#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCF3	55324	genome.wustl.edu	37	3	183905743	183905743	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:183905743G>C	ENST00000429586.2	+	6	726	c.541G>C	c.(541-543)Gag>Cag	p.E181Q	EIF2B5_ENST00000444495.1_Intron|ABCF3_ENST00000292808.5_Missense_Mutation_p.E175Q	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	181	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E181Q(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGTGCGAATTGAGAACTTTGA	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											162.0	166.0	164.0					3																	183905743		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.541G>C	3.37:g.183905743G>C	ENSP00000411471:p.Glu181Gln		A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E181Q	ENST00000429586.2	37	c.541	CCDS3254.1	3	.	.	.	.	.	.	.	.	.	.	G	19.47	3.834006	0.71373	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.92752	-3.09;-3.1	4.67	4.67	0.58626	ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.91300	0.7257	L	0.31371	0.925	0.80722	D	1	P;P	0.51449	0.945;0.81	P;B	0.53224	0.721;0.15	D	0.92335	0.5877	10	0.56958	D	0.05	-18.1056	16.5684	0.84604	0.0:0.0:1.0:0.0	.	175;181	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	Q	181;175	ENSP00000411471:E181Q;ENSP00000292808:E175Q	ENSP00000292808:E175Q	E	+	1	0	ABCF3	185388437	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	9.593000	0.98250	2.127000	0.65507	0.462000	0.41574	GAG	ABCF3	-	pfscan_ABC_transporter-like	ENSG00000161204		0.463	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF3	HGNC	protein_coding	OTTHUMT00000346047.1	154	0.00	0	G	NM_018358		183905743	183905743	+1	no_errors	ENST00000429586	ensembl	human	known	69_37n	missense	128	15.23	23	SNP	1.000	C
AKAP9	10142	genome.wustl.edu	37	7	91729014	91729014	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr7:91729014C>A	ENST00000359028.2	+	44	10964	c.10739C>A	c.(10738-10740)tCc>tAc	p.S3580Y	AKAP9_ENST00000358100.2_Missense_Mutation_p.S3526Y|AKAP9_ENST00000356239.3_Missense_Mutation_p.S3576Y			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3580					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.S3576Y(1)|p.S3580Y(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGCTTGGTGTCCCCAAGTACT	0.413			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Substitution - Missense(2)	breast(2)											151.0	150.0	150.0					7																	91729014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.10739C>A	7.37:g.91729014C>A	ENSP00000351922:p.Ser3580Tyr		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.S3580Y	ENST00000359028.2	37	c.10739		7	.	.	.	.	.	.	.	.	.	.	C	8.388	0.839045	0.16891	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.03745	3.91;3.91;3.93;3.82	5.18	2.38	0.29361	.	0.431022	0.17305	N	0.179097	T	0.07279	0.0184	M	0.62723	1.935	0.09310	N	1	D;B;B;B;B	0.57899	0.981;0.006;0.002;0.003;0.003	P;B;B;B;B	0.50231	0.635;0.007;0.003;0.007;0.007	T	0.23619	-1.0183	10	0.66056	D	0.02	.	4.9961	0.14240	0.1454:0.5735:0.0:0.281	.	851;3580;3580;3576;3568	B3KQF9;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	Y	3576;3580;3526;3580;1422	ENSP00000348573:S3576Y;ENSP00000351922:S3580Y;ENSP00000350813:S3526Y;ENSP00000378042:S1422Y	ENSP00000348573:S3576Y	S	+	2	0	AKAP9	91566950	0.926000	0.31397	0.084000	0.20598	0.514000	0.34195	2.804000	0.47931	0.287000	0.22375	-1.057000	0.02308	TCC	AKAP9	-	NULL	ENSG00000127914		0.413	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		97	0.00	0	C	NM_005751		91729014	91729014	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	40	33.33	20	SNP	0.012	A
ALG10B	144245	genome.wustl.edu	37	12	38712083	38712083	+	Silent	SNP	A	A	C	rs141713734		TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr12:38712083A>C	ENST00000308742.4	+	2	508	c.192A>C	c.(190-192)acA>acC	p.T64T	ALG10B_ENST00000551464.1_Silent_p.T64T	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	64					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)	p.T64T(1)		breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				TGATTACTACATTACCTGGCT	0.418																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											250.0	233.0	239.0					12																	38712083		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.192A>C	12.37:g.38712083A>C			B2RPF4	Missense_Mutation	SNP	pfam_Glycosyltransferase_ALG10	p.I56L	ENST00000308742.4	37	c.166	CCDS31772.1	12																																																																																			ALG10B	-	NULL	ENSG00000175548		0.418	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10B	HGNC	protein_coding	OTTHUMT00000403349.1	224	0.00	0	A	NM_001013620		38712083	38712083	+1	no_errors	ENST00000548240	ensembl	human	known	69_37n	missense	308	12.00	42	SNP	0.443	C
AP1S1	1174	genome.wustl.edu	37	7	100802408	100802408	+	Silent	SNP	G	G	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr7:100802408G>T	ENST00000337619.5	+	4	478	c.360G>T	c.(358-360)ggG>ggT	p.G120G	MIR4653_ENST00000585107.1_RNA	NM_001283.3	NP_001274.1	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1 subunit	120					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor-mediated endocytosis (GO:0006898)|regulation of defense response to virus by virus (GO:0050690)|response to virus (GO:0009615)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|coated pit (GO:0005905)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)	protein transporter activity (GO:0008565)	p.G120G(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)	8	Lung NSC(181;0.168)|all_lung(186;0.215)					TTTTGATGGGGGGGGATGTCC	0.562																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											61.0	65.0	63.0					7																	100802408		2040	4177	6217	-	-	-	SO:0001819	synonymous_variant	0			AB015319	CCDS47669.1	7q22.1	2014-02-04			ENSG00000106367	ENSG00000106367			559	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, small 1 (19kD)"", ""clathrin coat assembly protein AP19"", ""sigma1A subunit of AP-1 clathrin adaptor complex"", ""AP-1 complex subunit sigma-1A"", ""sigma1A-adaptin"", ""golgi adaptor HA1/AP1 adaptin sigma-1A subunit"", ""clathrin assembly protein complex 1 sigma-1A small chain"", ""HA1 19 kDa subunit"""	603531	"""erythrokeratodermia variabilis 3 (Kamouraska type)"""	CLAPS1, EKV3		9653655, 9733768, 19057675	Standard	NM_001283		Approved	AP19, SIGMA1A, WUGSC:H_DJ0747G18.2	uc003uxv.4	P61966	OTTHUMG00000157103	ENST00000337619.5:c.360G>T	7.37:g.100802408G>T			B2R5D8|P82267|Q00382|Q53YA7|Q9BTN4|Q9UDW9	Missense_Mutation	SNP	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom	p.G162V	ENST00000337619.5	37	c.485	CCDS47669.1	7	.	.	.	.	.	.	.	.	.	.	G	8.734	0.917439	0.17982	.	.	ENSG00000106367	ENST00000429457	.	.	.	4.82	-7.93	0.01156	.	0.056512	0.64402	D	0.000001	T	0.43122	0.1233	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51756	-0.8665	6	0.87932	D	0	-6.4642	0.4582	0.00512	0.3939:0.1862:0.1517:0.2682	.	.	.	.	V	162	.	ENSP00000399902:G162V	G	+	2	0	AP1S1	100589128	0.000000	0.05858	0.655000	0.29622	0.991000	0.79684	-7.102000	0.00044	-1.335000	0.02241	0.555000	0.69702	GGG	AP1S1	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom	ENSG00000106367		0.562	AP1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1S1	HGNC	protein_coding	OTTHUMT00000347439.1	84	0.00	0	G	NM_001283		100802408	100802408	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000429457	ensembl	human	putative	69_37n	missense	36	40.00	24	SNP	0.052	T
AP3B1	8546	genome.wustl.edu	37	5	77590365	77590365	+	Silent	SNP	T	T	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr5:77590365T>A	ENST00000255194.6	-	1	214	c.39A>T	c.(37-39)ggA>ggT	p.G13G	AP3B1_ENST00000519295.1_5'UTR	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	13					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)	p.G13G(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		CCTCCCCTCCTCCGGACTGCT	0.597									Hermansky-Pudlak syndrome																													dbGAP											1	Substitution - coding silent(1)	breast(1)											69.0	79.0	76.0					5																	77590365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.39A>T	5.37:g.77590365T>A			E5RJ68|O00580|Q7Z393|Q9HD66	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_bsu	p.G13	ENST00000255194.6	37	c.39	CCDS4041.1	5																																																																																			AP3B1	-	pirsf_AP3_complex_bsu	ENSG00000132842		0.597	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	72	0.00	0	T			77590365	77590365	-1	no_errors	ENST00000255194	ensembl	human	known	69_37n	silent	37	24.49	12	SNP	0.796	A
ARID3C	138715	genome.wustl.edu	37	9	34622463	34622463	+	Missense_Mutation	SNP	C	C	G	rs12337871	byFrequency	TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr9:34622463C>G	ENST00000378909.2	-	5	1021	c.929G>C	c.(928-930)cGg>cCg	p.R310P	DCTN3_ENST00000447983.2_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000477738.2_5'Flank|DCTN3_ENST00000378913.2_5'Flank|DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000259632.7_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	310	Pro-rich.|REKLES. {ECO:0000255|PROSITE- ProRule:PRU00819}.		R -> Q (in dbSNP:rs12337871).		positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		CAATTTCTCCCGTGTAGGTCC	0.592																																						dbGAP											0													65.0	67.0	67.0					9																	34622463		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.929G>C	9.37:g.34622463C>G	ENSP00000368189:p.Arg310Pro			Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.R310P	ENST00000378909.2	37	c.929	CCDS35006.1	9	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175263	0.38413	.	.	ENSG00000205143	ENST00000378909	T	0.58358	0.34	5.02	4.13	0.48395	REKLES domain (1);	0.162866	0.29348	N	0.012409	T	0.69788	0.3150	M	0.76170	2.325	0.38641	P	0.048395999999999995	D	0.89917	1.0	D	0.76575	0.988	T	0.76348	-0.2992	9	0.41790	T	0.15	-9.6161	12.8561	0.57886	0.0:0.9212:0.0:0.0788	.	310	A6NKF2	ARI3C_HUMAN	P	310	ENSP00000368189:R310P	ENSP00000368189:R310P	R	-	2	0	ARID3C	34612463	0.018000	0.18449	0.137000	0.22149	0.209000	0.24338	2.117000	0.41939	1.343000	0.45638	-0.480000	0.04831	CGG	ARID3C	-	NULL	ENSG00000205143		0.592	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3C	HGNC	protein_coding	OTTHUMT00000348265.1	52	0.00	0	C	XM_071061		34622463	34622463	-1	no_errors	ENST00000378909	ensembl	human	known	69_37n	missense	39	18.00	9	SNP	0.912	G
ATAD5	79915	genome.wustl.edu	37	17	29196617	29196617	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:29196617C>G	ENST00000321990.4	+	14	3938	c.3560C>G	c.(3559-3561)tCa>tGa	p.S1187*		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1187					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)	p.S1187*(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GGTGTAAACTCACAAAAACCC	0.353																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											85.0	86.0	86.0					17																	29196617		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.3560C>G	17.37:g.29196617C>G	ENSP00000313171:p.Ser1187*		Q05DH0|Q69YR6|Q9H9I1	Nonsense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.S1187*	ENST00000321990.4	37	c.3560	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	C	44	10.643102	0.99443	.	.	ENSG00000176208	ENST00000321990	.	.	.	5.49	5.49	0.81192	.	0.212911	0.39210	N	0.001439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	19.3687	0.94475	0.0:1.0:0.0:0.0	.	.	.	.	X	1187	.	ENSP00000313171:S1187X	S	+	2	0	ATAD5	26220743	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.325000	0.52030	2.573000	0.86826	0.561000	0.74099	TCA	ATAD5	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000176208		0.353	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	HGNC	protein_coding	OTTHUMT00000256206.2	167	0.00	0	C	NM_024857		29196617	29196617	+1	no_errors	ENST00000321990	ensembl	human	known	69_37n	nonsense	121	24.84	40	SNP	1.000	G
C3orf30	152405	genome.wustl.edu	37	3	118867057	118867057	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:118867057G>T	ENST00000295622.1	+	2	1469	c.1429G>T	c.(1429-1431)Ggt>Tgt	p.G477C	RP11-484M3.5_ENST00000490594.1_Intron|IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	477								p.G477C(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		CCAAGGAAAGGGTTATCATAT	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	90.0	88.0					3																	118867057		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.1429G>T	3.37:g.118867057G>T	ENSP00000295622:p.Gly477Cys		A1L4B7	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.G477C	ENST00000295622.1	37	c.1429	CCDS2984.1	3	.	.	.	.	.	.	.	.	.	.	G	11.48	1.650782	0.29336	.	.	ENSG00000163424	ENST00000295622;ENST00000470341	T	0.12569	2.67	4.27	1.8	0.24995	.	1.767630	0.03178	N	0.171631	T	0.09247	0.0228	N	0.08118	0	0.09310	N	1	B;P	0.50156	0.412;0.932	B;B	0.44133	0.128;0.442	T	0.13548	-1.0505	10	0.59425	D	0.04	0.2851	4.3948	0.11358	0.6922:0.2015:0.1063:0.0	.	477;477	E9PFE5;Q96M34	.;CC030_HUMAN	C	477	ENSP00000295622:G477C	ENSP00000295622:G477C	G	+	1	0	C3orf30	120349747	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.111000	0.10807	0.269000	0.21961	-0.238000	0.12139	GGT	C3orf30	-	NULL	ENSG00000163424		0.363	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf30	HGNC	protein_coding	OTTHUMT00000354838.1	130	0.00	0	G	NM_152539		118867057	118867057	+1	no_errors	ENST00000295622	ensembl	human	known	69_37n	missense	165	11.29	21	SNP	0.000	T
C3orf36	80111	genome.wustl.edu	37	3	133647451	133647451	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:133647451G>C	ENST00000408895.2	-	1	1205	c.197C>G	c.(196-198)tCt>tGt	p.S66C		NM_025041.2	NP_079317.2	Q3SXR2	CC036_HUMAN	chromosome 3 open reading frame 36	66								p.S66C(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6						TTCCAGTGTAGACTCCAGGAG	0.652																																						dbGAP											1	Substitution - Missense(1)	breast(1)											32.0	36.0	35.0					3																	133647451		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025826	CCDS3083.1	3q22.1	2011-09-30			ENSG00000221972	ENSG00000221972			26170	protein-coding gene	gene with protein product						12477932	Standard	NM_025041		Approved	FLJ22173	uc003epz.1	Q3SXR2		ENST00000408895.2:c.197C>G	3.37:g.133647451G>C	ENSP00000386219:p.Ser66Cys		Q3SXR3|Q9H6K8	Missense_Mutation	SNP	NULL	p.S66C	ENST00000408895.2	37	c.197	CCDS3083.1	3	.	.	.	.	.	.	.	.	.	.	G	9.178	1.022850	0.19433	.	.	ENSG00000221972	ENST00000408895	.	.	.	1.76	0.769	0.18492	.	.	.	.	.	T	0.32346	0.0826	N	0.08118	0	0.09310	N	1	D	0.89917	1.0	D	0.68621	0.959	T	0.13335	-1.0513	8	0.87932	D	0	.	5.0039	0.14279	0.0:0.0:0.6473:0.3527	.	66	Q3SXR2	CC036_HUMAN	C	66	.	ENSP00000386219:S66C	S	-	2	0	C3orf36	135130141	0.001000	0.12720	0.004000	0.12327	0.039000	0.13416	0.345000	0.19979	0.254000	0.21573	0.313000	0.20887	TCT	C3orf36	-	NULL	ENSG00000221972		0.652	C3orf36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf36	HGNC	protein_coding		65	0.00	0	G	NM_025041		133647451	133647451	-1	no_errors	ENST00000408895	ensembl	human	known	69_37n	missense	56	13.85	9	SNP	0.004	C
CACNA1F	778	genome.wustl.edu	37	X	49065105	49065105	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chrX:49065105C>T	ENST00000376265.2	-	43	5087	c.5026G>A	c.(5026-5028)Ggg>Agg	p.G1676R	CACNA1F_ENST00000323022.5_Missense_Mutation_p.G1665R|CACNA1F_ENST00000376251.1_Missense_Mutation_p.G1611R	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1676					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.G1676R(1)		autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ACAGAAATCCCGGAGCCCCGG	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											59.0	55.0	56.0					X																	49065105		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5026G>A	X.37:g.49065105C>T	ENSP00000365441:p.Gly1676Arg		A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.G1676R	ENST00000376265.2	37	c.5026	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	T	0.209	-1.038128	0.02013	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.95980	-3.87;-3.8;-3.8	4.89	-0.157	0.13387	.	47.063700	0.00166	N	0.000000	D	0.84933	0.5582	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.80448	-0.1378	10	0.13108	T	0.6	.	4.6109	0.12402	0.0:0.3623:0.3679:0.2698	.	1665;1676	F5CIQ9;O60840	.;CAC1F_HUMAN	R	1611;1665;1676	ENSP00000365427:G1611R;ENSP00000321618:G1665R;ENSP00000365441:G1676R	ENSP00000321618:G1665R	G	-	1	0	CACNA1F	48952049	0.018000	0.18449	0.040000	0.18447	0.208000	0.24298	-0.481000	0.06552	-0.269000	0.09298	-0.314000	0.08810	GGG	CACNA1F	-	NULL	ENSG00000102001		0.577	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	67	0.00	0	C	NM_005183		49065105	49065105	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	12	61.29	19	SNP	0.066	T
CCDC83	220047	genome.wustl.edu	37	11	85623726	85623726	+	Intron	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr11:85623726C>T	ENST00000342404.3	+	8	1010				CCDC83_ENST00000280245.4_Missense_Mutation_p.P277S|CCDC83_ENST00000376067.1_Intron|CCDC83_ENST00000529676.2_Intron			Q8IWF9	CCD83_HUMAN	coiled-coil domain containing 83									p.P277S(1)		breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|skin(3)|upper_aerodigestive_tract(2)	29		Acute lymphoblastic leukemia(157;4.88e-06)|all_hematologic(158;0.00572)				CACCTCTAATCCTCGTCATCT	0.522																																						dbGAP											1	Substitution - Missense(1)	breast(1)											420.0	346.0	371.0					11																	85623726		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AK124113	CCDS8271.1, CCDS66196.1	11q14.1-q14.2	2014-01-21			ENSG00000150676	ENSG00000150676			28535	protein-coding gene	gene with protein product						12477932	Standard	XM_005273842		Approved	MGC34732, FLJ42119, CT148	uc001pbg.1	Q8IWF9	OTTHUMG00000166978	ENST00000342404.3:c.794+1281C>T	11.37:g.85623726C>T			B2RA49|Q6X7T2|Q6ZVT5|Q8N9Y1	Missense_Mutation	SNP	NULL	p.P277S	ENST00000342404.3	37	c.829		11	.	.	.	.	.	.	.	.	.	.	C	15.19	2.759745	0.49468	.	.	ENSG00000150676	ENST00000280245	T	0.42900	0.96	3.12	-6.25	0.02039	.	1.666110	0.04151	N	0.321310	T	0.19446	0.0467	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.10177	-1.0641	8	.	.	.	5.9461	0.1441	0.00086	0.2566:0.184:0.2545:0.3049	.	277	Q8IWF9-2	.	S	277	ENSP00000280245:P277S	.	P	+	1	0	CCDC83	85301374	0.000000	0.05858	0.000000	0.03702	0.537000	0.34900	-0.811000	0.04500	-1.861000	0.01153	0.467000	0.42956	CCT	CCDC83	-	NULL	ENSG00000150676		0.522	CCDC83-002	KNOWN	basic|appris_principal	protein_coding	CCDC83	HGNC	protein_coding	OTTHUMT00000392215.1	250	0.00	0	C	NM_173556		85623726	85623726	+1	no_errors	ENST00000280245	ensembl	human	known	69_37n	missense	169	24.11	54	SNP	0.000	T
CHD3	1107	genome.wustl.edu	37	17	7800561	7800561	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:7800561G>A	ENST00000330494.7	+	11	2018	c.1868G>A	c.(1867-1869)cGt>cAt	p.R623H	CHD3_ENST00000358181.4_Missense_Mutation_p.R623H|CHD3_ENST00000380358.4_Missense_Mutation_p.R682H	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	623					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R623H(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				AAGTACTATCGTTTTGGCATC	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											155.0	121.0	132.0					17																	7800561		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1868G>A	17.37:g.7800561G>A	ENSP00000332628:p.Arg623His		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R623H	ENST00000330494.7	37	c.1868	CCDS32554.1	17	.	.	.	.	.	.	.	.	.	.	G	20.4	3.980801	0.74474	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	T;T;T	0.72725	-0.68;-0.68;-0.68	5.67	5.67	0.87782	.	0.000000	0.45126	D	0.000396	D	0.85141	0.5629	M	0.86953	2.85	0.58432	D	0.999996	D;D;D	0.71674	0.997;0.995;0.998	P;P;P	0.59288	0.855;0.719;0.791	D	0.87355	0.2340	10	0.87932	D	0	-11.4003	19.7619	0.96323	0.0:0.0:1.0:0.0	.	623;623;682	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	H	682;623;623	ENSP00000369716:R682H;ENSP00000350907:R623H;ENSP00000332628:R623H	ENSP00000332628:R623H	R	+	2	0	CHD3	7741286	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	5.404000	0.66344	2.681000	0.91329	0.561000	0.74099	CGT	CHD3	-	NULL	ENSG00000170004		0.532	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	54	0.00	0	G	NM_001005273		7800561	7800561	+1	no_errors	ENST00000330494	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	1.000	A
CD79B	974	genome.wustl.edu	37	17	62007688	62007688	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:62007688A>G	ENST00000006750.3	-	3	268	c.176T>C	c.(175-177)tTc>tCc	p.F59S	CD79B_ENST00000392795.3_Missense_Mutation_p.F60S|CD79B_ENST00000349817.2_Intron	NM_000626.2|NM_021602.2	NP_000617.1|NP_067613.1	P40259	CD79B_HUMAN	CD79b molecule, immunoglobulin-associated beta	59	Ig-like V-type.				B cell receptor signaling pathway (GO:0050853)|immune response (GO:0006955)|signal transduction (GO:0007165)	B cell receptor complex (GO:0019815)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)	p.F59S(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|stomach(1)	15						TTTCACCGTGAAGCCCCGTTT	0.572			"""Mis, O"""		DLBCL																																	dbGAP		Dom	yes		17	17q23	974	"""CD79b molecule, immunoglobulin-associated beta"""		L	1	Substitution - Missense(1)	breast(1)											70.0	60.0	63.0					17																	62007688		2203	4300	6503	-	-	-	SO:0001583	missense	0			L27587	CCDS11655.1, CCDS11656.1, CCDS42372.1	17q23	2014-09-17	2006-03-28			ENSG00000007312		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1699	protein-coding gene	gene with protein product		147245	"""CD79B antigen (immunoglobulin-associated beta)"""	IGB		9545642	Standard	XM_005257858		Approved	B29	uc002jdp.1	P40259		ENST00000006750.3:c.176T>C	17.37:g.62007688A>G	ENSP00000006750:p.Phe59Ser		Q53FS2|Q9BU06	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Phos_immunorcpt_sig_ITAM,smart_Ig_sub,smart_Phos_immunorcpt_sig_ITAM,pfscan_Phos_immunorcpt_sig_ITAM,pfscan_Ig-like	p.F60S	ENST00000006750.3	37	c.179	CCDS11655.1	17	.	.	.	.	.	.	.	.	.	.	A	8.448	0.852508	0.17106	.	.	ENSG00000007312	ENST00000392795;ENST00000006750	T;T	0.74632	-0.86;-0.86	5.71	-4.9	0.03094	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.070710	0.07028	N	0.827964	T	0.35566	0.0936	N	0.01668	-0.77	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.33803	-0.9854	10	0.07990	T	0.79	-9.3472	2.3667	0.04321	0.1543:0.1098:0.3106:0.4252	.	59	P40259	CD79B_HUMAN	S	60;59	ENSP00000376544:F60S;ENSP00000006750:F59S	ENSP00000006750:F59S	F	-	2	0	CD79B	59361420	0.000000	0.05858	0.003000	0.11579	0.479000	0.33129	-0.701000	0.05075	-0.505000	0.06568	-0.527000	0.04329	TTC	CD79B	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000007312		0.572	CD79B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD79B	HGNC	protein_coding	OTTHUMT00000417711.1	55	0.00	0	A			62007688	62007688	-1	no_errors	ENST00000392795	ensembl	human	known	69_37n	missense	62	17.33	13	SNP	0.000	G
CLDN9	9080	genome.wustl.edu	37	16	3063852	3063852	+	Silent	SNP	C	C	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr16:3063852C>G	ENST00000445369.2	+	1	1396	c.489C>G	c.(487-489)tcC>tcG	p.S163S		NM_020982.3	NP_066192.1	O95484	CLD9_HUMAN	claudin 9	163					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(5)|prostate(2)	10						TGGGGGCCTCCCTCTACCTGG	0.711																																						dbGAP											0													20.0	23.0	22.0					16																	3063852		2196	4295	6491	-	-	-	SO:0001819	synonymous_variant	0			AJ130941	CCDS10487.1	16p13.3	2008-08-01			ENSG00000213937	ENSG00000213937		"""Claudins"""	2051	protein-coding gene	gene with protein product		615799				9441748, 18234789	Standard	NM_020982		Approved		uc010uwo.1	O95484	OTTHUMG00000129000	ENST00000445369.2:c.489C>G	16.37:g.3063852C>G				Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin9	p.S163	ENST00000445369.2	37	c.489	CCDS10487.1	16																																																																																			CLDN9	-	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	ENSG00000213937		0.711	CLDN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN9	HGNC	protein_coding	OTTHUMT00000250989.1	15	0.00	0	C	NM_020982		3063852	3063852	+1	no_errors	ENST00000445369	ensembl	human	known	69_37n	silent	6	40.00	4	SNP	0.951	G
CTNNA2	1496	genome.wustl.edu	37	2	80801302	80801302	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr2:80801302G>A	ENST00000402739.4	+	12	1761	c.1756G>A	c.(1756-1758)Gct>Act	p.A586T	AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000466387.1_Missense_Mutation_p.A586T|CTNNA2_ENST00000540488.1_Missense_Mutation_p.A586T|CTNNA2_ENST00000496558.1_Missense_Mutation_p.A586T|CTNNA2_ENST00000361291.4_Missense_Mutation_p.A620T|AC008067.2_ENST00000430876.1_RNA|CTNNA2_ENST00000541047.1_Missense_Mutation_p.A586T|CTNNA2_ENST00000343114.3_Missense_Mutation_p.A265T	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	586					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.E587K(1)|p.A586T(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GCCACGCTTCGCTGAACAAGT	0.493																																						dbGAP											2	Substitution - Missense(2)	breast(2)											168.0	159.0	162.0					2																	80801302		2037	4209	6246	-	-	-	SO:0001583	missense	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.1756G>A	2.37:g.80801302G>A	ENSP00000384638:p.Ala586Thr		B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.A620T	ENST00000402739.4	37	c.1858		2	.	.	.	.	.	.	.	.	.	.	G	10.61	1.397986	0.25205	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2;1.2	5.87	5.87	0.94306	.	0.122511	0.56097	D	0.000039	T	0.29524	0.0736	N	0.20483	0.58	0.58432	D	0.999998	B;B;B;B	0.20671	0.027;0.025;0.047;0.02	B;B;B;B	0.27380	0.008;0.079;0.013;0.013	T	0.07139	-1.0788	9	.	.	.	.	20.2087	0.98285	0.0:0.0:1.0:0.0	.	218;586;586;586	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	T	586;586;620;586;586;586;265	ENSP00000418191:A586T;ENSP00000419295:A586T;ENSP00000355398:A620T;ENSP00000384638:A586T;ENSP00000444675:A586T;ENSP00000441705:A586T;ENSP00000341500:A265T	.	A	+	1	0	CTNNA2	80654813	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.588000	0.46137	2.791000	0.96007	0.655000	0.94253	GCT	CTNNA2	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000066032		0.493	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4	157	0.00	0	G	NM_004389		80801302	80801302	+1	no_errors	ENST00000361291	ensembl	human	known	69_37n	missense	81	28.32	32	SNP	1.000	A
COL6A3	1293	genome.wustl.edu	37	2	238245104	238245104	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr2:238245104G>A	ENST00000295550.4	-	40	9091	c.8639C>T	c.(8638-8640)aCg>aTg	p.T2880M	COL6A3_ENST00000409809.1_Missense_Mutation_p.T2674M|COL6A3_ENST00000353578.4_Missense_Mutation_p.T2674M|COL6A3_ENST00000472056.1_Missense_Mutation_p.T2273M|COL6A3_ENST00000347401.3_Missense_Mutation_p.T2679M|COL6A3_ENST00000346358.4_Missense_Mutation_p.T2680M	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	2880	Nonhelical region.|Thr-rich.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.T2880M(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		CACCGGCTTCGTCGTAGTCAC	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											162.0	153.0	156.0					2																	238245104		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.8639C>T	2.37:g.238245104G>A	ENSP00000295550:p.Thr2880Met		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.T2880M	ENST00000295550.4	37	c.8639	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	G	5.022	0.189834	0.09547	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.90324	-2.65;-2.61;-2.62;-2.6;-2.62;-2.58	3.68	1.77	0.24775	.	.	.	.	.	D	0.84497	0.5485	L	0.52266	1.64	0.09310	N	1	P;P;P	0.49862	0.783;0.861;0.929	B;B;B	0.40101	0.169;0.319;0.255	T	0.73858	-0.3850	9	0.38643	T	0.18	.	4.6746	0.12706	0.12:0.0:0.6673:0.2126	.	2273;2674;2880	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	M	2880;2679;2674;2273;2674;2680	ENSP00000295550:T2880M;ENSP00000315609:T2679M;ENSP00000315873:T2674M;ENSP00000418285:T2273M;ENSP00000386844:T2674M;ENSP00000295546:T2680M	ENSP00000295550:T2880M	T	-	2	0	COL6A3	237909843	0.007000	0.16637	0.000000	0.03702	0.009000	0.06853	1.618000	0.36954	0.149000	0.19098	-0.222000	0.12452	ACG	COL6A3	-	NULL	ENSG00000163359		0.468	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	265	0.00	0	G	NM_004369		238245104	238245104	-1	no_errors	ENST00000295550	ensembl	human	known	69_37n	missense	205	24.35	66	SNP	0.001	A
DENND2D	79961	genome.wustl.edu	37	1	111742287	111742287	+	Silent	SNP	T	T	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr1:111742287T>C	ENST00000357640.4	-	2	430	c.201A>G	c.(199-201)tcA>tcG	p.S67S	CHI3L2_ENST00000445067.2_5'Flank|DENND2D_ENST00000369752.5_Silent_p.S64S|DENND2D_ENST00000473682.1_5'UTR	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D	67	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.S67S(1)		breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		AATCATCCTCTGAACGCTTCT	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											110.0	117.0	115.0					1																	111742287		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.201A>G	1.37:g.111742287T>C			Q5T5V6|Q9BSU0	Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.S67	ENST00000357640.4	37	c.201	CCDS831.1	1																																																																																			DENND2D	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom	ENSG00000162777		0.512	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	HGNC	protein_coding	OTTHUMT00000034456.1	62	0.00	0	T	NM_024901		111742287	111742287	-1	no_errors	ENST00000357640	ensembl	human	known	69_37n	silent	41	28.07	16	SNP	0.000	C
DMRTA1	63951	genome.wustl.edu	37	9	22451752	22451752	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr9:22451752T>C	ENST00000325870.2	+	2	1582	c.1357T>C	c.(1357-1359)Tca>Cca	p.S453P		NM_022160.2	NP_071443.2	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	453					male mating behavior (GO:0060179)|ovarian follicle development (GO:0001541)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S453P(1)		breast(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		TGGTTTTATGTCACCCTACCT	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	114.0	120.0					9																	22451752		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ290954	CCDS6514.1	9p21.3	2008-05-15			ENSG00000176399	ENSG00000176399			13826	protein-coding gene	gene with protein product		614803					Standard	NM_022160		Approved		uc003zpp.1	Q5VZB9	OTTHUMG00000019693	ENST00000325870.2:c.1357T>C	9.37:g.22451752T>C	ENSP00000319651:p.Ser453Pro		A1L481|Q8N8Y9|Q9H4B9	Missense_Mutation	SNP	pfam_DM_DNA-bd,pfam_DMA,superfamily_DM_DNA-bd,superfamily_UBA-like,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.S453P	ENST00000325870.2	37	c.1357	CCDS6514.1	9	.	.	.	.	.	.	.	.	.	.	T	12.95	2.091998	0.36952	.	.	ENSG00000176399	ENST00000325870	T	0.37058	1.22	5.92	2.25	0.28309	.	0.451825	0.25786	N	0.028308	T	0.36635	0.0974	M	0.79475	2.455	0.45129	D	0.998141	B	0.25390	0.125	B	0.20184	0.028	T	0.13791	-1.0496	10	0.45353	T	0.12	-1.8901	9.3015	0.37849	0.0:0.2111:0.0:0.7889	.	453	Q5VZB9	DMRTA_HUMAN	P	453	ENSP00000319651:S453P	ENSP00000319651:S453P	S	+	1	0	DMRTA1	22441752	1.000000	0.71417	0.980000	0.43619	0.812000	0.45895	1.849000	0.39318	0.137000	0.18759	0.528000	0.53228	TCA	DMRTA1	-	NULL	ENSG00000176399		0.448	DMRTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTA1	HGNC	protein_coding	OTTHUMT00000051935.2	161	0.00	0	T			22451752	22451752	+1	no_errors	ENST00000325870	ensembl	human	known	69_37n	missense	130	17.72	28	SNP	1.000	C
DNA2	1763	genome.wustl.edu	37	10	70190364	70190364	+	Silent	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr10:70190364G>A	ENST00000358410.3	-	14	2087	c.2037C>T	c.(2035-2037)caC>caT	p.H679H	DNA2_ENST00000399179.2_Intron|DNA2_ENST00000399180.2_Silent_p.H765H	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	679	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)	p.H765H(1)|p.H679H(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						CAACAGCAGAGTGTGTATAGC	0.353																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											60.0	56.0	57.0					10																	70190364		1824	4082	5906	-	-	-	SO:0001819	synonymous_variant	0			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2037C>T	10.37:g.70190364G>A			Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	NULL	p.L1F	ENST00000358410.3	37	c.1		10	.	.	.	.	.	.	.	.	.	.	G	8.863	0.947360	0.18356	.	.	ENSG00000138346	ENST00000440722	.	.	.	5.34	1.23	0.21249	.	.	.	.	.	T	0.55593	0.1930	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46610	-0.9179	4	.	.	.	.	8.3016	0.32017	0.3269:0.0:0.6731:0.0	.	.	.	.	F	1	.	.	L	-	1	0	DNA2	69860370	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.458000	0.21892	0.207000	0.20607	0.650000	0.86243	CTC	DNA2	-	NULL	ENSG00000138346		0.353	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	HGNC	protein_coding	OTTHUMT00000048334.2	130	0.00	0	G			70190364	70190364	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000440722	ensembl	human	putative	69_37n	missense	116	13.43	18	SNP	1.000	A
DNAH2	146754	genome.wustl.edu	37	17	7708622	7708622	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:7708622G>A	ENST00000572933.1	+	61	10813	c.9353G>A	c.(9352-9354)cGg>cAg	p.R3118Q	DNAH2_ENST00000389173.2_Missense_Mutation_p.R3118Q			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3118	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R3118Q(1)		NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCTTATGGACGGCCCCCAGCC	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	105.0	105.0					17																	7708622		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.9353G>A	17.37:g.7708622G>A	ENSP00000458355:p.Arg3118Gln		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.R3118Q	ENST00000572933.1	37	c.9353	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372481	0.82573	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.74106	-0.81	5.52	5.52	0.82312	Dynein heavy chain, coiled coil stalk (1);	0.061993	0.64402	D	0.000004	T	0.74566	0.3733	M	0.64997	1.995	0.80722	D	1	P;P	0.43412	0.769;0.806	B;B	0.40782	0.165;0.34	T	0.77432	-0.2590	10	0.52906	T	0.07	.	18.2114	0.89871	0.0:0.0:1.0:0.0	.	3079;3118	Q9P225-2;Q9P225	.;DYH2_HUMAN	Q	3079;3118	ENSP00000373825:R3118Q	ENSP00000353818:R3079Q	R	+	2	0	DNAH2	7649347	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.548000	0.90669	2.605000	0.88082	0.591000	0.81541	CGG	DNAH2	-	NULL	ENSG00000183914		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	100	0.98	1	G	NM_020877		7708622	7708622	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	missense	36	60.00	54	SNP	1.000	A
DYTN	391475	genome.wustl.edu	37	2	207557962	207557962	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr2:207557962G>A	ENST00000452335.2	-	9	1033	c.917C>T	c.(916-918)gCg>gTg	p.A306V		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	306						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.A306V(2)		breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		CTGCCTTCTCGCTGCTTCTTT	0.547																																						dbGAP											2	Substitution - Missense(2)	breast(2)											68.0	69.0	69.0					2																	207557962		2014	4203	6217	-	-	-	SO:0001583	missense	0			ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.917C>T	2.37:g.207557962G>A	ENSP00000396593:p.Ala306Val			Missense_Mutation	SNP	pfam_EF-hand_dom_typ2,pfam_EF-hand_dom_typ1,pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	p.A306V	ENST00000452335.2	37	c.917	CCDS46502.1	2	.	.	.	.	.	.	.	.	.	.	G	7.875	0.729077	0.15507	.	.	ENSG00000232125	ENST00000452335	T	0.15017	2.46	5.09	-8.24	0.01029	.	.	.	.	.	T	0.04679	0.0127	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.35151	-0.9800	9	0.27082	T	0.32	6.9582	2.6082	0.04884	0.2448:0.0863:0.4455:0.2234	.	306	A2CJ06	DYTN_HUMAN	V	306	ENSP00000396593:A306V	ENSP00000396593:A306V	A	-	2	0	DYTN	207266207	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.167000	0.09940	-1.105000	0.03011	-1.056000	0.02311	GCG	DYTN	-	NULL	ENSG00000232125		0.547	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYTN	HGNC	protein_coding	OTTHUMT00000336799.1	108	0.00	0	G			207557962	207557962	-1	no_errors	ENST00000452335	ensembl	human	known	69_37n	missense	78	22.00	22	SNP	0.000	A
ELP5	23587	genome.wustl.edu	37	17	7162022	7162022	+	Intron	SNP	C	C	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:7162022C>G	ENST00000396628.2	+	6	952				ELP5_ENST00000356683.2_Missense_Mutation_p.A252G|RP1-4G17.5_ENST00000577138.1_Intron|ELP5_ENST00000396627.2_Intron|ELP5_ENST00000354429.2_Intron|ELP5_ENST00000574993.1_Missense_Mutation_p.A252G	NM_203414.1	NP_981959.1	Q8TE02	ELP5_HUMAN	elongator acetyltransferase complex subunit 5						chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Elongator holoenzyme complex (GO:0033588)|nucleus (GO:0005634)		p.A252G(1)									AATGCCAAGGCCAGAACAAGG	0.532																																						dbGAP											1	Substitution - Missense(1)	breast(1)											97.0	106.0	103.0					17																	7162022		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC002762	CCDS11094.1, CCDS11095.1	17p13.1	2012-08-14	2012-08-08	2012-08-08	ENSG00000170291	ENSG00000170291		"""Elongator acetyltransferase complex subunits"""	30617	protein-coding gene	gene with protein product	"""dermal papilla derived protein 6"", ""S-phase 2 protein"""	615019	"""chromosome 17 open reading frame 81"""	C17orf81		22854966	Standard	NM_203415		Approved	DERP6	uc002gfi.1	Q8TE02	OTTHUMG00000177974	ENST00000396628.2:c.735+20C>G	17.37:g.7162022C>G			A8K1M5|D3DTN9|Q659B6|Q7Z2T4|Q8TDR9|Q9BUB2|Q9Y2Q4	Missense_Mutation	SNP	pfam_Histone_acetylation_protein_2	p.A252G	ENST00000396628.2	37	c.755	CCDS11094.1	17	.	.	.	.	.	.	.	.	.	.	C	15.35	2.808864	0.50421	.	.	ENSG00000170291	ENST00000356683	T	0.50548	0.74	4.38	-0.788	0.10939	.	.	.	.	.	T	0.27098	0.0664	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.21143	-1.0254	7	.	.	.	.	6.8257	0.23883	0.4187:0.409:0.1723:0.0	.	252	A8K1M5	.	G	252	ENSP00000349111:A252G	.	A	+	2	0	C17orf81	7102746	0.000000	0.05858	0.007000	0.13788	0.066000	0.16364	0.199000	0.17237	0.106000	0.17784	0.453000	0.30009	GCC	ELP5	-	NULL	ENSG00000170291		0.532	ELP5-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ELP5	HGNC	protein_coding	OTTHUMT00000440111.1	104	0.00	0	C	NM_015362		7162022	7162022	+1	no_errors	ENST00000356683	ensembl	human	known	69_37n	missense	51	50.00	51	SNP	0.000	G
PDXDC2P	283970	genome.wustl.edu	37	16	70010517	70010519	+	RNA	DEL	TGT	TGT	-	rs372253115		TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	TGT	TGT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr16:70010517_70010519delTGT	ENST00000531894.1	-	0	3864_3866				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.Q253delQ(2)									AGTTATAGAATGTTGTTGAGTTG	0.507																																						dbGAP											2	Deletion - In frame(2)	breast(2)																																								-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70010520_70010522delTGT			A8K9Z5	In_Frame_Del	DEL	pfam_NPIP	p.Q253in_frame_del	ENST00000531894.1	37	c.761_759		16																																																																																			RP11-419C5.2	-	pfam_NPIP	ENSG00000226232		0.507	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	14	0.00	0	TGT			70010517	70010519	-1	no_errors	ENST00000532298	ensembl	human	novel	69_37n	in_frame_del	7	36.36	4	DEL	0.600:0.610:0.620	-
FNDC7	163479	genome.wustl.edu	37	1	109273351	109273351	+	Missense_Mutation	SNP	C	C	G	rs76462144	byFrequency	TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr1:109273351C>G	ENST00000370017.3	+	9	1957	c.1680C>G	c.(1678-1680)aaC>aaG	p.N560K	FNDC7_ENST00000271311.2_Missense_Mutation_p.N561K	NM_001144937.1	NP_001138409.1	Q5VTL7	FNDC7_HUMAN	fibronectin type III domain containing 7	560	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|skin(4)|stomach(1)|urinary_tract(1)	20		all_lung(203;0.00439)|Lung NSC(277;0.00683)|all_epithelial(167;0.00728)		Colorectal(144;0.0314)|Lung(183;0.0924)|COAD - Colon adenocarcinoma(174;0.119)|Epithelial(280;0.173)|all cancers(265;0.244)		CAGTAATCAACGTGAGCTGGA	0.453																																						dbGAP											0													151.0	133.0	139.0					1																	109273351		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS44185.1	1p13.3	2013-02-11			ENSG00000143107	ENSG00000143107		"""Fibronectin type III domain containing"""	26668	protein-coding gene	gene with protein product						12477932	Standard	NM_001144937		Approved	FLJ35838	uc001dvx.3	Q5VTL7	OTTHUMG00000011120	ENST00000370017.3:c.1680C>G	1.37:g.109273351C>G	ENSP00000359034:p.Asn560Lys		A1L468|E9PAZ5|Q6PF16|Q8NA51	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.N561K	ENST00000370017.3	37	c.1683	CCDS44185.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.24|19.24	3.789632|3.789632	0.70337|0.70337	.|.	.|.	ENSG00000143107|ENSG00000143107	ENST00000370017;ENST00000271311|ENST00000445274	D;D|.	0.99220|.	-5.58;-5.58|.	6.05|6.05	-0.336|-0.336	0.12658|0.12658	Fibronectin, type III (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.58337|0.58337	0.2115|0.2115	M|M	0.72894|0.72894	2.215|2.215	0.48135|0.48135	D|D	0.999595|0.999595	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.998|.	T|T	0.62300|0.62300	-0.6883|-0.6883	10|5	0.05833|.	T|.	0.94|.	-25.7874|-25.7874	12.6633|12.6633	0.56826|0.56826	0.0:0.563:0.0:0.437|0.0:0.563:0.0:0.437	.|.	561;560|.	Q5VTL7;E9PAZ5|.	FNDC7_HUMAN;.|.	K|G	560;561|336	ENSP00000359034:N560K;ENSP00000271311:N561K|.	ENSP00000271311:N561K|.	N|R	+|+	3|1	2|0	FNDC7|FNDC7	109074874|109074874	0.002000|0.002000	0.14202|0.14202	0.998000|0.998000	0.56505|0.56505	0.989000|0.989000	0.77384|0.77384	-1.351000|-1.351000	0.02622|0.02622	0.023000|0.023000	0.15187|0.15187	0.655000|0.655000	0.94253|0.94253	AAC|CGT	FNDC7	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000143107		0.453	FNDC7-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FNDC7	HGNC	protein_coding	OTTHUMT00000030589.4	127	0.00	0	C	NM_173532		109273351	109273351	+1	no_errors	ENST00000271311	ensembl	human	known	69_37n	missense	108	14.29	18	SNP	0.996	G
FLG	2312	genome.wustl.edu	37	1	152278649	152278649	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr1:152278649C>G	ENST00000368799.1	-	3	8748	c.8713G>C	c.(8713-8715)Gag>Cag	p.E2905Q	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2905	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.E2905Q(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCACCTCTCAGAGTCTTCT	0.567									Ichthyosis																													dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	178.0	156.0					1																	152278649		2027	4296	6323	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8713G>C	1.37:g.152278649C>G	ENSP00000357789:p.Glu2905Gln		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.E2905Q	ENST00000368799.1	37	c.8713	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	7.269	0.606716	0.14002	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.01516	4.81	2.41	-3.15	0.05233	.	.	.	.	.	T	0.00666	0.0022	L	0.48362	1.52	0.09310	N	1	B	0.14805	0.011	B	0.12156	0.007	T	0.35847	-0.9772	9	0.25751	T	0.34	.	12.2041	0.54342	0.0:0.2772:0.7228:0.0	.	2905	P20930	FILA_HUMAN	Q	2905;167	ENSP00000357789:E2905Q	ENSP00000357786:E167Q	E	-	1	0	FLG	150545273	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.732000	0.04904	-0.703000	0.05049	-0.840000	0.03056	GAG	FLG	-	NULL	ENSG00000143631		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	304	0.33	1	C	NM_002016		152278649	152278649	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	333	21.65	92	SNP	0.000	G
GNL3	26354	genome.wustl.edu	37	3	52726938	52726938	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:52726938C>T	ENST00000418458.1	+	10	1093	c.920C>T	c.(919-921)cCg>cTg	p.P307L	SNORD69_ENST00000391150.1_RNA|SNORD19_ENST00000410413.1_RNA|GNL3_ENST00000394799.2_Missense_Mutation_p.P295L|SNORD19B_ENST00000459623.1_RNA|GLT8D1_ENST00000463827.1_5'Flank	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	307	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.|Intermediate. {ECO:0000250}.				cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.P307L(1)		breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		ATAGATAGTCCGAGCTTCATC	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											160.0	146.0	151.0					3																	52726938		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.920C>T	3.37:g.52726938C>T	ENSP00000395772:p.Pro307Leu		B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Missense_Mutation	SNP	pfam_Gnl3_N_dom,pfam_GTP_binding_domain	p.P307L	ENST00000418458.1	37	c.920	CCDS2861.1	3	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532737	0.85812	.	.	ENSG00000163938	ENST00000418458;ENST00000394799	T;T	0.34667	1.35;1.35	5.91	5.91	0.95273	GTP-binding domain, HSR1-related (1);	0.000000	0.85682	D	0.000000	T	0.76716	0.4026	H	0.98646	4.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85527	0.1207	10	0.87932	D	0	.	18.4823	0.90817	0.0:1.0:0.0:0.0	.	307	Q9BVP2	GNL3_HUMAN	L	307;295	ENSP00000395772:P307L;ENSP00000378278:P295L	ENSP00000378278:P295L	P	+	2	0	GNL3	52701978	1.000000	0.71417	0.461000	0.27105	0.455000	0.32408	6.931000	0.75863	2.799000	0.96334	0.650000	0.86243	CCG	GNL3	-	pfam_GTP_binding_domain	ENSG00000163938		0.478	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3	HGNC	protein_coding	OTTHUMT00000352032.1	93	0.00	0	C	NM_014366		52726938	52726938	+1	no_errors	ENST00000418458	ensembl	human	known	69_37n	missense	72	25.00	24	SNP	1.000	T
GLT8D1	55830	genome.wustl.edu	37	3	52729961	52729961	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:52729961G>A	ENST00000407584.3	-	8	1478	c.628C>T	c.(628-630)Cgt>Tgt	p.R210C	GLT8D1_ENST00000266014.5_Missense_Mutation_p.R210C|GLT8D1_ENST00000491606.1_Missense_Mutation_p.R210C|GLT8D1_ENST00000478968.2_Missense_Mutation_p.R210C|GLT8D1_ENST00000394783.3_Missense_Mutation_p.R210C|GLT8D1_ENST00000463827.1_5'UTR	NM_001010983.1|NM_001278280.1	NP_001010983.1|NP_001265209.1	Q68CQ7	GL8D1_HUMAN	glycosyltransferase 8 domain containing 1	210			R -> H (in dbSNP:rs2276812). {ECO:0000269|Ref.7}.			integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)	p.R210C(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(3)	8				BRCA - Breast invasive adenocarcinoma(193;6.78e-05)|Kidney(197;0.000618)|KIRC - Kidney renal clear cell carcinoma(197;0.000779)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCTGCTCCACGGATGACAACT	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	97.0	99.0					3																	52729961		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358579	CCDS2862.1	3p21.1	2013-02-22			ENSG00000016864	ENSG00000016864		"""Glycosyltransferase family 8 domain containing"""	24870	protein-coding gene	gene with protein product						12975309	Standard	NM_152932		Approved	AD-017, FLJ14611	uc003dfi.4	Q68CQ7	OTTHUMG00000158759	ENST00000407584.3:c.628C>T	3.37:g.52729961G>A	ENSP00000385730:p.Arg210Cys		Q7Z4D1|Q8N2J6|Q9P0I5	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.R210C	ENST00000407584.3	37	c.628	CCDS2862.1	3	.	.	.	.	.	.	.	.	.	.	G	23.3	4.393752	0.83011	.	.	ENSG00000016864	ENST00000478968;ENST00000394783;ENST00000407584;ENST00000266014;ENST00000491606;ENST00000394786	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.94	5.94	0.96194	.	0.052462	0.85682	D	0.000000	T	0.70885	0.3275	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.67231	0.95;0.95	T	0.71056	-0.4703	10	0.56958	D	0.05	-11.6179	20.3594	0.98849	0.0:0.0:1.0:0.0	.	210;210	Q68CQ7-2;Q68CQ7	.;GL8D1_HUMAN	C	210;210;210;210;210;41	ENSP00000419612:R210C;ENSP00000378263:R210C;ENSP00000385730:R210C;ENSP00000266014:R210C;ENSP00000418853:R210C	ENSP00000266014:R210C	R	-	1	0	GLT8D1	52705001	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.195000	0.65131	2.816000	0.96949	0.563000	0.77884	CGT	GLT8D1	-	pfam_Glyco_trans_8	ENSG00000016864		0.428	GLT8D1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D1	HGNC	protein_coding	OTTHUMT00000352065.3	110	0.00	0	G	NM_152932		52729961	52729961	-1	no_errors	ENST00000266014	ensembl	human	known	69_37n	missense	94	18.26	21	SNP	1.000	A
GRAMD1B	57476	genome.wustl.edu	37	11	123479407	123479407	+	Silent	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr11:123479407G>A	ENST00000529750.1	+	11	1452	c.1125G>A	c.(1123-1125)caG>caA	p.Q375Q	GRAMD1B_ENST00000322282.7_Silent_p.Q375Q|GRAMD1B_ENST00000450171.2_Silent_p.Q66Q|GRAMD1B_ENST00000456860.2_Silent_p.Q382Q	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	375						integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.Q375Q(2)		NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GTGGCCGGCAGTACGTGAATG	0.582																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											55.0	59.0	58.0					11																	123479407		2055	4182	6237	-	-	-	SO:0001819	synonymous_variant	0			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1125G>A	11.37:g.123479407G>A			Q6UW85|Q9ULL9	Silent	SNP	pfam_GRAM,smart_GRAM	p.Q375	ENST00000529750.1	37	c.1125	CCDS53720.1	11																																																																																			GRAMD1B	-	NULL	ENSG00000023171		0.582	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRAMD1B	HGNC	protein_coding	OTTHUMT00000387404.2	86	0.00	0	G	XM_370660		123479407	123479407	+1	no_errors	ENST00000322282	ensembl	human	known	69_37n	silent	14	66.67	28	SNP	1.000	A
HECTD1	25831	genome.wustl.edu	37	14	31675003	31675003	+	Splice_Site	SNP	G	G	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr14:31675003G>C	ENST00000399332.1	-	2	628	c.140C>G	c.(139-141)aCa>aGa	p.T47R	HECTD1_ENST00000556474.1_5'UTR|HECTD1_ENST00000553700.1_Splice_Site_p.T47R	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	47					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)	p.T47R(1)		breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		ATGTACTTACGTTTCAAAACA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											163.0	150.0	155.0					14																	31675003		1984	4162	6146	-	-	-	SO:0001630	splice_region_variant	0			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.140+1C>G	14.37:g.31675003G>C			D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	pfam_HECT,pfam_Sad1_UNC_C,pfam_Mib_Herc2,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,superfamily_Galactose-bd-like,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT	p.T47R	ENST00000399332.1	37	c.140	CCDS41939.1	14	.	.	.	.	.	.	.	.	.	.	G	24.7	4.561278	0.86335	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000556224	T;T;T	0.28666	1.6;1.6;1.6	5.93	5.93	0.95920	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.35038	0.0918	N	0.04508	-0.205	0.80722	D	1	D	0.71674	0.998	D	0.74348	0.983	T	0.41466	-0.9507	9	.	.	.	-15.1618	20.3368	0.98748	0.0:0.0:1.0:0.0	.	47	Q9ULT8	HECD1_HUMAN	R	47	ENSP00000450697:T47R;ENSP00000382269:T47R;ENSP00000452015:T47R	.	T	-	2	0	HECTD1	30744754	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.444000	0.97578	2.805000	0.96524	0.655000	0.94253	ACA	HECTD1	-	superfamily_ARM-type_fold	ENSG00000092148		0.408	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD1	HGNC	protein_coding	OTTHUMT00000409942.1	116	0.00	0	G		Missense_Mutation	31675003	31675003	-1	no_errors	ENST00000399332	ensembl	human	known	69_37n	missense	59	34.07	31	SNP	1.000	C
HIST1H4L	8368	genome.wustl.edu	37	6	27841182	27841182	+	Missense_Mutation	SNP	C	C	T	rs200857174		TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr6:27841182C>T	ENST00000355981.2	-	1	107	c.107G>A	c.(106-108)cGa>cAa	p.R36Q	HIST1H3I_ENST00000328488.2_5'Flank	NM_003546.2	NP_003537.1	P62805	H4_HUMAN	histone cluster 1, H4l	36					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.R36Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	13						TGCCAGGCGTCGGATGGCGGG	0.587																																						dbGAP											1	Substitution - Missense(1)	breast(1)											73.0	64.0	67.0					6																	27841182		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83548	CCDS4637.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198558	ENSG00000275126		"""Histones / Replication-dependent"""	4791	protein-coding gene	gene with protein product		602831	"""H4 histone family, member K"", ""histone 1, H4l"""	H4FK		9031620, 9439656, 12408966	Standard	NM_003546		Approved	H4.k, H4/k	uc003njz.3	P62805	OTTHUMG00000016211	ENST00000355981.2:c.107G>A	6.37:g.27841182C>T	ENSP00000348258:p.Arg36Gln		A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.R36Q	ENST00000355981.2	37	c.107	CCDS4637.1	6	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846321	0.71603	.	.	ENSG00000198558	ENST00000355981	T	0.67523	-0.27	4.52	3.62	0.41486	.	0.000000	0.64402	D	0.000003	T	0.69628	0.3132	.	.	.	0.46078	D	0.998855	.	.	.	.	.	.	T	0.75258	-0.3381	7	0.87932	D	0	.	13.1523	0.59496	0.1615:0.8385:0.0:0.0	.	.	.	.	Q	36	ENSP00000348258:R36Q	ENSP00000348258:R36Q	R	-	2	0	HIST1H4L	27949161	1.000000	0.71417	0.828000	0.32881	0.055000	0.15305	7.350000	0.79385	1.155000	0.42497	0.655000	0.94253	CGA	HIST1H4L	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000198558		0.587	HIST1H4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4L	HGNC	protein_coding	OTTHUMT00000043513.1	66	0.00	0	C	NM_003546		27841182	27841182	-1	no_errors	ENST00000355981	ensembl	human	known	69_37n	missense	71	17.44	15	SNP	1.000	T
HIVEP3	59269	genome.wustl.edu	37	1	42048715	42048715	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr1:42048715C>T	ENST00000372583.1	-	4	2639	c.1754G>A	c.(1753-1755)cGg>cAg	p.R585Q	HIVEP3_ENST00000429157.2_Missense_Mutation_p.R585Q|HIVEP3_ENST00000247584.5_Missense_Mutation_p.R585Q|HIVEP3_ENST00000372584.1_Missense_Mutation_p.R585Q	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	585	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R585Q(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CTTCAGCATCCGGGGGTGGGA	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	52.0	51.0					1																	42048715		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.1754G>A	1.37:g.42048715C>T	ENSP00000361664:p.Arg585Gln		A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R585Q	ENST00000372583.1	37	c.1754	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.507887	0.85282	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	4.64	4.64	0.57946	.	0.000000	0.47852	D	0.000202	T	0.53530	0.1802	M	0.79614	2.46	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	T	0.59768	-0.7392	10	0.72032	D	0.01	-4.1011	17.2751	0.87113	0.0:1.0:0.0:0.0	.	585;585	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	Q	585	ENSP00000361665:R585Q;ENSP00000361664:R585Q;ENSP00000247584:R585Q;ENSP00000410828:R585Q	ENSP00000247584:R585Q	R	-	2	0	HIVEP3	41821302	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.408000	0.81797	0.561000	0.74099	CGG	HIVEP3	-	NULL	ENSG00000127124		0.597	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	45	0.00	0	C	NM_024503		42048715	42048715	-1	no_errors	ENST00000247584	ensembl	human	known	69_37n	missense	285	22.49	83	SNP	1.000	T
HN1	51155	genome.wustl.edu	37	17	73132265	73132265	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:73132265C>A	ENST00000409753.3	-	5	682	c.397G>T	c.(397-399)Gtg>Ttg	p.V133L	HN1_ENST00000482348.1_Missense_Mutation_p.V87L|HN1_ENST00000392566.2_Missense_Mutation_p.V87L|HN1_ENST00000405458.3_Missense_Mutation_p.V87L|HN1_ENST00000470924.1_Missense_Mutation_p.V87L|HN1_ENST00000476258.1_Missense_Mutation_p.V87L|HN1_ENST00000481647.1_Missense_Mutation_p.V87L|HN1_ENST00000356033.4_Silent_p.R126R|RP11-649A18.5_ENST00000584339.1_RNA	NM_016185.2	NP_057269.1	Q9UK76	HN1_HUMAN	hematological and neurological expressed 1	133					developmental process (GO:0032502)	nucleus (GO:0005634)		p.R126R(1)|p.V133L(1)	HN1/USH1G(2)	breast(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)					GCCGGGGCCACCGGGCTGGGC	0.597																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	breast(2)											48.0	52.0	51.0					17																	73132265		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086910	CCDS32729.1, CCDS45771.1, CCDS45772.1	17q25.1	2013-09-20			ENSG00000189159	ENSG00000189159			14569	protein-coding gene	gene with protein product	"""androgen-regulated protein 2"""					15094197	Standard	NM_001002032		Approved	ARM2, HN1A	uc002jnb.1	Q9UK76	OTTHUMG00000154521	ENST00000409753.3:c.397G>T	17.37:g.73132265C>A	ENSP00000387059:p.Val133Leu		B2R6K3|Q53FG7|Q7Z2D2|Q7Z2F0	Missense_Mutation	SNP	NULL	p.V133L	ENST00000409753.3	37	c.397	CCDS45771.1	17	.	.	.	.	.	.	.	.	.	.	C	27.4	4.832418	0.91036	.	.	ENSG00000189159	ENST00000405458;ENST00000409753;ENST00000392566	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	T	0.80127	0.4566	.	.	.	0.40815	D	0.983454	D	0.61697	0.99	D	0.75484	0.986	T	0.81745	-0.0792	7	0.56958	D	0.05	4.4765	17.8012	0.88587	0.0:1.0:0.0:0.0	.	133	Q9UK76	HN1_HUMAN	L	87;133;87	.	ENSP00000440912:V87L	V	-	1	0	HN1	70643860	0.995000	0.38212	0.930000	0.37139	0.989000	0.77384	3.499000	0.53310	2.624000	0.88883	0.643000	0.83706	GTG	HN1	-	NULL	ENSG00000189159		0.597	HN1-001	KNOWN	basic|CCDS	protein_coding	HN1	HGNC	protein_coding	OTTHUMT00000335692.1	21	0.00	0	C	NM_001002032		73132265	73132265	-1	no_errors	ENST00000409753	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.987	A
HPGDS	27306	genome.wustl.edu	37	4	95223325	95223325	+	Missense_Mutation	SNP	C	C	A	rs143378969	byFrequency	TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr4:95223325C>A	ENST00000295256.5	-	5	497	c.407G>T	c.(406-408)gGg>gTg	p.G136V	HPGDS_ENST00000514774.1_5'Flank	NM_014485.2	NP_055300.1	O60760	HPGDS_HUMAN	hematopoietic prostaglandin D synthase	136	GST C-terminal.				arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|glutathione derivative biosynthetic process (GO:1901687)|locomotory behavior (GO:0007626)|prostaglandin metabolic process (GO:0006693)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	calcium ion binding (GO:0005509)|glutathione transferase activity (GO:0004364)|magnesium ion binding (GO:0000287)|prostaglandin-D synthase activity (GO:0004667)|protein homodimerization activity (GO:0042803)	p.G136V(1)		breast(1)|cervix(1)|lung(3)|ovary(1)|urinary_tract(1)	7					Glutathione(DB00143)	TTCTCTCCCCCCTAAATATGT	0.353																																					Colon(86;1802 1843 17863 46794)	dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	157.0	155.0					4																	95223325		2203	4299	6502	-	-	-	SO:0001583	missense	0			D82073	CCDS3640.1	4q22.2	2012-06-21			ENSG00000163106	ENSG00000163106		"""Glutathione S-transferases / Soluble"""	17890	protein-coding gene	gene with protein product	"""glutathione S-transferase sigma"""	602598				9323136, 9353279, 11672424	Standard	XM_005262932		Approved	GSTS, PGDS, H-PGDS, PGD2, GSTS1-1	uc003hte.1	O60760	OTTHUMG00000130974	ENST00000295256.5:c.407G>T	4.37:g.95223325C>A	ENSP00000295256:p.Gly136Val		Q6FHT9	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.G136V	ENST00000295256.5	37	c.407	CCDS3640.1	4	.	.	.	.	.	.	.	.	.	.	C	12.55	1.973099	0.34848	.	.	ENSG00000163106	ENST00000295256	T	0.02015	4.5	5.49	2.7	0.31948	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.177955	0.38058	N	0.001836	T	0.05868	0.0153	M	0.75264	2.295	0.80722	D	1	P	0.43909	0.821	P	0.47430	0.547	T	0.14392	-1.0474	10	0.66056	D	0.02	.	9.5829	0.39499	0.0:0.6575:0.268:0.0745	.	136	O60760	HPGDS_HUMAN	V	136	ENSP00000295256:G136V	ENSP00000295256:G136V	G	-	2	0	HPGDS	95442348	0.960000	0.32886	0.597000	0.28824	0.078000	0.17371	2.124000	0.42006	0.705000	0.31890	-0.216000	0.12614	GGG	HPGDS	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000163106		0.353	HPGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPGDS	HGNC	protein_coding	OTTHUMT00000253587.1	145	0.00	0	C	NM_014485		95223325	95223325	-1	no_errors	ENST00000295256	ensembl	human	known	69_37n	missense	102	39.29	66	SNP	0.723	A
IGSF22	283284	genome.wustl.edu	37	11	18733928	18733928	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr11:18733928C>T	ENST00000513874.1	-	15	2238	c.2099G>A	c.(2098-2100)cGt>cAt	p.R700H	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	700								p.R700H(1)		NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						AGGCTTTGGACGGTCTGGGGA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	38.0	38.0					11																	18733928		692	1591	2283	-	-	-	SO:0001583	missense	0			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.2099G>A	11.37:g.18733928C>T	ENSP00000421191:p.Arg700His		A6NNA0|D6RGV7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R700H	ENST00000513874.1	37	c.2099	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	c	10.96	1.498032	0.26861	.	.	ENSG00000179057	ENST00000513874	T	0.44083	0.93	3.9	-2.04	0.07343	.	.	.	.	.	T	0.40694	0.1127	M	0.86268	2.805	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44651	-0.9314	9	0.51188	T	0.08	.	3.3718	0.07224	0.2781:0.3539:0.0:0.368	.	700	D6RGV7	.	H	700	ENSP00000421191:R700H	ENSP00000421191:R700H	R	-	2	0	IGSF22	18690504	0.000000	0.05858	0.002000	0.10522	0.507000	0.33981	-0.343000	0.07791	-0.679000	0.05217	0.550000	0.68814	CGT	IGSF22	-	superfamily_Fibronectin_type3	ENSG00000179057		0.567	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	74	0.00	0	C	NM_173588		18733928	18733928	-1	no_errors	ENST00000513874	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	0.591	T
KCND2	3751	genome.wustl.edu	37	7	119915032	119915032	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr7:119915032G>A	ENST00000331113.4	+	1	1311	c.346G>A	c.(346-348)Gat>Aat	p.D116N		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	116					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.D116N(1)		NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CTCTGCTTACGATGAAGAACT	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	146.0	146.0					7																	119915032		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.346G>A	7.37:g.119915032G>A	ENSP00000333496:p.Asp116Asn		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.D116N	ENST00000331113.4	37	c.346	CCDS5776.1	7	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082422	0.76528	.	.	ENSG00000184408	ENST00000331113	T	0.41400	1.0	5.71	5.71	0.89125	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.41282	0.1152	L	0.49256	1.55	0.80722	D	1	P	0.35481	0.504	B	0.33521	0.165	T	0.16070	-1.0415	9	.	.	.	.	19.8677	0.96824	0.0:0.0:1.0:0.0	.	116	Q9NZV8	KCND2_HUMAN	N	116	ENSP00000333496:D116N	.	D	+	1	0	KCND2	119702268	1.000000	0.71417	0.976000	0.42696	0.983000	0.72400	9.869000	0.99810	2.709000	0.92574	0.655000	0.94253	GAT	KCND2	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv3	ENSG00000184408		0.542	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	36	0.00	0	G	NM_012281		119915032	119915032	+1	no_errors	ENST00000331113	ensembl	human	known	69_37n	missense	22	17.86	5	SNP	1.000	A
KIAA0368	23392	genome.wustl.edu	37	9	114156470	114156470	+	Silent	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr9:114156470G>A	ENST00000338205.5	-	25	3111	c.2892C>T	c.(2890-2892)gtC>gtT	p.V964V	KIAA0368_ENST00000374378.3_5'UTR|KIAA0368_ENST00000259335.4_Silent_p.V1142V			Q5VYK3	ECM29_HUMAN	KIAA0368	970					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)		p.V1142V(1)		NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						TTAGCTTCCTGACAAGGGAAA	0.463																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											59.0	59.0	59.0					9																	114156470		1975	4173	6148	-	-	-	SO:0001819	synonymous_variant	0			AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.2892C>T	9.37:g.114156470G>A			O15074|Q8WU82	Silent	SNP	superfamily_ARM-type_fold	p.V1142	ENST00000338205.5	37	c.3426		9																																																																																			KIAA0368	-	superfamily_ARM-type_fold	ENSG00000136813		0.463	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	KIAA0368	HGNC	protein_coding	OTTHUMT00000053637.2	142	0.00	0	G	NM_014686		114156470	114156470	-1	no_errors	ENST00000259335	ensembl	human	known	69_37n	silent	62	42.06	45	SNP	1.000	A
KIF1B	23095	genome.wustl.edu	37	1	10355754	10355754	+	Silent	SNP	A	A	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr1:10355754A>T	ENST00000377086.1	+	19	1909	c.1707A>T	c.(1705-1707)atA>atT	p.I569I	KIF1B_ENST00000263934.6_Silent_p.I523I|KIF1B_ENST00000377093.4_Silent_p.I523I|KIF1B_ENST00000377083.1_Silent_p.I523I|KIF1B_ENST00000377081.1_Silent_p.I569I			O60333	KIF1B_HUMAN	kinesin family member 1B	569	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)	p.I523I(2)		breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GCCAGGACATAGTGCTGAGCG	0.512																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											83.0	88.0	86.0					1																	10355754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1707A>T	1.37:g.10355754A>T			A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I523	ENST00000377086.1	37	c.1569		1																																																																																			KIF1B	-	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	ENSG00000054523		0.512	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	75	0.00	0	A			10355754	10355754	+1	no_errors	ENST00000263934	ensembl	human	known	69_37n	silent	37	19.57	9	SNP	0.989	T
MYH15	22989	genome.wustl.edu	37	3	108220616	108220616	+	Silent	SNP	G	G	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:108220616G>C	ENST00000273353.3	-	4	398	c.342C>G	c.(340-342)ctC>ctG	p.L114L		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	114	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.L114L(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						ATGCCTCATTGAGGTGAGTCA	0.468																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											126.0	127.0	127.0					3																	108220616		2055	4239	6294	-	-	-	SO:0001819	synonymous_variant	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.342C>G	3.37:g.108220616G>C				Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.L114	ENST00000273353.3	37	c.342	CCDS43127.1	3																																																																																			MYH15	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000144821		0.468	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	94	0.00	0	G	XM_036988		108220616	108220616	-1	no_errors	ENST00000273353	ensembl	human	known	69_37n	silent	96	16.52	19	SNP	0.997	C
NLRC4	58484	genome.wustl.edu	37	2	32476335	32476335	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr2:32476335C>A	ENST00000404025.2	-	5	1086	c.598G>T	c.(598-600)Gtc>Ttc	p.V200F	NLRC4_ENST00000402280.1_Missense_Mutation_p.V200F|NLRC4_ENST00000360906.5_Missense_Mutation_p.V200F|NLRC4_ENST00000342905.6_Intron			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	200	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.|Nucleotide-binding domain (NBD). {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)	p.V200F(1)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGGAAGAAGACGAATTTGAAC	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	69.0	69.0					2																	32476335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.598G>T	2.37:g.32476335C>A	ENSP00000385090:p.Val200Phe		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_NACHT_NTPase,pfscan_CARD	p.V200F	ENST00000404025.2	37	c.598	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	C	12.91	2.079956	0.36662	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.22945	1.93;1.93;1.93	3.27	3.27	0.37495	NACHT nucleoside triphosphatase (1);	0.000000	0.42821	D	0.000653	T	0.48696	0.1514	M	0.71206	2.165	0.34991	D	0.754986	D	0.89917	1.0	D	0.91635	0.999	T	0.64567	-0.6377	9	0.87932	D	0	-13.2298	13.7957	0.63168	0.0:1.0:0.0:0.0	.	200	Q9NPP4	NLRC4_HUMAN	F	200	ENSP00000354159:V200F;ENSP00000385428:V200F;ENSP00000385090:V200F	ENSP00000354159:V200F	V	-	1	0	NLRC4	32329839	0.940000	0.31905	0.185000	0.23176	0.185000	0.23345	1.842000	0.39250	1.836000	0.53414	0.543000	0.68304	GTC	NLRC4	-	pfscan_NACHT_NTPase	ENSG00000091106		0.517	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	94	0.00	0	C	NM_021209		32476335	32476335	-1	no_errors	ENST00000360906	ensembl	human	known	69_37n	missense	61	14.08	10	SNP	0.982	A
NMT2	9397	genome.wustl.edu	37	10	15151734	15151734	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr10:15151734G>T	ENST00000378165.4	-	11	1523	c.1443C>A	c.(1441-1443)taC>taA	p.Y481*	NMT2_ENST00000466201.1_5'UTR|NMT2_ENST00000378150.1_Nonsense_Mutation_p.Y468*|NMT2_ENST00000535341.1_Nonsense_Mutation_p.Y468*|NMT2_ENST00000540259.1_Nonsense_Mutation_p.Y293*|RPP38_ENST00000451677.1_Intron	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	481					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)	p.Y481*(1)		breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						ACCTCCAATTGTACAGGTAAT	0.358																																					Melanoma(117;1345 1645 4130 12688 30625)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											129.0	123.0	125.0					10																	15151734		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.1443C>A	10.37:g.15151734G>T	ENSP00000367407:p.Tyr481*		B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Nonsense_Mutation	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.Y512*	ENST00000378165.4	37	c.1536	CCDS7109.1	10	.	.	.	.	.	.	.	.	.	.	G	38	7.222874	0.98146	.	.	ENSG00000152465	ENST00000441445;ENST00000378165;ENST00000378150;ENST00000378143;ENST00000540259;ENST00000535341	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.3262	10.0567	0.42250	0.15:0.0:0.85:0.0	.	.	.	.	X	45;481;468;512;293;468	.	ENSP00000367385:Y512X	Y	-	3	2	NMT2	15191740	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.494000	0.45329	2.669000	0.90835	0.655000	0.94253	TAC	NMT2	-	pfam_MyristoylCoA_TrFase_C,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	ENSG00000152465		0.358	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT2	HGNC	protein_coding	OTTHUMT00000046958.2	153	0.00	0	G	NM_004808		15151734	15151734	-1	no_errors	ENST00000378143	ensembl	human	known	69_37n	nonsense	95	29.41	40	SNP	1.000	T
NSUN7	79730	genome.wustl.edu	37	4	40810797	40810797	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr4:40810797C>G	ENST00000381782.2	+	12	2493	c.1998C>G	c.(1996-1998)atC>atG	p.I666M	NSUN7_ENST00000316607.5_3'UTR	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	666							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.I666M(1)		NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						CCCAAGGGATCAGATCTCGGA	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											128.0	111.0	116.0					4																	40810797		692	1591	2283	-	-	-	SO:0001583	missense	0			BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.1998C>G	4.37:g.40810797C>G	ENSP00000371201:p.Ile666Met		C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p	p.I666M	ENST00000381782.2	37	c.1998	CCDS3461.2	4	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544100	0.27563	.	.	ENSG00000179299	ENST00000381782	T	0.04917	3.53	5.64	4.8	0.61643	.	1.399860	0.04486	N	0.378694	T	0.08133	0.0203	N	0.19112	0.55	0.51767	D	0.999935	B	0.09022	0.002	B	0.06405	0.002	T	0.27640	-1.0068	10	0.44086	T	0.13	7.1478	16.3887	0.83524	0.0:0.8683:0.1317:0.0	.	666	Q8NE18	NSUN7_HUMAN	M	666	ENSP00000371201:I666M	ENSP00000371201:I666M	I	+	3	3	NSUN7	40505554	0.001000	0.12720	0.002000	0.10522	0.005000	0.04900	0.902000	0.28459	1.382000	0.46385	0.655000	0.94253	ATC	NSUN7	-	NULL	ENSG00000179299		0.493	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN7	HGNC	protein_coding	OTTHUMT00000250454.2	111	0.00	0	C	NM_024677		40810797	40810797	+1	no_errors	ENST00000381782	ensembl	human	known	69_37n	missense	75	23.47	23	SNP	0.023	G
NUP62	23636	genome.wustl.edu	37	19	50411501	50411501	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr19:50411501C>G	ENST00000596217.1	-	2	3451	c.1564G>C	c.(1564-1566)Gac>Cac	p.D522H	IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000422090.2_Missense_Mutation_p.D522H|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000413454.1_Missense_Mutation_p.D522H|NUP62_ENST00000597723.1_Missense_Mutation_p.D446H|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000352066.3_Missense_Mutation_p.D522H|NUP62_ENST00000597029.1_Missense_Mutation_p.D522H			P37198	NUP62_HUMAN	nucleoporin 62kDa	522					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)	p.D522H(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GTCGCTCAGTCAAAGGTGATC	0.617																																						dbGAP											1	Substitution - Missense(1)	breast(1)											39.0	36.0	37.0					19																	50411501		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.1564G>C	19.37:g.50411501C>G	ENSP00000471191:p.Asp522His		B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	pfam_Nucleoporin_NSP1_C	p.D522H	ENST00000596217.1	37	c.1564	CCDS12788.1	19	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895168	0.52121	.	.	ENSG00000213024	ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.61274	0.12;0.12;0.12	5.26	4.21	0.49690	Nucleoporin, NSP1-like, C-terminal (1);	0.153293	0.39909	U	0.001229	T	0.63260	0.2496	L	0.46157	1.445	0.43091	D	0.994767	D	0.69078	0.997	P	0.57620	0.824	T	0.62978	-0.6739	9	.	.	.	.	13.2573	0.60087	0.1602:0.8398:0.0:0.0	.	522	P37198	NUP62_HUMAN	H	522	ENSP00000305503:D522H;ENSP00000407331:D522H;ENSP00000387991:D522H	.	D	-	1	0	NUP62	55103313	0.999000	0.42202	0.901000	0.35422	0.293000	0.27360	4.022000	0.57203	1.341000	0.45600	0.655000	0.94253	GAC	NUP62	-	NULL	ENSG00000213024		0.617	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUP62	HGNC	protein_coding	OTTHUMT00000464991.1	37	0.00	0	C	NM_153719		50411501	50411501	-1	no_errors	ENST00000352066	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	0.991	G
OR5T3	390154	genome.wustl.edu	37	11	56019960	56019960	+	Silent	SNP	T	T	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr11:56019960T>C	ENST00000303059.3	+	1	285	c.285T>C	c.(283-285)gtT>gtC	p.V95V		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V95V(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					TTCTTAGTGTTTTATCATTCT	0.373																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											95.0	95.0	95.0					11																	56019960		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.285T>C	11.37:g.56019960T>C			Q6IFC7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V95	ENST00000303059.3	37	c.285	CCDS31524.1	11																																																																																			OR5T3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172489		0.373	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1	161	0.00	0	T	NM_001004747		56019960	56019960	+1	no_errors	ENST00000303059	ensembl	human	known	69_37n	silent	147	23.04	44	SNP	0.000	C
OR6K2	81448	genome.wustl.edu	37	1	158669827	158669827	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr1:158669827C>A	ENST00000359610.2	-	1	659	c.616G>T	c.(616-618)Gtg>Ttg	p.V206L		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V206L(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					ATAATCTCCACTGCATGAATG	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											170.0	135.0	147.0					1																	158669827		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.616G>T	1.37:g.158669827C>A	ENSP00000352626:p.Val206Leu		B9EH33|Q6IFR6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V206L	ENST00000359610.2	37	c.616	CCDS30902.1	1	.	.	.	.	.	.	.	.	.	.	C	1.536	-0.542968	0.04053	.	.	ENSG00000196171	ENST00000359610	T	0.34275	1.37	4.94	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.198981	0.24642	N	0.036787	T	0.04724	0.0128	N	0.05330	-0.07	0.22199	N	0.999294	B	0.17038	0.02	B	0.23150	0.044	T	0.41980	-0.9478	10	0.02654	T	1	-7.8582	8.9474	0.35767	0.0:0.8207:0.0:0.1792	.	206	Q8NGY2	OR6K2_HUMAN	L	206	ENSP00000352626:V206L	ENSP00000352626:V206L	V	-	1	0	OR6K2	156936451	0.000000	0.05858	0.986000	0.45419	0.947000	0.59692	-1.944000	0.01538	1.290000	0.44636	0.655000	0.94253	GTG	OR6K2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196171		0.488	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K2	HGNC	protein_coding	OTTHUMT00000059061.1	87	0.00	0	C	NM_001005279		158669827	158669827	-1	no_errors	ENST00000359610	ensembl	human	known	69_37n	missense	85	26.09	30	SNP	0.551	A
PCDHA12	56137	genome.wustl.edu	37	5	140256728	140256728	+	Silent	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr5:140256728C>T	ENST00000398631.2	+	1	1671	c.1671C>T	c.(1669-1671)gaC>gaT	p.D557D	PCDHA6_ENST00000527624.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	557	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D557D(1)		NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGTGCTGGACGAGAACGACA	0.701																																					Pancreas(113;759 1672 13322 24104 50104)	dbGAP											1	Substitution - coding silent(1)	breast(1)											140.0	146.0	144.0					5																	140256728		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1671C>T	5.37:g.140256728C>T			O75278|Q2M1N8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D557	ENST00000398631.2	37	c.1671	CCDS47285.1	5																																																																																			PCDHA12	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000251664		0.701	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	43	0.00	0	C	NM_018903		140256728	140256728	+1	no_errors	ENST00000398631	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	0.527	T
PEX6	5190	genome.wustl.edu	37	6	42934186	42934186	+	Splice_Site	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr6:42934186C>T	ENST00000304611.8	-	11	2164		c.e11-1		PEX6_ENST00000244546.4_Intron	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6						ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)	p.?(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			CTGAGGGGATCTAGGAGATGG	0.597																																						dbGAP											1	Unknown(1)	breast(1)											54.0	53.0	53.0					6																	42934186		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.2095-1G>A	6.37:g.42934186C>T			Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Splice_Site	SNP	-	e11-1	ENST00000304611.8	37	c.2095-1	CCDS4877.1	6	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569808	0.86439	.	.	ENSG00000124587	ENST00000304611	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9872	0.92777	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PEX6	43042164	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.487000	0.81328	2.564000	0.86499	0.563000	0.77884	.	PEX6	-	-	ENSG00000124587		0.597	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX6	HGNC	protein_coding	OTTHUMT00000040569.1	45	0.00	0	C	NM_000287	Intron	42934186	42934186	-1	no_errors	ENST00000304611	ensembl	human	known	69_37n	splice_site	46	16.36	9	SNP	1.000	T
PLCL2	23228	genome.wustl.edu	37	3	17051565	17051565	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:17051565G>C	ENST00000418129.2	+	2	814	c.349G>C	c.(349-351)Gtt>Ctt	p.V117L	PLCL2_ENST00000396755.2_Missense_Mutation_p.V117L|PLCL2_ENST00000432376.1_Missense_Mutation_p.V117L|PLCL2_ENST00000460467.1_3'UTR	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	243					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.V117L(1)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						AAACATCTGGGTTACAGGACT	0.398																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	109.0	109.0					3																	17051565		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.349G>C	3.37:g.17051565G>C	ENSP00000409637:p.Val117Leu		A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.V117L	ENST00000418129.2	37	c.349	CCDS33713.1	3	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836115	0.71373	.	.	ENSG00000154822	ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	T;T;T	0.66280	-0.2;-0.2;-0.2	5.33	5.33	0.75918	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.75889	0.3911	.	.	.	0.80722	D	1	D;D	0.61080	0.989;0.959	P;P	0.58210	0.78;0.835	T	0.77370	-0.2613	9	0.52906	T	0.07	.	19.0202	0.92910	0.0:0.0:1.0:0.0	.	243;117	Q9UPR0;Q9UPR0-2	PLCL2_HUMAN;.	L	117;244;117;117	ENSP00000409637:V117L;ENSP00000379979:V117L;ENSP00000412836:V117L	ENSP00000285094:V244L	V	+	1	0	PLCL2	17026569	1.000000	0.71417	0.996000	0.52242	0.896000	0.52359	9.869000	0.99810	2.507000	0.84556	0.561000	0.74099	GTT	PLCL2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000154822		0.398	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL2	HGNC	protein_coding	OTTHUMT00000340250.3	96	0.00	0	G			17051565	17051565	+1	no_errors	ENST00000418129	ensembl	human	known	69_37n	missense	66	14.29	11	SNP	1.000	C
POU6F1	5463	genome.wustl.edu	37	12	51584232	51584232	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr12:51584232C>T	ENST00000389243.4	-	11	1643	c.704G>A	c.(703-705)cGc>cAc	p.R235H	POU6F1_ENST00000333640.10_Missense_Mutation_p.R235H|POU6F1_ENST00000550824.1_Missense_Mutation_p.R235H			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	235					brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R235H(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						GCGGCGTTTGCGTTTCTTGGA	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											138.0	132.0	134.0					12																	51584232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.704G>A	12.37:g.51584232C>T	ENSP00000373895:p.Arg235His		Q15944|Q6DK47|Q7Z7P6	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,prints_POU,pfscan_Homeodomain,pfscan_POU_specific	p.R235H	ENST00000389243.4	37	c.704	CCDS31803.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.488263	0.96323	.	.	ENSG00000184271	ENST00000389243;ENST00000333640;ENST00000550824	D;D;D	0.97303	-4.33;-4.33;-4.33	5.43	5.43	0.79202	Homeodomain-related (1);Homeobox (3);POU (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98905	0.9629	H	0.94582	3.555	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.99651	1.0991	10	0.87932	D	0	.	18.0148	0.89236	0.0:1.0:0.0:0.0	.	235	Q14863	PO6F1_HUMAN	H	235	ENSP00000373895:R235H;ENSP00000330190:R235H;ENSP00000448389:R235H	ENSP00000330190:R235H	R	-	2	0	POU6F1	49870499	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.725000	0.84808	2.553000	0.86117	0.561000	0.74099	CGC	POU6F1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_POU,pfscan_Homeodomain	ENSG00000184271		0.557	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU6F1	HGNC	protein_coding	OTTHUMT00000405126.1	64	0.00	0	C	NM_002702		51584232	51584232	-1	no_errors	ENST00000333640	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	1.000	T
PRKG2	5593	genome.wustl.edu	37	4	82092953	82092953	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr4:82092953G>A	ENST00000395578.1	-	4	750	c.634C>T	c.(634-636)Cga>Tga	p.R212*	RP11-100N20.1_ENST00000505175.1_RNA|PRKG2_ENST00000264399.1_Nonsense_Mutation_p.R212*|PRKG2_ENST00000418486.2_Nonsense_Mutation_p.R212*|RP11-100N20.1_ENST00000512502.1_RNA			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	212					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)	p.R212*(2)		NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						ACCTCTAGTCGACCCTCTATC	0.383																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											72.0	75.0	74.0					4																	82092953		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.634C>T	4.37:g.82092953G>A	ENSP00000378945:p.Arg212*		B4DMX3|E7EPE6|O00125|O60916	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin	p.R212*	ENST00000395578.1	37	c.634	CCDS3589.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.106391	0.97286	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	.	.	.	5.42	3.33	0.38152	.	0.355648	0.28114	N	0.016541	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-2.8618	11.7692	0.51949	0.0:0.0:0.4096:0.5904	.	.	.	.	X	212	.	ENSP00000264399:R212X	R	-	1	2	PRKG2	82311977	0.585000	0.26774	0.846000	0.33378	0.883000	0.51084	3.249000	0.51437	1.366000	0.46076	0.655000	0.94253	CGA	PRKG2	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pirsf_cGMP-dependent_protein_kinase,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	ENSG00000138669		0.383	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	134	0.74	1	G	NM_006259		82092953	82092953	-1	no_errors	ENST00000264399	ensembl	human	known	69_37n	nonsense	93	30.60	41	SNP	0.009	A
PSTPIP1	9051	genome.wustl.edu	37	15	77310845	77310845	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr15:77310845G>A	ENST00000558012.1	+	3	674	c.185G>A	c.(184-186)cGg>cAg	p.R62Q	PSTPIP1_ENST00000267939.5_Missense_Mutation_p.R61Q|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.R62Q|PSTPIP1_ENST00000379595.3_Missense_Mutation_p.R62Q	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	62	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)		p.R62Q(2)		breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						CAGATCGCACGGAAGGCAGGT	0.582																																						dbGAP											2	Substitution - Missense(2)	breast(2)											32.0	39.0	36.0					15																	77310845		1978	4145	6123	-	-	-	SO:0001583	missense	0			U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.185G>A	15.37:g.77310845G>A	ENSP00000452746:p.Arg62Gln		B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	pfam_FCH,superfamily_Prismane-like,smart_FCH,pfscan_FCH	p.R127Q	ENST00000558012.1	37	c.380	CCDS45312.1	15	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916146	0.73098	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.43688	0.94;2.52	3.81	3.81	0.43845	Fps/Fes/Fer/CIP4 homology (3);Prismane-like (1);	0.068606	0.64402	D	0.000012	T	0.54224	0.1845	L	0.54323	1.7	0.46564	D	0.999107	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	P;D;D;D	0.69824	0.853;0.966;0.922;0.945	T	0.55879	-0.8071	10	0.66056	D	0.02	-19.9357	8.9215	0.35615	0.1066:0.0:0.8934:0.0	.	62;61;62;62	O43586-2;C9K004;B4E1Z9;O43586	.;.;.;PPIP1_HUMAN	Q	62;61	ENSP00000368914:R62Q;ENSP00000267939:R61Q	ENSP00000267939:R61Q	R	+	2	0	PSTPIP1	75097900	1.000000	0.71417	0.987000	0.45799	0.802000	0.45316	4.255000	0.58804	2.136000	0.66102	0.591000	0.81541	CGG	PSTPIP1	-	pfam_FCH,superfamily_Prismane-like,smart_FCH,pfscan_FCH	ENSG00000140368		0.582	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSTPIP1	HGNC	protein_coding	OTTHUMT00000419373.2	70	0.00	0	G	NM_003978		77310845	77310845	+1	no_errors	ENST00000559785	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	1.000	A
SCN11A	11280	genome.wustl.edu	37	3	38924780	38924780	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:38924780G>T	ENST00000302328.3	-	18	3361	c.3163C>A	c.(3163-3165)Cac>Aac	p.H1055N	SCN11A_ENST00000444237.2_Missense_Mutation_p.H1055N|SCN11A_ENST00000456224.3_Missense_Mutation_p.H1017N|SCN11A_ENST00000450244.1_Missense_Mutation_p.H1055N	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1055					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.H1055N(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACCAGCTGTGTTTCACTATT	0.488																																						dbGAP											1	Substitution - Missense(1)	breast(1)											124.0	113.0	117.0					3																	38924780		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3163C>A	3.37:g.38924780G>T	ENSP00000307599:p.His1055Asn		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.H1055N	ENST00000302328.3	37	c.3163	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829189	0.71258	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	5.57	5.57	0.84162	Sodium ion transport-associated (1);	0.000000	0.85682	D	0.000000	D	0.89389	0.6701	M	0.74389	2.26	0.51012	D	0.999909	P	0.46784	0.884	P	0.50490	0.642	D	0.87786	0.2615	10	0.35671	T	0.21	.	19.5175	0.95170	0.0:0.0:1.0:0.0	.	1055	Q9UI33	SCNBA_HUMAN	N	1055;1055;1017;1055	ENSP00000307599:H1055N;ENSP00000400945:H1055N;ENSP00000416757:H1017N;ENSP00000408028:H1055N	ENSP00000307599:H1055N	H	-	1	0	SCN11A	38899784	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.480000	0.81109	2.780000	0.95670	0.655000	0.94253	CAC	SCN11A	-	pfam_Na_trans_assoc	ENSG00000168356		0.488	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	90	0.00	0	G	NM_014139		38924780	38924780	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	76	22.45	22	SNP	1.000	T
SDAD1	55153	genome.wustl.edu	37	4	76891502	76891502	+	Silent	SNP	C	C	G	rs370225303		TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr4:76891502C>G	ENST00000356260.5	-	10	961	c.843G>C	c.(841-843)gtG>gtC	p.V281V	SDAD1_ENST00000395711.4_Silent_p.V244V|SDAD1_ENST00000513089.1_5'UTR	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	281					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)		p.V281V(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AAAAGTTAAACACCTCTGGTT	0.373																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											120.0	109.0	113.0					4																	76891502		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.843G>C	4.37:g.76891502C>G			Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Silent	SNP	pfam_SDA1,pfam_Uncharacterised_NUC130/133_N,superfamily_ARM-type_fold	p.V281	ENST00000356260.5	37	c.843	CCDS3573.2	4																																																																																			SDAD1	-	superfamily_ARM-type_fold	ENSG00000198301		0.373	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDAD1	HGNC	protein_coding	OTTHUMT00000252418.3	125	0.00	0	C	NM_018115		76891502	76891502	-1	no_errors	ENST00000356260	ensembl	human	known	69_37n	silent	96	32.87	47	SNP	1.000	G
SDHD	6392	genome.wustl.edu	37	11	111958687	111958687	+	Silent	SNP	G	G	A	rs201368675		TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr11:111958687G>A	ENST00000375549.3	+	2	294	c.159G>A	c.(157-159)ccG>ccA	p.P53P	SDHD_ENST00000526592.1_Silent_p.P53P|TIMM8B_ENST00000504148.2_5'Flank|SDHD_ENST00000528048.1_Silent_p.P53P|TIMM8B_ENST00000541231.1_5'Flank|SDHD_ENST00000532699.1_Silent_p.P53P|SDHD_ENST00000525291.1_Intron|SDHD_ENST00000528182.1_Silent_p.P53P|TIMM8B_ENST00000507614.1_5'Flank|SDHD_ENST00000528021.1_Silent_p.P53P	NM_003002.2	NP_002993.1	O14521	DHSD_HUMAN	succinate dehydrogenase complex, subunit D, integral membrane protein	53					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|succinate dehydrogenase activity (GO:0000104)|ubiquinone binding (GO:0048039)	p.P53P(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	9		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.13e-07)|BRCA - Breast invasive adenocarcinoma(274;6.17e-07)|all cancers(92;1.05e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0515)	Hexachlorophene(DB00756)|Succinic acid(DB00139)	ACTTGTCACCGAGCCACCATT	0.498			"""Mis, N, F, S"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																													dbGAP	yes	Rec		Familial paraganglioma	11	11q23	6392	"""succinate dehydrogenase complex, subunit D, integral membrane protein"""		O	1	Substitution - coding silent(1)	breast(1)											160.0	141.0	147.0					11																	111958687		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	AB006202	CCDS31678.1, CCDS60958.1, CCDS60959.1, CCDS60960.1	11q23	2014-09-17				ENSG00000204370		"""Mitochondrial respiratory chain complex / Complex II"""	10683	protein-coding gene	gene with protein product		602690		PGL, PGL1		9533030, 1301144	Standard	NM_003002		Approved		uc001pmz.4	O14521		ENST00000375549.3:c.159G>A	11.37:g.111958687G>A			A6ND90|B3KQQ8|E9PIC0|E9PIG3|E9PQI9|Q53XW5|Q6IRW2	Missense_Mutation	SNP	pfam_Cyt_b_succ_DH_CybS	p.R50Q	ENST00000375549.3	37	c.149	CCDS31678.1	11																																																																																			SDHD	-	pfam_Cyt_b_succ_DH_CybS	ENSG00000204370		0.498	SDHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDHD	HGNC	protein_coding	OTTHUMT00000392351.1	113	0.00	0	G	NM_003002		111958687	111958687	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000530923	ensembl	human	known	69_37n	missense	46	39.47	30	SNP	0.071	A
SH3BGR	6450	genome.wustl.edu	37	21	40834367	40834367	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr21:40834367G>A	ENST00000333634.4	+	2	379	c.301G>A	c.(301-303)Gat>Aat	p.D101N	SH3BGR_ENST00000380631.1_5'UTR|SH3BGR_ENST00000458295.1_5'UTR|SH3BGR_ENST00000380637.3_5'UTR|SH3BGR_ENST00000380634.1_5'UTR	NM_007341.2	NP_031367	P55822	SH3BG_HUMAN	SH3 domain binding glutamate-rich protein	101					positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)	p.D101N(1)		NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(2)	8		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		TAAGGAATTAGATATTGCTGG	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	115.0	113.0					21																	40834367		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13666.1, CCDS33560.1	21q22.3	2014-02-19	2014-02-19		ENSG00000185437	ENSG00000185437			10822	protein-coding gene	gene with protein product	"""21-glutamic acid-rich protein"""	602230	"""SH3 domain binding glutamic acid-rich protein"""			9050928	Standard	NM_007341		Approved	21-GARP	uc002yya.3	P55822	OTTHUMG00000074113	ENST00000333634.4:c.301G>A	21.37:g.40834367G>A	ENSP00000332513:p.Asp101Asn		A6ND59|D3DSI2|Q9BRB8	Missense_Mutation	SNP	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	p.D101N	ENST00000333634.4	37	c.301	CCDS13666.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.316124|5.316124	0.95655|0.95655	.|.	.|.	ENSG00000185437|ENSG00000185437	ENST00000333634|ENST00000452550	T|.	0.80909|.	-1.43|.	5.09|5.09	5.09|5.09	0.68999|0.68999	Thioredoxin-like fold (2);|.	0.093430|.	0.64402|.	D|.	0.000001|.	D|D	0.84999|0.84999	0.5597|0.5597	M|M	0.89840|0.89840	3.065|3.065	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.91635|.	0.999|.	D|D	0.87662|0.87662	0.2535|0.2535	10|5	0.87932|.	D|.	0|.	.|.	18.8874|18.8874	0.92385|0.92385	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	101|.	P55822|.	SH3BG_HUMAN|.	N|K	101|29	ENSP00000332513:D101N|.	ENSP00000332513:D101N|.	D|R	+|+	1|2	0|0	SH3BGR|SH3BGR	39756237|39756237	1.000000|1.000000	0.71417|0.71417	0.925000|0.925000	0.36789|0.36789	0.997000|0.997000	0.91878|0.91878	9.257000|9.257000	0.95545|0.95545	2.537000|2.537000	0.85549|0.85549	0.655000|0.655000	0.94253|0.94253	GAT|AGA	SH3BGR	-	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	ENSG00000185437		0.393	SH3BGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGR	HGNC	protein_coding	OTTHUMT00000157377.6	172	0.00	0	G	NM_007341		40834367	40834367	+1	no_errors	ENST00000333634	ensembl	human	known	69_37n	missense	291	14.62	50	SNP	1.000	A
SHMT1	6470	genome.wustl.edu	37	17	18232668	18232668	+	Silent	SNP	C	C	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:18232668C>G	ENST00000316694.3	-	11	1340	c.1206G>C	c.(1204-1206)cgG>cgC	p.R402R	SHMT1_ENST00000352886.6_Silent_p.R322R|SHMT1_ENST00000354098.3_Silent_p.R363R|SHMT1_ENST00000539052.1_Silent_p.R264R	NM_004169.3	NP_004160.3	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)	402					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|folic acid metabolic process (GO:0046655)|glycine biosynthetic process from serine (GO:0019264)|L-serine catabolic process (GO:0006565)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase biosynthetic process (GO:0009113)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	amino acid binding (GO:0016597)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)	p.R402R(1)		breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)	13					Glycine(DB00145)|Mimosine(DB01055)|Tetrahydrofolic acid(DB00116)	GGGTCCCCAGCCGCAGTCCAC	0.498																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											43.0	45.0	44.0					17																	18232668		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11196.1, CCDS11197.1, CCDS62112.1	17p11.2	2010-04-23			ENSG00000176974	ENSG00000176974	2.1.2.1		10850	protein-coding gene	gene with protein product	"""cytoplasmic serine hydroxymethyltransferase"", ""14 kDa protein"""	182144				8505317	Standard	NM_004169		Approved	CSHMT, SHMT, MGC15229, MGC24556	uc002gta.3	P34896	OTTHUMG00000059094	ENST00000316694.3:c.1206G>C	17.37:g.18232668C>G			B4DPM9|D3DXD0|Q96HY0|Q9UMD1|Q9UMD2	Silent	SNP	pfam_Ser_HO-MeTrfase,pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	p.R402	ENST00000316694.3	37	c.1206	CCDS11196.1	17																																																																																			SHMT1	-	pfam_Ser_HO-MeTrfase,pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	ENSG00000176974		0.498	SHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHMT1	HGNC	protein_coding	OTTHUMT00000130831.2	57	0.00	0	C	NM_004169		18232668	18232668	-1	no_errors	ENST00000316694	ensembl	human	known	69_37n	silent	59	11.94	8	SNP	0.466	G
SRBD1	55133	genome.wustl.edu	37	2	45774701	45774701	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr2:45774701delG	ENST00000263736.4	-	13	1788	c.1726delC	c.(1726-1728)cgafs	p.R576fs	SRBD1_ENST00000535761.1_Frame_Shift_Del_p.R95fs	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	576					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)	p.R576fs*6(1)|p.R576*(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			TCCGCCTCTCGGAAGCCTTGT	0.333																																						dbGAP											2	Substitution - Nonsense(1)|Deletion - Frameshift(1)	large_intestine(1)|breast(1)											66.0	66.0	66.0					2																	45774701		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.1726delC	2.37:g.45774701delG	ENSP00000263736:p.Arg576fs		Q53T56|Q96TA4|Q9NW11	Frame_Shift_Del	DEL	pfam_Tex-like_N,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,superfamily_RuvA_2-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.R576fs	ENST00000263736.4	37	c.1726	CCDS1823.1	2																																																																																			SRBD1	-	smart_YqgF/RNaseH-like_dom	ENSG00000068784		0.333	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRBD1	HGNC	protein_coding	OTTHUMT00000250747.3	133	0.00	0	G	NM_018079		45774701	45774701	-1	no_errors	ENST00000263736	ensembl	human	known	69_37n	frame_shift_del	118	19.59	29	DEL	1.000	-
SRBD1	55133	genome.wustl.edu	37	2	45774705	45774705	+	Silent	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr2:45774705G>A	ENST00000263736.4	-	13	1784	c.1722C>T	c.(1720-1722)ggC>ggT	p.G574G	SRBD1_ENST00000535761.1_Silent_p.G93G	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	574					nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)	p.G574G(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			CCTCTCGGAAGCCTTGTCCAC	0.338																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											69.0	68.0	69.0					2																	45774705		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.1722C>T	2.37:g.45774705G>A			Q53T56|Q96TA4|Q9NW11	Silent	SNP	pfam_Tex-like_N,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,superfamily_RuvA_2-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.G574	ENST00000263736.4	37	c.1722	CCDS1823.1	2																																																																																			SRBD1	-	smart_YqgF/RNaseH-like_dom	ENSG00000068784		0.338	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRBD1	HGNC	protein_coding	OTTHUMT00000250747.3	135	0.00	0	G	NM_018079		45774705	45774705	-1	no_errors	ENST00000263736	ensembl	human	known	69_37n	silent	121	21.29	33	SNP	0.985	A
SVIL	6840	genome.wustl.edu	37	10	29813436	29813436	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr10:29813436G>A	ENST00000355867.4	-	14	3303	c.2551C>T	c.(2551-2553)Caa>Taa	p.Q851*	SVIL_ENST00000375398.2_Nonsense_Mutation_p.Q851*|SVIL_ENST00000375400.3_Nonsense_Mutation_p.Q425*|SVIL_ENST00000535393.1_5'Flank	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	851					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.Q851*(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GGCTGAGTTTGATAGCGAGCG	0.463																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											165.0	153.0	157.0					10																	29813436		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.2551C>T	10.37:g.29813436G>A	ENSP00000348128:p.Gln851*		D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Nonsense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.Q851*	ENST00000355867.4	37	c.2551	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	G	47	13.352936	0.99737	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	.	.	.	5.82	5.82	0.92795	.	0.048996	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-23.4914	20.093	0.97828	0.0:0.0:1.0:0.0	.	.	.	.	X	425;851;851	.	.	Q	-	1	0	SVIL	29853442	1.000000	0.71417	0.994000	0.49952	0.515000	0.34225	9.357000	0.97099	2.756000	0.94617	0.561000	0.74099	CAA	SVIL	-	NULL	ENSG00000197321		0.463	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	231	0.00	0	G			29813436	29813436	-1	no_errors	ENST00000355867	ensembl	human	known	69_37n	nonsense	142	40.66	98	SNP	1.000	A
SYCE1L	100130958	genome.wustl.edu	37	16	77240349	77240349	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr16:77240349T>A	ENST00000378644.4	+	2	128	c.73T>A	c.(73-75)Tct>Act	p.S25T	RP11-538I12.2_ENST00000569032.1_RNA	NM_001129979.1	NP_001123451.1	A8MT33	SYC1L_HUMAN	synaptonemal complex central element protein 1-like	25					synaptonemal complex assembly (GO:0007130)	synaptonemal complex (GO:0000795)		p.S25T(1)		breast(1)|prostate(1)	2						GCAAGCCAAGTCTTTGAAGAC	0.493																																						dbGAP											1	Substitution - Missense(1)	breast(1)											141.0	123.0	128.0					16																	77240349		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45533.1	16q23.1	2009-10-06			ENSG00000205078	ENSG00000205078			37236	protein-coding gene	gene with protein product	"""meiosis-related protein"""					16328886	Standard	NM_001129979		Approved	MRP2	uc010vnh.1	A8MT33		ENST00000378644.4:c.73T>A	16.37:g.77240349T>A	ENSP00000367911:p.Ser25Thr		A6NF23	Missense_Mutation	SNP	NULL	p.S25T	ENST00000378644.4	37	c.73	CCDS45533.1	16	.	.	.	.	.	.	.	.	.	.	T	6.888	0.533289	0.13188	.	.	ENSG00000205078	ENST00000378644	T	0.51574	0.7	3.84	0.213	0.15244	.	.	.	.	.	T	0.37544	0.1007	L	0.61218	1.895	0.09310	N	1	B	0.27882	0.192	B	0.18263	0.021	T	0.37865	-0.9687	9	0.66056	D	0.02	.	2.6957	0.05134	0.1924:0.2179:0.0:0.5897	.	25	A8MT33	SYC1L_HUMAN	T	25	ENSP00000367911:S25T	ENSP00000367911:S25T	S	+	1	0	SYCE1L	75797850	0.002000	0.14202	0.002000	0.10522	0.013000	0.08279	0.076000	0.14712	0.008000	0.14787	0.451000	0.29950	TCT	SYCE1L	-	NULL	ENSG00000205078		0.493	SYCE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCE1L	HGNC	protein_coding	OTTHUMT00000433889.1	115	0.00	0	T	NM_001129979		77240349	77240349	+1	no_errors	ENST00000378644	ensembl	human	known	69_37n	missense	61	23.46	19	SNP	0.002	A
SYNGAP1	8831	genome.wustl.edu	37	6	33410890	33410890	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr6:33410890G>A	ENST00000418600.2	+	15	2662	c.2561G>A	c.(2560-2562)cGc>cAc	p.R854H	SYNGAP1_ENST00000428982.2_Missense_Mutation_p.R795H|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.R854H|SYNGAP1_ENST00000496374.1_3'UTR	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	854					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)	p.R854H(1)|p.R839H(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						CCTGGTGGCCGCCTCAACAGC	0.617																																						dbGAP											2	Substitution - Missense(2)	breast(2)											79.0	66.0	70.0					6																	33410890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.2561G>A	6.37:g.33410890G>A	ENSP00000403636:p.Arg854His		A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.R854H	ENST00000418600.2	37	c.2561	CCDS34434.2	6	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827716	0.71143	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.18016	2.24;2.32;2.32	4.52	4.52	0.55395	.	0.900830	0.09774	N	0.757589	T	0.21881	0.0527	L	0.40543	1.245	0.45015	D	0.99803	D;D;D	0.69078	0.997;0.997;0.997	P;P;P	0.62184	0.899;0.838;0.838	T	0.01208	-1.1418	10	0.49607	T	0.09	.	14.7663	0.69642	0.0:0.0:1.0:0.0	.	854;854;854	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	H	854;854;840;795	ENSP00000293748:R854H;ENSP00000403636:R854H;ENSP00000412475:R795H	ENSP00000293748:R854H	R	+	2	0	SYNGAP1	33518868	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.558000	0.60789	2.343000	0.79666	0.591000	0.81541	CGC	SYNGAP1	-	pfam_DUF3498	ENSG00000197283		0.617	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGAP1	HGNC	protein_coding	OTTHUMT00000076151.4	36	0.00	0	G	XM_166407		33410890	33410890	+1	no_errors	ENST00000418600	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	A
TAOK1	57551	genome.wustl.edu	37	17	27825439	27825439	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:27825439T>G	ENST00000261716.3	+	12	1622	c.1103T>G	c.(1102-1104)gTt>gGt	p.V368G	TAOK1_ENST00000536202.1_Missense_Mutation_p.V368G	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	368	Ser-rich.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)	p.V368G(2)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			AGCAGTAGTGTTAACAGTCTT	0.448																																						dbGAP											2	Substitution - Missense(2)	breast(2)											160.0	136.0	144.0					17																	27825439		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.1103T>G	17.37:g.27825439T>G	ENSP00000261716:p.Val368Gly		A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Homeodomain-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V368G	ENST00000261716.3	37	c.1103	CCDS32601.1	17	.	.	.	.	.	.	.	.	.	.	T	26.5	4.741838	0.89573	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	T;T	0.74632	-0.86;-0.76	5.46	5.46	0.80206	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.86091	0.5850	M	0.77616	2.38	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.75484	0.979;0.975;0.986	D	0.88023	0.2770	10	0.87932	D	0	.	15.5263	0.75910	0.0:0.0:0.0:1.0	.	368;194;368	B7ZLV6;Q7L7X3-2;Q7L7X3	.;.;TAOK1_HUMAN	G	368	ENSP00000261716:V368G;ENSP00000438819:V368G	ENSP00000261716:V368G	V	+	2	0	TAOK1	24849565	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.075000	0.62263	0.383000	0.25322	GTT	TAOK1	-	superfamily_Kinase-like_dom	ENSG00000160551		0.448	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	HGNC	protein_coding	OTTHUMT00000447790.1	65	0.00	0	T	NM_020791		27825439	27825439	+1	no_errors	ENST00000261716	ensembl	human	known	69_37n	missense	38	40.62	26	SNP	1.000	G
TASP1	55617	genome.wustl.edu	37	20	13610600	13610601	+	In_Frame_Ins	INS	-	-	CCT			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr20:13610600_13610601insCCT	ENST00000337743.4	-	2	245_246	c.125_126insAGG	c.(124-126)ggc>ggAGGc	p.42_42G>GG	TASP1_ENST00000539805.1_In_Frame_Ins_p.42_42G>GG|TASP1_ENST00000480436.1_5'UTR|TASP1_ENST00000544472.1_In_Frame_Ins_p.42_42G>GG	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	42					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)	p.G42_F43insG(1)		NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						CCAACACAAAGCCTCCTCGTTT	0.431																																						dbGAP											1	Insertion - In frame(1)	breast(1)																																								-	-	-	SO:0001652	inframe_insertion	0			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.123_125dupAGG	20.37:g.13610604_13610606dupCCT	ENSP00000338624:p.Gly42dup		B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	In_Frame_Ins	INS	pfam_Peptidase_T2	p.43in_frame_insG	ENST00000337743.4	37	c.126_125	CCDS13116.1	20																																																																																			TASP1	-	NULL	ENSG00000089123		0.431	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TASP1	HGNC	protein_coding	OTTHUMT00000078041.2	173	0.00	0	-	NM_017714		13610600	13610601	-1	no_errors	ENST00000337743	ensembl	human	known	69_37n	in_frame_ins	126	14.29	21	INS	1.000:1.000	CCT
TNRC18	84629	genome.wustl.edu	37	7	5396789	5396789	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr7:5396789C>G	ENST00000430969.1	-	16	5300	c.4952G>C	c.(4951-4953)aGt>aCt	p.S1651T	TNRC18_ENST00000399537.4_Missense_Mutation_p.S1651T	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1651							chromatin binding (GO:0003682)	p.S1651T(2)|p.S706T(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CCCCCCAGCACTGTCCGAAAA	0.592																																						dbGAP											3	Substitution - Missense(3)	breast(3)											50.0	45.0	47.0					7																	5396789		692	1591	2283	-	-	-	SO:0001583	missense	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4952G>C	7.37:g.5396789C>G	ENSP00000395538:p.Ser1651Thr		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.S1651T	ENST00000430969.1	37	c.4952	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	c	10.71	1.426592	0.25726	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	T;T;T	0.47177	2.59;2.6;0.85	5.25	0.0768	0.14405	.	0.666605	0.13239	N	0.403043	T	0.34919	0.0914	L	0.46157	1.445	0.09310	N	1	B;B	0.13594	0.0;0.008	B;B	0.06405	0.002;0.002	T	0.29088	-1.0023	10	0.15066	T	0.55	.	8.897	0.35470	0.0:0.5312:0.3397:0.1291	.	706;1651	A8MSW5;O15417	.;TNC18_HUMAN	T	1651;1651;706;141	ENSP00000382452:S1651T;ENSP00000395538:S1651T;ENSP00000395990:S141T	ENSP00000382452:S1651T	S	-	2	0	TNRC18	5363315	0.038000	0.19896	0.000000	0.03702	0.897000	0.52465	0.715000	0.25822	-0.297000	0.08934	0.561000	0.74099	AGT	TNRC18	-	NULL	ENSG00000182095		0.592	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		84	0.00	0	C			5396789	5396789	-1	no_errors	ENST00000399537	ensembl	human	known	69_37n	missense	51	21.54	14	SNP	0.056	G
TP53	7157	genome.wustl.edu	37	17	7574030	7574030	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr17:7574030delG	ENST00000269305.4	-	10	1186	c.997delC	c.(997-999)cgtfs	p.R333fs	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.R333fs|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	333	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R333fs*12(3)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCACGCCCACGGATCTGCAGC	0.512		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	13	Whole gene deletion(8)|Deletion - Frameshift(4)|Unknown(1)	bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|large_intestine(1)|stomach(1)|ovary(1)											45.0	37.0	40.0					17																	7574030		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.997delC	17.37:g.7574030delG	ENSP00000269305:p.Arg333fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R333fs	ENST00000269305.4	37	c.997	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	ENSG00000141510		0.512	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	43	0.00	0	G	NM_000546		7574030	7574030	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	16	55.56	20	DEL	0.645	-
TRA2B	6434	genome.wustl.edu	37	3	185644497	185644497	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr3:185644497C>T	ENST00000453386.2	-	2	337	c.62G>A	c.(61-63)gGa>gAa	p.G21E	TRA2B_ENST00000471134.1_5'Flank|TRA2B_ENST00000382191.4_Intron	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	21					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G21E(1)		breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						GTGAGCACTTCCACTTCTGGA	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	73.0	75.0					3																	185644497		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.62G>A	3.37:g.185644497C>T	ENSP00000416959:p.Gly21Glu		B4DVK2|D3DNU3|O15449|Q15815|Q64283	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G21E	ENST00000453386.2	37	c.62	CCDS33905.1	3	.	.	.	.	.	.	.	.	.	.	C	14.57	2.573704	0.45902	.	.	ENSG00000136527	ENST00000453386	T	0.19394	2.15	6.01	6.01	0.97437	.	0.175949	0.52532	D	0.000063	T	0.13970	0.0338	L	0.29908	0.895	0.80722	D	1	P;P	0.49090	0.789;0.919	B;B	0.31686	0.095;0.134	T	0.10776	-1.0615	10	0.18276	T	0.48	-9.6587	19.2926	0.94108	0.0:1.0:0.0:0.0	.	21;21	B2RDQ3;P62995	.;TRA2B_HUMAN	E	21	ENSP00000416959:G21E	ENSP00000416959:G21E	G	-	2	0	TRA2B	187127191	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.610000	0.46325	2.861000	0.98227	0.650000	0.86243	GGA	TRA2B	-	NULL	ENSG00000136527		0.468	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRA2B	HGNC	protein_coding	OTTHUMT00000344984.1	65	0.00	0	C	NM_004593		185644497	185644497	-1	no_errors	ENST00000453386	ensembl	human	known	69_37n	missense	98	13.27	15	SNP	1.000	T
TUBA3D	113457	genome.wustl.edu	37	2	132237879	132237879	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr2:132237879G>A	ENST00000321253.6	+	4	720	c.613G>A	c.(613-615)Gac>Aac	p.D205N	TUBA3D_ENST00000409047.2_3'UTR	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	205					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.D205N(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		CTTCATGGTCGACAATGAAGC	0.557																																					Ovarian(137;2059 2432 35543 39401)	dbGAP											1	Substitution - Missense(1)	breast(1)											35.0	46.0	42.0					2																	132237879		2193	4267	6460	-	-	-	SO:0001583	missense	0			K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.613G>A	2.37:g.132237879G>A	ENSP00000326042:p.Asp205Asn		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.D205N	ENST00000321253.6	37	c.613	CCDS33290.1	2	.	.	.	.	.	.	.	.	.	.	g	10.95	1.496250	0.26861	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	T	0.72282	-0.64	2.24	2.24	0.28232	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.47852	U	0.000220	D	0.87625	0.6224	H	0.97540	4.025	0.46458	D	0.999055	D	0.76494	0.999	D	0.75020	0.985	D	0.89459	0.3735	10	0.87932	D	0	.	10.1507	0.42791	0.0:0.0:1.0:0.0	.	205	Q13748	TBA3C_HUMAN	N	205	ENSP00000326042:D205N	ENSP00000326042:D205N	D	+	1	0	TUBA3D	131954349	1.000000	0.71417	0.996000	0.52242	0.051000	0.14879	8.225000	0.89784	1.243000	0.43853	0.194000	0.17425	GAC	TUBA3D	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin	ENSG00000075886		0.557	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3D	HGNC	protein_coding	OTTHUMT00000331800.2	236	0.42	1	G	NM_080386		132237879	132237879	+1	no_errors	ENST00000321253	ensembl	human	known	69_37n	missense	204	18.07	45	SNP	1.000	A
TYR	7299	genome.wustl.edu	37	11	88911667	88911667	+	Silent	SNP	T	T	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr11:88911667T>C	ENST00000263321.5	+	1	1048	c.546T>C	c.(544-546)taT>taC	p.Y182Y	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	182					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.Y182Y(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	TGCATTATTATGTGTCAATGG	0.423																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											187.0	175.0	179.0					11																	88911667		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.546T>C	11.37:g.88911667T>C			Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.Y182	ENST00000263321.5	37	c.546	CCDS8284.1	11																																																																																			TYR	-	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre	ENSG00000077498		0.423	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	94	0.00	0	T	NM_000372		88911667	88911667	+1	no_errors	ENST00000263321	ensembl	human	known	69_37n	silent	70	23.08	21	SNP	1.000	C
UNC13A	23025	genome.wustl.edu	37	19	17756618	17756618	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr19:17756618G>A	ENST00000519716.2	-	19	2220	c.2221C>T	c.(2221-2223)Cgc>Tgc	p.R741C	UNC13A_ENST00000551649.1_Missense_Mutation_p.R741C|UNC13A_ENST00000552293.1_Missense_Mutation_p.R741C|UNC13A_ENST00000252773.7_Missense_Mutation_p.R741C|UNC13A_ENST00000428389.2_Missense_Mutation_p.R829C|UNC13A_ENST00000550896.1_Missense_Mutation_p.R739C	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	741	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)	p.R829C(1)|p.R741C(1)		breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						TCCCAGACGCGCACCTTGATG	0.587																																						dbGAP											2	Substitution - Missense(2)	breast(2)											58.0	58.0	58.0					19																	17756618		2102	4235	6337	-	-	-	SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2221C>T	19.37:g.17756618G>A	ENSP00000429562:p.Arg741Cys		E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.R829C	ENST00000519716.2	37	c.2485	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480374	0.84747	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	3.88	3.88	0.44766	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	T	0.73450	0.3588	L	0.35793	1.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76987	-0.2755	10	0.87932	D	0	-13.5854	13.6855	0.62513	0.0:0.0:1.0:0.0	.	741	Q9UPW8	UN13A_HUMAN	C	741;829;741;741;741;739	ENSP00000429562:R741C;ENSP00000400409:R829C;ENSP00000252773:R741C;ENSP00000447236:R741C;ENSP00000447572:R741C;ENSP00000446831:R739C	ENSP00000252773:R741C	R	-	1	0	UNC13A	17617618	1.000000	0.71417	0.988000	0.46212	0.970000	0.65996	9.501000	0.97979	1.869000	0.54173	0.313000	0.20887	CGC	UNC13A	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	ENSG00000130477		0.587	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	100	0.99	1	G	XM_038604		17756618	17756618	-1	no_errors	ENST00000428389	ensembl	human	known	69_37n	missense	45	44.44	36	SNP	1.000	A
WDR46	9277	genome.wustl.edu	37	6	33248585	33248585	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr6:33248585G>A	ENST00000374617.4	-	11	1651	c.1295C>T	c.(1294-1296)gCc>gTc	p.A432V	B3GALT4_ENST00000606990.1_Intron	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	432							poly(A) RNA binding (GO:0044822)	p.A432V(1)		NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						GGGTGGGCTGGCCTTGCCCTG	0.652																																						dbGAP											1	Substitution - Missense(1)	breast(1)											64.0	59.0	61.0					6																	33248585		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.1295C>T	6.37:g.33248585G>A	ENSP00000363746:p.Ala432Val		A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Missense_Mutation	SNP	pfam_BING4_C_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A432V	ENST00000374617.4	37	c.1295	CCDS4772.1	6	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609234	0.28623	.	.	ENSG00000227057	ENST00000374617	T	0.22539	1.95	5.09	-0.332	0.12675	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.454937	0.26528	N	0.023865	T	0.07279	0.0184	L	0.40543	1.245	0.26393	N	0.976543	B;B	0.24483	0.044;0.104	B;B	0.21708	0.024;0.036	T	0.32508	-0.9904	10	0.30854	T	0.27	-5.1556	17.2952	0.87169	0.0:0.7275:0.2725:0.0	.	378;432	B4DP15;O15213	.;WDR46_HUMAN	V	432	ENSP00000363746:A432V	ENSP00000363746:A432V	A	-	2	0	WDR46	33356563	0.047000	0.20315	0.999000	0.59377	0.831000	0.47069	0.152000	0.16302	0.086000	0.17137	-0.234000	0.12200	GCC	WDR46	-	superfamily_WD40_repeat_dom	ENSG00000227057		0.652	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR46	HGNC	protein_coding	OTTHUMT00000076382.2	50	0.00	0	G	NM_005452		33248585	33248585	-1	no_errors	ENST00000374617	ensembl	human	known	69_37n	missense	53	18.18	12	SNP	0.983	A
CFAP57	149465	genome.wustl.edu	37	1	43672428	43672428	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr1:43672428T>C	ENST00000372492.4	+	10	1904	c.1580T>C	c.(1579-1581)cTg>cCg	p.L527P	WDR65_ENST00000528956.1_Missense_Mutation_p.L527P	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN		527								p.L527P(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GATAGCAAACTGATTTCTGGT	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											197.0	172.0	180.0					1																	43672428		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000372492.4:c.1580T>C	1.37:g.43672428T>C	ENSP00000361570:p.Leu527Pro		A6NKQ3|Q17RI9|Q5TAI0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L527P	ENST00000372492.4	37	c.1580		1	.	.	.	.	.	.	.	.	.	.	T	19.54	3.846911	0.71603	.	.	ENSG00000243710	ENST00000372492;ENST00000528956	T;T	0.70749	-0.51;-0.51	4.83	4.83	0.62350	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.185389	0.36234	N	0.002710	D	0.89030	0.6599	H	0.98238	4.18	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.978	D	0.92169	0.5742	10	0.87932	D	0	.	12.0987	0.53769	0.0:0.0:0.1429:0.8571	.	527;527	Q96MR6;Q96MR6-2	WDR65_HUMAN;.	P	527	ENSP00000361570:L527P;ENSP00000435310:L527P	ENSP00000361570:L527P	L	+	2	0	WDR65	43445015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.562000	0.67346	2.153000	0.67306	0.460000	0.39030	CTG	WDR65	-	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000243710		0.448	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	WDR65	HGNC	protein_coding	OTTHUMT00000384325.1	121	0.00	0	T			43672428	43672428	+1	no_errors	ENST00000528956	ensembl	human	known	69_37n	missense	117	70.75	283	SNP	1.000	C
PI4KB	5298	genome.wustl.edu	37	1	151261988	151261988	+	IGR	SNP	A	A	G			TCGA-A2-A0YM-01A-11D-A10G-09	TCGA-A2-A0YM-10A-01D-A10G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	1125ec93-6d24-4537-9c89-526f2d6b2299	1b5a4092-b33a-442c-808c-abbaf60d033c	g.chr1:151261988A>G	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Missense_Mutation_p.Q869R			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.Q869R(1)		breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTCTTTGCCCAAAAAAGGACC	0.542																																					Colon(154;765 1838 9854 28443 37492)	dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	120.0	123.0					1																	151261988		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		1.37:g.151261988A>G			B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q869R	ENST00000368873.1	37	c.2606		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.61|16.61	3.170768|3.170768	0.57584|0.57584	.|.	.|.	ENSG00000143373|ENSG00000143373	ENST00000426871|ENST00000336715;ENST00000324048;ENST00000368879	.|T;T;T	.|0.27402	.|1.67;1.67;1.67	5.13|5.13	3.99|3.99	0.46301|0.46301	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	.|0.000000	.|0.33916	.|N	.|0.004421	T|T	0.42108|0.42108	0.1188|0.1188	M|M	0.72894|0.72894	2.215|2.215	0.58432|0.58432	D|D	0.999994|0.999994	.|D;D	.|0.89917	.|0.997;1.0	.|D;D	.|0.83275	.|0.943;0.996	T|T	0.45264|0.45264	-0.9273|-0.9273	5|10	.|0.72032	.|D	.|0.01	.|.	11.3195|11.3195	0.49412|0.49412	0.8472:0.1528:0.0:0.0|0.8472:0.1528:0.0:0.0	.|.	.|869;869	.|Q8N1G0-2;Q8N1G0	.|.;ZN687_HUMAN	E|R	472|869	.|ENSP00000336620:Q869R;ENSP00000319829:Q869R;ENSP00000357874:Q869R	.|ENSP00000319829:Q869R	K|Q	+|+	1|2	0|0	ZNF687|ZNF687	149528612|149528612	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.540000|0.540000	0.34992|0.34992	9.113000|9.113000	0.94321|0.94321	0.953000|0.953000	0.37825|0.37825	-0.466000|-0.466000	0.05196|0.05196	AAA|CAA	ZNF687	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000143373		0.542	PI4KB-002	KNOWN	basic	protein_coding	ZNF687	HGNC	protein_coding	OTTHUMT00000034400.3	86	0.00	0	A	NM_002651		151261988	151261988	+1	no_errors	ENST00000324048	ensembl	human	known	69_37n	missense	125	10.64	15	SNP	1.000	G
