#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABT1	29777	genome.wustl.edu	37	6	26598278	26598278	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:26598278C>A	ENST00000274849.1	+	2	409	c.378C>A	c.(376-378)caC>caA	p.H126Q		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	126	RRM.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						CCAGTCTACACAACACGCCTA	0.582																																						dbGAP											0													53.0	50.0	51.0					6																	26598278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.378C>A	6.37:g.26598278C>A	ENSP00000274849:p.His126Gln			Missense_Mutation	SNP	NULL	p.H126Q	ENST00000274849.1	37	c.378	CCDS4616.1	6	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175117	0.78564	.	.	ENSG00000146109	ENST00000274849	T	0.44083	0.93	5.23	3.44	0.39384	Nucleotide-binding, alpha-beta plait (1);	0.048011	0.85682	D	0.000000	T	0.44095	0.1277	M	0.66939	2.045	0.53688	D	0.999974	D	0.69078	0.997	D	0.65010	0.931	T	0.46857	-0.9161	10	0.66056	D	0.02	-15.1748	7.2815	0.26314	0.0:0.7279:0.0:0.2721	.	126	Q9ULW3	ABT1_HUMAN	Q	126	ENSP00000274849:H126Q	ENSP00000274849:H126Q	H	+	3	2	ABT1	26706257	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.443000	0.44881	0.714000	0.32081	0.563000	0.77884	CAC	ABT1	-	NULL	ENSG00000146109		0.582	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABT1	HGNC	protein_coding	OTTHUMT00000043698.1	30	0.00	0	C			26598278	26598278	+1	no_errors	ENST00000274849	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	A
ACVR1	90	genome.wustl.edu	37	2	158655952	158655952	+	Silent	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr2:158655952G>T	ENST00000263640.3	-	3	483	c.54C>A	c.(52-54)tcC>tcA	p.S18S	ACVR1_ENST00000409283.2_Silent_p.S18S|ACVR1_ENST00000434821.1_Silent_p.S18S|ACVR1_ENST00000410057.2_Silent_p.S18S	NM_001105.4	NP_001096.1	Q04771	ACVR1_HUMAN	activin A receptor, type I	18					activin receptor signaling pathway (GO:0032924)|acute inflammatory response (GO:0002526)|atrial septum primum morphogenesis (GO:0003289)|BMP signaling pathway (GO:0030509)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to glucocorticoid stimulus (GO:0071385)|determination of left/right symmetry (GO:0007368)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion cell fate commitment (GO:0061445)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation with mouth forming second (GO:0001702)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|mesoderm formation (GO:0001707)|mitral valve morphogenesis (GO:0003183)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of signal transduction (GO:0009968)|neural crest cell migration (GO:0001755)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of bone mineralization (GO:0030501)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of ossification (GO:0030278)|regulation of skeletal muscle tissue development (GO:0048641)|smooth muscle cell differentiation (GO:0051145)|transforming growth factor beta receptor signaling pathway (GO:0007179)|urogenital system development (GO:0001655)	activin receptor complex (GO:0048179)|apical part of cell (GO:0045177)|integral component of plasma membrane (GO:0005887)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	19				BRCA - Breast invasive adenocarcinoma(221;0.104)	Adenosine triphosphate(DB00171)	CCATACTAGGGGAGGGGAGAG	0.353																																						dbGAP											0													141.0	122.0	129.0					2																	158655952		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2206.1	2q23-q24	2008-06-13			ENSG00000115170	ENSG00000115170			171	protein-coding gene	gene with protein product		102576		ACVRLK2		8397373	Standard	NM_001105		Approved	SKR1, ALK2, ACVR1A	uc010fog.2	Q04771	OTTHUMG00000131967	ENST00000263640.3:c.54C>A	2.37:g.158655952G>T				Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt	p.S18	ENST00000263640.3	37	c.54	CCDS2206.1	2																																																																																			ACVR1	-	NULL	ENSG00000115170		0.353	ACVR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1	HGNC	protein_coding	OTTHUMT00000254927.1	28	0.00	0	G	NM_001105		158655952	158655952	-1	no_errors	ENST00000263640	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	0.999	T
AK9	221264	genome.wustl.edu	37	6	109931716	109931716	+	Splice_Site	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:109931716G>T	ENST00000424296.2	-	17	1770	c.1694C>A	c.(1693-1695)gCc>gAc	p.A565D	AK9_ENST00000341338.6_5'UTR|AK9_ENST00000368948.2_Splice_Site_p.A565D	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	565					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										TTCTGTTGGGGCTAAAGTAAA	0.323																																						dbGAP											0													115.0	94.0	100.0					6																	109931716		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.1694-1C>A	6.37:g.109931716G>T			A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,smart_AAA+_ATPase	p.A565D	ENST00000424296.2	37	c.1694	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	G	1.331	-0.596704	0.03771	.	.	ENSG00000155085	ENST00000424296;ENST00000368948	T;T	0.66460	-0.18;-0.21	4.28	-1.6	0.08426	.	1.359770	0.05234	N	0.510990	T	0.12860	0.0312	N	0.01874	-0.695	0.21105	N	0.999788	B	0.02656	0.0	B	0.01281	0.0	T	0.04509	-1.0946	9	.	.	.	.	4.017	0.09649	0.3338:0.0:0.4202:0.246	.	565	Q5TCS8	AKD1_HUMAN	D	565	ENSP00000410186:A565D;ENSP00000357944:A565D	.	A	-	2	0	AKD1	110038409	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.577000	0.05847	-0.279000	0.09167	-0.455000	0.05494	GCC	AKD1	-	NULL	ENSG00000155085		0.323	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		81	0.00	0	G	NM_001145128	Missense_Mutation	109931716	109931716	-1	no_errors	ENST00000424296	ensembl	human	known	69_37n	missense	67	34.95	36	SNP	0.000	T
AIG1	51390	genome.wustl.edu	37	6	143382177	143382177	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:143382177T>A	ENST00000275235.4	+	1	140	c.115T>A	c.(115-117)Tgg>Agg	p.W39R	AIG1_ENST00000367596.1_Missense_Mutation_p.W39R|AIG1_ENST00000344492.5_Missense_Mutation_p.W39R|AIG1_ENST00000357847.4_Missense_Mutation_p.W39R|AIG1_ENST00000367598.5_Missense_Mutation_p.W39R|AIG1_ENST00000494282.2_Missense_Mutation_p.W39R			Q9NVV5	AIG1_HUMAN	androgen-induced 1	39						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		CGGAGGGAGCTGGAAATTCCT	0.582																																						dbGAP											0													159.0	130.0	140.0					6																	143382177		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF153605	CCDS5198.1, CCDS69216.1	6q24.1	2008-02-05			ENSG00000146416	ENSG00000146416			21607	protein-coding gene	gene with protein product		608514				11266118	Standard	NM_001286587		Approved	dJ95L4.1, AIG-1, FLJ10485	uc003qjh.3	Q9NVV5	OTTHUMG00000015721	ENST00000275235.4:c.115T>A	6.37:g.143382177T>A	ENSP00000275235:p.Trp39Arg		B4DPX2|C9J569|Q5T2H2|Q6N047|Q7Z378|Q8TB14|Q9Y3A9|Q9Y5B4	Missense_Mutation	SNP	pfam_Far-17a_AIG1	p.W39R	ENST00000275235.4	37	c.115		6	.	.	.	.	.	.	.	.	.	.	T	21.8	4.196211	0.78902	.	.	ENSG00000146416	ENST00000367601;ENST00000419072;ENST00000367598;ENST00000447498;ENST00000357847;ENST00000344492;ENST00000367596;ENST00000275235	T;T;T;T;T;T;T	0.57752	1.44;1.44;0.38;1.44;1.03;1.44;1.44	4.03	2.86	0.33363	.	0.000000	0.85682	D	0.000000	T	0.62816	0.2459	M	0.82193	2.58	0.58432	D	0.999992	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0	D;D;D;D;D	0.97110	0.998;0.999;0.999;0.996;1.0	T	0.67329	-0.5698	10	0.72032	D	0.01	-20.86	9.2482	0.37539	0.0:0.087:0.0:0.913	.	39;39;39;39;35	B4DPX2;Q9NVV5-3;Q9NVV5-2;Q9NVV5-5;E7ENG8	.;.;.;.;.	R	35;35;39;39;39;39;39;39	ENSP00000356573:W35R;ENSP00000356570:W39R;ENSP00000405048:W39R;ENSP00000350509:W39R;ENSP00000340090:W39R;ENSP00000356568:W39R;ENSP00000275235:W39R	ENSP00000275235:W39R	W	+	1	0	AIG1	143423870	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.109000	0.77062	0.717000	0.32145	0.460000	0.39030	TGG	AIG1	-	pfam_Far-17a_AIG1	ENSG00000146416		0.582	AIG1-005	KNOWN	basic	protein_coding	AIG1	HGNC	protein_coding	OTTHUMT00000042510.1	70	0.00	0	T	NM_016108		143382177	143382177	+1	no_errors	ENST00000275235	ensembl	human	known	69_37n	missense	55	42.11	40	SNP	1.000	A
ANKRD22	118932	genome.wustl.edu	37	10	90591731	90591731	+	Missense_Mutation	SNP	A	A	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr10:90591731A>C	ENST00000371930.4	-	2	284	c.74T>G	c.(73-75)gTg>gGg	p.V25G		NM_144590.2	NP_653191.2	Q5VYY1	ANR22_HUMAN	ankyrin repeat domain 22	25										NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(3)	10		Colorectal(252;0.0163)		Colorectal(12;6.29e-05)|COAD - Colon adenocarcinoma(12;7.69e-05)		GTCTTCTTTCACCCACCGCCA	0.488																																						dbGAP											0													245.0	239.0	241.0					10																	90591731		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC021671	CCDS7390.1	10q23.31	2013-09-20			ENSG00000152766	ENSG00000152766		"""Ankyrin repeat domain containing"""	28321	protein-coding gene	gene with protein product						12477932	Standard	NM_144590		Approved	MGC22805	uc001kfj.4	Q5VYY1	OTTHUMG00000018699	ENST00000371930.4:c.74T>G	10.37:g.90591731A>C	ENSP00000360998:p.Val25Gly		B2R9Y7|Q8WU06	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.V25G	ENST00000371930.4	37	c.74	CCDS7390.1	10	.	.	.	.	.	.	.	.	.	.	A	11.14	1.551453	0.27739	.	.	ENSG00000152766	ENST00000371930	T	0.55052	0.54	5.58	1.79	0.24919	Ankyrin repeat-containing domain (2);	0.381500	0.28718	N	0.014370	T	0.50274	0.1606	M	0.74881	2.28	0.09310	N	0.999992	B	0.23442	0.085	B	0.24974	0.057	T	0.51772	-0.8663	10	0.87932	D	0	-7.7884	8.882	0.35380	0.7682:0.0:0.2318:0.0	.	25	Q5VYY1	ANR22_HUMAN	G	25	ENSP00000360998:V25G	ENSP00000360998:V25G	V	-	2	0	ANKRD22	90581711	0.945000	0.32115	0.050000	0.19076	0.523000	0.34469	2.694000	0.47035	0.371000	0.24564	-0.441000	0.05720	GTG	ANKRD22	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000152766		0.488	ANKRD22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD22	HGNC	protein_coding	OTTHUMT00000049262.1	103	0.00	0	A	NM_144590		90591731	90591731	-1	no_errors	ENST00000371930	ensembl	human	known	69_37n	missense	40	45.21	33	SNP	0.023	C
ANKS1A	23294	genome.wustl.edu	37	6	35050934	35050934	+	Silent	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:35050934T>C	ENST00000360359.3	+	19	2976	c.2838T>C	c.(2836-2838)taT>taC	p.Y946Y	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	946	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCCCACAGTATCTGGGCTCCA	0.582																																						dbGAP											0													60.0	52.0	55.0					6																	35050934		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.2838T>C	6.37:g.35050934T>C			A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTyr_interaction_dom,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTyr_interaction_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTyr_interaction_dom,pfscan_SAM,prints_Ankyrin_rpt	p.Y946	ENST00000360359.3	37	c.2838	CCDS4798.1	6																																																																																			ANKS1A	-	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	ENSG00000064999		0.582	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS1A	HGNC	protein_coding	OTTHUMT00000040262.1	46	0.00	0	T	XM_166478		35050934	35050934	+1	no_errors	ENST00000360359	ensembl	human	known	69_37n	silent	32	30.43	14	SNP	0.867	C
ANLN	54443	genome.wustl.edu	37	7	36450289	36450289	+	Silent	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr7:36450289C>G	ENST00000265748.2	+	6	1484	c.1263C>G	c.(1261-1263)acC>acG	p.T421T	ANLN_ENST00000495714.1_3'UTR|ANLN_ENST00000396068.2_Silent_p.T421T	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	421	Interaction with F-actin.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						CATCTACTACCCATTTAGCAC	0.418																																						dbGAP											0													182.0	164.0	170.0					7																	36450289		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.1263C>G	7.37:g.36450289C>G			Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T421	ENST00000265748.2	37	c.1263	CCDS5447.1	7																																																																																			ANLN	-	NULL	ENSG00000011426		0.418	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANLN	HGNC	protein_coding	OTTHUMT00000218582.3	56	0.00	0	C	NM_018685		36450289	36450289	+1	no_errors	ENST00000265748	ensembl	human	known	69_37n	silent	47	25.40	16	SNP	0.110	G
BUB1B	701	genome.wustl.edu	37	15	40491905	40491905	+	Missense_Mutation	SNP	C	C	G	rs75763304		TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr15:40491905C>G	ENST00000287598.6	+	10	1573	c.1378C>G	c.(1378-1380)Cag>Gag	p.Q460E	BUB1B_ENST00000412359.3_Missense_Mutation_p.Q474E	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	460					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		CCAAACTACTCAGCAAGAAAG	0.323			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																													dbGAP	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0													113.0	119.0	117.0					15																	40491905		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.1378C>G	15.37:g.40491905C>G	ENSP00000287598:p.Gln460Glu		B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I	p.Q474E	ENST00000287598.6	37	c.1420	CCDS10053.1	15	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093112	0.56075	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.40476	1.03;1.03	5.48	5.48	0.80851	.	0.251821	0.34460	N	0.003949	T	0.46444	0.1393	M	0.62723	1.935	0.26436	N	0.975853	P;P	0.52692	0.955;0.85	P;B	0.51657	0.676;0.392	T	0.42396	-0.9454	10	0.07325	T	0.83	-11.8265	12.2992	0.54864	0.2809:0.7191:0.0:0.0	.	474;460	O60566-3;O60566	.;BUB1B_HUMAN	E	460;474;406	ENSP00000287598:Q460E;ENSP00000398470:Q474E	ENSP00000287598:Q460E	Q	+	1	0	BUB1B	38279197	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.766000	0.47629	2.563000	0.86464	0.655000	0.94253	CAG	BUB1B	-	NULL	ENSG00000156970		0.323	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	HGNC	protein_coding	OTTHUMT00000252122.4	25	0.00	0	C			40491905	40491905	+1	no_errors	ENST00000412359	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.999	G
BUB1B	701	genome.wustl.edu	37	15	40498656	40498656	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr15:40498656T>C	ENST00000287598.6	+	15	2201	c.2006T>C	c.(2005-2007)cTg>cCg	p.L669P	BUB1B_ENST00000412359.3_Missense_Mutation_p.L683P	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	669					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		ATCAAGAAGCTGAGGTGATTG	0.418			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																													dbGAP	yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0													97.0	103.0	101.0					15																	40498656		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2006T>C	15.37:g.40498656T>C	ENSP00000287598:p.Leu669Pro		B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I	p.L683P	ENST00000287598.6	37	c.2048	CCDS10053.1	15	.	.	.	.	.	.	.	.	.	.	T	21.0	4.083015	0.76642	.	.	ENSG00000156970	ENST00000287598;ENST00000412359	T;T	0.27890	1.67;1.64	5.51	5.51	0.81932	.	0.110120	0.39210	N	0.001431	T	0.55832	0.1945	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.59804	-0.7385	10	0.72032	D	0.01	-2.6617	15.6014	0.76628	0.0:0.0:0.0:1.0	.	683;669	O60566-3;O60566	.;BUB1B_HUMAN	P	669;683	ENSP00000287598:L669P;ENSP00000398470:L683P	ENSP00000287598:L669P	L	+	2	0	BUB1B	38285948	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	5.316000	0.65815	2.080000	0.62538	0.482000	0.46254	CTG	BUB1B	-	NULL	ENSG00000156970		0.418	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	HGNC	protein_coding	OTTHUMT00000252122.4	105	0.00	0	T			40498656	40498656	+1	no_errors	ENST00000412359	ensembl	human	known	69_37n	missense	76	31.53	35	SNP	1.000	C
C1orf127	148345	genome.wustl.edu	37	1	11026510	11026510	+	5'UTR	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:11026510A>G	ENST00000377008.4	-	0	276				C1orf127_ENST00000377004.4_Missense_Mutation_p.S93P			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127											NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		GCAAGAGAAGAATCCAGGTGG	0.522																																						dbGAP											0													45.0	42.0	43.0					1																	11026510		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.-171T>C	1.37:g.11026510A>G			A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	superfamily_DNA-bd_dom_put	p.S93P	ENST00000377008.4	37	c.277		1	.	.	.	.	.	.	.	.	.	.	A	7.791	0.711625	0.15306	.	.	ENSG00000175262	ENST00000377004	T	0.27557	1.66	3.88	-4.62	0.03370	.	.	.	.	.	T	0.19886	0.0478	N	0.19112	0.55	0.22489	N	0.999055	.	.	.	.	.	.	T	0.31503	-0.9941	7	0.30078	T	0.28	.	11.4305	0.50038	0.3469:0.0:0.6531:0.0	.	.	.	.	P	93	ENSP00000366203:S93P	ENSP00000366203:S93P	S	-	1	0	C1orf127	10949097	0.045000	0.20229	0.003000	0.11579	0.091000	0.18340	-0.085000	0.11250	-1.007000	0.03408	-0.376000	0.06991	TCT	C1orf127	-	NULL	ENSG00000175262		0.522	C1orf127-202	KNOWN	basic	protein_coding	C1orf127	HGNC	protein_coding		40	0.00	0	A	NM_173507		11026510	11026510	-1	no_errors	ENST00000377004	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.001	G
C1orf61	10485	genome.wustl.edu	37	1	156386464	156386464	+	Intron	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:156386464C>T	ENST00000368243.1	-	3	188					NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61							nucleus (GO:0005634)				large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					TTCTGCCACGCGGACTCCAAC	0.458																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.71+96G>A	1.37:g.156386464C>T			B1ALL5|B1ALL8	RNA	SNP	-	NULL	ENST00000368243.1	37	NULL	CCDS1142.1	1																																																																																			C1orf61	-	-	ENSG00000125462		0.458	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf61	HGNC	protein_coding	OTTHUMT00000075988.1	22	0.00	0	C	NM_006365		156386464	156386464	-1	no_errors	ENST00000462458	ensembl	human	known	69_37n	rna	19	47.22	17	SNP	0.000	T
C2orf71	388939	genome.wustl.edu	37	2	29295688	29295688	+	Silent	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr2:29295688A>G	ENST00000331664.5	-	1	1439	c.1440T>C	c.(1438-1440)tcT>tcC	p.S480S		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	480					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TGTCACTAAGAGATGAAGCGT	0.532																																						dbGAP											0													82.0	83.0	83.0					2																	29295688		2060	4229	6289	-	-	-	SO:0001819	synonymous_variant	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1440T>C	2.37:g.29295688A>G				Silent	SNP	NULL	p.S480	ENST00000331664.5	37	c.1440	CCDS42669.1	2																																																																																			C2orf71	-	NULL	ENSG00000179270		0.532	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	121	0.00	0	A	NM_001029883		29295688	29295688	-1	no_errors	ENST00000331664	ensembl	human	novel	69_37n	silent	158	15.87	30	SNP	0.005	G
DCANP1	140947	genome.wustl.edu	37	5	134782577	134782577	+	Silent	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr5:134782577T>C	ENST00000503143.2	-	1	461	c.222A>G	c.(220-222)aaA>aaG	p.K74K	TIFAB_ENST00000537858.1_3'UTR	NM_130848.2	NP_570900.1	Q8TF63	DCNP1_HUMAN		74						nucleus (GO:0005634)				endometrium(1)|lung(1)|prostate(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTGGCAAGGTTTTGTTCCTCC	0.597																																						dbGAP											0													29.0	32.0	31.0					5																	134782577		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000503143.2:c.222A>G	5.37:g.134782577T>C				Silent	SNP	NULL	p.K74	ENST00000503143.2	37	c.222	CCDS4186.1	5																																																																																			C5orf20	-	NULL	ENSG00000251380		0.597	C5orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf20	HGNC	protein_coding	OTTHUMT00000372531.1	43	0.00	0	T			134782577	134782577	-1	no_errors	ENST00000503143	ensembl	human	known	69_37n	silent	17	46.88	15	SNP	0.001	C
CASP9	842	genome.wustl.edu	37	1	15844722	15844722	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:15844722G>C	ENST00000333868.5	-	2	395	c.301C>G	c.(301-303)Cca>Gca	p.P101A	CASP9_ENST00000469637.1_5'UTR|CASP9_ENST00000546424.1_Missense_Mutation_p.P101A|CASP9_ENST00000375890.4_Missense_Mutation_p.P18A|CASP9_ENST00000348549.5_Missense_Mutation_p.P101A	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	101					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		TCTAGGGTTGGCTTCGACAAC	0.522																																						dbGAP											0													123.0	107.0	112.0					1																	15844722		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.301C>G	1.37:g.15844722G>C	ENSP00000330237:p.Pro101Ala		B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Missense_Mutation	SNP	pfam_Pept_C14_cat,pfam_CARD,superfamily_DEATH-like,smart_CARD,smart_Pept_C14_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.P101A	ENST00000333868.5	37	c.301	CCDS158.1	1	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806143	0.31961	.	.	ENSG00000132906	ENST00000546424;ENST00000333868;ENST00000348549;ENST00000375890;ENST00000447522;ENST00000440484	T;T;T;T;T;T	0.07908	4.7;4.73;3.15;4.62;3.95;3.66	4.8	-1.01	0.10169	.	3.120320	0.00465	N	0.000115	T	0.07638	0.0192	L	0.50333	1.59	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.08055	0.002;0.001;0.003	T	0.31696	-0.9934	10	0.08381	T	0.77	.	2.8055	0.05426	0.0887:0.3211:0.3041:0.2862	.	101;101;101	P55211-2;P55211;F8VVS7	.;CASP9_HUMAN;.	A	101;101;101;18;18;101	ENSP00000449584:P101A;ENSP00000330237:P101A;ENSP00000255256:P101A;ENSP00000365051:P18A;ENSP00000396540:P18A;ENSP00000411304:P101A	ENSP00000330237:P101A	P	-	1	0	CASP9	15717309	0.005000	0.15991	0.000000	0.03702	0.122000	0.20287	0.306000	0.19279	-0.247000	0.09597	0.514000	0.50259	CCA	CASP9	-	pirsf_Caspase_IL-1_beta	ENSG00000132906		0.522	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP9	HGNC	protein_coding	OTTHUMT00000006438.1	162	0.00	0	G	NM_032996		15844722	15844722	-1	no_errors	ENST00000333868	ensembl	human	known	69_37n	missense	125	24.70	41	SNP	0.000	C
CCPG1	9236	genome.wustl.edu	37	15	55664092	55664092	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr15:55664092G>T	ENST00000310958.6	-	6	903	c.605C>A	c.(604-606)cCt>cAt	p.P202H	CCPG1_ENST00000569205.1_Missense_Mutation_p.P202H|MIR628_ENST00000385229.1_RNA|CCPG1_ENST00000442196.3_Missense_Mutation_p.P202H|DYX1C1-CCPG1_ENST00000565113.1_RNA|CCPG1_ENST00000425574.3_Missense_Mutation_p.P202H	NM_001204450.1|NM_001204451.1|NM_004748.4|NM_020739.3	NP_001191379.1|NP_001191380.1|NP_004739.3|NP_065790.2	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1	202	Interaction with MCF2L and SRC. {ECO:0000250}.				cell cycle (GO:0007049)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001106)	integral component of membrane (GO:0016021)				autonomic_ganglia(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|stomach(3)	30				all cancers(107;0.0354)		CTCCTTAGAAGGTTCAGTTTC	0.448																																						dbGAP											0													108.0	99.0	102.0					15																	55664092		1878	4109	5987	-	-	-	SO:0001583	missense	0			AF212228	CCDS42039.1, CCDS55966.1, CCDS55967.1	15q21.1	2011-04-20				ENSG00000260916			24227	protein-coding gene	gene with protein product		611326				9383053, 10574462	Standard	NM_004748		Approved	KIAA1254, CPR8	uc010bfk.2	Q9ULG6		ENST00000310958.6:c.605C>A	15.37:g.55664092G>T	ENSP00000311656:p.Pro202His		A0PJH3|A8K9T0|O14712|Q05DG4|Q5U5S7|Q8IYV8|Q9BY53|Q9HA17	Missense_Mutation	SNP	NULL	p.P202H	ENST00000310958.6	37	c.605	CCDS42039.1	15	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113790	0.56398	.	.	ENSG00000256061	ENST00000310958;ENST00000442196;ENST00000425574	T;T;T	0.35973	3.62;3.63;1.28	5.74	4.81	0.61882	.	0.428189	0.27981	N	0.017064	T	0.61060	0.2317	M	0.73962	2.25	0.09310	N	0.999997	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.979;0.971	T	0.58929	-0.7549	10	0.87932	D	0	.	15.6664	0.77234	0.0:0.1374:0.8626:0.0	.	202;202;202;58	A8K9T0;Q9ULG6-3;Q9ULG6;Q9ULG6-2	.;.;CCPG1_HUMAN;.	H	202	ENSP00000311656:P202H;ENSP00000403400:P202H;ENSP00000415128:P202H	ENSP00000311656:P202H	P	-	2	0	DYX1C1	53451384	0.951000	0.32395	0.014000	0.15608	0.606000	0.37113	4.158000	0.58150	1.392000	0.46585	0.655000	0.94253	CCT	CCPG1	-	NULL	ENSG00000260916		0.448	CCPG1-001	KNOWN	basic|CCDS	protein_coding	CCPG1	HGNC	protein_coding	OTTHUMT00000419850.1	42	0.00	0	G	NM_004748		55664092	55664092	-1	no_errors	ENST00000310958	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.018	T
CDH23	64072	genome.wustl.edu	37	10	73556871	73556871	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr10:73556871G>C	ENST00000224721.6	+	48	6743	c.6738G>C	c.(6736-6738)atG>atC	p.M2246I	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Start_Codon_SNP_p.M1I	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2241	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GATCTGTAATGGTGAAGTCCC	0.567																																						dbGAP											0													52.0	52.0	52.0					10																	73556871		1950	4149	6099	-	-	-	SO:0001583	missense	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.6738G>C	10.37:g.73556871G>C	ENSP00000224721:p.Met2246Ile		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.M2244I	ENST00000224721.6	37	c.6732		10	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177579	0.38413	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.54479	0.57	5.87	1.74	0.24563	Cadherin (4);Cadherin-like (1);	0.466822	0.25686	N	0.028968	T	0.25531	0.0621	N	0.08118	0	0.22424	N	0.999112	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10359	-1.0633	10	0.33141	T	0.24	.	4.0287	0.09700	0.1245:0.1117:0.533:0.2308	.	2241;2241	E9PEX1;Q9H251	.;CAD23_HUMAN	I	2246;2241;2244;1	ENSP00000381768:M1I	ENSP00000224721:M2246I	M	+	3	0	CDH23	73226877	1.000000	0.71417	0.965000	0.40720	0.931000	0.56810	1.580000	0.36547	0.058000	0.16222	0.655000	0.94253	ATG	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.567	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	110	0.00	0	G	NM_052836		73556871	73556871	+1	no_errors	ENST00000224721	ensembl	human	known	69_37n	missense	44	43.59	34	SNP	0.999	C
CDK5RAP3	80279	genome.wustl.edu	37	17	46057970	46057970	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr17:46057970C>A	ENST00000338399.4	+	12	1195	c.1089C>A	c.(1087-1089)ttC>ttA	p.F363L	CDK5RAP3_ENST00000578663.1_3'UTR|RP11-6N17.10_ENST00000578239.1_RNA|CDK5RAP3_ENST00000536708.2_Missense_Mutation_p.F388L	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	363					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						TTGAGATCTTCTTAGCCCAGA	0.547																																						dbGAP											0													213.0	209.0	211.0					17																	46057970		2082	4215	6297	-	-	-	SO:0001583	missense	0			AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.1089C>A	17.37:g.46057970C>A	ENSP00000344683:p.Phe363Leu		B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Missense_Mutation	SNP	pfam_DUF773	p.F363L	ENST00000338399.4	37	c.1089	CCDS42356.1	17	.	.	.	.	.	.	.	.	.	.	C	26.8	4.767764	0.90020	.	.	ENSG00000108465	ENST00000536708;ENST00000338399	T;T	0.67171	-0.25;-0.25	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.86435	0.5932	M	0.92317	3.295	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.998;0.999	D	0.89490	0.3756	10	0.87932	D	0	-21.9569	18.1139	0.89545	0.0:1.0:0.0:0.0	.	388;276;363;138	F5H3I5;Q96JB5-2;Q96JB5;Q96JB5-3	.;.;CK5P3_HUMAN;.	L	388;363	ENSP00000438886:F388L;ENSP00000344683:F363L	ENSP00000344683:F363L	F	+	3	2	CDK5RAP3	43412969	1.000000	0.71417	1.000000	0.80357	0.611000	0.37282	4.459000	0.60102	2.579000	0.87056	0.655000	0.94253	TTC	CDK5RAP3	-	pfam_DUF773	ENSG00000108465		0.547	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	HGNC	protein_coding	OTTHUMT00000442913.1	80	0.00	0	C	NM_176096		46057970	46057970	+1	no_errors	ENST00000338399	ensembl	human	known	69_37n	missense	71	29.70	30	SNP	1.000	A
CKAP5	9793	genome.wustl.edu	37	11	46775039	46775039	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr11:46775039C>G	ENST00000529230.1	-	37	4924	c.4878G>C	c.(4876-4878)caG>caC	p.Q1626H	CKAP5_ENST00000354558.3_Missense_Mutation_p.Q1566H|CKAP5_ENST00000415402.1_Missense_Mutation_p.Q1626H|CKAP5_ENST00000312055.5_Missense_Mutation_p.Q1566H|MIR5582_ENST00000579697.1_RNA			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1626					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GGCTCTCTATCTGAAACAGCT	0.428																																					Ovarian(4;85 273 2202 4844 13323)	dbGAP											0													84.0	83.0	84.0					11																	46775039		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.4878G>C	11.37:g.46775039C>G	ENSP00000432768:p.Gln1626His		Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.Q1626H	ENST00000529230.1	37	c.4878	CCDS31477.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.27|15.27	2.783439|2.783439	0.49891|0.49891	.|.	.|.	ENSG00000175216|ENSG00000175216	ENST00000527333|ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558;ENST00000526876	.|T;T;T;T	.|0.51325	.|0.8;0.82;0.71;0.71	5.72|5.72	4.82|4.82	0.62117|0.62117	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.108387	.|0.64402	.|D	.|0.000003	T|T	0.47488|0.47488	0.1448|0.1448	N|N	0.17474|0.17474	0.49|0.49	0.20764|0.20764	N|N	0.99986|0.99986	.|D;D;P	.|0.64830	.|0.994;0.969;0.947	.|P;P;P	.|0.59643	.|0.861;0.742;0.556	T|T	0.42932|0.42932	-0.9422|-0.9422	5|10	.|0.28530	.|T	.|0.3	-21.9791|-21.9791	14.6894|14.6894	0.69072|0.69072	0.0:0.9305:0.0:0.0695|0.0:0.9305:0.0:0.0695	.|.	.|1626;1566;1626	.|Q14008-3;Q14008-2;Q14008	.|.;.;CKAP5_HUMAN	H|H	155|1626;1626;1566;1566;357	.|ENSP00000432768:Q1626H;ENSP00000395302:Q1626H;ENSP00000310227:Q1566H;ENSP00000346566:Q1566H	.|ENSP00000310227:Q1566H	D|Q	-|-	1|3	0|2	CKAP5|CKAP5	46731615|46731615	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.946000|0.946000	0.59487|0.59487	1.921000|1.921000	0.40035|0.40035	1.428000|1.428000	0.47296|0.47296	-0.136000|-0.136000	0.14681|0.14681	GAT|CAG	CKAP5	-	superfamily_ARM-type_fold	ENSG00000175216		0.428	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	HGNC	protein_coding	OTTHUMT00000390679.1	36	0.00	0	C	NM_014756		46775039	46775039	-1	no_errors	ENST00000415402	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	1.000	G
CNNM2	54805	genome.wustl.edu	37	10	104809536	104809536	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr10:104809536G>A	ENST00000369878.4	+	2	1882	c.1694G>A	c.(1693-1695)gGa>gAa	p.G565E	CNNM2_ENST00000433628.2_Missense_Mutation_p.G565E	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	565	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)	p.G565E(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GAAGTTCTGGGAATCGTCACC	0.388																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											158.0	155.0	156.0					10																	104809536		1880	4141	6021	-	-	-	SO:0001583	missense	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1694G>A	10.37:g.104809536G>A	ENSP00000358894:p.Gly565Glu		Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.G565E	ENST00000369878.4	37	c.1694	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.117431	0.94385	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369878;ENST00000345419	D;D	0.99594	-6.25;-6.25	5.61	5.61	0.85477	Cystathionine beta-synthase, core (1);	0.000000	0.85682	D	0.000000	D	0.99846	0.9929	H	0.98936	4.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96607	0.9449	10	0.87932	D	0	.	19.6562	0.95842	0.0:0.0:1.0:0.0	.	565;565	Q9H8M5-2;Q9H8M5	.;CNNM2_HUMAN	E	565	ENSP00000392875:G565E;ENSP00000358894:G565E	ENSP00000286899:G565E	G	+	2	0	CNNM2	104799526	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	9.363000	0.97131	2.639000	0.89480	0.555000	0.69702	GGA	CNNM2	-	NULL	ENSG00000148842		0.388	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	72	0.00	0	G	NM_017649		104809536	104809536	+1	no_errors	ENST00000457502	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	1.000	A
COA1	55744	genome.wustl.edu	37	7	43680287	43680287	+	Intron	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr7:43680287G>C	ENST00000395879.1	-	4	1946				COA1_ENST00000488813.1_5'UTR|COA1_ENST00000395880.3_Intron|COA1_ENST00000310564.6_Intron|COA1_ENST00000223336.6_Intron			Q9GZY4	COA1_HUMAN	cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)						mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)	cytoplasm (GO:0005737)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrion (GO:0005739)											GATGTAATTGGATAATTATTG	0.403																																						dbGAP											0													55.0	55.0	55.0					7																	43680287		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK001665	CCDS5471.1	7p13	2012-12-05	2012-10-15	2012-06-25	ENSG00000106603	ENSG00000106603		"""Mitochondrial respiratory chain complex assembly factors"""	21868	protein-coding gene	gene with protein product		614769	"""chromosome 7 open reading frame 44"""	C7orf44		22356826	Standard	NM_018224		Approved	FLJ10803, MITRAC15	uc003tin.2	Q9GZY4	OTTHUMG00000128949	ENST00000395879.1:c.265-39C>G	7.37:g.43680287G>C			A6NJU8|A8KAH8|Q9HAB7|Q9NVD2	RNA	SNP	-	NULL	ENST00000395879.1	37	NULL	CCDS5471.1	7																																																																																			COA1	-	-	ENSG00000106603		0.403	COA1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COA1	HGNC	protein_coding	OTTHUMT00000313664.1	21	0.00	0	G	NM_018224		43680287	43680287	-1	no_errors	ENST00000488813	ensembl	human	known	69_37n	rna	17	34.62	9	SNP	0.000	C
CPA6	57094	genome.wustl.edu	37	8	68397009	68397009	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr8:68397009T>C	ENST00000297770.4	-	7	867	c.652A>G	c.(652-654)Aag>Gag	p.K218E	CPA6_ENST00000518549.1_Missense_Mutation_p.K218E|CPA6_ENST00000297769.4_Missense_Mutation_p.K70E	NM_020361.4	NP_065094.3	Q8N4T0	CBPA6_HUMAN	carboxypeptidase A6	218						proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(5)	26			Epithelial(68;0.04)|OV - Ovarian serous cystadenocarcinoma(28;0.0593)|all cancers(69;0.136)			GGGTCACTCTTATATGTTAGA	0.353																																						dbGAP											0													80.0	71.0	74.0					8																	68397009		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF221594	CCDS6200.1	8q12.3	2012-02-10			ENSG00000165078	ENSG00000165078			17245	protein-coding gene	gene with protein product		609562				11836249	Standard	NM_020361		Approved	CPAH	uc003xxq.4	Q8N4T0	OTTHUMG00000164575	ENST00000297770.4:c.652A>G	8.37:g.68397009T>C	ENSP00000297770:p.Lys218Glu		Q8NEX8|Q8TDE8|Q9NRI9	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.K218E	ENST00000297770.4	37	c.652	CCDS6200.1	8	.	.	.	.	.	.	.	.	.	.	T	11.37	1.619420	0.28801	.	.	ENSG00000165078	ENST00000297769;ENST00000297770;ENST00000518549	T;T;T	0.28255	1.62;1.62;3.98	5.25	1.45	0.22620	Peptidase M14, carboxypeptidase A (2);	0.176985	0.50627	D	0.000101	T	0.16471	0.0396	N	0.17594	0.5	0.24732	N	0.993082	B;B;B	0.27140	0.169;0.114;0.001	B;B;B	0.24006	0.05;0.033;0.003	T	0.21552	-1.0242	10	0.15499	T	0.54	.	12.5306	0.56113	0.0:0.0:0.6542:0.3458	.	218;70;218	Q8N4T0-2;Q8N4T0-3;Q8N4T0	.;.;CBPA6_HUMAN	E	70;218;218	ENSP00000297769:K70E;ENSP00000297770:K218E;ENSP00000431112:K218E	ENSP00000297769:K70E	K	-	1	0	CPA6	68559563	1.000000	0.71417	0.326000	0.25389	0.650000	0.38633	2.212000	0.42835	0.388000	0.25054	-0.332000	0.08345	AAG	CPA6	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000165078		0.353	CPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA6	HGNC	protein_coding	OTTHUMT00000379296.2	27	0.00	0	T	NM_020361		68397009	68397009	-1	no_errors	ENST00000297770	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	0.998	C
DAPK2	23604	genome.wustl.edu	37	15	64200774	64200774	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr15:64200774T>C	ENST00000457488.1	-	12	1088	c.1058A>G	c.(1057-1059)gAg>gGg	p.E353G	DAPK2_ENST00000261891.3_Missense_Mutation_p.E353G	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	353					anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		GGCGATGTCCTCCTCAGTGTC	0.612																																						dbGAP											0													50.0	36.0	41.0					15																	64200774		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.1058A>G	15.37:g.64200774T>C	ENSP00000408277:p.Glu353Gly		E9JGM7|O75892|Q24JS1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E353G	ENST00000457488.1	37	c.1058	CCDS10188.1	15	.	.	.	.	.	.	.	.	.	.	T	18.03	3.532120	0.64972	.	.	ENSG00000035664	ENST00000261891;ENST00000457488	T;T	0.69435	-0.4;-0.4	5.26	5.26	0.73747	.	0.000000	0.56097	D	0.000022	T	0.61800	0.2376	L	0.47716	1.5	0.49582	D	0.999808	B	0.28900	0.227	B	0.32211	0.142	T	0.64512	-0.6390	10	0.87932	D	0	.	12.5593	0.56271	0.0:0.0:0.0:1.0	.	353	Q9UIK4	DAPK2_HUMAN	G	353	ENSP00000261891:E353G;ENSP00000408277:E353G	ENSP00000261891:E353G	E	-	2	0	DAPK2	61987827	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.293000	0.65680	1.991000	0.58162	0.533000	0.62120	GAG	DAPK2	-	NULL	ENSG00000035664		0.612	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK2	HGNC	protein_coding	OTTHUMT00000256479.1	87	0.00	0	T	NM_014326		64200774	64200774	-1	no_errors	ENST00000261891	ensembl	human	known	69_37n	missense	102	20.31	26	SNP	1.000	C
DDB2	1643	genome.wustl.edu	37	11	47237948	47237948	+	Silent	SNP	G	G	A	rs191773047		TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr11:47237948G>A	ENST00000256996.4	+	2	384	c.189G>A	c.(187-189)ctG>ctA	p.L63L	DDB2_ENST00000378601.3_Silent_p.L63L|DDB2_ENST00000378600.3_Silent_p.L63L|DDB2_ENST00000378603.3_Silent_p.L63L	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	63					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						CACAGATCCTGCCACCATGCC	0.562			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	0													67.0	67.0	67.0					11																	47237948		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.189G>A	11.37:g.47237948G>A			B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L63	ENST00000256996.4	37	c.189	CCDS7927.1	11																																																																																			DDB2	-	NULL	ENSG00000134574		0.562	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DDB2	HGNC	protein_coding		43	0.00	0	G	NM_000107		47237948	47237948	+1	no_errors	ENST00000256996	ensembl	human	known	69_37n	silent	35	30.00	15	SNP	0.000	A
DFNA5	1687	genome.wustl.edu	37	7	24745946	24745946	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr7:24745946T>C	ENST00000342947.3	-	8	1465	c.1040A>G	c.(1039-1041)gAg>gGg	p.E347G	DFNA5_ENST00000545231.1_Missense_Mutation_p.E183G|DFNA5_ENST00000409775.3_Missense_Mutation_p.E347G|DFNA5_ENST00000419307.1_Missense_Mutation_p.E183G|DFNA5_ENST00000409970.1_Missense_Mutation_p.E183G	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	347					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						GGGCTTCAGCTCCCCCAGCAC	0.662																																					GBM(78;184 1250 20134 20900 23600)	dbGAP											0													22.0	24.0	24.0					7																	24745946		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.1040A>G	7.37:g.24745946T>C	ENSP00000339587:p.Glu347Gly		A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	pfam_Gasdermin	p.E347G	ENST00000342947.3	37	c.1040	CCDS5389.1	7	.	.	.	.	.	.	.	.	.	.	T	18.27	3.587505	0.66105	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	5.14	2.78	0.32641	.	0.606781	0.17825	N	0.160736	T	0.38427	0.1040	M	0.75447	2.3	0.38643	D	0.95164	P	0.43231	0.801	P	0.51550	0.673	T	0.24225	-1.0166	10	0.56958	D	0.05	-14.6402	7.3907	0.26909	0.0:0.1747:0.0:0.8253	.	347	O60443	DFNA5_HUMAN	G	347;183;183;183;347	ENSP00000339587:E347G;ENSP00000401332:E183G;ENSP00000442661:E183G;ENSP00000387119:E183G;ENSP00000386670:E347G	ENSP00000339587:E347G	E	-	2	0	DFNA5	24712471	0.759000	0.28416	0.613000	0.29037	0.059000	0.15707	1.370000	0.34238	0.431000	0.26258	0.460000	0.39030	GAG	DFNA5	-	pfam_Gasdermin	ENSG00000105928		0.662	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNA5	HGNC	protein_coding	OTTHUMT00000214060.2	41	0.00	0	T	NM_004403		24745946	24745946	-1	no_errors	ENST00000342947	ensembl	human	known	69_37n	missense	15	55.88	19	SNP	0.956	C
DIAPH2	1730	genome.wustl.edu	37	X	96200577	96200577	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:96200577A>G	ENST00000324765.8	+	14	1843	c.1496A>G	c.(1495-1497)gAg>gGg	p.E499G	DIAPH2_ENST00000355827.4_Missense_Mutation_p.E499G|DIAPH2_ENST00000373061.3_Missense_Mutation_p.E499G|DIAPH2_ENST00000373049.4_Missense_Mutation_p.E499G|DIAPH2_ENST00000373054.4_Missense_Mutation_p.E495G			O60879	DIAP2_HUMAN	diaphanous-related formin 2	499					actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						AAAGCTGCAGAGTTTTCAAAG	0.313																																						dbGAP											0													65.0	63.0	64.0					X																	96200577		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.1496A>G	X.37:g.96200577A>G	ENSP00000321348:p.Glu499Gly		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.E499G	ENST00000324765.8	37	c.1496	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	A	12.47	1.947323	0.34377	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	5.27	5.27	0.74061	.	0.063063	0.64402	D	0.000010	T	0.58566	0.2131	M	0.89095	3.005	0.50467	D	0.999871	D;D	0.71674	0.998;0.989	D;P	0.63381	0.914;0.818	T	0.67677	-0.5609	10	0.87932	D	0	.	13.1838	0.59670	1.0:0.0:0.0:0.0	.	499;499	O60879;O60879-2	DIAP2_HUMAN;.	G	499;495;499;499;499;506	ENSP00000362152:E499G;ENSP00000362145:E495G;ENSP00000348082:E499G;ENSP00000362140:E499G;ENSP00000321348:E499G	ENSP00000321348:E499G	E	+	2	0	DIAPH2	96087233	1.000000	0.71417	0.396000	0.26296	0.201000	0.24016	7.575000	0.82447	1.860000	0.53959	0.486000	0.48141	GAG	DIAPH2	-	NULL	ENSG00000147202		0.313	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	64	0.00	0	A	NM_006729, NM_007309		96200577	96200577	+1	no_errors	ENST00000324765	ensembl	human	known	69_37n	missense	62	18.42	14	SNP	0.993	G
DIO3OS	64150	genome.wustl.edu	37	14	102024322	102024322	+	lincRNA	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr14:102024322G>T	ENST00000408206.1	-	0	272					NR_031649.1				DIO3 opposite strand/antisense RNA (head to head)																		GTCCGGCGGGGGGGTCCGCAC	0.647																																						dbGAP											0																																										-	-	-			0			AF305836		14q32.31	2012-10-19	2012-10-15	2011-11-14		ENSG00000258498		"""Long non-coding RNAs"", ""-"""	20348	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 41"""	608523	"""chromosome 14 open reading frame 134"", ""deiodinase, iodothyronine, type III opposite strand"", ""DIO3 opposite strand/antisense RNA"""	C14orf134		14962667	Standard	NR_002770		Approved	NCRNA00041, DIO3-AS1	uc001yke.3		OTTHUMG00000171682		14.37:g.102024322G>T				RNA	SNP	-	NULL	ENST00000408206.1	37	NULL		14																																																																																			DIO3OS	-	-	ENSG00000258498		0.647	DIO3OS-201	KNOWN	basic	miRNA	DIO3OS	HGNC	lincRNA		55	0.00	0	G	NR_002770		102024322	102024322	-1	no_errors	ENST00000554735	ensembl	human	known	69_37n	rna	40	23.08	12	SNP	0.000	T
DOCK9	23348	genome.wustl.edu	37	13	99478200	99478200	+	Intron	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr13:99478200C>G	ENST00000376460.1	-	45	5035				DOCK9_ENST00000339416.2_Intron|DOCK9_ENST00000448493.2_Intron	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9						blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGCTTCTAAACATGAGGAAAT	0.537																																						dbGAP											0													19.0	22.0	21.0					13																	99478200		1874	4093	5967	-	-	-	SO:0001627	intron_variant	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.4955-6G>C	13.37:g.99478200C>G			B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	RNA	SNP	-	NULL	ENST00000376460.1	37	NULL	CCDS45062.1	13																																																																																			DOCK9	-	-	ENSG00000088387		0.537	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	73	0.00	0	C	NM_015296		99478200	99478200	-1	no_errors	ENST00000481051	ensembl	human	known	69_37n	rna	34	35.85	19	SNP	0.907	G
EFR3B	22979	genome.wustl.edu	37	2	25354666	25354666	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr2:25354666C>T	ENST00000403714.3	+	10	1216	c.1033C>T	c.(1033-1035)Ctc>Ttc	p.L345F	EFR3B_ENST00000402191.1_Missense_Mutation_p.L310F|EFR3B_ENST00000401432.3_Missense_Mutation_p.L345F|EFR3B_ENST00000405108.1_Missense_Mutation_p.L197F	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	345										endometrium(1)	1						GCAGCTGCGGCTCAGCATCGA	0.652																																						dbGAP											0													18.0	23.0	21.0					2																	25354666		689	1586	2275	-	-	-	SO:0001583	missense	0			AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.1033C>T	2.37:g.25354666C>T	ENSP00000384081:p.Leu345Phe		B7WPL8|Q86XU6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L345F	ENST00000403714.3	37	c.1033	CCDS46231.1	2	.	.	.	.	.	.	.	.	.	.	C	18.14	3.558151	0.65538	.	.	ENSG00000084710	ENST00000401432;ENST00000403714;ENST00000402191;ENST00000545169;ENST00000405108;ENST00000264719	T;T;T;T;T	0.66995	1.48;1.48;-0.24;3.57;1.47	4.28	4.28	0.50868	Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.70334	0.3212	L	0.52364	1.645	0.80722	D	1	D;B	0.63880	0.993;0.037	P;B	0.56700	0.804;0.067	T	0.65845	-0.6069	10	0.15066	T	0.55	-17.098	15.4574	0.75327	0.0:1.0:0.0:0.0	.	345;345	Q9Y2G0;Q9Y2G0-3	EFR3B_HUMAN;.	F	345;345;310;310;197;224	ENSP00000386082:L345F;ENSP00000384081:L345F;ENSP00000385832:L310F;ENSP00000384454:L197F;ENSP00000264719:L224F	ENSP00000264719:L224F	L	+	1	0	EFR3B	25208170	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.446000	0.80609	2.214000	0.71695	0.655000	0.94253	CTC	EFR3B	-	superfamily_ARM-type_fold	ENSG00000084710		0.652	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFR3B	HGNC	protein_coding	OTTHUMT00000324808.1	94	0.00	0	C	NM_014971		25354666	25354666	+1	no_errors	ENST00000403714	ensembl	human	known	69_37n	missense	108	13.60	17	SNP	1.000	T
EPC1	80314	genome.wustl.edu	37	10	32573961	32573961	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr10:32573961G>T	ENST00000263062.8	-	10	1678	c.1409C>A	c.(1408-1410)gCt>gAt	p.A470D	EPC1_ENST00000319778.6_Missense_Mutation_p.A470D|RP11-166N17.3_ENST00000419441.1_RNA|EPC1_ENST00000375110.2_Missense_Mutation_p.A420D	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	470					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				GTCTGAATGAGCTCTGTCCAG	0.348																																						dbGAP											0													78.0	77.0	77.0					10																	32573961		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1409C>A	10.37:g.32573961G>T	ENSP00000263062:p.Ala470Asp		B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.A470D	ENST00000263062.8	37	c.1409	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600556	0.87055	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.20332	2.08;2.08;2.08	5.98	5.98	0.97165	.	0.089007	0.85682	D	0.000000	T	0.40297	0.1111	M	0.76574	2.34	0.80722	D	1	P;P;B	0.50369	0.934;0.71;0.155	P;P;B	0.49637	0.617;0.501;0.241	T	0.17776	-1.0358	10	0.66056	D	0.02	-10.7202	20.4434	0.99119	0.0:0.0:1.0:0.0	.	420;470;470	Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;EPC1_HUMAN	D	420;470;470	ENSP00000364251:A420D;ENSP00000318559:A470D;ENSP00000263062:A470D	ENSP00000263062:A470D	A	-	2	0	EPC1	32613967	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.476000	0.97823	2.838000	0.97847	0.655000	0.94253	GCT	EPC1	-	NULL	ENSG00000120616		0.348	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	HGNC	protein_coding	OTTHUMT00000047484.1	30	0.00	0	G			32573961	32573961	-1	no_errors	ENST00000263062	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	1.000	T
ERBB4	2066	genome.wustl.edu	37	2	212288987	212288987	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr2:212288987G>C	ENST00000342788.4	-	23	3069	c.2759C>G	c.(2758-2760)cCc>cGc	p.P920R	ERBB4_ENST00000436443.1_Missense_Mutation_p.P920R|ERBB4_ENST00000402597.1_Missense_Mutation_p.P910R	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	920	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TCCATCATAGGGTTTTCCTCC	0.388										TSP Lung(8;0.080)																												dbGAP											0													104.0	99.0	101.0					2																	212288987		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2759C>G	2.37:g.212288987G>C	ENSP00000342235:p.Pro920Arg		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P920R	ENST00000342788.4	37	c.2759	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	G	28.0	4.882585	0.91740	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	D;D;D	0.88201	-2.35;-2.35;-2.35	6.16	6.16	0.99307	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97340	0.9130	H	0.98849	4.35	0.80722	D	1	D;D;D;D	0.76494	0.994;0.999;0.994;0.996	D;D;D;D	0.91635	0.988;0.999;0.988;0.993	D	0.97900	1.0302	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	910;910;920;920	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	R	920;920;910	ENSP00000342235:P920R;ENSP00000403204:P920R;ENSP00000385565:P910R	ENSP00000342235:P920R	P	-	2	0	ERBB4	211997232	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	CCC	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000178568		0.388	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	69	0.00	0	G	NM_001042599		212288987	212288987	-1	no_errors	ENST00000342788	ensembl	human	known	69_37n	missense	59	14.49	10	SNP	1.000	C
FARP2	9855	genome.wustl.edu	37	2	242381025	242381025	+	Intron	SNP	C	C	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr2:242381025C>A	ENST00000264042.3	+	13	1581				FARP2_ENST00000373287.4_Intron|FARP2_ENST00000545004.1_Intron	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TGCTGGGGGGCAGAGTTTCAG	0.602																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.1411+54C>A	2.37:g.242381025C>A			B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	pfam_FERM-adjacent	p.Q176K	ENST00000264042.3	37	c.526	CCDS33424.1	2	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349378	0.61183	.	.	ENSG00000006607	ENST00000413432	T	0.79845	-1.31	4.89	0.686	0.18015	.	.	.	.	.	T	0.72614	0.3482	.	.	.	0.30281	N	0.791305	.	.	.	.	.	.	T	0.64939	-0.6289	5	.	.	.	.	6.6503	0.22959	0.0:0.3788:0.4426:0.1786	.	.	.	.	K	176	ENSP00000412772:Q176K	.	Q	+	1	0	FARP2	242029698	0.810000	0.29049	0.040000	0.18447	0.255000	0.26057	0.682000	0.25335	0.113000	0.18004	0.655000	0.94253	CAG	FARP2	-	NULL	ENSG00000006607		0.602	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP2	HGNC	protein_coding	OTTHUMT00000323153.1	59	0.00	0	C			242381025	242381025	+1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000413432	ensembl	human	novel	69_37n	missense	39	27.78	15	SNP	0.542	A
FBXW7	55294	genome.wustl.edu	37	4	153271249	153271249	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr4:153271249C>G	ENST00000281708.4	-	3	1758	c.529G>C	c.(529-531)Gag>Cag	p.E177Q	FBXW7_ENST00000393956.3_5'Flank|FBXW7_ENST00000263981.5_Missense_Mutation_p.E97Q|FBXW7_ENST00000603841.1_Missense_Mutation_p.E177Q|FBXW7_ENST00000296555.5_Missense_Mutation_p.E59Q|FBXW7_ENST00000603548.1_Missense_Mutation_p.E177Q	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	177					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)			NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GAGCGGACCTCAGAACCATGG	0.308			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	0													27.0	28.0	28.0					4																	153271249		2195	4281	6476	-	-	-	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.529G>C	4.37:g.153271249C>G	ENSP00000281708:p.Glu177Gln		B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E177Q	ENST00000281708.4	37	c.529	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025222	0.75390	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981	T;T;T	0.59083	0.29;0.43;0.35	6.17	6.17	0.99709	.	0.099013	0.64402	D	0.000002	T	0.42245	0.1194	N	0.08118	0	0.80722	D	1	B;B;B	0.29301	0.048;0.039;0.241	B;B;B	0.28139	0.058;0.064;0.086	T	0.26950	-1.0088	10	0.30078	T	0.28	-22.7436	20.8794	0.99867	0.0:1.0:0.0:0.0	.	177;59;97	Q969H0;Q969H0-4;Q969H0-2	FBXW7_HUMAN;.;.	Q	177;59;97	ENSP00000281708:E177Q;ENSP00000296555:E59Q;ENSP00000263981:E97Q	ENSP00000263981:E97Q	E	-	1	0	FBXW7	153490699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.440000	0.80464	2.941000	0.99782	0.655000	0.94253	GAG	FBXW7	-	NULL	ENSG00000109670		0.308	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	47	0.00	0	C			153271249	153271249	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	G
FLNA	2316	genome.wustl.edu	37	X	153581202	153581202	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:153581202T>G	ENST00000369850.3	-	39	6553	c.6317A>C	c.(6316-6318)tAc>tCc	p.Y2106S	FLNA_ENST00000344736.4_Missense_Mutation_p.Y2066S|FLNA_ENST00000498491.1_5'Flank|FLNA_ENST00000422373.1_Missense_Mutation_p.Y2098S|FLNA_ENST00000360319.4_Missense_Mutation_p.Y2098S|FLNA_ENST00000369856.3_Missense_Mutation_p.Y239S	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	2106					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGTGGGGCAGTAGGTGACCCT	0.607																																						dbGAP											0													111.0	112.0	112.0					X																	153581202		2152	4241	6393	-	-	-	SO:0001583	missense	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.6317A>C	X.37:g.153581202T>G	ENSP00000358866:p.Tyr2106Ser		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.Y2106S	ENST00000369850.3	37	c.6317	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	T	19.93	3.917575	0.73098	.	.	ENSG00000196924	ENST00000360319;ENST00000422373;ENST00000369850;ENST00000369856;ENST00000344736;ENST00000444578	D;D;D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92;-3.92;-3.92	5.64	5.64	0.86602	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.98707	0.9566	H	0.98525	4.255	0.80722	D	1	D;D;D;D	0.89917	0.999;0.996;1.0;1.0	D;D;D;D	0.87578	0.967;0.936;0.998;0.998	D	0.99509	1.0955	10	0.87932	D	0	.	14.8797	0.70522	0.0:0.0:0.0:1.0	.	239;2098;2106;2106	E9PHF0;P21333-2;P21333;E9KL45	.;.;FLNA_HUMAN;.	S	2098;2098;2106;239;2066;87	ENSP00000353467:Y2098S;ENSP00000416926:Y2098S;ENSP00000358866:Y2106S;ENSP00000358872:Y239S;ENSP00000358863:Y2066S;ENSP00000397824:Y87S	ENSP00000358863:Y2066S	Y	-	2	0	FLNA	153234396	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	8.000000	0.88501	1.896000	0.54893	0.417000	0.27973	TAC	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.607	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	74	0.00	0	T			153581202	153581202	-1	no_errors	ENST00000369850	ensembl	human	known	69_37n	missense	66	50.75	68	SNP	1.000	G
FREM1	158326	genome.wustl.edu	37	9	14819423	14819423	+	Silent	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr9:14819423C>G	ENST00000380880.3	-	14	3138	c.2355G>C	c.(2353-2355)ctG>ctC	p.L785L	FREM1_ENST00000380881.4_Silent_p.L786L|FREM1_ENST00000422223.2_Silent_p.L785L			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	785					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CAGTCACTTTCAGAGGGTTGG	0.443																																						dbGAP											0													71.0	67.0	68.0					9																	14819423		1916	4134	6050	-	-	-	SO:0001819	synonymous_variant	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2355G>C	9.37:g.14819423C>G			B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.L786	ENST00000380880.3	37	c.2358	CCDS47952.1	9																																																																																			FREM1	-	NULL	ENSG00000164946		0.443	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	66	0.00	0	C	NM_144966		14819423	14819423	-1	no_errors	ENST00000380881	ensembl	human	known	69_37n	silent	96	20.66	25	SNP	0.998	G
FUT8	2530	genome.wustl.edu	37	14	65878620	65878620	+	5'UTR	SNP	C	C	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr14:65878620C>A	ENST00000360689.5	+	0	1311				FUT8_ENST00000557164.1_5'UTR|FUT8_ENST00000394586.2_5'UTR|FUT8_ENST00000358307.2_5'Flank|FUT8_ENST00000394585.1_5'Flank	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)						cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		CTCCGGTCCTCCCGCTCAGCT	0.711																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.-417C>A	14.37:g.65878620C>A			B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	RNA	SNP	-	NULL	ENST00000360689.5	37	NULL	CCDS9775.1	14																																																																																			FUT8	-	-	ENSG00000033170		0.711	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT8	HGNC	protein_coding	OTTHUMT00000286406.1	61	0.00	0	C	NM_004480		65878620	65878620	+1	no_errors	ENST00000549235	ensembl	human	known	69_37n	rna	56	18.84	13	SNP	0.277	A
GABRG1	2565	genome.wustl.edu	37	4	46125919	46125919	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr4:46125919C>G	ENST00000295452.4	-	1	179	c.12G>C	c.(10-12)ttG>ttC	p.L4F		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	4					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAAAAGCTTTCAAAGGACCCA	0.498																																						dbGAP											0													68.0	70.0	69.0					4																	46125919		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.12G>C	4.37:g.46125919C>G	ENSP00000295452:p.Leu4Phe		Q5H9T8	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg1_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.L4F	ENST00000295452.4	37	c.12	CCDS3470.1	4	.	.	.	.	.	.	.	.	.	.	C	5.473	0.272273	0.10349	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	T	0.67523	-0.27	4.88	4.03	0.46877	.	0.793410	0.11785	N	0.529812	T	0.45054	0.1323	N	0.08118	0	0.22827	N	0.998684	B	0.12013	0.005	B	0.12156	0.007	T	0.21008	-1.0258	10	0.16896	T	0.51	.	11.4617	0.50215	0.0:0.8192:0.1808:0.0	.	4	Q8N1C3	GBRG1_HUMAN	F	4	ENSP00000295452:L4F	ENSP00000295452:L4F	L	-	3	2	GABRG1	45820676	0.998000	0.40836	0.951000	0.38953	0.164000	0.22412	2.142000	0.42177	1.399000	0.46721	0.563000	0.77884	TTG	GABRG1	-	prints_GABBAg1_rcpt	ENSG00000163285		0.498	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG1	HGNC	protein_coding	OTTHUMT00000250470.1	16	0.00	0	C	NM_173536		46125919	46125919	-1	no_errors	ENST00000295452	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	0.989	G
GAL3ST1	9514	genome.wustl.edu	37	22	30951295	30951295	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr22:30951295T>G	ENST00000402321.1	-	3	1234	c.917A>C	c.(916-918)cAc>cCc	p.H306P	GAL3ST1_ENST00000338911.5_Missense_Mutation_p.H306P|GAL3ST1_ENST00000406361.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000401975.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000402369.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000406955.1_Missense_Mutation_p.H306P|GAL3ST1_ENST00000443111.2_Missense_Mutation_p.H306P			Q99999	G3ST1_HUMAN	galactose-3-O-sulfotransferase 1	306					galactosylceramide biosynthetic process (GO:0006682)|glycosphingolipid metabolic process (GO:0006687)|myelination (GO:0042552)|protein N-linked glycosylation (GO:0006487)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21						GCGGTAGAGGTGGGAGTCCAG	0.701																																						dbGAP											0													18.0	23.0	21.0					22																	30951295		2198	4292	6490	-	-	-	SO:0001583	missense	0			D88667	CCDS13879.1	22q12.2	2007-04-02			ENSG00000128242	ENSG00000128242		"""Sulfotransferases, membrane-bound"""	24240	protein-coding gene	gene with protein product	"""cerebroside (3' phosphoadenylylsulfate:galactosylceramide 3') sulfotransferase"""	602300				9847074, 9030544	Standard	NM_004861		Approved	CST	uc003aii.1	Q99999	OTTHUMG00000151200	ENST00000402321.1:c.917A>C	22.37:g.30951295T>G	ENSP00000385735:p.His306Pro		Q96C63	Missense_Mutation	SNP	pfam_Gal-3-0_sulfotransfrase	p.H306P	ENST00000402321.1	37	c.917	CCDS13879.1	22	.	.	.	.	.	.	.	.	.	.	T	11.38	1.621434	0.28889	.	.	ENSG00000128242	ENST00000406955;ENST00000402321;ENST00000402369;ENST00000401975;ENST00000338911;ENST00000406361;ENST00000443111	T;T;T;T;T;T;T	0.14640	2.49;2.49;2.49;2.49;2.49;2.49;2.49	5.55	-2.15	0.07102	.	0.377651	0.30455	N	0.009593	T	0.06234	0.0161	N	0.17082	0.46	0.40178	D	0.977252	B	0.09022	0.002	B	0.04013	0.001	T	0.28933	-1.0028	10	0.31617	T	0.26	-12.3476	6.7124	0.23284	0.5427:0.2902:0.0:0.1671	.	306	Q99999	G3ST1_HUMAN	P	306	ENSP00000385825:H306P;ENSP00000385735:H306P;ENSP00000384122:H306P;ENSP00000384388:H306P;ENSP00000343234:H306P;ENSP00000385207:H306P;ENSP00000402587:H306P	ENSP00000343234:H306P	H	-	2	0	GAL3ST1	29281295	0.987000	0.35691	0.949000	0.38748	0.765000	0.43378	0.315000	0.19451	-0.005000	0.14395	-1.643000	0.00768	CAC	GAL3ST1	-	pfam_Gal-3-0_sulfotransfrase	ENSG00000128242		0.701	GAL3ST1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GAL3ST1	HGNC	protein_coding	OTTHUMT00000321745.1	106	0.93	1	T	NM_004861		30951295	30951295	-1	no_errors	ENST00000338911	ensembl	human	known	69_37n	missense	35	38.60	22	SNP	0.539	G
GAS2L2	246176	genome.wustl.edu	37	17	34072743	34072743	+	Silent	SNP	G	G	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr17:34072743G>A	ENST00000254466.6	-	6	1800	c.1773C>T	c.(1771-1773)ccC>ccT	p.P591P	GAS2L2_ENST00000587565.1_Silent_p.P575P	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	591					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TCCCGCCCAAGGGCAGAGGTG	0.602																																						dbGAP											0													82.0	80.0	81.0					17																	34072743		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1773C>T	17.37:g.34072743G>A			Q8NHY4	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.P591	ENST00000254466.6	37	c.1773	CCDS11298.1	17																																																																																			GAS2L2	-	NULL	ENSG00000132139		0.602	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L2	HGNC	protein_coding	OTTHUMT00000256497.1	50	0.00	0	G	NM_139285		34072743	34072743	-1	no_errors	ENST00000254466	ensembl	human	known	69_37n	silent	30	41.18	21	SNP	0.002	A
GFI1	2672	genome.wustl.edu	37	1	92945969	92945969	+	Missense_Mutation	SNP	T	T	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:92945969T>G	ENST00000370332.1	-	5	1178	c.860A>C	c.(859-861)gAg>gCg	p.E287A	GFI1_ENST00000483490.1_5'Flank|GFI1_ENST00000427103.1_Missense_Mutation_p.E287A|GFI1_ENST00000294702.5_Missense_Mutation_p.E287A	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	287					auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		GCCGCACATCTCGCAGGCAAA	0.697																																						dbGAP											0													19.0	15.0	17.0					1																	92945969		1954	3775	5729	-	-	-	SO:0001583	missense	0			U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.860A>C	1.37:g.92945969T>G	ENSP00000359357:p.Glu287Ala		Q8N564	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E287A	ENST00000370332.1	37	c.860	CCDS30773.1	1	.	.	.	.	.	.	.	.	.	.	t	17.06	3.291716	0.59976	.	.	ENSG00000162676	ENST00000370332;ENST00000427103;ENST00000294702	T;T;T	0.18657	2.2;2.2;2.2	4.55	4.55	0.56014	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.181563	0.47852	D	0.000213	T	0.11922	0.0290	N	0.16862	0.45	0.45806	D	0.998685	P	0.47484	0.896	P	0.50754	0.649	T	0.06534	-1.0821	10	0.41790	T	0.15	-37.5328	14.2245	0.65850	0.0:0.0:0.0:1.0	.	287	Q99684	GFI1_HUMAN	A	287	ENSP00000359357:E287A;ENSP00000399719:E287A;ENSP00000294702:E287A	ENSP00000294702:E287A	E	-	2	0	GFI1	92718557	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.995000	0.57001	1.827000	0.53221	0.449000	0.29647	GAG	GFI1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000162676		0.697	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFI1	HGNC	protein_coding	OTTHUMT00000030054.1	74	0.00	0	T	NM_005263		92945969	92945969	-1	no_errors	ENST00000294702	ensembl	human	known	69_37n	missense	97	25.95	34	SNP	1.000	G
GPNMB	10457	genome.wustl.edu	37	7	23300074	23300074	+	Splice_Site	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr7:23300074G>T	ENST00000381990.2	+	6	861		c.e6-1		GPNMB_ENST00000258733.4_Splice_Site|GPNMB_ENST00000539136.1_Splice_Site|GPNMB_ENST00000453162.2_Splice_Site	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb						bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			GTATCTTTTAGATCAGATTCC	0.388																																						dbGAP											0													89.0	80.0	83.0					7																	23300074		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.701-1G>T	7.37:g.23300074G>T			A4D155|Q6UVX1|Q8N1A1	Splice_Site	SNP	-	e6-1	ENST00000381990.2	37	c.701-1	CCDS34610.1	7	.	.	.	.	.	.	.	.	.	.	G	14.79	2.639681	0.47153	.	.	ENSG00000136235	ENST00000258733;ENST00000435486;ENST00000381990;ENST00000425903;ENST00000539136;ENST00000453162	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6178	0.95640	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPNMB	23266599	1.000000	0.71417	1.000000	0.80357	0.257000	0.26127	8.651000	0.91078	2.709000	0.92574	0.655000	0.94253	.	GPNMB	-	-	ENSG00000136235		0.388	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPNMB	HGNC	protein_coding	OTTHUMT00000327152.1	36	0.00	0	G	NM_001005340	Intron	23300074	23300074	+1	no_errors	ENST00000381990	ensembl	human	known	69_37n	splice_site	30	26.83	11	SNP	1.000	T
GPR112	139378	genome.wustl.edu	37	X	135405034	135405034	+	Silent	SNP	A	A	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:135405034A>T	ENST00000394143.1	+	5	459	c.168A>T	c.(166-168)acA>acT	p.T56T	GPR112_ENST00000412101.1_Intron|GPR112_ENST00000394141.1_Intron|GPR112_ENST00000370652.1_Silent_p.T56T|GPR112_ENST00000287534.4_5'UTR	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	56					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GCCGATTCACAGCATGCATTG	0.413																																						dbGAP											0													101.0	98.0	99.0					X																	135405034		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.168A>T	X.37:g.135405034A>T			A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T56	ENST00000394143.1	37	c.168	CCDS35409.1	X																																																																																			GPR112	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin	ENSG00000156920		0.413	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	71	0.00	0	A			135405034	135405034	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	silent	60	26.83	22	SNP	0.978	T
HHLA1	10086	genome.wustl.edu	37	8	133107850	133107850	+	Splice_Site	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr8:133107850C>G	ENST00000414222.1	-	6	364		c.e6-1		HHLA1_ENST00000434736.2_Splice_Site	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1							extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						AGGTTAGAAACTGTGAAGAGA	0.483																																						dbGAP											0													127.0	114.0	118.0					8																	133107850		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.365-1G>C	8.37:g.133107850C>G				Splice_Site	SNP	-	e6-1	ENST00000414222.1	37	c.365-1		8	.	.	.	.	.	.	.	.	.	.	C	13.06	2.123351	0.37436	.	.	ENSG00000132297	ENST00000414222;ENST00000434736	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5076	0.90902	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HHLA1	133177032	1.000000	0.71417	1.000000	0.80357	0.284000	0.27059	5.657000	0.67996	2.683000	0.91414	0.655000	0.94253	.	HHLA1	-	-	ENSG00000132297		0.483	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	HHLA1	HGNC	protein_coding		60	0.00	0	C	XR_017860	Intron	133107850	133107850	-1	no_errors	ENST00000414222	ensembl	human	known	69_37n	splice_site	42	33.33	21	SNP	1.000	G
HLA-DOA	3111	genome.wustl.edu	37	6	32975108	32975108	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:32975108G>C	ENST00000229829.5	-	3	668	c.593C>G	c.(592-594)gCg>gGg	p.A198G	HLA-DOA_ENST00000450833.2_Missense_Mutation_p.A168G|HLA-DOA_ENST00000495532.1_5'Flank	NM_002119.3	NP_002110.1	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO alpha	198	Alpha-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|regulation of T cell differentiation (GO:0045580)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)	p.A198V(1)|p.A198E(1)		NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)	9						GAGGAGTGGCGCATCCAGGCC	0.592																																						dbGAP											2	Substitution - Missense(2)	lung(1)|prostate(1)											94.0	109.0	104.0					6																	32975108		1511	2709	4220	-	-	-	SO:0001583	missense	0			M31525	CCDS4763.1	6p21.3	2013-01-11		2001-10-05	ENSG00000204252	ENSG00000204252		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4936	protein-coding gene	gene with protein product		142930		HLA-DZA, HLA-DNA		2370084	Standard	XM_005272804		Approved	HLA-D0-alpha	uc003ocr.3	P06340	OTTHUMG00000031211	ENST00000229829.5:c.593C>G	6.37:g.32975108G>C	ENSP00000229829:p.Ala198Gly		Q58HU0|Q58HU1|Q5STC7|Q9TQC6|Q9TQC7|Q9TQC8|Q9TQC9|Q9TQD0|Q9TQD1|Q9TQD2|Q9TQD3	Missense_Mutation	SNP	pfam_MHC_II_a_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_a_N,smart_Ig_C1-set,pfscan_Ig-like	p.A198G	ENST00000229829.5	37	c.593	CCDS4763.1	6	.	.	.	.	.	.	.	.	.	.	G	6.430	0.447407	0.12223	.	.	ENSG00000204252	ENST00000229829;ENST00000450833	T;T	0.02974	4.09;4.09	4.51	-8.04	0.01110	Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	1.542140	0.03688	N	0.246555	T	0.00580	0.0019	N	0.04880	-0.145	0.09310	N	1	P;B	0.34815	0.47;0.003	B;B	0.36378	0.223;0.017	T	0.44862	-0.9300	10	0.87932	D	0	.	8.826	0.35054	0.0:0.3248:0.4968:0.1784	.	168;198	B4DW77;P06340	.;DOA_HUMAN	G	198;168	ENSP00000229829:A198G;ENSP00000403896:A168G	ENSP00000229829:A198G	A	-	2	0	HLA-DOA	33083086	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.374000	0.07484	-1.833000	0.01195	-1.051000	0.02340	GCG	HLA-DOA	-	pfam_Ig_C1-set,smart_Ig_C1-set	ENSG00000204252		0.592	HLA-DOA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DOA	HGNC	protein_coding	OTTHUMT00000076426.2	54	0.00	0	G	NM_002119		32975108	32975108	-1	no_errors	ENST00000229829	ensembl	human	known	69_37n	missense	27	35.71	15	SNP	0.000	C
HUWE1	10075	genome.wustl.edu	37	X	53575991	53575991	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:53575991C>T	ENST00000342160.3	-	66	10421	c.9964G>A	c.(9964-9966)Gtc>Atc	p.V3322I	HUWE1_ENST00000262854.6_Missense_Mutation_p.V3322I|HUWE1_ENST00000474288.1_5'Flank			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3322					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGGATGTGGACGGTGGAGCCA	0.527																																						dbGAP											0													73.0	53.0	60.0					X																	53575991		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.9964G>A	X.37:g.53575991C>T	ENSP00000340648:p.Val3322Ile		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.V3322I	ENST00000342160.3	37	c.9964	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.56|17.56	3.420598|3.420598	0.62622|0.62622	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052;ENST00000426907|ENST00000342160;ENST00000262854	.|T;T	.|0.49432	.|0.78;0.78	5.88|5.88	5.88|5.88	0.94601|0.94601	.|.	.|0.240515	.|0.33854	.|N	.|0.004493	T|T	0.51805|0.51805	0.1696|0.1696	N|N	0.21324|0.21324	0.655|0.655	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.71674	.|0.968;0.998	.|P;D	.|0.73708	.|0.854;0.981	T|T	0.38499|0.38499	-0.9658|-0.9658	5|10	.|0.06494	.|T	.|0.89	.|.	17.8502|17.8502	0.88744|0.88744	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|3322;3306	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	H|I	2355;159|3322	.|ENSP00000340648:V3322I;ENSP00000262854:V3322I	.|ENSP00000262854:V3322I	R|V	-|-	2|1	0|0	HUWE1|HUWE1	53592716|53592716	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.824000|0.824000	0.46624|0.46624	6.866000|6.866000	0.75506|0.75506	2.489000|2.489000	0.83994|0.83994	0.600000|0.600000	0.82982|0.82982	CGT|GTC	HUWE1	-	NULL	ENSG00000086758		0.527	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	64	0.00	0	C	XM_497119		53575991	53575991	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	1.000	T
IGHE	3497	genome.wustl.edu	37	14	106067791	106067791	+	lincRNA	SNP	G	G	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr14:106067791G>A	ENST00000390540.2	-	0	1154				IGHE_ENST00000576077.1_RNA|AL928742.12_ENST00000412518.1_lincRNA|IGHE_ENST00000577108.1_RNA																							GTCTGTGGACGATGGAGTGTG	0.597																																						dbGAP											0													196.0	206.0	202.0					14																	106067791		2148	4251	6399	-	-	-			0																															14.37:g.106067791G>A				Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.S92L	ENST00000390540.2	37	c.275		14																																																																																			IGHE	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211891		0.597	RP11-731F5.1-001	KNOWN	basic	lincRNA	IGHE	HGNC	lincRNA	OTTHUMT00000380286.1	163	0.00	0	G			106067791	106067791	-1	no_start_codon	ENST00000390541	ensembl	human	known	69_37n	missense	69	26.60	25	SNP	0.004	A
IGSF21	84966	genome.wustl.edu	37	1	18691740	18691740	+	Silent	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:18691740A>G	ENST00000251296.1	+	6	947	c.564A>G	c.(562-564)gaA>gaG	p.E188E		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	188						extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		GAGATGGGGAACCAATCGACG	0.552																																						dbGAP											0													51.0	51.0	51.0					1																	18691740		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.564A>G	1.37:g.18691740A>G			Q8NBR8	Missense_Mutation	SNP	NULL	p.T141A	ENST00000251296.1	37	c.421	CCDS184.1	1	.	.	.	.	.	.	.	.	.	.	A	0.394	-0.922158	0.02396	.	.	ENSG00000117154	ENST00000412684	.	.	.	4.63	-4.32	0.03688	.	.	.	.	.	T	0.63827	0.2544	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.64521	-0.6388	4	.	.	.	-15.1896	15.1798	0.72947	0.2022:0.0:0.7978:0.0	.	.	.	.	A	141	.	.	T	+	1	0	IGSF21	18564327	0.000000	0.05858	0.114000	0.21550	0.162000	0.22319	-0.502000	0.06390	-0.672000	0.05266	-0.464000	0.05259	ACC	IGSF21	-	NULL	ENSG00000117154		0.552	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF21	HGNC	protein_coding	OTTHUMT00000006924.1	30	0.00	0	A	NM_032880		18691740	18691740	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000412684	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	0.266	G
IL1RAPL2	26280	genome.wustl.edu	37	X	104512185	104512185	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:104512185G>C	ENST00000372582.1	+	5	1414	c.658G>C	c.(658-660)Gga>Cga	p.G220R	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.G220R	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	220	Ig-like C2-type 2.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TAAATATGAAGGAAAACTTGT	0.328																																						dbGAP											0													74.0	68.0	70.0					X																	104512185		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.658G>C	X.37:g.104512185G>C	ENSP00000361663:p.Gly220Arg		Q2M3U3|Q9NZN0	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_Interleukin-1_rcpt_II	p.G220R	ENST00000372582.1	37	c.658	CCDS14517.1	X	.	.	.	.	.	.	.	.	.	.	G	16.03	3.006963	0.54361	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.14766	2.48;2.48	5.55	5.55	0.83447	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000010	T	0.38532	0.1044	M	0.78285	2.405	0.80722	D	1	D	0.63046	0.992	D	0.63877	0.919	T	0.18871	-1.0323	10	0.59425	D	0.04	.	17.4286	0.87533	0.0:0.0:1.0:0.0	.	220	Q9NP60	IRPL2_HUMAN	R	220	ENSP00000361663:G220R;ENSP00000344976:G220R	ENSP00000344976:G220R	G	+	1	0	IL1RAPL2	104398841	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.981000	0.63819	2.330000	0.79161	0.513000	0.50165	GGA	IL1RAPL2	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000189108		0.328	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL2	HGNC	protein_coding	OTTHUMT00000057785.1	39	0.00	0	G	NM_017416		104512185	104512185	+1	no_errors	ENST00000344799	ensembl	human	known	69_37n	missense	32	39.62	21	SNP	1.000	C
JAG1	182	genome.wustl.edu	37	20	10621851	10621851	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr20:10621851C>G	ENST00000254958.5	-	24	3473	c.2958G>C	c.(2956-2958)ttG>ttC	p.L986F	JAG1_ENST00000423891.2_Missense_Mutation_p.L827F	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	986					angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						TCAAAATATTCAAATTCCTCA	0.388									Alagille Syndrome																													dbGAP											0													94.0	92.0	93.0					20																	10621851		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2958G>C	20.37:g.10621851C>G	ENSP00000254958:p.Leu986Phe		A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,smart_DSL,smart_EGF-like,smart_EGF-like_Ca-bd,smart_VWC_out,smart_VWF_C,pfscan_DSL,pfscan_EG-like_dom	p.L986F	ENST00000254958.5	37	c.2958	CCDS13112.1	20	.	.	.	.	.	.	.	.	.	.	C	21.5	4.151791	0.78001	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.90900	-2.75;-2.72	6.07	6.07	0.98685	.	0.066435	0.64402	D	0.000013	D	0.94092	0.8106	M	0.79011	2.435	0.52099	D	0.999941	D	0.67145	0.996	D	0.65010	0.931	D	0.93920	0.7205	10	0.87932	D	0	.	10.3149	0.43732	0.0:0.7941:0.1361:0.0698	.	986	P78504	JAG1_HUMAN	F	986;827	ENSP00000254958:L986F;ENSP00000389519:L827F	ENSP00000254958:L986F	L	-	3	2	JAG1	10569851	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.923000	0.28757	2.884000	0.98904	0.655000	0.94253	TTG	JAG1	-	NULL	ENSG00000101384		0.388	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG1	HGNC	protein_coding		36	0.00	0	C	NM_000214		10621851	10621851	-1	no_errors	ENST00000254958	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	1.000	G
KCTD14	65987	genome.wustl.edu	37	11	77728118	77728118	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr11:77728118G>C	ENST00000353172.5	-	2	333	c.289C>G	c.(289-291)Caa>Gaa	p.Q97E	NDUFC2-KCTD14_ENST00000528251.1_3'UTR|KCTD14_ENST00000533144.1_Missense_Mutation_p.Q67E|RP11-7I15.3_ENST00000533697.1_RNA|NDUFC2-KCTD14_ENST00000530054.1_3'UTR	NM_001203260.1|NM_001203262.1|NM_001282406.1|NM_023930.3	NP_001190189.1|NP_001190191.1|NP_001269335.1|NP_076419.2	Q9BQ13	KCD14_HUMAN	potassium channel tetramerization domain containing 14	97	BTB.				protein homooligomerization (GO:0051260)					endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	15	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			GTGGGCACTTGCCCAGTGCGC	0.577																																					NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)	dbGAP											0													79.0	68.0	72.0					11																	77728118		2200	4292	6492	-	-	-	SO:0001583	missense	0			BC001062	CCDS8255.2, CCDS60908.1	11q13.4	2013-06-20	2013-06-20		ENSG00000151364	ENSG00000151364			23295	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 14"""			12477932	Standard	NM_023930		Approved	MGC2376	uc001oyw.4	Q9BQ13	OTTHUMG00000150224	ENST00000353172.5:c.289C>G	11.37:g.77728118G>C	ENSP00000316482:p.Gln97Glu		B2R9R8	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.Q97E	ENST00000353172.5	37	c.289	CCDS8255.2	11	.	.	.	.	.	.	.	.	.	.	G	8.484	0.860557	0.17178	.	.	ENSG00000151364	ENST00000353172;ENST00000533144	T;T	0.75704	-0.96;-0.96	5.28	5.28	0.74379	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.438747	0.24429	N	0.038612	T	0.65154	0.2664	N	0.21545	0.675	0.80722	D	1	P	0.44090	0.826	P	0.45195	0.473	T	0.61955	-0.6956	10	0.20519	T	0.43	.	14.5003	0.67716	0.0:0.0:0.8532:0.1468	.	97	Q9BQ13	KCD14_HUMAN	E	97;67	ENSP00000316482:Q97E;ENSP00000431155:Q67E	ENSP00000316482:Q97E	Q	-	1	0	KCTD14	77405766	0.999000	0.42202	0.918000	0.36340	0.144000	0.21451	2.838000	0.48199	2.473000	0.83533	0.561000	0.74099	CAA	KCTD14	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000151364		0.577	KCTD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD14	HGNC	protein_coding	OTTHUMT00000316888.1	37	0.00	0	G	NM_023930		77728118	77728118	-1	no_errors	ENST00000353172	ensembl	human	known	69_37n	missense	44	26.67	16	SNP	0.998	C
KLHL5	51088	genome.wustl.edu	37	4	39104910	39104910	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr4:39104910C>A	ENST00000504108.1	+	7	1725	c.1442C>A	c.(1441-1443)gCa>gAa	p.A481E	KLHL5_ENST00000359687.2_Missense_Mutation_p.A481E|KLHL5_ENST00000508137.2_Missense_Mutation_p.A294E|KLHL5_ENST00000261426.5_Missense_Mutation_p.A420E|KLHL5_ENST00000261425.3_Missense_Mutation_p.A435E|KLHL5_ENST00000381930.3_Missense_Mutation_p.A481E	NM_015990.4	NP_057074.3	Q96PQ7	KLHL5_HUMAN	kelch-like family member 5	481						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(1)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29						TATGAAGGAGCAACAAGCATT	0.323																																						dbGAP											0													53.0	52.0	52.0					4																	39104910		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF272976	CCDS3449.1, CCDS33974.1, CCDS33975.1, CCDS54756.1	4p15.1	2013-01-30	2013-01-30		ENSG00000109790	ENSG00000109790		"""Kelch-like"", ""BTB/POZ domain containing"""	6356	protein-coding gene	gene with protein product		608064	"""kelch (Drosophila)-like 5"", ""kelch-like 5 (Drosophila)"""			11590829, 14672410	Standard	NM_001007075		Approved		uc003gtp.3	Q96PQ7	OTTHUMG00000097819	ENST00000504108.1:c.1442C>A	4.37:g.39104910C>A	ENSP00000423897:p.Ala481Glu		A8K170|B7WP68|E9PCF4|F8WAE7|G3XA92|Q6Y881|Q86XW0|Q9NUK3|Q9NV27|Q9NVA9|Q9Y2X2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.A481E	ENST00000504108.1	37	c.1442	CCDS33974.1	4	.	.	.	.	.	.	.	.	.	.	C	29.7	5.025874	0.93518	.	.	ENSG00000109790	ENST00000544221;ENST00000261425;ENST00000508137;ENST00000504108;ENST00000359687;ENST00000381930;ENST00000261426;ENST00000546147	T;T;T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09;-1.09;-1.09	5.42	5.42	0.78866	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.85570	0.5727	L	0.58583	1.82	0.80722	D	1	P;D;P	0.59357	0.758;0.985;0.876	P;P;P	0.62298	0.738;0.9;0.738	D	0.85316	0.1081	10	0.52906	T	0.07	.	19.5998	0.95557	0.0:1.0:0.0:0.0	.	420;481;481	F8WAE7;Q96PQ7;Q96PQ7-2	.;KLHL5_HUMAN;.	E	515;435;294;481;481;481;420;75	ENSP00000261425:A435E;ENSP00000423080:A294E;ENSP00000423897:A481E;ENSP00000352716:A481E;ENSP00000371355:A481E;ENSP00000261426:A420E	ENSP00000261425:A435E	A	+	2	0	KLHL5	38781305	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.818000	0.86416	2.717000	0.92951	0.655000	0.94253	GCA	KLHL5	-	pfam_Kelch_1,smart_Kelch_1	ENSG00000109790		0.323	KLHL5-006	KNOWN	basic|CCDS	protein_coding	KLHL5	HGNC	protein_coding	OTTHUMT00000360604.1	39	0.00	0	C			39104910	39104910	+1	no_errors	ENST00000359687	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	1.000	A
LCMT2	9836	genome.wustl.edu	37	15	43622236	43622236	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr15:43622236T>C	ENST00000305641.5	-	1	567	c.452A>G	c.(451-453)gAg>gGg	p.E151G	ADAL_ENST00000428046.3_5'Flank|LCMT2_ENST00000567039.1_Intron|ADAL_ENST00000389651.4_5'Flank|LCMT2_ENST00000544735.1_Intron|ADAL_ENST00000422466.2_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	151					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	GTCTGCGCTCTCAAAGCACAG	0.677																																						dbGAP											0													36.0	43.0	41.0					15																	43622236		2198	4299	6497	-	-	-	SO:0001583	missense	0			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.452A>G	15.37:g.43622236T>C	ENSP00000307214:p.Glu151Gly		Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	pfam_LCM_MeTrfase	p.E151G	ENST00000305641.5	37	c.452	CCDS10094.1	15	.	.	.	.	.	.	.	.	.	.	T	13.52	2.260258	0.39995	.	.	ENSG00000168806	ENST00000305641	T	0.23348	1.91	5.54	4.4	0.53042	.	0.505434	0.20191	N	0.097303	T	0.22898	0.0553	L	0.55481	1.735	0.53688	D	0.999979	P	0.34864	0.473	B	0.34931	0.192	T	0.02417	-1.1162	10	0.25751	T	0.34	-1.2349	8.9506	0.35788	0.0:0.0:0.2027:0.7973	.	151	O60294	LCMT2_HUMAN	G	151	ENSP00000307214:E151G	ENSP00000307214:E151G	E	-	2	0	LCMT2	41409528	0.021000	0.18746	0.837000	0.33122	0.706000	0.40770	1.300000	0.33436	2.326000	0.78906	0.533000	0.62120	GAG	LCMT2	-	pfam_LCM_MeTrfase	ENSG00000168806		0.677	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT2	HGNC	protein_coding	OTTHUMT00000253205.1	23	0.00	0	T	NM_014793		43622236	43622236	-1	no_errors	ENST00000305641	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.705	C
FAM230C	26080	genome.wustl.edu	37	22	21663626	21663626	+	lincRNA	SNP	T	T	G	rs673334	byFrequency	TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr22:21663626T>G	ENST00000436681.1	-	0	544																											CGCTGGCGATTCCGTGGGCGG	0.746													.|||	104	0.0207668	0.0234	0.013	5008	,	,		13103	0.0248		0.0129	False		,,,				2504	0.0266					dbGAP											0																																										-	-	-			0																															22.37:g.21663626T>G				RNA	SNP	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			LINC00281	-	-	ENSG00000206142		0.746	KB-1183D5.13-003	KNOWN	basic	lincRNA	LINC00281	HGNC	lincRNA	OTTHUMT00000320109.1	36	0.00	0	T			21663626	21663626	-1	no_errors	ENST00000436681	ensembl	human	known	69_37n	rna	39	15.22	7	SNP	0.771	G
LINC00493	388789	genome.wustl.edu	37	20	18548129	18548129	+	lincRNA	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr20:18548129C>G	ENST00000608034.1	+	0	39									long intergenic non-protein coding RNA 493																		ACCCATGTATCGAAATGAGTT	0.632																																						dbGAP											0																																										-	-	-			0					20p11.23	2012-10-12			ENSG00000232388	ENSG00000232388		"""Long non-coding RNAs"""	43430	non-coding RNA	RNA, long non-coding							Standard	NR_015432		Approved		uc002wre.4		OTTHUMG00000031978		20.37:g.18548129C>G				Missense_Mutation	SNP	NULL	p.R3G	ENST00000608034.1	37	c.7		20																																																																																			LINC00493	-	NULL	ENSG00000232388		0.632	LINC00493-003	KNOWN	basic	lincRNA	LINC00493	HGNC	lincRNA	OTTHUMT00000472199.1	74	0.00	0	C	NR_015432		18548129	18548129	+1	no_errors	ENST00000411646	ensembl	human	novel	69_37n	missense	77	11.49	10	SNP	0.000	G
MACF1	23499	genome.wustl.edu	37	1	39950403	39950403	+	Splice_Site	SNP	G	G	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:39950403G>A	ENST00000372915.3	+	96	21997		c.e96+1		MACF1_ENST00000539005.1_Splice_Site|MACF1_ENST00000361689.2_Splice_Site|MACF1_ENST00000289893.4_Splice_Site|MACF1_ENST00000564288.1_Splice_Site|MACF1_ENST00000317713.7_Splice_Site|MACF1_ENST00000567887.1_Splice_Site|MACF1_ENST00000545844.1_Splice_Site			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATCGGGCAGGTAAGTACCTG	0.517																																						dbGAP											0													62.0	70.0	67.0					1																	39950403		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.21910+1G>A	1.37:g.39950403G>A			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Splice_Site	SNP	-	e92+1	ENST00000372915.3	37	c.16036+1		1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.163152	0.78226	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000372925;ENST00000289893;ENST00000360115;ENST00000446276;ENST00000539218;ENST00000442046	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7374	0.91761	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MACF1	39722990	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	6.824000	0.75288	2.861000	0.98227	0.655000	0.94253	.	MACF1	-	-	ENSG00000127603		0.517	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	26	0.00	0	G	NM_033044	Intron	39950403	39950403	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	splice_site	38	17.39	8	SNP	1.000	A
LRRC8C	84230	genome.wustl.edu	37	1	90179573	90179573	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:90179573C>T	ENST00000370454.4	+	3	1699	c.1444C>T	c.(1444-1446)Cac>Tac	p.H482Y	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	482					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TGTCAAAATCCACAGTGCGGC	0.468																																						dbGAP											0													80.0	77.0	78.0					1																	90179573		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1444C>T	1.37:g.90179573C>T	ENSP00000359483:p.His482Tyr		B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.H482Y	ENST00000370454.4	37	c.1444	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131470	0.56828	.	.	ENSG00000171488	ENST00000370454	T	0.16897	2.31	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.11153	0.0272	M	0.61703	1.905	0.58432	D	0.999999	D	0.53312	0.959	B	0.43575	0.424	T	0.07578	-1.0765	10	0.02654	T	1	.	20.4024	0.99000	0.0:1.0:0.0:0.0	.	482	Q8TDW0	LRC8C_HUMAN	Y	482	ENSP00000359483:H482Y	ENSP00000359483:H482Y	H	+	1	0	LRRC8C	89952161	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.999000	0.70665	2.827000	0.97445	0.650000	0.86243	CAC	LRRC8C	-	NULL	ENSG00000171488		0.468	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	40	0.00	0	C	NM_032270		90179573	90179573	+1	no_errors	ENST00000370454	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	1.000	T
MAGED1	9500	genome.wustl.edu	37	X	51641057	51641057	+	Intron	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:51641057G>T	ENST00000375722.1	+	7	1910				MAGED1_ENST00000375695.2_Intron|MAGED1_ENST00000375772.3_Intron|MAGED1_ENST00000326587.7_Intron|MAGED1_ENST00000494718.1_3'UTR			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					GTAGATCAGGGTCCAGGgttc	0.522										Multiple Myeloma(10;0.10)																												dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1658+75G>T	X.37:g.51641057G>T			Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	RNA	SNP	-	NULL	ENST00000375722.1	37	NULL	CCDS14337.1	X																																																																																			MAGED1	-	-	ENSG00000179222		0.522	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	56	0.00	0	G	NM_001005332		51641057	51641057	+1	no_errors	ENST00000485420	ensembl	human	known	69_37n	rna	49	14.04	8	SNP	0.006	T
MIPOL1	145282	genome.wustl.edu	37	14	37739693	37739693	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr14:37739693G>C	ENST00000327441.7	+	7	922	c.456G>C	c.(454-456)gaG>gaC	p.E152D	MIPOL1_ENST00000537471.1_Missense_Mutation_p.E152D|MIPOL1_ENST00000536774.1_Intron|MIPOL1_ENST00000545536.1_Missense_Mutation_p.E121D|MIPOL1_ENST00000539174.2_3'UTR|MIPOL1_ENST00000396294.2_Missense_Mutation_p.E152D|MIPOL1_ENST00000556451.1_Missense_Mutation_p.E121D|MIPOL1_ENST00000539062.2_Missense_Mutation_p.E121D	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	152						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		AACTCCAAGAGAAAGAAACAG	0.338																																						dbGAP											0													55.0	54.0	54.0					14																	37739693		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.456G>C	14.37:g.37739693G>C	ENSP00000333539:p.Glu152Asp		D3DSA4|Q7Z3J0|Q8IV14	Missense_Mutation	SNP	NULL	p.E152D	ENST00000327441.7	37	c.456	CCDS9664.1	14	.	.	.	.	.	.	.	.	.	.	G	13.96	2.394231	0.42410	.	.	ENSG00000151338	ENST00000327441;ENST00000539062;ENST00000556451;ENST00000396294;ENST00000537471;ENST00000545536	T;T;T;T;T;T	0.52057	0.69;0.7;0.68;0.69;0.69;0.68	5.08	-0.119	0.13543	.	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.54390	-0.8301	10	0.27785	T	0.31	-11.5428	6.2269	0.20714	0.4559:0.1244:0.4197:0.0	.	152;121	Q8TD10;Q49AL5	MIPO1_HUMAN;.	D	152;121;121;152;152;121	ENSP00000333539:E152D;ENSP00000438319:E121D;ENSP00000450479:E121D;ENSP00000379589:E152D;ENSP00000444254:E152D;ENSP00000442529:E121D	ENSP00000333539:E152D	E	+	3	2	MIPOL1	36809444	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	0.938000	0.28965	-0.085000	0.12573	-0.145000	0.13849	GAG	MIPOL1	-	NULL	ENSG00000151338		0.338	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPOL1	HGNC	protein_coding	OTTHUMT00000276734.1	12	0.00	0	G	NM_138731		37739693	37739693	+1	no_errors	ENST00000327441	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	0.992	C
CAMK1D	57118	genome.wustl.edu	37	10	12767318	12767318	+	Intron	SNP	C	C	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr10:12767318C>A	ENST00000378847.3	+	4	636				CAMK1D_ENST00000378845.1_Intron|MIR548Q_ENST00000408404.1_RNA	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID						inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		aaagtaatggcaaaaaccgcc	0.358																																						dbGAP											0													28.0	29.0	29.0					10																	12767318		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.300-35629C>A	10.37:g.12767318C>A			B0YIY0|Q9HD31	RNA	SNP	-	NULL	ENST00000378847.3	37	NULL	CCDS7091.1	10																																																																																			MIR548Q	-	-	ENSG00000221331		0.358	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR548Q	HGNC	protein_coding	OTTHUMT00000046820.1	54	0.00	0	C	NM_020397		12767318	12767318	-1	no_errors	ENST00000408404	ensembl	human	known	69_37n	rna	23	53.85	28	SNP	0.057	A
MPP1	4354	genome.wustl.edu	37	X	154033610	154033610	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:154033610G>T	ENST00000369534.3	-	1	186	c.39C>A	c.(37-39)agC>agA	p.S13R	MPP1_ENST00000393531.1_Missense_Mutation_p.S13R|MPP1_ENST00000413259.3_5'UTR	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	13					nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CCGTGTGCATGCTGCCCCCAC	0.667																																						dbGAP											0													37.0	29.0	32.0					X																	154033610		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.39C>A	X.37:g.154033610G>T	ENSP00000358547:p.Ser13Arg		B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.S13R	ENST00000369534.3	37	c.39	CCDS14762.1	X	.	.	.	.	.	.	.	.	.	.	g	8.864	0.947541	0.18356	.	.	ENSG00000130830	ENST00000369534;ENST00000393531;ENST00000453245;ENST00000428488;ENST00000369531	T;T;T;T	0.46451	2.2;2.01;0.87;1.64	4.63	2.84	0.33178	.	0.214261	0.47852	D	0.000209	T	0.39809	0.1092	M	0.63843	1.955	0.80722	D	1	P;D;P;B	0.54964	0.624;0.969;0.785;0.437	B;P;B;B	0.45506	0.206;0.483;0.35;0.134	T	0.31475	-0.9942	10	0.87932	D	0	.	5.8086	0.18454	0.2474:0.0:0.7526:0.0	.	13;13;13;13	B4E325;C9J9J4;G3XAI1;Q00013	.;.;.;EM55_HUMAN	R	13	ENSP00000358547:S13R;ENSP00000377165:S13R;ENSP00000410888:S13R;ENSP00000358544:S13R	ENSP00000358544:S13R	S	-	3	2	MPP1	153686804	1.000000	0.71417	0.998000	0.56505	0.210000	0.24377	2.055000	0.41345	0.761000	0.33130	0.529000	0.55759	AGC	MPP1	-	NULL	ENSG00000130830		0.667	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP1	HGNC	protein_coding	OTTHUMT00000061191.3	119	0.00	0	G	NM_002436		154033610	154033610	-1	no_errors	ENST00000369534	ensembl	human	known	69_37n	missense	131	29.95	56	SNP	1.000	T
MTPAP	55149	genome.wustl.edu	37	10	30653864	30653864	+	Silent	SNP	A	A	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr10:30653864A>C	ENST00000358107.4	-	2	317	c.318T>G	c.(316-318)ggT>ggG	p.G106G	MTPAP_ENST00000488290.1_5'UTR|AL161651.1_ENST00000408070.1_RNA|RN7SL241P_ENST00000482973.2_RNA			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	0					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						ccccacccccacccccacAGA	0.652																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000358107.4:c.318T>G	10.37:g.30653864A>C			D3DRX0|Q659E3|Q6P7E5|Q9HA74	Silent	SNP	pfam_PAP_assoc	p.G106	ENST00000358107.4	37	c.318		10																																																																																			MTPAP	-	NULL	ENSG00000107951		0.652	MTPAP-201	KNOWN	basic	protein_coding	MTPAP	HGNC	protein_coding		80	0.00	0	A	NM_018109		30653864	30653864	-1	no_errors	ENST00000358107	ensembl	human	known	69_37n	silent	40	35.94	23	SNP	0.011	C
NOTCH1	4851	genome.wustl.edu	37	9	139405185	139405185	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr9:139405185G>A	ENST00000277541.6	-	17	2735	c.2660C>T	c.(2659-2661)aCc>aTc	p.T887I		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	887	EGF-like 23; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GCCGCCGTGGGTGTTCTGGCA	0.692			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												dbGAP		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													21.0	30.0	27.0					9																	139405185		2041	4165	6206	-	-	-	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2660C>T	9.37:g.139405185G>A	ENSP00000277541:p.Thr887Ile		Q59ED8|Q5SXM3	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_1,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.T887I	ENST00000277541.6	37	c.2660	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681901	0.47991	.	.	ENSG00000148400	ENST00000277541	D	0.86694	-2.16	4.88	2.87	0.33458	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.108002	0.64402	D	0.000007	D	0.87665	0.6234	L	0.56769	1.78	0.50813	D	0.999892	P	0.38535	0.635	P	0.48982	0.597	D	0.85435	0.1151	10	0.41790	T	0.15	.	10.1659	0.42879	0.0:0.1483:0.698:0.1537	.	887	P46531	NOTC1_HUMAN	I	887	ENSP00000277541:T887I	ENSP00000277541:T887I	T	-	2	0	NOTCH1	138525006	1.000000	0.71417	0.750000	0.31169	0.092000	0.18411	6.329000	0.72920	1.022000	0.39626	0.561000	0.74099	ACC	NOTCH1	-	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000148400		0.692	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	41	0.00	0	G	NM_017617		139405185	139405185	-1	no_errors	ENST00000277541	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	0.996	A
NR2C2AP	126382	genome.wustl.edu	37	19	19313894	19313894	+	5'UTR	SNP	G	G	A	rs544754974		TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr19:19313894G>A	ENST00000331552.7	-	0	339				NR2C2AP_ENST00000538165.2_5'UTR|NR2C2AP_ENST00000544883.1_5'UTR|NR2C2AP_ENST00000420605.3_5'UTR	NM_176880.4	NP_795361.1	Q86WQ0	NR2CA_HUMAN	nuclear receptor 2C2-associated protein						cell adhesion (GO:0007155)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|kidney(2)|ovary(1)	5			Epithelial(12;0.00235)			ACCTCGCAgggcttaggattg	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		18082	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													69.0	65.0	66.0					19																	19313894		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AY101377	CCDS32967.1, CCDS74316.1	19p13.11	2008-01-10				ENSG00000184162			30763	protein-coding gene	gene with protein product	"""TR4 orphan receptor associated protein TRA16"""	608719				12486131	Standard	XM_005259740		Approved	TRA16	uc002nlx.3	Q86WQ0		ENST00000331552.7:c.-25C>T	19.37:g.19313894G>A			A6NGP7|B4DW92	RNA	SNP	-	NULL	ENST00000331552.7	37	NULL	CCDS32967.1	19																																																																																			NR2C2AP	-	-	ENSG00000184162		0.592	NR2C2AP-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	NR2C2AP	HGNC	protein_coding	OTTHUMT00000402936.4	41	0.00	0	G	NM_176880		19313894	19313894	-1	no_errors	ENST00000590907	ensembl	human	known	69_37n	rna	49	10.91	6	SNP	0.000	A
NRIP1	8204	genome.wustl.edu	37	21	16337149	16337149	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr21:16337149C>G	ENST00000400202.1	-	3	4077	c.3365G>C	c.(3364-3366)aGa>aCa	p.R1122T	NRIP1_ENST00000318948.4_Missense_Mutation_p.R1122T|AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000400199.1_Missense_Mutation_p.R1122T			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1122	Interaction with ZNF366.|Repression domain 4.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		GTAAGGGCTTCTTAAATTAAA	0.428																																						dbGAP											0													88.0	91.0	90.0					21																	16337149		2203	4299	6502	-	-	-	SO:0001583	missense	0			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.3365G>C	21.37:g.16337149C>G	ENSP00000383063:p.Arg1122Thr		Q8IWE8	Missense_Mutation	SNP	NULL	p.R1122T	ENST00000400202.1	37	c.3365	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887052	0.72410	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.10763	2.84;2.84;2.84	5.73	5.73	0.89815	.	0.105581	0.39146	N	0.001456	T	0.19485	0.0468	L	0.34521	1.04	0.44736	D	0.997734	D	0.59767	0.986	P	0.53593	0.73	T	0.00096	-1.2074	10	0.59425	D	0.04	-17.0963	20.2574	0.98430	0.0:1.0:0.0:0.0	.	1122	P48552	NRIP1_HUMAN	T	1122	ENSP00000383060:R1122T;ENSP00000383063:R1122T;ENSP00000327213:R1122T	ENSP00000327213:R1122T	R	-	2	0	NRIP1	15259020	1.000000	0.71417	0.982000	0.44146	0.950000	0.60333	4.202000	0.58446	2.864000	0.98301	0.551000	0.68910	AGA	NRIP1	-	NULL	ENSG00000180530		0.428	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	85	0.00	0	C	NM_003489		16337149	16337149	-1	no_errors	ENST00000318948	ensembl	human	known	69_37n	missense	80	13.04	12	SNP	0.999	G
OR10A5	144124	genome.wustl.edu	37	11	6867817	6867817	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr11:6867817C>T	ENST00000299454.4	+	1	935	c.904C>T	c.(904-906)Ctc>Ttc	p.L302F	OR10A5_ENST00000379831.2_Missense_Mutation_p.L306F			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	302					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GAAGAATGCCCTCAGCAGGAC	0.423																																					Pancreas(44;21 1072 25662 28041 45559)	dbGAP											0													77.0	79.0	79.0					11																	6867817		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.904C>T	11.37:g.6867817C>T	ENSP00000299454:p.Leu302Phe		O95223|Q52M66|Q96R21|Q96R22	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L306F	ENST00000299454.4	37	c.916	CCDS7773.1	11	.	.	.	.	.	.	.	.	.	.	.	0.561	-0.845280	0.02671	.	.	ENSG00000166363	ENST00000299454;ENST00000379831	T;T	0.39406	1.08;1.08	3.59	1.7	0.24286	.	0.402333	0.21385	N	0.075420	T	0.25975	0.0633	N	0.20530	0.585	0.09310	N	0.999992	B	0.12630	0.006	B	0.20577	0.03	T	0.17531	-1.0366	10	0.42905	T	0.14	.	8.5704	0.33565	0.0:0.7859:0.0:0.2141	.	302	Q9H207	O10A5_HUMAN	F	302;306	ENSP00000299454:L302F;ENSP00000369159:L306F	ENSP00000299454:L302F	L	+	1	0	OR10A5	6824393	0.000000	0.05858	0.216000	0.23742	0.133000	0.20885	-0.998000	0.03701	0.145000	0.18977	-1.094000	0.02160	CTC	OR10A5	-	NULL	ENSG00000166363		0.423	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A5	HGNC	protein_coding	OTTHUMT00000385983.1	31	0.00	0	C	NM_178168		6867817	6867817	+1	no_errors	ENST00000379831	ensembl	human	known	69_37n	missense	23	41.03	16	SNP	0.262	T
OR4M2	390538	genome.wustl.edu	37	15	22369004	22369004	+	Silent	SNP	C	C	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr15:22369004C>A	ENST00000332663.2	+	1	527	c.429C>A	c.(427-429)atC>atA	p.I143I	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCTGCTGTATCCTGGTGGCTC	0.507																																						dbGAP											0													319.0	271.0	287.0					15																	22369004		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.429C>A	15.37:g.22369004C>A			B9EH16|Q6IEY2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I143	ENST00000332663.2	37	c.429	CCDS32172.1	15																																																																																			OR4M2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000182974		0.507	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	OR4M2	HGNC	protein_coding	OTTHUMT00000414921.1	365	0.00	0	C			22369004	22369004	+1	no_errors	ENST00000332663	ensembl	human	known	69_37n	silent	308	11.24	39	SNP	0.031	A
OR8B4	283162	genome.wustl.edu	37	11	124294625	124294625	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr11:124294625A>G	ENST00000356130.3	-	1	164	c.143T>C	c.(142-144)tTa>tCa	p.L48S		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TATCCCAATTAAGGTGATCAA	0.443																																						dbGAP											0													82.0	78.0	79.0					11																	124294625		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.143T>C	11.37:g.124294625A>G	ENSP00000348449:p.Leu48Ser		B2RNF8|Q6IFQ7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L48S	ENST00000356130.3	37	c.143	CCDS31710.1	11	.	.	.	.	.	.	.	.	.	.	a	15.35	2.808920	0.50421	.	.	ENSG00000198657	ENST00000356130	T	0.02837	4.14	4.62	4.62	0.57501	GPCR, rhodopsin-like superfamily (1);	0.204155	0.24688	N	0.036419	T	0.13157	0.0319	M	0.85710	2.77	0.09310	N	0.999997	D	0.76494	0.999	D	0.68943	0.961	T	0.09357	-1.0678	10	0.87932	D	0	.	6.2923	0.21067	0.7516:0.1629:0.0855:0.0	.	48	Q96RC9	OR8B4_HUMAN	S	48	ENSP00000348449:L48S	ENSP00000348449:L48S	L	-	2	0	OR8B4	123799835	0.068000	0.21057	0.606000	0.28943	0.890000	0.51754	3.644000	0.54381	2.073000	0.62155	0.533000	0.62120	TTA	OR8B4	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000198657		0.443	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B4	HGNC	protein_coding	OTTHUMT00000387055.1	24	0.00	0	A	NM_001005196		124294625	124294625	-1	no_errors	ENST00000356130	ensembl	human	putative	69_37n	missense	16	23.81	5	SNP	0.225	G
PCDHB18	54660	genome.wustl.edu	37	5	140615248	140615248	+	RNA	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr5:140615248C>T	ENST00000526308.1	+	0	1311					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						GAGACCAAGACGCTGGAGACA	0.488																																						dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615248C>T			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.488	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	76	0.00	0	C			140615248	140615248	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	44	46.34	38	SNP	0.974	T
PHACTR3	116154	genome.wustl.edu	37	20	58322830	58322830	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr20:58322830G>C	ENST00000371015.1	+	3	765	c.298G>C	c.(298-300)Gcc>Ccc	p.A100P	PHACTR3_ENST00000361300.4_Missense_Mutation_p.A59P|PHACTR3_ENST00000395636.2_Missense_Mutation_p.A59P|PHACTR3_ENST00000355648.4_Missense_Mutation_p.A59P|PHACTR3_ENST00000359926.3_Missense_Mutation_p.A97P|PHACTR3_ENST00000395639.4_Missense_Mutation_p.A59P|PHACTR3_ENST00000541461.1_Missense_Mutation_p.A59P	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	100						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GAAGAAGATGGCCGGCAGGCA	0.607																																						dbGAP											0													146.0	133.0	138.0					20																	58322830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.298G>C	20.37:g.58322830G>C	ENSP00000360054:p.Ala100Pro		B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.A100P	ENST00000371015.1	37	c.298	CCDS13480.1	20	.	.	.	.	.	.	.	.	.	.	G	13.46	2.243134	0.39697	.	.	ENSG00000087495	ENST00000359926;ENST00000371015;ENST00000395639;ENST00000541461;ENST00000355648;ENST00000395636;ENST00000361300	T;T;T;T;T;T;T	0.32753	1.84;1.85;1.44;1.86;1.86;1.86;1.44	4.26	2.28	0.28536	.	0.351081	0.33199	N	0.005169	T	0.24586	0.0596	L	0.48642	1.525	0.34893	D	0.745778	P;B;B	0.39883	0.693;0.337;0.337	B;B;B	0.41332	0.354;0.188;0.092	T	0.26326	-1.0106	10	0.59425	D	0.04	-5.5525	3.4531	0.07506	0.3106:0.0:0.5107:0.1787	.	59;100;97	Q96KR7-3;Q96KR7;B1AKX0	.;PHAR3_HUMAN;.	P	97;100;59;59;59;59;59	ENSP00000353002:A97P;ENSP00000360054:A100P;ENSP00000379001:A59P;ENSP00000442483:A59P;ENSP00000347866:A59P;ENSP00000378998:A59P;ENSP00000354555:A59P	ENSP00000347866:A59P	A	+	1	0	PHACTR3	57756225	1.000000	0.71417	0.954000	0.39281	0.933000	0.57130	1.266000	0.33039	0.359000	0.24239	0.563000	0.77884	GCC	PHACTR3	-	smart_RPEL_repeat,pfscan_RPEL_repeat	ENSG00000087495		0.607	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHACTR3	HGNC	protein_coding	OTTHUMT00000079923.3	57	0.00	0	G	NM_080672		58322830	58322830	+1	no_errors	ENST00000371015	ensembl	human	known	69_37n	missense	31	42.59	23	SNP	0.982	C
PIGR	5284	genome.wustl.edu	37	1	207110625	207110625	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:207110625C>T	ENST00000356495.4	-	4	1043	c.860G>A	c.(859-861)gGg>gAg	p.G287E		NM_002644.3	NP_002635.2	P01833	PIGR_HUMAN	polymeric immunoglobulin receptor	287	Ig-like V-type 3.				detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc receptor signaling pathway (GO:0038093)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|receptor clustering (GO:0043113)|retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	polymeric immunoglobulin receptor activity (GO:0001792)			central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGCCCTCTTCCCCAGGGTGTT	0.592																																						dbGAP											0													80.0	76.0	78.0					1																	207110625		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1474.1	1q31-q41	2013-01-11			ENSG00000162896	ENSG00000162896		"""Immunoglobulin superfamily / V-set domain containing"""	8968	protein-coding gene	gene with protein product		173880					Standard	NM_002644		Approved		uc001hez.3	P01833	OTTHUMG00000036581	ENST00000356495.4:c.860G>A	1.37:g.207110625C>T	ENSP00000348888:p.Gly287Glu		Q68D81|Q8IZY7	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.G287E	ENST00000356495.4	37	c.860	CCDS1474.1	1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.433028	0.62844	.	.	ENSG00000162896	ENST00000356495	T	0.04917	3.53	5.78	3.92	0.45320	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.157339	0.45606	D	0.000351	T	0.23727	0.0574	M	0.83953	2.67	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.04946	-1.0916	10	0.51188	T	0.08	-11.9985	8.8745	0.35337	0.0:0.8285:0.0:0.1715	.	287	P01833	PIGR_HUMAN	E	287	ENSP00000348888:G287E	ENSP00000348888:G287E	G	-	2	0	PIGR	205177248	0.004000	0.15560	0.018000	0.16275	0.054000	0.15201	0.890000	0.28295	0.804000	0.34136	0.650000	0.86243	GGG	PIGR	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr	ENSG00000162896		0.592	PIGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGR	HGNC	protein_coding	OTTHUMT00000088975.1	62	0.00	0	C	NM_002644		207110625	207110625	-1	no_errors	ENST00000356495	ensembl	human	known	69_37n	missense	99	22.66	29	SNP	0.068	T
PKD2L1	9033	genome.wustl.edu	37	10	102055882	102055882	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr10:102055882G>C	ENST00000318222.3	-	7	1735	c.1353C>G	c.(1351-1353)atC>atG	p.I451M	PKD2L1_ENST00000338519.3_Missense_Mutation_p.I376M|PKD2L1_ENST00000353274.3_Missense_Mutation_p.I451M	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	451					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CAGGTACCTTGATCCAGGCGA	0.448																																						dbGAP											0													170.0	124.0	139.0					10																	102055882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.1353C>G	10.37:g.102055882G>C	ENSP00000325296:p.Ile451Met		O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2,prints_PKD_1	p.I451M	ENST00000318222.3	37	c.1353	CCDS7492.1	10	.	.	.	.	.	.	.	.	.	.	G	14.81	2.647777	0.47258	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.71934	-0.61;-0.61;-0.61	6.04	4.18	0.49190	Polycystin cation channel, PKD1/PKD2 (1);	0.000000	0.85682	D	0.000000	T	0.80623	0.4658	M	0.73962	2.25	0.42665	D	0.99349	D;D	0.65815	0.995;0.989	D;D	0.68039	0.914;0.955	T	0.81380	-0.0959	10	0.51188	T	0.08	-25.3094	9.8186	0.40869	0.2103:0.0:0.7897:0.0	.	404;451	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	M	376;451;451;449	ENSP00000345068:I376M;ENSP00000266049:I451M;ENSP00000325296:I451M	ENSP00000325296:I451M	I	-	3	3	PKD2L1	102045872	0.998000	0.40836	1.000000	0.80357	0.477000	0.33069	0.434000	0.21494	1.569000	0.49696	-0.291000	0.09656	ATC	PKD2L1	-	pfam_PKD1_2_channel,pfam_Ion_trans_dom,prints_PKD_2	ENSG00000107593		0.448	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2L1	HGNC	protein_coding	OTTHUMT00000049863.2	77	0.00	0	G	NM_016112		102055882	102055882	-1	no_errors	ENST00000318222	ensembl	human	known	69_37n	missense	49	26.87	18	SNP	1.000	C
PPIEL	728448	genome.wustl.edu	37	1	40011602	40011602	+	RNA	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:40011602C>G	ENST00000440190.1	-	0	257				RP11-69E11.4_ENST00000417869.1_RNA																							ACACACCCACCCAGAACACAA	0.572																																						dbGAP											0																																										-	-	-			0																															1.37:g.40011602C>G				RNA	SNP	-	NULL	ENST00000440190.1	37	NULL		1																																																																																			RP11-69E11.4	-	-	ENSG00000182109		0.572	RP11-69E11.4-003	KNOWN	basic	antisense	PPIEL	Clone_based_vega_gene	antisense	OTTHUMT00000025214.1	25	0.00	0	C			40011602	40011602	-1	no_errors	ENST00000440190	ensembl	human	known	69_37n	rna	26	36.59	15	SNP	0.001	G
PRRT3	285368	genome.wustl.edu	37	3	9991723	9991723	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr3:9991723A>G	ENST00000412055.1	-	2	206	c.77T>C	c.(76-78)cTg>cCg	p.L26P	PRRT3_ENST00000411976.2_Missense_Mutation_p.L26P|PRRT3-AS1_ENST00000431558.1_RNA	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	26						integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						GCCCCTCCCCAGGGCAGGGCC	0.632																																						dbGAP											0													32.0	37.0	36.0					3																	9991723		1889	4103	5992	-	-	-	SO:0001583	missense	0			AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.77T>C	3.37:g.9991723A>G	ENSP00000392511:p.Leu26Pro		Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	NULL	p.L26P	ENST00000412055.1	37	c.77	CCDS43049.1	3	.	.	.	.	.	.	.	.	.	.	A	12.50	1.956744	0.34565	.	.	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.35789	1.67;1.29	3.99	1.64	0.23874	.	0.504921	0.14962	N	0.288308	T	0.40297	0.1111	L	0.34521	1.04	0.50467	D	0.999873	D;D	0.76494	0.999;0.99	D;P	0.71414	0.973;0.858	T	0.23226	-1.0194	9	.	.	.	-1.8826	4.8996	0.13767	0.7479:0.0:0.2521:0.0	.	26;26	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	P	26	ENSP00000392511:L26P;ENSP00000404512:L26P	.	L	-	2	0	PRRT3	9966723	0.370000	0.25047	0.882000	0.34594	0.238000	0.25445	1.151000	0.31651	0.665000	0.31066	0.455000	0.32223	CTG	PRRT3	-	NULL	ENSG00000163704		0.632	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT3	HGNC	protein_coding	OTTHUMT00000339322.1	44	0.00	0	A	NM_207351		9991723	9991723	-1	no_errors	ENST00000295984	ensembl	human	known	69_37n	missense	51	21.54	14	SNP	0.983	G
RAB23	51715	genome.wustl.edu	37	6	57054942	57054942	+	3'UTR	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:57054942A>G	ENST00000317483.3	-	0	1650				RAB23_ENST00000468148.1_3'UTR	NM_016277.3	NP_057361.3	Q9ULC3	RAB23_HUMAN	RAB23, member RAS oncogene family						autophagic vacuole assembly (GO:0000045)|cellular defense response (GO:0006968)|cilium assembly (GO:0042384)|craniofacial suture morphogenesis (GO:0097094)|embryonic digit morphogenesis (GO:0042733)|GTP catabolic process (GO:0006184)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription factor import into nucleus (GO:0042992)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|small GTPase mediated signal transduction (GO:0007264)|spinal cord dorsal/ventral patterning (GO:0021513)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	8	Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CAATATATTTAGGCATTTCAT	0.323																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB034244	CCDS4962.1	6p12.1	2008-05-15			ENSG00000112210	ENSG00000112210		"""RAB, member RAS oncogene"""	14263	protein-coding gene	gene with protein product		606144					Standard	NM_016277		Approved		uc003pdt.3	Q9ULC3	OTTHUMG00000014918	ENST00000317483.3:c.*317T>C	6.37:g.57054942A>G			B2R9I5|Q68DJ6|Q8NI06|Q9P023	RNA	SNP	-	NULL	ENST00000317483.3	37	NULL	CCDS4962.1	6																																																																																			RAB23	-	-	ENSG00000112210		0.323	RAB23-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB23	HGNC	protein_coding	OTTHUMT00000041042.1	17	0.00	0	A			57054942	57054942	-1	no_errors	ENST00000344445	ensembl	human	known	69_37n	rna	5	70.59	12	SNP	0.981	G
RBMXL3	139804	genome.wustl.edu	37	X	114425148	114425148	+	Missense_Mutation	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:114425148C>T	ENST00000424776.3	+	1	1186	c.1144C>T	c.(1144-1146)Cgc>Tgc	p.R382C	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	382	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.R382C(1)		endometrium(13)|kidney(2)|skin(1)	16						CCGGAGTGACCGCTACGGAGA	0.632																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											13.0	14.0	13.0					X																	114425148		688	1577	2265	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1144C>T	X.37:g.114425148C>T	ENSP00000417451:p.Arg382Cys		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R382C	ENST00000424776.3	37	c.1144	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	C	6.679	0.493774	0.12702	.	.	ENSG00000175718	ENST00000424776	T	0.06142	3.34	0.341	-0.683	0.11335	.	.	.	.	.	T	0.04182	0.0116	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	P	0.49953	0.627	T	0.30563	-0.9974	8	0.87932	D	0	.	.	.	.	.	382	Q8N7X1	RMXL3_HUMAN	C	382	ENSP00000417451:R382C	ENSP00000417451:R382C	R	+	1	0	RBMXL3	114331404	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.381000	0.01065	-1.475000	0.01876	-1.599000	0.00816	CGC	RBMXL3	-	NULL	ENSG00000175718		0.632	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	62	0.00	0	C	NM_001145346		114425148	114425148	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	57	21.92	16	SNP	0.001	T
LILRB3	11025	genome.wustl.edu	37	19	54735619	54735619	+	Intron	SNP	G	G	A	rs7250243	byFrequency	TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr19:54735619G>A	ENST00000407860.2	-	4	357				LILRA6_ENST00000419410.2_Intron|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000270464.5_Intron|LILRA6_ENST00000391735.3_Intron			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3						cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TTAAACAGGCGGGAGCCTCTG	0.577													.|||	773	0.154353	0.1717	0.1744	5008	,	,		20262	0.0794		0.172	False		,,,				2504	0.1759					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000407860.2:c.356-9617C>T	19.37:g.54735619G>A			C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	pfam_Ribosomal_S4/S9_N,tigrfam_Ribosomal_S4/S9_euk/arc	p.G75R	ENST00000407860.2	37	c.223		19																																																																																			RPS9	-	NULL	ENSG00000170889		0.577	LILRB3-201	KNOWN	basic|appris_candidate_longest	protein_coding	RPS9	HGNC	protein_coding		31	0.00	0	G	NM_006864		54735619	54735619	+1	no_errors	ENST00000448962	ensembl	human	known	69_37n	missense	15	16.67	3	SNP	0.008	A
SDHAP1	255812	genome.wustl.edu	37	3	195711501	195711501	+	RNA	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr3:195711501G>C	ENST00000427841.1	-	0	446					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		CCGTCACGTAGTGGATGGCAT	0.587																																					Ovarian(67;1158 1227 12109 20189 43170)	dbGAP											0																																										-	-	-			0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195711501G>C				RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.587	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	152	0.00	0	G			195711501	195711501	-1	no_errors	ENST00000427841	ensembl	human	known	69_37n	rna	133	10.74	16	SNP	0.999	C
SEC63	11231	genome.wustl.edu	37	6	108279120	108279120	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:108279120A>G	ENST00000369002.4	-	1	273	c.94T>C	c.(94-96)Tac>Cac	p.Y32H	SEC63_ENST00000460009.1_5'UTR|RP1-191J18.66_ENST00000606070.1_RNA	NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	32					liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		CAGAGGTAGTATGTCGCCGGG	0.677																																						dbGAP											0													108.0	89.0	95.0					6																	108279120		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.94T>C	6.37:g.108279120A>G	ENSP00000357998:p.Tyr32His		O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_ARM-type_fold,smart_DnaJ_N,smart_Sec63-dom,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.Y32H	ENST00000369002.4	37	c.94	CCDS5061.1	6	.	.	.	.	.	.	.	.	.	.	A	30	5.053635	0.93793	.	.	ENSG00000025796	ENST00000369002	T	0.78595	-1.19	4.72	4.72	0.59763	.	0.064504	0.64402	D	0.000004	T	0.81927	0.4926	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.65987	0.94	D	0.84102	0.0396	10	0.59425	D	0.04	-2.6835	13.329	0.60475	1.0:0.0:0.0:0.0	.	32	Q9UGP8	SEC63_HUMAN	H	32	ENSP00000357998:Y32H	ENSP00000357998:Y32H	Y	-	1	0	SEC63	108385813	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	7.715000	0.84713	1.976000	0.57569	0.533000	0.62120	TAC	SEC63	-	NULL	ENSG00000025796		0.677	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC63	HGNC	protein_coding	OTTHUMT00000041705.4	16	0.00	0	A	NM_007214		108279120	108279120	-1	no_errors	ENST00000369002	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	0.998	G
SEMA4A	64218	genome.wustl.edu	37	1	156146717	156146717	+	Missense_Mutation	SNP	C	C	G	rs372008176		TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:156146717C>G	ENST00000368285.3	+	15	2482	c.2215C>G	c.(2215-2217)Ccc>Gcc	p.P739A	SEMA4A_ENST00000355014.2_Missense_Mutation_p.P739A|SEMA4A_ENST00000368286.2_Missense_Mutation_p.P607A|SEMA4A_ENST00000368284.1_Missense_Mutation_p.P607A|SEMA4A_ENST00000368282.1_Missense_Mutation_p.P739A	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	739					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					CCTCCAGTCTCCCAAGGAATG	0.617																																						dbGAP											0													53.0	50.0	51.0					1																	156146717		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.2215C>G	1.37:g.156146717C>G	ENSP00000357268:p.Pro739Ala		B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.P739A	ENST00000368285.3	37	c.2215	CCDS1132.1	1	.	.	.	.	.	.	.	.	.	.	c	2.145	-0.395959	0.04899	.	.	ENSG00000196189	ENST00000355014;ENST00000368285;ENST00000368284;ENST00000368283;ENST00000544376;ENST00000368286;ENST00000368282	T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36	5.18	-0.269	0.12930	.	0.857379	0.09485	U	0.795762	T	0.46483	0.1395	L	0.38531	1.155	0.09310	N	1	B;B	0.20261	0.043;0.022	B;B	0.14023	0.01;0.009	T	0.24584	-1.0156	10	0.25751	T	0.34	.	4.5692	0.12202	0.0:0.3692:0.2595:0.3712	.	607;739	Q5TCJ6;Q9H3S1	.;SEM4A_HUMAN	A	739;739;607;701;701;607;739	ENSP00000347117:P739A;ENSP00000357268:P739A;ENSP00000357267:P607A;ENSP00000357269:P607A;ENSP00000357265:P739A	ENSP00000347117:P739A	P	+	1	0	SEMA4A	154413341	0.000000	0.05858	0.031000	0.17742	0.255000	0.26057	0.203000	0.17315	-0.021000	0.14009	0.306000	0.20318	CCC	SEMA4A	-	NULL	ENSG00000196189		0.617	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4A	HGNC	protein_coding	OTTHUMT00000039484.2	74	0.00	0	C	NM_022367		156146717	156146717	+1	no_errors	ENST00000355014	ensembl	human	known	69_37n	missense	106	36.90	62	SNP	0.034	G
SEMA6A	57556	genome.wustl.edu	37	5	115823874	115823874	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr5:115823874G>T	ENST00000343348.6	-	9	1461	c.674C>A	c.(673-675)gCc>gAc	p.A225D	CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000503962.1_5'Flank|SEMA6A_ENST00000257414.8_Missense_Mutation_p.A225D|SEMA6A_ENST00000510263.1_Missense_Mutation_p.A225D	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	225	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GTAATCCACGGCTTGAACAAA	0.408																																						dbGAP											0													89.0	81.0	84.0					5																	115823874		1871	4120	5991	-	-	-	SO:0001583	missense	0			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.674C>A	5.37:g.115823874G>T	ENSP00000345512:p.Ala225Asp		Q9P2H9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.A225D	ENST00000343348.6	37	c.674	CCDS47256.1	5	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203784	0.79127	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263	T;T;T	0.15603	2.41;2.41;2.41	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.56277	0.1974	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.65681	-0.6109	10	0.87932	D	0	.	20.1581	0.98126	0.0:0.0:1.0:0.0	.	225;225	Q9H2E6;Q9H2E6-2	SEM6A_HUMAN;.	D	225	ENSP00000345512:A225D;ENSP00000257414:A225D;ENSP00000424388:A225D	ENSP00000257414:A225D	A	-	2	0	SEMA6A	115851773	1.000000	0.71417	0.974000	0.42286	0.487000	0.33371	9.813000	0.99286	2.937000	0.99478	0.650000	0.86243	GCC	SEMA6A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000092421		0.408	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1	97	0.00	0	G	NM_020796		115823874	115823874	-1	no_errors	ENST00000257414	ensembl	human	known	69_37n	missense	37	43.08	28	SNP	1.000	T
EIF4A1	1973	genome.wustl.edu	37	17	7482194	7482194	+	3'UTR	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr17:7482194C>G	ENST00000293831.8	+	0	1627				SNORD10_ENST00000459579.1_RNA|EIF4A1_ENST00000582746.1_3'UTR|SNORA67_ENST00000384423.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|CD68_ENST00000380498.6_5'Flank|CD68_ENST00000250092.6_5'Flank	NM_001416.3	NP_001407.1	P60842	IF4A1_HUMAN	eukaryotic translation initiation factor 4A1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			NS(1)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	22						GTGAGGTTGCCCAGGGGGTTG	0.463																																					Melanoma(120;278 1668 15796 27423 46368)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			D13748	CCDS11113.1, CCDS58511.1	17p13	2012-02-23	2010-02-10		ENSG00000161960	ENSG00000161960		"""DEAD-boxes"""	3282	protein-coding gene	gene with protein product		602641	"""eukaryotic translation initiation factor 4A, isoform 1"""	EIF4A		8493113, 9790779	Standard	NM_001416		Approved	DDX2A, EIF-4A		P60842	OTTHUMG00000108149	ENST00000293831.8:c.*390C>G	17.37:g.7482194C>G			B2R6L8|D3DTP9|J3QLC4|P04765|Q5U018|Q61516	RNA	SNP	-	NULL	ENST00000293831.8	37	NULL	CCDS11113.1	17																																																																																			RP11-186B7.4	-	-	ENSG00000264772		0.463	EIF4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA67	Clone_based_vega_gene	protein_coding	OTTHUMT00000226952.6	78	0.00	0	C	NM_001416		7482194	7482194	+1	no_errors	ENST00000581621	ensembl	human	known	69_37n	rna	35	33.96	18	SNP	0.901	G
SZT2	23334	genome.wustl.edu	37	1	43889967	43889967	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:43889967G>A	ENST00000562955.1	+	16	2335	c.2335G>A	c.(2335-2337)Ggc>Agc	p.G779S	SZT2_ENST00000372442.1_5'UTR	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	779					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CTTGGTGTCAGGCCGCTCAGC	0.612																																						dbGAP											0													63.0	56.0	58.0					1																	43889967		876	1991	2867	-	-	-	SO:0001583	missense	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.2335G>A	1.37:g.43889967G>A	ENSP00000457168:p.Gly779Ser		A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.G779S	ENST00000562955.1	37	c.2335	CCDS30694.2	1																																																																																			SZT2	-	NULL	ENSG00000198198		0.612	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	69	0.00	0	G	NM_015284		43889967	43889967	+1	no_errors	ENST00000562955	ensembl	human	known	69_37n	missense	36	52.63	40	SNP	0.998	A
SPAG17	200162	genome.wustl.edu	37	1	118584483	118584483	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:118584483C>G	ENST00000336338.5	-	21	3062	c.2997G>C	c.(2995-2997)aaG>aaC	p.K999N		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	999						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTTCTTGGATCTTGACTTGTT	0.398																																						dbGAP											0													340.0	341.0	340.0					1																	118584483		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2997G>C	1.37:g.118584483C>G	ENSP00000337804:p.Lys999Asn		Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.K999N	ENST00000336338.5	37	c.2997	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.245727	0.22796	.	.	ENSG00000155761	ENST00000336338	T	0.29142	1.58	4.72	0.558	0.17266	.	0.806942	0.11169	N	0.592203	T	0.07143	0.0181	N	0.08118	0	0.09310	N	1	P	0.47762	0.9	P	0.47645	0.553	T	0.09862	-1.0655	10	0.62326	D	0.03	.	3.2218	0.06717	0.3024:0.3992:0.0:0.2985	.	999	Q6Q759	SPG17_HUMAN	N	999	ENSP00000337804:K999N	ENSP00000337804:K999N	K	-	3	2	SPAG17	118386006	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.730000	0.26043	-0.077000	0.12752	-0.142000	0.14014	AAG	SPAG17	-	NULL	ENSG00000155761		0.398	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	157	0.00	0	C	NM_206996		118584483	118584483	-1	no_errors	ENST00000336338	ensembl	human	known	69_37n	missense	113	31.93	53	SNP	0.000	G
TBL1X	6907	genome.wustl.edu	37	X	9661204	9661204	+	Silent	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chrX:9661204T>C	ENST00000217964.7	+	10	1547	c.907T>C	c.(907-909)Ttg>Ctg	p.L303L	TBL1X_ENST00000380961.1_Silent_p.L252L|TBL1X_ENST00000536365.1_Silent_p.L252L|TBL1X_ENST00000424279.1_Silent_p.L252L|TBL1X_ENST00000407597.2_Silent_p.L303L	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	303					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				TGGAACACTCTTGGCTACGGG	0.537																																						dbGAP											0													160.0	139.0	146.0					X																	9661204		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.907T>C	X.37:g.9661204T>C			A8K044|A8K4J7|Q86UY2	Silent	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L303	ENST00000217964.7	37	c.907	CCDS14133.1	X																																																																																			TBL1X	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000101849		0.537	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	TBL1X	HGNC	protein_coding	OTTHUMT00000055709.1	155	0.00	0	T	NM_005647		9661204	9661204	+1	no_errors	ENST00000217964	ensembl	human	known	69_37n	silent	108	33.74	55	SNP	0.002	C
TCF20	6942	genome.wustl.edu	37	22	42607383	42607383	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr22:42607383G>C	ENST00000359486.3	-	1	4065	c.3929C>G	c.(3928-3930)tCt>tGt	p.S1310C	TCF20_ENST00000335626.4_Missense_Mutation_p.S1310C|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CTTAGGGATAGACTTGATATC	0.463																																						dbGAP											0													176.0	168.0	171.0					22																	42607383		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3929C>G	22.37:g.42607383G>C	ENSP00000352463:p.Ser1310Cys		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.S1310C	ENST00000359486.3	37	c.3929	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	12.74	2.027333	0.35797	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.59638	0.25;0.25	5.38	4.36	0.52297	.	0.373982	0.26086	N	0.026426	T	0.52757	0.1754	L	0.38175	1.15	0.80722	D	1	P;P	0.47484	0.896;0.833	P;B	0.48815	0.591;0.387	T	0.52808	-0.8526	10	0.46703	T	0.11	-6.7293	9.4117	0.38496	0.0768:0.1621:0.7611:0.0	.	1310;1310	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	C	1310	ENSP00000352463:S1310C;ENSP00000335561:S1310C	ENSP00000335561:S1310C	S	-	2	0	TCF20	40937327	0.991000	0.36638	0.995000	0.50966	0.982000	0.71751	2.476000	0.45171	1.506000	0.48736	0.655000	0.94253	TCT	TCF20	-	NULL	ENSG00000100207		0.463	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	41	0.00	0	G	NM_181492		42607383	42607383	-1	no_errors	ENST00000359486	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	0.940	C
TECTA	7007	genome.wustl.edu	37	11	121016479	121016479	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr11:121016479G>T	ENST00000392793.1	+	12	4030	c.3759G>T	c.(3757-3759)gaG>gaT	p.E1253D	TECTA_ENST00000478058.1_3'UTR|TECTA_ENST00000264037.2_Missense_Mutation_p.E1253D			O75443	TECTA_HUMAN	tectorin alpha	1253	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		ATGACCTGGAGATGCCCATGG	0.582																																						dbGAP											0													153.0	127.0	136.0					11																	121016479		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.3759G>T	11.37:g.121016479G>T	ENSP00000376543:p.Glu1253Asp			Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.E1253D	ENST00000392793.1	37	c.3759	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	10.76	1.441937	0.25900	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.59364	0.27;0.27	5.76	4.8	0.61643	von Willebrand factor, type D domain (3);	0.124010	0.56097	D	0.000032	T	0.45135	0.1327	L	0.29908	0.895	0.26186	N	0.979657	B	0.25772	0.134	B	0.26202	0.067	T	0.17228	-1.0376	10	0.13470	T	0.59	.	16.2742	0.82636	0.0:0.1325:0.8675:0.0	.	1253	O75443	TECTA_HUMAN	D	1253	ENSP00000376543:E1253D;ENSP00000264037:E1253D	ENSP00000264037:E1253D	E	+	3	2	TECTA	120521689	0.131000	0.22433	1.000000	0.80357	0.968000	0.65278	0.337000	0.19841	2.721000	0.93114	0.591000	0.81541	GAG	TECTA	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000109927		0.582	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	103	0.00	0	G	NM_005422		121016479	121016479	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	missense	141	11.32	18	SNP	1.000	T
TANGO6	79613	genome.wustl.edu	37	16	68901011	68901011	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr16:68901011G>T	ENST00000261778.1	+	4	894	c.882G>T	c.(880-882)agG>agT	p.R294S		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	294						integral component of membrane (GO:0016021)											CACAGATGAGGTGTCGGGCCC	0.502																																						dbGAP											0													105.0	104.0	104.0					16																	68901011		1925	4131	6056	-	-	-	SO:0001583	missense	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.882G>T	16.37:g.68901011G>T	ENSP00000261778:p.Arg294Ser		Q569F9|Q9H9K1	Missense_Mutation	SNP	pfam_DUF2411,superfamily_ARM-type_fold	p.R294S	ENST00000261778.1	37	c.882	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	G	8.720	0.914174	0.17907	.	.	ENSG00000103047	ENST00000261778	T	0.70282	-0.47	5.83	1.4	0.22301	.	.	.	.	.	T	0.52158	0.1717	L	0.35288	1.05	0.09310	N	1	B;B	0.13594	0.008;0.003	B;B	0.06405	0.002;0.002	T	0.30387	-0.9980	9	0.13853	T	0.58	-1.8044	5.4659	0.16642	0.317:0.0:0.5269:0.1561	.	294;133	Q9C0B7;B3KTB6	TMCO7_HUMAN;.	S	294	ENSP00000261778:R294S	ENSP00000261778:R294S	R	+	3	2	TMCO7	67458512	0.003000	0.15002	0.009000	0.14445	0.177000	0.22998	0.494000	0.22467	0.394000	0.25230	0.650000	0.86243	AGG	TMCO7	-	NULL	ENSG00000103047		0.502	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO7	HGNC	protein_coding	OTTHUMT00000433471.2	61	0.00	0	G	XM_928235.2		68901011	68901011	+1	no_errors	ENST00000261778	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.001	T
TMPRSS5	80975	genome.wustl.edu	37	11	113565113	113565113	+	Intron	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr11:113565113G>C	ENST00000299882.5	-	8	934				TMPRSS5_ENST00000545579.1_Intron|TMPRSS5_ENST00000540540.1_Intron|TMPRSS5_ENST00000536856.1_Intron|TMPRSS5_ENST00000545265.1_5'Flank|TMPRSS5_ENST00000538955.1_Intron|TMPRSS5_ENST00000544476.1_Intron|TMPRSS5_ENST00000544634.1_Intron	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5						proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		GAGACAGTTGGACACGAACAT	0.443																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.785+86C>G	11.37:g.113565113G>C				RNA	SNP	-	NULL	ENST00000299882.5	37	NULL	CCDS44735.1	11																																																																																			TMPRSS5	-	-	ENSG00000166682		0.443	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS5	HGNC	protein_coding	OTTHUMT00000398652.1	34	0.00	0	G	NM_030770		113565113	113565113	-1	no_errors	ENST00000545412	ensembl	human	putative	69_37n	rna	32	33.33	16	SNP	0.002	C
TOE1	114034	genome.wustl.edu	37	1	45809422	45809422	+	3'UTR	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:45809422C>G	ENST00000372090.5	+	0	2164				TOE1_ENST00000495703.1_3'UTR|TOE1_ENST00000539779.1_3'UTR|TESK2_ENST00000486676.1_5'Flank	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)							nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					TTTTGGGTCTCTCTAGCCTGA	0.507																																						dbGAP											0													39.0	39.0	39.0					1																	45809422		2200	4294	6494	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.*48C>G	1.37:g.45809422C>G			B4DEM6|Q6IA35|Q8IWN5|Q9H846	RNA	SNP	-	NULL	ENST00000372090.5	37	NULL	CCDS521.1	1																																																																																			TOE1	-	-	ENSG00000132773		0.507	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOE1	HGNC	protein_coding	OTTHUMT00000020517.1	17	0.00	0	C	NM_025077		45809422	45809422	+1	no_errors	ENST00000495703	ensembl	human	known	69_37n	rna	18	25.00	6	SNP	0.000	G
TP53	7157	genome.wustl.edu	37	17	7578527	7578527	+	Missense_Mutation	SNP	A	A	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr17:7578527A>G	ENST00000269305.4	-	5	592	c.403T>C	c.(403-405)Tgc>Cgc	p.C135R	TP53_ENST00000413465.2_Missense_Mutation_p.C135R|TP53_ENST00000359597.4_Missense_Mutation_p.C135R|TP53_ENST00000455263.2_Missense_Mutation_p.C135R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.C135R|TP53_ENST00000445888.2_Missense_Mutation_p.C135R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135R(11)|p.0?(8)|p.C135G(6)|p.C135fs*35(4)|p.C135S(4)|p.N131fs*27(2)|p.V73fs*9(1)|p.F134_T140>S(1)|p.C135_T140delCQLAKT(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C135_A138delCQLA(1)|p.K132_A138delKMFCQLA(1)|p.C135fs*36(1)|p.S127_Q136del10(1)|p.C135T(1)|p.F134fs*14(1)|p.C42R(1)|p.M133fs*13(1)|p.C3R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCAGTTGGCAAAACATCTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	49	Substitution - Missense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(2)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(5)|biliary_tract(5)|breast(5)|large_intestine(4)|oesophagus(4)|lung(4)|bone(4)|upper_aerodigestive_tract(2)|urinary_tract(2)|pancreas(2)|stomach(1)|skin(1)|penis(1)|ovary(1)											49.0	50.0	49.0					17																	7578527		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.403T>C	17.37:g.7578527A>G	ENSP00000269305:p.Cys135Arg		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C135R	ENST00000269305.4	37	c.403	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	22.8	4.340491	0.81911	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99743	0.9898	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0;1.0;1.0	D;D;P;D;D;D;D	0.97110	0.997;1.0;0.904;1.0;1.0;1.0;1.0	D	0.97181	0.9851	10	0.87932	D	0	-26.815	13.8301	0.63375	1.0:0.0:0.0:0.0	.	96;135;135;42;135;135;135	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	135;135;135;135;135;135;124;42;3;42;3;135	ENSP00000410739:C135R;ENSP00000352610:C135R;ENSP00000269305:C135R;ENSP00000398846:C135R;ENSP00000391127:C135R;ENSP00000391478:C135R;ENSP00000425104:C3R;ENSP00000423862:C42R;ENSP00000424104:C135R	ENSP00000269305:C135R	C	-	1	0	TP53	7519252	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.283000	0.95860	2.206000	0.71126	0.533000	0.62120	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	42	0.00	0	A	NM_000546		7578527	7578527	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	1.000	G
TPR	7175	genome.wustl.edu	37	1	186322968	186322968	+	Missense_Mutation	SNP	T	T	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr1:186322968T>A	ENST00000367478.4	-	18	2482	c.2186A>T	c.(2185-2187)cAa>cTa	p.Q729L	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	729					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AACATTATCTTGCAGCATTTC	0.338			T	NTRK1	papillary thyroid																																	dbGAP		Dom	yes		1	1q25	7175	translocated promoter region		E	0													187.0	162.0	169.0					1																	186322968		1871	4109	5980	-	-	-	SO:0001583	missense	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.2186A>T	1.37:g.186322968T>A	ENSP00000356448:p.Gln729Leu		Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.Q729L	ENST00000367478.4	37	c.2186	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	T	31	5.094042	0.94149	.	.	ENSG00000047410	ENST00000367478	T	0.17691	2.26	5.83	5.83	0.93111	.	0.106873	0.64402	D	0.000004	T	0.42494	0.1205	M	0.72118	2.19	0.80722	D	1	D	0.63880	0.993	D	0.72338	0.977	T	0.28522	-1.0041	10	0.62326	D	0.03	.	16.1968	0.82036	0.0:0.0:0.0:1.0	.	729	P12270	TPR_HUMAN	L	729	ENSP00000356448:Q729L	ENSP00000356448:Q729L	Q	-	2	0	TPR	184589591	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	7.655000	0.83696	2.225000	0.72522	0.533000	0.62120	CAA	TPR	-	NULL	ENSG00000047410		0.338	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	88	0.00	0	T	NM_003292		186322968	186322968	-1	no_errors	ENST00000367478	ensembl	human	known	69_37n	missense	116	13.43	18	SNP	1.000	A
TRAV13-2	28670	genome.wustl.edu	37	14	22386766	22386766	+	RNA	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr14:22386766G>T	ENST00000390439.2	+	0	245									T cell receptor alpha variable 13-2																		GTACAAGCAAGAATCTGGAAA	0.413																																						dbGAP											0													81.0	79.0	80.0					14																	22386766		1868	4102	5970	-	-	-			0			AE000659		14q11.2	2012-02-07			ENSG00000211791	ENSG00000211791		"""T cell receptors / TRA locus"""	12109	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000168997		14.37:g.22386766G>T				Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E59*	ENST00000390439.2	37	c.175		14																																																																																			TRAV13-2	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211791		0.413	TRAV13-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRAV13-2	HGNC	TR_V_gene	OTTHUMT00000401895.1	45	0.00	0	G	NG_001332		22386766	22386766	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390439	ensembl	human	known	69_37n	nonsense	30	26.83	11	SNP	0.022	T
TRIM26	7726	genome.wustl.edu	37	6	30153878	30153878	+	Silent	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:30153878G>C	ENST00000454678.2	-	10	1831	c.1395C>G	c.(1393-1395)ctC>ctG	p.L465L	TRIM26_ENST00000437089.1_Silent_p.L465L|TRIM26_ENST00000453195.1_Silent_p.L465L	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	465	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			lung(1)|ovary(2)	3						CGGAGGAGGAGAGGCGCAGCG	0.642																																						dbGAP											0													30.0	20.0	24.0					6																	30153878		1508	2707	4215	-	-	-	SO:0001819	synonymous_variant	0			AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.1395C>G	6.37:g.30153878G>C			A6NG96|Q5SRL2	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L465	ENST00000454678.2	37	c.1395	CCDS4678.1	6																																																																																			TRIM26	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000234127		0.642	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM26	HGNC	protein_coding	OTTHUMT00000253442.1	58	0.00	0	G	NM_003449		30153878	30153878	-1	no_errors	ENST00000437089	ensembl	human	known	69_37n	silent	64	27.27	24	SNP	0.044	C
TTN	7273	genome.wustl.edu	37	2	179428450	179428450	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr2:179428450G>T	ENST00000591111.1	-	276	77710	c.77486C>A	c.(77485-77487)cCa>cAa	p.P25829Q	TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P18530Q|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P18405Q|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P18597Q|TTN_ENST00000342992.6_Missense_Mutation_p.P24902Q|TTN_ENST00000589042.1_Missense_Mutation_p.P27470Q			Q8WZ42	TITIN_HUMAN	titin	25829					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGAGGACCTGGTGGCTTATA	0.488																																						dbGAP											0													113.0	108.0	109.0					2																	179428450		1923	4145	6068	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77486C>A	2.37:g.179428450G>T	ENSP00000465570:p.Pro25829Gln		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.P24902Q	ENST00000591111.1	37	c.74705		2	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429672	0.43122	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13	5.97	5.97	0.96955	Fibronectin, type III (3);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.96673	0.8914	H	0.98388	4.22	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;1.0;0.998	D	0.97517	1.0070	9	0.87932	D	0	.	20.4387	0.99107	0.0:0.0:1.0:0.0	.	18405;18530;18597;25829	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	24902;18405;18597;18530;18403	ENSP00000343764:P24902Q;ENSP00000434586:P18405Q;ENSP00000340554:P18597Q;ENSP00000352154:P18530Q	ENSP00000340554:P18597Q	P	-	2	0	TTN	179136696	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	9.807000	0.99171	2.836000	0.97738	0.655000	0.94253	CCA	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.488	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	99	0.00	0	G	NM_133378		179428450	179428450	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	91	18.02	20	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179560939	179560939	+	Missense_Mutation	SNP	G	G	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr2:179560939G>T	ENST00000591111.1	-	112	30133	c.29909C>A	c.(29908-29910)aCc>aAc	p.T9970N	TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.T9043N|TTN_ENST00000589042.1_Missense_Mutation_p.T10287N			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTCTTTCTGGTTATAGTCAT	0.328																																						dbGAP											0													51.0	41.0	44.0					2																	179560939		1799	4042	5841	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29909C>A	2.37:g.179560939G>T	ENSP00000465570:p.Thr9970Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.T9043N	ENST00000591111.1	37	c.27128		2	.	.	.	.	.	.	.	.	.	.	G	12.67	2.008084	0.35415	.	.	ENSG00000155657	ENST00000342992;ENST00000414766	T	0.65178	-0.14	5.5	3.71	0.42584	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.57592	0.2064	M	0.64997	1.995	0.80722	D	1	B;B	0.30634	0.012;0.288	B;B	0.32533	0.015;0.147	T	0.57568	-0.7789	9	0.87932	D	0	.	7.786	0.29093	0.0866:0.1624:0.7509:0.0	.	9970;9970	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	N	9043;165	ENSP00000343764:T9043N	ENSP00000343764:T9043N	T	-	2	0	TTN	179269184	0.932000	0.31603	0.996000	0.52242	0.630000	0.37929	2.394000	0.44450	0.697000	0.31718	0.650000	0.86243	ACC	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.328	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	59	0.00	0	G	NM_133378		179560939	179560939	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179659960	179659960	+	Missense_Mutation	SNP	T	T	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr2:179659960T>C	ENST00000591111.1	-	7	1158	c.934A>G	c.(934-936)Aga>Gga	p.R312G	TTN_ENST00000359218.5_Missense_Mutation_p.R312G|TTN_ENST00000460472.2_Missense_Mutation_p.R312G|TTN_ENST00000360870.5_Missense_Mutation_p.R312G|TTN_ENST00000342175.6_Missense_Mutation_p.R312G|TTN_ENST00000342992.6_Missense_Mutation_p.R312G|TTN_ENST00000589042.1_Missense_Mutation_p.R312G			Q8WZ42	TITIN_HUMAN	titin	0	ZIS1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGGAGATTCTTGCTGCTGGA	0.517																																						dbGAP											0													78.0	72.0	74.0					2																	179659960		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.934A>G	2.37:g.179659960T>C	ENSP00000465570:p.Arg312Gly		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R312G	ENST00000591111.1	37	c.934		2	.	.	.	.	.	.	.	.	.	.	T	12.93	2.086311	0.36855	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.70399	-0.48;-0.15;-0.19;-0.2;-0.17	6.07	4.93	0.64822	.	.	.	.	.	T	0.71779	0.3380	L	0.56769	1.78	0.26247	N	0.978776	P;P;P;P;P	0.49185	0.518;0.518;0.518;0.518;0.92	B;B;B;B;P	0.48030	0.115;0.115;0.115;0.115;0.564	T	0.65417	-0.6173	9	0.87932	D	0	.	9.9689	0.41741	0.0:0.1349:0.0:0.8651	.	312;312;312;312;312	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	G	312	ENSP00000343764:R312G;ENSP00000434586:R312G;ENSP00000340554:R312G;ENSP00000352154:R312G;ENSP00000354117:R312G	ENSP00000340554:R312G	R	-	1	2	TTN	179368205	1.000000	0.71417	0.990000	0.47175	0.852000	0.48524	4.820000	0.62671	1.125000	0.41998	0.533000	0.62120	AGA	TTN	-	NULL	ENSG00000155657		0.517	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	34	0.00	0	T	NM_133378		179659960	179659960	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	C
UBE2I	7329	genome.wustl.edu	37	16	1370586	1370586	+	Intron	SNP	C	C	T			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr16:1370586C>T	ENST00000355803.4	+	6	964				UBE2I_ENST00000325437.5_Intron|UBE2I_ENST00000397514.3_Intron|LA16c-358B7.3_ENST00000567829.1_RNA|LA16c-358B7.3_ENST00000568106.1_RNA|UBE2I_ENST00000566587.1_Intron|UBE2I_ENST00000397515.2_Intron|UBE2I_ENST00000403747.2_Intron|UBE2I_ENST00000406620.1_Intron|UBE2I_ENST00000402301.1_Missense_Mutation_p.R161W	NM_194260.2	NP_919236.1	P63279	UBC9_HUMAN	ubiquitin-conjugating enzyme E2I						cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intracellular steroid hormone receptor signaling pathway (GO:0033145)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein sumoylation (GO:0016925)|regulation of receptor activity (GO:0010469)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|fibrillar center (GO:0001650)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RING-like zinc finger domain binding (GO:0071535)|SUMO ligase activity (GO:0019789)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	5		Hepatocellular(780;0.00369)				CCTGGCAGGACGGGAGTGGAG	0.667																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D45050	CCDS10433.1	16p13.3	2011-05-19	2011-05-19		ENSG00000103275	ENSG00000103275	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12485	protein-coding gene	gene with protein product		601661	"""ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9)"", ""ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)"""			8565643	Standard	NM_003345		Approved	UBC9	uc002cld.2	P63279	OTTHUMG00000047845	ENST00000355803.4:c.413+68C>T	16.37:g.1370586C>T			D3DU69|P50550|Q15698|Q59GX1|Q86VB3	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.R161W	ENST00000355803.4	37	c.481	CCDS10433.1	16	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580119	0.46006	.	.	ENSG00000103275	ENST00000402301	T	0.74315	-0.83	2.15	-0.0588	0.13796	.	.	.	.	.	T	0.46698	0.1406	.	.	.	0.09310	N	1	P	0.47677	0.899	B	0.22880	0.042	T	0.38564	-0.9655	7	.	.	.	.	4.6746	0.12706	0.1452:0.4365:0.4183:0.0	.	161	B0QYN7	.	W	161	ENSP00000384361:R161W	.	R	+	1	2	UBE2I	1310587	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.037000	0.12164	-0.261000	0.09405	-1.847000	0.00572	CGG	UBE2I	-	NULL	ENSG00000103275		0.667	UBE2I-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBE2I	HGNC	protein_coding	OTTHUMT00000250317.2	46	0.00	0	C	NM_003345		1370586	1370586	+1	no_errors	ENST00000402301	ensembl	human	putative	69_37n	missense	28	49.09	27	SNP	0.000	T
UTP20	27340	genome.wustl.edu	37	12	101748661	101748661	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr12:101748661G>C	ENST00000261637.4	+	41	5333	c.5159G>C	c.(5158-5160)cGt>cCt	p.R1720P		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1720					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GAATTAGAGCGTGTGGATGAG	0.428																																						dbGAP											0													97.0	86.0	90.0					12																	101748661		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.5159G>C	12.37:g.101748661G>C	ENSP00000261637:p.Arg1720Pro		Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.R1720P	ENST00000261637.4	37	c.5159	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	7.797	0.712799	0.15306	.	.	ENSG00000120800	ENST00000261637	T	0.18338	2.22	5.64	1.84	0.25277	Armadillo-type fold (1);	1.430090	0.03834	N	0.269442	T	0.10078	0.0247	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30534	-0.9975	10	0.39692	T	0.17	0.033	6.0942	0.20010	0.6059:0.3119:0.0822:0.0	.	1720	O75691	UTP20_HUMAN	P	1720	ENSP00000261637:R1720P	ENSP00000261637:R1720P	R	+	2	0	UTP20	100272792	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.234000	0.09028	0.059000	0.16252	-0.294000	0.09567	CGT	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.428	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	40	0.00	0	G	NM_014503		101748661	101748661	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	40	24.53	13	SNP	0.000	C
WAC	51322	genome.wustl.edu	37	10	28872359	28872359	+	Missense_Mutation	SNP	C	C	G			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr10:28872359C>G	ENST00000354911.4	+	4	467	c.306C>G	c.(304-306)caC>caG	p.H102Q	WAC_ENST00000428935.1_Missense_Mutation_p.H57Q|WAC_ENST00000375646.1_Missense_Mutation_p.H57Q|WAC_ENST00000347934.4_Missense_Mutation_p.H102Q|WAC_ENST00000375664.4_Missense_Mutation_p.H57Q	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	102					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						AAAATTCACACAACCACAGTG	0.313																																						dbGAP											0													150.0	161.0	158.0					10																	28872359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.306C>G	10.37:g.28872359C>G	ENSP00000346986:p.His102Gln		A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.H102Q	ENST00000354911.4	37	c.306	CCDS7159.1	10	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797809	0.70567	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911;ENST00000428935;ENST00000420266;ENST00000424454;ENST00000538000;ENST00000442148;ENST00000448193;ENST00000414108	T;T;T;T;T;T;T	0.45276	1.95;1.98;2.01;1.98;1.5;0.94;0.9	5.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.24509	0.0594	L	0.29908	0.895	0.58432	D	0.999999	B;B;B	0.33637	0.22;0.42;0.141	B;B;B	0.34652	0.135;0.187;0.064	T	0.09684	-1.0663	10	0.12430	T	0.62	-11.6304	3.7941	0.08733	0.0:0.6694:0.0:0.3306	.	57;102;102	Q9BTA9-2;Q9BTA9-5;Q9BTA9	.;.;WAC_HUMAN	Q	57;57;102;102;57;57;57;57;57;57;57	ENSP00000364816:H57Q;ENSP00000364797:H57Q;ENSP00000311106:H102Q;ENSP00000346986:H102Q;ENSP00000399706:H57Q;ENSP00000404758:H57Q;ENSP00000415645:H57Q	ENSP00000311106:H102Q	H	+	3	2	WAC	28912365	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.627000	0.37050	2.733000	0.93635	0.467000	0.42956	CAC	WAC	-	NULL	ENSG00000095787		0.313	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	WAC	HGNC	protein_coding	OTTHUMT00000047371.1	40	0.00	0	C	NM_100264		28872359	28872359	+1	no_errors	ENST00000354911	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	1.000	G
ZKSCAN5	23660	genome.wustl.edu	37	7	99110156	99110156	+	Silent	SNP	G	G	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr7:99110156G>A	ENST00000394170.2	+	3	746	c.495G>A	c.(493-495)ctG>ctA	p.L165L	ZKSCAN5_ENST00000451158.1_Silent_p.L165L|ZKSCAN5_ENST00000326775.5_Silent_p.L165L	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CCCATCCCCTGACCGTGGACA	0.552																																						dbGAP											0													147.0	125.0	133.0					7																	99110156		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.495G>A	7.37:g.99110156G>A			A4D280|D6W5S9	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L165	ENST00000394170.2	37	c.495	CCDS5667.1	7																																																																																			ZKSCAN5	-	NULL	ENSG00000196652		0.552	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN5	HGNC	protein_coding	OTTHUMT00000345597.1	137	0.00	0	G	NM_014569		99110156	99110156	+1	no_errors	ENST00000326775	ensembl	human	known	69_37n	silent	112	27.27	42	SNP	0.002	A
ZNF169	169841	genome.wustl.edu	37	9	97062216	97062216	+	Missense_Mutation	SNP	G	G	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr9:97062216G>A	ENST00000395395.2	+	5	466	c.376G>A	c.(376-378)Gga>Aga	p.G126R	ZNF169_ENST00000340911.4_3'UTR	NM_194320.2	NP_919301.2	Q14929	ZN169_HUMAN	zinc finger protein 169	126					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	24		Acute lymphoblastic leukemia(62;0.136)				CTCATCTGCAGGAGGTGACTT	0.517																																						dbGAP											0													69.0	66.0	67.0					9																	97062216		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28322	CCDS6709.2	9q22.32	2014-07-30			ENSG00000175787	ENSG00000175787		"""Zinc fingers, C2H2-type"", ""-"""	12957	protein-coding gene	gene with protein product		603404				9186526, 9071574	Standard	NM_001301275		Approved	MGC51961	uc004aum.1	Q14929	OTTHUMG00000020264	ENST00000395395.2:c.376G>A	9.37:g.97062216G>A	ENSP00000378792:p.Gly126Arg		A2AGP5|A8K127|Q6PI28	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G126R	ENST00000395395.2	37	c.376	CCDS6709.2	9	.	.	.	.	.	.	.	.	.	.	G	3.586	-0.084568	0.07097	.	.	ENSG00000175787	ENST00000395395	T	0.06294	3.32	2.73	1.81	0.25067	.	.	.	.	.	T	0.03011	0.0089	N	0.05280	-0.08	0.09310	N	0.999997	P	0.36483	0.555	B	0.38156	0.266	T	0.45249	-0.9274	9	0.16420	T	0.52	.	5.6514	0.17618	0.1567:0.0:0.8433:0.0	.	126	Q14929	ZN169_HUMAN	R	126	ENSP00000378792:G126R	ENSP00000378792:G126R	G	+	1	0	ZNF169	96102037	0.006000	0.16342	0.001000	0.08648	0.003000	0.03518	1.459000	0.35234	0.711000	0.32018	0.603000	0.83216	GGA	ZNF169	-	NULL	ENSG00000175787		0.517	ZNF169-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF169	HGNC	protein_coding	OTTHUMT00000253714.1	27	0.00	0	G	NM_194320		97062216	97062216	+1	no_errors	ENST00000395395	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.002	A
ZNF451	26036	genome.wustl.edu	37	6	56965700	56965700	+	Intron	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr6:56965700G>C	ENST00000370706.4	+	3	430				ZNF451_ENST00000491832.2_Intron|ZNF451_ENST00000370708.4_Missense_Mutation_p.E162D|ZNF451_ENST00000357489.3_Intron|ZNF451_ENST00000370702.1_Intron	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CCTCTTCTGAGGTCAAAGAGA	0.453																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.186+1761G>C	6.37:g.56965700G>C			Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	pfam_LAP2alpha	p.E162D	ENST00000370706.4	37	c.486	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811699	0.32053	.	.	ENSG00000112200	ENST00000370708;ENST00000508603	T	0.69806	-0.43	5.08	2.32	0.28847	.	.	.	.	.	T	0.24547	0.0595	N	0.08118	0	0.80722	D	1	B	0.32507	0.373	B	0.35278	0.199	T	0.04320	-1.0960	9	0.25751	T	0.34	.	6.3807	0.21533	0.2971:0.0:0.7029:0.0	.	162	Q9Y4E5-4	.	D	162;134	ENSP00000359742:E162D	ENSP00000359742:E162D	E	+	3	2	ZNF451	57073659	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	0.840000	0.27600	0.825000	0.34637	0.591000	0.81541	GAG	ZNF451	-	NULL	ENSG00000112200		0.453	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2	55	0.00	0	G	NM_015555		56965700	56965700	+1	no_errors	ENST00000370708	ensembl	human	known	69_37n	missense	67	33.00	33	SNP	1.000	C
ZNF540	163255	genome.wustl.edu	37	19	38103256	38103256	+	Missense_Mutation	SNP	G	G	C			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr19:38103256G>C	ENST00000592533.1	+	5	1407	c.1075G>C	c.(1075-1077)Gaa>Caa	p.E359Q	ZNF540_ENST00000316433.4_Missense_Mutation_p.E359Q|ZNF540_ENST00000589117.1_Missense_Mutation_p.E327Q|ZNF540_ENST00000343599.5_Missense_Mutation_p.E359Q	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	359					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CGAATGTAAGGAATGTGGAAA	0.388																																						dbGAP											0													73.0	71.0	72.0					19																	38103256		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1075G>C	19.37:g.38103256G>C	ENSP00000466274:p.Glu359Gln		A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E359Q	ENST00000592533.1	37	c.1075	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608969	0.46527	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.39229	1.09	2.39	2.39	0.29439	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32823	0.0842	L	0.33710	1.025	0.09310	N	1	B;B	0.26120	0.117;0.142	B;B	0.27170	0.046;0.077	T	0.23226	-1.0194	9	0.36615	T	0.2	.	11.8424	0.52361	0.0:0.0:1.0:0.0	.	327;359	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	Q	359;327	ENSP00000324598:E359Q	ENSP00000324598:E359Q	E	+	1	0	ZNF540	42795096	0.001000	0.12720	0.927000	0.36925	0.814000	0.46013	1.072000	0.30678	1.313000	0.45069	0.305000	0.20034	GAA	ZNF540	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171817		0.388	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	46	0.00	0	G	NM_152606		38103256	38103256	+1	no_errors	ENST00000316433	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.110	C
ZNF611	81856	genome.wustl.edu	37	19	53208833	53208833	+	Missense_Mutation	SNP	C	C	A			TCGA-A2-A3XT-01A-11D-A22X-09	TCGA-A2-A3XT-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	f5afb86a-e57a-422a-abdb-6bab20273cc0	47db5812-3372-46bd-a59f-5fac0d3d1a97	g.chr19:53208833C>A	ENST00000319783.1	-	7	1791	c.1475G>T	c.(1474-1476)gGt>gTt	p.G492V	ZNF611_ENST00000543227.1_Missense_Mutation_p.G492V|ZNF611_ENST00000602162.1_Missense_Mutation_p.G423V|ZNF611_ENST00000595798.1_Missense_Mutation_p.G423V|ZNF611_ENST00000453741.2_Missense_Mutation_p.G423V|ZNF611_ENST00000540744.1_Missense_Mutation_p.G492V|ZNF611_ENST00000602046.1_5'Flank	NM_030972.3	NP_112234.3	Q8N823	ZN611_HUMAN	zinc finger protein 611	492					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)		TGAATTTTGACCAAAGGTCTT	0.368																																						dbGAP											0													91.0	93.0	93.0					19																	53208833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091389	CCDS12855.1, CCDS54312.1	19q13.42	2013-01-08			ENSG00000213020	ENSG00000213020		"""Zinc fingers, C2H2-type"", ""-"""	28766	protein-coding gene	gene with protein product						12477932	Standard	NM_030972		Approved	MGC5384	uc010ydq.2	Q8N823	OTTHUMG00000154908	ENST00000319783.1:c.1475G>T	19.37:g.53208833C>A	ENSP00000322427:p.Gly492Val		B3KRD5|Q69YG9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G492V	ENST00000319783.1	37	c.1475	CCDS12855.1	19	.	.	.	.	.	.	.	.	.	.	.	6.762	0.509515	0.12883	.	.	ENSG00000213020	ENST00000543227;ENST00000540744;ENST00000453741;ENST00000319783	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	1.51	0.166	0.14999	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20292	0.0488	N	0.04880	-0.145	0.09310	N	1	B	0.23990	0.095	B	0.33121	0.158	T	0.35201	-0.9798	9	0.56958	D	0.05	.	7.9952	0.30265	0.0:0.7424:0.2576:0.0	.	492	Q8N823	ZN611_HUMAN	V	492;492;423;492	ENSP00000437616:G492V;ENSP00000439211:G492V;ENSP00000443505:G423V;ENSP00000322427:G492V	ENSP00000322427:G492V	G	-	2	0	ZNF611	57900645	0.000000	0.05858	0.001000	0.08648	0.080000	0.17528	-7.695000	0.00031	-0.099000	0.12263	0.205000	0.17691	GGT	ZNF611	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213020		0.368	ZNF611-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF611	HGNC	protein_coding	OTTHUMT00000337612.1	39	0.00	0	C	NM_030972		53208833	53208833	-1	no_errors	ENST00000319783	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.007	A
