#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AFF2	2334	genome.wustl.edu	37	X	147744200	147744200	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chrX:147744200C>A	ENST00000370460.2	+	3	1431	c.952C>A	c.(952-954)Ctg>Atg	p.L318M	AFF2_ENST00000370458.1_Missense_Mutation_p.L314M|AFF2_ENST00000342251.3_Missense_Mutation_p.L314M|AFF2_ENST00000370457.5_Missense_Mutation_p.L314M	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	318					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CTTTGGGAATCTGTCATTTGG	0.458																																						dbGAP											0													69.0	63.0	65.0					X																	147744200		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.952C>A	X.37:g.147744200C>A	ENSP00000359489:p.Leu318Met		A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.L318M	ENST00000370460.2	37	c.952	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721904	0.48728	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000370458	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.92	5.92	0.95590	.	0.454591	0.21684	N	0.070673	T	0.68274	0.2983	N	0.24115	0.695	0.80722	D	1	D;D;D;D;D;D	0.62365	0.989;0.989;0.989;0.989;0.991;0.988	P;P;P;P;P;P	0.62014	0.834;0.834;0.834;0.834;0.897;0.854	T	0.70941	-0.4735	10	0.59425	D	0.04	.	19.2293	0.93831	0.0:1.0:0.0:0.0	.	318;314;314;314;318;314	P51816-6;P51816-3;P51816-2;P51816-5;P51816;P51816-4	.;.;.;.;AFF2_HUMAN;.	M	318;314;314;314	ENSP00000359489:L318M;ENSP00000359486:L314M;ENSP00000345459:L314M;ENSP00000359487:L314M	ENSP00000345459:L314M	L	+	1	2	AFF2	147551892	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.113000	0.64640	2.492000	0.84095	0.600000	0.82982	CTG	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.458	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	136	0.00	0	C	NM_002025		147744200	147744200	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	missense	82	40.58	56	SNP	1.000	A
AKAP11	11215	genome.wustl.edu	37	13	42875568	42875568	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr13:42875568G>A	ENST00000025301.2	+	8	2861	c.2686G>A	c.(2686-2688)Gtt>Att	p.V896I		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	896					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ATCATTGGAAGTTACAAAAAT	0.368																																						dbGAP											0													34.0	34.0	34.0					13																	42875568		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.2686G>A	13.37:g.42875568G>A	ENSP00000025301:p.Val896Ile		O75124|Q9NUK7	Missense_Mutation	SNP	NULL	p.V896I	ENST00000025301.2	37	c.2686	CCDS9383.1	13	.	.	.	.	.	.	.	.	.	.	G	9.857	1.195205	0.22037	.	.	ENSG00000023516	ENST00000025301	T	0.15718	2.4	6.03	4.29	0.51040	.	0.765777	0.11916	N	0.517182	T	0.15782	0.0380	L	0.40543	1.245	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.19778	-1.0295	10	0.48119	T	0.1	.	9.234	0.37455	0.1279:0.0:0.7515:0.1206	.	896	Q9UKA4	AKA11_HUMAN	I	896	ENSP00000025301:V896I	ENSP00000025301:V896I	V	+	1	0	AKAP11	41773568	0.994000	0.37717	0.004000	0.12327	0.363000	0.29612	2.287000	0.43505	0.863000	0.35553	0.655000	0.94253	GTT	AKAP11	-	NULL	ENSG00000023516		0.368	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	HGNC	protein_coding	OTTHUMT00000044700.2	16	0.00	0	G	NM_016248		42875568	42875568	+1	no_errors	ENST00000025301	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.104	A
ANXA11	311	genome.wustl.edu	37	10	81928877	81928878	+	Frame_Shift_Ins	INS	-	-	G	rs530828539|rs201734622	byFrequency	TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr10:81928877_81928878insG	ENST00000438331.1	-	6	890_891	c.408_409insC	c.(406-411)cccggafs	p.G137fs	ANXA11_ENST00000537102.1_Frame_Shift_Ins_p.G104fs|ANXA11_ENST00000535999.1_Frame_Shift_Ins_p.G137fs|ANXA11_ENST00000360615.4_Frame_Shift_Ins_p.G137fs|ANXA11_ENST00000372231.3_Frame_Shift_Ins_p.G137fs|ANXA11_ENST00000422982.3_Frame_Shift_Ins_p.G137fs|ANXA11_ENST00000265447.4_Frame_Shift_Ins_p.G137fs	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	137					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			GGCTGCTGTCCGGGGGGTGGCA	0.683																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.409dupC	10.37:g.81928883_81928883dupG	ENSP00000398610:p.Gly137fs		B4DVE7	Frame_Shift_Ins	INS	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinXI,prints_AnnexinVII	p.G136fs	ENST00000438331.1	37	c.409_408	CCDS7364.1	10																																																																																			ANXA11	-	NULL	ENSG00000122359		0.683	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANXA11	HGNC	protein_coding	OTTHUMT00000049044.1	30	0.00	0	-	NM_145869		81928877	81928878	-1	no_errors	ENST00000265447	ensembl	human	known	69_37n	frame_shift_ins	43	10.42	5	INS	0.686:0.396	G
BOC	91653	genome.wustl.edu	37	3	113005658	113005658	+	Silent	SNP	C	C	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr3:113005658C>T	ENST00000495514.1	+	20	3998	c.3294C>T	c.(3292-3294)tcC>tcT	p.S1098S	BOC_ENST00000273395.4_Silent_p.S1099S|BOC_ENST00000355385.3_Silent_p.S1098S			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	1098					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TGCAGCTCTCCCCGGGGCCAC	0.507																																						dbGAP											0													100.0	108.0	105.0					3																	113005658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.3294C>T	3.37:g.113005658C>T			A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S1099	ENST00000495514.1	37	c.3297	CCDS2971.1	3																																																																																			BOC	-	NULL	ENSG00000144857		0.507	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3	122	0.00	0	C	NM_033254		113005658	113005658	+1	no_errors	ENST00000273395	ensembl	human	known	69_37n	silent	56	37.08	33	SNP	0.000	T
CCDC7	79741	genome.wustl.edu	37	10	33134181	33134181	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr10:33134181delG	ENST00000375028.3	+	13	1174	c.1104delG	c.(1102-1104)aagfs	p.K368fs	C10orf68_ENST00000375030.2_Intron|C10orf68_ENST00000375025.4_Frame_Shift_Del_p.K428fs			Q9H943	CJ068_HUMAN		374										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						AGACTGATAAGGAACACTTAG	0.294																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0																														ENST00000375028.3:c.1104delG	10.37:g.33134181delG	ENSP00000364168:p.Lys368fs		B0QZ71|Q08AN7|Q8N7T7	Frame_Shift_Del	DEL	NULL	p.E429fs	ENST00000375028.3	37	c.1284		10																																																																																			C10orf68	-	NULL	ENSG00000150076		0.294	C10orf68-002	PUTATIVE	basic|appris_candidate	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000314000.2	13	0.00	0	G			33134181	33134181	+1	no_errors	ENST00000375025	ensembl	human	known	69_37n	frame_shift_del	4	42.86	3	DEL	0.000	-
CCDC7	79741	genome.wustl.edu	37	10	33134185	33134186	+	Frame_Shift_Ins	INS	-	-	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr10:33134185_33134186insT	ENST00000375028.3	+	13	1178_1179	c.1108_1109insT	c.(1108-1110)cacfs	p.H370fs	C10orf68_ENST00000375030.2_Intron|C10orf68_ENST00000375025.4_Frame_Shift_Ins_p.H430fs			Q9H943	CJ068_HUMAN		374										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						TGATAAGGAACACTTAGCAGAT	0.292																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0																														Exception_encountered	10.37:g.33134185_33134186insT	ENSP00000364168:p.His370fs		B0QZ71|Q08AN7|Q8N7T7	Frame_Shift_Ins	INS	NULL	p.H430fs	ENST00000375028.3	37	c.1288_1289		10																																																																																			C10orf68	-	NULL	ENSG00000150076		0.292	C10orf68-002	PUTATIVE	basic|appris_candidate	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000314000.2	13	0.00	0	-			33134185	33134186	+1	no_errors	ENST00000375025	ensembl	human	known	69_37n	frame_shift_ins	4	42.86	3	INS	0.000:0.000	T
CLTCL1	8218	genome.wustl.edu	37	22	19203720	19203720	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr22:19203720G>A	ENST00000263200.10	-	19	3038	c.2966C>T	c.(2965-2967)tCg>tTg	p.S989L	CLTCL1_ENST00000427926.1_Missense_Mutation_p.S989L|CLTCL1_ENST00000353891.5_Missense_Mutation_p.S989L	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	989	Heavy chain arm.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					GACAGTGACCGAAATCTCTTC	0.423			T	?	ALCL																																	dbGAP		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													99.0	95.0	96.0					22																	19203720		1889	4115	6004	-	-	-	SO:0001583	missense	0				CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.2966C>T	22.37:g.19203720G>A	ENSP00000445677:p.Ser989Leu		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.S989L	ENST00000263200.10	37	c.2966	CCDS46662.1	22	.	.	.	.	.	.	.	.	.	.	G	16.82	3.227557	0.58668	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.22539	1.95;1.95;1.95	3.4	3.4	0.38934	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000006	T	0.52693	0.1750	M	0.90814	3.15	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.87578	0.882;0.998	T	0.64719	-0.6341	10	0.51188	T	0.08	-7.4877	15.3273	0.74176	0.0:0.0:1.0:0.0	.	989;989	P53675-2;P53675	.;CLH2_HUMAN	L	989	ENSP00000439662:S989L;ENSP00000445677:S989L;ENSP00000441158:S989L	ENSP00000445677:S989L	S	-	2	0	CLTCL1	17583720	1.000000	0.71417	0.057000	0.19452	0.256000	0.26092	5.889000	0.69766	1.884000	0.54569	0.563000	0.77884	TCG	CLTCL1	-	pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	ENSG00000070371		0.423	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CLTCL1	HGNC	protein_coding	OTTHUMT00000316397.5	105	0.00	0	G	NM_007098		19203720	19203720	-1	no_errors	ENST00000263200	ensembl	human	known	69_37n	missense	56	46.67	49	SNP	0.996	A
COL6A5	256076	genome.wustl.edu	37	3	130116502	130116502	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr3:130116502C>T	ENST00000432398.2	+	9	4138	c.3644C>T	c.(3643-3645)cCc>cTc	p.P1215L	COL6A5_ENST00000265379.6_Missense_Mutation_p.P1215L	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1215	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CAGGGCCACCCCCAGCTGGAA	0.537																																						dbGAP											0													48.0	46.0	47.0					3																	130116502		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.3644C>T	3.37:g.130116502C>T	ENSP00000390895:p.Pro1215Leu		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.P1215L	ENST00000432398.2	37	c.3644		3	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049300	0.36181	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.37058	1.22;1.22	5.25	4.38	0.52667	.	.	.	.	.	T	0.48314	0.1493	L	0.56769	1.78	0.09310	N	1	P	0.51057	0.941	P	0.58520	0.84	T	0.29305	-1.0016	9	0.37606	T	0.19	.	8.6488	0.34022	0.1507:0.7681:0.0:0.0812	.	1215	A8TX70-2	.	L	1215	ENSP00000390895:P1215L;ENSP00000265379:P1215L	ENSP00000265379:P1215L	P	+	2	0	COL6A5	131599192	0.000000	0.05858	0.911000	0.35937	0.923000	0.55619	0.584000	0.23864	1.201000	0.43203	-0.291000	0.09656	CCC	COL6A5	-	NULL	ENSG00000172752		0.537	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		135	0.00	0	C	NM_153264		130116502	130116502	+1	no_errors	ENST00000265379	ensembl	human	known	69_37n	missense	127	39.91	85	SNP	0.043	T
CTCF	10664	genome.wustl.edu	37	16	67654645	67654645	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr16:67654645C>G	ENST00000264010.4	+	6	1576	c.1132C>G	c.(1132-1134)Ccg>Gcg	p.P378A	CTCF_ENST00000401394.1_Missense_Mutation_p.P50A	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	378					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		TGGAGAGCGTCCGTTTCAGTG	0.438																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											0													166.0	127.0	140.0					16																	67654645		2198	4300	6498	-	-	-	SO:0001583	missense	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.1132C>G	16.37:g.67654645C>G	ENSP00000264010:p.Pro378Ala		B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P378A	ENST00000264010.4	37	c.1132	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.488339	0.96323	.	.	ENSG00000102974	ENST00000264010;ENST00000401394	T;T	0.28255	1.62;1.62	6.06	6.06	0.98353	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000002	T	0.65688	0.2715	M	0.89214	3.015	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.69738	-0.5064	10	0.87932	D	0	-1.5756	20.6208	0.99490	0.0:1.0:0.0:0.0	.	378	P49711	CTCF_HUMAN	A	378;50	ENSP00000264010:P378A;ENSP00000384707:P50A	ENSP00000264010:P378A	P	+	1	0	CTCF	66212146	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	CCG	CTCF	-	pfscan_Znf_C2H2	ENSG00000102974		0.438	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	181	0.00	0	C	NM_006565		67654645	67654645	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	missense	41	70.55	103	SNP	1.000	G
CTIF	9811	genome.wustl.edu	37	18	46163042	46163043	+	Frame_Shift_Ins	INS	-	-	C			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr18:46163042_46163043insC	ENST00000256413.3	+	3	533_534	c.238_239insC	c.(238-240)gccfs	p.A80fs	CTIF_ENST00000382998.4_Frame_Shift_Ins_p.A80fs	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	80	Interaction with NCBP1/CBP80.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						CCGAGGGCGAGCCCCCCCACAG	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.245dupC	18.37:g.46163049_46163049dupC	ENSP00000256413:p.Ala80fs		B3KTR8|Q8IVD5	Frame_Shift_Ins	INS	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.Q83fs	ENST00000256413.3	37	c.238_239	CCDS11935.1	18																																																																																			CTIF	-	NULL	ENSG00000134030		0.644	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTIF	HGNC	protein_coding	OTTHUMT00000255907.1	33	0.00	0	-	NM_014772		46163042	46163043	+1	no_errors	ENST00000382998	ensembl	human	known	69_37n	frame_shift_ins	35	10.26	4	INS	0.986:0.778	C
DIP2C	22982	genome.wustl.edu	37	10	323355	323355	+	Silent	SNP	G	G	A			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr10:323355G>A	ENST00000280886.6	-	37	4668	c.4581C>T	c.(4579-4581)atC>atT	p.I1527I	AL603831.1_ENST00000579524.1_RNA	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1527						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		CACGGGAGTTGATGGGGATGA	0.582																																						dbGAP											0													145.0	115.0	125.0					10																	323355		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.4581C>T	10.37:g.323355G>A			B4DPI5|Q5SS78	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.I1527	ENST00000280886.6	37	c.4581	CCDS7054.1	10																																																																																			DIP2C	-	NULL	ENSG00000151240		0.582	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	HGNC	protein_coding	OTTHUMT00000046389.1	137	0.00	0	G	NM_014974		323355	323355	-1	no_errors	ENST00000280886	ensembl	human	known	69_37n	silent	104	28.57	42	SNP	1.000	A
GPAT2	150763	genome.wustl.edu	37	2	96688929	96688929	+	Missense_Mutation	SNP	G	G	A	rs201647131	byFrequency	TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr2:96688929G>A	ENST00000434632.1	-	20	2533	c.2074C>T	c.(2074-2076)Cgc>Tgc	p.R692C	GPAT2_ENST00000359548.4_Missense_Mutation_p.R692C|GPAT2_ENST00000377137.3_Intron|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Missense_Mutation_p.R621C			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	692					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.R692C(3)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTGAGCAGGCGGCAGAGGAAA	0.652																																						dbGAP											3	Substitution - Missense(3)	large_intestine(1)|NS(1)|skin(1)											14.0	17.0	16.0					2																	96688929		1816	4045	5861	-	-	-	SO:0001583	missense	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2074C>T	2.37:g.96688929G>A	ENSP00000389395:p.Arg692Cys		Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	smart_Acyltransferase	p.R692C	ENST00000434632.1	37	c.2074	CCDS42714.1	2	152	0.0695970695970696	8	0.016260162601626018	16	0.04419889502762431	27	0.0472027972027972	101	0.13324538258575197	g	16.45	3.127649	0.56721	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.80480	-1.38;-1.38;-0.41	5.44	5.44	0.79542	.	0.381151	0.27411	N	0.019488	T	0.02727	0.0082	L	0.50333	1.59	0.80722	D	1	P;D;P;B	0.54207	0.584;0.965;0.953;0.354	B;B;B;B	0.42062	0.093;0.374;0.267;0.065	T	0.41840	-0.9486	10	0.66056	D	0.02	-11.9956	16.7485	0.85479	0.0:0.0:1.0:0.0	.	621;698;692;621	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	C	692;692;621	ENSP00000352547:R692C;ENSP00000389395:R692C;ENSP00000393770:R621C	ENSP00000352547:R692C	R	-	1	0	GPAT2	96052656	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.041000	0.49807	2.569000	0.86673	0.637000	0.83480	CGC	GPAT2	-	NULL	ENSG00000186281		0.652	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	64	0.00	0	G	NM_207328		96688929	96688929	-1	no_errors	ENST00000359548	ensembl	human	known	69_37n	missense	76	10.47	9	SNP	1.000	A
DOCK10	55619	genome.wustl.edu	37	2	225729785	225729785	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr2:225729785C>T	ENST00000258390.7	-	12	1344	c.1277G>A	c.(1276-1278)aGt>aAt	p.S426N	DOCK10_ENST00000409592.3_Missense_Mutation_p.S420N	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	426					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AAGTGCCACACTCACAAAAAA	0.393																																						dbGAP											0													93.0	90.0	91.0					2																	225729785		1898	4128	6026	-	-	-	SO:0001583	missense	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.1277G>A	2.37:g.225729785C>T	ENSP00000258390:p.Ser426Asn		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S426N	ENST00000258390.7	37	c.1277	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566797	0.65651	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.54866	0.55;0.55	5.77	5.77	0.91146	.	0.089083	0.85682	D	0.000000	T	0.72399	0.3455	M	0.68593	2.085	0.41683	D	0.989308	D;D;D	0.76494	0.998;0.999;0.997	D;D;D	0.85130	0.993;0.997;0.989	T	0.67841	-0.5566	10	0.36615	T	0.2	.	20.3472	0.98799	0.0:1.0:0.0:0.0	.	426;426;420	Q96BY6;Q96BY6-2;B3FL70	DOC10_HUMAN;.;.	N	420;426	ENSP00000386694:S420N;ENSP00000258390:S426N	ENSP00000258390:S426N	S	-	2	0	DOCK10	225438029	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.847000	0.62867	2.890000	0.99128	0.650000	0.86243	AGT	DOCK10	-	NULL	ENSG00000135905		0.393	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	89	0.00	0	C			225729785	225729785	-1	no_errors	ENST00000258390	ensembl	human	known	69_37n	missense	28	42.86	21	SNP	1.000	T
GRHL2	79977	genome.wustl.edu	37	8	102661656	102661656	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr8:102661656A>T	ENST00000251808.3	+	14	1965	c.1627A>T	c.(1627-1629)Agg>Tgg	p.R543W	GRHL2_ENST00000395927.1_Missense_Mutation_p.R527W|GRHL2_ENST00000517674.1_Intron	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	543					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			CTTGTACGTGAGGAAGGAGAC	0.542																																						dbGAP											0													201.0	148.0	166.0					8																	102661656		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.1627A>T	8.37:g.102661656A>T	ENSP00000251808:p.Arg543Trp		A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	pfam_CP2	p.R543W	ENST00000251808.3	37	c.1627	CCDS34931.1	8	.	.	.	.	.	.	.	.	.	.	A	21.2	4.106027	0.77096	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.12774	2.65;2.65	4.89	2.36	0.29203	.	0.044728	0.85682	D	0.000000	T	0.36468	0.0968	M	0.84219	2.685	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	T	0.09207	-1.0685	10	0.87932	D	0	-29.0943	9.6222	0.39727	0.6585:0.3415:0.0:0.0	.	543	Q6ISB3	GRHL2_HUMAN	W	543;527;543	ENSP00000251808:R543W;ENSP00000379260:R527W	ENSP00000251808:R543W	R	+	1	2	GRHL2	102730832	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.552000	0.36244	0.305000	0.22832	0.533000	0.62120	AGG	GRHL2	-	NULL	ENSG00000083307		0.542	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL2	HGNC	protein_coding	OTTHUMT00000313882.1	135	0.00	0	A	NM_024915		102661656	102661656	+1	no_errors	ENST00000251808	ensembl	human	known	69_37n	missense	114	43.56	88	SNP	1.000	T
HLA-DRB5	3127	genome.wustl.edu	37	6	32497905	32497905	+	Silent	SNP	G	G	T	rs71549219	byFrequency	TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr6:32497905G>T	ENST00000374975.3	-	1	159	c.97C>A	c.(97-99)Cga>Aga	p.R33R		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						CACTTACGTCGGGTGTCCCCA	0.532																																						dbGAP											0													102.0	104.0	103.0					6																	32497905		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.97C>A	6.37:g.32497905G>T				Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.R33	ENST00000374975.3	37	c.97	CCDS4751.1	6																																																																																			HLA-DRB5	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000198502		0.532	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB5	HGNC	protein_coding	OTTHUMT00000076022.2	121	0.82	1	G	NM_002125		32497905	32497905	-1	no_errors	ENST00000374975	ensembl	human	known	69_37n	silent	37	50.67	38	SNP	0.000	T
IGSF9B	22997	genome.wustl.edu	37	11	133790102	133790102	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr11:133790102G>C	ENST00000321016.8	-	18	3748	c.3518C>G	c.(3517-3519)cCc>cGc	p.P1173R	IGSF9B_ENST00000533871.2_Missense_Mutation_p.P1173R			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1173	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCGGGGCTGGGGCTCATACCA	0.697																																						dbGAP											0													26.0	32.0	30.0					11																	133790102		1889	4089	5978	-	-	-	SO:0001583	missense	0			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3518C>G	11.37:g.133790102G>C	ENSP00000317980:p.Pro1173Arg		G5EA26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P1173R	ENST00000321016.8	37	c.3518		11	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681454	0.29872	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.64991	0.2;-0.13	5.08	5.08	0.68730	.	0.000000	0.44285	D	0.000464	T	0.44871	0.1314	N	0.08118	0	0.33284	D	0.562634	P	0.44877	0.845	B	0.41813	0.367	T	0.63528	-0.6617	10	0.72032	D	0.01	.	13.7744	0.63044	0.0:0.1542:0.8458:0.0	.	1173	Q9UPX0	TUTLB_HUMAN	R	1173;1015	ENSP00000317980:P1173R;ENSP00000436552:P1015R	ENSP00000317980:P1173R	P	-	2	0	IGSF9B	133295312	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.468000	0.60162	2.358000	0.79984	0.455000	0.32223	CCC	IGSF9B	-	NULL	ENSG00000080854		0.697	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding		8	0.00	0	G	XM_290502		133790102	133790102	-1	no_errors	ENST00000321016	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	1.000	C
IPPK	64768	genome.wustl.edu	37	9	95381788	95381788	+	Silent	SNP	A	A	G			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr9:95381788A>G	ENST00000287996.3	-	12	1506	c.1230T>C	c.(1228-1230)tcT>tcC	p.S410S	IPPK_ENST00000486841.1_5'UTR|IPPK_ENST00000375522.1_Silent_p.S82S|CENPP_ENST00000375587.3_3'UTR	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	410					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						GCAGACAGGGAGACAGTGCAA	0.557																																						dbGAP											0													65.0	45.0	52.0					9																	95381788		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.1230T>C	9.37:g.95381788A>G			Q5T9F7|Q9H7V8	Silent	SNP	pfam_Ins_P5_2-kin	p.S410	ENST00000287996.3	37	c.1230	CCDS6699.1	9																																																																																			IPPK	-	pfam_Ins_P5_2-kin	ENSG00000127080		0.557	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPPK	HGNC	protein_coding	OTTHUMT00000053101.1	24	0.00	0	A	NM_022755		95381788	95381788	-1	no_errors	ENST00000287996	ensembl	human	known	69_37n	silent	27	40.82	20	SNP	0.979	G
KCNV1	27012	genome.wustl.edu	37	8	110980575	110980575	+	Silent	SNP	C	C	T	rs201081474		TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr8:110980575C>T	ENST00000524391.1	-	4	2277	c.1245G>A	c.(1243-1245)tcG>tcA	p.S415S	KCNV1_ENST00000297404.1_Silent_p.S415S			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	415					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CAAGAATTCCCGATAATATAC	0.478																																						dbGAP											0													110.0	112.0	111.0					8																	110980575		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.1245G>A	8.37:g.110980575C>T			Q9UHJ4	Silent	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.S415	ENST00000524391.1	37	c.1245	CCDS6314.1	8																																																																																			KCNV1	-	pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl,prints_K_chnl_volt-dep_Kv9	ENSG00000164794		0.478	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1	81	0.00	0	C	NM_014379		110980575	110980575	-1	no_errors	ENST00000297404	ensembl	human	known	69_37n	silent	41	32.79	20	SNP	0.234	T
KCTD7	154881	genome.wustl.edu	37	7	66103260	66103260	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr7:66103260G>T	ENST00000275532.3	+	3	519	c.335G>T	c.(334-336)cGc>cTc	p.R112L	KCTD7_ENST00000443322.1_Missense_Mutation_p.R112L	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	112	BTB.				cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)		p.R112H(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						AATTTCCTGCGCTCAGGGGAC	0.567																																						dbGAP											1	Substitution - Missense(1)	lung(1)											104.0	97.0	99.0					7																	66103260		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.335G>T	7.37:g.66103260G>T	ENSP00000275532:p.Arg112Leu		A4D2M4|Q8IVR0	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.R112L	ENST00000275532.3	37	c.335	CCDS5534.1	7	.	.	.	.	.	.	.	.	.	.	g	34	5.365833	0.95900	.	.	ENSG00000243335	ENST00000275532;ENST00000443322	T;T	0.54675	0.56;0.56	5.61	5.61	0.85477	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	.	.	.	.	T	0.80171	0.4574	M	0.92970	3.365	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.84681	0.0717	9	0.87932	D	0	.	18.6402	0.91393	0.0:0.0:1.0:0.0	.	112	Q96MP8	KCTD7_HUMAN	L	112	ENSP00000275532:R112L;ENSP00000411624:R112L	ENSP00000275532:R112L	R	+	2	0	KCTD7	65740695	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.152000	0.94680	2.656000	0.90262	0.561000	0.74099	CGC	KCTD7	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000243335		0.567	KCTD7-001	KNOWN	basic|CCDS	protein_coding	KCTD7	HGNC	protein_coding	OTTHUMT00000251733.2	87	0.00	0	G	NM_153033		66103260	66103260	+1	no_errors	ENST00000275532	ensembl	human	known	69_37n	missense	75	36.97	44	SNP	1.000	T
MACF1	23499	genome.wustl.edu	37	1	39853331	39853331	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr1:39853331G>C	ENST00000372915.3	+	57	14919	c.14832G>C	c.(14830-14832)gaG>gaC	p.E4944D	MACF1_ENST00000567887.1_Missense_Mutation_p.E4976D|MACF1_ENST00000545844.1_Missense_Mutation_p.E2877D|MACF1_ENST00000564288.1_Missense_Mutation_p.E4939D|MACF1_ENST00000539005.1_Missense_Mutation_p.E2856D|MACF1_ENST00000361689.2_Missense_Mutation_p.E2877D|MACF1_ENST00000289893.4_Missense_Mutation_p.E3379D|MACF1_ENST00000317713.7_Missense_Mutation_p.E2877D			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	4944					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGCAGCTAGAGTCCAGTCTCC	0.458																																						dbGAP											0													55.0	56.0	56.0					1																	39853331		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.14832G>C	1.37:g.39853331G>C	ENSP00000362006:p.Glu4944Asp		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E2877D	ENST00000372915.3	37	c.8631		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.83|10.83	1.461792|1.461792	0.26248|0.26248	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.55413|.	0.52;0.52;0.52;0.52;0.52;0.52|.	6.17|6.17	1.23|1.23	0.21249|0.21249	.|.	0.000000|.	0.64402|.	D|.	0.000005|.	T|T	0.60983|0.60983	0.2311|0.2311	M|M	0.64170|0.64170	1.965|1.965	0.80722|0.80722	D|D	1|1	B;P;B|.	0.39094|.	0.22;0.659;0.311|.	B;B;B|.	0.41036|.	0.075;0.346;0.233|.	T|T	0.54899|0.54899	-0.8224|-0.8224	10|5	0.46703|.	T|.	0.11|.	.|.	9.9674|9.9674	0.41732|0.41732	0.4512:0.0:0.5488:0.0|0.4512:0.0:0.5488:0.0	.|.	4944;2877;2821|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	D|L	2877;4944;2877;2877;2856;3379|1990	ENSP00000439537:E2877D;ENSP00000362006:E4944D;ENSP00000354573:E2877D;ENSP00000313438:E2877D;ENSP00000444364:E2856D;ENSP00000289893:E3379D|.	ENSP00000289893:E3379D|.	E|V	+|+	3|1	2|0	MACF1|MACF1	39625918|39625918	1.000000|1.000000	0.71417|0.71417	0.959000|0.959000	0.39883|0.39883	0.890000|0.890000	0.51754|0.51754	0.841000|0.841000	0.27613|0.27613	-0.010000|-0.010000	0.14271|0.14271	-0.768000|-0.768000	0.03414|0.03414	GAG|GTC	MACF1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000127603		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	81	0.00	0	G	NM_033044		39853331	39853331	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	0.959	C
MADCAM1	8174	genome.wustl.edu	37	19	501786	501786	+	Missense_Mutation	SNP	C	C	A	rs77264553	byFrequency	TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr19:501786C>A	ENST00000215637.3	+	4	831	c.785C>A	c.(784-786)cCg>cAg	p.P262Q	MADCAM1_ENST00000382683.4_Intron|MADCAM1_ENST00000346144.4_Intron|MADCAM1_ENST00000587541.1_Missense_Mutation_p.P43Q|AC005775.2_ENST00000592413.1_RNA	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	262	5.5 X 8 AA tandem repeats of [PS]-P-D-T- T-S-[QP]-E.|Mucin-like.				aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCACCTCCCCGGAGCCTCCC	0.726																																						dbGAP											0													21.0	23.0	22.0					19																	501786		2174	4254	6428	-	-	-	SO:0001583	missense	0			U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.785C>A	19.37:g.501786C>A	ENSP00000215637:p.Pro262Gln		A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	pfam_Adhes-Ig-like,smart_Ig_sub,pfscan_Ig-like	p.P262Q	ENST00000215637.3	37	c.785	CCDS12028.1	19	.	.	.	.	.	.	.	.	.	.	c	9.375	1.071453	0.20147	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637	T	0.12147	2.71	3.07	-3.57	0.04612	.	3.584140	0.00988	N	0.003486	T	0.04907	0.0132	N	0.03608	-0.345	0.80722	P	0.0	B	0.33073	0.396	B	0.12837	0.008	T	0.24584	-1.0156	9	0.72032	D	0.01	.	3.8366	0.08897	0.3193:0.4698:0.0:0.2109	.	262	Q13477	MADCA_HUMAN	Q	286;278;270;262	ENSP00000215637:P262Q	ENSP00000215637:P262Q	P	+	2	0	MADCAM1	452786	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.770000	0.04705	-0.633000	0.05545	-0.962000	0.02626	CCG	MADCAM1	-	NULL	ENSG00000099866		0.726	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MADCAM1	HGNC	protein_coding	OTTHUMT00000451884.1	13	0.00	0	C	NM_130760		501786	501786	+1	no_errors	ENST00000215637	ensembl	human	known	69_37n	missense	40	29.82	17	SNP	0.000	A
MEPCE	56257	genome.wustl.edu	37	7	100028415	100028415	+	Silent	SNP	T	T	A			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr7:100028415T>A	ENST00000310512.2	+	1	1162	c.774T>A	c.(772-774)acT>acA	p.T258T	MEPCE_ENST00000414441.1_5'UTR|ZCWPW1_ENST00000360951.4_5'Flank|ZCWPW1_ENST00000324725.6_5'Flank|ZCWPW1_ENST00000398027.2_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	258					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CACTCAAGACTGGTCGGAAGC	0.597																																						dbGAP											0													127.0	138.0	134.0					7																	100028415		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.774T>A	7.37:g.100028415T>A			B3KP86|D6W5V7|Q9NPD4	Silent	SNP	pfam_Bin3	p.T258	ENST00000310512.2	37	c.774	CCDS5693.1	7																																																																																			MEPCE	-	NULL	ENSG00000146834		0.597	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPCE	HGNC	protein_coding	OTTHUMT00000339135.1	23	0.00	0	T			100028415	100028415	+1	no_errors	ENST00000310512	ensembl	human	known	69_37n	silent	23	35.14	13	SNP	1.000	A
MFSD11	79157	genome.wustl.edu	37	17	74772590	74772590	+	Silent	SNP	C	C	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr17:74772590C>T	ENST00000588460.1	+	12	3194	c.1152C>T	c.(1150-1152)agC>agT	p.S384S	MFSD11_ENST00000336509.4_Silent_p.S384S|MFSD11_ENST00000590514.1_Silent_p.S384S|MFSD11_ENST00000590070.1_3'UTR|MFSD11_ENST00000593181.1_Silent_p.S332S|MFSD11_ENST00000586622.1_Silent_p.S384S|MFSD11_ENST00000355954.3_Silent_p.S332S	NM_001242534.1	NP_001229463.1	O43934	MFS11_HUMAN	major facilitator superfamily domain containing 11	384						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)	17						CTGAAGACAGCGCCCCAGCAT	0.448																																						dbGAP											0													177.0	168.0	171.0					17																	74772590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC002753	CCDS11750.1, CCDS56045.1	17q25.1	2012-03-09			ENSG00000092931	ENSG00000092931			25458	protein-coding gene	gene with protein product						9358160	Standard	NM_001242532		Approved	FLJ22196, FLJ20226	uc002jte.3	O43934		ENST00000588460.1:c.1152C>T	17.37:g.74772590C>T			O43442|Q9NXI5	Missense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt	p.R139C	ENST00000588460.1	37	c.415	CCDS11750.1	17																																																																																			MFSD11	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000092931		0.448	MFSD11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MFSD11	HGNC	protein_coding	OTTHUMT00000451516.1	103	0.00	0	C	NM_024311		74772590	74772590	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000585865	ensembl	human	putative	69_37n	missense	114	37.70	69	SNP	0.218	T
NDNF	79625	genome.wustl.edu	37	4	121966920	121966920	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr4:121966920G>A	ENST00000379692.4	-	2	599	c.73C>T	c.(73-75)Cgg>Tgg	p.R25W		NM_024574.3	NP_078850.3	Q8TB73	NDNF_HUMAN	neuron-derived neurotrophic factor	25					cell growth (GO:0016049)|extracellular matrix organization (GO:0030198)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron projection development (GO:0010976)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(3)|skin(1)|urinary_tract(1)	29						TCCTCATCCCGGGTGGGTAAC	0.473																																						dbGAP											0													50.0	51.0	51.0					4																	121966920		1933	4151	6084	-	-	-	SO:0001583	missense	0			BC019351	CCDS3717.2	4q27	2011-07-05	2011-07-05	2011-07-05	ENSG00000173376	ENSG00000173376			26256	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 31"""	C4orf31		12975309, 20969804	Standard	NM_024574		Approved	FLJ23191	uc003idq.1	Q8TB73	OTTHUMG00000132973	ENST00000379692.4:c.73C>T	4.37:g.121966920G>A	ENSP00000369014:p.Arg25Trp		A8K0Q0|Q6UWE5|Q9H5P7	Missense_Mutation	SNP	pfam_DUF2369,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.R25W	ENST00000379692.4	37	c.73	CCDS3717.2	4	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104846	0.77096	.	.	ENSG00000173376	ENST00000379692;ENST00000515757;ENST00000511408	.	.	.	5.72	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.74015	0.3661	L	0.60455	1.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	T	0.76708	-0.2860	9	0.72032	D	0.01	-15.024	12.7212	0.57144	0.0:0.0:0.4933:0.5067	.	25	Q8TB73	NDNF_HUMAN	W	25	.	ENSP00000369014:R25W	R	-	1	2	NDNF	122186370	0.998000	0.40836	0.992000	0.48379	0.982000	0.71751	2.289000	0.43523	1.407000	0.46875	0.655000	0.94253	CGG	NDNF	-	NULL	ENSG00000173376		0.473	NDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDNF	HGNC	protein_coding	OTTHUMT00000256532.2	42	0.00	0	G	NM_024574		121966920	121966920	-1	no_errors	ENST00000379692	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	0.979	A
NEK8	284086	genome.wustl.edu	37	17	27068449	27068449	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr17:27068449G>C	ENST00000268766.6	+	14	1944	c.1910G>C	c.(1909-1911)tGg>tCg	p.W637S	AC010761.6_ENST00000582536.1_RNA|AC010761.6_ENST00000584779.1_RNA|TRAF4_ENST00000262395.5_5'Flank|TRAF4_ENST00000262396.6_5'Flank|TRAF4_ENST00000444415.3_5'Flank	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	637					organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					GTGTACTCTTGGGGCAAAGGG	0.612																																					NSCLC(6;19 293 14866 25253 49845)	dbGAP											0													80.0	66.0	71.0					17																	27068449		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.1910G>C	17.37:g.27068449G>C	ENSP00000268766:p.Trp637Ser		A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Reg_chr_condens,prints_Ser-Thr/Tyr_kinase_cat_dom	p.W637S	ENST00000268766.6	37	c.1910	CCDS32597.1	17	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433893	0.83776	.	.	ENSG00000160602	ENST00000268766	D	0.92495	-3.05	5.43	5.43	0.79202	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.96374	0.8817	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96785	0.9578	10	0.87932	D	0	.	18.2463	0.89986	0.0:0.0:1.0:0.0	.	637	Q86SG6	NEK8_HUMAN	S	637	ENSP00000268766:W637S	ENSP00000268766:W637S	W	+	2	0	NEK8	24092576	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.847000	0.99503	2.547000	0.85894	0.655000	0.94253	TGG	NEK8	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	ENSG00000160602		0.612	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK8	HGNC	protein_coding	OTTHUMT00000446467.2	80	0.00	0	G			27068449	27068449	+1	no_errors	ENST00000268766	ensembl	human	known	69_37n	missense	21	54.17	26	SNP	1.000	C
OR6C2	341416	genome.wustl.edu	37	12	55846918	55846918	+	Silent	SNP	A	A	G			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr12:55846918A>G	ENST00000322678.1	+	1	921	c.921A>G	c.(919-921)gcA>gcG	p.A307A	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	307					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						AGAGGATTGCATTTCTCTCAA	0.388																																						dbGAP											0													60.0	58.0	59.0					12																	55846918		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.921A>G	12.37:g.55846918A>G				Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A307	ENST00000322678.1	37	c.921	CCDS31824.1	12																																																																																			OR6C2	-	NULL	ENSG00000179695		0.388	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C2	HGNC	protein_coding	OTTHUMT00000406676.1	171	0.00	0	A	NM_054105		55846918	55846918	+1	no_errors	ENST00000322678	ensembl	human	known	69_37n	silent	131	38.60	83	SNP	0.000	G
PADI4	23569	genome.wustl.edu	37	1	17668843	17668843	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr1:17668843C>T	ENST00000375448.4	+	8	907	c.881C>T	c.(880-882)gCg>gTg	p.A294V	AC004824.2_ENST00000602074.1_Intron	NM_012387.2	NP_036519.2	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV	294					cellular protein modification process (GO:0006464)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|histone citrullination (GO:0036414)|histone H3-R26 citrullination (GO:0036413)|innate immune response (GO:0045087)|nucleosome assembly (GO:0006334)|protein citrullination (GO:0018101)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	arginine deiminase activity (GO:0016990)|calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(2)|urinary_tract(3)	26		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	TTCCGCGTGGCGCCCTGGATC	0.677																																						dbGAP											0													57.0	54.0	55.0					1																	17668843		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB017919	CCDS180.1	1p36.13	2014-06-06	2003-02-12		ENSG00000159339	ENSG00000159339	3.5.3.15	"""Peptidyl arginine deiminases"""	18368	protein-coding gene	gene with protein product		605347	"""peptidyl arginine deiminase, type V"""	PADI5		10488123	Standard	NM_012387		Approved	PAD, PDI5, PDI4	uc001baj.2	Q9UM07	OTTHUMG00000002371	ENST00000375448.4:c.881C>T	1.37:g.17668843C>T	ENSP00000364597:p.Ala294Val		A8K392|B2RBW0|Q5VTZ8|Q70SX4	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.A294V	ENST00000375448.4	37	c.881	CCDS180.1	1	.	.	.	.	.	.	.	.	.	.	c	27.7	4.853501	0.91355	.	.	ENSG00000159339	ENST00000375448	T	0.32753	1.44	4.97	4.97	0.65823	Protein-arginine deiminase, C-terminal (1);	0.059587	0.64402	D	0.000002	T	0.65595	0.2706	M	0.93594	3.435	0.42398	D	0.992554	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.76315	-0.3004	10	0.87932	D	0	-30.1701	15.0236	0.71650	0.0:1.0:0.0:0.0	.	294;294	A8K392;Q9UM07	.;PADI4_HUMAN	V	294	ENSP00000364597:A294V	ENSP00000364597:A294V	A	+	2	0	PADI4	17541430	1.000000	0.71417	0.984000	0.44739	0.923000	0.55619	6.040000	0.70980	2.312000	0.78011	0.555000	0.69702	GCG	PADI4	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub	ENSG00000159339		0.677	PADI4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI4	HGNC	protein_coding	OTTHUMT00000006799.1	57	0.00	0	C	NM_012387		17668843	17668843	+1	no_errors	ENST00000375448	ensembl	human	known	69_37n	missense	31	49.18	30	SNP	0.995	T
PALM3	342979	genome.wustl.edu	37	19	14165287	14165287	+	Silent	SNP	C	C	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr19:14165287C>T	ENST00000340790.4	-	6	1151	c.1152G>A	c.(1150-1152)acG>acA	p.T384T		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	384	Glu-rich.				negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						CGCCTCCTCCCGTCTTGGCCC	0.627																																						dbGAP											0													187.0	144.0	157.0					19																	14165287		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.1152G>A	19.37:g.14165287C>T				Silent	SNP	NULL	p.T384	ENST00000340790.4	37	c.1152	CCDS46001.1	19																																																																																			PALM3	-	NULL	ENSG00000187867		0.627	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALM3	HGNC	protein_coding	OTTHUMT00000458540.1	169	0.00	0	C	NM_001145028		14165287	14165287	-1	no_errors	ENST00000340790	ensembl	human	known	69_37n	silent	251	23.40	77	SNP	0.000	T
PLXNA1	5361	genome.wustl.edu	37	3	126736736	126736736	+	Splice_Site	SNP	G	G	A			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr3:126736736G>A	ENST00000393409.2	+	18	3660		c.e18+1		PLXNA1_ENST00000251772.4_Splice_Site	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1						axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		CAAGGTCACGGTGCGTCTGTC	0.657																																						dbGAP											0													50.0	46.0	47.0					3																	126736736		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3660+1G>A	3.37:g.126736736G>A				Splice_Site	SNP	-	e18+1	ENST00000393409.2	37	c.3660+1	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	G	27.7	4.855865	0.91355	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	.	.	.	4.49	4.49	0.54785	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3544	0.87331	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLXNA1	128219426	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.621000	0.98376	2.316000	0.78162	0.591000	0.81541	.	PLXNA1	-	-	ENSG00000114554		0.657	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	10	0.00	0	G	NM_032242	Intron	126736736	126736736	+1	no_errors	ENST00000393409	ensembl	human	known	69_37n	splice_site	7	53.33	8	SNP	1.000	A
PTCHD1	139411	genome.wustl.edu	37	X	23397729	23397729	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chrX:23397729A>T	ENST00000379361.4	+	2	1233	c.373A>T	c.(373-375)Atc>Ttc	p.I125F		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	125					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						TGTCACCAAGATCCAGGTTCC	0.398																																						dbGAP											0													75.0	69.0	71.0					X																	23397729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.373A>T	X.37:g.23397729A>T	ENSP00000368666:p.Ile125Phe		B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.I125F	ENST00000379361.4	37	c.373	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	A	16.26	3.073336	0.55646	.	.	ENSG00000165186	ENST00000379361	D	0.86030	-2.06	5.06	5.06	0.68205	.	0.110120	0.64402	D	0.000004	T	0.79155	0.4398	L	0.43923	1.385	0.58432	D	0.99999	P;B	0.39665	0.682;0.079	B;B	0.33690	0.168;0.077	T	0.81028	-0.1118	10	0.52906	T	0.07	.	14.135	0.65281	1.0:0.0:0.0:0.0	.	20;125	Q96NR3-3;Q96NR3	.;PTHD1_HUMAN	F	125	ENSP00000368666:I125F	ENSP00000368666:I125F	I	+	1	0	PTCHD1	23307650	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.455000	0.73497	1.983000	0.57843	0.486000	0.48141	ATC	PTCHD1	-	pfam_Patched	ENSG00000165186		0.398	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	45	0.00	0	A	NM_173495		23397729	23397729	+1	no_errors	ENST00000379361	ensembl	human	known	69_37n	missense	49	26.87	18	SNP	1.000	T
SKIDA1	387640	genome.wustl.edu	37	10	21804124	21804124	+	Frame_Shift_Del	DEL	A	A	-			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr10:21804124delA	ENST00000449193.2	-	4	4880	c.2628delT	c.(2626-2628)tctfs	p.S876fs	SKIDA1_ENST00000444772.3_Frame_Shift_Del_p.S797fs	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	795						nucleus (GO:0005634)											GAGGAGTTTGAGAATCCTTAG	0.428																																						dbGAP											0													65.0	60.0	61.0					10																	21804124		1837	4094	5931	-	-	-	SO:0001589	frameshift_variant	0			AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.2628delT	10.37:g.21804124delA	ENSP00000410041:p.Ser876fs		B1ANA5|Q6ZMX4|Q8N3C3	Frame_Shift_Del	DEL	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.Q877fs	ENST00000449193.2	37	c.2628	CCDS44363.1	10																																																																																			SKIDA1	-	NULL	ENSG00000180592		0.428	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	HGNC	protein_coding	OTTHUMT00000286950.2	107	0.00	0	A	NM_207371		21804124	21804124	-1	no_errors	ENST00000449193	ensembl	human	known	69_37n	frame_shift_del	64	38.32	41	DEL	1.000	-
SLC9A1	6548	genome.wustl.edu	37	1	27436074	27436074	+	Silent	SNP	G	G	C			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr1:27436074G>C	ENST00000263980.3	-	3	1583	c.1008C>G	c.(1006-1008)ctC>ctG	p.L336L	SLC9A1_ENST00000545949.1_5'UTR|SLC9A1_ENST00000374086.3_Silent_p.L336L	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	336					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	TGTAGCTGTAGAGGAAGACGA	0.632																																						dbGAP											0													133.0	132.0	133.0					1																	27436074		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.1008C>G	1.37:g.27436074G>C			B1ALD6|D3DPL4|Q96EM2	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_1,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.L336	ENST00000263980.3	37	c.1008	CCDS295.1	1																																																																																			SLC9A1	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000090020		0.632	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A1	HGNC	protein_coding	OTTHUMT00000012336.2	47	0.00	0	G	NM_003047		27436074	27436074	-1	no_errors	ENST00000263980	ensembl	human	known	69_37n	silent	30	36.17	17	SNP	1.000	C
SLC9C2	284525	genome.wustl.edu	37	1	173542380	173542380	+	Silent	SNP	G	G	A	rs201172272		TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr1:173542380G>A	ENST00000367714.3	-	9	1409	c.987C>T	c.(985-987)caC>caT	p.H329H	RP3-436N22.3_ENST00000431459.1_RNA|SLC9C2_ENST00000466087.1_5'UTR|SLC9C2_ENST00000536496.1_Silent_p.H227H	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	329					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										GAAATTCATAGTGGCTGAGTT	0.279													A|||	1	0.000199681	0.0	0.0014	5008	,	,		17536	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													53.0	53.0	53.0					1																	173542380		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.987C>T	1.37:g.173542380G>A			Q86UF3	Silent	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.H329	ENST00000367714.3	37	c.987	CCDS1308.1	1																																																																																			SLC9C2	-	pfam_Cation/H_exchanger	ENSG00000162753		0.279	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C2	HGNC	protein_coding	OTTHUMT00000084205.1	73	0.00	0	G	NM_178527		173542380	173542380	-1	no_errors	ENST00000367714	ensembl	human	known	69_37n	silent	79	23.81	25	SNP	0.010	A
SSPO	23145	genome.wustl.edu	37	7	149484837	149484838	+	RNA	INS	-	-	C			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr7:149484837_149484838insC	ENST00000378016.2	+	0	3659_3660							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CACGCGGAGGTCCCCCCGCAGC	0.658																																						dbGAP											0																																										-	-	-			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149484843_149484843dupC			Q76B61	RNA	INS	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.658	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		11	0.00	0	-			149484837	149484838	+1	no_errors	ENST00000262089	ensembl	human	known	69_37n	rna	4	33.33	2	INS	1.000:1.000	C
TET3	200424	genome.wustl.edu	37	2	74329151	74329152	+	Frame_Shift_Ins	INS	-	-	G	rs190925009	byFrequency	TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr2:74329151_74329152insG	ENST00000409262.3	+	9	4831_4832	c.4831_4832insG	c.(4831-4833)tggfs	p.W1611fs		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	1611					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAGCGCAAGTGGGGGGGCACT	0.688																																						dbGAP											0										17,3831		0,17,1907						5.2	1.0			13	13,7927		0,13,3957	no	frameshift	TET3	NM_144993.1		0,30,5864	A1A1,A1R,RR		0.1637,0.4418,0.2545				30,11758				-	-	-	SO:0001589	frameshift_variant	0				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.4838dupG	2.37:g.74329158_74329158dupG	ENSP00000386869:p.Trp1611fs		A6NEI3|Q86Z24|Q8TBM9	Frame_Shift_Ins	INS	NULL	p.T1614fs	ENST00000409262.3	37	c.4831_4832	CCDS46339.1	2																																																																																			TET3	-	NULL	ENSG00000187605		0.688	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TET3	HGNC	protein_coding	OTTHUMT00000328141.4	28	0.00	0	-			74329151	74329152	+1	no_errors	ENST00000409262	ensembl	human	known	69_37n	frame_shift_ins	28	12.50	4	INS	1.000:1.000	G
TRIP11	9321	genome.wustl.edu	37	14	92499550	92499550	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr14:92499550T>C	ENST00000267622.4	-	2	560	c.187A>G	c.(187-189)Atc>Gtc	p.I63V	TRIP11_ENST00000555105.1_5'UTR	NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	63					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		GATCTCAAGATTGCATGAATG	0.284			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	dbGAP		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													63.0	67.0	66.0					14																	92499550		2203	4287	6490	-	-	-	SO:0001583	missense	0			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.187A>G	14.37:g.92499550T>C	ENSP00000267622:p.Ile63Val		B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	superfamily_Ribosomal_L29,pfscan_GRIP	p.I63V	ENST00000267622.4	37	c.187	CCDS9899.1	14	.	.	.	.	.	.	.	.	.	.	T	0.623	-0.820364	0.02755	.	.	ENSG00000100815	ENST00000267622	T	0.62498	0.02	5.53	-5.41	0.02648	.	1.015530	0.07864	N	0.966856	T	0.32496	0.0831	N	0.08118	0	0.09310	N	0.999997	B	0.02656	0.0	B	0.06405	0.002	T	0.43278	-0.9401	10	0.02654	T	1	.	10.6721	0.45764	0.0:0.5138:0.1044:0.3818	.	63	Q15643	TRIPB_HUMAN	V	63	ENSP00000267622:I63V	ENSP00000267622:I63V	I	-	1	0	TRIP11	91569303	0.952000	0.32445	0.006000	0.13384	0.852000	0.48524	-0.075000	0.11431	-1.378000	0.02120	-0.408000	0.06270	ATC	TRIP11	-	NULL	ENSG00000100815		0.284	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	38	0.00	0	T			92499550	92499550	-1	no_errors	ENST00000267622	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	0.513	C
TST	7263	genome.wustl.edu	37	22	37407107	37407108	+	Frame_Shift_Ins	INS	-	-	G			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr22:37407107_37407108insG	ENST00000403892.3	-	2	1588_1589	c.854_855insC	c.(853-855)ccafs	p.P285fs	TST_ENST00000249042.3_Frame_Shift_Ins_p.P285fs|Y_RNA_ENST00000516603.1_RNA	NM_001270483.1	NP_001257412.1	Q16762	THTR_HUMAN	thiosulfate sulfurtransferase (rhodanese)	285	Rhodanese 2. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cellular nitrogen compound metabolic process (GO:0034641)|cyanate catabolic process (GO:0009440)|epithelial cell differentiation (GO:0030855)|rRNA import into mitochondrion (GO:0035928)|rRNA transport (GO:0051029)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|thiosulfate sulfurtransferase activity (GO:0004792)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	7						CACGGCTCTCTGGGGGGGCCCG	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			Z73420	CCDS13938.1	22q13.1	2002-02-05			ENSG00000128311	ENSG00000128311	2.8.1.1		12388	protein-coding gene	gene with protein product		180370				1953758	Standard	NM_003312		Approved	RDS	uc003aqh.4	Q16762	OTTHUMG00000150533	ENST00000403892.3:c.855dupC	22.37:g.37407114_37407114dupG	ENSP00000385828:p.Pro285fs		B3KRM1|Q6IB06	Frame_Shift_Ins	INS	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.E286fs	ENST00000403892.3	37	c.855_854	CCDS13938.1	22																																																																																			TST	-	superfamily_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	ENSG00000128311		0.629	TST-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TST	HGNC	protein_coding	OTTHUMT00000318790.1	26	0.00	0	-			37407107	37407108	-1	no_errors	ENST00000249042	ensembl	human	known	69_37n	frame_shift_ins	25	10.71	3	INS	0.014:0.995	G
UPF1	5976	genome.wustl.edu	37	19	18965708	18965708	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr19:18965708C>T	ENST00000599848.1	+	10	1528	c.1319C>T	c.(1318-1320)aCg>aTg	p.T440M	UPF1_ENST00000262803.5_Missense_Mutation_p.T429M			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	440					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.T429M(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GCATTGAAAACGTTTGCCGTG	0.592																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											87.0	74.0	79.0					19																	18965708		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1319C>T	19.37:g.18965708C>T	ENSP00000470142:p.Thr440Met		O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom	p.T429M	ENST00000599848.1	37	c.1286		19	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613593	0.46631	.	.	ENSG00000005007	ENST00000262803	D	0.90261	-2.64	4.5	3.45	0.39498	.	0.051284	0.85682	D	0.000000	D	0.90967	0.7160	L	0.51422	1.61	0.80722	D	1	D;D	0.57899	0.968;0.981	P;P	0.54499	0.572;0.754	D	0.90917	0.4780	10	0.72032	D	0.01	-36.6574	11.9801	0.53115	0.0:0.9134:0.0:0.0866	.	440;429	Q92900;Q92900-2	RENT1_HUMAN;.	M	429	ENSP00000262803:T429M	ENSP00000262803:T429M	T	+	2	0	UPF1	18826708	1.000000	0.71417	0.020000	0.16555	0.004000	0.04260	7.433000	0.80362	1.018000	0.39521	0.655000	0.94253	ACG	UPF1	-	NULL	ENSG00000005007		0.592	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1	82	0.00	0	C	NM_002911		18965708	18965708	+1	no_errors	ENST00000262803	ensembl	human	known	69_37n	missense	31	41.51	22	SNP	0.997	T
ZNF578	147660	genome.wustl.edu	37	19	53014601	53014601	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0CQ-01A-21W-A050-09	TCGA-A2-A0CQ-10A-01W-A055-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	fa0d7183-8757-4f95-87b2-2366a1dbd508	a300b0ed-eb05-4a95-8947-258940ad090b	g.chr19:53014601T>A	ENST00000421239.2	+	6	1211	c.967T>A	c.(967-969)Tcc>Acc	p.S323T	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		ATGTGGAAAGTCCTTCAGTTA	0.413																																						dbGAP											0													104.0	108.0	107.0					19																	53014601		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.967T>A	19.37:g.53014601T>A	ENSP00000459216:p.Ser323Thr		B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S323T	ENST00000421239.2	37	c.967	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	-	2.267	-0.367837	0.05069	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.48	-2.97	0.05530	.	.	.	.	.	T	0.15522	0.0374	N	0.16016	0.355	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24693	-1.0153	7	.	.	.	.	3.1204	0.06388	0.2974:0.0:0.2035:0.4991	.	323	G3V4F6	.	T	323	.	.	S	+	1	0	ZNF578	57706413	0.000000	0.05858	0.004000	0.12327	0.149000	0.21700	-0.490000	0.06482	-0.536000	0.06298	-1.181000	0.01715	TCC	ZNF578	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000258405		0.413	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	HGNC	protein_coding	OTTHUMT00000344298.3	135	0.00	0	T	NM_152472		53014601	53014601	+1	no_errors	ENST00000421239	ensembl	human	known	69_37n	missense	126	36.36	72	SNP	0.016	A
