#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AARSD1	80755	genome.wustl.edu	37	17	41103846	41103846	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:41103846T>G	ENST00000427569.2	-	11	1109	c.1074A>C	c.(1072-1074)ccA>ccC	p.P358P	PTGES3L-AARSD1_ENST00000409399.1_Silent_p.P532P|PTGES3L-AARSD1_ENST00000360221.4_Silent_p.P471P|PTGES3L-AARSD1_ENST00000409103.1_Silent_p.P441P|PTGES3L-AARSD1_ENST00000421990.2_Silent_p.P532P	NM_001261434.1	NP_001248363.1	Q9BTE6	AASD1_HUMAN	alanyl-tRNA synthetase domain containing 1	358					alanyl-tRNA aminoacylation (GO:0006419)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	alanine-tRNA ligase activity (GO:0004813)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|Ser-tRNA(Ala) hydrolase activity (GO:0002196)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|skin(1)	17		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		CAGACGCAGGTGGCCCTGCCA	0.498																																						dbGAP											0													60.0	54.0	56.0					17																	41103846		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC004172	CCDS11447.1, CCDS45691.1, CCDS58552.1	17q21.31	2012-10-05			ENSG00000266967	ENSG00000266967			28417	protein-coding gene	gene with protein product		613212					Standard	NM_001261434		Approved	MGC2744		Q9BTE6	OTTHUMG00000153515	ENST00000427569.2:c.1074A>C	17.37:g.41103846T>G			B4DI73	Silent	SNP	pfam_tRNA_SAD,pfam_CS_domain,pfam_Ala-tRNA-synth_IIc_N,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_HSP20-like_chaperone,smart_tRNA_SAD,pfscan_CS-like_domain,pfscan_Ala-tRNA-synth_IIc_core	p.P532	ENST00000427569.2	37	c.1596	CCDS58552.1	17																																																																																			AARSD1	-	NULL	ENSG00000108825		0.498	AARSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARSD1	HGNC	protein_coding	OTTHUMT00000467729.1	72	0.00	0	T	NM_001261434		41103846	41103846	-1	no_errors	ENST00000409399	ensembl	human	known	69_37n	silent	37	23.53	12	SNP	0.005	G
ABCC8	6833	genome.wustl.edu	37	11	17449890	17449890	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:17449890T>G	ENST00000389817.3	-	14	2054	c.1986A>C	c.(1984-1986)ccA>ccC	p.P662P	ABCC8_ENST00000528202.1_5'Flank|ABCC8_ENST00000302539.4_Silent_p.P662P			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	662					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GGCTCTGCAGTGGGCCGGTGA	0.667																																						dbGAP											0													53.0	60.0	58.0					11																	17449890		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1986A>C	11.37:g.17449890T>G			A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.P662	ENST00000389817.3	37	c.1986	CCDS31437.1	11																																																																																			ABCC8	-	NULL	ENSG00000006071		0.667	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	66	0.00	0	T	NM_000352		17449890	17449890	-1	no_errors	ENST00000302539	ensembl	human	known	69_37n	silent	27	12.90	4	SNP	0.003	G
ADAMTS15	170689	genome.wustl.edu	37	11	130340998	130340998	+	Splice_Site	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:130340998T>G	ENST00000299164.2	+	6	1902		c.e6+2			NM_139055.2	NP_620686.1	Q8TE58	ATS15_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 15							proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(8)|urinary_tract(1)	36	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GCACCCAAGGTGAGTGAGCCT	0.597																																						dbGAP											0													42.0	44.0	44.0					11																	130340998		2201	4297	6498	-	-	-	SO:0001630	splice_region_variant	0			AJ315733	CCDS8488.1	11q25	2008-02-01	2005-08-19		ENSG00000166106	ENSG00000166106		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	16305	protein-coding gene	gene with protein product		607509	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 15"""			11867212	Standard	NM_139055		Approved		uc010scd.2	Q8TE58	OTTHUMG00000165657	ENST00000299164.2:c.1902+2T>G	11.37:g.130340998T>G			Q32MI6	Splice_Site	SNP	-	e6+2	ENST00000299164.2	37	c.1902+2	CCDS8488.1	11	.	.	.	.	.	.	.	.	.	.	T	18.33	3.600253	0.66332	.	.	ENSG00000166106	ENST00000299164	.	.	.	5.6	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8869	0.52608	0.131:0.0:0.0:0.869	.	.	.	.	.	-1	.	.	.	+	.	.	ADAMTS15	129846208	1.000000	0.71417	0.995000	0.50966	0.934000	0.57294	4.991000	0.63883	0.910000	0.36722	0.533000	0.62120	.	ADAMTS15	-	-	ENSG00000166106		0.597	ADAMTS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS15	HGNC	protein_coding	OTTHUMT00000385638.1	53	0.00	0	T	NM_139055	Intron	130340998	130340998	+1	no_errors	ENST00000299164	ensembl	human	known	69_37n	splice_site	37	15.56	7	SNP	1.000	G
AGRN	375790	genome.wustl.edu	37	1	957654	957654	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr1:957654T>G	ENST00000379370.2	+	2	325	c.275T>G	c.(274-276)gTg>gGg	p.V92G		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	92	NtA. {ECO:0000255|PROSITE- ProRule:PRU00443}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GGCAACAAGGTGGTGATCAGC	0.612																																						dbGAP											0													124.0	133.0	130.0					1																	957654		2203	4300	6503	-	-	-	SO:0001583	missense	0			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.275T>G	1.37:g.957654T>G	ENSP00000368678:p.Val92Gly		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,pfam_EGF_laminin,pfam_SEA,pfam_EGF-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl,smart_FacI_MAC,smart_Fol_N,smart_Prot_inh_Kazal,smart_EGF-like,smart_EGF_laminin,smart_SEA,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA	p.V92G	ENST00000379370.2	37	c.275	CCDS30551.1	1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.121640	0.77436	.	.	ENSG00000188157	ENST00000379370	T	0.39229	1.09	3.88	3.88	0.44766	Agrin NtA (2);Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.000000	0.38164	U	0.001793	T	0.52108	0.1714	L	0.32530	0.975	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.56792	-0.7920	10	0.87932	D	0	-16.359	13.1646	0.59562	0.0:0.0:0.0:1.0	.	92	O00468	AGRIN_HUMAN	G	92	ENSP00000368678:V92G	ENSP00000368678:V92G	V	+	2	0	AGRN	947517	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	5.662000	0.68032	1.770000	0.52166	0.459000	0.35465	GTG	AGRN	-	pfam_Agrin_NtA,superfamily_TIMP-like_OB-fold,pfscan_Agrin_NtA	ENSG00000188157		0.612	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	117	0.00	0	T	NM_198576		957654	957654	+1	no_errors	ENST00000379370	ensembl	human	known	69_37n	missense	54	20.29	14	SNP	1.000	G
AHNAK2	113146	genome.wustl.edu	37	14	105421045	105421045	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr14:105421045A>C	ENST00000333244.5	-	7	862	c.743T>G	c.(742-744)gTg>gGg	p.V248G	AHNAK2_ENST00000557457.1_5'Flank	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	248						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCCTCTCCCCACCCTTGGTTT	0.567																																						dbGAP											0													26.0	28.0	28.0					14																	105421045		1886	4111	5997	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.743T>G	14.37:g.105421045A>C	ENSP00000353114:p.Val248Gly		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V248G	ENST00000333244.5	37	c.743	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	a	3.616	-0.078607	0.07141	.	.	ENSG00000185567	ENST00000333244	T	0.02498	4.27	5.23	-2.41	0.06562	.	0.741903	0.11614	U	0.546426	T	0.01976	0.0062	L	0.29908	0.895	0.09310	N	1	B	0.14012	0.009	B	0.14023	0.01	T	0.45264	-0.9273	10	0.46703	T	0.11	.	1.5032	0.02480	0.3124:0.0823:0.2923:0.3131	.	248	Q8IVF2	AHNK2_HUMAN	G	248	ENSP00000353114:V248G	ENSP00000353114:V248G	V	-	2	0	AHNAK2	104492090	0.000000	0.05858	0.000000	0.03702	0.125000	0.20455	-0.285000	0.08410	-0.198000	0.10333	0.528000	0.53228	GTG	AHNAK2	-	NULL	ENSG00000185567		0.567	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	72	0.00	0	A	NM_138420		105421045	105421045	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	47	23.81	15	SNP	0.000	C
ALDH3B2	222	genome.wustl.edu	37	11	67433785	67433785	+	Splice_Site	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:67433785A>C	ENST00000349015.3	-	5	676		c.e5+1		ALDH3B2_ENST00000531881.1_5'Flank|ALDH3B2_ENST00000530069.1_Splice_Site	NM_000695.3	NP_000686	P48448	AL3B2_HUMAN	aldehyde dehydrogenase 3 family, member B2						alcohol metabolic process (GO:0006066)|ethanol catabolic process (GO:0006068)|lipid metabolic process (GO:0006629)		3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	18						GGCCACCCTCACCTGGTCCAG	0.672																																						dbGAP											0													26.0	26.0	26.0					11																	67433785		2200	4294	6494	-	-	-	SO:0001630	splice_region_variant	0			U37519	CCDS31622.1	11q13.2	2014-09-04			ENSG00000132746	ENSG00000132746	1.2.1.5	"""Aldehyde dehydrogenases"""	411	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase 8"", ""acetaldehyde dehydrogenase 8"""	601917		ALDH8		8890755, 9161417	Standard	NM_000695		Approved		uc001oms.3	P48448	OTTHUMG00000167284	ENST00000349015.3:c.237+1T>G	11.37:g.67433785A>C			Q53Y98|Q8NAL5|Q96IB2	Splice_Site	SNP	-	e3+2	ENST00000349015.3	37	c.237+2	CCDS31622.1	11	.	.	.	.	.	.	.	.	.	.	A	17.72	3.458056	0.63401	.	.	ENSG00000132746	ENST00000530069;ENST00000349015;ENST00000525827;ENST00000528756	.	.	.	4.2	4.2	0.49525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3699	0.60707	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALDH3B2	67190361	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	4.933000	0.63484	1.887000	0.54652	0.533000	0.62120	.	ALDH3B2	-	-	ENSG00000132746		0.672	ALDH3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH3B2	HGNC	protein_coding	OTTHUMT00000394004.1	52	0.00	0	A	NM_000695	Intron	67433785	67433785	-1	no_errors	ENST00000349015	ensembl	human	known	69_37n	splice_site	33	12.82	5	SNP	1.000	C
ANGPTL6	83854	genome.wustl.edu	37	19	10205446	10205446	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:10205446T>G	ENST00000253109.4	-	3	989	c.751A>C	c.(751-753)Acc>Ccc	p.T251P	ANGPTL6_ENST00000592641.1_Missense_Mutation_p.T251P|ANGPTL6_ENST00000589181.1_Missense_Mutation_p.T251P	NM_031917.2	NP_114123.2	Q8NI99	ANGL6_HUMAN	angiopoietin-like 6	251	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)	12			OV - Ovarian serous cystadenocarcinoma(20;3.58e-08)|Epithelial(33;2.5e-05)|all cancers(31;5.96e-05)			ACAGGCTTGGTGGGGACCGCA	0.557																																						dbGAP											0													88.0	95.0	93.0					19																	10205446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB054064	CCDS12224.1	19p13.2	2013-02-06				ENSG00000130812		"""Fibrinogen C domain containing"""	23140	protein-coding gene	gene with protein product	"""angiopoietin-related protein 5"""	609336				12871997	Standard	NM_031917		Approved	ARP5, AGF	uc002mmy.1	Q8NI99		ENST00000253109.4:c.751A>C	19.37:g.10205446T>G	ENSP00000253109:p.Thr251Pro		A5PKV7|Q9BZZ0	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.T251P	ENST00000253109.4	37	c.751	CCDS12224.1	19	.	.	.	.	.	.	.	.	.	.	T	3.427	-0.116983	0.06838	.	.	ENSG00000130812	ENST00000253109	D	0.81499	-1.5	4.23	3.19	0.36642	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.496467	0.18830	N	0.129989	T	0.57533	0.2060	N	0.03608	-0.345	0.40610	D	0.981666	B	0.09022	0.002	B	0.08055	0.003	T	0.48714	-0.9011	10	0.30078	T	0.28	.	8.9257	0.35639	0.0:0.0:0.1885:0.8115	.	251	Q8NI99	ANGL6_HUMAN	P	251	ENSP00000253109:T251P	ENSP00000253109:T251P	T	-	1	0	ANGPTL6	10066446	0.998000	0.40836	0.564000	0.28396	0.023000	0.10783	2.227000	0.42972	0.749000	0.32854	0.397000	0.26171	ACC	ANGPTL6	-	NULL	ENSG00000130812		0.557	ANGPTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL6	HGNC	protein_coding	OTTHUMT00000451142.1	124	0.00	0	T	NM_031917		10205446	10205446	-1	no_errors	ENST00000253109	ensembl	human	known	69_37n	missense	72	16.09	14	SNP	0.992	G
ANK1	286	genome.wustl.edu	37	8	41566342	41566342	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr8:41566342A>C	ENST00000347528.4	-	17	2035	c.1952T>G	c.(1951-1953)gTg>gGg	p.V651G	ANK1_ENST00000352337.4_Missense_Mutation_p.V651G|ANK1_ENST00000265709.8_Missense_Mutation_p.V684G|ANK1_ENST00000396942.1_Missense_Mutation_p.V651G|ANK1_ENST00000396945.1_Missense_Mutation_p.V651G|ANK1_ENST00000379758.2_Missense_Mutation_p.V651G|ANK1_ENST00000289734.7_Missense_Mutation_p.V651G	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	651	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CAGCAGAGCCACCATCTCTGC	0.612																																						dbGAP											0													130.0	115.0	121.0					8																	41566342		2203	4300	6503	-	-	-	SO:0001583	missense	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1952T>G	8.37:g.41566342A>C	ENSP00000339620:p.Val651Gly		A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.V651G	ENST00000347528.4	37	c.1952	CCDS6119.1	8	.	.	.	.	.	.	.	.	.	.	A	20.2	3.946180	0.73672	.	.	ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	T;T;T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75;-0.75;-0.75	5.74	5.74	0.90152	Ankyrin repeat-containing domain (3);	0.061139	0.64402	D	0.000004	D	0.86802	0.6020	M	0.84585	2.705	0.80722	D	1	D;P;D;D;D	0.89917	0.992;0.954;0.996;1.0;0.983	P;P;D;P;P	0.64687	0.901;0.839;0.928;0.725;0.901	D	0.89017	0.3432	10	0.87932	D	0	.	16.0356	0.80625	1.0:0.0:0.0:0.0	.	684;651;651;651;651	P16157-21;P16157-4;P16157;P16157-5;P16157-3	.;.;ANK1_HUMAN;.;.	G	651;651;651;651;651;651;684;651	ENSP00000339620:V651G;ENSP00000289734:V651G;ENSP00000369082:V651G;ENSP00000380149:V651G;ENSP00000380147:V651G;ENSP00000309131:V651G;ENSP00000265709:V684G	ENSP00000265709:V684G	V	-	2	0	ANK1	41685499	1.000000	0.71417	0.955000	0.39395	0.622000	0.37654	5.339000	0.65953	2.187000	0.69744	0.528000	0.53228	GTG	ANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.612	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	89	0.00	0	A	NM_020475		41566342	41566342	-1	no_errors	ENST00000396942	ensembl	human	known	69_37n	missense	25	16.13	5	SNP	0.997	C
AP5B1	91056	genome.wustl.edu	37	11	65545693	65545693	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:65545693T>G	ENST00000532090.2	-	2	2481	c.2271A>C	c.(2269-2271)ccA>ccC	p.P757P		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	757					endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						CGAACAGGGGTGGCAAGTGGG	0.642																																						dbGAP											0													48.0	56.0	53.0					11																	65545693		2084	4201	6285	-	-	-	SO:0001819	synonymous_variant	0			JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.2271A>C	11.37:g.65545693T>G			A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Silent	SNP	NULL	p.P757	ENST00000532090.2	37	c.2271	CCDS58146.1	11																																																																																			AP5B1	-	NULL	ENSG00000254470		0.642	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AP5B1	HGNC	protein_coding	OTTHUMT00000390636.2	72	0.00	0	T	NM_138368		65545693	65545693	-1	no_errors	ENST00000532090	ensembl	human	novel	69_37n	silent	40	16.67	8	SNP	0.707	G
ASAP2	8853	genome.wustl.edu	37	2	9517076	9517076	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr2:9517076G>A	ENST00000281419.3	+	18	2126	c.1786G>A	c.(1786-1788)Gtg>Atg	p.V596M	ASAP2_ENST00000315273.4_Missense_Mutation_p.V596M	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	596					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AGTCAGATCCGTGGATCGAAC	0.458																																						dbGAP											0													134.0	142.0	139.0					2																	9517076		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.1786G>A	2.37:g.9517076G>A	ENSP00000281419:p.Val596Met		D6W4Y8	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.V596M	ENST00000281419.3	37	c.1786	CCDS1661.1	2	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712905	0.89112	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.57752	0.42;0.38	5.45	5.45	0.79879	Ankyrin repeat-containing domain (3);	0.056013	0.64402	D	0.000001	T	0.67730	0.2924	L	0.44542	1.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.979;0.997	T	0.68577	-0.5372	10	0.59425	D	0.04	.	19.2922	0.94105	0.0:0.0:1.0:0.0	.	596;596	O43150-2;O43150	.;ASAP2_HUMAN	M	596	ENSP00000281419:V596M;ENSP00000316404:V596M	ENSP00000281419:V596M	V	+	1	0	ASAP2	9434527	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	9.440000	0.97547	2.547000	0.85894	0.655000	0.94253	GTG	ASAP2	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151693		0.458	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	131	0.00	0	G	NM_003887		9517076	9517076	+1	no_errors	ENST00000281419	ensembl	human	known	69_37n	missense	146	14.62	25	SNP	1.000	A
ATG13	9776	genome.wustl.edu	37	11	46687026	46687026	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:46687026A>C	ENST00000434074.1	+	12	1683	c.994A>C	c.(994-996)Acc>Ccc	p.T332P	ATG13_ENST00000312040.4_Missense_Mutation_p.T332P|ATG13_ENST00000530500.1_Missense_Mutation_p.T216P|ATG13_ENST00000526508.1_Missense_Mutation_p.T332P|ATG13_ENST00000451945.1_Missense_Mutation_p.T295P|ATG13_ENST00000524625.1_Missense_Mutation_p.T295P|ATG13_ENST00000528494.1_Missense_Mutation_p.T365P|ATG13_ENST00000359513.4_Missense_Mutation_p.T332P|ATG13_ENST00000529655.1_Missense_Mutation_p.T295P	NM_001205120.1	NP_001192049.1	O75143	ATG13_HUMAN	autophagy related 13	332					autophagic vacuole assembly (GO:0000045)	ATG1/UKL1 signaling complex (GO:0034273)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)|ULK1-ATG13-FIP200 complex (GO:0070969)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	15						GGCAACCTGCACCCCTTCTGA	0.602																																						dbGAP											0													91.0	75.0	80.0					11																	46687026		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB014552	CCDS7921.1, CCDS44582.1, CCDS55760.1, CCDS55761.1	11p11.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000175224	ENSG00000175224			29091	protein-coding gene	gene with protein product		615088	"""KIAA0652"", ""ATG13 autophagy related 13 homolog (S. cerevisiae)"""	KIAA0652		15169610, 18339812, 17204848	Standard	NM_001205120		Approved		uc001nda.3	O75143	OTTHUMG00000166538	ENST00000434074.1:c.994A>C	11.37:g.46687026A>C	ENSP00000400642:p.Thr332Pro		B4DFI4|D3DQQ1|D3DQQ2|E9PQZ8|Q53EN6|Q9BRL3|Q9H8B0	Missense_Mutation	SNP	pfam_Autophagy-rel_p13	p.T332P	ENST00000434074.1	37	c.994	CCDS44582.1	11	.	.	.	.	.	.	.	.	.	.	A	16.41	3.116627	0.56505	.	.	ENSG00000175224	ENST00000395549;ENST00000434074;ENST00000312040;ENST00000451945;ENST00000529655;ENST00000530500;ENST00000526508;ENST00000524625;ENST00000359513;ENST00000528494;ENST00000525009	.	.	.	5.7	3.4	0.38934	.	0.341006	0.35677	N	0.003048	T	0.33411	0.0862	L	0.36672	1.1	0.30126	N	0.805256	B;B;B;B	0.06786	0.001;0.0;0.0;0.0	B;B;B;B	0.06405	0.002;0.001;0.001;0.001	T	0.24297	-1.0164	9	0.19590	T	0.45	-0.1867	8.887	0.35409	0.8569:0.0:0.1431:0.0	.	216;332;365;295	B4DFI4;O75143;E9PQZ8;O75143-2	.;ATG13_HUMAN;.;.	P	295;332;332;295;295;216;332;295;332;365;64	.	ENSP00000310321:T332P	T	+	1	0	ATG13	46643602	1.000000	0.71417	0.906000	0.35671	0.879000	0.50718	2.873000	0.48475	0.444000	0.26612	-0.899000	0.02877	ACC	ATG13	-	NULL	ENSG00000175224		0.602	ATG13-202	KNOWN	basic|CCDS	protein_coding	ATG13	HGNC	protein_coding	OTTHUMT00000390300.2	156	0.00	0	A	NM_014741		46687026	46687026	+1	no_errors	ENST00000312040	ensembl	human	known	69_37n	missense	51	24.64	17	SNP	1.000	C
BAK1	578	genome.wustl.edu	37	6	33541881	33541881	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:33541881A>C	ENST00000374467.3	-	5	709	c.461T>G	c.(460-462)gTg>gGg	p.V154G	BAK1_ENST00000442998.2_3'UTR|BAK1_ENST00000360661.5_Missense_Mutation_p.V154G	NM_001188.3	NP_001179.1	Q16611	BAK_HUMAN	BCL2-antagonist/killer 1	154					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic process involved in patterning of blood vessels (GO:1902262)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|B cell negative selection (GO:0002352)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast apoptotic process (GO:0044346)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|limb morphogenesis (GO:0035108)|mitochondrial fusion (GO:0008053)|myeloid cell homeostasis (GO:0002262)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of gene expression (GO:0010629)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic camera-type eye morphogenesis (GO:0048597)|regulation of cell cycle (GO:0051726)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|release of cytochrome c from mitochondria (GO:0001836)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to fungus (GO:0009620)|response to gamma radiation (GO:0010332)|response to hydrogen peroxide (GO:0042542)|response to mycotoxin (GO:0010046)|response to organic cyclic compound (GO:0014070)|response to UV-C (GO:0010225)|thymocyte apoptotic process (GO:0070242)|vagina development (GO:0060068)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|pore complex (GO:0046930)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4						GAAGCGGGTCACCTGGCCTAG	0.602																																						dbGAP											0													66.0	59.0	61.0					6																	33541881		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23765	CCDS4781.1	6p21.31	2014-03-07			ENSG00000030110	ENSG00000030110			949	protein-coding gene	gene with protein product		600516		CDN1		7715730, 7715731	Standard	NM_001188		Approved	BCL2L7, BAK	uc003oes.3	Q16611	OTTHUMG00000014530	ENST00000374467.3:c.461T>G	6.37:g.33541881A>C	ENSP00000363591:p.Val154Gly		C0H5Y7|Q6I9T6|Q92533	Missense_Mutation	SNP	pfam_Bcl2_BH,smart_Bcl2_BH,prints_Bcl2_BH,pfscan_Bcl2-like_apoptosis	p.V154G	ENST00000374467.3	37	c.461	CCDS4781.1	6	.	.	.	.	.	.	.	.	.	.	A	23.0	4.360409	0.82353	.	.	ENSG00000030110	ENST00000374460;ENST00000374467;ENST00000360661	T;T	0.06608	3.28;3.28	4.64	4.64	0.57946	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (3);	0.282885	0.26474	N	0.024175	T	0.13243	0.0321	M	0.74881	2.28	0.80722	D	1	D	0.58620	0.983	P	0.60345	0.873	T	0.00482	-1.1713	10	0.87932	D	0	-18.5987	13.0813	0.59115	1.0:0.0:0.0:0.0	.	154	Q16611	BAK_HUMAN	G	134;154;154	ENSP00000363591:V154G;ENSP00000353878:V154G	ENSP00000353878:V154G	V	-	2	0	BAK1	33649859	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	6.374000	0.73132	1.974000	0.57490	0.477000	0.44152	GTG	BAK1	-	pfam_Bcl2_BH,smart_Bcl2_BH,prints_Bcl2_BH,pfscan_Bcl2-like_apoptosis	ENSG00000030110		0.602	BAK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BAK1	HGNC	protein_coding	OTTHUMT00000040202.1	67	0.00	0	A	NM_001188		33541881	33541881	-1	no_errors	ENST00000360661	ensembl	human	known	69_37n	missense	30	13.89	5	SNP	0.970	C
BCR	613	genome.wustl.edu	37	22	23656229	23656229	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr22:23656229A>C	ENST00000305877.8	+	21	4283	c.3532A>C	c.(3532-3534)Acc>Ccc	p.T1178P	BCR_ENST00000436990.2_3'UTR|BCR_ENST00000359540.3_Missense_Mutation_p.T1134P	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	1178	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CAACCTGCTCACCTTCCTTTT	0.617			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																	dbGAP		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													127.0	118.0	121.0					22																	23656229		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3532A>C	22.37:g.23656229A>C	ENSP00000303507:p.Thr1178Pro		P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_Ca-dep,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RhoGAP_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.T1178P	ENST00000305877.8	37	c.3532	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	.	21.6	4.176184	0.78564	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.23950	1.88;1.88	4.37	3.33	0.38152	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.55257	0.1909	M	0.93939	3.475	0.80722	D	1	D;D;D	0.65815	0.995;0.969;0.967	D;D;D	0.66602	0.945;0.943;0.928	T	0.60752	-0.7201	10	0.72032	D	0.01	.	8.812	0.34974	0.9096:0.0:0.0904:0.0	.	767;1134;1178	B4E065;P11274-2;P11274	.;.;BCR_HUMAN	P	1178;1134;843	ENSP00000303507:T1178P;ENSP00000352535:T1134P	ENSP00000303507:T1178P	T	+	1	0	BCR	21986229	1.000000	0.71417	0.977000	0.42913	0.985000	0.73830	7.204000	0.77872	0.679000	0.31345	0.374000	0.22700	ACC	BCR	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000186716		0.617	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	168	0.59	1	A	NM_004327		23656229	23656229	+1	no_errors	ENST00000305877	ensembl	human	known	69_37n	missense	47	11.11	6	SNP	1.000	C
BLK	640	genome.wustl.edu	37	8	11412359	11412359	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr8:11412359A>C	ENST00000259089.4	+	7	1172	c.580A>C	c.(580-582)Acc>Ccc	p.T194P	RP11-148O21.6_ENST00000602626.1_lincRNA|BLK_ENST00000529894.1_Missense_Mutation_p.T123P|RP11-148O21.3_ENST00000527922.1_RNA|RP11-148O21.4_ENST00000528629.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	194	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CCCCCGGATCACCTTCCCCTC	0.597																																						dbGAP											0													48.0	45.0	46.0					8																	11412359		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.580A>C	8.37:g.11412359A>C	ENSP00000259089:p.Thr194Pro		Q16291|Q96IN1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.T194P	ENST00000259089.4	37	c.580	CCDS5982.1	8	.	.	.	.	.	.	.	.	.	.	a	12.85	2.060777	0.36373	.	.	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894	D;D	0.89485	-2.52;-2.52	4.57	0.616	0.17613	SH2 motif (5);	0.309663	0.22699	N	0.056716	T	0.82116	0.4967	L	0.47716	1.5	0.80722	D	1	B	0.15930	0.015	B	0.23419	0.046	T	0.69774	-0.5054	10	0.45353	T	0.12	.	4.7039	0.12841	0.701:0.0:0.1594:0.1396	.	194	P51451	BLK_HUMAN	P	194;194;123	ENSP00000259089:T194P;ENSP00000433663:T123P	ENSP00000259089:T194P	T	+	1	0	BLK	11449768	0.713000	0.27926	0.489000	0.27452	0.947000	0.59692	1.800000	0.38833	-0.065000	0.13021	-0.520000	0.04383	ACC	BLK	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000136573		0.597	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLK	HGNC	protein_coding	OTTHUMT00000207460.1	35	0.00	0	A			11412359	11412359	+1	no_errors	ENST00000259089	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.937	C
HID1	283987	genome.wustl.edu	37	17	72948400	72948400	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:72948400A>C	ENST00000425042.2	-	17	2185	c.2108T>G	c.(2107-2109)gTg>gGg	p.V703G		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	703					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											CGGAACCAGCACCTGCAGCAG	0.687																																						dbGAP											0													35.0	39.0	37.0					17																	72948400		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.2108T>G	17.37:g.72948400A>C	ENSP00000413520:p.Val703Gly		Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	pfam_Dymeclin	p.V703G	ENST00000425042.2	37	c.2108	CCDS32726.1	17	.	.	.	.	.	.	.	.	.	.	A	28.1	4.891122	0.91889	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.80974	0.4727	M	0.86420	2.815	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.83890	0.0284	9	0.52906	T	0.07	-25.2689	14.8916	0.70614	1.0:0.0:0.0:0.0	.	703	Q8IV36	CQ028_HUMAN	G	475;703;475	.	ENSP00000317795:V475G	V	-	2	0	C17orf28	70459995	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.153000	0.94687	1.928000	0.55862	0.533000	0.62120	GTG	C17orf28	-	NULL	ENSG00000167861		0.687	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf28	HGNC	protein_coding	OTTHUMT00000390011.2	79	0.00	0	A	NM_030630		72948400	72948400	-1	no_errors	ENST00000425042	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	C
OGFOD3	79701	genome.wustl.edu	37	17	80356194	80356194	+	Splice_Site	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:80356194A>C	ENST00000313056.5	-	8	852	c.701T>G	c.(700-702)gTg>gGg	p.V234G	OGFOD3_ENST00000329197.5_Splice_Site_p.V234G|RP13-20L14.4_ENST00000579188.1_RNA	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	234	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										GCCGTAGGTCACCTGAGGGCA	0.557																																						dbGAP											0													36.0	34.0	34.0					17																	80356194		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.700-1T>G	17.37:g.80356194A>C			C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	smart_Pro_4_hyd_alph	p.V234G	ENST00000313056.5	37	c.701	CCDS11811.1	17	.	.	.	.	.	.	.	.	.	.	A	16.06	3.016429	0.54468	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.58940	0.3;1.46	4.31	3.19	0.36642	Oxoglutarate/iron-dependent oxygenase (1);Prolyl 4-hydroxylase, alpha subunit (1);	0.073771	0.53938	D	0.000048	T	0.60637	0.2284	L	0.46157	1.445	0.80722	D	1	D;D	0.71674	0.991;0.998	P;P	0.62089	0.898;0.857	T	0.55373	-0.8151	10	0.19147	T	0.46	-27.6895	9.0747	0.36513	0.907:0.0:0.093:0.0	.	234;234	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	G	234	ENSP00000320116:V234G;ENSP00000330075:V234G	ENSP00000320116:V234G	V	-	2	0	C17orf101	77949483	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.118000	0.57884	1.776000	0.52262	0.402000	0.26972	GTG	C17orf101	-	smart_Pro_4_hyd_alph	ENSG00000181396		0.557	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf101	HGNC	protein_coding	OTTHUMT00000442895.1	83	0.00	0	A	NM_175902	Missense_Mutation	80356194	80356194	-1	no_errors	ENST00000329197	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	C
CASZ1	54897	genome.wustl.edu	37	1	10714070	10714070	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr1:10714070T>G	ENST00000377022.3	-	11	2361	c.2044A>C	c.(2044-2046)Acc>Ccc	p.T682P	CASZ1_ENST00000344008.5_Missense_Mutation_p.T682P|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	682					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		ATCTGGCTGGTGGAGGTGAAG	0.652																																						dbGAP											0													77.0	74.0	75.0					1																	10714070		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.2044A>C	1.37:g.10714070T>G	ENSP00000366221:p.Thr682Pro		Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T682P	ENST00000377022.3	37	c.2044	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.603244	0.87157	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.84	4.84	0.62591	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.152393	0.64402	D	0.000016	T	0.67477	0.2897	L	0.38531	1.155	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.987;0.987;0.998	T	0.70802	-0.4773	9	0.66056	D	0.02	-41.3928	15.1343	0.72552	0.0:0.0:0.0:1.0	.	706;682;682	B7Z1S3;Q86V15-2;Q86V15	.;.;CASZ1_HUMAN	P	682	.	ENSP00000339445:T682P	T	-	1	0	CASZ1	10636657	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.740000	0.62087	2.117000	0.64856	0.459000	0.35465	ACC	CASZ1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000130940		0.652	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	174	0.00	0	T	NM_017766		10714070	10714070	-1	no_errors	ENST00000377022	ensembl	human	known	69_37n	missense	39	26.42	14	SNP	1.000	G
CBLC	23624	genome.wustl.edu	37	19	45285673	45285673	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:45285673A>C	ENST00000270279.3	+	4	767	c.704A>C	c.(703-705)cAc>cCc	p.H235P	CBLC_ENST00000341505.4_Missense_Mutation_p.H235P	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	235	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				GCAGTCAACCACCCAGGCTAC	0.617			M		AML																																	dbGAP		Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	0													105.0	95.0	99.0					19																	45285673		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.704A>C	19.37:g.45285673A>C	ENSP00000270279:p.His235Pro		Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	SNP	pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Adaptor_Cbl_N_hlx,pfam_Znf_C3HC4_RING-type,superfamily_Adaptor_Cbl_N_hlx,smart_Znf_RING,pfscan_Znf_RING	p.H235P	ENST00000270279.3	37	c.704	CCDS12643.1	19	.	.	.	.	.	.	.	.	.	.	.	20.4	3.978341	0.74360	.	.	ENSG00000142273	ENST00000270279;ENST00000341505	D;D	0.81908	-1.55;-1.55	4.6	4.6	0.57074	Adaptor protein Cbl, PTB domain (1);SH2 motif (2);Adaptor protein Cbl, SH2-like (1);	0.000000	0.64402	D	0.000004	D	0.90123	0.6914	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.91184	0.4978	10	0.87932	D	0	-32.1608	12.2472	0.54576	1.0:0.0:0.0:0.0	.	235;235	Q9ULV8-2;Q9ULV8	.;CBLC_HUMAN	P	235	ENSP00000270279:H235P;ENSP00000340250:H235P	ENSP00000270279:H235P	H	+	2	0	CBLC	49977513	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.784000	0.75084	2.066000	0.61787	0.402000	0.26972	CAC	CBLC	-	pfam_Adaptor_Cbl_SH2-like	ENSG00000142273		0.617	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLC	HGNC	protein_coding	OTTHUMT00000319732.2	114	0.85	1	A	NM_012116		45285673	45285673	+1	no_errors	ENST00000270279	ensembl	human	known	69_37n	missense	35	20.00	9	SNP	1.000	C
CDC42BPB	9578	genome.wustl.edu	37	14	103404703	103404703	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr14:103404703T>G	ENST00000361246.2	-	35	5161	c.4873A>C	c.(4873-4875)Acc>Ccc	p.T1625P	RP11-365N19.2_ENST00000560931.1_RNA	NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GCCAGGTTGGTGGGAGCGGGG	0.672																																						dbGAP											0													56.0	65.0	62.0					14																	103404703		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.4873A>C	14.37:g.103404703T>G	ENSP00000355237:p.Thr1625Pro			Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.T1625P	ENST00000361246.2	37	c.4873	CCDS9978.1	14	.	.	.	.	.	.	.	.	.	.	T	8.979	0.974900	0.18736	.	.	ENSG00000198752	ENST00000361246	T	0.65178	-0.14	4.34	-7.09	0.01553	.	0.924706	0.09191	N	0.836027	T	0.35740	0.0942	N	0.10782	0.045	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22382	-1.0218	10	0.45353	T	0.12	.	8.8707	0.35314	0.0:0.2235:0.2003:0.5762	.	1625	Q9Y5S2	MRCKB_HUMAN	P	1625	ENSP00000355237:T1625P	ENSP00000355237:T1625P	T	-	1	0	CDC42BPB	102474456	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.604000	0.02076	-1.759000	0.01313	-1.610000	0.00802	ACC	CDC42BPB	-	NULL	ENSG00000198752		0.672	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	155	0.00	0	T	NM_006035		103404703	103404703	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	0.000	G
CDH1	999	genome.wustl.edu	37	16	68867233	68867234	+	Frame_Shift_Ins	INS	-	-	TGAT			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr16:68867233_68867234insTGAT	ENST00000261769.5	+	16	2671_2672	c.2480_2481insTGAT	c.(2479-2484)tatgatfs	p.-828fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Ins_p.-767fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)						adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GCCCCGCCTTATGATTCTCTGC	0.495			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0																																										-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2481_2484dupTGAT	16.37:g.68867234_68867237dupTGAT	ENSP00000261769:p.Asp828fs		A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S829fs	ENST00000261769.5	37	c.2480_2481	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000039068		0.495	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	129	0.00	0	-	NM_004360		68867233	68867234	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	52	27.78	20	INS	1.000:0.967	TGAT
CDH16	1014	genome.wustl.edu	37	16	66944217	66944217	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr16:66944217T>G	ENST00000299752.4	-	15	2306	c.2113A>C	c.(2113-2115)Acc>Ccc	p.T705P	CDH16_ENST00000568632.1_Missense_Mutation_p.T608P|CDH16_ENST00000570262.1_Missense_Mutation_p.T625P|CDH16_ENST00000565796.1_Missense_Mutation_p.T666P|CDH16_ENST00000394055.3_Missense_Mutation_p.T683P	NM_001204744.1|NM_001204745.1|NM_004062.3	NP_001191673.1|NP_001191674.1|NP_004053.1	O75309	CAD16_HUMAN	cadherin 16, KSP-cadherin	705	Ectodomain G.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(3)|large_intestine(10)|lung(15)|ovary(2)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0877)|Epithelial(162;0.203)		GGACCAAGGGTGAAGCTGTAG	0.632																																						dbGAP											0													113.0	112.0	113.0					16																	66944217		2200	4300	6500	-	-	-	SO:0001583	missense	0			AF016272	CCDS10823.1, CCDS56002.1, CCDS58471.1, CCDS58472.1	16q22.1	2010-01-26			ENSG00000166589	ENSG00000166589		"""Cadherins / Major cadherins"""	1755	protein-coding gene	gene with protein product		603118				9721215, 7615566	Standard	NM_004062		Approved		uc002eql.3	O75309	OTTHUMG00000137518	ENST00000299752.4:c.2113A>C	16.37:g.66944217T>G	ENSP00000299752:p.Thr705Pro		B4DPA8|H3BPD3|Q6UW93	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T705P	ENST00000299752.4	37	c.2113	CCDS10823.1	16	.	.	.	.	.	.	.	.	.	.	T	9.447	1.089490	0.20390	.	.	ENSG00000166589	ENST00000394055;ENST00000299752;ENST00000544875	T;T	0.55588	0.51;0.51	4.9	0.223	0.15292	.	0.236366	0.36591	N	0.002506	T	0.35068	0.0919	L	0.29908	0.895	0.24971	N	0.991662	P;B;B	0.40875	0.731;0.31;0.167	B;B;B	0.41894	0.369;0.092;0.068	T	0.20706	-1.0267	10	0.59425	D	0.04	-10.9508	3.0194	0.06070	0.3759:0.409:0.0:0.2151	.	683;705;705	O75309-2;B2R7S8;O75309	.;.;CAD16_HUMAN	P	683;705;669	ENSP00000377619:T683P;ENSP00000299752:T705P	ENSP00000299752:T705P	T	-	1	0	CDH16	65501718	0.645000	0.27286	0.996000	0.52242	0.012000	0.07955	-0.361000	0.07612	0.227000	0.20999	-0.232000	0.12228	ACC	CDH16	-	NULL	ENSG00000166589		0.632	CDH16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH16	HGNC	protein_coding	OTTHUMT00000268839.2	285	0.69	2	T	NM_004062		66944217	66944217	-1	no_errors	ENST00000299752	ensembl	human	known	69_37n	missense	71	17.05	15	SNP	0.979	G
CDK20	23552	genome.wustl.edu	37	9	90588982	90588982	+	Intron	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr9:90588982A>C	ENST00000325303.8	-	2	381				CDK20_ENST00000375883.3_Intron|CDK20_ENST00000605159.1_Intron|CDK20_ENST00000336654.5_Missense_Mutation_p.V28G|CDK20_ENST00000375871.4_Intron	NM_001039803.2	NP_001034892.1	Q8IZL9	CDK20_HUMAN	cyclin-dependent kinase 20						cell cycle (GO:0007049)|cell division (GO:0051301)|multicellular organismal development (GO:0007275)	cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			skin(1)	1						CTGCCAGCCCACCCTCGGCTG	0.637																																						dbGAP											0													37.0	38.0	38.0					9																	90588982		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF035013	CCDS6677.1, CCDS6678.1, CCDS35060.1, CCDS55324.1, CCDS65075.1	9q22.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000156345	ENSG00000156345		"""Cyclin-dependent kinases"""	21420	protein-coding gene	gene with protein product		610076	"""cell cycle related kinase"""	CCRK		19884882	Standard	NM_178432		Approved	p42	uc004apr.3	Q8IZL9	OTTHUMG00000020161	ENST00000325303.8:c.76-32T>G	9.37:g.90588982A>C			A2A389|A2A390|B4DQX1|O95137|Q5EDC4|Q5VYW1|Q9BUF4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V28G	ENST00000325303.8	37	c.83	CCDS35060.1	9	.	.	.	.	.	.	.	.	.	.	.	13.42	2.233326	0.39498	.	.	ENSG00000156345	ENST00000336654	T	0.64618	-0.11	3.7	-0.0552	0.13810	.	.	.	.	.	T	0.41766	0.1173	.	.	.	0.09310	N	0.999998	B	0.19935	0.04	B	0.19666	0.026	T	0.22730	-1.0208	7	.	.	.	.	5.9902	0.19456	0.6417:0.0:0.3583:0.0	.	28	A2A390	.	G	28	ENSP00000338975:V28G	.	V	-	2	0	CDK20	89778802	0.049000	0.20398	0.002000	0.10522	0.570000	0.35934	0.922000	0.28734	-0.099000	0.12263	0.374000	0.22700	GTG	CDK20	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000156345		0.637	CDK20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK20	HGNC	protein_coding	OTTHUMT00000214996.1	63	0.00	0	A	NM_012119		90588982	90588982	-1	no_errors	ENST00000336654	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.007	C
CHRNA2	1135	genome.wustl.edu	37	8	27319270	27319270	+	Splice_Site	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr8:27319270A>C	ENST00000520933.2	-	6	1619	c.1466T>G	c.(1465-1467)gTg>gGg	p.V489G	CHRNA2_ENST00000407991.1_Splice_Site_p.V489G|CHRNA2_ENST00000240132.2_Splice_Site_p.V474G			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	489					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	GTCCTCCTTCACCTGTGGGGA	0.592																																						dbGAP											0													221.0	178.0	192.0					8																	27319270		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.1465-1T>G	8.37:g.27319270A>C			A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.V489G	ENST00000520933.2	37	c.1466	CCDS6059.1	8	.	.	.	.	.	.	.	.	.	.	A	24.8	4.575463	0.86645	.	.	ENSG00000120903	ENST00000407991;ENST00000520933;ENST00000240132	D;D;D	0.88046	-2.33;-2.33;-2.33	5.59	5.59	0.84812	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94460	0.8217	M	0.91196	3.185	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.74348	0.983;0.983	D	0.95424	0.8510	10	0.87932	D	0	.	13.7168	0.62702	1.0:0.0:0.0:0.0	.	474;489	B4DK19;Q15822	.;ACHA2_HUMAN	G	489;489;474	ENSP00000385026:V489G;ENSP00000429616:V489G;ENSP00000240132:V474G	ENSP00000240132:V474G	V	-	2	0	CHRNA2	27375187	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.297000	0.96120	2.119000	0.64992	0.459000	0.35465	GTG	CHRNA2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000120903		0.592	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA2	HGNC	protein_coding	OTTHUMT00000376125.4	188	0.53	1	A		Missense_Mutation	27319270	27319270	-1	no_errors	ENST00000407991	ensembl	human	known	69_37n	missense	70	15.66	13	SNP	1.000	C
COL4A1	1282	genome.wustl.edu	37	13	110833735	110833735	+	Splice_Site	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr13:110833735A>C	ENST00000375820.4	-	29	2218	c.2097T>G	c.(2095-2097)ggT>ggG	p.G699G		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	699	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			AGCCGTCAACACCTGTTTTAA	0.498																																						dbGAP											0													32.0	32.0	32.0					13																	110833735		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.2096-1T>G	13.37:g.110833735A>C			A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G699	ENST00000375820.4	37	c.2097	CCDS9511.1	13																																																																																			COL4A1	-	pfam_Collagen	ENSG00000187498		0.498	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	HGNC	protein_coding	OTTHUMT00000045759.3	45	0.00	0	A		Silent	110833735	110833735	-1	no_errors	ENST00000375820	ensembl	human	known	69_37n	silent	35	20.45	9	SNP	0.769	C
CPSF1	29894	genome.wustl.edu	37	8	145621651	145621651	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr8:145621651T>G	ENST00000349769.3	-	26	2985	c.2891A>C	c.(2890-2892)cAc>cCc	p.H964P	MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'Flank	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	964					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GGCCATGGGGTGTAGCCGCAG	0.647																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													20.0	21.0	20.0					8																	145621651		2197	4298	6495	-	-	-	SO:0001583	missense	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2891A>C	8.37:g.145621651T>G	ENSP00000339353:p.His964Pro		Q96AF0	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.H964P	ENST00000349769.3	37	c.2891	CCDS34966.1	8	.	.	.	.	.	.	.	.	.	.	T	16.89	3.247919	0.59103	.	.	ENSG00000071894	ENST00000349769	T	0.54866	0.55	5.09	3.89	0.44902	.	0.119748	0.56097	D	0.000032	T	0.73118	0.3546	M	0.88775	2.98	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	T	0.74484	-0.3650	10	0.66056	D	0.02	-13.7464	8.7584	0.34658	0.0:0.0:0.1914:0.8086	.	964	Q10570	CPSF1_HUMAN	P	964	ENSP00000339353:H964P	ENSP00000339353:H964P	H	-	2	0	CPSF1	145592459	1.000000	0.71417	0.999000	0.59377	0.288000	0.27193	7.134000	0.77268	0.732000	0.32470	0.374000	0.22700	CAC	CPSF1	-	NULL	ENSG00000071894		0.647	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	37	0.00	0	T	NM_013291		145621651	145621651	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	G
CPSF1	29894	genome.wustl.edu	37	8	145623023	145623023	+	Silent	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr8:145623023A>C	ENST00000349769.3	-	21	2239	c.2145T>G	c.(2143-2145)ggT>ggG	p.G715G	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	715					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CACGGGCCCCACCCAGGCGGC	0.701																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													14.0	15.0	15.0					8																	145623023		2192	4287	6479	-	-	-	SO:0001819	synonymous_variant	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2145T>G	8.37:g.145623023A>C			Q96AF0	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.G715	ENST00000349769.3	37	c.2145	CCDS34966.1	8																																																																																			CPSF1	-	NULL	ENSG00000071894		0.701	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	29	0.00	0	A	NM_013291		145623023	145623023	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	silent	13	31.58	6	SNP	0.243	C
CSPG4	1464	genome.wustl.edu	37	15	75982208	75982208	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr15:75982208T>G	ENST00000308508.5	-	3	1290	c.1198A>C	c.(1198-1200)Acc>Ccc	p.T400P		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	400	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GGGGCCAGGGTGGAGAAAGCT	0.612																																						dbGAP											0													23.0	23.0	23.0					15																	75982208		2194	4289	6483	-	-	-	SO:0001583	missense	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1198A>C	15.37:g.75982208T>G	ENSP00000312506:p.Thr400Pro		D3DW77|Q92675	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.T400P	ENST00000308508.5	37	c.1198	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	11.91	1.778746	0.31502	.	.	ENSG00000173546	ENST00000308508	T	0.29917	1.55	4.74	3.61	0.41365	.	0.086607	0.47852	D	0.000202	T	0.27349	0.0671	L	0.39633	1.23	0.43919	D	0.996568	P	0.50710	0.938	P	0.49752	0.621	T	0.05852	-1.0860	10	0.27785	T	0.31	.	4.1903	0.10417	0.1905:0.0962:0.0:0.7132	.	400	Q6UVK1	CSPG4_HUMAN	P	400	ENSP00000312506:T400P	ENSP00000312506:T400P	T	-	1	0	CSPG4	73769263	1.000000	0.71417	0.999000	0.59377	0.871000	0.50021	2.213000	0.42844	0.838000	0.34948	0.454000	0.30748	ACC	CSPG4	-	NULL	ENSG00000173546		0.612	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	27	0.00	0	T	NM_001897		75982208	75982208	-1	no_errors	ENST00000308508	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	1.000	G
DEAF1	10522	genome.wustl.edu	37	11	688337	688337	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:688337T>G	ENST00000382409.3	-	3	995	c.511A>C	c.(511-513)Acc>Ccc	p.T171P	DEAF1_ENST00000338675.6_Missense_Mutation_p.T171P	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor	171					anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		GTACCTGGGGTGAGGGGAGCT	0.537																																						dbGAP											0													40.0	39.0	39.0					11																	688337		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.511A>C	11.37:g.688337T>G	ENSP00000371846:p.Thr171Pro		A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	pfam_SAND_dom,pfam_Znf_MYND,superfamily_SAND_dom-like,smart_SAND_dom,pfscan_Znf_MYND,pfscan_SAND_dom	p.T171P	ENST00000382409.3	37	c.511	CCDS31327.1	11	.	.	.	.	.	.	.	.	.	.	T	16.63	3.177478	0.57692	.	.	ENSG00000177030	ENST00000382409;ENST00000338675;ENST00000359958;ENST00000388804	T	0.68903	-0.36	3.99	2.82	0.32997	.	0.231517	0.34245	N	0.004122	T	0.65228	0.2671	L	0.27053	0.805	0.31059	N	0.714354	D	0.71674	0.998	P	0.60682	0.878	T	0.66838	-0.5822	10	0.62326	D	0.03	-25.494	8.9749	0.35930	0.1663:0.0:0.0:0.8337	.	171	O75398	DEAF1_HUMAN	P	171;171;157;94	ENSP00000371846:T171P	ENSP00000341902:T171P	T	-	1	0	DEAF1	678337	1.000000	0.71417	0.933000	0.37362	0.683000	0.39861	1.863000	0.39459	0.674000	0.31244	0.459000	0.35465	ACC	DEAF1	-	NULL	ENSG00000177030		0.537	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEAF1	HGNC	protein_coding	OTTHUMT00000383614.3	75	0.00	0	T	NM_021008		688337	688337	-1	no_errors	ENST00000382409	ensembl	human	known	69_37n	missense	47	21.67	13	SNP	0.999	G
DEDD	9191	genome.wustl.edu	37	1	161094221	161094221	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr1:161094221A>C	ENST00000368006.3	-	3	246	c.32T>G	c.(31-33)gTg>gGg	p.V11G	DEDD_ENST00000458050.2_Missense_Mutation_p.V11G|DEDD_ENST00000489249.1_Intron|DEDD_ENST00000368005.1_Missense_Mutation_p.V11G|DEDD_ENST00000545495.1_Missense_Mutation_p.V11G|DEDD_ENST00000490843.2_Missense_Mutation_p.V11G|DEDD_ENST00000392188.1_Missense_Mutation_p.V11G|NIT1_ENST00000368008.1_3'UTR	NM_032998.2	NP_127491.1	O75618	DEDD_HUMAN	death effector domain containing	11					decidualization (GO:0046697)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|regulation of apoptotic process (GO:0042981)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	DNA binding (GO:0003677)			cervix(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|skin(1)	10	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			TTCTGGCCACACCTGGCTTGC	0.592																																						dbGAP											0													66.0	64.0	64.0					1																	161094221		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043733	CCDS1219.1	1q23.1	2008-02-05	2002-01-14		ENSG00000158796	ENSG00000158796			2755	protein-coding gene	gene with protein product		606841	"""death effector domain-containing"""			9774341, 9832420	Standard	XM_005245597		Approved	DEFT, FLDED1, CASP8IP1, KE05, DEDD1	uc001fxz.3	O75618	OTTHUMG00000033104	ENST00000368006.3:c.32T>G	1.37:g.161094221A>C	ENSP00000356985:p.Val11Gly		D3DVF5|O60737	Missense_Mutation	SNP	pfam_DED,superfamily_DEATH-like,smart_DED,pfscan_DED	p.V11G	ENST00000368006.3	37	c.32	CCDS1219.1	1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.414942	0.25465	.	.	ENSG00000158796	ENST00000368006;ENST00000392188;ENST00000545495;ENST00000458050;ENST00000541906;ENST00000368005;ENST00000535389	.	.	.	5.13	2.78	0.32641	.	0.111471	0.64402	D	0.000011	T	0.11750	0.0286	N	0.08118	0	0.50632	D	0.999888	B;B;B	0.17038	0.0;0.02;0.0	B;B;B	0.16722	0.001;0.016;0.0	T	0.07139	-1.0788	9	0.32370	T	0.25	.	4.2167	0.10539	0.649:0.1749:0.176:0.0	.	11;11;11	B4DKM1;B1AQP5;O75618	.;.;DEDD_HUMAN	G	11	.	ENSP00000356984:V11G	V	-	2	0	DEDD	159360845	0.998000	0.40836	1.000000	0.80357	0.910000	0.53928	1.022000	0.30052	0.407000	0.25591	-0.316000	0.08728	GTG	DEDD	-	NULL	ENSG00000158796		0.592	DEDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEDD	HGNC	protein_coding	OTTHUMT00000080582.1	142	0.69	1	A	NM_004216		161094221	161094221	-1	no_errors	ENST00000368005	ensembl	human	known	69_37n	missense	48	18.64	11	SNP	1.000	C
DMRTC2	63946	genome.wustl.edu	37	19	42351833	42351833	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:42351833T>G	ENST00000269945.3	+	3	305	c.254T>G	c.(253-255)gTg>gGg	p.V85G	DMRTC2_ENST00000596827.1_Missense_Mutation_p.V85G|DMRTC2_ENST00000602098.1_3'UTR	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	85					male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						GCTGCCCAGGTGGCCTTGCGT	0.597																																						dbGAP											0													36.0	33.0	34.0					19																	42351833		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.254T>G	19.37:g.42351833T>G	ENSP00000269945:p.Val85Gly		Q8N6Q2|Q96M39|Q96SD4	Missense_Mutation	SNP	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.V85G	ENST00000269945.3	37	c.254	CCDS33034.1	19	.	.	.	.	.	.	.	.	.	.	T	19.65	3.867786	0.72065	.	.	ENSG00000142025	ENST00000269945	.	.	.	5.3	4.28	0.50868	DM DNA-binding (2);	0.000000	0.51477	D	0.000084	T	0.71091	0.3299	M	0.86028	2.79	0.58432	D	0.999997	D;D	0.62365	0.988;0.991	P;P	0.58013	0.72;0.831	T	0.73363	-0.4006	9	0.72032	D	0.01	-7.8438	7.8051	0.29198	0.0:0.0948:0.0:0.9052	.	85;85	B4DX56;Q8IXT2	.;DMRTD_HUMAN	G	85	.	ENSP00000269945:V85G	V	+	2	0	DMRTC2	47043673	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.009000	0.57110	0.985000	0.38656	0.533000	0.62120	GTG	DMRTC2	-	smart_DM_DNA-bd,pfscan_DM_DNA-bd	ENSG00000142025		0.597	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTC2	HGNC	protein_coding	OTTHUMT00000463045.1	57	0.00	0	T	NM_001040283		42351833	42351833	+1	no_errors	ENST00000269945	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	1.000	G
DNAJC4	3338	genome.wustl.edu	37	11	63999906	63999906	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:63999906A>C	ENST00000321685.3	+	4	650	c.185A>C	c.(184-186)cAc>cCc	p.H62P	DNAJC4_ENST00000355040.4_Intron|DNAJC4_ENST00000321460.5_Missense_Mutation_p.H62P|RP11-783K16.14_ENST00000534988.1_RNA|VEGFB_ENST00000309422.2_5'Flank|VEGFB_ENST00000426086.2_5'Flank|RP11-783K16.14_ENST00000539963.1_RNA	NM_005528.3	NP_005519.2	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	62	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	unfolded protein binding (GO:0051082)			endometrium(1)|lung(1)|prostate(1)	3						CCCCAGCTGCACCCAGACCGG	0.642																																						dbGAP											0													29.0	41.0	37.0					11																	63999906		2051	4175	6226	-	-	-	SO:0001583	missense	0			AF012106	CCDS41666.1	11q13	2011-09-02			ENSG00000110011	ENSG00000110011		"""Heat shock proteins / DNAJ (HSP40)"""	5271	protein-coding gene	gene with protein product		604189		HSPF2		9473517, 11147971	Standard	NM_005528		Approved	MCG18	uc001nys.3	Q9NNZ3	OTTHUMG00000167792	ENST00000321685.3:c.185A>C	11.37:g.63999906A>C	ENSP00000396896:p.His62Pro		O14716	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.H62P	ENST00000321685.3	37	c.185	CCDS41666.1	11	.	.	.	.	.	.	.	.	.	.	A	14.65	2.598747	0.46318	.	.	ENSG00000110011	ENST00000321685;ENST00000321460	D;D	0.98901	-5.22;-5.22	4.16	0.426	0.16479	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	D	0.99330	0.9765	H	0.99391	4.545	0.47547	D	0.999459	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.96753	0.9555	10	0.87932	D	0	-15.8313	3.6444	0.08178	0.5957:0.1938:0.2105:0.0	.	62;62	Q6PIN0;Q9NNZ3	.;DNJC4_HUMAN	P	62	ENSP00000396896:H62P;ENSP00000320548:H62P	ENSP00000320548:H62P	H	+	2	0	DNAJC4	63756482	1.000000	0.71417	0.811000	0.32455	0.425000	0.31504	4.652000	0.61454	-0.027000	0.13873	0.379000	0.24179	CAC	DNAJC4	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	ENSG00000110011		0.642	DNAJC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC4	HGNC	protein_coding	OTTHUMT00000396305.1	48	0.00	0	A			63999906	63999906	+1	no_errors	ENST00000321685	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.998	C
DRGX	644168	genome.wustl.edu	37	10	50574265	50574265	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr10:50574265T>G	ENST00000374139.2	-	6	698	c.688A>C	c.(688-690)Acc>Ccc	p.T230P	DRGX_ENST00000434016.1_Missense_Mutation_p.T235P			A6NNA5	DRGX_HUMAN	dorsal root ganglia homeobox	230					axon guidance (GO:0007411)|detection of chemical stimulus (GO:0009593)|detection of temperature stimulus (GO:0016048)|dorsal spinal cord development (GO:0021516)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of mechanical stimulus (GO:0050954)|transcription, DNA-templated (GO:0006351)|trigeminal nerve development (GO:0021559)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	11						CTGCTGCTGGTGGAAGGCAGG	0.657																																						dbGAP											0													55.0	67.0	63.0					10																	50574265		2117	4210	6327	-	-	-	SO:0001583	missense	0				CCDS44388.1, CCDS44388.2	10q11.23	2011-06-20	2007-07-26	2007-07-26	ENSG00000165606	ENSG00000165606		"""Homeoboxes / PRD class"""	21536	protein-coding gene	gene with protein product	"""paired-like homeodomain trancription factor DRG11"""	606701	"""paired related homeobox-like 1"""	PRRXL1		7496632	Standard	NM_001276451		Approved	DRG11	uc021pqd.2	A6NNA5	OTTHUMG00000018192	ENST00000374139.2:c.688A>C	10.37:g.50574265T>G	ENSP00000363254:p.Thr230Pro			Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.T235P	ENST00000374139.2	37	c.703		10	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638209	0.29157	.	.	ENSG00000165606	ENST00000374139;ENST00000434016	D;D	0.91521	-2.86;-2.79	5.54	-0.996	0.10218	.	0.740665	0.13700	N	0.368909	D	0.82879	0.5133	N	0.19112	0.55	0.09310	N	1	B	0.14438	0.01	B	0.22386	0.039	T	0.71817	-0.4478	10	0.66056	D	0.02	.	12.6718	0.56872	0.0:0.5391:0.0:0.4609	.	235	C9JW76	.	P	230;235	ENSP00000363254:T230P;ENSP00000401653:T235P	ENSP00000363254:T230P	T	-	1	0	DRGX	50244271	0.000000	0.05858	0.008000	0.14137	0.704000	0.40688	-0.773000	0.04689	-0.179000	0.10654	-0.408000	0.06270	ACC	DRGX	-	NULL	ENSG00000165606		0.657	DRGX-001	KNOWN	basic|appris_principal	protein_coding	DRGX	HGNC	protein_coding	OTTHUMT00000047987.2	147	0.68	1	T	XM_060970		50574265	50574265	-1	no_errors	ENST00000434016	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.012	G
EBF3	253738	genome.wustl.edu	37	10	131761677	131761677	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr10:131761677A>C	ENST00000355311.5	-	2	317	c.245T>G	c.(244-246)gTg>gGg	p.V82G	EBF3_ENST00000368648.3_Missense_Mutation_p.V82G			Q9H4W6	COE3_HUMAN	early B-cell factor 3	82					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TTCAATCTCCACCGGCTGCCC	0.557																																						dbGAP											0													73.0	80.0	78.0					10																	131761677		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.245T>G	10.37:g.131761677A>C	ENSP00000347463:p.Val82Gly		A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	p.V82G	ENST00000355311.5	37	c.245		10	.	.	.	.	.	.	.	.	.	.	A	18.20	3.570430	0.65765	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.58940	0.3;0.31	3.45	3.45	0.39498	.	0.000000	0.64402	U	0.000001	T	0.75474	0.3854	M	0.83012	2.62	0.80722	D	1	D;D	0.76494	0.999;0.996	D;D	0.87578	0.998;0.983	T	0.78912	-0.2017	10	0.87932	D	0	-6.2174	11.604	0.51020	1.0:0.0:0.0:0.0	.	82;82	Q9H4W6;Q9H4W6-2	COE3_HUMAN;.	G	82	ENSP00000347463:V82G;ENSP00000357637:V82G	ENSP00000347463:V82G	V	-	2	0	EBF3	131651667	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	8.364000	0.90105	1.192000	0.43071	0.172000	0.16884	GTG	EBF3	-	NULL	ENSG00000108001		0.557	EBF3-001	KNOWN	basic|appris_principal	protein_coding	EBF3	HGNC	protein_coding	OTTHUMT00000051015.2	102	0.00	0	A	NM_001005463		131761677	131761677	-1	no_errors	ENST00000355311	ensembl	human	known	69_37n	missense	60	17.81	13	SNP	1.000	C
TMEM218	219854	genome.wustl.edu	37	11	124983938	124983938	+	5'Flank	SNP	G	G	A	rs146031711	byFrequency	TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:124983938G>A	ENST00000279968.4	-	0	0				TMEM218_ENST00000531909.1_5'Flank|KRT18P59_ENST00000534728.1_RNA|TMEM218_ENST00000532407.1_5'Flank|TMEM218_ENST00000532156.1_5'Flank|TMEM218_ENST00000527271.1_5'Flank|TMEM218_ENST00000526175.1_5'Flank|TMEM218_ENST00000531262.1_5'Flank|TMEM218_ENST00000527766.1_5'Flank|TMEM218_ENST00000529609.1_5'Flank|TMEM218_ENST00000529583.1_5'Flank			A2RU14	TM218_HUMAN	transmembrane protein 218							integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(1)|prostate(1)	5						GACAATGCCCGTCTTGCTGCT	0.493													G|||	138	0.0275559	0.0885	0.0173	5008	,	,		22055	0.0		0.002	False		,,,				2504	0.0072					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0				CCDS31715.1	11q24.2	2008-08-08			ENSG00000150433	ENSG00000150433			27344	protein-coding gene	gene with protein product							Standard	NM_001258238		Approved		uc031qeu.1	A2RU14			11.37:g.124983938G>A	Exception_encountered		B7ZM48	RNA	SNP	-	NULL	ENST00000279968.4	37	NULL	CCDS31715.1	11																																																																																			RP11-687M24.3	-	-	ENSG00000187686		0.493	TMEM218-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000187686	Clone_based_vega_gene	protein_coding	OTTHUMT00000386849.1	9	0.00	0	G	NM_001080546		124983938	124983938	+1	no_errors	ENST00000534728	ensembl	human	known	69_37n	rna	1	80.00	4	SNP	1.000	A
LGALS17A	400696	genome.wustl.edu	37	19	40172131	40172131	+	RNA	SNP	C	C	A			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:40172131C>A	ENST00000412609.1	+	0	120																											ATCACAGGGACACCGATCATC	0.542																																					Colon(98;189 2488 3678)	dbGAP											0													244.0	189.0	206.0					19																	40172131		692	1591	2283	-	-	-			0																															19.37:g.40172131C>A				RNA	SNP	-	NULL	ENST00000412609.1	37	NULL		19																																																																																			AC093063.1	-	-	ENSG00000226025		0.542	LGALS17A-001	KNOWN	basic	processed_transcript	ENSG00000226025	Clone_based_vega_gene	pseudogene	OTTHUMT00000280514.1	444	0.00	0	C			40172131	40172131	+1	no_errors	ENST00000412609	ensembl	human	known	69_37n	rna	102	38.55	64	SNP	0.008	A
FAM205B	389715	genome.wustl.edu	37	9	34835451	34835451	+	RNA	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr9:34835451T>G	ENST00000455647.2	-	0	942							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B									p.H13P(2)									AAATGGCAGGTGGGCAGGGAG	0.537																																						dbGAP											2	Substitution - Missense(2)	endometrium(1)|kidney(1)																																								-	-	-			0					9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34835451T>G			Q6ZRJ7	Missense_Mutation	SNP	NULL	p.H13P	ENST00000455647.2	37	c.38		9	.	.	.	.	.	.	.	.	.	.	T	12.54	1.968552	0.34754	.	.	ENSG00000257198	ENST00000455647	.	.	.	4.19	1.84	0.25277	.	1.422500	0.04821	N	0.436980	T	0.27205	0.0667	.	.	.	0.09310	N	1	B	0.16802	0.019	B	0.18561	0.022	T	0.20773	-1.0265	8	0.30078	T	0.28	.	3.7939	0.08732	0.0:0.118:0.2391:0.6429	.	13	Q63HN1	F205B_HUMAN	P	13	.	ENSP00000398718:H13P	H	-	2	0	AL589645.1	34825451	0.013000	0.17824	0.155000	0.22561	0.226000	0.24999	1.149000	0.31626	0.756000	0.33013	0.459000	0.35465	CAC	AL589645.1	-	NULL	ENSG00000257198		0.537	FAM205B-001	KNOWN	basic	processed_transcript	ENSG00000257198	Clone_based_ensembl_gene	pseudogene	OTTHUMT00000052246.5	112	0.00	0	T	NR_024481		34835451	34835451	-1	no_errors	ENST00000455647	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	0.017	G
ERBB2	2064	genome.wustl.edu	37	17	37879658	37879658	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:37879658G>A	ENST00000269571.5	+	17	2192	c.2033G>A	c.(2032-2034)cGg>cAg	p.R678Q	ERBB2_ENST00000584601.1_Missense_Mutation_p.R648Q|ERBB2_ENST00000406381.2_Missense_Mutation_p.R648Q|ERBB2_ENST00000541774.1_Missense_Mutation_p.R663Q|ERBB2_ENST00000445658.2_Missense_Mutation_p.R402Q|ERBB2_ENST00000540147.1_Missense_Mutation_p.R648Q|ERBB2_ENST00000584450.1_Missense_Mutation_p.R678Q			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	678	Nuclear localization signal.|Required for interaction with KPNB1 and EEA1.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	ATCAAGCGACGGCAGCAGAAG	0.637		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	0													110.0	103.0	105.0					17																	37879658		2203	4300	6503	-	-	-	SO:0001583	missense	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2033G>A	17.37:g.37879658G>A	ENSP00000269571:p.Arg678Gln		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R678Q	ENST00000269571.5	37	c.2033	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952183	0.73787	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.79141	-1.23;-1.24;-1.22;-1.24;-1.23	4.97	4.97	0.65823	Cytochrome c1, transmembrane anchor, C-terminal (1);	.	.	.	.	T	0.68742	0.3034	L	0.41710	1.295	0.80722	D	1	P;B;P	0.39003	0.654;0.043;0.654	B;B;B	0.29524	0.103;0.02;0.103	T	0.73285	-0.4031	9	0.52906	T	0.07	.	17.8613	0.88781	0.0:0.0:1.0:0.0	.	402;663;678	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	Q	648;663;402;678;648	ENSP00000385185:R648Q;ENSP00000446466:R663Q;ENSP00000404047:R402Q;ENSP00000269571:R678Q;ENSP00000443562:R648Q	ENSP00000269571:R678Q	R	+	2	0	ERBB2	35133184	1.000000	0.71417	0.980000	0.43619	0.888000	0.51559	6.363000	0.73082	2.317000	0.78254	0.561000	0.74099	CGG	ERBB2	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000141736		0.637	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	246	0.00	0	G			37879658	37879658	+1	no_errors	ENST00000269571	ensembl	human	known	69_37n	missense	79	23.81	25	SNP	1.000	A
ERBB2	2064	genome.wustl.edu	37	17	37880219	37880220	+	Missense_Mutation	DNP	TT	TT	AG	rs121913470|rs121913469		TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:37880219_37880220TT>AG	ENST00000269571.5	+	19	2422_2423	c.2263_2264TT>AG	c.(2263-2265)TTg>AGg	p.L755R	ERBB2_ENST00000584601.1_Missense_Mutation_p.L725R|ERBB2_ENST00000406381.2_Missense_Mutation_p.L725R|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000541774.1_Missense_Mutation_p.L740R|ERBB2_ENST00000445658.2_Missense_Mutation_p.L479R|ERBB2_ENST00000540147.1_Missense_Mutation_p.L725R|ERBB2_ENST00000584450.1_Missense_Mutation_p.L755R			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	755	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> P (in a lung adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:15457249}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.L755S(10)|p.L755P(2)|p.L755_S760>A(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	CATCAAAGTGTTGAGGGAAAAC	0.53	L755S(LN229_CENTRAL_NERVOUS_SYSTEM)	1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	13	Substitution - Missense(12)|Complex - insertion inframe(1)	breast(7)|lung(3)|stomach(2)|large_intestine(1)																																								-	-	-	SO:0001583	missense	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		Exception_encountered	17.37:g.37880219_37880220delinsAG	ENSP00000269571:p.Leu755Arg		B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Nonsense_Mutation|Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom|pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.C123*|p.L755W	ENST00000269571.5	37	c.369|c.2264	CCDS32642.1	17																																																																																			ERBB2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom|pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000141736		0.530	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	195|194	0.00	0	T			37880219|37880220	37880219|37880220	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region|no_errors	ENST00000580074|ENST00000269571	ensembl	human	novel|known	69_37n	nonsense|missense	115	28.12|28.57	45|46	SNP	1.000	A|G
FAM107B	83641	genome.wustl.edu	37	10	14816537	14816537	+	Silent	SNP	C	C	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr10:14816537C>T	ENST00000181796.2	-	1	359	c.126G>A	c.(124-126)caG>caA	p.Q42Q		NM_031453.2	NP_113641.2	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	0					sensory perception of sound (GO:0007605)					breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CCACGCCGGACTGATTGAAGG	0.547																																						dbGAP											0													102.0	85.0	91.0					10																	14816537		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000181796.2:c.126G>A	10.37:g.14816537C>T			A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Silent	SNP	pfam_DUF1151	p.Q42	ENST00000181796.2	37	c.126	CCDS7102.1	10																																																																																			FAM107B	-	NULL	ENSG00000065809		0.547	FAM107B-001	KNOWN	basic|CCDS	protein_coding	FAM107B	HGNC	protein_coding	OTTHUMT00000356966.1	118	0.00	0	C	NM_031453		14816537	14816537	-1	no_errors	ENST00000181796	ensembl	human	known	69_37n	silent	36	30.77	16	SNP	0.950	T
FAM90A24P	441332	genome.wustl.edu	37	8	7878200	7878200	+	RNA	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr8:7878200A>C	ENST00000521100.1	-	0	591							P0C7X0	F90AO_HUMAN	family with sequence similarity 90, member A24, pseudogene								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										CTCGGCAGCCACCCTCGGGGC	0.682																																						dbGAP											0																																										-	-	-			0					8p23.1	2011-08-31	2011-04-15	2008-06-19		ENSG00000215354			32272	pseudogene	pseudogene			"""family with sequence similarity 90, member A24"""	FAM90A24			Standard	NG_006004		Approved			P0C7X0	OTTHUMG00000163642		8.37:g.7878200A>C			A8MWA1	RNA	SNP	-	NULL	ENST00000521100.1	37	NULL		8																																																																																			FAM90A24P	-	-	ENSG00000215354		0.682	FAM90A24P-002	KNOWN	mRNA_end_NF|basic	processed_transcript	FAM90A24P	HGNC	pseudogene	OTTHUMT00000374637.1	183	0.53	1	A	NG_006004		7878200	7878200	-1	no_errors	ENST00000521100	ensembl	human	known	69_37n	rna	59	20.78	16	SNP	0.002	C
FBF1	85302	genome.wustl.edu	37	17	73924155	73924155	+	Splice_Site	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:73924155A>C	ENST00000586717.1	-	7	629		c.e7+1		FBF1_ENST00000319129.5_Splice_Site|FBF1_ENST00000389570.4_Splice_Site			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1						apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						CTACTGACCCACCTGCAGGCT	0.527																																						dbGAP											0													43.0	48.0	46.0					17																	73924155		1964	4143	6107	-	-	-	SO:0001630	splice_region_variant	0			AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.355+1T>G	17.37:g.73924155A>C			B5MEM5|Q96IF6|Q96JG4|Q96MA8	Splice_Site	SNP	-	e6+2	ENST00000586717.1	37	c.355+2		17	.	.	.	.	.	.	.	.	.	.	A	3.163	-0.171651	0.06421	.	.	ENSG00000188878	ENST00000337792;ENST00000389570;ENST00000319129;ENST00000427433	.	.	.	4.68	-6.68	0.01778	.	.	.	.	.	.	.	.	.	.	.	0.19775	N	0.999952	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.8451	0.01159	0.3184:0.1028:0.2959:0.2829	.	.	.	.	.	-1	.	.	.	-	.	.	FBF1	71435750	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.461000	0.06712	-0.810000	0.04375	-0.242000	0.12053	.	FBF1	-	-	ENSG00000188878		0.527	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	FBF1	HGNC	protein_coding	OTTHUMT00000448945.2	161	0.62	1	A	NM_001080542	Intron	73924155	73924155	-1	no_errors	ENST00000389570	ensembl	human	known	69_37n	splice_site	111	26.00	39	SNP	0.000	C
FDX1L	112812	genome.wustl.edu	37	19	10426603	10426603	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:10426603A>C	ENST00000393708.3	-	1	88	c.70T>G	c.(70-72)Tgg>Ggg	p.W24G	CTD-2369P2.12_ENST00000586529.1_Intron|CTD-2369P2.10_ENST00000452032.2_Missense_Mutation_p.W24G|FDX1L_ENST00000492239.1_5'Flank|FDX1L_ENST00000494368.1_Intron|FDX1L_ENST00000541276.1_Missense_Mutation_p.W27G	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like	24					oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			GGTCTGTTCCACCAGGTGCCC	0.677																																						dbGAP											0													19.0	22.0	21.0					19																	10426603		2200	4298	6498	-	-	-	SO:0001583	missense	0			AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299	ENST00000393708.3:c.70T>G	19.37:g.10426603A>C	ENSP00000377311:p.Trp24Gly		Q8N8B8	Missense_Mutation	SNP	pfam_2Fe-2S_ferredoxin-type,superfamily_2Fe-2S_ferredoxin-type,pfscan_2Fe-2S_ferredoxin-type,prints_Adrenodoxin	p.W24G	ENST00000393708.3	37	c.70	CCDS32905.1	19	.	.	.	.	.	.	.	.	.	.	A	12.44	1.939414	0.34189	.	.	ENSG00000167807	ENST00000541276;ENST00000393708	.	.	.	4.96	-0.0419	0.13865	.	0.544936	0.19694	N	0.108189	T	0.22244	0.0536	N	0.24115	0.695	0.20307	N	0.999912	B	0.02656	0.0	B	0.01281	0.0	T	0.14282	-1.0478	9	0.87932	D	0	-14.331	2.0787	0.03630	0.4399:0.3218:0.0918:0.1465	.	24	Q6P4F2	ADXL_HUMAN	G	27;24	.	ENSP00000341665:W24G	W	-	1	0	FDX1L	10287603	0.000000	0.05858	0.121000	0.21740	0.066000	0.16364	0.327000	0.19663	-0.075000	0.12798	0.379000	0.24179	TGG	FDX1L	-	NULL	ENSG00000267673		0.677	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDX1L	Clone_based_vega_gene	protein_coding	OTTHUMT00000280567.2	26	0.00	0	A			10426603	10426603	-1	no_errors	ENST00000393708	ensembl	human	known	69_37n	missense	29	16.67	6	SNP	0.018	C
FIZ1	84922	genome.wustl.edu	37	19	56109047	56109047	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:56109047T>G	ENST00000221665.3	-	2	274	c.185A>C	c.(184-186)cAc>cCc	p.H62P	FIZ1_ENST00000592585.1_Intron|ZNF524_ENST00000301073.3_5'Flank	NM_032836.2	NP_116225.2	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	62					positive regulation of protein phosphorylation (GO:0001934)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GTTGAAGCTGTGCTTGAAACC	0.682																																						dbGAP											0													65.0	58.0	60.0					19																	56109047		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027674	CCDS12928.1	19q13.42	2013-01-08				ENSG00000179943		"""Zinc fingers, C2H2-type"""	25917	protein-coding gene	gene with protein product		609133				12566383	Standard	NM_032836		Approved	FLJ14768, ZNF798	uc002qli.4	Q96SL8		ENST00000221665.3:c.185A>C	19.37:g.56109047T>G	ENSP00000221665:p.His62Pro		A2RU72|Q6ZMJ7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H62P	ENST00000221665.3	37	c.185	CCDS12928.1	19	.	.	.	.	.	.	.	.	.	.	T	15.29	2.788461	0.49997	.	.	ENSG00000179943	ENST00000221665	T	0.19669	2.13	3.57	3.57	0.40892	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42743	0.1216	M	0.78456	2.415	0.80722	D	1	D	0.61080	0.989	D	0.63488	0.915	T	0.43196	-0.9406	9	0.59425	D	0.04	-22.4384	11.5511	0.50721	0.0:0.0:0.0:1.0	.	62	Q96SL8	FIZ1_HUMAN	P	62	ENSP00000221665:H62P	ENSP00000221665:H62P	H	-	2	0	FIZ1	60800859	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	0.510000	0.22723	1.639000	0.50556	0.379000	0.24179	CAC	FIZ1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179943		0.682	FIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIZ1	HGNC	protein_coding	OTTHUMT00000453350.1	57	0.00	0	T	NM_032836		56109047	56109047	-1	no_errors	ENST00000221665	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.997	G
FLII	2314	genome.wustl.edu	37	17	18155869	18155869	+	Splice_Site	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:18155869A>C	ENST00000327031.4	-	10	1240	c.1015T>G	c.(1015-1017)Tgc>Ggc	p.C339G	FLII_ENST00000545457.2_Splice_Site_p.C285G|FLII_ENST00000579294.1_Splice_Site_p.C328G|FLII_ENST00000584444.1_5'Flank|FLII_ENST00000578558.1_Splice_Site_p.C339G|FLII_ENST00000379450.4_Splice_Site_p.C254G	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	339	Interaction with LRRFIP1 and LRRFIP2.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					AGCTTTGGGCACCTGTGAAGA	0.587																																						dbGAP											0													71.0	63.0	66.0					17																	18155869		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.1014-1T>G	17.37:g.18155869A>C			B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Gelsolin,prints_Gelsolin	p.C339G	ENST00000327031.4	37	c.1015	CCDS11192.1	17	.	.	.	.	.	.	.	.	.	.	A	26.5	4.745142	0.89663	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T	0.26223	1.75;1.75	5.67	5.67	0.87782	.	0.090958	0.85682	D	0.000000	T	0.50667	0.1629	M	0.67517	2.055	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;0.998	D;D;D;D;D	0.91635	0.991;0.991;0.999;0.999;0.99	T	0.53092	-0.8487	10	0.87932	D	0	-39.0322	15.9059	0.79430	1.0:0.0:0.0:0.0	.	254;254;339;339;308	E7EPM0;B4DIL0;F5H407;Q13045;B4DIX0	.;.;.;FLII_HUMAN;.	G	339;339;254	ENSP00000324573:C339G;ENSP00000368763:C254G	ENSP00000324573:C339G	C	-	1	0	FLII	18096594	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.757000	0.91657	2.161000	0.67846	0.459000	0.35465	TGC	FLII	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000177731		0.587	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLII	HGNC	protein_coding	OTTHUMT00000132032.2	58	0.00	0	A	NM_002018	Missense_Mutation	18155869	18155869	-1	no_errors	ENST00000327031	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	C
FLNB	2317	genome.wustl.edu	37	3	58062922	58062922	+	Missense_Mutation	SNP	T	T	G	rs80356493		TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:58062922T>G	ENST00000295956.4	+	2	607	c.442T>G	c.(442-444)Tgg>Ggg	p.W148G	FLNB_ENST00000490882.1_Missense_Mutation_p.W148G|FLNB_ENST00000493452.1_5'Flank|FLNB_ENST00000348383.5_Missense_Mutation_p.W148G|FLNB_ENST00000357272.4_Missense_Mutation_p.W148G|FLNB_ENST00000429972.2_Missense_Mutation_p.W148G|FLNB_ENST00000419752.2_5'Flank|FLNB_ENST00000358537.3_Missense_Mutation_p.W148G	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	148	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GCTGCTGGGGTGGATTCAGAA	0.567																																						dbGAP											0			GRCh37	CM062740	FLNB	M	rs80356493						81.0	79.0	79.0					3																	58062922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.442T>G	3.37:g.58062922T>G	ENSP00000295956:p.Trp148Gly		B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.W148G	ENST00000295956.4	37	c.442	CCDS2885.1	3	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185093	0.78677	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272	D;D;D;D;D;D	0.99727	-6.55;-6.55;-6.55;-6.55;-6.55;-6.55	5.04	5.04	0.67666	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.99849	0.9930	H	0.98559	4.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.998;0.998	D	0.96455	0.9337	10	0.87932	D	0	.	15.0692	0.72021	0.0:0.0:0.0:1.0	.	148;148;148;148	O75369-2;B2ZZ83;Q60FE7;O75369	.;.;.;FLNB_HUMAN	G	148	ENSP00000295956:W148G;ENSP00000420213:W148G;ENSP00000351339:W148G;ENSP00000415599:W148G;ENSP00000232447:W148G;ENSP00000349819:W148G	ENSP00000295956:W148G	W	+	1	0	FLNB	58037962	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.997000	0.88414	2.019000	0.59389	0.374000	0.22700	TGG	FLNB	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000136068		0.567	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLNB	HGNC	protein_coding	OTTHUMT00000353569.1	103	0.00	0	T	NM_001457		58062922	58062922	+1	no_errors	ENST00000295956	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	1.000	G
FLOT1	10211	genome.wustl.edu	37	6	30698753	30698753	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:30698753A>C	ENST00000376389.3	-	9	1068	c.848T>G	c.(847-849)gTg>gGg	p.V283G	FLOT1_ENST00000456573.2_Missense_Mutation_p.V235G	NM_005803.2	NP_005794.1	P41440	S19A1_HUMAN	flotillin 1	262					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|methotrexate transporter activity (GO:0015350)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|prostate(1)	13					Methotrexate(DB00563)|Pralatrexate(DB06813)	TGGCTTCCGCACCCGGGCCTC	0.677																																						dbGAP											0													40.0	46.0	44.0					6																	30698753		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF089750	CCDS4688.1	6p21.3	2010-02-17			ENSG00000137312	ENSG00000137312			3757	protein-coding gene	gene with protein product		606998					Standard	XM_005248780		Approved		uc003nrm.3	O75955	OTTHUMG00000031151	ENST00000376389.3:c.848T>G	6.37:g.30698753A>C	ENSP00000365569:p.Val283Gly		B2R7U8|B7Z8C3|E9PFY4|O00553|O60227|Q13026|Q9BTX8	Missense_Mutation	SNP	pfam_Band_7,smart_Band_7	p.V283G	ENST00000376389.3	37	c.848	CCDS4688.1	6	.	.	.	.	.	.	.	.	.	.	A	20.5	3.994473	0.74703	.	.	ENSG00000137312	ENST00000376389;ENST00000456573;ENST00000413165	T;T	0.41065	1.01;1.23	4.67	4.67	0.58626	.	0.289217	0.32952	N	0.005448	T	0.56140	0.1965	M	0.86651	2.83	0.58432	D	0.999997	D;D	0.59357	0.973;0.985	P;P	0.59825	0.864;0.797	T	0.65825	-0.6074	10	0.87932	D	0	-18.502	12.4241	0.55536	1.0:0.0:0.0:0.0	.	235;283	B4DVY7;O75955	.;FLOT1_HUMAN	G	283;235;220	ENSP00000365569:V283G;ENSP00000394375:V235G	ENSP00000365569:V283G	V	-	2	0	FLOT1	30806732	0.978000	0.34361	0.970000	0.41538	0.651000	0.38670	5.605000	0.67634	2.105000	0.64084	0.529000	0.55759	GTG	FLOT1	-	NULL	ENSG00000137312		0.677	FLOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLOT1	HGNC	protein_coding	OTTHUMT00000076276.2	54	0.00	0	A			30698753	30698753	-1	no_errors	ENST00000376389	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.981	C
CMTR1	23070	genome.wustl.edu	37	6	37418099	37418099	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:37418099G>A	ENST00000373451.4	+	5	681	c.517G>A	c.(517-519)Gat>Aat	p.D173N		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	173					7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										GGAAATGAGCGATTGGATGGT	0.458																																						dbGAP											0													161.0	126.0	138.0					6																	37418099		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.517G>A	6.37:g.37418099G>A	ENSP00000362550:p.Asp173Asn		A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	pfam_rRNA_MeTrfase_FtsJ_dom,pfam_G_patch_dom,smart_G_patch_dom,smart_WW_Rsp5_WWP,pfscan_G_patch_dom	p.D173N	ENST00000373451.4	37	c.517	CCDS4835.1	6	.	.	.	.	.	.	.	.	.	.	G	16.01	3.002606	0.54254	.	.	ENSG00000137200	ENST00000373451;ENST00000455891;ENST00000373427	.	.	.	5.71	4.84	0.62591	.	0.249280	0.47455	D	0.000222	T	0.20129	0.0484	L	0.28556	0.865	0.48511	D	0.999661	P;B	0.42993	0.797;0.029	B;B	0.33620	0.167;0.009	T	0.04440	-1.0951	9	0.19147	T	0.46	-10.8374	13.7126	0.62678	0.0736:0.0:0.9264:0.0	.	173;173	Q5T7F5;Q8N1G2	.;MTR1_HUMAN	N	173	.	ENSP00000362526:D173N	D	+	1	0	FTSJD2	37526077	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	3.458000	0.53014	1.422000	0.47177	0.655000	0.94253	GAT	FTSJD2	-	NULL	ENSG00000137200		0.458	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJD2	HGNC	protein_coding	OTTHUMT00000040408.1	298	0.00	0	G	NM_015050		37418099	37418099	+1	no_errors	ENST00000373451	ensembl	human	known	69_37n	missense	122	29.07	50	SNP	0.998	A
FNDC1	84624	genome.wustl.edu	37	6	159650900	159650900	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:159650900A>C	ENST00000297267.9	+	10	1434	c.1234A>C	c.(1234-1236)Acc>Ccc	p.T412P	FNDC1_ENST00000340366.6_Intron	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	412	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AAAGTCCCTCACCTATCCTGG	0.507																																						dbGAP											0													186.0	191.0	189.0					6																	159650900		1920	4131	6051	-	-	-	SO:0001583	missense	0			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1234A>C	6.37:g.159650900A>C	ENSP00000297267:p.Thr412Pro		A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T412P	ENST00000297267.9	37	c.1234	CCDS47512.1	6	.	.	.	.	.	.	.	.	.	.	A	15.18	2.757869	0.49468	.	.	ENSG00000164694	ENST00000297267	T	0.59638	0.25	5.82	4.64	0.57946	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.053627	0.64402	D	0.000001	T	0.55609	0.1931	L	0.54323	1.7	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	T	0.55457	-0.8138	10	0.24483	T	0.36	-21.6518	10.0484	0.42201	0.6162:0.0:0.0:0.3838	.	412	Q4ZHG4	FNDC1_HUMAN	P	412	ENSP00000297267:T412P	ENSP00000297267:T412P	T	+	1	0	FNDC1	159570888	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.647000	0.61418	1.017000	0.39495	-0.333000	0.08304	ACC	FNDC1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000164694		0.507	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	HGNC	protein_coding	OTTHUMT00000042897.3	143	0.69	1	A	NM_032532		159650900	159650900	+1	no_errors	ENST00000297267	ensembl	human	known	69_37n	missense	66	13.16	10	SNP	1.000	C
GAN	8139	genome.wustl.edu	37	16	81397481	81397481	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr16:81397481C>A	ENST00000568107.2	+	7	1331	c.1169C>A	c.(1168-1170)tCc>tAc	p.S390Y		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	390					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				GAGCTGATTTCCATGGAGTGT	0.413																																					GBM(106;1239 1507 7582 9741 33976)	dbGAP											0													231.0	210.0	217.0					16																	81397481		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.1169C>A	16.37:g.81397481C>A	ENSP00000476795:p.Ser390Tyr			Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S390Y	ENST00000568107.2	37	c.1169	CCDS10935.1	16	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000009	0.74818	.	.	ENSG00000127688	ENST00000248272	T	0.81330	-1.48	5.07	5.07	0.68467	Galactose oxidase, beta-propeller (1);	0.279124	0.41097	D	0.000955	D	0.89543	0.6745	M	0.83774	2.66	0.51233	D	0.999918	D	0.61080	0.989	P	0.61070	0.883	D	0.91014	0.4852	10	0.87932	D	0	.	18.6463	0.91411	0.0:1.0:0.0:0.0	.	390	Q9H2C0	GAN_HUMAN	Y	390	ENSP00000248272:S390Y	ENSP00000248272:S390Y	S	+	2	0	GAN	79954982	1.000000	0.71417	0.998000	0.56505	0.836000	0.47400	5.554000	0.67294	2.631000	0.89168	0.563000	0.77884	TCC	GAN	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000127688		0.413	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAN	HGNC	protein_coding	OTTHUMT00000269050.3	397	0.00	0	C			81397481	81397481	+1	no_errors	ENST00000248272	ensembl	human	known	69_37n	missense	189	11.68	25	SNP	1.000	A
GEMIN5	25929	genome.wustl.edu	37	5	154317530	154317530	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr5:154317530C>T	ENST00000285873.7	-	1	239	c.164G>A	c.(163-165)cGa>cAa	p.R55Q		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	55					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TGAGTTACCTCGAAACGGGGG	0.672																																						dbGAP											0													22.0	25.0	24.0					5																	154317530		2201	4298	6499	-	-	-	SO:0001583	missense	0			AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.164G>A	5.37:g.154317530C>T	ENSP00000285873:p.Arg55Gln		Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R55Q	ENST00000285873.7	37	c.164	CCDS4330.1	5	.	.	.	.	.	.	.	.	.	.	C	15.90	2.968902	0.53614	.	.	ENSG00000082516	ENST00000285873	T	0.65178	-0.14	4.32	4.32	0.51571	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.525151	0.18621	N	0.135848	T	0.38904	0.1058	N	0.13299	0.325	0.34088	D	0.660384	P;P	0.48407	0.91;0.91	B;B	0.40477	0.33;0.33	T	0.47861	-0.9084	10	0.34782	T	0.22	-18.6244	5.1516	0.15013	0.0:0.7603:0.0:0.2397	.	55;55	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	Q	55	ENSP00000285873:R55Q	ENSP00000285873:R55Q	R	-	2	0	GEMIN5	154297723	1.000000	0.71417	1.000000	0.80357	0.596000	0.36781	2.721000	0.47260	2.688000	0.91661	0.591000	0.81541	CGA	GEMIN5	-	smart_WD40_repeat	ENSG00000082516		0.672	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN5	HGNC	protein_coding	OTTHUMT00000252507.1	32	0.00	0	C			154317530	154317530	-1	no_errors	ENST00000285873	ensembl	human	known	69_37n	missense	12	45.45	10	SNP	1.000	T
GNAZ	2781	genome.wustl.edu	37	22	23465518	23465518	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr22:23465518A>C	ENST00000248996.4	+	3	1634	c.968A>C	c.(967-969)cAc>cCc	p.H323P	RTDR1_ENST00000216036.4_Intron	NM_002073.2	NP_002064.1	P19086	GNAZ_HUMAN	guanine nucleotide binding protein (G protein), alpha z polypeptide	323					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|signal transducer activity (GO:0004871)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(5)|urinary_tract(1)	19	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.166)		ATCTACTCCCACTTCACCTGC	0.527																																						dbGAP											0													145.0	107.0	120.0					22																	23465518		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13804.1	22q11.1-q11.2	2008-06-10			ENSG00000128266	ENSG00000128266			4395	protein-coding gene	gene with protein product		139160				2115889	Standard	NM_002073		Approved		uc002zwu.1	P19086	OTTHUMG00000150611	ENST00000248996.4:c.968A>C	22.37:g.23465518A>C	ENSP00000248996:p.His323Pro		B2R6C1|Q4QRJ6	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.H323P	ENST00000248996.4	37	c.968	CCDS13804.1	22	.	.	.	.	.	.	.	.	.	.	A	28.3	4.909922	0.92107	.	.	ENSG00000128266	ENST00000248996;ENST00000456059	D	0.91011	-2.77	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.97040	0.9033	H	0.97732	4.065	0.80722	D	1	D	0.63880	0.993	D	0.79108	0.992	D	0.98372	1.0554	10	0.87932	D	0	.	14.8683	0.70434	1.0:0.0:0.0:0.0	.	323	P19086	GNAZ_HUMAN	P	323;271	ENSP00000248996:H323P	ENSP00000248996:H323P	H	+	2	0	GNAZ	21795518	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.082000	0.94059	2.176000	0.68965	0.533000	0.62120	CAC	GNAZ	-	pfam_Gprotein_alpha_su,smart_Gprotein_alpha_su	ENSG00000128266		0.527	GNAZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAZ	HGNC	protein_coding	OTTHUMT00000319073.1	217	0.46	1	A	NM_002073		23465518	23465518	+1	no_errors	ENST00000248996	ensembl	human	known	69_37n	missense	49	24.62	16	SNP	1.000	C
GNL1	2794	genome.wustl.edu	37	6	30514036	30514036	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:30514036A>C	ENST00000376621.3	-	12	2607	c.1637T>G	c.(1636-1638)gTg>gGg	p.V546G		NM_005275.3	NP_005266.2	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1	546					cellular response to DNA damage stimulus (GO:0006974)|GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)|signal transduction (GO:0007165)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			cervix(2)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	25						TGCTGGCCCCACCCTGCCCTG	0.587																																						dbGAP											0													38.0	30.0	33.0					6																	30514036		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS4680.1	6p21.3	2010-02-17			ENSG00000204590	ENSG00000204590			4413	protein-coding gene	gene with protein product		143024				8180467	Standard	NM_005275		Approved	HSR1	uc003nqh.3	P36915	OTTHUMG00000031137	ENST00000376621.3:c.1637T>G	6.37:g.30514036A>C	ENSP00000365806:p.Val546Gly		B0S838|Q96CT5	Missense_Mutation	SNP	pfam_GTP_binding_domain	p.V546G	ENST00000376621.3	37	c.1637	CCDS4680.1	6	.	.	.	.	.	.	.	.	.	.	A	13.65	2.300884	0.40694	.	.	ENSG00000204590	ENST00000376621;ENST00000426875;ENST00000429126	T	0.45276	0.9	5.63	1.83	0.25207	.	0.370797	0.27787	N	0.017853	T	0.10165	0.0249	N	0.22421	0.69	0.49798	D	0.999829	B;B;B	0.30326	0.276;0.11;0.002	B;B;B	0.19666	0.026;0.026;0.002	T	0.09228	-1.0684	10	0.22109	T	0.4	-14.6149	9.2346	0.37459	0.7802:0.0:0.2198:0.0	.	544;343;546	B4DYK6;B4DWZ0;P36915	.;.;GNL1_HUMAN	G	546;368;343	ENSP00000365806:V546G	ENSP00000365806:V546G	V	-	2	0	GNL1	30622015	0.900000	0.30661	1.000000	0.80357	0.997000	0.91878	0.548000	0.23314	0.415000	0.25817	0.459000	0.35465	GTG	GNL1	-	NULL	ENSG00000204590		0.587	GNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL1	HGNC	protein_coding	OTTHUMT00000076241.2	128	0.77	1	A			30514036	30514036	-1	no_errors	ENST00000376621	ensembl	human	known	69_37n	missense	68	18.07	15	SNP	1.000	C
GOLGA6L2	283685	genome.wustl.edu	37	15	23685300	23685301	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr15:23685300_23685301delTT	ENST00000567107.1	-	8	2373_2374	c.2321_2322delAA	c.(2320-2322)gaafs	p.E774fs	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						ctcctgcatcttctcttgctgc	0.564																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2321_2322delAA	15.37:g.23685300_23685301delTT	ENSP00000454407:p.Glu774fs		A1L301	Frame_Shift_Del	DEL	NULL	p.E774fs	ENST00000567107.1	37	c.2322_2321		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.564	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	48	0.00	0	TT	NM_182561		23685300	23685301	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	frame_shift_del	12	31.58	6	DEL	0.104:0.092	-
POMGNT2	84892	genome.wustl.edu	37	3	43121374	43121374	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:43121374A>C	ENST00000344697.2	-	2	1895	c.1550T>G	c.(1549-1551)gTg>gGg	p.V517G	POMGNT2_ENST00000441964.1_Missense_Mutation_p.V517G	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	517	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										CACCTCCCTCACCTTCAGGTA	0.597																																						dbGAP											0													111.0	93.0	99.0					3																	43121374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.1550T>G	3.37:g.43121374A>C	ENSP00000344125:p.Val517Gly		B3KWC3|Q96SY3	Missense_Mutation	SNP	pfam_Glycosyltransferase_AER61,superfamily_Fibronectin_type3	p.V517G	ENST00000344697.2	37	c.1550	CCDS2709.1	3	.	.	.	.	.	.	.	.	.	.	A	14.77	2.634099	0.47049	.	.	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.79141	-1.24;-1.24	5.57	5.57	0.84162	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87993	0.6318	M	0.81802	2.56	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	D	0.88726	0.3233	10	0.51188	T	0.08	-13.6461	14.905	0.70711	1.0:0.0:0.0:0.0	.	517	Q8NAT1	AGO61_HUMAN	G	517	ENSP00000408992:V517G;ENSP00000344125:V517G	ENSP00000344125:V517G	V	-	2	0	C3orf39	43096378	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.164000	0.77533	2.116000	0.64780	0.533000	0.62120	GTG	GTDC2	-	superfamily_Fibronectin_type3	ENSG00000144647		0.597	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTDC2	HGNC	protein_coding	OTTHUMT00000256643.1	203	0.00	0	A	NM_032806		43121374	43121374	-1	no_errors	ENST00000344697	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	C
HPN	3249	genome.wustl.edu	37	19	35540195	35540195	+	Splice_Site	SNP	T	T	G	rs375787478		TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:35540195T>G	ENST00000262626.2	+	3	843	c.18T>G	c.(16-18)ggT>ggG	p.G6G	HPN_ENST00000392226.1_Splice_Site_p.G6G|HPN_ENST00000597419.1_Intron	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	6					basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	CTGTTGCAGGTGGCCGGACTG	0.662																																						dbGAP											0													80.0	78.0	78.0					19																	35540195		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.17-1T>G	19.37:g.35540195T>G			B2RDS4	Silent	SNP	pfam_Peptidase_S1_S6,pfam_Hepsin-SRCR,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.G6	ENST00000262626.2	37	c.18	CCDS32993.1	19																																																																																			HPN	-	NULL	ENSG00000105707		0.662	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPN	HGNC	protein_coding	OTTHUMT00000461573.1	90	0.00	0	T	NM_002151	Silent	35540195	35540195	+1	no_errors	ENST00000262626	ensembl	human	known	69_37n	silent	39	18.37	9	SNP	1.000	G
HS6ST2	90161	genome.wustl.edu	37	X	131762942	131762942	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chrX:131762942T>C	ENST00000370836.2	-	4	1542	c.1127A>G	c.(1126-1128)aAa>aGa	p.K376R	HS6ST2_ENST00000406696.3_Missense_Mutation_p.K102R|HS6ST2_ENST00000521489.1_Missense_Mutation_p.K416R|HS6ST2_ENST00000370833.2_Missense_Mutation_p.K270R	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	376					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					CATAAACTCTTTGAGGGGGCA	0.572																																						dbGAP											0													54.0	53.0	53.0					X																	131762942		2088	4195	6283	-	-	-	SO:0001583	missense	0			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.1127A>G	X.37:g.131762942T>C	ENSP00000359873:p.Lys376Arg		B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	pfam_Sulfotransferase	p.K416R	ENST00000370836.2	37	c.1247	CCDS48169.1	X	.	.	.	.	.	.	.	.	.	.	T	16.18	3.049251	0.55218	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000406696;ENST00000370833;ENST00000319809	T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76	5.87	4.7	0.59300	.	0.192757	0.56097	D	0.000037	T	0.55893	0.1949	N	0.12182	0.205	0.32958	D	0.520646	P;B;B	0.40398	0.716;0.387;0.001	B;B;B	0.39068	0.289;0.212;0.003	T	0.63795	-0.6556	10	0.33940	T	0.23	-0.0372	10.2998	0.43646	0.0:0.0775:0.0:0.9225	.	376;416;102	Q96MM7;E9PDY5;B7Z5H6	H6ST2_HUMAN;.;.	R	230;376;416;102;270;257	ENSP00000359874:K230R;ENSP00000359873:K376R;ENSP00000429473:K416R;ENSP00000384013:K102R;ENSP00000359870:K270R	ENSP00000324617:K257R	K	-	2	0	HS6ST2	131590623	0.979000	0.34478	0.988000	0.46212	0.993000	0.82548	1.271000	0.33098	0.833000	0.34828	0.486000	0.48141	AAA	HS6ST2	-	pfam_Sulfotransferase	ENSG00000171004		0.572	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HS6ST2	HGNC	protein_coding	OTTHUMT00000058332.3	162	0.00	0	T	NM_147174		131762942	131762942	-1	no_errors	ENST00000521489	ensembl	human	known	69_37n	missense	62	27.06	23	SNP	1.000	C
HS6ST3	266722	genome.wustl.edu	37	13	97485222	97485222	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr13:97485222C>T	ENST00000376705.2	+	2	1210	c.1186C>T	c.(1186-1188)Cgc>Tgc	p.R396C		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	396					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					TGCCCGCCAACGCATTGAGGA	0.507																																						dbGAP											0													97.0	90.0	92.0					13																	97485222		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.1186C>T	13.37:g.97485222C>T	ENSP00000365895:p.Arg396Cys		Q5W0L0|Q68CW6	Missense_Mutation	SNP	pfam_Sulfotransferase	p.R396C	ENST00000376705.2	37	c.1186	CCDS9481.1	13	.	.	.	.	.	.	.	.	.	.	C	18.17	3.563879	0.65651	.	.	ENSG00000185352	ENST00000376705	T	0.76186	-1.0	5.91	5.91	0.95273	.	0.053567	0.64402	D	0.000001	T	0.75715	0.3887	M	0.84683	2.71	0.58432	D	0.999996	P	0.35411	0.5	B	0.28916	0.096	T	0.78954	-0.2000	10	0.72032	D	0.01	-13.4886	14.4562	0.67418	0.0:0.9301:0.0:0.0699	.	396	Q8IZP7	H6ST3_HUMAN	C	396	ENSP00000365895:R396C	ENSP00000365895:R396C	R	+	1	0	HS6ST3	96283223	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.965000	0.63708	2.791000	0.96007	0.655000	0.94253	CGC	HS6ST3	-	pfam_Sulfotransferase	ENSG00000185352		0.507	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST3	HGNC	protein_coding	OTTHUMT00000045517.2	120	0.00	0	C	NM_153456		97485222	97485222	+1	no_errors	ENST00000376705	ensembl	human	known	69_37n	missense	60	23.08	18	SNP	1.000	T
IQSEC3	440073	genome.wustl.edu	37	12	247490	247490	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr12:247490A>C	ENST00000538872.1	+	4	1079	c.961A>C	c.(961-963)Acc>Ccc	p.T321P	IQSEC3_ENST00000326261.4_Missense_Mutation_p.T321P|RP11-598F7.4_ENST00000508953.2_RNA|IQSEC3_ENST00000382841.2_Missense_Mutation_p.T18P|RP11-598F7.4_ENST00000505893.2_RNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	321	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CGCCGCTTGCACCATCCAAAC	0.592																																						dbGAP											0													56.0	49.0	51.0					12																	247490		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.961A>C	12.37:g.247490A>C	ENSP00000437554:p.Thr321Pro		A6NIF2|A6NKV9|Q8TB43	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.T321P	ENST00000538872.1	37	c.961	CCDS53728.1	12	.	.	.	.	.	.	.	.	.	.	A	25.7	4.662897	0.88251	.	.	ENSG00000120645	ENST00000538872;ENST00000326261;ENST00000382841	T;T;T	0.81163	-1.46;-1.46;-1.09	5.29	5.29	0.74685	.	0.183469	0.64402	D	0.000019	D	0.87795	0.6267	M	0.79123	2.44	0.54753	D	0.999981	D;D	0.63880	0.993;0.989	P;P	0.58266	0.69;0.836	D	0.89493	0.3758	10	0.72032	D	0.01	.	15.2344	0.73416	1.0:0.0:0.0:0.0	.	321;18	Q9UPP2;Q9UPP2-2	IQEC3_HUMAN;.	P	321;321;18	ENSP00000437554:T321P;ENSP00000315662:T321P;ENSP00000372292:T18P	ENSP00000315662:T321P	T	+	1	0	IQSEC3	117751	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.321000	0.96353	2.003000	0.58678	0.379000	0.24179	ACC	IQSEC3	-	pfscan_IQ_motif_EF-hand-BS	ENSG00000120645		0.592	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IQSEC3	HGNC	protein_coding	OTTHUMT00000397382.3	110	0.00	0	A	XM_495902		247490	247490	+1	no_errors	ENST00000326261	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	1.000	C
ITFG3	83986	genome.wustl.edu	37	16	314064	314064	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr16:314064T>C	ENST00000399932.3	+	11	1689	c.1238T>C	c.(1237-1239)cTc>cCc	p.L413P	ITFG3_ENST00000450082.2_Missense_Mutation_p.L413P|ITFG3_ENST00000301678.3_Missense_Mutation_p.L413P|ITFG3_ENST00000442458.2_Missense_Mutation_p.L413P|ITFG3_ENST00000301679.2_Missense_Mutation_p.L413P|ITFG3_ENST00000600536.1_Missense_Mutation_p.L413P	NM_001284497.1	NP_001271426.1	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	413						cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(3)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				AGCCTAGCCCTCCCGAGCCTC	0.672																																						dbGAP											0													30.0	37.0	35.0					16																	314064		2002	4153	6155	-	-	-	SO:0001583	missense	0			AL136542	CCDS10402.1	16p13.3	2006-03-31	2006-03-31	2006-03-31	ENSG00000167930	ENSG00000167930			14163	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 9"""	C16orf9			Standard	XM_005255622		Approved	DKFZP761D0211, FLJ32603	uc002cgf.3	Q9H0X4	OTTHUMG00000060728	ENST00000399932.3:c.1238T>C	16.37:g.314064T>C	ENSP00000382814:p.Leu413Pro		D3DU45|Q7L416|Q96FR1|Q96MC7|Q96S30	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.L413P	ENST00000399932.3	37	c.1238	CCDS10402.1	16	.	.	.	.	.	.	.	.	.	.	T	11.92	1.783755	0.31593	.	.	ENSG00000167930	ENST00000399932;ENST00000301679;ENST00000442458;ENST00000301678;ENST00000450082	T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09	5.57	4.48	0.54585	Quinonprotein alcohol dehydrogenase-like (1);	0.261225	0.38959	N	0.001503	T	0.73606	0.3608	M	0.81239	2.535	0.33588	D	0.600692	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	T	0.81816	-0.0759	10	0.87932	D	0	-13.8678	8.5644	0.33531	0.0:0.0873:0.0:0.9127	.	413;413	Q9H0X4-2;Q9H0X4	.;ITFG3_HUMAN	P	413	ENSP00000382814:L413P;ENSP00000301679:L413P;ENSP00000397477:L413P;ENSP00000301678:L413P;ENSP00000411394:L413P	ENSP00000301678:L413P	L	+	2	0	ITFG3	254065	0.792000	0.28813	0.245000	0.24217	0.126000	0.20510	2.668000	0.46816	2.117000	0.64856	0.459000	0.35465	CTC	ITFG3	-	superfamily_Quinonprotein_ADH-like	ENSG00000167930		0.672	ITFG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG3	HGNC	protein_coding	OTTHUMT00000134227.2	62	0.00	0	T	NM_032039		314064	314064	+1	no_errors	ENST00000301678	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.076	C
KCNT1	57582	genome.wustl.edu	37	9	138676624	138676624	+	Silent	SNP	C	C	T	rs576099213	byFrequency	TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr9:138676624C>T	ENST00000263604.3	+	27	2988	c.2988C>T	c.(2986-2988)ggC>ggT	p.G996G	KCNT1_ENST00000488444.2_Silent_p.G996G|KCNT1_ENST00000491806.2_Silent_p.G982G|KCNT1_ENST00000298480.5_Silent_p.G1015G|KCNT1_ENST00000371757.2_Silent_p.G1015G|KCNT1_ENST00000490355.2_Silent_p.G994G|KCNT1_ENST00000487664.1_Silent_p.G970G|KCNT1_ENST00000486577.2_Silent_p.G974G			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	996					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		TCACCGAGGGCGACCTGTGGA	0.637													C|||	2	0.000399361	0.0	0.0	5008	,	,		11633	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													64.0	68.0	67.0					9																	138676624		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2988C>T	9.37:g.138676624C>T			B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Silent	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.G1015	ENST00000263604.3	37	c.3045		9																																																																																			KCNT1	-	NULL	ENSG00000107147		0.637	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	HGNC	protein_coding		43	0.00	0	C	NM_020822		138676624	138676624	+1	no_errors	ENST00000298480	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	0.961	T
KHNYN	23351	genome.wustl.edu	37	14	24901064	24901064	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr14:24901064T>G	ENST00000251343.5	+	3	736	c.597T>G	c.(595-597)agT>agG	p.S199R	CBLN3_ENST00000267406.6_5'Flank|KHNYN_ENST00000556842.1_Missense_Mutation_p.S199R|KHNYN_ENST00000554268.1_5'Flank|KHNYN_ENST00000553935.1_Missense_Mutation_p.S199R|CBLN3_ENST00000555436.1_5'Flank			O15037	KHNYN_HUMAN	KH and NYN domain containing	199							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						AGGCGTCTAGTGGGCAGGGGC	0.662											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													53.0	59.0	57.0					14																	24901064		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.597T>G	14.37:g.24901064T>G	ENSP00000251343:p.Ser199Arg	774	Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.S199R	ENST00000251343.5	37	c.597	CCDS32058.1	14	.	.	.	.	.	.	.	.	.	.	T	0.007	-1.993641	0.00439	.	.	ENSG00000100441	ENST00000251343;ENST00000556842;ENST00000553935	T;T;T	0.22134	1.97;1.97;1.97	4.62	0.29	0.15728	.	0.663459	0.14314	N	0.327500	T	0.03783	0.0107	N	0.00347	-1.61	0.19775	N	0.999954	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40156	-0.9578	10	0.15066	T	0.55	.	3.3838	0.07264	0.2834:0.0:0.3697:0.3469	.	240;199	D3DS77;O15037	.;KHNYN_HUMAN	R	199	ENSP00000251343:S199R;ENSP00000451106:S199R;ENSP00000450799:S199R	ENSP00000251343:S199R	S	+	3	2	KHNYN	23970904	0.009000	0.17119	0.110000	0.21437	0.002000	0.02628	-0.193000	0.09573	-0.174000	0.10743	-0.461000	0.05368	AGT	KHNYN	-	NULL	ENSG00000100441		0.662	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KHNYN	HGNC	protein_coding	OTTHUMT00000412928.1	27	0.00	0	T			24901064	24901064	+1	no_errors	ENST00000251343	ensembl	human	known	69_37n	missense	30	16.22	6	SNP	0.032	G
GSE1	23199	genome.wustl.edu	37	16	85667564	85667564	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr16:85667564A>C	ENST00000253458.7	+	2	228	c.52A>C	c.(52-54)Acc>Ccc	p.T18P	GSE1_ENST00000405402.2_Intron|GSE1_ENST00000393243.1_Intron	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	18																	GATGCTTTCCACCGCGACCAG	0.667																																						dbGAP											0													76.0	86.0	82.0					16																	85667564		2198	4300	6498	-	-	-	SO:0001583	missense	0			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.52A>C	16.37:g.85667564A>C	ENSP00000253458:p.Thr18Pro		D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	pfam_DUF3736	p.T18P	ENST00000253458.7	37	c.52	CCDS10952.1	16	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727259	0.69074	.	.	ENSG00000131149	ENST00000253458	T	0.36878	1.23	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.45236	0.1332	N	0.24115	0.695	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.49661	-0.8916	10	0.72032	D	0.01	-25.2834	13.691	0.62547	1.0:0.0:0.0:0.0	.	18	Q14687	GSE1_HUMAN	P	18	ENSP00000253458:T18P	ENSP00000253458:T18P	T	+	1	0	KIAA0182	84225065	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.802000	0.75175	1.770000	0.52166	0.402000	0.26972	ACC	KIAA0182	-	NULL	ENSG00000131149		0.667	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA0182	HGNC	protein_coding	OTTHUMT00000325527.1	123	0.80	1	A	NM_014615		85667564	85667564	+1	no_errors	ENST00000253458	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	C
KIF17	57576	genome.wustl.edu	37	1	21013963	21013963	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr1:21013963A>C	ENST00000247986.2	-	8	2166	c.1856T>G	c.(1855-1857)gTg>gGg	p.V619G	KIF17_ENST00000400463.3_Missense_Mutation_p.V619G|KIF17_ENST00000375044.1_Missense_Mutation_p.V519G|KIF17_ENST00000490034.1_Intron			Q9P2E2	KIF17_HUMAN	kinesin family member 17	619					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CTTGGCTTCCACCTCGGCAAA	0.647																																						dbGAP											0													76.0	70.0	72.0					1																	21013963		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1856T>G	1.37:g.21013963A>C	ENSP00000247986:p.Val619Gly		A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V619G	ENST00000247986.2	37	c.1856	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	A	12.67	2.007656	0.35415	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.71341	-0.56;-0.44;-0.44	4.84	4.84	0.62591	.	1.148870	0.07003	U	0.823628	T	0.74756	0.3758	L	0.53249	1.67	0.54753	D	0.999983	P;P	0.52061	0.95;0.759	P;B	0.49421	0.61;0.248	T	0.69386	-0.5159	10	0.87932	D	0	.	10.999	0.47593	1.0:0.0:0.0:0.0	.	619;619	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	G	519;619;619	ENSP00000364184:V519G;ENSP00000383311:V619G;ENSP00000247986:V619G	ENSP00000247986:V619G	V	-	2	0	KIF17	20886550	0.987000	0.35691	0.877000	0.34402	0.436000	0.31835	2.394000	0.44450	2.155000	0.67459	0.460000	0.39030	GTG	KIF17	-	NULL	ENSG00000117245		0.647	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	56	0.00	0	A	NM_020816		21013963	21013963	-1	no_errors	ENST00000247986	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.882	C
KLHL33	123103	genome.wustl.edu	37	14	20898533	20898533	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr14:20898533T>G	ENST00000344581.4	-	2	524	c.302A>C	c.(301-303)cAc>cCc	p.H101P		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	101												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		AGCAGGCAGGTGGGTGAGGAG	0.617																																						dbGAP											0													73.0	79.0	77.0					14																	20898533		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.302A>C	14.37:g.20898533T>G	ENSP00000341549:p.His101Pro			Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,superfamily_BTB/POZ_fold,smart_BACK,smart_Kelch_1	p.H101P	ENST00000344581.4	37	c.302	CCDS53882.1	14	.	.	.	.	.	.	.	.	.	.	T	16.26	3.074056	0.55646	.	.	ENSG00000185271	ENST00000344581	T	0.70516	-0.49	4.52	4.52	0.55395	BTB/Kelch-associated (2);	0.061993	0.64402	D	0.000006	T	0.79592	0.4472	M	0.64404	1.975	0.39752	D	0.971908	D	0.71674	0.998	D	0.66351	0.943	T	0.82598	-0.0378	10	0.87932	D	0	.	11.4688	0.50254	0.0:0.0:0.0:1.0	.	101	A6NCF5	KLH33_HUMAN	P	101	ENSP00000341549:H101P	ENSP00000341549:H101P	H	-	2	0	KLHL33	19968373	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.532000	0.60608	1.902000	0.55061	0.533000	0.62120	CAC	KLHL33	-	pfam_BACK,smart_BACK	ENSG00000185271		0.617	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL33	HGNC	protein_coding	OTTHUMT00000411038.1	120	0.81	1	T	XM_063481		20898533	20898533	-1	no_errors	ENST00000344581	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	G
KLK3	354	genome.wustl.edu	37	19	51358236	51358236	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:51358236A>C	ENST00000326003.2	+	1	66	c.25A>C	c.(25-27)Acc>Ccc	p.T9P	KLK3_ENST00000597483.1_Missense_Mutation_p.T9P|KLK3_ENST00000593997.1_Missense_Mutation_p.T9P|KLK3_ENST00000595952.1_Missense_Mutation_p.T9P|KLK3_ENST00000360617.3_Missense_Mutation_p.T9P	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	9					cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		TGTCTTCCTCACCCTGTCCGT	0.622																																					Colon(185;1767 2023 13025 30120 37630)	dbGAP											0													119.0	86.0	97.0					19																	51358236		2203	4300	6503	-	-	-	SO:0001583	missense	0			X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.25A>C	19.37:g.51358236A>C	ENSP00000314151:p.Thr9Pro		C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.T9P	ENST00000326003.2	37	c.25	CCDS12807.1	19	.	.	.	.	.	.	.	.	.	.	A	9.543	1.113898	0.20795	.	.	ENSG00000142515	ENST00000326003;ENST00000422986;ENST00000360617;ENST00000435152;ENST00000326052	D;D;D	0.90844	-2.52;-2.74;-2.47	2.16	-3.95	0.04118	.	0.552015	0.13637	N	0.373219	D	0.82742	0.5103	L	0.32530	0.975	0.09310	N	1	B;P;P;B	0.37398	0.006;0.593;0.593;0.277	B;B;B;B	0.39465	0.005;0.3;0.225;0.029	T	0.74456	-0.3659	10	0.66056	D	0.02	.	6.9449	0.24512	0.5981:0.0:0.4019:0.0	.	9;9;9;9	Q8NCW4;G3XAE3;G3V0H4;C9JXH3	.;.;.;.	P	9	ENSP00000314151:T9P;ENSP00000393628:T9P;ENSP00000353829:T9P	ENSP00000314151:T9P	T	+	1	0	KLK3	56050048	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.314000	0.08092	-0.934000	0.03733	0.329000	0.21502	ACC	KLK3	-	NULL	ENSG00000142515		0.622	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK3	HGNC	protein_coding	OTTHUMT00000464067.1	107	0.00	0	A	NM_145864		51358236	51358236	+1	no_errors	ENST00000326003	ensembl	human	known	69_37n	missense	58	19.18	14	SNP	0.000	C
KRT83	3889	genome.wustl.edu	37	12	52708539	52708539	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr12:52708539A>C	ENST00000293670.3	-	9	1420	c.1358T>G	c.(1357-1359)gTg>gGg	p.V453G	AC121757.1_ENST00000594763.1_5'Flank	NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	453	Tail.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GCTGCCCGTCACCGGCCGGGA	0.672																																					GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	dbGAP											0													23.0	23.0	23.0					12																	52708539		2194	4294	6488	-	-	-	SO:0001583	missense	0			X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.1358T>G	12.37:g.52708539A>C	ENSP00000293670:p.Val453Gly		A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.V453G	ENST00000293670.3	37	c.1358	CCDS8823.1	12	.	.	.	.	.	.	.	.	.	.	A	10.19	1.282455	0.23392	.	.	ENSG00000170523	ENST00000293670	D	0.87809	-2.3	3.8	3.8	0.43715	.	0.502627	0.14131	U	0.339409	D	0.82688	0.5091	L	0.42245	1.32	0.38068	D	0.936272	P	0.41748	0.761	B	0.43867	0.434	T	0.78076	-0.2345	10	0.19590	T	0.45	.	9.2218	0.37382	1.0:0.0:0.0:0.0	.	453	P78385	KRT83_HUMAN	G	453	ENSP00000293670:V453G	ENSP00000293670:V453G	V	-	2	0	KRT83	50994806	0.063000	0.20901	0.078000	0.20375	0.035000	0.12851	2.161000	0.42358	1.503000	0.48686	0.260000	0.18958	GTG	KRT83	-	NULL	ENSG00000170523		0.672	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT83	HGNC	protein_coding	OTTHUMT00000405182.1	35	0.00	0	A	NM_002282		52708539	52708539	-1	no_errors	ENST00000293670	ensembl	human	known	69_37n	missense	18	17.39	4	SNP	0.388	C
LAMB2	3913	genome.wustl.edu	37	3	49159431	49159431	+	Silent	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:49159431A>C	ENST00000418109.1	-	30	5033	c.4869T>G	c.(4867-4869)ggT>ggG	p.G1623G	USP19_ENST00000398898.2_5'Flank|USP19_ENST00000398888.2_5'Flank|LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000434032.2_5'Flank|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000417901.1_5'Flank|USP19_ENST00000398892.3_5'Flank|LAMB2_ENST00000305544.4_Silent_p.G1623G|USP19_ENST00000453664.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1623	Domain I.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCCGGATGGCACCCTGGGCAA	0.607																																						dbGAP											0													97.0	91.0	93.0					3																	49159431		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.4869T>G	3.37:g.49159431A>C			Q16321	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.G1623	ENST00000418109.1	37	c.4869	CCDS2789.1	3																																																																																			LAMB2	-	NULL	ENSG00000172037		0.607	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	132	0.75	1	A	NM_002292		49159431	49159431	-1	no_errors	ENST00000305544	ensembl	human	known	69_37n	silent	44	21.43	12	SNP	0.323	C
LGALS9C	654346	genome.wustl.edu	37	17	18390968	18390968	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:18390968T>G	ENST00000328114.6	+	4	422	c.341T>G	c.(340-342)gTg>gGg	p.V114G	LGALS9C_ENST00000584941.1_Missense_Mutation_p.V114G|LGALS9C_ENST00000412421.2_Missense_Mutation_p.V26G|LGALS9C_ENST00000583322.1_Missense_Mutation_p.V114G|LGALS9C_ENST00000581545.1_Missense_Mutation_p.V114G	NM_001040078.2	NP_001035167.2	Q6DKI2	LEG9C_HUMAN	lectin, galactoside-binding, soluble, 9C	114	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)			NS(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	7						CAGGTGATGGTGAACGGGAGC	0.597																																						dbGAP											0													18.0	13.0	15.0					17																	18390968		2187	4177	6364	-	-	-	SO:0001583	missense	0				CCDS32587.1	17p11.2	2011-08-04			ENSG00000171916	ENSG00000171916		"""Lectins, galactoside-binding"""	33874	protein-coding gene	gene with protein product							Standard	NM_001040078		Approved		uc002gtw.3	Q6DKI2	OTTHUMG00000059251	ENST00000328114.6:c.341T>G	17.37:g.18390968T>G	ENSP00000329932:p.Val114Gly		B0AZM7	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.V114G	ENST00000328114.6	37	c.341	CCDS32587.1	17	.	.	.	.	.	.	.	.	.	.	t	12.37	1.918063	0.33815	.	.	ENSG00000171916	ENST00000412421;ENST00000328114	T;T	0.11495	2.77;2.77	3.37	3.37	0.38596	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.481200	0.21287	N	0.077047	T	0.45196	0.1330	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58578	-0.7612	10	0.87932	D	0	.	10.0585	0.42259	0.0:0.0:0.0:1.0	.	114	Q6DKI2	LEG9C_HUMAN	G	26;114	ENSP00000390286:V26G;ENSP00000329932:V114G	ENSP00000329932:V114G	V	+	2	0	LGALS9C	18331693	1.000000	0.71417	0.903000	0.35520	0.383000	0.30230	5.328000	0.65887	1.317000	0.45149	0.155000	0.16302	GTG	LGALS9C	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	ENSG00000171916		0.597	LGALS9C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LGALS9C	HGNC	protein_coding	OTTHUMT00000131456.2	70	0.00	0	T	NM_001040078		18390968	18390968	+1	no_errors	ENST00000328114	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.999	G
LIMS2	55679	genome.wustl.edu	37	2	128400528	128400528	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr2:128400528T>G	ENST00000355119.4	-	5	644	c.479A>C	c.(478-480)cAc>cCc	p.H160P	LIMS2_ENST00000409754.1_Missense_Mutation_p.H8P|LIMS2_ENST00000409808.2_Missense_Mutation_p.H155P|LIMS2_ENST00000410011.1_Missense_Mutation_p.H155P|LIMS2_ENST00000409455.1_Missense_Mutation_p.H155P|LIMS2_ENST00000409254.1_Missense_Mutation_p.H8P|LIMS2_ENST00000324938.5_Missense_Mutation_p.H184P|LIMS2_ENST00000494613.1_5'Flank|LIMS2_ENST00000545738.2_Missense_Mutation_p.H182P|GPR17_ENST00000544369.1_5'Flank|LIMS2_ENST00000410038.1_Missense_Mutation_p.H8P|LIMS2_ENST00000409286.1_Missense_Mutation_p.H8P	NM_001161403.1	NP_001154875.1	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2	160	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		GTGGTCAGGGTGGTAGGCGTC	0.667																																						dbGAP											0													79.0	55.0	63.0					2																	128400528		2189	4292	6481	-	-	-	SO:0001583	missense	0			AF520987	CCDS2147.1, CCDS54394.1, CCDS54395.1, CCDS54396.1, CCDS58725.1	2q21.1	2008-02-05			ENSG00000072163	ENSG00000072163			16084	protein-coding gene	gene with protein product		607908					Standard	NM_017980		Approved		uc002tox.3	Q7Z4I7	OTTHUMG00000131529	ENST00000355119.4:c.479A>C	2.37:g.128400528T>G	ENSP00000347240:p.His160Pro		A6NLH0|B4DMV1|F5H6E6|Q7Z4I2|Q7Z4I6|Q7Z4I8|Q8NFE7|Q9HA13	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH,pfscan_Znf_LIM	p.H184P	ENST00000355119.4	37	c.551	CCDS54395.1	2	.	.	.	.	.	.	.	.	.	.	t	19.83	3.899335	0.72754	.	.	ENSG00000072163	ENST00000545738;ENST00000355119;ENST00000409286;ENST00000409754;ENST00000324938;ENST00000409455;ENST00000410109;ENST00000409808;ENST00000410011;ENST00000342067;ENST00000537572;ENST00000410038;ENST00000544917;ENST00000409254	D;D;D;D;D;D;D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99;-3.99;-3.99;-3.99;-3.99;-3.99;-3.99	5.31	5.31	0.75309	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.98868	0.9617	H	0.97874	4.095	0.80722	D	1	B;D;D	0.69078	0.127;0.991;0.997	B;D;D	0.80764	0.299;0.986;0.994	D	0.99513	1.0956	10	0.87932	D	0	.	15.2555	0.73582	0.0:0.0:0.0:1.0	.	182;160;184	F5H6E6;Q7Z4I7;Q7Z4I7-2	.;LIMS2_HUMAN;.	P	182;160;8;8;184;155;155;155;155;68;8;8;182;8	ENSP00000443794:H182P;ENSP00000347240:H160P;ENSP00000386252:H8P;ENSP00000386345:H8P;ENSP00000326888:H184P;ENSP00000386383:H155P;ENSP00000386637:H155P;ENSP00000387002:H155P;ENSP00000386570:H8P;ENSP00000386907:H8P	ENSP00000326888:H184P	H	-	2	0	LIMS2	128116998	1.000000	0.71417	0.971000	0.41717	0.402000	0.30811	7.835000	0.86780	2.004000	0.58718	0.455000	0.32223	CAC	LIMS2	-	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH	ENSG00000072163		0.667	LIMS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LIMS2	HGNC	protein_coding	OTTHUMT00000331133.2	128	0.77	1	T	NM_017980		128400528	128400528	-1	no_errors	ENST00000324938	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	1.000	G
LRRC41	10489	genome.wustl.edu	37	1	46751084	46751084	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr1:46751084T>G	ENST00000343304.6	-	4	1730	c.1445A>C	c.(1444-1446)cAc>cCc	p.H482P	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	482					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCTCAGCAGGTGGCATAGTGT	0.567																																						dbGAP											0													68.0	64.0	65.0					1																	46751084		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1445A>C	1.37:g.46751084T>G	ENSP00000343298:p.His482Pro		A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.H482P	ENST00000343304.6	37	c.1445	CCDS533.1	1	.	.	.	.	.	.	.	.	.	.	t	16.50	3.140670	0.56936	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	T	0.51574	0.7	5.16	4.04	0.47022	.	0.148787	0.46145	D	0.000309	T	0.44787	0.1310	N	0.19112	0.55	0.35929	D	0.832415	D;D;D	0.64830	0.994;0.994;0.994	P;P;P	0.56865	0.737;0.808;0.737	T	0.55270	-0.8167	10	0.48119	T	0.1	0.3699	10.3444	0.43897	0.0:0.0774:0.0:0.9226	.	482;460;482	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	P	482;460	ENSP00000343298:H482P	ENSP00000343298:H482P	H	-	2	0	LRRC41	46523671	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.683000	0.54663	1.962000	0.57031	0.370000	0.22315	CAC	LRRC41	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000132128		0.567	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	HGNC	protein_coding	OTTHUMT00000021438.1	97	0.00	0	T	NM_006369		46751084	46751084	-1	no_errors	ENST00000343304	ensembl	human	known	69_37n	missense	45	19.64	11	SNP	1.000	G
MAPKAPK3	7867	genome.wustl.edu	37	3	50683586	50683586	+	Silent	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:50683586A>C	ENST00000446044.1	+	10	1316	c.720A>C	c.(718-720)ccA>ccC	p.P240P	MAPKAPK3_ENST00000357955.2_Silent_p.P240P	NM_001243926.1	NP_001230855.1	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated protein kinase 3	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|innate immune response (GO:0045087)|macropinocytosis (GO:0044351)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|Ras protein signal transduction (GO:0007265)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|ovary(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)		GTGGCTTCCCACCCTTCTACT	0.602																																						dbGAP											0													127.0	137.0	134.0					3																	50683586		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U43784	CCDS2832.1	3p21.3	2004-03-10			ENSG00000114738	ENSG00000114738			6888	protein-coding gene	gene with protein product		602130				8626550, 8622688	Standard	NM_004635		Approved	3pK, MAPKAP3, 3PK	uc003dba.2	Q16644	OTTHUMG00000156850	ENST00000446044.1:c.720A>C	3.37:g.50683586A>C			B5BU67	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P240	ENST00000446044.1	37	c.720	CCDS2832.1	3																																																																																			MAPKAPK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000114738		0.602	MAPKAPK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAPKAPK3	HGNC	protein_coding	OTTHUMT00000346237.1	143	0.69	1	A	NM_004635		50683586	50683586	+1	no_errors	ENST00000357955	ensembl	human	known	69_37n	silent	61	21.25	17	SNP	0.917	C
MED23	9439	genome.wustl.edu	37	6	131912472	131912472	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:131912472G>A	ENST00000368068.3	-	26	3846	c.3667C>T	c.(3667-3669)Caa>Taa	p.Q1223*	MED23_ENST00000368058.1_Nonsense_Mutation_p.Q1229*|MED23_ENST00000545957.1_Nonsense_Mutation_p.Q864*|MED23_ENST00000403834.3_Nonsense_Mutation_p.Q1229*|MED23_ENST00000368060.3_Nonsense_Mutation_p.Q1223*|MED23_ENST00000479213.1_5'UTR|MED23_ENST00000354577.4_Nonsense_Mutation_p.Q1229*	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	1223					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		AGAGAAAGTTGTCCGATGCTA	0.443																																						dbGAP											0													81.0	75.0	77.0					6																	131912472		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.3667C>T	6.37:g.131912472G>A	ENSP00000357047:p.Gln1223*		B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Nonsense_Mutation	SNP	pfam_Mediator_Med23	p.Q1229*	ENST00000368068.3	37	c.3685	CCDS5147.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.404300	0.97537	.	.	ENSG00000112282	ENST00000354577;ENST00000368068;ENST00000403834;ENST00000368060;ENST00000368058;ENST00000545957	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	-15.215	19.9813	0.97326	0.0:0.0:1.0:0.0	.	.	.	.	X	1229;1223;1229;1223;1229;864	.	ENSP00000346588:Q1229X	Q	-	1	0	MED23	131954165	1.000000	0.71417	0.988000	0.46212	0.245000	0.25701	9.799000	0.99117	2.726000	0.93360	0.655000	0.94253	CAA	MED23	-	pfam_Mediator_Med23	ENSG00000112282		0.443	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED23	HGNC	protein_coding	OTTHUMT00000042215.1	47	0.00	0	G			131912472	131912472	-1	no_errors	ENST00000368058	ensembl	human	known	69_37n	nonsense	38	32.14	18	SNP	1.000	A
METTL12	751071	genome.wustl.edu	37	11	62434166	62434166	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:62434166T>G	ENST00000532971.1	+	3	623	c.366T>G	c.(364-366)ggT>ggG	p.G122G	C11orf48_ENST00000524958.1_5'Flank|RP11-831H9.11_ENST00000528405.1_5'Flank|C11orf48_ENST00000525675.1_5'Flank|C11orf48_ENST00000532208.1_Intron|METTL12_ENST00000398922.2_3'UTR|C11orf48_ENST00000354588.3_Intron|C11orf48_ENST00000431002.2_Intron|SNORA57_ENST00000383870.1_RNA	NM_001043229.1	NP_001036694.1	A8MUP2	MET12_HUMAN	methyltransferase like 12	122						mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	6						TCCTGGAGGGTGGCCCAGGCC	0.587																																						dbGAP											0													43.0	47.0	46.0					11																	62434166		1985	4163	6148	-	-	-	SO:0001819	synonymous_variant	0			BC041359	CCDS41657.1	11q12.3	2013-09-30			ENSG00000214756	ENSG00000214756			33113	protein-coding gene	gene with protein product							Standard	NM_001043229		Approved	U99HG	uc001nuh.3	A8MUP2	OTTHUMG00000167545	ENST00000532971.1:c.366T>G	11.37:g.62434166T>G			B7Z4C1	Silent	SNP	pfam_Methyltransf_11	p.G122	ENST00000532971.1	37	c.366	CCDS41657.1	11																																																																																			METTL12	-	pfam_Methyltransf_11	ENSG00000214756		0.587	METTL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL12	HGNC	protein_coding	OTTHUMT00000394990.1	46	0.00	0	T	NM_001043229		62434166	62434166	+1	no_errors	ENST00000532971	ensembl	human	known	69_37n	silent	28	20.00	7	SNP	0.652	G
MUC16	94025	genome.wustl.edu	37	19	8976382	8976382	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:8976382T>G	ENST00000397910.4	-	75	42649	c.42446A>C	c.(42445-42447)cAc>cCc	p.H14149P	MUC16_ENST00000380951.5_Missense_Mutation_p.H790P|MUC16_ENST00000596956.1_Intron	NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	14180	SEA 14. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGGTCAGGGTGGTAGGTGCA	0.607																																						dbGAP											0													34.0	34.0	34.0					19																	8976382		1976	4168	6144	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.42446A>C	19.37:g.8976382T>G	ENSP00000381008:p.His14149Pro		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.H14149P	ENST00000397910.4	37	c.42446	CCDS54212.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	11.59|11.59	1.683178|1.683178	0.29872|0.29872	.|.	.|.	ENSG00000181143|ENSG00000181143	ENST00000397910;ENST00000380951|ENST00000542240	T;T|.	0.34859|.	1.34;1.34|.	4.07|4.07	-5.69|-5.69	0.02428|0.02428	SEA (1);|.	1.053320|.	0.07557|.	N|.	0.916338|.	T|T	0.46034|0.46034	0.1372|0.1372	M|M	0.63843|0.63843	1.955|1.955	.|.	.|.	.|.	P;D|.	0.56746|.	0.891;0.977|.	B;D|.	0.66351|.	0.403;0.943|.	T|T	0.54430|0.54430	-0.8295|-0.8295	8|4	.|.	.|.	.|.	.|.	8.5425|8.5425	0.33402|0.33402	0.1456:0.6215:0.0:0.2328|0.1456:0.6215:0.0:0.2328	.|.	21794;14149|.	Q8WXI7;B5ME49|.	MUC16_HUMAN;.|.	P|P	14149;790|972	ENSP00000381008:H14149P;ENSP00000370338:H790P|.	.|.	H|T	-|-	2|1	0|0	MUC16|MUC16	8837382|8837382	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-1.328000|-1.328000	0.02680|0.02680	-1.094000|-1.094000	0.03054|0.03054	-0.477000|-0.477000	0.04895|0.04895	CAC|ACC	MUC16	-	pfam_SEA	ENSG00000181143		0.607	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	47	0.00	0	T	NM_024690		8976382	8976382	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	0.000	G
MYBPC2	4606	genome.wustl.edu	37	19	50939296	50939296	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:50939296T>G	ENST00000357701.5	+	4	275	c.224T>G	c.(223-225)gTg>gGg	p.V75G		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	75	Ig-like C2-type 1.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		GTGGCCAAGGTGAACGGGAAG	0.597																																						dbGAP											0													34.0	40.0	38.0					19																	50939296		2082	4214	6296	-	-	-	SO:0001583	missense	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.224T>G	19.37:g.50939296T>G	ENSP00000350332:p.Val75Gly		A1L4G9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V75G	ENST00000357701.5	37	c.224	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	.	16.47	3.133465	0.56828	.	.	ENSG00000086967	ENST00000357701	T	0.75367	-0.93	3.74	3.74	0.42951	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.30383	U	0.009755	D	0.84737	0.5538	M	0.80332	2.49	0.80722	D	1	D	0.56035	0.974	D	0.68943	0.961	D	0.86578	0.1852	10	0.87932	D	0	.	11.7535	0.51862	0.0:0.0:0.0:1.0	.	75	Q14324	MYPC2_HUMAN	G	75	ENSP00000350332:V75G	ENSP00000350332:V75G	V	+	2	0	MYBPC2	55631108	1.000000	0.71417	0.999000	0.59377	0.427000	0.31564	7.324000	0.79115	1.485000	0.48380	0.383000	0.25322	GTG	MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000086967		0.597	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	125	0.00	0	T	NM_004533		50939296	50939296	+1	no_errors	ENST00000357701	ensembl	human	known	69_37n	missense	51	17.46	11	SNP	1.000	G
MYO1A	4640	genome.wustl.edu	37	12	57422605	57422605	+	Silent	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr12:57422605A>C	ENST00000442789.2	-	29	3353	c.3066T>G	c.(3064-3066)ggT>ggG	p.G1022G	TAC3_ENST00000415231.1_5'UTR|MYO1A_ENST00000300119.3_Silent_p.G1022G|MYO1A_ENST00000544473.1_Silent_p.G860G	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	1022	Myosin tail. {ECO:0000255}.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						TGTTGTCACCACCTGCAGGGC	0.547																																						dbGAP											0													190.0	154.0	166.0					12																	57422605		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.3066T>G	12.37:g.57422605A>C			Q9UQD7	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G1022	ENST00000442789.2	37	c.3066	CCDS8929.1	12																																																																																			MYO1A	-	pfam_Myosin_tail_2	ENSG00000166866		0.547	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1A	HGNC	protein_coding	OTTHUMT00000313833.2	252	0.78	2	A	NM_005379		57422605	57422605	-1	no_errors	ENST00000300119	ensembl	human	known	69_37n	silent	96	21.14	26	SNP	0.000	C
MYO9B	4650	genome.wustl.edu	37	19	17311482	17311482	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:17311482T>G	ENST00000594824.1	+	26	4554	c.4407T>G	c.(4405-4407)ggT>ggG	p.G1469G	MYO9B_ENST00000397274.2_Silent_p.G1469G|MYO9B_ENST00000595618.1_Silent_p.G1469G			Q13459	MYO9B_HUMAN	myosin IXB	1469	Tail.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						ACGCTGCAGGTGAGAAGCGCA	0.602																																						dbGAP											0													92.0	105.0	101.0					19																	17311482		2156	4256	6412	-	-	-	SO:0001819	synonymous_variant	0				CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.4407T>G	19.37:g.17311482T>G			O75314|Q9NUJ2|Q9UHN0	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.G1469	ENST00000594824.1	37	c.4407		19																																																																																			MYO9B	-	NULL	ENSG00000099331		0.602	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	MYO9B	HGNC	protein_coding	OTTHUMT00000463236.1	204	0.96	2	T			17311482	17311482	+1	no_errors	ENST00000397274	ensembl	human	known	69_37n	silent	87	18.52	20	SNP	0.000	G
NAB2	4665	genome.wustl.edu	37	12	57488479	57488479	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr12:57488479T>G	ENST00000300131.3	+	7	1931	c.1553T>G	c.(1552-1554)gTg>gGg	p.V518G	NAB2_ENST00000357680.4_3'UTR|NAB2_ENST00000342556.6_Missense_Mutation_p.V454G	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	518					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AGCGTGAAAGTGGAGGCTGAG	0.647																																						dbGAP											0													52.0	44.0	46.0					12																	57488479		2169	4244	6413	-	-	-	SO:0001583	missense	0			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.1553T>G	12.37:g.57488479T>G	ENSP00000300131:p.Val518Gly		B2RAK3|O76006|Q14797	Missense_Mutation	SNP	pfam_NAB_co-repressor_dom,pfam_Nab_N,superfamily_SAM/pointed	p.V518G	ENST00000300131.3	37	c.1553	CCDS8930.1	12	.	.	.	.	.	.	.	.	.	.	T	10.27	1.305011	0.23736	.	.	ENSG00000166886	ENST00000300131;ENST00000342556	.	.	.	4.08	4.08	0.47627	.	0.000000	0.33515	N	0.004825	T	0.31451	0.0797	N	0.03608	-0.345	0.80722	D	1	P	0.48350	0.909	P	0.52909	0.713	T	0.07693	-1.0759	9	0.14252	T	0.57	-14.2472	9.7384	0.40401	0.0:0.0:0.0:1.0	.	518	Q15742	NAB2_HUMAN	G	518;454	.	ENSP00000300131:V518G	V	+	2	0	NAB2	55774746	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.343000	0.59348	1.630000	0.50440	0.402000	0.26972	GTG	NAB2	-	NULL	ENSG00000166886		0.647	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAB2	HGNC	protein_coding	OTTHUMT00000412222.1	126	0.00	0	T	NM_005967		57488479	57488479	+1	no_errors	ENST00000300131	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	1.000	G
NACAD	23148	genome.wustl.edu	37	7	45124808	45124808	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr7:45124808A>C	ENST00000490531.2	-	2	990	c.971T>G	c.(970-972)gTg>gGg	p.V324G		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	324					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TGTCACCTCCACTGCCTCCAC	0.632																																						dbGAP											0													54.0	51.0	52.0					7																	45124808		692	1591	2283	-	-	-	SO:0001583	missense	0			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.971T>G	7.37:g.45124808A>C	ENSP00000420477:p.Val324Gly			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	p.V324G	ENST00000490531.2	37	c.971	CCDS47582.1	7	.	.	.	.	.	.	.	.	.	.	A	19.47	3.834089	0.71373	.	.	ENSG00000136274	ENST00000490531	T	0.24151	1.87	4.39	4.39	0.52855	.	0.477174	0.15382	U	0.265250	T	0.34193	0.0889	N	0.24115	0.695	0.54753	D	0.999989	D	0.76494	0.999	D	0.64237	0.923	T	0.15235	-1.0444	10	0.87932	D	0	-8.5167	12.5565	0.56257	1.0:0.0:0.0:0.0	.	324	O15069	NACAD_HUMAN	G	324	ENSP00000420477:V324G	ENSP00000420477:V324G	V	-	2	0	NACAD	45091333	0.883000	0.30277	0.860000	0.33809	0.914000	0.54420	4.207000	0.58480	1.845000	0.53610	0.379000	0.24179	GTG	NACAD	-	NULL	ENSG00000136274		0.632	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	HGNC	protein_coding	OTTHUMT00000353652.2	112	0.00	0	A	NM_001146334		45124808	45124808	-1	no_errors	ENST00000490531	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.996	C
NBEAL2	23218	genome.wustl.edu	37	3	47045885	47045885	+	Splice_Site	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:47045885T>G	ENST00000450053.3	+	37	6377		c.e37+2		NBEAL2_ENST00000383740.2_Splice_Site|NBEAL2_ENST00000292309.5_Splice_Site	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2						blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CTTACCCAGGTGAGAGCCCTG	0.647																																						dbGAP											0													34.0	37.0	36.0					3																	47045885		2028	4176	6204	-	-	-	SO:0001630	splice_region_variant	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.6198+2T>G	3.37:g.47045885T>G			O60288|Q6P994|Q6UX91|Q8NAC9	Splice_Site	SNP	-	e37+2	ENST00000450053.3	37	c.6198+2	CCDS46817.1	3	.	.	.	.	.	.	.	.	.	.	T	16.65	3.182218	0.57800	.	.	ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053;ENST00000416683;ENST00000443829;ENST00000445550	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8075	0.63243	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	NBEAL2	47020889	1.000000	0.71417	0.982000	0.44146	0.663000	0.39108	5.926000	0.70070	2.143000	0.66587	0.459000	0.35465	.	NBEAL2	-	-	ENSG00000160796		0.647	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	68	0.00	0	T	XM_291064	Intron	47045885	47045885	+1	no_errors	ENST00000450053	ensembl	human	known	69_37n	splice_site	33	17.50	7	SNP	0.999	G
NDST2	8509	genome.wustl.edu	37	10	75567934	75567934	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr10:75567934T>G	ENST00000309979.6	-	3	769	c.213A>C	c.(211-213)ccA>ccC	p.P71P	NDST2_ENST00000299641.4_Intron|NDST2_ENST00000398701.2_5'Flank|RP11-574K11.31_ENST00000603027.1_Silent_p.P71P			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	71	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					GGGGCCGAGGTGGAACTGGAG	0.637																																						dbGAP											0													33.0	30.0	31.0					10																	75567934		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.213A>C	10.37:g.75567934T>G			Q2TB32|Q59H89	Silent	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.P71	ENST00000309979.6	37	c.213	CCDS7335.1	10																																																																																			NDST2	-	pfam_Heparan_SO4_deacetylase	ENSG00000166507		0.637	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	HGNC	protein_coding	OTTHUMT00000048710.1	73	0.00	0	T	NM_003635		75567934	75567934	-1	no_errors	ENST00000309979	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	0.954	G
NHSL2	340527	genome.wustl.edu	37	X	71359432	71359432	+	Silent	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chrX:71359432A>C	ENST00000373677.1	+	2	2198	c.936A>C	c.(934-936)tcA>tcC	p.S312S	NHSL2_ENST00000540800.1_Silent_p.S678S|NHSL2_ENST00000535692.1_Silent_p.S312S|NHSL2_ENST00000510661.1_Silent_p.S447S			Q5HYW2	NHSL2_HUMAN	NHS-like 2	312	Ser-rich.									NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					CTCTTGCCTCACCTTCCACCT	0.582																																						dbGAP											0													61.0	50.0	54.0					X																	71359432		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.936A>C	X.37:g.71359432A>C			B2RN94	Silent	SNP	NULL	p.S678	ENST00000373677.1	37	c.2034		X																																																																																			NHSL2	-	NULL	ENSG00000204131		0.582	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	55	0.00	0	A	NM_001013627		71359432	71359432	+1	no_errors	ENST00000540800	ensembl	human	known	69_37n	silent	39	18.75	9	SNP	0.992	C
NOP9	161424	genome.wustl.edu	37	14	24772338	24772338	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr14:24772338A>C	ENST00000267425.3	+	6	1295	c.1202A>C	c.(1201-1203)cAc>cCc	p.H401P	NOP9_ENST00000396802.3_Missense_Mutation_p.H401P	NM_174913.1	NP_777573.1	Q86U38	NOP9_HUMAN	NOP9 nucleolar protein	401							poly(A) RNA binding (GO:0044822)										GCCCAGGGCCACCCAGGGGTA	0.557																																						dbGAP											0													79.0	76.0	77.0					14																	24772338		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9624.1, CCDS66616.1	14q12	2012-12-10	2012-12-10	2012-06-06	ENSG00000196943	ENSG00000196943			19826	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 21"", ""NOP9 nucleolar protein homolog (yeast)"""	C14orf21		21653694	Standard	XM_005267385		Approved		uc001wol.1	Q86U38	OTTHUMG00000029342	ENST00000267425.3:c.1202A>C	14.37:g.24772338A>C	ENSP00000267425:p.His401Pro		A8MY76|Q8IVF0|Q8TBS6	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt	p.H401P	ENST00000267425.3	37	c.1202	CCDS9624.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.9|20.9	4.070709|4.070709	0.76301|0.76301	.|.	.|.	ENSG00000196943|ENSG00000196943	ENST00000267425;ENST00000396802|ENST00000557362	T;T|.	0.14640|.	2.49;2.49|.	5.16|5.16	5.16|5.16	0.70880|0.70880	Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72566|0.72566	0.3476|0.3476	M|M	0.71036|0.71036	2.16|2.16	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.76494|.	0.999|.	D|.	0.85130|.	0.997|.	T|T	0.73043|0.73043	-0.4107|-0.4107	10|5	0.38643|.	T|.	0.18|.	-15.1395|-15.1395	14.0994|14.0994	0.65044|0.65044	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	401|.	Q86U38|.	CN021_HUMAN|.	P|P	401|27	ENSP00000267425:H401P;ENSP00000380020:H401P|.	ENSP00000267425:H401P|.	H|T	+|+	2|1	0|0	C14orf21|C14orf21	23842178|23842178	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	5.078000|5.078000	0.64425|0.64425	2.168000|2.168000	0.68352|0.68352	0.460000|0.460000	0.39030|0.39030	CAC|ACC	NOP9	-	superfamily_ARM-type_fold	ENSG00000196943		0.557	NOP9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP9	HGNC	protein_coding	OTTHUMT00000073186.2	125	0.00	0	A			24772338	24772338	+1	no_errors	ENST00000267425	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	1.000	C
NTNG1	22854	genome.wustl.edu	37	1	107691449	107691449	+	Silent	SNP	G	G	A			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr1:107691449G>A	ENST00000370068.1	+	2	1080	c.234G>A	c.(232-234)acG>acA	p.T78T	NTNG1_ENST00000370061.3_Silent_p.T78T|NTNG1_ENST00000370070.2_Silent_p.T78T|NTNG1_ENST00000370065.1_Silent_p.T78T|NTNG1_ENST00000370073.2_Silent_p.T78T|NTNG1_ENST00000370066.1_Silent_p.T78T|NTNG1_ENST00000542803.1_Silent_p.T78T|NTNG1_ENST00000370067.1_Silent_p.T78T|NTNG1_ENST00000370074.4_Silent_p.T78T|NTNG1_ENST00000370071.2_Silent_p.T78T|NTNG1_ENST00000370072.3_Silent_p.T78T			Q9Y2I2	NTNG1_HUMAN	netrin G1	78	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CTCCTGAGACGTTCTGTGCAA	0.438																																						dbGAP											0													106.0	111.0	109.0					1																	107691449		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.234G>A	1.37:g.107691449G>A			Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.T78	ENST00000370068.1	37	c.234	CCDS44180.1	1																																																																																			NTNG1	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000162631		0.438	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTNG1	HGNC	protein_coding	OTTHUMT00000030340.1	102	0.00	0	G	NM_014917		107691449	107691449	+1	no_errors	ENST00000370068	ensembl	human	known	69_37n	silent	64	28.09	25	SNP	0.702	A
OR2B11	127623	genome.wustl.edu	37	1	247614794	247614794	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr1:247614794A>C	ENST00000318749.6	-	1	514	c.491T>G	c.(490-492)gTg>gGg	p.V164G		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CGTCAGGACCACCTGCACGAA	0.602																																						dbGAP											0													59.0	52.0	55.0					1																	247614794		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.491T>G	1.37:g.247614794A>C	ENSP00000325682:p.Val164Gly		B2RP03	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V164G	ENST00000318749.6	37	c.491	CCDS31090.1	1	.	.	.	.	.	.	.	.	.	.	A	9.363	1.068438	0.20067	.	.	ENSG00000177535	ENST00000318749	T	0.00207	8.55	4.96	3.84	0.44239	GPCR, rhodopsin-like superfamily (1);	1.794200	0.03116	N	0.163061	T	0.00241	0.0007	L	0.60012	1.86	0.18873	N	0.999989	B	0.31153	0.31	B	0.24848	0.056	T	0.52852	-0.8520	10	0.56958	D	0.05	.	8.8135	0.34983	0.9107:0.0:0.0893:0.0	.	164	Q5JQS5	OR2BB_HUMAN	G	164	ENSP00000325682:V164G	ENSP00000325682:V164G	V	-	2	0	OR2B11	245681417	0.001000	0.12720	0.045000	0.18777	0.039000	0.13416	1.326000	0.33735	1.039000	0.40074	0.450000	0.29827	GTG	OR2B11	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam	ENSG00000177535		0.602	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B11	HGNC	protein_coding	OTTHUMT00000097620.1	91	0.00	0	A	NM_001004492		247614794	247614794	-1	no_errors	ENST00000318749	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	0.007	C
OTOF	9381	genome.wustl.edu	37	2	26696085	26696085	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr2:26696085T>G	ENST00000272371.2	-	29	3774	c.3648A>C	c.(3646-3648)acA>acC	p.T1216T	OTOF_ENST00000338581.6_Silent_p.T469T|OTOF_ENST00000402415.3_Silent_p.T526T|OTOF_ENST00000403946.3_Silent_p.T1216T|OTOF_ENST00000339598.3_Silent_p.T469T	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1216					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCCACCAGTGTGTAGCGAC	0.667																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													56.0	57.0	57.0					2																	26696085		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3648A>C	2.37:g.26696085T>G			B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.T72P	ENST00000272371.2	37	c.214	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	T	9.869	1.198529	0.22037	.	.	ENSG00000115155	ENST00000426958	T	0.67698	-0.28	4.57	2.67	0.31697	.	0.102918	0.64402	D	0.000003	T	0.66886	0.2835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64428	-0.6410	7	0.87932	D	0	-32.4273	3.7082	0.08408	0.0917:0.1598:0.5682:0.1804	.	.	.	.	P	72	ENSP00000389917:T72P	ENSP00000389917:T72P	T	-	1	0	OTOF	26549589	0.681000	0.27614	1.000000	0.80357	0.869000	0.49853	-0.121000	0.10643	0.318000	0.23185	0.254000	0.18369	ACT	OTOF	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000115155		0.667	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	101	0.00	0	T			26696085	26696085	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426958	ensembl	human	putative	69_37n	missense	30	13.51	5	SNP	1.000	G
OR6B3	150681	genome.wustl.edu	37	2	240984826	240984826	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr2:240984826T>G	ENST00000319423.4	-	1	663	c.664A>C	c.(664-666)Acc>Ccc	p.T222P	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		ACAGCCAGGGTGATGTGCGCA	0.587																																						dbGAP											0													59.0	64.0	62.0					2																	240984826		2148	4250	6398	-	-	-	SO:0001583	missense	0				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.664A>C	2.37:g.240984826T>G	ENSP00000322435:p.Thr222Pro		Q6IFH3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T222P	ENST00000319423.4	37	c.664	CCDS42837.1	2	.	.	.	.	.	.	.	.	.	.	t	10.99	1.507276	0.27036	.	.	ENSG00000178586	ENST00000319423	T	0.00123	8.7	4.09	-6.3	0.02007	GPCR, rhodopsin-like superfamily (1);	0.679299	0.12600	N	0.454750	T	0.00109	0.0003	N	0.25890	0.77	0.09310	N	0.999999	P	0.38788	0.647	B	0.41412	0.356	T	0.34800	-0.9814	10	0.87932	D	0	.	3.8091	0.08789	0.1132:0.4915:0.115:0.2803	.	222	Q8NGW1	OR6B3_HUMAN	P	222	ENSP00000322435:T222P	ENSP00000322435:T222P	T	-	1	0	OR6B3	240633499	0.000000	0.05858	0.000000	0.03702	0.706000	0.40770	-3.171000	0.00573	-1.377000	0.02123	0.491000	0.48974	ACC	OR6B3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000178586		0.587	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B3	HGNC	protein_coding	OTTHUMT00000326078.1	168	0.59	1	T			240984826	240984826	-1	no_errors	ENST00000319423	ensembl	human	known	69_37n	missense	49	26.47	18	SNP	0.000	G
PALD1	27143	genome.wustl.edu	37	10	72289740	72289740	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr10:72289740T>G	ENST00000263563.6	+	4	652	c.384T>G	c.(382-384)ggT>ggG	p.G128G		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	128						cytosol (GO:0005829)											AGGTGCAGGGTGGGCTCACTG	0.622																																						dbGAP											0													44.0	43.0	43.0					10																	72289740		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.384T>G	10.37:g.72289740T>G			B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Silent	SNP	smart_Tyr_Pase_cat	p.G128	ENST00000263563.6	37	c.384	CCDS31215.1	10																																																																																			PALD1	-	NULL	ENSG00000107719		0.622	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALD1	HGNC	protein_coding	OTTHUMT00000048515.2	63	0.00	0	T	NM_014431		72289740	72289740	+1	no_errors	ENST00000263563	ensembl	human	known	69_37n	silent	20	28.57	8	SNP	0.002	G
PDE2A	5138	genome.wustl.edu	37	11	72300262	72300262	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:72300262A>C	ENST00000334456.5	-	12	1141	c.896T>G	c.(895-897)gTg>gGg	p.V299G	RP11-169D4.2_ENST00000545254.1_RNA|PDE2A_ENST00000418754.2_Missense_Mutation_p.V184G|PDE2A_ENST00000540345.1_Missense_Mutation_p.V290G|PDE2A_ENST00000376450.3_Intron|PDE2A_ENST00000544570.1_Missense_Mutation_p.V292G|PDE2A_ENST00000444035.2_Missense_Mutation_p.V290G	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	299	GAF 1.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	GTCTTCCACCACCTGGCCCAG	0.602																																						dbGAP											0													76.0	59.0	65.0					11																	72300262		2200	4293	6493	-	-	-	SO:0001583	missense	0			U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.896T>G	11.37:g.72300262A>C	ENSP00000334910:p.Val299Gly		B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.V299G	ENST00000334456.5	37	c.896	CCDS8216.1	11	.	.	.	.	.	.	.	.	.	.	A	25.2	4.616248	0.87359	.	.	ENSG00000186642	ENST00000334456;ENST00000444035;ENST00000429363;ENST00000544570;ENST00000418754;ENST00000540345;ENST00000475807	T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7;-0.7	5.46	5.46	0.80206	GAF (2);	0.992707	0.08167	N	0.987647	T	0.80259	0.4590	M	0.68593	2.085	0.80722	D	1	P;P;D;P;D	0.57257	0.732;0.955;0.977;0.944;0.979	B;P;P;P;P	0.54759	0.133;0.692;0.576;0.461;0.76	T	0.74919	-0.3500	10	0.87932	D	0	.	12.9074	0.58160	1.0:0.0:0.0:0.0	.	184;299;290;292;299	E9PEF1;O00408;E9PGI1;F6W5Z0;B2R646	.;PDE2A_HUMAN;.;.;.	G	299;290;368;292;184;290;123	ENSP00000334910:V299G;ENSP00000411657:V290G;ENSP00000442256:V292G;ENSP00000410310:V184G;ENSP00000446399:V290G;ENSP00000439077:V123G	ENSP00000334910:V299G	V	-	2	0	PDE2A	71977910	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.383000	0.79741	2.071000	0.62044	0.402000	0.26972	GTG	PDE2A	-	pfam_GAF,smart_GAF	ENSG00000186642		0.602	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE2A	HGNC	protein_coding	OTTHUMT00000219839.2	99	0.98	1	A	NM_002599		72300262	72300262	-1	no_errors	ENST00000334456	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	1.000	C
PDIA5	10954	genome.wustl.edu	37	3	122842988	122842988	+	Missense_Mutation	SNP	A	A	C	rs149160539		TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:122842988A>C	ENST00000316218.7	+	9	780	c.685A>C	c.(685-687)Acc>Ccc	p.T229P		NM_006810.3	NP_006801.1	Q14554	PDIA5_HUMAN	protein disulfide isomerase family A, member 5	229	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	oxidoreductase activity (GO:0016491)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	21				GBM - Glioblastoma multiforme(114;0.0427)		CGGCTTCCCCACCATCTGCTA	0.532																																						dbGAP											0													78.0	71.0	74.0					3																	122842988		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054963	CCDS3020.1	3q21.1	2009-11-20	2005-06-29		ENSG00000065485	ENSG00000065485	5.3.4.1	"""Protein disulfide isomerases"""	24811	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 5"""			7556671	Standard	NM_006810		Approved	PDIR, FLJ30401	uc003egc.2	Q14554	OTTHUMG00000159558	ENST00000316218.7:c.685A>C	3.37:g.122842988A>C	ENSP00000323313:p.Thr229Pro		D3DN95|Q9BV43	Missense_Mutation	SNP	pfam_Thioredoxin_domain,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.T229P	ENST00000316218.7	37	c.685	CCDS3020.1	3	.	.	.	.	.	.	.	.	.	.	A	22.2	4.264210	0.80358	.	.	ENSG00000065485	ENST00000316218	T	0.42131	0.98	5.27	5.27	0.74061	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.76976	0.4063	H	0.98155	4.16	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85567	0.1231	10	0.87932	D	0	.	13.9334	0.64010	1.0:0.0:0.0:0.0	.	229	Q14554	PDIA5_HUMAN	P	229	ENSP00000323313:T229P	ENSP00000323313:T229P	T	+	1	0	PDIA5	124325678	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.015000	0.88690	2.209000	0.71365	0.533000	0.62120	ACC	PDIA5	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000065485		0.532	PDIA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA5	HGNC	protein_coding	OTTHUMT00000356192.1	108	0.00	0	A	NM_006810		122842988	122842988	+1	no_errors	ENST00000316218	ensembl	human	known	69_37n	missense	64	11.11	8	SNP	1.000	C
PHACTR2	9749	genome.wustl.edu	37	6	143929461	143929461	+	Splice_Site	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:143929461T>G	ENST00000427704.2	+	1	143		c.e1+2		PHACTR2_ENST00000305766.6_Splice_Site|PHACTR2_ENST00000367584.4_Intron	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2								protein phosphatase inhibitor activity (GO:0004864)			NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		ACAACGCCGGTGGGTAAATCA	0.542																																					Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)	dbGAP											0													70.0	74.0	73.0					6																	143929461		2007	4174	6181	-	-	-	SO:0001630	splice_region_variant	0			AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.13+2T>G	6.37:g.143929461T>G			A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Splice_Site	SNP	-	e1+2	ENST00000427704.2	37	c.13+2	CCDS47492.1	6	.	.	.	.	.	.	.	.	.	.	T	13.46	2.242726	0.39598	.	.	ENSG00000112419	ENST00000427704;ENST00000305766	.	.	.	5.68	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2887	0.54807	0.0:0.0:0.1418:0.8582	.	.	.	.	.	-1	.	.	.	+	.	.	PHACTR2	143971154	1.000000	0.71417	1.000000	0.80357	0.573000	0.36030	5.307000	0.65762	0.963000	0.38082	-0.313000	0.08912	.	PHACTR2	-	-	ENSG00000112419		0.542	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	PHACTR2	HGNC	protein_coding	OTTHUMT00000042528.2	180	0.55	1	T	NM_014721	Intron	143929461	143929461	+1	no_errors	ENST00000427704	ensembl	human	known	69_37n	splice_site	47	18.64	11	SNP	1.000	G
PIP5K1C	23396	genome.wustl.edu	37	19	3633481	3633481	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:3633481T>G	ENST00000335312.3	-	17	2046	c.1958A>C	c.(1957-1959)cAc>cCc	p.H653P	PIP5K1C_ENST00000539785.1_Intron	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	653	Mediates interaction with TLN2.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		GGCGCTATAGTGGAGCGGGGA	0.692																																					Esophageal Squamous(135;99 1744 12852 27186 39851)	dbGAP											0													18.0	22.0	21.0					19																	3633481		2198	4297	6495	-	-	-	SO:0001583	missense	0			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.1958A>C	19.37:g.3633481T>G	ENSP00000335333:p.His653Pro		B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.H653P	ENST00000335312.3	37	c.1958	CCDS32872.1	19	.	.	.	.	.	.	.	.	.	.	T	16.45	3.127139	0.56721	.	.	ENSG00000186111	ENST00000335312	T	0.29142	1.58	3.39	3.39	0.38822	.	0.000000	0.64402	U	0.000005	T	0.38532	0.1044	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.31613	-0.9937	10	0.87932	D	0	-29.9206	11.305	0.49329	0.0:0.0:0.0:1.0	.	653	O60331	PI51C_HUMAN	P	653	ENSP00000335333:H653P	ENSP00000335333:H653P	H	-	2	0	PIP5K1C	3584481	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	3.868000	0.56055	1.325000	0.45301	0.260000	0.18958	CAC	PIP5K1C	-	NULL	ENSG00000186111		0.692	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIP5K1C	HGNC	protein_coding	OTTHUMT00000453432.2	49	0.00	0	T	NM_012398		3633481	3633481	-1	no_errors	ENST00000335312	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	G
PLA2G12A	81579	genome.wustl.edu	37	4	110650902	110650902	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr4:110650902A>C	ENST00000243501.5	-	1	331	c.64T>G	c.(64-66)Tgc>Ggc	p.C22G	PLA2G12A_ENST00000502283.1_Missense_Mutation_p.C22G	NM_030821.4	NP_110448.2	Q9BZM1	PG12A_HUMAN	phospholipase A2, group XIIA	22					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			kidney(1)|lung(1)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000268)		TGCTCCTGGCACCTGACAACA	0.677																																						dbGAP											0													37.0	29.0	32.0					4																	110650902		2196	4298	6494	-	-	-	SO:0001583	missense	0				CCDS3686.1	4q25	2010-11-24	2004-01-13	2004-01-14	ENSG00000123739	ENSG00000123739	3.1.1.4		18554	protein-coding gene	gene with protein product		611652	"""phospholipase A2, group XII"""	PLA2G12		11031251	Standard	NM_030821		Approved		uc003hzp.3	Q9BZM1	OTTHUMG00000131915	ENST00000243501.5:c.64T>G	4.37:g.110650902A>C	ENSP00000243501:p.Cys22Gly		Q9BZ89	Missense_Mutation	SNP	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2	p.C22G	ENST00000243501.5	37	c.64	CCDS3686.1	4	.	.	.	.	.	.	.	.	.	.	A	14.46	2.542782	0.45280	.	.	ENSG00000123739	ENST00000243501;ENST00000502283	.	.	.	3.83	-0.846	0.10734	.	0.405543	0.28796	N	0.014107	T	0.35595	0.0937	L	0.51422	1.61	0.25771	N	0.984831	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24368	-1.0162	9	0.26408	T	0.33	-9.3473	9.5976	0.39584	0.285:0.5963:0.0:0.1186	.	22;22	Q542Y6;Q9BZM1	.;PG12A_HUMAN	G	22	.	ENSP00000243501:C22G	C	-	1	0	PLA2G12A	110870351	0.001000	0.12720	0.314000	0.25224	0.762000	0.43233	-0.160000	0.10041	-0.226000	0.09899	0.260000	0.18958	TGC	PLA2G12A	-	pfam_PLipase_A2_secretory_G12	ENSG00000123739		0.677	PLA2G12A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLA2G12A	HGNC	protein_coding	OTTHUMT00000254868.3	135	0.00	0	A			110650902	110650902	-1	no_errors	ENST00000243501	ensembl	human	known	69_37n	missense	41	17.65	9	SNP	0.665	C
PMM1	5372	genome.wustl.edu	37	22	41980363	41980363	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr22:41980363T>G	ENST00000216259.7	-	4	380	c.296A>C	c.(295-297)cAc>cCc	p.H99P	PMM1_ENST00000466645.1_5'UTR	NM_002676.2	NP_002667.2	Q92871	PMM1_HUMAN	phosphomannomutase 1	99					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	metal ion binding (GO:0046872)|phosphomannomutase activity (GO:0004615)			NS(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(2)	11						CTCCCCCAGGTGGTTCTGGAT	0.632																																						dbGAP											0													55.0	45.0	48.0					22																	41980363		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14020.1	22q13	2008-12-01			ENSG00000100417	ENSG00000100417	5.4.2.8		9114	protein-coding gene	gene with protein product	"""brain glucose-1,6-bisphosphatase"""	601786				9070917, 9271215	Standard	NM_002676		Approved	Sec53	uc003bal.2	Q92871	OTTHUMG00000150972	ENST00000216259.7:c.296A>C	22.37:g.41980363T>G	ENSP00000216259:p.His99Pro		A8K003|Q92586	Missense_Mutation	SNP	pfam_PMM,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB	p.H99P	ENST00000216259.7	37	c.296	CCDS14020.1	22	.	.	.	.	.	.	.	.	.	.	T	19.84	3.901354	0.72754	.	.	ENSG00000100417	ENST00000216259	D	0.98329	-4.87	4.85	4.85	0.62838	HAD-like domain (1);	0.103335	0.64402	D	0.000003	D	0.98409	0.9471	M	0.84683	2.71	0.80722	D	1	P	0.41420	0.749	P	0.50617	0.646	D	0.98597	1.0657	10	0.36615	T	0.2	-31.8024	14.4428	0.67330	0.0:0.0:0.0:1.0	.	99	Q92871	PMM1_HUMAN	P	99	ENSP00000216259:H99P	ENSP00000216259:H99P	H	-	2	0	PMM1	40310309	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.922000	0.87538	1.816000	0.52996	0.460000	0.39030	CAC	PMM1	-	pfam_PMM,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB	ENSG00000100417		0.632	PMM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMM1	HGNC	protein_coding	OTTHUMT00000320711.3	104	0.00	0	T	NM_002676		41980363	41980363	-1	no_errors	ENST00000216259	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	G
POC1A	25886	genome.wustl.edu	37	3	52183914	52183914	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:52183914T>G	ENST00000296484.2	-	3	232	c.193A>C	c.(193-195)Acc>Ccc	p.T65P	POC1A_ENST00000394970.2_Missense_Mutation_p.T65P|POC1A_ENST00000474012.1_Missense_Mutation_p.T27P	NM_015426.4	NP_056241.3	Q8NBT0	POC1A_HUMAN	POC1 centriolar protein A	65					cell projection organization (GO:0030030)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|large_intestine(4)|liver(1)|lung(4)|prostate(3)|skin(1)	14						TTCACACAGGTGACGGCATCC	0.577																																						dbGAP											0													113.0	98.0	103.0					3																	52183914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL117629	CCDS2846.1, CCDS54591.1, CCDS54592.1	3p21.2	2014-05-02	2013-08-21	2010-03-26	ENSG00000164087	ENSG00000164087		"""WD repeat domain containing"""	24488	protein-coding gene	gene with protein product		614783	"""WD repeat domain 51A"", ""POC1 centriolar protein homolog A (Chlamydomonas)"""	WDR51A		19109428, 22840364	Standard	NM_015426		Approved	DKFZP434C245	uc003dcu.3	Q8NBT0	OTTHUMG00000157817	ENST00000296484.2:c.193A>C	3.37:g.52183914T>G	ENSP00000296484:p.Thr65Pro		A4FUW4|E9PFC6|Q0VDF8|Q2TAK6|Q96IK6|Q9UFJ8	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T65P	ENST00000296484.2	37	c.193	CCDS2846.1	3	.	.	.	.	.	.	.	.	.	.	T	16.16	3.043264	0.55003	.	.	ENSG00000164087	ENST00000296484;ENST00000394970;ENST00000474012	T;T;T	0.63744	-0.06;-0.06;-0.06	5.32	5.32	0.75619	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.266896	0.39475	N	0.001357	T	0.70587	0.3241	M	0.80028	2.48	0.33279	D	0.562076	D;D	0.58970	0.963;0.984	P;P	0.54815	0.648;0.761	T	0.78735	-0.2088	10	0.36615	T	0.2	.	7.317	0.26505	0.1419:0.0:0.1476:0.7105	.	65;65	Q8NBT0-2;Q8NBT0	.;POC1A_HUMAN	P	65;65;27	ENSP00000296484:T65P;ENSP00000378421:T65P;ENSP00000418968:T27P	ENSP00000296484:T65P	T	-	1	0	POC1A	52158954	1.000000	0.71417	0.993000	0.49108	0.896000	0.52359	2.733000	0.47360	2.017000	0.59298	0.482000	0.46254	ACC	POC1A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000164087		0.577	POC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1A	HGNC	protein_coding	OTTHUMT00000349685.1	144	0.69	1	T	NM_015426		52183914	52183914	-1	no_errors	ENST00000296484	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.992	G
PPOX	5498	genome.wustl.edu	37	1	161136696	161136696	+	Missense_Mutation	SNP	A	A	C	rs121918326		TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr1:161136696A>C	ENST00000367999.4	+	2	325	c.59A>C	c.(58-60)cAc>cCc	p.H20P	PPOX_ENST00000535223.1_Missense_Mutation_p.H20P|PPOX_ENST00000544598.1_Missense_Mutation_p.H20P|PPOX_ENST00000432542.2_Missense_Mutation_p.H20P|PPOX_ENST00000352210.5_Missense_Mutation_p.H20P|PPOX_ENST00000495483.1_3'UTR	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	20			H -> P (in VP; strongly decreases enzyme activity; more resistant to thermal denaturation than wild-type enzyme; abolishes mitochondrial protein targeting and localization). {ECO:0000269|PubMed:8817334}.		heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GCCAGTTACCACCTGAGCCGG	0.612																																						dbGAP											0			GRCh37	CM961144	PPOX	M	rs121918326						27.0	34.0	31.0					1																	161136696		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.59A>C	1.37:g.161136696A>C	ENSP00000356978:p.His20Pro		D3DVG0|Q5VTW8	Missense_Mutation	SNP	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	p.H20P	ENST00000367999.4	37	c.59	CCDS1221.1	1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.770945	0.90108	.	.	ENSG00000143224	ENST00000352210;ENST00000367999;ENST00000544598;ENST00000435935;ENST00000535223;ENST00000432542	D;D;D;D;D	0.96365	-3.15;-3.15;-3.15;-3.99;-3.15	5.27	5.27	0.74061	Amine oxidase (1);NAD(P)-binding domain (1);	0.178826	0.49305	D	0.000150	D	0.96926	0.8996	M	0.75777	2.31	0.42552	A	0.993112	D;P;P	0.56035	0.974;0.873;0.874	P;P;P	0.59703	0.862;0.628;0.58	D	0.97273	0.9912	9	0.54805	T	0.06	-1.4335	14.4708	0.67514	1.0:0.0:0.0:0.0	.	20;20;20	B4DQQ7;F5GZT7;P50336	.;.;PPOX_HUMAN	P	20	ENSP00000343943:H20P;ENSP00000356978:H20P;ENSP00000444216:H20P;ENSP00000443769:H20P;ENSP00000396841:H20P	ENSP00000343943:H20P	H	+	2	0	PPOX	159403320	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.526000	0.73799	2.116000	0.64780	0.533000	0.62120	CAC	PPOX	-	pfam_Amino_oxidase,tigrfam_Protoporphyrinogen_oxidase	ENSG00000143224		0.612	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	HGNC	protein_coding	OTTHUMT00000082993.1	71	0.00	0	A	NM_000309		161136696	161136696	+1	no_errors	ENST00000352210	ensembl	human	known	69_37n	missense	49	13.79	8	SNP	1.000	C
PPP2R4	5524	genome.wustl.edu	37	9	131891338	131891339	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr9:131891338_131891339delCT	ENST00000337738.1	+	5	663_664	c.396_397delCT	c.(394-399)ccctctfs	p.S133fs	PPP2R4_ENST00000355007.3_Intron|PPP2R4_ENST00000358994.4_Frame_Shift_Del_p.S98fs|PPP2R4_ENST00000393370.2_Frame_Shift_Del_p.S98fs|PPP2R4_ENST00000348141.5_Frame_Shift_Del_p.S104fs|PPP2R4_ENST00000357197.4_Frame_Shift_Del_p.S69fs|PPP2R4_ENST00000347048.4_Intron|PPP2R4_ENST00000452489.2_Frame_Shift_Del_p.S133fs	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	133					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)			breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		TGGACCAGCCCTCTCGGTTTGG	0.559																																					Colon(158;2158 2504 4450 20433)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.396_397delCT	9.37:g.131891340_131891341delCT	ENSP00000337448:p.Ser133fs		A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Frame_Shift_Del	DEL	pfam_Phstyr_phstse_ac,pirsf_Phstyr_phstse_ac	p.R134fs	ENST00000337738.1	37	c.396_397		9																																																																																			PPP2R4	-	pfam_Phstyr_phstse_ac,pirsf_Phstyr_phstse_ac	ENSG00000119383		0.559	PPP2R4-201	KNOWN	basic	protein_coding	PPP2R4	HGNC	protein_coding		120	0.00	0	CT	NM_021131		131891338	131891339	+1	no_errors	ENST00000452489	ensembl	human	known	69_37n	frame_shift_del	61	11.59	8	DEL	1.000:1.000	-
PPP2R4	5524	genome.wustl.edu	37	9	131891344	131891347	+	Frame_Shift_Del	DEL	GTTT	GTTT	-			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	GTTT	GTTT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr9:131891344_131891347delGTTT	ENST00000337738.1	+	5	669_672	c.402_405delGTTT	c.(400-405)cggtttfs	p.RF134fs	PPP2R4_ENST00000355007.3_Intron|PPP2R4_ENST00000358994.4_Frame_Shift_Del_p.RF99fs|PPP2R4_ENST00000393370.2_Frame_Shift_Del_p.RF99fs|PPP2R4_ENST00000348141.5_Frame_Shift_Del_p.RF105fs|PPP2R4_ENST00000357197.4_Frame_Shift_Del_p.RF70fs|PPP2R4_ENST00000347048.4_Intron|PPP2R4_ENST00000452489.2_Frame_Shift_Del_p.RF134fs	NM_178001.2	NP_821068.1	Q15257	PTPA_HUMAN	protein phosphatase 2A activator, regulatory subunit 4	134					ATP catabolic process (GO:0006200)|mitotic spindle organization in nucleus (GO:0030472)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of protein dephosphorylation (GO:0035308)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein dephosphorylation (GO:0035307)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|regulation of phosphoprotein phosphatase activity (GO:0043666)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	ATP binding (GO:0005524)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein tyrosine phosphatase activator activity (GO:0008160)|receptor binding (GO:0005102)			breast(3)|endometrium(1)|kidney(1)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12		Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		AGCCCTCTCGGTTTGGGAATAAGG	0.559																																					Colon(158;2158 2504 4450 20433)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X73478	CCDS6920.1, CCDS65156.1, CCDS75917.1	9q34	2010-06-18	2007-01-22		ENSG00000119383	ENSG00000119383		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9308	protein-coding gene	gene with protein product	"""phosphotyrosyl phosphatase activator"", ""PP2A phosphatase activator"""	600756	"""protein phosphatase 2A, regulatory subunit B' (PR 53)"""			8530035	Standard	NM_021131		Approved	PTPA, PR53	uc004bxm.2	Q15257	OTTHUMG00000020774	ENST00000337738.1:c.402_405delGTTT	9.37:g.131891344_131891347delGTTT	ENSP00000337448:p.Arg134fs		A2A347|A9IZU4|B4DXM4|Q15258|Q53GZ3|Q5TZQ2|Q9BUK1|Q9NNZ7|Q9NNZ8|Q9NNZ9	Frame_Shift_Del	DEL	pfam_Phstyr_phstse_ac,pirsf_Phstyr_phstse_ac	p.F135fs	ENST00000337738.1	37	c.402_405		9																																																																																			PPP2R4	-	pfam_Phstyr_phstse_ac,pirsf_Phstyr_phstse_ac	ENSG00000119383		0.559	PPP2R4-201	KNOWN	basic	protein_coding	PPP2R4	HGNC	protein_coding		108	0.00	0	GTTT	NM_021131		131891344	131891347	+1	no_errors	ENST00000452489	ensembl	human	known	69_37n	frame_shift_del	60	11.76	8	DEL	0.836:1.000:1.000:0.999	-
RAI14	26064	genome.wustl.edu	37	5	34823772	34823772	+	Missense_Mutation	SNP	A	A	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr5:34823772A>T	ENST00000265109.3	+	15	2112	c.1825A>T	c.(1825-1827)Atg>Ttg	p.M609L	RAI14_ENST00000512629.1_Missense_Mutation_p.M580L|RAI14_ENST00000506376.1_Missense_Mutation_p.M601L|RAI14_ENST00000503673.1_Missense_Mutation_p.M609L|RAI14_ENST00000397449.1_Missense_Mutation_p.M602L|RAI14_ENST00000428746.2_Missense_Mutation_p.M609L|RAI14_ENST00000515799.1_Missense_Mutation_p.M612L	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	609						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					AGAAGAAATCATGAAATTAAA	0.353																																						dbGAP											0													53.0	57.0	56.0					5																	34823772		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.1825A>T	5.37:g.34823772A>T	ENSP00000265109:p.Met609Leu		E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.M612L	ENST00000265109.3	37	c.1834	CCDS34142.1	5	.	.	.	.	.	.	.	.	.	.	A	11.35	1.613052	0.28712	.	.	ENSG00000039560	ENST00000265109;ENST00000512629;ENST00000428746;ENST00000503673;ENST00000515799;ENST00000506376;ENST00000397449	T;T;T;T;T;T;T	0.33654	1.43;1.4;1.43;1.43;1.43;1.48;1.47	5.44	1.71	0.24356	.	.	.	.	.	T	0.20292	0.0488	N	0.14661	0.345	0.21675	N	0.999597	B;B;B;B	0.12013	0.004;0.002;0.005;0.002	B;B;B;B	0.10450	0.002;0.001;0.005;0.001	T	0.20207	-1.0282	9	0.45353	T	0.12	2.0E-4	6.5645	0.22505	0.7316:0.1309:0.1375:0.0	.	601;580;612;609	Q9P0K7-3;E9PED3;Q9P0K7-2;Q9P0K7	.;.;.;RAI14_HUMAN	L	609;580;609;609;612;601;602	ENSP00000265109:M609L;ENSP00000422377:M580L;ENSP00000388725:M609L;ENSP00000422942:M609L;ENSP00000427123:M612L;ENSP00000423854:M601L;ENSP00000380591:M602L	ENSP00000265109:M609L	M	+	1	0	RAI14	34859529	0.015000	0.18098	0.324000	0.25361	0.988000	0.76386	1.002000	0.29796	0.061000	0.16311	0.454000	0.30748	ATG	RAI14	-	NULL	ENSG00000039560		0.353	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RAI14	HGNC	protein_coding	OTTHUMT00000366786.1	19	0.00	0	A	NM_015577		34823772	34823772	+1	no_errors	ENST00000515799	ensembl	human	known	69_37n	missense	49	38.75	31	SNP	0.656	T
RELA	5970	genome.wustl.edu	37	11	65422220	65422220	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr11:65422220T>G	ENST00000406246.3	-	11	1546	c.1285A>C	c.(1285-1287)Acc>Ccc	p.T429P	RELA_ENST00000308639.9_Missense_Mutation_p.T426P|RELA_ENST00000525693.1_3'UTR	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	429	Activation domain.				acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						CCAGCCTGGGTGGGCTTGGGG	0.657																																						dbGAP											0													13.0	14.0	13.0					11																	65422220		2184	4280	6464	-	-	-	SO:0001583	missense	0			Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.1285A>C	11.37:g.65422220T>G	ENSP00000384273:p.Thr429Pro		Q6GTV1|Q6SLK1	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NF_Rel_dor	p.T429P	ENST00000406246.3	37	c.1285	CCDS31609.1	11	.	.	.	.	.	.	.	.	.	.	T	13.89	2.373400	0.42105	.	.	ENSG00000173039	ENST00000406246;ENST00000308639	T;T	0.48522	0.81;0.81	3.84	-0.136	0.13473	.	0.454912	0.18582	N	0.136990	T	0.21062	0.0507	N	0.08118	0	0.29092	N	0.88204	B;B;B;B	0.25609	0.13;0.13;0.13;0.079	B;B;B;B	0.25291	0.059;0.059;0.059;0.026	T	0.09422	-1.0675	10	0.56958	D	0.05	-9.3608	2.25	0.04041	0.2453:0.2665:0.0:0.4882	.	419;416;426;429	Q04206-3;Q04206-2;Q04206-4;Q04206	.;.;.;TF65_HUMAN	P	429;426	ENSP00000384273:T429P;ENSP00000311508:T426P	ENSP00000311508:T426P	T	-	1	0	RELA	65178796	0.184000	0.23200	0.915000	0.36163	0.994000	0.84299	-0.144000	0.10280	0.143000	0.18926	0.418000	0.28097	ACC	RELA	-	NULL	ENSG00000173039		0.657	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELA	HGNC	protein_coding	OTTHUMT00000390457.2	59	0.00	0	T	NM_021975		65422220	65422220	-1	no_errors	ENST00000406246	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.896	G
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037843	10037843	+	RNA	SNP	C	C	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chrY:10037843C>T	ENST00000515896.1	+	0	80									RNA, 5.8S ribosomal pseudogene 6																		AATTGCAGGACACATTGATCA	0.512																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037843C>T				RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.512	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		54	0.00	0	C			10037843	10037843	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	28	20.00	7	SNP	1.000	T
RP1	6101	genome.wustl.edu	37	8	55534763	55534763	+	Silent	SNP	C	C	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr8:55534763C>T	ENST00000220676.1	+	3	850	c.702C>T	c.(700-702)atC>atT	p.I234I		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	234					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			ATTATGACATCCAAAAATACT	0.478																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													91.0	90.0	90.0					8																	55534763		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.702C>T	8.37:g.55534763C>T				Silent	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.I234	ENST00000220676.1	37	c.702	CCDS6160.1	8																																																																																			RP1	-	superfamily_Doublecortin_dom	ENSG00000104237		0.478	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	176	0.00	0	C	NM_006269		55534763	55534763	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	silent	153	25.73	53	SNP	0.987	T
KHNYN	23351	genome.wustl.edu	37	14	24910213	24910213	+	3'UTR	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr14:24910213A>C	ENST00000251343.5	+	0	5898				SDR39U1_ENST00000555561.1_5'Flank|SDR39U1_ENST00000399395.3_Intron|SDR39U1_ENST00000555365.1_Intron|SDR39U1_ENST00000553930.1_Intron|SDR39U1_ENST00000554698.1_Intron|SDR39U1_ENST00000538105.2_Intron|SDR39U1_ENST00000399390.1_Splice_Site			O15037	KHNYN_HUMAN	KH and NYN domain containing								RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						CCTTGGCCTCACCTTCTCTGG	0.552																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.*3722A>C	14.37:g.24910213A>C			Q86TZ6|Q8IUQ2|Q96BA9	Splice_Site	SNP	-	e1+2	ENST00000251343.5	37	c.43+2	CCDS32058.1	14	.	.	.	.	.	.	.	.	.	.	A	3.993	-0.004119	0.07773	.	.	ENSG00000100445	ENST00000399390	.	.	.	3.56	-0.315	0.12746	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0909	0.19993	0.6117:0.0:0.3883:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SDR39U1	23980053	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.487000	0.06505	-0.057000	0.13199	0.459000	0.35465	.	SDR39U1	-	-	ENSG00000100445		0.552	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SDR39U1	HGNC	protein_coding	OTTHUMT00000412928.1	45	0.00	0	A			24910213	24910213	-1	no_errors	ENST00000399390	ensembl	human	known	69_37n	splice_site	37	17.78	8	SNP	0.001	C
SEC14L6	730005	genome.wustl.edu	37	22	30921505	30921505	+	Splice_Site	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr22:30921505A>C	ENST00000402034.2	-	11	912	c.913T>G	c.(913-915)Tgg>Ggg	p.W305G		NM_001193336.2	NP_001180265.2	B5MCN3	S14L6_HUMAN	SEC14-like 6 (S. cerevisiae)	305	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			lung(3)	3						GCAAACTGCCACCTGCAGTGG	0.617																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS54518.1	22q12.2	2011-05-06			ENSG00000214491	ENSG00000214491			40047	protein-coding gene	gene with protein product							Standard	NM_001193336		Approved		uc021wnu.1	B5MCN3	OTTHUMG00000151267	ENST00000402034.2:c.912-1T>G	22.37:g.30921505A>C				Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.W305G	ENST00000402034.2	37	c.913	CCDS54518.1	22	.	.	.	.	.	.	.	.	.	.	A	11.19	1.564486	0.27915	.	.	ENSG00000214491	ENST00000402034	D	0.83673	-1.75	3.82	2.78	0.32641	.	.	.	.	.	D	0.91586	0.7342	H	0.95645	3.7	0.80722	D	1	.	.	.	.	.	.	D	0.90511	0.4481	7	0.87932	D	0	-16.1563	8.4868	0.33076	0.903:0.0:0.097:0.0	.	.	.	.	G	305	ENSP00000385695:W305G	ENSP00000385695:W305G	W	-	1	0	SEC14L6	29251505	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	3.988000	0.56951	0.374000	0.24650	-0.495000	0.04643	TGG	SEC14L6	-	superfamily_GOLD,pfscan_GOLD	ENSG00000214491		0.617	SEC14L6-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	SEC14L6	HGNC	protein_coding	OTTHUMT00000322022.2	60	0.00	0	A		Missense_Mutation	30921505	30921505	-1	no_errors	ENST00000402034	ensembl	human	novel	69_37n	missense	36	21.74	10	SNP	1.000	C
SETD2	29072	genome.wustl.edu	37	3	47129736	47129736	+	Splice_Site	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:47129736A>C	ENST00000409792.3	-	10	5186	c.5144T>G	c.(5143-5145)gTg>gGg	p.V1715G	snoU13_ENST00000516129.1_RNA	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1715					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTCTCCATCCACCTACCACAG	0.363			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													83.0	87.0	86.0					3																	47129736		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.5143-1T>G	3.37:g.47129736A>C			O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.V1715G	ENST00000409792.3	37	c.5144	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	A	22.9	4.355622	0.82243	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	D	0.89939	-2.59	4.46	4.46	0.54185	.	0.000000	0.47093	D	0.000256	D	0.90594	0.7051	L	0.38531	1.155	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	D	0.89077	0.3473	10	0.30078	T	0.28	.	14.2024	0.65712	1.0:0.0:0.0:0.0	.	1715;1715	F2Z317;Q9BYW2	.;SETD2_HUMAN	G	1715	ENSP00000386759:V1715G	ENSP00000386759:V1715G	V	-	2	0	SETD2	47104740	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.709000	0.91379	1.995000	0.58328	0.528000	0.53228	GTG	SETD2	-	NULL	ENSG00000181555		0.363	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	51	0.00	0	A	NM_014159	Missense_Mutation	47129736	47129736	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	missense	107	13.49	17	SNP	1.000	C
SHMT1	6470	genome.wustl.edu	37	17	18232119	18232119	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr17:18232119T>C	ENST00000316694.3	-	12	1531	c.1397A>G	c.(1396-1398)gAg>gGg	p.E466G	SHMT1_ENST00000539052.1_Missense_Mutation_p.E328G|SHMT1_ENST00000352886.6_Missense_Mutation_p.E386G|SHMT1_ENST00000354098.3_Missense_Mutation_p.E427G|RP1-178F10.3_ENST00000577764.1_lincRNA	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	466					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	CTCAACCTCCTCCCGGAGAGC	0.617																																						dbGAP											0													29.0	28.0	29.0					17																	18232119		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.1397A>G	17.37:g.18232119T>C	ENSP00000318868:p.Glu466Gly		B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Missense_Mutation	SNP	pfam_Ser_HO-MeTrfase,pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	p.E466G	ENST00000316694.3	37	c.1397	CCDS11196.1	17	.	.	.	.	.	.	.	.	.	.	T	13.08	2.128936	0.37533	.	.	ENSG00000176974	ENST00000316694;ENST00000395684;ENST00000352886;ENST00000539052;ENST00000354098;ENST00000395685	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.37	3.08	0.35506	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.310059	0.38778	N	0.001572	T	0.30448	0.0765	M	0.68593	2.085	0.46725	D	0.999171	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.12156	0.001;0.007;0.001	T	0.08166	-1.0735	10	0.54805	T	0.06	-11.1234	8.6392	0.33968	0.125:0.0:0.1409:0.7341	.	429;427;466	A8MYA6;P34896-2;P34896	.;.;GLYC_HUMAN	G	466;241;386;328;427;429	ENSP00000318868:E466G;ENSP00000345881:E386G;ENSP00000440089:E328G;ENSP00000318805:E427G	ENSP00000318868:E466G	E	-	2	0	SHMT1	18172844	0.922000	0.31269	0.052000	0.19188	0.664000	0.39144	3.378000	0.52432	0.401000	0.25424	0.533000	0.62120	GAG	SHMT1	-	superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	ENSG00000176974		0.617	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHMT1	HGNC	protein_coding	OTTHUMT00000130831.2	71	0.00	0	T	NM_004169		18232119	18232119	-1	no_errors	ENST00000316694	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.868	C
SIGLEC1	6614	genome.wustl.edu	37	20	3687197	3687197	+	Missense_Mutation	SNP	A	A	C	rs201950990		TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr20:3687197A>C	ENST00000344754.4	-	2	205	c.206T>G	c.(205-207)gTg>gGg	p.V69G	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.V69G	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	69	Ig-like V-type.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GTGGCTCACCACCTGCCGCTG	0.667																																						dbGAP											0													23.0	23.0	23.0					20																	3687197		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.206T>G	20.37:g.3687197A>C	ENSP00000341141:p.Val69Gly		Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V69G	ENST00000344754.4	37	c.206	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	A	16.35	3.097429	0.56075	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.66460	-0.21;-0.21	5.31	5.31	0.75309	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.000000	0.36374	N	0.002626	T	0.74733	0.3755	M	0.78049	2.395	0.58432	D	0.999998	D;D	0.63880	0.993;0.991	P;P	0.57371	0.819;0.794	T	0.72953	-0.4135	10	0.12430	T	0.62	.	11.6376	0.51213	1.0:0.0:0.0:0.0	.	69;69	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	G	69	ENSP00000341141:V69G;ENSP00000202578:V69G	ENSP00000202578:V69G	V	-	2	0	SIGLEC1	3635197	0.417000	0.25432	0.998000	0.56505	0.035000	0.12851	4.433000	0.59929	2.014000	0.59158	0.460000	0.39030	GTG	SIGLEC1	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000088827		0.667	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	17	0.00	0	A	NM_023068		3687197	3687197	-1	no_errors	ENST00000344754	ensembl	human	known	69_37n	missense	4	63.64	7	SNP	1.000	C
SIX5	147912	genome.wustl.edu	37	19	46269274	46269274	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:46269274T>G	ENST00000317578.6	-	3	2086	c.1705A>C	c.(1705-1707)Acc>Ccc	p.T569P	AC074212.5_ENST00000559756.1_RNA|AC074212.6_ENST00000590076.1_RNA|AC074212.5_ENST00000592217.2_RNA|SIX5_ENST00000560168.1_3'UTR	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	569					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		AGCATGCTGGTGGGGAAGGTG	0.677																																						dbGAP											0													30.0	33.0	32.0					19																	46269274		2201	4299	6500	-	-	-	SO:0001583	missense	0			L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.1705A>C	19.37:g.46269274T>G	ENSP00000316842:p.Thr569Pro			Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.T569P	ENST00000317578.6	37	c.1705	CCDS12673.1	19	.	.	.	.	.	.	.	.	.	.	t	13.31	2.199137	0.38806	.	.	ENSG00000177045	ENST00000317578	D	0.91237	-2.81	4.42	2.2	0.27929	.	0.939717	0.08732	N	0.901884	T	0.78329	0.4266	N	0.08118	0	0.27704	N	0.945673	P	0.37466	0.596	B	0.34779	0.189	T	0.71104	-0.4689	10	0.49607	T	0.09	-13.4882	4.919	0.13860	0.0:0.2616:0.0:0.7384	.	569	Q8N196	SIX5_HUMAN	P	569	ENSP00000316842:T569P	ENSP00000316842:T569P	T	-	1	0	SIX5	50961114	1.000000	0.71417	0.997000	0.53966	0.625000	0.37756	2.399000	0.44495	0.747000	0.32809	0.459000	0.35465	ACC	SIX5	-	NULL	ENSG00000177045		0.677	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX5	HGNC	protein_coding	OTTHUMT00000417341.3	101	0.98	1	T	NM_175875		46269274	46269274	-1	no_errors	ENST00000317578	ensembl	human	known	69_37n	missense	40	10.87	5	SNP	0.992	G
SLC7A14	57709	genome.wustl.edu	37	3	170198117	170198117	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:170198117T>G	ENST00000231706.5	-	7	2269	c.1954A>C	c.(1954-1956)Acc>Ccc	p.T652P	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	652					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CATGTGATGGTGGAGAGCTTT	0.517																																						dbGAP											0													119.0	123.0	122.0					3																	170198117		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1954A>C	3.37:g.170198117T>G	ENSP00000231706:p.Thr652Pro		B3KV33|Q9HCF9	Missense_Mutation	SNP	pfam_AA-permease_dom	p.T652P	ENST00000231706.5	37	c.1954	CCDS33892.1	3	.	.	.	.	.	.	.	.	.	.	T	11.22	1.575080	0.28092	.	.	ENSG00000013293	ENST00000231706	D	0.87103	-2.21	5.72	4.55	0.56014	.	0.149802	0.64402	D	0.000008	T	0.74122	0.3675	N	0.11313	0.125	0.41929	D	0.990551	B	0.02656	0.0	B	0.04013	0.001	T	0.66594	-0.5884	10	0.35671	T	0.21	.	10.206	0.43114	0.2653:0.0:0.0:0.7347	.	652	Q8TBB6	S7A14_HUMAN	P	652	ENSP00000231706:T652P	ENSP00000231706:T652P	T	-	1	0	SLC7A14	171680811	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.327000	0.43858	0.963000	0.38082	0.533000	0.62120	ACC	SLC7A14	-	NULL	ENSG00000013293		0.517	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A14	HGNC	protein_coding	OTTHUMT00000352598.2	100	0.00	0	T	NM_020949		170198117	170198117	-1	no_errors	ENST00000231706	ensembl	human	known	69_37n	missense	37	15.56	7	SNP	1.000	G
SMAD3	4088	genome.wustl.edu	37	15	67479838	67479838	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr15:67479838C>T	ENST00000327367.4	+	8	1455	c.1145C>T	c.(1144-1146)gCg>gTg	p.A382V	SMAD3_ENST00000540846.2_Missense_Mutation_p.A277V|SMAD3_ENST00000537194.2_Missense_Mutation_p.A187V|SMAD3_ENST00000439724.3_Missense_Mutation_p.A338V	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	382	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		GGCTGGGGAGCGGAGTACAGG	0.602																																						dbGAP											0													107.0	103.0	105.0					15																	67479838		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.1145C>T	15.37:g.67479838C>T	ENSP00000332973:p.Ala382Val		A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.A382V	ENST00000327367.4	37	c.1145	CCDS10222.1	15	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943740	0.73672	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.98862	-5.19;-5.19;-5.19;-5.19	5.71	5.71	0.89125	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.168158	0.52532	D	0.000066	D	0.98036	0.9353	M	0.78916	2.43	0.80722	D	1	P;P	0.43826	0.818;0.638	B;B	0.39465	0.3;0.206	D	0.99457	1.0942	10	0.87932	D	0	.	19.8575	0.96767	0.0:1.0:0.0:0.0	.	338;382	B7Z4Z5;P84022	.;SMAD3_HUMAN	V	382;382;277;338;187	ENSP00000332973:A382V;ENSP00000437757:A277V;ENSP00000401133:A338V;ENSP00000445348:A187V	ENSP00000332973:A382V	A	+	2	0	SMAD3	65266892	1.000000	0.71417	0.806000	0.32338	0.397000	0.30659	7.636000	0.83301	2.698000	0.92095	0.561000	0.74099	GCG	SMAD3	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000166949		0.602	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD3	HGNC	protein_coding	OTTHUMT00000256967.2	214	0.00	0	C	NM_005902		67479838	67479838	+1	no_errors	ENST00000327367	ensembl	human	known	69_37n	missense	61	28.89	26	SNP	1.000	T
SPTBN4	57731	genome.wustl.edu	37	19	41071621	41071621	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:41071621T>G	ENST00000352632.3	+	29	6195	c.6109T>G	c.(6109-6111)Tgg>Ggg	p.W2037G	SPTBN4_ENST00000338932.3_Missense_Mutation_p.W2037G|SPTBN4_ENST00000392025.1_Missense_Mutation_p.W780G|SPTBN4_ENST00000598249.1_Missense_Mutation_p.W2037G			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	2037					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GTCGGAAAAGTGGGACCGCCA	0.637																																						dbGAP											0													56.0	49.0	51.0					19																	41071621		2153	4236	6389	-	-	-	SO:0001583	missense	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.6109T>G	19.37:g.41071621T>G	ENSP00000263373:p.Trp2037Gly		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.W2037G	ENST00000352632.3	37	c.6109	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	T	19.98	3.926834	0.73327	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025	T;T;T	0.50001	0.76;0.76;0.76	4.58	4.58	0.56647	.	0.000000	0.64402	U	0.000010	T	0.69233	0.3088	M	0.82630	2.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.72666	-0.4224	10	0.48119	T	0.1	.	13.0471	0.58933	0.0:0.0:0.0:1.0	.	780;2037	C9JY79;Q9H254	.;SPTN4_HUMAN	G	2037;2037;2037;780	ENSP00000263373:W2037G;ENSP00000340345:W2037G;ENSP00000375879:W780G	ENSP00000340345:W2037G	W	+	1	0	SPTBN4	45763461	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.460000	0.80816	1.931000	0.55961	0.418000	0.28097	TGG	SPTBN4	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000160460		0.637	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	198	0.50	1	T			41071621	41071621	+1	no_errors	ENST00000352632	ensembl	human	known	69_37n	missense	69	17.44	15	SNP	1.000	G
SRCAP	10847	genome.wustl.edu	37	16	30736382	30736382	+	Silent	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr16:30736382A>C	ENST00000262518.4	+	25	6022	c.5637A>C	c.(5635-5637)ccA>ccC	p.P1879P	SRCAP_ENST00000395059.2_Silent_p.P1817P|SRCAP_ENST00000344771.4_Silent_p.P1721P	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1879	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCCCCCCACCACCTCGTTCCC	0.567																																						dbGAP											0													47.0	57.0	54.0					16																	30736382		2195	4289	6484	-	-	-	SO:0001819	synonymous_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5637A>C	16.37:g.30736382A>C			B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.P1879	ENST00000262518.4	37	c.5637	CCDS10689.2	16																																																																																			SRCAP	-	NULL	ENSG00000080603		0.567	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	50	0.00	0	A	NM_006662		30736382	30736382	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	1.000	C
TMEM205	374882	genome.wustl.edu	37	19	11453680	11453680	+	Silent	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:11453680A>C	ENST00000354882.5	-	3	807	c.381T>G	c.(379-381)ggT>ggG	p.G127G	TMEM205_ENST00000586590.1_Silent_p.G127G|RAB3D_ENST00000589655.1_Intron|TMEM205_ENST00000589555.1_Silent_p.G127G|TMEM205_ENST00000587948.1_Silent_p.G127G|CCDC159_ENST00000588790.1_5'Flank|TMEM205_ENST00000588560.1_Silent_p.G127G|TMEM205_ENST00000586218.1_Silent_p.G66G|TMEM205_ENST00000447337.1_Silent_p.G127G|TMEM205_ENST00000593256.2_Silent_p.G127G|TMEM205_ENST00000586956.1_Silent_p.G127G			Q6UW68	TM205_HUMAN	transmembrane protein 205	127						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						GTACCTCCCCACCCAGGCCTC	0.647																																						dbGAP											0													74.0	68.0	70.0					19																	11453680		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127147	CCDS32909.1	19p13.2	2008-01-09				ENSG00000105518			29631	protein-coding gene	gene with protein product		613771				12975309	Standard	NM_198536		Approved	UNQ501, MBC3205	uc002mrb.2	Q6UW68		ENST00000354882.5:c.381T>G	19.37:g.11453680A>C				Missense_Mutation	SNP	NULL	p.W73G	ENST00000354882.5	37	c.217	CCDS32909.1	19																																																																																			TMEM205	-	NULL	ENSG00000105518		0.647	TMEM205-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM205	HGNC	protein_coding	OTTHUMT00000458743.1	128	0.00	0	A	NM_198536		11453680	11453680	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000592952	ensembl	human	putative	69_37n	missense	49	18.33	11	SNP	0.007	C
AC002472.1	0	genome.wustl.edu	37	22	21363642	21363642	+	5'Flank	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr22:21363642A>C	ENST00000547793.2	-	0	0				TUBA3FP_ENST00000422086.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000436079.1_RNA																							CCCGTAGTCCACCGAGAGCCG	0.597																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0																															22.37:g.21363642A>C	Exception_encountered			RNA	SNP	-	NULL	ENST00000547793.2	37	NULL		22																																																																																			TUBA3FP	-	-	ENSG00000161149		0.597	AC002472.1-201	NOVEL	basic|appris_principal	protein_coding	TUBA3FP	HGNC	protein_coding		131	0.00	0	A			21363642	21363642	-1	no_errors	ENST00000292748	ensembl	human	known	69_37n	rna	41	18.87	10	SNP	1.000	C
TUBB2B	347733	genome.wustl.edu	37	6	3227744	3227744	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:3227744A>C	ENST00000259818.7	-	1	225	c.34T>G	c.(34-36)Tgc>Ggc	p.C12G	TUBB2B_ENST00000473006.1_Intron	NM_178012.4	NP_821080.1	Q9BVA1	TBB2B_HUMAN	tubulin, beta 2B class IIb	12					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|neuron migration (GO:0001764)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			kidney(2)|large_intestine(5)|lung(1)|prostate(1)|skin(1)	10	Ovarian(93;0.0386)	all_hematologic(90;0.108)				TGGTTGCCGCACTGGCCCGCC	0.726																																						dbGAP											0													42.0	42.0	42.0					6																	3227744		2200	4299	6499	-	-	-	SO:0001583	missense	0			BC001352	CCDS4485.1	6p25.2	2011-10-10	2011-10-10		ENSG00000137285	ENSG00000137285		"""Tubulins"""	30829	protein-coding gene	gene with protein product	"""class IIb beta-tubulin"""	612850	"""tubulin, beta 2B"""			8619474, 9110174	Standard	NM_178012		Approved	MGC8685, DKFZp566F223, bA506K6.1	uc003mvg.3	Q9BVA1	OTTHUMG00000014143	ENST00000259818.7:c.34T>G	6.37:g.3227744A>C	ENSP00000259818:p.Cys12Gly		A8K068	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.C12G	ENST00000259818.7	37	c.34	CCDS4485.1	6	.	.	.	.	.	.	.	.	.	.	A	17.05	3.291000	0.59976	.	.	ENSG00000137285	ENST00000259818	T	0.74002	-0.8	4.34	3.17	0.36434	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.64402	D	0.000004	D	0.85647	0.5745	H	0.94847	3.59	0.58432	D	0.999998	D;P	0.76494	0.999;0.944	D;D	0.97110	1.0;0.928	D	0.87638	0.2520	10	0.87932	D	0	.	10.1043	0.42524	0.9198:0.0:0.0802:0.0	.	12;12	Q8IZ29;Q9BVA1	.;TBB2B_HUMAN	G	12	ENSP00000259818:C12G	ENSP00000259818:C12G	C	-	1	0	TUBB2B	3172743	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	5.837000	0.69381	0.802000	0.34089	-0.411000	0.06167	TGC	TUBB2B	-	pfam_Tubulin_FtsZ_GTPase,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,prints_Tubulin	ENSG00000137285		0.726	TUBB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2B	HGNC	protein_coding	OTTHUMT00000039680.2	54	0.00	0	A	NM_178012		3227744	3227744	-1	no_errors	ENST00000259818	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	1.000	C
TUBGCP4	27229	genome.wustl.edu	37	15	43668321	43668321	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr15:43668321A>C	ENST00000260383.7	+	2	358	c.104A>C	c.(103-105)cAc>cCc	p.H35P	TUBGCP4_ENST00000570081.1_3'UTR|TUBGCP4_ENST00000399460.3_5'Flank|TUBGCP4_ENST00000564079.1_Missense_Mutation_p.H35P			Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	35					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|spindle pole (GO:0000922)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(4)|prostate(2)|upper_aerodigestive_tract(2)	21		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		CCTTTCCTCCACCCCAGTGAG	0.542											OREG0023088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													138.0	145.0	143.0					15																	43668321		2023	4178	6201	-	-	-	SO:0001583	missense	0			AJ249677	CCDS42030.1, CCDS66745.1	15q15.3	2014-08-12			ENSG00000137822	ENSG00000137822			16691	protein-coding gene	gene with protein product		609610				10562286	Standard	NM_001286414		Approved	76P, FLJ14797	uc001zrn.3	Q9UGJ1	OTTHUMG00000176647	ENST00000260383.7:c.104A>C	15.37:g.43668321A>C	ENSP00000260383:p.His35Pro	918	B3KNK6|Q969X3|Q9NVF0	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.H35P	ENST00000260383.7	37	c.104		15	.	.	.	.	.	.	.	.	.	.	A	28.0	4.884731	0.91814	.	.	ENSG00000137822	ENST00000260383	T	0.06449	3.3	5.64	5.64	0.86602	.	0.042568	0.85682	D	0.000000	T	0.17916	0.0430	M	0.61703	1.905	0.80722	D	1	P;P	0.42248	0.774;0.733	P;P	0.54431	0.752;0.637	T	0.00785	-1.1567	10	0.30854	T	0.27	-20.7559	15.3291	0.74193	1.0:0.0:0.0:0.0	.	35;35	Q9UGJ1;Q9UGJ1-2	GCP4_HUMAN;.	P	35	ENSP00000260383:H35P	ENSP00000260383:H35P	H	+	2	0	TUBGCP4	41455613	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.377000	0.73145	2.265000	0.75225	0.482000	0.46254	CAC	TUBGCP4	-	pfam_Spc97_Spc98	ENSG00000137822		0.542	TUBGCP4-001	KNOWN	basic|appris_candidate_longest	protein_coding	TUBGCP4	HGNC	protein_coding	OTTHUMT00000432970.1	241	0.00	0	A	NM_014444		43668321	43668321	+1	no_errors	ENST00000260383	ensembl	human	known	69_37n	missense	63	17.95	14	SNP	1.000	C
UBE2C	11065	genome.wustl.edu	37	20	44441931	44441931	+	Intron	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr20:44441931T>G	ENST00000356455.4	+	2	221				UBE2C_ENST00000335046.3_Intron|UBE2C_ENST00000352551.5_Intron|UBE2C_ENST00000372568.4_Splice_Site|UBE2C_ENST00000405520.1_5'UTR|UBE2C_ENST00000243893.6_Intron	NM_007019.2	NP_008950.1	O00762	UBE2C_HUMAN	ubiquitin-conjugating enzyme E2C						activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cyclin catabolic process (GO:0008054)|exit from mitosis (GO:0010458)|free ubiquitin chain polymerization (GO:0010994)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(2)|lung(2)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				GTGGATCTGGTGAGTATACCC	0.562																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U73379	CCDS13370.1, CCDS13371.1, CCDS13372.1, CCDS13374.1, CCDS74733.1, CCDS74734.1	20q13.12	2007-02-05			ENSG00000175063	ENSG00000175063		"""Ubiquitin-conjugating enzymes E2"""	15937	protein-coding gene	gene with protein product		605574				9122200	Standard	NM_007019		Approved	UBCH10	uc002xpm.3	O00762	OTTHUMG00000033038	ENST00000356455.4:c.102-145T>G	20.37:g.44441931T>G			A6NP33|E1P5N7|G3XAB7	Splice_Site	SNP	-	e0+2	ENST00000356455.4	37	c.1+2	CCDS13370.1	20																																																																																			UBE2C	-	-	ENSG00000175063		0.562	UBE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2C	HGNC	protein_coding	OTTHUMT00000080309.2	26	0.00	0	T	NM_007019		44441931	44441931	+1	no_errors	ENST00000372568	ensembl	human	known	69_37n	splice_site	24	17.24	5	SNP	0.000	G
UFSP1	402682	genome.wustl.edu	37	7	100486564	100486564	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr7:100486564A>C	ENST00000388761.2	-	1	775	c.329T>G	c.(328-330)gTg>gGg	p.V110G		NM_001015072.3	NP_001015072.2	Q6NVU6	UFSP1_HUMAN	UFM1-specific peptidase 1 (non-functional)	110						extracellular vesicular exosome (GO:0070062)	thiolester hydrolase activity (GO:0016790)|UFM1 hydrolase activity (GO:0071567)			lung(1)|stomach(1)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)					TTGCCAGCCCACCCACCCAGC	0.582																																						dbGAP											0													116.0	110.0	112.0					7																	100486564		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF312032	CCDS34710.1	7q22.1	2008-03-25			ENSG00000176125	ENSG00000176125			33821	protein-coding gene	gene with protein product		611481				17182609, 18321862	Standard	NM_001015072		Approved	UFSP	uc003uxc.4	Q6NVU6	OTTHUMG00000159662	ENST00000388761.2:c.329T>G	7.37:g.100486564A>C	ENSP00000373413:p.Val110Gly		A4D2E4|A8K8V2|B6ZDG6|Q9BXP6	Missense_Mutation	SNP	pfam_Peptidase_C78_UfSP1/2	p.V110G	ENST00000388761.2	37	c.329	CCDS34710.1	7	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062184	0.76187	.	.	ENSG00000176125	ENST00000388761	T	0.35048	1.33	5.19	5.19	0.71726	.	0.000000	0.56097	D	0.000021	T	0.60625	0.2283	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65768	-0.6088	10	0.87932	D	0	-11.6634	13.27	0.60155	1.0:0.0:0.0:0.0	.	110	Q6NVU6	UFSP1_HUMAN	G	110	ENSP00000373413:V110G	ENSP00000373413:V110G	V	-	2	0	UFSP1	100324500	1.000000	0.71417	1.000000	0.80357	0.510000	0.34073	7.592000	0.82676	2.090000	0.63153	0.477000	0.44152	GTG	UFSP1	-	pfam_Peptidase_C78_UfSP1/2	ENSG00000176125		0.582	UFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFSP1	HGNC	protein_coding	OTTHUMT00000356751.1	133	0.75	1	A	NM_001015072		100486564	100486564	-1	no_errors	ENST00000388761	ensembl	human	known	69_37n	missense	58	20.55	15	SNP	1.000	C
VILL	50853	genome.wustl.edu	37	3	38039036	38039036	+	Silent	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr3:38039036T>G	ENST00000283713.6	+	7	890	c.624T>G	c.(622-624)ggT>ggG	p.G208G	VILL_ENST00000383759.2_Silent_p.G208G|VILL_ENST00000465644.1_Intron			O15195	VILL_HUMAN	villin-like	208					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CACAGATTGGTGTGGTGGATG	0.657																																						dbGAP											0													105.0	94.0	98.0					3																	38039036		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.624T>G	3.37:g.38039036T>G			A8MZP1|Q9BT80|Q9BWH7	Silent	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.G208	ENST00000283713.6	37	c.624	CCDS2670.2	3																																																																																			VILL	-	pfam_Gelsolin_dom,smart_Gelsolin	ENSG00000136059		0.657	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VILL	HGNC	protein_coding	OTTHUMT00000253360.3	200	0.99	2	T	NM_015873		38039036	38039036	+1	no_errors	ENST00000283713	ensembl	human	known	69_37n	silent	53	19.70	13	SNP	0.379	G
XAB2	56949	genome.wustl.edu	37	19	7687733	7687733	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr19:7687733A>C	ENST00000358368.4	-	10	1323	c.1286T>G	c.(1285-1287)gTg>gGg	p.V429G	XAB2_ENST00000534844.1_Missense_Mutation_p.V426G	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	429					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						CAGGTCATCCACCTGCTTGAA	0.642								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													78.0	59.0	66.0					19																	7687733		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.1286T>G	19.37:g.7687733A>C	ENSP00000351137:p.Val429Gly		Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V429G	ENST00000358368.4	37	c.1286	CCDS32892.1	19	.	.	.	.	.	.	.	.	.	.	A	23.2	4.387034	0.82902	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.16897	2.31;2.31	5.36	4.33	0.51752	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000001	T	0.47173	0.1431	M	0.91872	3.25	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	T	0.54622	-0.8266	10	0.62326	D	0.03	-39.6666	11.4592	0.50199	0.8487:0.1513:0.0:0.0	.	429	Q9HCS7	SYF1_HUMAN	G	429;426	ENSP00000351137:V429G;ENSP00000438225:V426G	ENSP00000351137:V429G	V	-	2	0	XAB2	7593733	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.870000	0.92336	0.854000	0.35336	0.533000	0.62120	GTG	XAB2	-	smart_HAT,pfscan_TPR-contain_dom	ENSG00000076924		0.642	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XAB2	HGNC	protein_coding	OTTHUMT00000461021.1	131	0.00	0	A	NM_020196		7687733	7687733	-1	no_errors	ENST00000358368	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	C
XIRP2	129446	genome.wustl.edu	37	2	168104724	168104724	+	Silent	SNP	C	C	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr2:168104724C>T	ENST00000409195.1	+	9	6911	c.6822C>T	c.(6820-6822)atC>atT	p.I2274I	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Silent_p.I2274I|XIRP2_ENST00000409273.1_Silent_p.I2052I	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2099					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)		p.I2274M(1)		NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGAATCCAATCAACTTTAACC	0.418																																						dbGAP											1	Substitution - Missense(1)	lung(1)											69.0	66.0	67.0					2																	168104724		1890	4091	5981	-	-	-	SO:0001819	synonymous_variant	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6822C>T	2.37:g.168104724C>T			A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.I2274	ENST00000409195.1	37	c.6822	CCDS42769.1	2																																																																																			XIRP2	-	NULL	ENSG00000163092		0.418	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	21	0.00	0	C	NM_152381		168104724	168104724	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	silent	39	29.09	16	SNP	0.794	T
XKR7	343702	genome.wustl.edu	37	20	30556255	30556255	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr20:30556255A>C	ENST00000562532.2	+	1	451	c.277A>C	c.(277-279)Acc>Ccc	p.T93P		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	93						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CTTCAGCCTCACCTTGCTGTT	0.637																																						dbGAP											0													83.0	65.0	71.0					20																	30556255		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.277A>C	20.37:g.30556255A>C	ENSP00000477059:p.Thr93Pro		Q9NUG5	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.T93P	ENST00000562532.2	37	c.277	CCDS33459.1	20	.	.	.	.	.	.	.	.	.	.	A	17.23	3.337454	0.60963	.	.	ENSG00000101321	ENST00000217299	T	0.70045	-0.45	3.41	3.41	0.39046	.	0.000000	0.64402	D	0.000008	D	0.83096	0.5180	M	0.91300	3.195	0.52501	D	0.999958	D	0.89917	1.0	D	0.91635	0.999	D	0.85511	0.1197	10	0.72032	D	0.01	.	10.1278	0.42661	1.0:0.0:0.0:0.0	.	93	Q5GH72	XKR7_HUMAN	P	93	ENSP00000217299:T93P	ENSP00000217299:T93P	T	+	1	0	XKR7	30019916	1.000000	0.71417	0.980000	0.43619	0.680000	0.39746	8.374000	0.90133	1.550000	0.49438	0.519000	0.50382	ACC	XKR7	-	pfam_Transport_prot_XK	ENSG00000101321		0.637	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	HGNC	protein_coding	OTTHUMT00000078597.3	120	0.83	1	A	NM_001011718		30556255	30556255	+1	no_errors	ENST00000217299	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	C
ZSCAN12	9753	genome.wustl.edu	37	6	28360727	28360727	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr6:28360727C>T	ENST00000361028.1	-	3	644	c.499G>A	c.(499-501)Gcc>Acc	p.A167T	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.A167T			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	167					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						TTTGGCTGGGCTTTCATGGAC	0.488																																						dbGAP											0													187.0	153.0	163.0					6																	28360727		692	1591	2283	-	-	-	SO:0001583	missense	0			AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.499G>A	6.37:g.28360727C>T	ENSP00000354305:p.Ala167Thr		O43724	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A167T	ENST00000361028.1	37	c.499		6	.	.	.	.	.	.	.	.	.	.	C	0.201	-1.044675	0.01997	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.06687	3.27;3.27	3.25	1.37	0.22104	.	.	.	.	.	T	0.00608	0.0020	N	0.02539	-0.55	0.09310	N	1	B;B	0.34103	0.437;0.437	B;B	0.24701	0.055;0.055	T	0.39603	-0.9606	9	0.10636	T	0.68	.	3.919	0.09236	0.2338:0.6351:0.0:0.1311	.	167;167	A8K187;O43309	.;ZSC12_HUMAN	T	167	ENSP00000354305:A167T;ENSP00000380039:A167T	ENSP00000354305:A167T	A	-	1	0	ZSCAN12	28468706	0.000000	0.05858	0.000000	0.03702	0.536000	0.34869	-0.070000	0.11523	0.197000	0.20387	0.655000	0.94253	GCC	ZSCAN12	-	NULL	ENSG00000158691		0.488	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	322	0.00	0	C	NM_014724		28360727	28360727	-1	no_errors	ENST00000361028	ensembl	human	known	69_37n	missense	212	26.04	75	SNP	0.001	T
ZSWIM2	151112	genome.wustl.edu	37	2	187713647	187713647	+	Intron	SNP	T	T	G			TCGA-A2-A0T6-01A-11D-A099-09	TCGA-A2-A0T6-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	e4dcb280-c309-4ebb-a58d-e6389a0306ee	f0f5e37a-90f7-4800-b7d2-a514e8be3a13	g.chr2:187713647T>G	ENST00000295131.2	-	1	205					NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2						apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			GGGAACCTGGTGGGCGGGGAT	0.617																																						dbGAP											0													43.0	48.0	47.0					2																	187713647		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0			AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.165+45A>C	2.37:g.187713647T>G			B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	NULL	p.T71P	ENST00000295131.2	37	c.211	CCDS33348.1	2																																																																																			ZSWIM2	-	NULL	ENSG00000163012		0.617	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM2	HGNC	protein_coding	OTTHUMT00000334565.1	20	0.00	0	T	NM_182521		187713647	187713647	-1	no_errors	ENST00000419862	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.000	G
