0.5809:0.0	.	637	Q96QF7	ACRC_HUMAN	N	637	ENSP00000362800:K637N;ENSP00000362799:K637N	ENSP00000362799:K637N	K	+	3	2	ACRC	70749090	1.000000	0.71417	0.947000	0.38551	0.103000	0.19146	1.771000	0.38542	-0.019000	0.14055	0.292000	0.19580	AAG	ACRC	-	pfam_SprT-like_domain,smart_SprT-like_domain	ENSG00000147174		0.468	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACRC	HGNC	protein_coding	OTTHUMT00000081856.1	62	0.00	0	G			70832365	70832365	+1	no_errors	ENST00000373695	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.999	C
ADAM33	80332	genome.wustl.edu	37	20	3649953	3649953	+	Missense_Mutation	SNP	G	G	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr20:3649953G>T	ENST00000356518.2	-	21	2638	c.2397C>A	c.(2395-2397)gaC>gaA	p.D799E	ADAM33_ENST00000379861.4_Missense_Mutation_p.D799E|ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000350009.2_Missense_Mutation_p.D773E	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33	799					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						TACCTTGGGGGTCAGGCGAGA	0.582																																						dbGAP											0													44.0	47.0	46.0					20																	3649953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.2397C>A	20.37:g.3649953G>T	ENSP00000348912:p.Asp799Glu		A0A1K6|Q5JT75|Q5JT76|Q8N0W6	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D799E	ENST00000356518.2	37	c.2397	CCDS13058.1	20	.	.	.	.	.	.	.	.	.	.	G	6.678	0.493638	0.12702	.	.	ENSG00000149451	ENST00000356518;ENST00000379861;ENST00000350009;ENST00000439201	T;T;T	0.01430	4.9;4.9;4.91	4.61	-8.16	0.01061	.	.	.	.	.	T	0.00695	0.0023	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.22346	0.007;0.004;0.004;0.068	B;B;B;B	0.15052	0.003;0.001;0.001;0.012	T	0.49818	-0.8899	9	0.02654	T	1	.	2.3422	0.04263	0.5082:0.0961:0.136:0.2597	.	773;799;799;679	Q9BZ11-2;Q9BZ11;A2A2L3;Q08AM2	.;ADA33_HUMAN;.;.	E	799;799;773;679	ENSP00000348912:D799E;ENSP00000369190:D799E;ENSP00000322550:D773E	ENSP00000322550:D773E	D	-	3	2	ADAM33	3597953	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.732000	0.04904	-1.523000	0.01767	-1.036000	0.02392	GAC	ADAM33	-	NULL	ENSG00000149451		0.582	ADAM33-001	KNOWN	basic|CCDS	protein_coding	ADAM33	HGNC	protein_coding	OTTHUMT00000077763.2	62	0.00	0	G	NM_025220		3649953	3649953	-1	no_errors	ENST00000356518	ensembl	human	known	69_37n	missense	34	34.62	18	SNP	0.000	T
AKAP9	10142	genome.wustl.edu	37	7	91631496	91631497	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr7:91631496_91631497delAG	ENST00000359028.2	+	9	2526_2527	c.2301_2302delAG	c.(2299-2304)ttagaafs	p.E768fs	AKAP9_ENST00000358100.2_Frame_Shift_Del_p.E768fs|AKAP9_ENST00000356239.3_Frame_Shift_Del_p.E756fs			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	768	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CAGAATTGTTAGAAAAACAGAT	0.297			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0																																										-	-	-	SO:0001589	frameshift_variant	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.2301_2302delAG	7.37:g.91631496_91631497delAG	ENSP00000351922:p.Glu768fs		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Frame_Shift_Del	DEL	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.E768fs	ENST00000359028.2	37	c.2301_2302		7																																																																																			AKAP9	-	NULL	ENSG00000127914		0.297	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		36	0.00	0	AG	NM_005751		91631496	91631497	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	frame_shift_del	19	24.00	6	DEL	1.000:1.000	-
APLP2	334	genome.wustl.edu	37	11	129993589	129993589	+	Silent	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr11:129993589C>T	ENST00000263574.5	+	7	1077	c.1005C>T	c.(1003-1005)tgC>tgT	p.C335C	APLP2_ENST00000345598.5_Intron|APLP2_ENST00000543137.1_Silent_p.C242C|APLP2_ENST00000539648.1_Intron|APLP2_ENST00000338167.5_Silent_p.C335C|APLP2_ENST00000528499.1_Intron|APLP2_ENST00000278756.7_Silent_p.C345C	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	335	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.				cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		AGGGAAAGTGCGTGCGCTTTA	0.547																																						dbGAP											0													129.0	123.0	125.0					11																	129993589		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.1005C>T	11.37:g.129993589C>T			B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Silent	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.C335	ENST00000263574.5	37	c.1005	CCDS8486.1	11																																																																																			APLP2	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000084234		0.547	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APLP2	HGNC	protein_coding	OTTHUMT00000386109.1	66	0.00	0	C	NM_001642		129993589	129993589	+1	no_errors	ENST00000263574	ensembl	human	known	69_37n	silent	34	22.22	10	SNP	1.000	T
ARHGAP31	57514	genome.wustl.edu	37	3	119133124	119133124	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr3:119133124C>G	ENST00000264245.4	+	12	2880	c.2348C>G	c.(2347-2349)cCt>cGt	p.P783R		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	783	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CCACTCCCACCTGCTCCTCCC	0.552																																					Pancreas(7;176 297 5394 51128 51241)	dbGAP											0													52.0	55.0	54.0					3																	119133124		1932	4129	6061	-	-	-	SO:0001583	missense	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2348C>G	3.37:g.119133124C>G	ENSP00000264245:p.Pro783Arg		Q9ULL6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P783R	ENST00000264245.4	37	c.2348	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287413	0.59976	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.05996	3.36	4.44	4.44	0.53790	.	0.228548	0.32190	N	0.006446	T	0.12390	0.0301	L	0.32530	0.975	0.36186	D	0.849723	D	0.62365	0.991	P	0.60949	0.881	T	0.03887	-1.0995	10	0.45353	T	0.12	.	12.1847	0.54231	0.1707:0.8293:0.0:0.0	.	783	Q2M1Z3	RHG31_HUMAN	R	783	ENSP00000264245:P783R	ENSP00000264245:P783R	P	+	2	0	ARHGAP31	120615814	0.996000	0.38824	0.998000	0.56505	0.880000	0.50808	4.427000	0.59888	2.757000	0.94681	0.655000	0.94253	CCT	ARHGAP31	-	NULL	ENSG00000031081		0.552	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	23	0.00	0	C			119133124	119133124	+1	no_errors	ENST00000264245	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.985	G
C6orf136	221545	genome.wustl.edu	37	6	30613843	30613843	+	5'Flank	SNP	G	G	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr6:30613843G>C	ENST00000376473.5	+	0	0				ATAT1_ENST00000376485.4_Splice_Site|C6orf136_ENST00000293604.6_5'Flank|ATAT1_ENST00000468713.1_Splice_Site|ATAT1_ENST00000330083.5_Splice_Site|C6orf136_ENST00000376471.4_5'Flank|ATAT1_ENST00000376478.2_Splice_Site|AL662800.2_ENST00000583820.1_RNA	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						TATTTCCACAGGCAACCAAGA	0.493																																						dbGAP											0													83.0	82.0	83.0					6																	30613843		1953	4150	6103	-	-	-	SO:0001631	upstream_gene_variant	0			BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221		6.37:g.30613843G>C	Exception_encountered		A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Splice_Site	SNP	-	e12-1	ENST00000376473.5	37	c.1049-1	CCDS43443.1	6	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430455	0.62844	.	.	ENSG00000137343	ENST00000376485;ENST00000376478;ENST00000330083	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9841	0.64324	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATAT1	30721822	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.426000	0.59882	2.460000	0.83146	0.557000	0.71058	.	ATAT1	-	-	ENSG00000137343		0.493	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAT1	HGNC	protein_coding	OTTHUMT00000076457.4	70	0.00	0	G	NM_145029		30613843	30613843	+1	no_errors	ENST00000376485	ensembl	human	known	69_37n	splice_site	51	32.89	25	SNP	1.000	C
BPTF	2186	genome.wustl.edu	37	17	65850252	65850252	+	Silent	SNP	T	T	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr17:65850252T>C	ENST00000321892.4	+	2	871	c.810T>C	c.(808-810)ttT>ttC	p.F270F	BPTF_ENST00000306378.6_Silent_p.F270F|BPTF_ENST00000335221.5_Silent_p.F270F|BPTF_ENST00000424123.3_Silent_p.F131F			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	270	DDT. {ECO:0000255|PROSITE- ProRule:PRU00063}.				anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			TTGAGGACTTTTGTGCAGCTC	0.443																																						dbGAP											0													140.0	126.0	131.0					17																	65850252		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.810T>C	17.37:g.65850252T>C			Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.F270	ENST00000321892.4	37	c.810		17																																																																																			BPTF	-	pfam_DDT_dom,smart_DDT_dom_subgr,pfscan_DDT_dom_superfamily	ENSG00000171634		0.443	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		83	0.00	0	T	NM_182641, NM_004459		65850252	65850252	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	silent	65	15.58	12	SNP	0.999	C
C4BPA	722	genome.wustl.edu	37	1	207317171	207317171	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr1:207317171C>T	ENST00000367070.3	+	11	1647	c.1453C>T	c.(1453-1455)Cgg>Tgg	p.R485W		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	485	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						AGCTCTGTGTCGGAAACCAGA	0.368																																						dbGAP											0													161.0	147.0	152.0					1																	207317171		2203	4300	6503	-	-	-	SO:0001583	missense	0			M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.1453C>T	1.37:g.207317171C>T	ENSP00000356037:p.Arg485Trp		Q5VVQ8	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R485W	ENST00000367070.3	37	c.1453	CCDS1477.1	1	.	.	.	.	.	.	.	.	.	.	C	14.48	2.549305	0.45383	.	.	ENSG00000123838	ENST00000367070	T	0.65916	-0.18	5.29	-1.32	0.09201	Complement control module (2);Sushi/SCR/CCP (3);	3.229310	0.00837	N	0.001707	T	0.64692	0.2621	L	0.52573	1.65	0.09310	N	1	P	0.41643	0.758	P	0.51453	0.67	T	0.49670	-0.8915	10	0.66056	D	0.02	.	1.6973	0.02865	0.2527:0.361:0.2372:0.1491	.	485	P04003	C4BPA_HUMAN	W	485	ENSP00000356037:R485W	ENSP00000356037:R485W	R	+	1	2	C4BPA	205383794	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	-0.306000	0.08178	-0.434000	0.07275	-0.969000	0.02612	CGG	C4BPA	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000123838		0.368	C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4BPA	HGNC	protein_coding	OTTHUMT00000088089.3	119	0.83	1	C			207317171	207317171	+1	no_errors	ENST00000367070	ensembl	human	known	69_37n	missense	102	16.39	20	SNP	0.000	T
CABYR	26256	genome.wustl.edu	37	18	21735836	21735836	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr18:21735836C>T	ENST00000399496.3	+	4	536	c.371C>T	c.(370-372)tCa>tTa	p.S124L	CABYR_ENST00000581397.1_Missense_Mutation_p.S124L|CABYR_ENST00000327201.6_Missense_Mutation_p.S26L|CABYR_ENST00000415309.2_Missense_Mutation_p.S124L|CABYR_ENST00000399481.2_Missense_Mutation_p.S26L|CABYR_ENST00000399499.1_Missense_Mutation_p.S124L	NM_012189.2|NM_153769.1	NP_036321.2|NP_722453.1	O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	124					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					CAGTTTCCATCAGTTTATGCT	0.468																																						dbGAP											0													130.0	106.0	114.0					18																	21735836		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399496.3:c.371C>T	18.37:g.21735836C>T	ENSP00000382419:p.Ser124Leu		B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Missense_Mutation	SNP	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b	p.S124L	ENST00000399496.3	37	c.371	CCDS42420.1	18	.	.	.	.	.	.	.	.	.	.	C	16.61	3.172377	0.57584	.	.	ENSG00000154040	ENST00000399496;ENST00000415309;ENST00000399481;ENST00000327201;ENST00000399499	T;T;T;T	0.57436	0.4;0.97;1.19;0.4	5.95	5.95	0.96441	.	0.299066	0.24828	N	0.035262	T	0.68714	0.3031	L	0.54323	1.7	0.38049	D	0.935719	D;D;P;D	0.76494	0.992;0.989;0.775;0.999	P;P;B;D	0.68765	0.838;0.882;0.356;0.96	T	0.71787	-0.4487	10	0.87932	D	0	-2.6944	17.2969	0.87172	0.0:1.0:0.0:0.0	.	106;124;124;124	O75952-2;O75952-4;O75952-3;O75952	.;.;.;CABYR_HUMAN	L	124;124;26;26;124	ENSP00000382419:S124L;ENSP00000399973:S124L;ENSP00000382404:S26L;ENSP00000382421:S124L	ENSP00000317095:S26L	S	+	2	0	CABYR	19989834	0.951000	0.32395	0.754000	0.31244	0.081000	0.17604	2.113000	0.41902	2.822000	0.97130	0.563000	0.77884	TCA	CABYR	-	NULL	ENSG00000154040		0.468	CABYR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CABYR	HGNC	protein_coding	OTTHUMT00000090926.2	55	0.00	0	C	NM_153770		21735836	21735836	+1	no_errors	ENST00000463087	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	0.984	T
CDC6	990	genome.wustl.edu	37	17	38457154	38457154	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr17:38457154G>C	ENST00000209728.4	+	10	1795	c.1324G>C	c.(1324-1326)Gat>Cat	p.D442H	CTD-2267D19.6_ENST00000602403.1_lincRNA	NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	442					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						CTCAGAAGTTGATGGTAACAG	0.428																																						dbGAP											0													217.0	193.0	202.0					17																	38457154		2203	4300	6503	-	-	-	SO:0001583	missense	0			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.1324G>C	17.37:g.38457154G>C	ENSP00000209728:p.Asp442His		Q8TB30	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6	p.D442H	ENST00000209728.4	37	c.1324	CCDS11365.1	17	.	.	.	.	.	.	.	.	.	.	G	15.22	2.770021	0.49680	.	.	ENSG00000094804	ENST00000209728	T	0.41758	0.99	5.96	3.88	0.44766	.	0.108387	0.64402	D	0.000004	T	0.24812	0.0602	L	0.33485	1.01	0.39188	D	0.962916	P	0.42735	0.788	B	0.36719	0.231	T	0.06356	-1.0831	10	0.18276	T	0.48	-12.2492	6.6019	0.22705	0.0906:0.0:0.5785:0.3309	.	442	Q99741	CDC6_HUMAN	H	442	ENSP00000209728:D442H	ENSP00000209728:D442H	D	+	1	0	CDC6	35710680	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	4.300000	0.59079	1.537000	0.49254	0.655000	0.94253	GAT	CDC6	-	pirsf_Cell_div_Cdc6	ENSG00000094804		0.428	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	HGNC	protein_coding	OTTHUMT00000257129.1	49	0.00	0	G			38457154	38457154	+1	no_errors	ENST00000209728	ensembl	human	known	69_37n	missense	351	10.69	42	SNP	1.000	C
CDC6	990	genome.wustl.edu	37	17	38458209	38458209	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr17:38458209G>C	ENST00000209728.4	+	12	2110	c.1639G>C	c.(1639-1641)Gat>Cat	p.D547H	CTD-2267D19.6_ENST00000602403.1_lincRNA	NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	547					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						TGCTCTGAAAGATAAAGCTTT	0.373																																						dbGAP											0													103.0	107.0	106.0					17																	38458209		2203	4300	6503	-	-	-	SO:0001583	missense	0			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.1639G>C	17.37:g.38458209G>C	ENSP00000209728:p.Asp547His		Q8TB30	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6	p.D547H	ENST00000209728.4	37	c.1639	CCDS11365.1	17	.	.	.	.	.	.	.	.	.	.	G	23.4	4.408530	0.83340	.	.	ENSG00000094804	ENST00000209728	T	0.48522	0.81	5.76	5.76	0.90799	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.046134	0.85682	D	0.000000	T	0.68988	0.3061	M	0.71581	2.175	0.58432	D	0.99999	D	0.89917	1.0	D	0.68765	0.96	T	0.70171	-0.4945	10	0.87932	D	0	-8.0163	19.0945	0.93244	0.0:0.0:1.0:0.0	.	547	Q99741	CDC6_HUMAN	H	547	ENSP00000209728:D547H	ENSP00000209728:D547H	D	+	1	0	CDC6	35711735	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.313000	0.78978	2.882000	0.98803	0.655000	0.94253	GAT	CDC6	-	pirsf_Cell_div_Cdc6	ENSG00000094804		0.373	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	HGNC	protein_coding	OTTHUMT00000257129.1	88	0.00	0	G			38458209	38458209	+1	no_errors	ENST00000209728	ensembl	human	known	69_37n	missense	434	12.85	64	SNP	1.000	C
CDS2	8760	genome.wustl.edu	37	20	5165585	5165585	+	Silent	SNP	C	C	A			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr20:5165585C>A	ENST00000460006.1	+	8	1060	c.753C>A	c.(751-753)ctC>ctA	p.L251L	CDS2_ENST00000535100.1_Silent_p.L72L|CDS2_ENST00000379062.4_Silent_p.L131L|CDS2_ENST00000379070.3_3'UTR	NM_003818.3	NP_003809.1	O95674	CDS2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 2	251					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	phosphatidate cytidylyltransferase activity (GO:0004605)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|stomach(1)	14						GGACCCCACTCATCAAGGTAA	0.438																																						dbGAP											0													268.0	227.0	241.0					20																	5165585		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF069532	CCDS13088.1	20p13	2006-03-28			ENSG00000101290	ENSG00000101290	2.7.7.41		1801	protein-coding gene	gene with protein product		603549				9806839, 9889000	Standard	NM_003818		Approved		uc002wls.3	O95674	OTTHUMG00000031801	ENST00000460006.1:c.753C>A	20.37:g.5165585C>A			B2RDC6|D3DW04|Q5TDY2|Q5TDY3|Q5TDY4|Q5TDY5|Q9BYK5|Q9NTT2	Silent	SNP	pfam_PC_trans,pirsf_PC_Trfase_euk	p.L251	ENST00000460006.1	37	c.753	CCDS13088.1	20																																																																																			CDS2	-	pfam_PC_trans,pirsf_PC_Trfase_euk	ENSG00000101290		0.438	CDS2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CDS2	HGNC	protein_coding	OTTHUMT00000077858.2	118	0.00	0	C			5165585	5165585	+1	no_errors	ENST00000460006	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	1.000	A
CLECL1	160365	genome.wustl.edu	37	12	9885586	9885586	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr12:9885586C>T	ENST00000327839.3	-	1	309	c.275G>A	c.(274-276)cGg>cAg	p.R92Q		NM_172004.3	NP_742001.1	Q8IZS7	CLCL1_HUMAN	C-type lectin-like 1	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|kidney(1)|large_intestine(4)|lung(3)	9						CGGGGAAGTCCGAACAGTTTT	0.418																																						dbGAP											0													73.0	77.0	76.0					12																	9885586		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF518873	CCDS8603.1, CCDS73441.1	12p13.31	2007-06-21				ENSG00000184293			24462	protein-coding gene	gene with protein product	"""dendritic cell associated lectin 1"""	607467				12421943	Standard	NM_172004		Approved	DCAL1	uc001qwi.3	Q8IZS7		ENST00000327839.3:c.275G>A	12.37:g.9885586C>T	ENSP00000331766:p.Arg92Gln			Missense_Mutation	SNP	superfamily_C-type_lectin_fold	p.R92Q	ENST00000327839.3	37	c.275	CCDS8603.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.684|9.684	1.150125|1.150125	0.21371|0.21371	.|.	.|.	ENSG00000184293|ENSG00000184293	ENST00000542530|ENST00000327839	.|T	.|0.49432	.|0.78	1.74|1.74	-0.635|-0.635	0.11512|0.11512	.|.	.|.	.|.	.|.	.|.	T|T	0.29850|0.29850	0.0746|0.0746	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	.|B	.|0.28419	.|0.211	.|B	.|0.10450	.|0.005	T|T	0.13683|0.13683	-1.0500|-1.0500	5|8	.|.	.|.	.|.	.|.	4.1913|4.1913	0.10422|0.10422	0.0:0.4497:0.0:0.5503|0.0:0.4497:0.0:0.5503	.|.	.|92	.|Q8IZS7	.|CLCL1_HUMAN	R|Q	44|92	.|ENSP00000331766:R92Q	.|.	G|R	-|-	1|2	0|0	CLECL1|CLECL1	9776853|9776853	0.000000|0.000000	0.05858|0.05858	0.003000|0.003000	0.11579|0.11579	0.007000|0.007000	0.05969|0.05969	-0.398000|-0.398000	0.07259|0.07259	-0.183000|-0.183000	0.10585|0.10585	-0.148000|-0.148000	0.13756|0.13756	GGA|CGG	CLECL1	-	NULL	ENSG00000184293		0.418	CLECL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLECL1	HGNC	protein_coding	OTTHUMT00000399815.1	37	0.00	0	C	NM_172004		9885586	9885586	-1	no_errors	ENST00000327839	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.006	T
DNAAF3	352909	genome.wustl.edu	37	19	55677342	55677342	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr19:55677342C>G	ENST00000524407.2	-	3	145	c.112G>C	c.(112-114)Gcc>Ccc	p.A38P	DNAAF3_ENST00000391720.4_Missense_Mutation_p.A85P|CTD-2587H24.5_ENST00000591665.1_RNA|DNAAF3_ENST00000527223.2_Missense_Mutation_p.A106P|snoU13_ENST00000459370.1_RNA|DNAAF3_ENST00000455045.1_5'Flank			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	38					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											ACTGTATCGGCCTGGGAGTCT	0.607											OREG0025679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													50.0	58.0	55.0					19																	55677342		2072	4218	6290	-	-	-	SO:0001583	missense	0			AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.112G>C	19.37:g.55677342C>G	ENSP00000432046:p.Ala38Pro	1009	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	NULL	p.A106P	ENST00000524407.2	37	c.316	CCDS59422.1	19	.	.	.	.	.	.	.	.	.	.	C	14.11	2.436329	0.43224	.	.	ENSG00000167646	ENST00000301249;ENST00000391720;ENST00000528476	T	0.19250	2.16	3.35	2.28	0.28536	.	0.680982	0.13663	N	0.371465	T	0.15825	0.0381	N	0.14661	0.345	0.21499	N	0.999665	P;P;P	0.52061	0.899;0.95;0.899	P;P;B	0.48227	0.571;0.55;0.367	T	0.10683	-1.0619	10	0.39692	T	0.17	-6.497	9.3789	0.38301	0.2243:0.7757:0.0:0.0	.	106;59;38	E9PAX5;Q8N9W5-3;Q8N9W5	.;.;CS051_HUMAN	P	106;85;106	ENSP00000375600:A85P	ENSP00000301249:A106P	A	-	1	0	C19orf51	60369154	0.000000	0.05858	0.004000	0.12327	0.024000	0.10985	0.375000	0.20518	0.920000	0.36970	0.561000	0.74099	GCC	DNAAF3	-	NULL	ENSG00000167646		0.607	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DNAAF3	HGNC	protein_coding	OTTHUMT00000250388.5	36	0.00	0	C	NM_178837		55677342	55677342	-1	no_errors	ENST00000527223	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.004	G
DNAH12	201625	genome.wustl.edu	37	3	57419477	57419477	+	Silent	SNP	A	A	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr3:57419477A>G	ENST00000351747.2	-	31	4845	c.4665T>C	c.(4663-4665)aaT>aaC	p.N1555N		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1555	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						AGCCATGTTCATTCATTAAAG	0.383																																						dbGAP											0													189.0	168.0	175.0					3																	57419477		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.4665T>C	3.37:g.57419477A>G			A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.N1555	ENST00000351747.2	37	c.4665		3																																																																																			DNAH12	-	pfam_ATPase_dyneun-rel_AAA	ENSG00000174844		0.383	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		126	0.00	0	A	NM_178504		57419477	57419477	-1	no_errors	ENST00000351747	ensembl	human	known	69_37n	silent	31	38.00	19	SNP	0.998	G
DNAH5	1767	genome.wustl.edu	37	5	13865914	13865914	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr5:13865914C>A	ENST00000265104.4	-	27	4322	c.4218G>T	c.(4216-4218)aaG>aaT	p.K1406N	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1406	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K1406N(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTAGTTGCTTCTTTATTTCAA	0.343									Kartagener syndrome																													dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											50.0	54.0	52.0					5																	13865914		2202	4299	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.4218G>T	5.37:g.13865914C>A	ENSP00000265104:p.Lys1406Asn		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.K1406N	ENST00000265104.4	37	c.4218	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	18.36	3.605872	0.66445	.	.	ENSG00000039139	ENST00000265104	T	0.62105	0.05	5.88	3.13	0.36017	Dynein heavy chain, domain-2 (1);	0.061993	0.64402	D	0.000001	T	0.77558	0.4148	M	0.85630	2.765	0.50039	D	0.999845	D	0.63046	0.992	D	0.69654	0.965	T	0.78763	-0.2077	10	0.72032	D	0.01	.	9.5253	0.39160	0.0:0.7339:0.0:0.2661	.	1406	Q8TE73	DYH5_HUMAN	N	1406	ENSP00000265104:K1406N	ENSP00000265104:K1406N	K	-	3	2	DNAH5	13918914	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.603000	0.24149	0.843000	0.35070	0.637000	0.83480	AAG	DNAH5	-	pfam_Dynein_heavy_dom-2	ENSG00000039139		0.343	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	58	0.00	0	C	NM_001369		13865914	13865914	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	missense	63	10.00	7	SNP	1.000	A
DNM3	26052	genome.wustl.edu	37	1	172011231	172011231	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr1:172011231G>A	ENST00000355305.5	+	8	1232	c.1075G>A	c.(1075-1077)Ggt>Agt	p.G359S	DNM3_ENST00000367731.1_Missense_Mutation_p.G359S|DNM3_ENST00000358155.4_Missense_Mutation_p.G359S|DNM3_ENST00000520906.1_Missense_Mutation_p.G359S|DNM3_ENST00000367733.2_Missense_Mutation_p.G359S			Q9UQ16	DYN3_HUMAN	dynamin 3	359					endocytosis (GO:0006897)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|synapse assembly (GO:0007416)	dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(9)|lung(16)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						ACTCTCAGGTGGTGCTAAAAT	0.373																																						dbGAP											0													153.0	149.0	150.0					1																	172011231		1834	4081	5915	-	-	-	SO:0001583	missense	0			AL136712	CCDS44276.1, CCDS60356.1	1q24.1	2013-01-10			ENSG00000197959	ENSG00000197959		"""Pleckstrin homology (PH) domain containing"""	29125	protein-coding gene	gene with protein product	"""Dyna III"""	611445				10048485	Standard	NM_015569		Approved	KIAA0820	uc001gie.4	Q9UQ16	OTTHUMG00000034913	ENST00000355305.5:c.1075G>A	1.37:g.172011231G>A	ENSP00000347457:p.Gly359Ser		A9Z1Y1|O14982|O95555|Q1MTM8|Q5W129|Q6P2G1|Q9H0P3|Q9H548|Q9NQ68|Q9NQN6	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.G359S	ENST00000355305.5	37	c.1075		1	.	.	.	.	.	.	.	.	.	.	G	35	5.562871	0.96527	.	.	ENSG00000197959	ENST00000359070;ENST00000358155;ENST00000367733;ENST00000355305;ENST00000367731;ENST00000520906;ENST00000523513	T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19;-1.19	5.65	5.65	0.86999	.	0.049142	0.85682	D	0.000000	D	0.91875	0.7428	H	0.97103	3.94	0.80722	D	1	D;D;D;D	0.89917	1.0;0.992;0.984;0.998	D;D;D;D	0.87578	0.998;0.947;0.927;0.992	D	0.94040	0.7308	10	0.87932	D	0	.	18.2887	0.90122	0.0:0.0:1.0:0.0	.	359;359;359;359	E5RHK8;Q9UQ16-2;Q9UQ16-3;Q6P2G1	.;.;.;.	S	359;359;359;359;359;359;249	ENSP00000350876:G359S;ENSP00000356707:G359S;ENSP00000347457:G359S;ENSP00000356705:G359S;ENSP00000429701:G359S;ENSP00000429416:G249S	ENSP00000347457:G359S	G	+	1	0	DNM3	170277854	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.669000	0.90835	0.491000	0.48974	GGT	DNM3	-	pfam_Dynamin_central	ENSG00000197959		0.373	DNM3-003	NOVEL	not_organism_supported|basic	protein_coding	DNM3	HGNC	protein_coding	OTTHUMT00000084531.1	120	0.00	0	G	NM_015569		172011231	172011231	+1	no_errors	ENST00000358155	ensembl	human	known	69_37n	missense	28	58.82	40	SNP	1.000	A
DPCR1	135656	genome.wustl.edu	37	6	30917380	30917380	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr6:30917380C>T	ENST00000462446.1	+	2	1167	c.1139C>T	c.(1138-1140)cCt>cTt	p.P380L	DPCR1_ENST00000304311.2_5'UTR|HCG21_ENST00000419481.1_RNA			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	285	Thr-rich.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						CCAGCAGAGCCTACAGAACAT	0.493																																						dbGAP											0													168.0	146.0	152.0					6																	30917380		692	1591	2283	-	-	-	SO:0001583	missense	0			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.1139C>T	6.37:g.30917380C>T	ENSP00000417182:p.Pro380Leu		C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	NULL	p.P380L	ENST00000462446.1	37	c.1139	CCDS4692.2	6	.	.	.	.	.	.	.	.	.	.	-	14.31	2.496647	0.44352	.	.	ENSG00000168631	ENST00000462446	T	0.58797	0.31	2.02	2.02	0.26589	.	.	.	.	.	T	0.45538	0.1347	L	0.34521	1.04	0.80722	D	1	D	0.56035	0.974	P	0.58130	0.833	T	0.37033	-0.9723	9	0.34782	T	0.22	.	10.1892	0.43017	0.0:1.0:0.0:0.0	.	380	E9PEI6	.	L	380	ENSP00000417182:P380L	ENSP00000417182:P380L	P	+	2	0	DPCR1	31025359	0.009000	0.17119	0.001000	0.08648	0.040000	0.13550	2.607000	0.46300	1.466000	0.48025	0.430000	0.28490	CCT	DPCR1	-	NULL	ENSG00000168631		0.493	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	DPCR1	HGNC	protein_coding	OTTHUMT00000076173.3	138	0.00	0	C	NM_080870		30917380	30917380	+1	no_errors	ENST00000462446	ensembl	human	novel	69_37n	missense	122	13.48	19	SNP	0.008	T
DZANK1	55184	genome.wustl.edu	37	20	18365188	18365188	+	Missense_Mutation	SNP	T	T	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr20:18365188T>G	ENST00000358866.6	-	20	2136	c.2114A>C	c.(2113-2115)aAg>aCg	p.K705T	DZANK1_ENST00000262547.5_Missense_Mutation_p.K705T|DZANK1_ENST00000329494.5_Missense_Mutation_p.K683T|DZANK1_ENST00000487128.1_5'UTR|DZANK1_ENST00000357236.4_Missense_Mutation_p.K591T			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	705							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						TGCATTCTTCTTTTGGATGCT	0.507																																						dbGAP											0													70.0	70.0	70.0					20																	18365188		1996	4164	6160	-	-	-	SO:0001583	missense	0			AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.2114A>C	20.37:g.18365188T>G	ENSP00000351734:p.Lys705Thr		B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.K705T	ENST00000358866.6	37	c.2114	CCDS46582.1	20	.	.	.	.	.	.	.	.	.	.	T	10.11	1.259376	0.23051	.	.	ENSG00000089091	ENST00000377630;ENST00000262547;ENST00000329494;ENST00000414623;ENST00000377637;ENST00000357236	T;T;T;T	0.70516	0.67;0.67;-0.49;0.67	5.59	5.59	0.84812	.	0.165284	0.51477	D	0.000096	T	0.65739	0.2720	L	0.35593	1.075	0.35379	D	0.789761	D;D;P;B	0.58268	0.957;0.982;0.692;0.206	P;P;B;B	0.51193	0.614;0.662;0.22;0.076	T	0.69727	-0.5067	10	0.22109	T	0.4	-16.2474	10.8551	0.46794	0.0:0.0:0.1579:0.8421	.	724;591;705;490	B7Z631;Q9NVP4-4;Q9NVP4;A6NKD0	.;.;DZAN1_HUMAN;.	T	538;705;683;537;490;591	ENSP00000366857:K538T;ENSP00000262547:K705T;ENSP00000328866:K683T;ENSP00000349774:K591T	ENSP00000262547:K705T	K	-	2	0	C20orf12	18313188	1.000000	0.71417	0.712000	0.30502	0.025000	0.11179	3.079000	0.50104	2.130000	0.65690	0.533000	0.62120	AAG	DZANK1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000089091		0.507	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	DZANK1	HGNC	protein_coding	OTTHUMT00000471926.1	51	0.00	0	T	NM_001099407		18365188	18365188	-1	no_errors	ENST00000262547	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	G
ELFN2	114794	genome.wustl.edu	37	22	37770941	37770941	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr22:37770941G>A	ENST00000402918.2	-	3	1419	c.634C>T	c.(634-636)Cgc>Tgc	p.R212C	RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	212	LRRCT.				negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					CACTGCAGGCGGTCGTAGTTC	0.637																																						dbGAP											0													25.0	33.0	30.0					22																	37770941		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.634C>T	22.37:g.37770941G>A	ENSP00000385277:p.Arg212Cys		Q96PY3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG-motif_cell_wall_anchor	p.R212C	ENST00000402918.2	37	c.634	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	G	17.76	3.469383	0.63625	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.53423	0.62;0.62	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.68760	0.3036	M	0.71206	2.165	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69316	-0.5177	10	0.45353	T	0.12	-32.4608	18.5971	0.91232	0.0:0.0:1.0:0.0	.	212	Q5R3F8	PPR29_HUMAN	C	212	ENSP00000300147:R212C;ENSP00000385277:R212C	ENSP00000300147:R212C	R	-	1	0	ELFN2	36100887	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.408000	0.73285	2.468000	0.83385	0.609000	0.83330	CGC	ELFN2	-	NULL	ENSG00000166897		0.637	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	29	0.00	0	G	NM_052906		37770941	37770941	-1	no_errors	ENST00000349653	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	1.000	A
EPS15L1	58513	genome.wustl.edu	37	19	16528799	16528799	+	Missense_Mutation	SNP	G	G	C	rs201602551		TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr19:16528799G>C	ENST00000248070.6	-	11	1206	c.1067C>G	c.(1066-1068)cCg>cGg	p.P356R	EPS15L1_ENST00000455140.2_Missense_Mutation_p.P356R|EPS15L1_ENST00000594975.1_Missense_Mutation_p.P356R|EPS15L1_ENST00000597937.1_Missense_Mutation_p.P356R|EPS15L1_ENST00000602009.1_Missense_Mutation_p.P202R|EPS15L1_ENST00000535753.2_Missense_Mutation_p.P356R	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	356	EH 3. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						GACCATGTCCGGCGAGAGGAC	0.582											OREG0025334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													150.0	119.0	129.0					19																	16528799		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.1067C>G	19.37:g.16528799G>C	ENSP00000248070:p.Pro356Arg	711	A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.P356R	ENST00000248070.6	37	c.1067	CCDS32944.1	19	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126299	0.56721	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	T;T;T	0.32272	1.46;1.46;1.46	4.45	3.41	0.39046	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.118857	0.56097	N	0.000024	T	0.53834	0.1821	M	0.85630	2.765	0.29122	N	0.880217	D;P;D;D;P;P	0.59357	0.985;0.904;0.985;0.982;0.9;0.482	P;P;P;P;P;P	0.62298	0.9;0.648;0.813;0.775;0.771;0.496	T	0.55921	-0.8064	10	0.56958	D	0.05	.	11.4805	0.50322	0.088:0.0:0.912:0.0	.	356;356;355;356;356;356	A8K5P4;A5PL29;A5PKY0;A2RRF3;Q9UBC2;G3V0H2	.;.;.;.;EP15R_HUMAN;.	R	356	ENSP00000393313:P356R;ENSP00000248070:P356R;ENSP00000440103:P356R	ENSP00000248070:P356R	P	-	2	0	EPS15L1	16389799	1.000000	0.71417	0.155000	0.22561	0.843000	0.47879	6.253000	0.72453	1.075000	0.40932	0.655000	0.94253	CCG	EPS15L1	-	smart_EPS15_homology,pfscan_EPS15_homology	ENSG00000127527		0.582	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	HGNC	protein_coding	OTTHUMT00000461040.1	55	0.00	0	G	NM_021235		16528799	16528799	-1	no_errors	ENST00000455140	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	0.315	C
GRM8	2918	genome.wustl.edu	37	7	126544645	126544645	+	Missense_Mutation	SNP	T	T	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr7:126544645T>G	ENST00000339582.2	-	4	1628	c.820A>C	c.(820-822)Aat>Cat	p.N274H	GRM8_ENST00000444921.2_Missense_Mutation_p.N274H|GRM8_ENST00000358373.3_Missense_Mutation_p.N274H|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000405249.1_Missense_Mutation_p.N274H			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	274					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GCTCGAGCATTAGGTGTTTCT	0.408										HNSCC(24;0.065)																												dbGAP											0													116.0	109.0	111.0					7																	126544645		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.820A>C	7.37:g.126544645T>G	ENSP00000344173:p.Asn274His		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.N274H	ENST00000339582.2	37	c.820	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137753	0.56936	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830	D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72	5.24	5.24	0.73138	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.87462	0.6183	M	0.85777	2.775	0.58432	D	0.999999	P;B	0.50528	0.936;0.097	P;B	0.48141	0.568;0.078	D	0.89430	0.3716	10	0.62326	D	0.03	.	14.3421	0.66633	0.0:0.0:0.0:1.0	.	274;274	O00222-2;O00222	.;GRM8_HUMAN	H	274	ENSP00000344173:N274H;ENSP00000409790:N274H;ENSP00000351142:N274H;ENSP00000385731:N274H;ENSP00000415522:N274H	ENSP00000344173:N274H	N	-	1	0	GRM8	126331881	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.970000	0.88000	1.981000	0.57761	0.455000	0.32223	AAT	GRM8	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3_mtglu_rcpt	ENSG00000179603		0.408	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	110	0.00	0	T			126544645	126544645	-1	no_errors	ENST00000339582	ensembl	human	known	69_37n	missense	64	67.18	131	SNP	1.000	G
HS6ST2	90161	genome.wustl.edu	37	X	131762534	131762534	+	Missense_Mutation	SNP	C	C	T	rs267606357		TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chrX:131762534C>T	ENST00000370836.2	-	4	1950	c.1535G>A	c.(1534-1536)cGa>cAa	p.R512Q	HS6ST2_ENST00000370833.2_Missense_Mutation_p.R406Q|HS6ST2_ENST00000521489.1_Missense_Mutation_p.R552Q|HS6ST2_ENST00000406696.3_Missense_Mutation_p.R238Q	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	512					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					CTGACGCTTTCGCCTGGCCTC	0.488																																						dbGAP											0													113.0	110.0	111.0					X																	131762534		1977	4130	6107	-	-	-	SO:0001583	missense	0			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.1535G>A	X.37:g.131762534C>T	ENSP00000359873:p.Arg512Gln		B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R552Q	ENST00000370836.2	37	c.1655	CCDS48169.1	X	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442263	0.25987	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000406696;ENST00000370833	T;T;T;T;T	0.78246	-1.08;-0.51;-0.53;-1.16;-1.05	6.02	4.22	0.49857	.	0.359313	0.32147	N	0.006507	T	0.60741	0.2292	N	0.16368	0.405	0.26908	N	0.966956	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.04013	0.0;0.0;0.001	T	0.45011	-0.9290	10	0.22109	T	0.4	-5.0884	10.7163	0.46015	0.0:0.8382:0.0:0.1618	.	512;552;238	Q96MM7;E9PDY5;B7Z5H6	H6ST2_HUMAN;.;.	Q	366;512;552;238;406	ENSP00000359874:R366Q;ENSP00000359873:R512Q;ENSP00000429473:R552Q;ENSP00000384013:R238Q;ENSP00000359870:R406Q	ENSP00000359870:R406Q	R	-	2	0	HS6ST2	131590215	0.892000	0.30473	0.994000	0.49952	0.934000	0.57294	1.192000	0.32150	0.623000	0.30267	0.600000	0.82982	CGA	HS6ST2	-	NULL	ENSG00000171004		0.488	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HS6ST2	HGNC	protein_coding	OTTHUMT00000058332.3	91	0.00	0	C	NM_147174		131762534	131762534	-1	no_errors	ENST00000521489	ensembl	human	known	69_37n	missense	39	43.48	30	SNP	0.996	T
INTS1	26173	genome.wustl.edu	37	7	1512808	1512808	+	Silent	SNP	G	G	A	rs138397380	byFrequency	TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr7:1512808G>A	ENST00000404767.3	-	43	6055	c.5970C>T	c.(5968-5970)ttC>ttT	p.F1990F	INTS1_ENST00000389470.4_Silent_p.F2194F	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1990					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)		p.F2194F(1)		autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CACTGTTGTCGAAGGACAGGT	0.627																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											46.0	50.0	48.0					7																	1512808		2116	4231	6347	-	-	-	SO:0001819	synonymous_variant	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.5970C>T	7.37:g.1512808G>A			A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Silent	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.F2194	ENST00000404767.3	37	c.6582	CCDS47526.1	7																																																																																			INTS1	-	NULL	ENSG00000164880		0.627	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	35	0.00	0	G			1512808	1512808	-1	no_errors	ENST00000389470	ensembl	human	known	69_37n	silent	27	25.00	9	SNP	0.942	A
IPP	3652	genome.wustl.edu	37	1	46180091	46180091	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr1:46180091delG	ENST00000396478.3	-	8	1459	c.1357delC	c.(1357-1359)cgtfs	p.R453fs	IPP_ENST00000495072.1_5'Flank	NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	453						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TCAAAAGAACGAAGTTCTATT	0.408																																						dbGAP											0													80.0	68.0	72.0					1																	46180091		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.1357delC	1.37:g.46180091delG	ENSP00000379739:p.Arg453fs		A2A6V4|D3DQ11|Q8N5C3	Frame_Shift_Del	DEL	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R453fs	ENST00000396478.3	37	c.1357	CCDS30702.1	1																																																																																			IPP	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000197429		0.408	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	HGNC	protein_coding	OTTHUMT00000021974.3	36	0.00	0	G	NM_005897		46180091	46180091	-1	no_errors	ENST00000396478	ensembl	human	known	69_37n	frame_shift_del	21	12.50	3	DEL	1.000	-
IQSEC2	23096	genome.wustl.edu	37	X	53265517	53265517	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chrX:53265517G>C	ENST00000375368.5	-	12	3608	c.3408C>G	c.(3406-3408)gaC>gaG	p.D1136E	IQSEC2_ENST00000396435.3_Missense_Mutation_p.D1146E|IQSEC2_ENST00000375365.2_Missense_Mutation_p.D941E			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1136					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CATCAGAGAGGTCTCGCAGGG	0.652																																						dbGAP											0													59.0	41.0	47.0					X																	53265517		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3408C>G	X.37:g.53265517G>C	ENSP00000364517:p.Asp1136Glu		B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.D1146E	ENST00000375368.5	37	c.3438		X	.	.	.	.	.	.	.	.	.	.	g	13.10	2.134898	0.37728	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.57273	0.41;0.41;0.41	4.91	2.15	0.27550	.	.	.	.	.	T	0.66867	0.2833	M	0.76574	2.34	0.50467	D	0.999877	D;D	0.76494	0.999;0.99	D;D	0.80764	0.994;0.986	T	0.65183	-0.6230	9	0.87932	D	0	.	7.2056	0.25905	0.3824:0.0:0.6176:0.0	.	1146;941	Q5JU85-2;Q5JU85-3	.;.	E	1146;1136;941	ENSP00000379712:D1146E;ENSP00000364517:D1136E;ENSP00000364514:D941E	ENSP00000364514:D941E	D	-	3	2	IQSEC2	53282242	1.000000	0.71417	0.999000	0.59377	0.850000	0.48378	1.316000	0.33620	0.343000	0.23821	0.464000	0.42555	GAC	IQSEC2	-	NULL	ENSG00000124313		0.652	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		37	0.00	0	G	XM_291345		53265517	53265517	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	C
IRS4	8471	genome.wustl.edu	37	X	107978147	107978147	+	Silent	SNP	G	G	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chrX:107978147G>T	ENST00000372129.2	-	1	1504	c.1428C>A	c.(1426-1428)ggC>ggA	p.G476G	RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	476					positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GATCTTCTTTGCCCTGGGGAT	0.587																																						dbGAP											0													117.0	108.0	111.0					X																	107978147		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.1428C>A	X.37:g.107978147G>T				Silent	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.G476	ENST00000372129.2	37	c.1428	CCDS14544.1	X																																																																																			IRS4	-	NULL	ENSG00000133124		0.587	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	74	0.00	0	G	NM_003604		107978147	107978147	-1	no_errors	ENST00000372129	ensembl	human	known	69_37n	silent	46	13.21	7	SNP	0.021	T
KIAA0232	9778	genome.wustl.edu	37	4	6863027	6863027	+	Missense_Mutation	SNP	A	A	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr4:6863027A>T	ENST00000307659.5	+	7	1373	c.918A>T	c.(916-918)ttA>ttT	p.L306F	KIAA0232_ENST00000425103.1_Missense_Mutation_p.L306F	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	306							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						AGGGAGAATTAAAAGCATCCA	0.473																																						dbGAP											0													61.0	60.0	61.0					4																	6863027		1941	4130	6071	-	-	-	SO:0001583	missense	0			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.918A>T	4.37:g.6863027A>T	ENSP00000303928:p.Leu306Phe		A7E2D2	Missense_Mutation	SNP	NULL	p.L306F	ENST00000307659.5	37	c.918	CCDS43209.1	4	.	.	.	.	.	.	.	.	.	.	A	14.49	2.549668	0.45383	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.91	-6.11	0.02131	.	1.332180	0.04795	N	0.432324	T	0.31358	0.0794	L	0.36672	1.1	0.21355	N	0.999717	B	0.28998	0.23	B	0.29663	0.105	T	0.30794	-0.9966	9	0.35671	T	0.21	1.6119	10.9825	0.47504	0.2125:0.3047:0.4828:0.0	.	306	Q92628	K0232_HUMAN	F	306	.	ENSP00000303928:L306F	L	+	3	2	KIAA0232	6913928	0.000000	0.05858	0.002000	0.10522	0.986000	0.74619	-1.070000	0.03440	-1.086000	0.03084	0.533000	0.62120	TTA	KIAA0232	-	NULL	ENSG00000170871		0.473	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0232	HGNC	protein_coding	OTTHUMT00000359102.2	27	0.00	0	A	NM_014743		6863027	6863027	+1	no_errors	ENST00000307659	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.001	T
KIF26B	55083	genome.wustl.edu	37	1	245583003	245583003	+	Silent	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr1:245583003C>T	ENST00000407071.2	+	4	1562	c.1122C>T	c.(1120-1122)agC>agT	p.S374S		NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	374					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			GCGTGGCCAGCGAGACTTCCA	0.602																																						dbGAP											0													88.0	91.0	90.0					1																	245583003		1993	4167	6160	-	-	-	SO:0001819	synonymous_variant	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1122C>T	1.37:g.245583003C>T			Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S374	ENST00000407071.2	37	c.1122	CCDS44342.1	1																																																																																			KIF26B	-	NULL	ENSG00000162849		0.602	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	39	0.00	0	C	XM_371354		245583003	245583003	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	0.984	T
KNTC1	9735	genome.wustl.edu	37	12	123058840	123058840	+	Silent	SNP	T	T	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr12:123058840T>C	ENST00000333479.7	+	27	2472	c.2295T>C	c.(2293-2295)aaT>aaC	p.N765N	KNTC1_ENST00000450485.2_Silent_p.N728N	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	765					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ATTTACTGAATAGATGCAGCT	0.338																																						dbGAP											0													82.0	73.0	75.0					12																	123058840		1863	4104	5967	-	-	-	SO:0001819	synonymous_variant	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.2295T>C	12.37:g.123058840T>C			A7E2C4|B3KSG2	Silent	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.N765	ENST00000333479.7	37	c.2295	CCDS45002.1	12																																																																																			KNTC1	-	NULL	ENSG00000184445		0.338	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	51	0.00	0	T			123058840	123058840	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	silent	31	13.89	5	SNP	0.998	C
KRT24	192666	genome.wustl.edu	37	17	38857431	38857431	+	Silent	SNP	G	G	A			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr17:38857431G>A	ENST00000264651.2	-	3	872	c.816C>T	c.(814-816)ttC>ttT	p.F272F		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	272	Coil 1B.|Rod.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				GCTCCTCGGTGAAACTCTCAA	0.502																																					GBM(61;380 1051 14702 23642 31441)	dbGAP											0													135.0	117.0	123.0					17																	38857431		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.816C>T	17.37:g.38857431G>A			Q9NXG7	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.F272	ENST00000264651.2	37	c.816	CCDS11372.1	17																																																																																			KRT24	-	pfam_F,superfamily_Prefoldin	ENSG00000167916		0.502	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT24	HGNC	protein_coding	OTTHUMT00000257217.1	67	0.00	0	G	NM_019016		38857431	38857431	-1	no_errors	ENST00000264651	ensembl	human	known	69_37n	silent	98	16.95	20	SNP	0.230	A
MCHR2	84539	genome.wustl.edu	37	6	100404004	100404004	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr6:100404004G>C	ENST00000281806.2	-	2	334	c.20C>G	c.(19-21)tCt>tGt	p.S7C	MCHR2_ENST00000369212.2_Missense_Mutation_p.S7C	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		GTTCCAACAAGATGCATGAAA	0.388																																						dbGAP											0													139.0	142.0	141.0					6																	100404004		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.20C>G	6.37:g.100404004G>C	ENSP00000281806:p.Ser7Cys		B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_MCH2_receptor,prints_7TM_GPCR_Rhodpsn,prints_MCH_rcpt	p.S7C	ENST00000281806.2	37	c.20	CCDS5044.1	6	.	.	.	.	.	.	.	.	.	.	G	6.927	0.540661	0.13250	.	.	ENSG00000152034	ENST00000445970;ENST00000281806;ENST00000369212	T;T;T	0.70399	-0.48;-0.48;-0.48	4.63	1.65	0.23941	.	0.290510	0.24542	N	0.037625	T	0.31327	0.0793	L	0.29908	0.895	0.09310	N	1	P	0.46327	0.876	B	0.34038	0.174	T	0.14980	-1.0453	10	0.87932	D	0	.	7.7746	0.29030	0.3073:0.0:0.6927:0.0	.	7	Q969V1	MCHR2_HUMAN	C	7	ENSP00000403490:S7C;ENSP00000281806:S7C;ENSP00000358214:S7C	ENSP00000281806:S7C	S	-	2	0	MCHR2	100510725	0.575000	0.26692	0.086000	0.20670	0.272000	0.26649	1.198000	0.32223	0.076000	0.16826	-0.367000	0.07326	TCT	MCHR2	-	prints_MCH2_receptor	ENSG00000152034		0.388	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MCHR2	HGNC	protein_coding	OTTHUMT00000041620.2	79	0.00	0	G	NM_032503		100404004	100404004	-1	no_errors	ENST00000281806	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	0.080	C
MUC5B	727897	genome.wustl.edu	37	11	1264225	1264225	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr11:1264225C>T	ENST00000529681.1	+	31	6173	c.6115C>T	c.(6115-6117)Ccc>Tcc	p.P2039S	MUC5B_ENST00000447027.1_Missense_Mutation_p.P2042S|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2039	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		TGTGGCCACCCCCTCCTCCAC	0.652																																						dbGAP											0													114.0	144.0	134.0					11																	1264225		2076	4192	6268	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6115C>T	11.37:g.1264225C>T	ENSP00000436812:p.Pro2039Ser		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.P2042S	ENST00000529681.1	37	c.6124	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	9.740	1.164540	0.21538	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.16196	2.36;2.54	2.46	-4.92	0.03075	.	.	.	.	.	T	0.14313	0.0346	M	0.67397	2.05	0.09310	N	1	B;B	0.17667	0.023;0.023	B;B	0.13407	0.006;0.009	T	0.26503	-1.0101	9	0.87932	D	0	.	1.3161	0.02107	0.4119:0.1255:0.1033:0.3592	.	2732;2042	A7Y9J9;E9PBJ0	.;.	S	2039;2042;2040;2109	ENSP00000436812:P2039S;ENSP00000415793:P2042S	ENSP00000343037:P2040S	P	+	1	0	MUC5B	1220801	0.002000	0.14202	0.000000	0.03702	0.147000	0.21601	-0.186000	0.09670	-3.369000	0.00177	0.305000	0.20034	CCC	MUC5B	-	NULL	ENSG00000117983		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	148	0.00	0	C	XM_001126093		1264225	1264225	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	76	42.86	57	SNP	0.000	T
NBEAL1	65065	genome.wustl.edu	37	2	204001448	204001448	+	Missense_Mutation	SNP	C	C	A			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr2:204001448C>A	ENST00000449802.1	+	28	4762	c.4429C>A	c.(4429-4431)Cca>Aca	p.P1477T		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1477										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ACTAAGTAAACCAGGAATATC	0.368																																						dbGAP											0													139.0	133.0	135.0					2																	204001448		1883	4109	5992	-	-	-	SO:0001583	missense	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.4429C>A	2.37:g.204001448C>A	ENSP00000399903:p.Pro1477Thr		A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P1477T	ENST00000449802.1	37	c.4429	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580794	0.28180	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.52057	0.68	5.8	4.87	0.63330	.	0.503060	0.22290	N	0.062002	T	0.40619	0.1124	L	0.51422	1.61	0.33395	D	0.576644	B;B	0.17038	0.02;0.02	B;B	0.19148	0.024;0.024	T	0.49143	-0.8970	10	0.29301	T	0.29	.	9.8283	0.40925	0.0:0.8315:0.0:0.1685	.	1477;1466	Q6ZS30;C9JGK5	NBEL1_HUMAN;.	T	1477	ENSP00000399903:P1477T	ENSP00000344985:P1477T	P	+	1	0	NBEAL1	203709693	1.000000	0.71417	0.998000	0.56505	0.698000	0.40448	2.935000	0.48963	1.320000	0.45209	0.650000	0.86243	CCA	NBEAL1	-	NULL	ENSG00000144426		0.368	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	38	0.00	0	C			204001448	204001448	+1	no_errors	ENST00000449802	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	A
NCOR1	9611	genome.wustl.edu	37	17	16029439	16029439	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr17:16029439C>G	ENST00000268712.3	-	15	1848	c.1591G>C	c.(1591-1593)Gaa>Caa	p.E531Q	NCOR1_ENST00000395851.1_Missense_Mutation_p.E531Q|NCOR1_ENST00000395848.1_Missense_Mutation_p.E422Q	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	531					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		tctttcttttcttcttctttt	0.274																																						dbGAP											0													18.0	18.0	18.0					17																	16029439		2185	4274	6459	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.1591G>C	17.37:g.16029439C>G	ENSP00000268712:p.Glu531Gln		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E531Q	ENST00000268712.3	37	c.1591	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	c	12.22	1.871234	0.33069	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510	T;T;T;T	0.34667	1.35;1.35;1.35;1.35	4.88	4.88	0.63580	.	0.152899	0.56097	D	0.000021	T	0.45438	0.1342	N	0.24115	0.695	0.80722	D	1	P;P;P;B;B;D	0.61080	0.947;0.947;0.947;0.337;0.09;0.989	D;D;D;B;B;D	0.70487	0.932;0.932;0.932;0.107;0.042;0.969	T	0.44742	-0.9308	10	0.54805	T	0.06	-11.6782	15.1693	0.72858	0.0:1.0:0.0:0.0	.	540;532;532;422;531;531	E7EU93;E7EV02;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;NCOR1_HUMAN;.	Q	531;531;422;540;422;532	ENSP00000268712:E531Q;ENSP00000379192:E531Q;ENSP00000379189:E422Q;ENSP00000407998:E532Q	ENSP00000268712:E531Q	E	-	1	0	NCOR1	15970164	0.997000	0.39634	0.994000	0.49952	0.994000	0.84299	4.330000	0.59266	2.417000	0.82017	0.552000	0.68991	GAA	NCOR1	-	NULL	ENSG00000141027		0.274	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	77	0.00	0	C	NM_006311		16029439	16029439	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	44	25.00	15	SNP	0.998	G
NEK8	284086	genome.wustl.edu	37	17	27061083	27061083	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr17:27061083G>C	ENST00000268766.6	+	2	164	c.130G>C	c.(130-132)Gag>Cag	p.E44Q	NEK8_ENST00000593261.1_3'UTR|AC010761.6_ENST00000584779.1_RNA	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	44	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					GACCAAGGAAGAGCGGCAGGC	0.527																																					NSCLC(6;19 293 14866 25253 49845)	dbGAP											0													107.0	95.0	99.0					17																	27061083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.130G>C	17.37:g.27061083G>C	ENSP00000268766:p.Glu44Gln		A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Reg_chr_condens,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E44Q	ENST00000268766.6	37	c.130	CCDS32597.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.223429	0.95139	.	.	ENSG00000160602	ENST00000543014;ENST00000268766	T;T	0.65549	-0.16;-0.16	4.92	4.92	0.64577	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	N	0.16567	0.415	0.80722	D	1	D	0.54397	0.966	P	0.60117	0.869	T	0.65199	-0.6226	10	0.38643	T	0.18	.	17.124	0.86710	0.0:0.0:1.0:0.0	.	44	Q86SG6	NEK8_HUMAN	Q	44	ENSP00000465859:E44Q;ENSP00000268766:E44Q	ENSP00000268766:E44Q	E	+	1	0	NEK8	24085210	1.000000	0.71417	0.999000	0.59377	0.924000	0.55760	7.706000	0.84615	2.267000	0.75376	0.313000	0.20887	GAG	NEK8	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000160602		0.527	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK8	HGNC	protein_coding	OTTHUMT00000446467.2	46	0.00	0	G			27061083	27061083	+1	no_errors	ENST00000268766	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	1.000	C
NGB	58157	genome.wustl.edu	37	14	77735657	77735657	+	Silent	SNP	C	C	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr14:77735657C>G	ENST00000298352.4	-	2	476	c.102G>C	c.(100-102)ctG>ctC	p.L34L		NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin	34	Globin.				apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		GGTCAGGCTCCAGGGCAAACA	0.642																																						dbGAP											0													37.0	27.0	31.0					14																	77735657		2060	3999	6059	-	-	-	SO:0001819	synonymous_variant	0			AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.102G>C	14.37:g.77735657C>G				Silent	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin	p.L34	ENST00000298352.4	37	c.102	CCDS9856.1	14																																																																																			NGB	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin	ENSG00000165553		0.642	NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGB	HGNC	protein_coding	OTTHUMT00000414194.1	33	0.00	0	C	NM_021257		77735657	77735657	-1	no_errors	ENST00000298352	ensembl	human	known	69_37n	silent	21	32.26	10	SNP	1.000	G
NPR1	4881	genome.wustl.edu	37	1	153659695	153659695	+	Missense_Mutation	SNP	A	A	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr1:153659695A>T	ENST00000368680.3	+	13	2427	c.1955A>T	c.(1954-1956)aAt>aTt	p.N652I		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	652	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	TTTCTACACAATGGGGCTATC	0.567																																					Pancreas(141;1349 1870 15144 15830 40702)	dbGAP											0													133.0	118.0	123.0					1																	153659695		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1955A>T	1.37:g.153659695A>T	ENSP00000357669:p.Asn652Ile		B0ZBF0|Q5SR08|Q6P4Q3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.N652I	ENST00000368680.3	37	c.1955	CCDS1051.1	1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.144226	0.57044	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	T	0.63255	-0.03	4.33	3.2	0.36748	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.060204	0.64402	D	0.000007	T	0.63954	0.2555	M	0.73372	2.23	0.80722	D	1	P;P	0.52842	0.728;0.956	P;P	0.62649	0.629;0.905	T	0.66724	-0.5851	10	0.59425	D	0.04	.	8.1011	0.30857	0.9019:0.0:0.0981:0.0	.	131;652	B7Z4Y7;P16066	.;ANPRA_HUMAN	I	652;131	ENSP00000357669:N652I	ENSP00000357669:N652I	N	+	2	0	NPR1	151926319	1.000000	0.71417	0.996000	0.52242	0.865000	0.49528	5.043000	0.64208	0.811000	0.34303	0.374000	0.22700	AAT	NPR1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169418		0.567	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	HGNC	protein_coding	OTTHUMT00000090034.1	43	0.00	0	A	NM_000906		153659695	153659695	+1	no_errors	ENST00000368680	ensembl	human	known	69_37n	missense	82	11.83	11	SNP	1.000	T
OR5T3	390154	genome.wustl.edu	37	11	56020439	56020439	+	Missense_Mutation	SNP	T	T	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr11:56020439T>C	ENST00000303059.3	+	1	764	c.764T>C	c.(763-765)aTt>aCt	p.I255T		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					CTGTTGTCCATTCTGAAGATG	0.418																																						dbGAP											0													239.0	217.0	225.0					11																	56020439		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.764T>C	11.37:g.56020439T>C	ENSP00000305403:p.Ile255Thr		Q6IFC7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I255T	ENST00000303059.3	37	c.764	CCDS31524.1	11	.	.	.	.	.	.	.	.	.	.	T	11.90	1.775768	0.31411	.	.	ENSG00000172489	ENST00000303059	T	0.00265	8.39	4.65	4.65	0.58169	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000205	T	0.00608	0.0020	M	0.93763	3.455	0.21967	N	0.999446	P	0.51147	0.942	P	0.55508	0.777	T	0.14035	-1.0487	10	0.87932	D	0	.	11.759	0.51892	0.0:0.0:0.1467:0.8533	.	255	Q8NGG3	OR5T3_HUMAN	T	255	ENSP00000305403:I255T	ENSP00000305403:I255T	I	+	2	0	OR5T3	55777015	0.225000	0.23685	0.759000	0.31340	0.096000	0.18686	2.873000	0.48475	2.076000	0.62316	0.523000	0.50628	ATT	OR5T3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172489		0.418	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1	95	0.00	0	T	NM_001004747		56020439	56020439	+1	no_errors	ENST00000303059	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	0.560	C
PHKG2	5261	genome.wustl.edu	37	16	30760196	30760196	+	Missense_Mutation	SNP	G	G	A			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr16:30760196G>A	ENST00000563588.1	+	2	294	c.55G>A	c.(55-57)Gag>Aag	p.E19K	RP11-2C24.4_ENST00000483578.1_lincRNA|PHKG2_ENST00000328273.7_Missense_Mutation_p.E19K|PHKG2_ENST00000424889.3_Missense_Mutation_p.E19K	NM_000294.2	NP_000285.1	P15735	PHKG2_HUMAN	phosphorylase kinase, gamma 2 (testis)	19					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|positive regulation of glycogen catabolic process (GO:0045819)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)	ATP binding (GO:0005524)|phosphorylase kinase activity (GO:0004689)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			ovary(1)|skin(1)	2			Colorectal(24;0.198)			CGCCGCCAAAGAGTTTTACCA	0.662																																						dbGAP											0													22.0	17.0	19.0					16																	30760196		2146	4205	6351	-	-	-	SO:0001583	missense	0			S73483, M31606	CCDS10690.1, CCDS54002.1	16p11.2	2008-02-05			ENSG00000156873	ENSG00000156873			8931	protein-coding gene	gene with protein product		172471				2915644, 8020963	Standard	NM_000294		Approved		uc021tgo.1	P15735	OTTHUMG00000132400	ENST00000563588.1:c.55G>A	16.37:g.30760196G>A	ENSP00000455607:p.Glu19Lys		A8K0C7|B4DEB7|E9PEU3|P11800	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Phosph_kin_gamma,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E19K	ENST00000563588.1	37	c.55	CCDS10690.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.265809	0.95399	.	.	ENSG00000156873	ENST00000328273;ENST00000424889	T;T	0.38887	1.11;1.11	5.38	4.43	0.53597	Protein kinase-like domain (1);	0.000000	0.38605	U	0.001626	T	0.40222	0.1108	L	0.38953	1.18	0.53688	D	0.999975	P;P;P	0.52061	0.603;0.917;0.95	B;B;P	0.48524	0.232;0.443;0.58	T	0.13388	-1.0511	10	0.33141	T	0.24	-16.4045	13.1045	0.59239	0.0792:0.0:0.9208:0.0	.	11;19;19	Q16221;P15735;P15735-2	.;PHKG2_HUMAN;.	K	19	ENSP00000329968:E19K;ENSP00000388571:E19K	ENSP00000329968:E19K	E	+	1	0	PHKG2	30667697	1.000000	0.71417	0.995000	0.50966	0.924000	0.55760	9.255000	0.95524	1.275000	0.44379	-0.145000	0.13849	GAG	PHKG2	-	superfamily_Kinase-like_dom	ENSG00000156873		0.662	PHKG2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHKG2	HGNC	protein_coding	OTTHUMT00000255531.2	19	0.00	0	G	NM_000294		30760196	30760196	+1	no_errors	ENST00000563588	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	1.000	A
PLCE1	51196	genome.wustl.edu	37	10	96066253	96066253	+	Missense_Mutation	SNP	G	G	C			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr10:96066253G>C	ENST00000371380.3	+	25	5927	c.5692G>C	c.(5692-5694)Ggc>Cgc	p.G1898R	PLCE1_ENST00000371375.1_Missense_Mutation_p.G1590R|PLCE1_ENST00000260766.3_Missense_Mutation_p.G1898R|PLCE1_ENST00000371385.3_Missense_Mutation_p.G1590R			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1898	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				CGACGTCCTGGGCATGCCTCT	0.527																																						dbGAP											0													135.0	136.0	136.0					10																	96066253		2029	4186	6215	-	-	-	SO:0001583	missense	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.5692G>C	10.37:g.96066253G>C	ENSP00000360431:p.Gly1898Arg		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,smart_Ras-assoc,pfscan_C2_membr_targeting,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.G1898R	ENST00000371380.3	37	c.5692	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027821	0.93518	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.17528	2.27;2.27;2.27;2.27	5.43	5.43	0.79202	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.56455	0.1986	H	0.94462	3.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.69007	-0.5259	10	0.87932	D	0	.	19.2269	0.93821	0.0:0.0:1.0:0.0	.	1882;1590;1898	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	R	1898;1898;1590;1590	ENSP00000260766:G1898R;ENSP00000360431:G1898R;ENSP00000360438:G1590R;ENSP00000360426:G1590R	ENSP00000260766:G1898R	G	+	1	0	PLCE1	96056243	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.740000	0.98839	2.721000	0.93114	0.655000	0.94253	GGC	PLCE1	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000138193		0.527	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	80	0.00	0	G	NM_016341		96066253	96066253	+1	no_errors	ENST00000371380	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	1.000	C
RBM39	9584	genome.wustl.edu	37	20	34312573	34312573	+	Silent	SNP	G	G	A			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr20:34312573G>A	ENST00000253363.6	-	8	629	c.606C>T	c.(604-606)gtC>gtT	p.V202V	RBM39_ENST00000528062.3_Silent_p.V180V|RBM39_ENST00000361162.6_Silent_p.V202V|RBM39_ENST00000407261.4_Silent_p.V45V			Q14498	RBM39_HUMAN	RNA binding motif protein 39	202	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					AGCTAACATCGACGAACTCCA	0.408																																						dbGAP											0													146.0	132.0	137.0					20																	34312573		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.606C>T	20.37:g.34312573G>A			A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_CC1_SF	p.R75*	ENST00000253363.6	37	c.223	CCDS13266.1	20	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321067	0.23994	.	.	ENSG00000131051	ENST00000448303	.	.	.	5.36	-9.17	0.00691	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9718	0.47444	0.2855:0.2037:0.5109:0.0	.	.	.	.	X	75	.	.	R	-	1	2	RBM39	33775987	0.159000	0.22864	0.737000	0.30932	0.987000	0.75469	-0.267000	0.08619	-1.733000	0.01357	-0.355000	0.07637	CGA	RBM39	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_CC1_SF	ENSG00000131051		0.408	RBM39-002	KNOWN	basic|CCDS	protein_coding	RBM39	HGNC	protein_coding	OTTHUMT00000078931.2	65	0.00	0	G	NM_184237		34312573	34312573	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000448303	ensembl	human	novel	69_37n	nonsense	38	22.45	11	SNP	0.569	A
SPAM1	6677	genome.wustl.edu	37	7	123594426	123594426	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr7:123594426C>T	ENST00000439500.1	+	4	1415	c.802C>T	c.(802-804)Cag>Tag	p.Q268*	SPAM1_ENST00000340011.5_Nonsense_Mutation_p.Q268*|SPAM1_ENST00000460182.1_Nonsense_Mutation_p.Q268*|SPAM1_ENST00000402183.2_Nonsense_Mutation_p.Q268*|SPAM1_ENST00000223028.7_Nonsense_Mutation_p.Q268*	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	268					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TTTGAACACTCAGCAGTCTCC	0.418																																						dbGAP											0													121.0	113.0	116.0					7																	123594426		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.802C>T	7.37:g.123594426C>T	ENSP00000402123:p.Gln268*		Q8TC30	Nonsense_Mutation	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Glyco_hydro_56_PH20,prints_Hyaluronidase	p.Q268*	ENST00000439500.1	37	c.802	CCDS5791.1	7	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613462	0.87359	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	.	.	.	6.02	-12.0	0.00017	.	2.835140	0.00447	N	0.000087	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4063	6.5641	0.22503	0.0958:0.4645:0.2921:0.1476	.	.	.	.	X	268	.	.	Q	+	1	0	SPAM1	123381662	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.193000	0.01244	-2.992000	0.00279	-1.217000	0.01609	CAG	SPAM1	-	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase	ENSG00000106304		0.418	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPAM1	HGNC	protein_coding	OTTHUMT00000348309.1	68	0.00	0	C			123594426	123594426	+1	no_errors	ENST00000340011	ensembl	human	known	69_37n	nonsense	60	18.92	14	SNP	0.000	T
SPANXN2	494119	genome.wustl.edu	37	X	142795593	142795593	+	Missense_Mutation	SNP	C	C	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chrX:142795593C>G	ENST00000370498.1	-	2	838	c.85G>C	c.(85-87)Gag>Cag	p.E29Q		NM_001009615.1	NP_001009615.1	Q5MJ10	SPXN2_HUMAN	SPANX family, member N2	29										NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)					TTCGGTGCCTCCTGCATCTGA	0.423																																						dbGAP											0													89.0	79.0	83.0					X																	142795593		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35419.1	Xq27.3	2012-06-12			ENSG00000203924	ENSG00000268988			33175	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 7"""	300665				14973187, 17012309	Standard	NM_001009615		Approved	SPANX-N2, CT11.7	uc004fbz.3	Q5MJ10	OTTHUMG00000022583	ENST00000370498.1:c.85G>C	X.37:g.142795593C>G	ENSP00000359529:p.Glu29Gln		Q0ZNM2	Missense_Mutation	SNP	pfam_SPANX_prot	p.E29Q	ENST00000370498.1	37	c.85	CCDS35419.1	X	.	.	.	.	.	.	.	.	.	.	C	9.464	1.093916	0.20471	.	.	ENSG00000203924	ENST00000370498	T	0.15718	2.4	0.636	-0.57	0.11753	.	.	.	.	.	T	0.35422	0.0931	M	0.78801	2.425	0.09310	N	1	D	0.71674	0.998	D	0.71870	0.975	T	0.12863	-1.0531	8	0.72032	D	0.01	.	.	.	.	.	29	Q5MJ10	SPXN2_HUMAN	Q	29	ENSP00000359529:E29Q	ENSP00000359529:E29Q	E	-	1	0	SPANXN2	142623259	0.001000	0.12720	0.001000	0.08648	0.013000	0.08279	0.087000	0.14958	-0.315000	0.08703	0.284000	0.19432	GAG	SPANXN2	-	pfam_SPANX_prot	ENSG00000203924		0.423	SPANXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN2	HGNC	protein_coding	OTTHUMT00000058621.2	94	0.00	0	C	NM_001009615		142795593	142795593	-1	no_errors	ENST00000370498	ensembl	human	known	69_37n	missense	66	22.35	19	SNP	0.001	G
TICRR	90381	genome.wustl.edu	37	15	90143862	90143862	+	Missense_Mutation	SNP	A	A	G			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr15:90143862A>G	ENST00000268138.7	+	9	2204	c.2099A>G	c.(2098-2100)aAa>aGa	p.K700R	TICRR_ENST00000560985.1_Missense_Mutation_p.K699R			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	700					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										AAAACTAGTAAAAGTCTTCGA	0.294																																						dbGAP											0													38.0	36.0	37.0					15																	90143862		1798	4063	5861	-	-	-	SO:0001583	missense	0			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2099A>G	15.37:g.90143862A>G	ENSP00000268138:p.Lys700Arg		B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	NULL	p.K700R	ENST00000268138.7	37	c.2099	CCDS10352.2	15	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443378	0.83993	.	.	ENSG00000140534	ENST00000268138	T	0.20463	2.07	5.35	5.35	0.76521	.	0.150842	0.64402	D	0.000016	T	0.42017	0.1184	L	0.55834	1.745	0.43218	D	0.995098	D	0.89917	1.0	D	0.85130	0.997	T	0.24835	-1.0149	10	0.62326	D	0.03	-15.2885	14.4649	0.67477	1.0:0.0:0.0:0.0	.	700	Q7Z2Z1	TICRR_HUMAN	R	700	ENSP00000268138:K700R	ENSP00000268138:K700R	K	+	2	0	C15orf42	87944866	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.850000	0.48294	2.163000	0.67991	0.533000	0.62120	AAA	TICRR	-	NULL	ENSG00000140534		0.294	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TICRR	HGNC	protein_coding	OTTHUMT00000312856.1	39	0.00	0	A	NM_152259		90143862	90143862	+1	no_errors	ENST00000268138	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	G
TRIM39	56658	genome.wustl.edu	37	6	30298612	30298612	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr6:30298612C>T	ENST00000396547.1	+	3	668	c.508C>T	c.(508-510)Cgc>Tgc	p.R170C	TRIM39_ENST00000540416.1_Missense_Mutation_p.R170C|TRIM39_ENST00000396548.1_Missense_Mutation_p.R170C|TRIM39_ENST00000376656.4_Missense_Mutation_p.R170C|TRIM39_ENST00000376659.5_Missense_Mutation_p.R170C|TRIM39-RPP21_ENST00000513556.1_Missense_Mutation_p.R82C|TRIM39_ENST00000396551.3_Missense_Mutation_p.R170C			Q9HCM9	TRI39_HUMAN	tripartite motif containing 39	170					apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						GGAGATCACTCGCTGCAAGTC	0.527																																						dbGAP											0													70.0	67.0	68.0					6																	30298612		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000396547.1:c.508C>T	6.37:g.30298612C>T	ENSP00000379796:p.Arg170Cys		Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R170C	ENST00000396547.1	37	c.508	CCDS34377.1	6	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658017	0.47467	.	.	ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000204599;ENSG00000248167	ENST00000396551;ENST00000376656;ENST00000545104;ENST00000540416;ENST00000449040;ENST00000412529;ENST00000428728;ENST00000396548;ENST00000376659;ENST00000396547;ENST00000513556	T;T;T;T;T;T;T;T	0.66099	0.02;0.04;0.06;-0.19;0.02;0.02;0.04;0.79	5.41	4.53	0.55603	.	0.403546	0.21979	N	0.066328	T	0.47600	0.1454	L	0.34521	1.04	0.37041	D	0.897159	B;B;P	0.44241	0.001;0.009;0.829	B;B;P	0.51229	0.0;0.004;0.663	T	0.55636	-0.8110	10	0.59425	D	0.04	.	9.0861	0.36581	0.0:0.9003:0.0:0.0997	.	84;170;170	F5H2V3;Q9HCM9;Q9HCM9-2	.;TRI39_HUMAN;.	C	170;170;170;170;170;84;170;170;170;170;82	ENSP00000379800:R170C;ENSP00000365844:R170C;ENSP00000439400:R170C;ENSP00000406019:R170C;ENSP00000379797:R170C;ENSP00000365847:R170C;ENSP00000379796:R170C;ENSP00000424048:R82C	ENSP00000365844:R170C	R	+	1	0	TRIM39-RPP21;TRIM39	30406591	0.000000	0.05858	0.998000	0.56505	0.991000	0.79684	0.389000	0.20751	1.495000	0.48549	0.555000	0.69702	CGC	TRIM39	-	NULL	ENSG00000204599		0.527	TRIM39-002	KNOWN	basic|CCDS	protein_coding	TRIM39	HGNC	protein_coding	OTTHUMT00000076086.2	50	0.00	0	C	NM_172016		30298612	30298612	+1	no_errors	ENST00000376656	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.997	T
WDR47	22911	genome.wustl.edu	37	1	109538271	109538271	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr1:109538271C>T	ENST00000369962.3	-	8	1844	c.1622G>A	c.(1621-1623)aGc>aAc	p.S541N	WDR47_ENST00000400794.3_Missense_Mutation_p.S549N|WDR47_ENST00000361054.3_Missense_Mutation_p.S513N|WDR47_ENST00000369965.4_Missense_Mutation_p.S542N|WDR47_ENST00000357672.3_Missense_Mutation_p.S513N			O94967	WDR47_HUMAN	WD repeat domain 47	541					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		ACGAGGAGTGCTTGTATGAAT	0.388																																						dbGAP											0													273.0	275.0	274.0					1																	109538271		2203	4296	6499	-	-	-	SO:0001583	missense	0			AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.1622G>A	1.37:g.109538271C>T	ENSP00000358979:p.Ser541Asn		A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_CTLH_C,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_CTLH_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S549N	ENST00000369962.3	37	c.1646	CCDS44187.1	1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977569	0.92982	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	T;T;T;T;T	0.57273	0.41;0.44;0.41;0.41;0.41	5.64	5.64	0.86602	.	0.036467	0.85682	D	0.000000	T	0.56790	0.2009	L	0.34521	1.04	0.58432	D	0.999999	D;D;D;D	0.71674	0.998;0.996;0.997;0.99	D;D;D;P	0.77557	0.99;0.977;0.986;0.889	T	0.49781	-0.8903	10	0.33940	T	0.23	-0.2055	20.0625	0.97681	0.0:1.0:0.0:0.0	.	513;549;541;542	O94967-2;A8MX09;O94967;O94967-3	.;.;WDR47_HUMAN;.	N	549;541;513;542;513	ENSP00000383599:S549N;ENSP00000358979:S541N;ENSP00000354339:S513N;ENSP00000358982:S542N;ENSP00000350301:S513N	ENSP00000350301:S513N	S	-	2	0	WDR47	109339794	1.000000	0.71417	0.991000	0.47740	0.934000	0.57294	6.006000	0.70724	2.816000	0.96949	0.561000	0.74099	AGC	WDR47	-	NULL	ENSG00000085433		0.388	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR47	HGNC	protein_coding	OTTHUMT00000032414.2	100	0.00	0	C	NM_014969		109538271	109538271	-1	no_errors	ENST00000400794	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	1.000	T
XKR4	114786	genome.wustl.edu	37	8	56436404	56436404	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr8:56436404C>T	ENST00000327381.6	+	3	1671	c.1571C>T	c.(1570-1572)cCa>cTa	p.P524L	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	524						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GGGCAGTCACCAAGTTGTGCT	0.532																																						dbGAP											0													81.0	73.0	75.0					8																	56436404		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1571C>T	8.37:g.56436404C>T	ENSP00000328326:p.Pro524Leu		Q96PZ8	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.P524L	ENST00000327381.6	37	c.1571	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	C	13.47	2.245457	0.39697	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.82344	-1.6	5.95	5.95	0.96441	.	0.158140	0.56097	D	0.000024	T	0.75796	0.3898	L	0.29908	0.895	0.58432	D	0.999999	B	0.12630	0.006	B	0.09377	0.004	T	0.69213	-0.5204	10	0.12766	T	0.61	1.4771	20.3932	0.98965	0.0:1.0:0.0:0.0	.	524	Q5GH76	XKR4_HUMAN	L	524	ENSP00000328326:P524L	ENSP00000328326:P524L	P	+	2	0	XKR4	56598958	0.999000	0.42202	0.749000	0.31150	0.885000	0.51271	6.066000	0.71185	2.824000	0.97209	0.655000	0.94253	CCA	XKR4	-	NULL	ENSG00000206579		0.532	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	37	0.00	0	C	NM_052898		56436404	56436404	+1	no_errors	ENST00000327381	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	0.977	T
ZNF682	91120	genome.wustl.edu	37	19	20116956	20116956	+	Missense_Mutation	SNP	C	C	T	rs368709233		TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr19:20116956C>T	ENST00000397165.2	-	4	1515	c.1355G>A	c.(1354-1356)cGc>cAc	p.R452H	ZNF682_ENST00000397162.1_Missense_Mutation_p.R420H|ZNF682_ENST00000595736.1_Missense_Mutation_p.R376H|ZNF682_ENST00000596019.1_Intron|ZNF682_ENST00000597972.1_Missense_Mutation_p.R458H|ZNF682_ENST00000358523.5_Missense_Mutation_p.R420H	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						ACATTTATAGCGTTTGACGGC	0.378																																						dbGAP											0													88.0	97.0	94.0					19																	20116956		2163	4285	6448	-	-	-	SO:0001583	missense	0			AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.1355G>A	19.37:g.20116956C>T	ENSP00000380351:p.Arg452His		B3KU64|E9PFJ5|Q96JV9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R452H	ENST00000397165.2	37	c.1355	CCDS42533.1	19	.	.	.	.	.	.	.	.	.	.	C	2.479	-0.320066	0.05386	.	.	ENSG00000197124	ENST00000397165;ENST00000397162;ENST00000341262;ENST00000358523	T;T;T	0.18810	2.19;2.19;2.19	1.09	-2.18	0.07037	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12561	0.0305	N	0.25426	0.745	0.09310	N	1	B	0.09022	0.002	B	0.13407	0.009	T	0.17715	-1.0360	9	0.66056	D	0.02	.	4.4336	0.11540	0.0:0.2366:0.4052:0.3582	.	452	O95780	ZN682_HUMAN	H	452;420;121;420	ENSP00000380351:R452H;ENSP00000380348:R420H;ENSP00000351324:R420H	ENSP00000340236:R121H	R	-	2	0	ZNF682	19977956	0.518000	0.26234	0.000000	0.03702	0.000000	0.00434	0.477000	0.22196	-2.624000	0.00438	-2.658000	0.00147	CGC	ZNF682	-	pfscan_Znf_C2H2	ENSG00000197124		0.378	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF682	HGNC	protein_coding	OTTHUMT00000462888.1	54	0.00	0	C	NM_033196		20116956	20116956	-1	no_errors	ENST00000397165	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.091	T
ZNF677	342926	genome.wustl.edu	37	19	53741328	53741328	+	Missense_Mutation	SNP	C	C	T			TCGA-A1-A0SN-01A-11D-A142-09	TCGA-A1-A0SN-10B-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1b8d93f4-acc2-48ee-9ca8-a327eb0463c2	14f376b8-4bd0-4931-9ddd-0b4b1cb89137	g.chr19:53741328C>T	ENST00000598513.1	-	5	802	c.652G>A	c.(652-654)Gag>Aag	p.E218K	ZNF677_ENST00000333952.4_Missense_Mutation_p.E218K|CTD-2245F17.6_ENST00000596041.1_RNA	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		ATAGACTTCTCAACTGGATTA	0.338																																						dbGAP											0													55.0	56.0	56.0					19																	53741328		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.652G>A	19.37:g.53741328C>T	ENSP00000469391:p.Glu218Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E218K	ENST00000598513.1	37	c.652	CCDS12861.1	19	.	.	.	.	.	.	.	.	.	.	C	5.907	0.351466	0.11182	.	.	ENSG00000197928	ENST00000333952	T	0.07567	3.18	2.16	-0.189	0.13260	.	0.527792	0.14232	N	0.332664	T	0.06917	0.0176	L	0.43923	1.385	0.09310	N	0.999996	B	0.09022	0.002	B	0.06405	0.002	T	0.30327	-0.9982	10	0.62326	D	0.03	.	4.9484	0.14002	0.0:0.6387:0.219:0.1423	.	218	Q86XU0	ZN677_HUMAN	K	218	ENSP00000334394:E218K	ENSP00000334394:E218K	E	-	1	0	ZNF677	58433140	0.000000	0.05858	0.004000	0.12327	0.347000	0.29111	0.515000	0.22801	0.028000	0.15324	0.655000	0.94253	GAG	ZNF677	-	NULL	ENSG00000197928		0.338	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	52	0.00	0	C	NM_182609		53741328	53741328	-1	no_errors	ENST00000333952	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	0.384	T
