#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM19	8728	genome.wustl.edu	37	5	156907975	156907975	+	IGR	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr5:156907975C>T	ENST00000517905.1	-	0	3312				ADAM19_ENST00000430702.2_Intron|ADAM19_ENST00000394020.1_Missense_Mutation_p.M915I|ADAM19_ENST00000257527.4_Missense_Mutation_p.M913I			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19						heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCGAGCTAATCATCCCTCCAG	0.512																																						dbGAP											0													122.0	110.0	114.0					5																	156907975		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242		5.37:g.156907975C>T			Q9BZL5|Q9UHP2	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.M915I	ENST00000517905.1	37	c.2745		5	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.462530	0.01062	.	.	ENSG00000135074	ENST00000257527;ENST00000394020	T;T	0.01335	5.0;5.03	5.34	1.49	0.22878	.	0.771339	0.12289	N	0.482184	T	0.00875	0.0029	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.48514	-0.9029	9	.	.	.	.	6.8219	0.23862	0.0:0.6149:0.0:0.3851	.	913	Q9H013-2	.	I	913;915	ENSP00000257527:M913I;ENSP00000377588:M915I	.	M	-	3	0	ADAM19	156840553	0.019000	0.18553	0.043000	0.18650	0.016000	0.09150	0.508000	0.22692	0.621000	0.30232	-0.346000	0.07831	ATG	ADAM19	-	NULL	ENSG00000135074		0.512	ADAM19-003	PUTATIVE	basic	protein_coding	ADAM19	HGNC	protein_coding	OTTHUMT00000373918.1	55	0.00	0	C	NM_033274		156907975	156907975	-1	no_errors	ENST00000394020	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	0.010	T
ADAM19	8728	genome.wustl.edu	37	5	156907975	156907975	+	IGR	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr5:156907975C>T	ENST00000517905.1	-	0	3312				ADAM19_ENST00000430702.2_Intron|ADAM19_ENST00000394020.1_Missense_Mutation_p.M915I|ADAM19_ENST00000257527.4_Missense_Mutation_p.M913I			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19						heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCGAGCTAATCATCCCTCCAG	0.512																																						dbGAP											0													122.0	110.0	114.0					5																	156907975		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242		5.37:g.156907975C>T			Q9BZL5|Q9UHP2	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.M915I	ENST00000517905.1	37	c.2745		5	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.462530	0.01062	.	.	ENSG00000135074	ENST00000257527;ENST00000394020	T;T	0.01335	5.0;5.03	5.34	1.49	0.22878	.	0.771339	0.12289	N	0.482184	T	0.00875	0.0029	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.48514	-0.9029	9	.	.	.	.	6.8219	0.23862	0.0:0.6149:0.0:0.3851	.	913	Q9H013-2	.	I	913;915	ENSP00000257527:M913I;ENSP00000377588:M915I	.	M	-	3	0	ADAM19	156840553	0.019000	0.18553	0.043000	0.18650	0.016000	0.09150	0.508000	0.22692	0.621000	0.30232	-0.346000	0.07831	ATG	ADAM19	-	NULL	ENSG00000135074		0.512	ADAM19-003	PUTATIVE	basic	protein_coding	ADAM19	HGNC	protein_coding	OTTHUMT00000373918.1	45	0.00	0	C	NM_033274		156907975	156907975	-1	no_errors	ENST00000394020	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	0.010	T
ADORA3	140	genome.wustl.edu	37	1	112042833	112042833	+	Silent	SNP	C	C	T	rs545833813		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr1:112042833C>T	ENST00000241356.4	-	2	1101	c.696G>A	c.(694-696)ttG>ttA	p.L232L	ADORA3_ENST00000369716.4_Intron|ADORA3_ENST00000369717.4_Intron|ADORA3_ENST00000486342.1_5'Flank	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	232					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	GAACCAGAAACAAGGACTTAG	0.413																																						dbGAP											0													139.0	136.0	137.0					1																	112042833		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.696G>A	1.37:g.112042833C>T			A2A3P4|Q6UWU0|Q9BYZ1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adeno_A3_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.L232	ENST00000241356.4	37	c.696	CCDS839.1	1																																																																																			ADORA3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Adenosn_rcpt	ENSG00000121933		0.413	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA3	HGNC	protein_coding	OTTHUMT00000033065.1	17	0.00	0	C	NM_000677, NM_020683		112042833	112042833	-1	no_errors	ENST00000241356	ensembl	human	known	69_37n	silent	24	20.00	6	SNP	1.000	T
ADORA3	140	genome.wustl.edu	37	1	112042833	112042833	+	Silent	SNP	C	C	T	rs545833813		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:112042833C>T	ENST00000241356.4	-	2	1101	c.696G>A	c.(694-696)ttG>ttA	p.L232L	ADORA3_ENST00000369716.4_Intron|ADORA3_ENST00000369717.4_Intron|ADORA3_ENST00000486342.1_5'Flank	NM_000677.3	NP_000668.1	P33765	AA3R_HUMAN	adenosine A3 receptor	232					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	GAACCAGAAACAAGGACTTAG	0.413																																						dbGAP											0													139.0	136.0	137.0					1																	112042833		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000241356.4:c.696G>A	1.37:g.112042833C>T			A2A3P4|Q6UWU0|Q9BYZ1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adeno_A3_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.L232	ENST00000241356.4	37	c.696	CCDS839.1	1																																																																																			ADORA3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Adenosn_rcpt	ENSG00000121933		0.413	ADORA3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA3	HGNC	protein_coding	OTTHUMT00000033065.1	41	0.00	0	C	NM_000677, NM_020683		112042833	112042833	-1	no_errors	ENST00000241356	ensembl	human	known	69_37n	silent	24	20.00	6	SNP	1.000	T
AGBL1	123624	genome.wustl.edu	37	15	86807904	86807904	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr15:86807904C>G	ENST00000441037.2	+	10	1459	c.1364C>G	c.(1363-1365)aCa>aGa	p.T455R	AGBL1_ENST00000389298.3_Missense_Mutation_p.T186R|AGBL1_ENST00000421325.2_Missense_Mutation_p.T455R	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	455					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CTTCTGCAGACACATCTGAAG	0.448																																						dbGAP											0													137.0	135.0	136.0					15																	86807904		1894	4118	6012	-	-	-	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1364C>G	15.37:g.86807904C>G	ENSP00000413001:p.Thr455Arg		A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.T455R	ENST00000441037.2	37	c.1364	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	C	10.32	1.317620	0.23994	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.09445	2.99;2.98	5.51	-0.671	0.11381	Armadillo-type fold (1);	1.315750	0.04639	N	0.404960	T	0.08714	0.0216	L	0.59436	1.845	0.09310	N	1	B;P;B	0.34977	0.418;0.478;0.003	B;B;B	0.26693	0.053;0.072;0.002	T	0.33343	-0.9872	10	0.21540	T	0.41	2.6734	1.3542	0.02179	0.2581:0.2854:0.2959:0.1606	.	154;186;455	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	R	484;455;186	ENSP00000397173:T455R;ENSP00000373949:T186R	ENSP00000373949:T186R	T	+	2	0	AGBL1	84608908	0.000000	0.05858	0.000000	0.03702	0.237000	0.25408	-0.476000	0.06591	0.074000	0.16767	0.650000	0.86243	ACA	AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.448	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	41	0.00	0	C	NM_152336		86807904	86807904	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	missense	54	25.33	19	SNP	0.000	G
AGBL1	123624	genome.wustl.edu	37	15	86807904	86807904	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr15:86807904C>G	ENST00000441037.2	+	10	1459	c.1364C>G	c.(1363-1365)aCa>aGa	p.T455R	AGBL1_ENST00000389298.3_Missense_Mutation_p.T186R|AGBL1_ENST00000421325.2_Missense_Mutation_p.T455R	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	455					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CTTCTGCAGACACATCTGAAG	0.448																																						dbGAP											0													137.0	135.0	136.0					15																	86807904		1894	4118	6012	-	-	-	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1364C>G	15.37:g.86807904C>G	ENSP00000413001:p.Thr455Arg		A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.T455R	ENST00000441037.2	37	c.1364	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	C	10.32	1.317620	0.23994	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.09445	2.99;2.98	5.51	-0.671	0.11381	Armadillo-type fold (1);	1.315750	0.04639	N	0.404960	T	0.08714	0.0216	L	0.59436	1.845	0.09310	N	1	B;P;B	0.34977	0.418;0.478;0.003	B;B;B	0.26693	0.053;0.072;0.002	T	0.33343	-0.9872	10	0.21540	T	0.41	2.6734	1.3542	0.02179	0.2581:0.2854:0.2959:0.1606	.	154;186;455	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	R	484;455;186	ENSP00000397173:T455R;ENSP00000373949:T186R	ENSP00000373949:T186R	T	+	2	0	AGBL1	84608908	0.000000	0.05858	0.000000	0.03702	0.237000	0.25408	-0.476000	0.06591	0.074000	0.16767	0.650000	0.86243	ACA	AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.448	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	59	0.00	0	C	NM_152336		86807904	86807904	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	missense	54	25.33	19	SNP	0.000	G
ATP2B2	491	genome.wustl.edu	37	3	10491115	10491115	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr3:10491115C>T	ENST00000352432.4	-	1	182	c.113G>A	c.(112-114)cGg>cAg	p.R38Q	ATP2B2_ENST00000383800.4_Missense_Mutation_p.R38Q|ATP2B2_ENST00000360273.2_Missense_Mutation_p.R38Q|ATP2B2_ENST00000343816.4_Missense_Mutation_p.R38Q|ATP2B2_ENST00000397077.1_Missense_Mutation_p.R38Q			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	38					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CTCAGTGCCCCGCAGCTCCAT	0.547																																					Ovarian(125;1619 1709 15675 19819 38835)	dbGAP											0													100.0	92.0	95.0					3																	10491115		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.113G>A	3.37:g.10491115C>T	ENSP00000324172:p.Arg38Gln		O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.R38Q	ENST00000352432.4	37	c.113	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.261115	0.95368	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000342354	D;D;D;D;D	0.93076	-3.15;-3.16;-3.16;-3.15;-3.15	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000001	D	0.96577	0.8883	M	0.82630	2.6	0.80722	D	1	D;P;P	0.76494	0.999;0.796;0.944	D;B;B	0.74023	0.982;0.245;0.433	D	0.97099	0.9796	10	0.66056	D	0.02	-25.5086	15.2863	0.73831	0.0:1.0:0.0:0.0	.	38;50;38	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	Q	38;38;38;38;38;4;38	ENSP00000324172:R38Q;ENSP00000373311:R38Q;ENSP00000380267:R38Q;ENSP00000353414:R38Q;ENSP00000344677:R38Q	ENSP00000342954:R38Q	R	-	2	0	ATP2B2	10466115	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.711000	0.84669	2.192000	0.70111	0.462000	0.41574	CGG	ATP2B2	-	NULL	ENSG00000157087		0.547	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	54	0.00	0	C	NM_001683		10491115	10491115	-1	no_errors	ENST00000352432	ensembl	human	known	69_37n	missense	120	18.37	27	SNP	1.000	T
ATP2B2	491	genome.wustl.edu	37	3	10491115	10491115	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr3:10491115C>T	ENST00000352432.4	-	1	182	c.113G>A	c.(112-114)cGg>cAg	p.R38Q	ATP2B2_ENST00000383800.4_Missense_Mutation_p.R38Q|ATP2B2_ENST00000360273.2_Missense_Mutation_p.R38Q|ATP2B2_ENST00000343816.4_Missense_Mutation_p.R38Q|ATP2B2_ENST00000397077.1_Missense_Mutation_p.R38Q			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	38					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CTCAGTGCCCCGCAGCTCCAT	0.547																																					Ovarian(125;1619 1709 15675 19819 38835)	dbGAP											0													100.0	92.0	95.0					3																	10491115		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.113G>A	3.37:g.10491115C>T	ENSP00000324172:p.Arg38Gln		O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.R38Q	ENST00000352432.4	37	c.113	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.261115	0.95368	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000342354	D;D;D;D;D	0.93076	-3.15;-3.16;-3.16;-3.15;-3.15	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000001	D	0.96577	0.8883	M	0.82630	2.6	0.80722	D	1	D;P;P	0.76494	0.999;0.796;0.944	D;B;B	0.74023	0.982;0.245;0.433	D	0.97099	0.9796	10	0.66056	D	0.02	-25.5086	15.2863	0.73831	0.0:1.0:0.0:0.0	.	38;50;38	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	Q	38;38;38;38;38;4;38	ENSP00000324172:R38Q;ENSP00000373311:R38Q;ENSP00000380267:R38Q;ENSP00000353414:R38Q;ENSP00000344677:R38Q	ENSP00000342954:R38Q	R	-	2	0	ATP2B2	10466115	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.711000	0.84669	2.192000	0.70111	0.462000	0.41574	CGG	ATP2B2	-	NULL	ENSG00000157087		0.547	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	98	0.00	0	C	NM_001683		10491115	10491115	-1	no_errors	ENST00000352432	ensembl	human	known	69_37n	missense	120	18.37	27	SNP	1.000	T
BCL6B	255877	genome.wustl.edu	37	17	6927077	6927077	+	Silent	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr17:6927077C>T	ENST00000293805.5	+	2	179	c.87C>T	c.(85-87)aaC>aaT	p.N29N	BCL6B_ENST00000572216.1_3'UTR	NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	29					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						GCAACCTCAACGAGCTGCGCC	0.672																																						dbGAP											0													28.0	32.0	30.0					17																	6927077		2140	4245	6385	-	-	-	SO:0001819	synonymous_variant	0			AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.87C>T	17.37:g.6927077C>T			Q6PCB4	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.N29	ENST00000293805.5	37	c.87	CCDS42248.1	17																																																																																			BCL6B	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold	ENSG00000161940		0.672	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6B	HGNC	protein_coding	OTTHUMT00000439455.2	56	0.00	0	C	NM_181844		6927077	6927077	+1	no_errors	ENST00000293805	ensembl	human	known	69_37n	silent	87	20.18	22	SNP	0.634	T
BCL6B	255877	genome.wustl.edu	37	17	6927077	6927077	+	Silent	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr17:6927077C>T	ENST00000293805.5	+	2	179	c.87C>T	c.(85-87)aaC>aaT	p.N29N	BCL6B_ENST00000572216.1_3'UTR	NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	29					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						GCAACCTCAACGAGCTGCGCC	0.672																																						dbGAP											0													28.0	32.0	30.0					17																	6927077		2140	4245	6385	-	-	-	SO:0001819	synonymous_variant	0			AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.87C>T	17.37:g.6927077C>T			Q6PCB4	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.N29	ENST00000293805.5	37	c.87	CCDS42248.1	17																																																																																			BCL6B	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold	ENSG00000161940		0.672	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6B	HGNC	protein_coding	OTTHUMT00000439455.2	75	0.00	0	C	NM_181844		6927077	6927077	+1	no_errors	ENST00000293805	ensembl	human	known	69_37n	silent	87	20.18	22	SNP	0.634	T
BLVRA	644	genome.wustl.edu	37	7	43846680	43846680	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr7:43846680T>C	ENST00000402924.1	+	9	900	c.737T>C	c.(736-738)gTg>gCg	p.V246A	BLVRA_ENST00000265523.4_Missense_Mutation_p.V246A	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	246					heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						AATGTAGGAGTGAATAAGAAC	0.398																																						dbGAP											0													59.0	59.0	59.0					7																	43846680		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.737T>C	7.37:g.43846680T>C	ENSP00000385757:p.Val246Ala		A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Missense_Mutation	SNP	pfam_Biliverdin_Rdtase_cat,pfam_Oxidoreductase_N,pirsf_Biliverdin_Rdtase_A	p.V246A	ENST00000402924.1	37	c.737	CCDS5472.1	7	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.133958	0.00338	.	.	ENSG00000106605	ENST00000265523;ENST00000402924	T;T	0.20738	2.05;2.05	4.38	-0.288	0.12855	Biliverdin reductase, catalytic (1);	0.503936	0.21432	N	0.074633	T	0.07369	0.0186	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.39396	-0.9616	10	0.08837	T	0.75	.	6.5031	0.22180	0.0:0.1047:0.5065:0.3888	.	246	P53004	BIEA_HUMAN	A	246	ENSP00000265523:V246A;ENSP00000385757:V246A	ENSP00000265523:V246A	V	+	2	0	BLVRA	43813205	0.002000	0.14202	0.053000	0.19242	0.001000	0.01503	0.645000	0.24782	0.143000	0.18926	-0.466000	0.05196	GTG	BLVRA	-	pirsf_Biliverdin_Rdtase_A	ENSG00000106605		0.398	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BLVRA	HGNC	protein_coding	OTTHUMT00000339006.1	28	0.00	0	T	NM_000712		43846680	43846680	+1	no_errors	ENST00000265523	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.009	C
BLVRA	644	genome.wustl.edu	37	7	43846680	43846680	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr7:43846680T>C	ENST00000402924.1	+	9	900	c.737T>C	c.(736-738)gTg>gCg	p.V246A	BLVRA_ENST00000265523.4_Missense_Mutation_p.V246A	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	246					heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						AATGTAGGAGTGAATAAGAAC	0.398																																						dbGAP											0													59.0	59.0	59.0					7																	43846680		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.737T>C	7.37:g.43846680T>C	ENSP00000385757:p.Val246Ala		A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Missense_Mutation	SNP	pfam_Biliverdin_Rdtase_cat,pfam_Oxidoreductase_N,pirsf_Biliverdin_Rdtase_A	p.V246A	ENST00000402924.1	37	c.737	CCDS5472.1	7	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.133958	0.00338	.	.	ENSG00000106605	ENST00000265523;ENST00000402924	T;T	0.20738	2.05;2.05	4.38	-0.288	0.12855	Biliverdin reductase, catalytic (1);	0.503936	0.21432	N	0.074633	T	0.07369	0.0186	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.39396	-0.9616	10	0.08837	T	0.75	.	6.5031	0.22180	0.0:0.1047:0.5065:0.3888	.	246	P53004	BIEA_HUMAN	A	246	ENSP00000265523:V246A;ENSP00000385757:V246A	ENSP00000265523:V246A	V	+	2	0	BLVRA	43813205	0.002000	0.14202	0.053000	0.19242	0.001000	0.01503	0.645000	0.24782	0.143000	0.18926	-0.466000	0.05196	GTG	BLVRA	-	pirsf_Biliverdin_Rdtase_A	ENSG00000106605		0.398	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BLVRA	HGNC	protein_coding	OTTHUMT00000339006.1	42	0.00	0	T	NM_000712		43846680	43846680	+1	no_errors	ENST00000265523	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.009	C
CASKIN2	57513	genome.wustl.edu	37	17	73497206	73497206	+	Silent	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr17:73497206G>A	ENST00000321617.3	-	20	4150	c.3564C>T	c.(3562-3564)acC>acT	p.T1188T	CASKIN2_ENST00000433559.2_Silent_p.T1106T	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	1188						cytoplasm (GO:0005737)				endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGTCGAACATGGTGCTGATGT	0.637																																						dbGAP											0													105.0	71.0	82.0					17																	73497206		2191	4296	6487	-	-	-	SO:0001819	synonymous_variant	0			AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.3564C>T	17.37:g.73497206G>A			B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_SAM,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_SH3_domain	p.T1188	ENST00000321617.3	37	c.3564	CCDS11723.1	17																																																																																			CASKIN2	-	NULL	ENSG00000177303		0.637	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASKIN2	HGNC	protein_coding	OTTHUMT00000447609.1	45	0.00	0	G	NM_020753		73497206	73497206	-1	no_errors	ENST00000321617	ensembl	human	known	69_37n	silent	37	44.78	30	SNP	1.000	A
CASKIN2	57513	genome.wustl.edu	37	17	73497206	73497206	+	Silent	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr17:73497206G>A	ENST00000321617.3	-	20	4150	c.3564C>T	c.(3562-3564)acC>acT	p.T1188T	CASKIN2_ENST00000433559.2_Silent_p.T1106T	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	1188						cytoplasm (GO:0005737)				endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGTCGAACATGGTGCTGATGT	0.637																																						dbGAP											0													105.0	71.0	82.0					17																	73497206		2191	4296	6487	-	-	-	SO:0001819	synonymous_variant	0			AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.3564C>T	17.37:g.73497206G>A			B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_SAM,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_SH3_domain	p.T1188	ENST00000321617.3	37	c.3564	CCDS11723.1	17																																																																																			CASKIN2	-	NULL	ENSG00000177303		0.637	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASKIN2	HGNC	protein_coding	OTTHUMT00000447609.1	65	0.00	0	G	NM_020753		73497206	73497206	-1	no_errors	ENST00000321617	ensembl	human	known	69_37n	silent	37	44.78	30	SNP	1.000	A
CENPF	1063	genome.wustl.edu	37	1	214795494	214795494	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr1:214795494A>G	ENST00000366955.3	+	7	1106	c.938A>G	c.(937-939)aAt>aGt	p.N313S		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGCCAAGTGAATAAGTTTCAA	0.363																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													106.0	108.0	107.0					1																	214795494		2203	4300	6503	-	-	-	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.938A>G	1.37:g.214795494A>G	ENSP00000355922:p.Asn313Ser		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.N313S	ENST00000366955.3	37	c.938	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	A	15.15	2.747767	0.49257	.	.	ENSG00000117724	ENST00000366955	T	0.78246	-1.16	4.93	2.62	0.31277	.	.	.	.	.	T	0.70710	0.3255	.	.	.	0.28317	N	0.922402	P	0.48764	0.915	P	0.45506	0.483	T	0.62609	-0.6818	8	0.48119	T	0.1	.	4.9183	0.13856	0.6787:0.1565:0.1648:0.0	.	313	P49454	CENPF_HUMAN	S	313	ENSP00000355922:N313S	ENSP00000355922:N313S	N	+	2	0	CENPF	212862117	1.000000	0.71417	0.757000	0.31301	0.700000	0.40528	1.804000	0.38873	0.329000	0.23460	0.358000	0.22013	AAT	CENPF	-	NULL	ENSG00000117724		0.363	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	34	0.00	0	A	NM_016343		214795494	214795494	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	0.970	G
CENPF	1063	genome.wustl.edu	37	1	214795494	214795494	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:214795494A>G	ENST00000366955.3	+	7	1106	c.938A>G	c.(937-939)aAt>aGt	p.N313S		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GGCCAAGTGAATAAGTTTCAA	0.363																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													106.0	108.0	107.0					1																	214795494		2203	4300	6503	-	-	-	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.938A>G	1.37:g.214795494A>G	ENSP00000355922:p.Asn313Ser		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.N313S	ENST00000366955.3	37	c.938	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	A	15.15	2.747767	0.49257	.	.	ENSG00000117724	ENST00000366955	T	0.78246	-1.16	4.93	2.62	0.31277	.	.	.	.	.	T	0.70710	0.3255	.	.	.	0.28317	N	0.922402	P	0.48764	0.915	P	0.45506	0.483	T	0.62609	-0.6818	8	0.48119	T	0.1	.	4.9183	0.13856	0.6787:0.1565:0.1648:0.0	.	313	P49454	CENPF_HUMAN	S	313	ENSP00000355922:N313S	ENSP00000355922:N313S	N	+	2	0	CENPF	212862117	1.000000	0.71417	0.757000	0.31301	0.700000	0.40528	1.804000	0.38873	0.329000	0.23460	0.358000	0.22013	AAT	CENPF	-	NULL	ENSG00000117724		0.363	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	50	0.00	0	A	NM_016343		214795494	214795494	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	0.970	G
CEP112	201134	genome.wustl.edu	37	17	63685174	63685174	+	Intron	SNP	C	C	T	rs11079582	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr17:63685174C>T	ENST00000392769.2	-	24	2916				CEP112_ENST00000535342.2_Intron|CEP112_ENST00000537949.1_Intron|CEP112_ENST00000317442.8_Intron|CEP112_ENST00000541355.1_Intron|CEP112_ENST00000580482.1_5'UTR	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa						receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						gtgtgagccactgcacctggc	0.498													C|||	1631	0.325679	0.2776	0.3501	5008	,	,		17339	0.2946		0.3539	False		,,,				2504	0.3763					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.2697+72G>A	17.37:g.63685174C>T			Q6PIB5|Q8NCR4|Q8NFR4	RNA	SNP	-	NULL	ENST00000392769.2	37	NULL	CCDS32710.1	17																																																																																			CEP112	-	-	ENSG00000154240		0.498	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP112	HGNC	protein_coding	OTTHUMT00000446582.1	34	0.00	0	C	NM_145036		63685174	63685174	-1	no_errors	ENST00000580482	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	0.001	T
CEP112	201134	genome.wustl.edu	37	17	63685174	63685174	+	Intron	SNP	C	C	T	rs11079582	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr17:63685174C>T	ENST00000392769.2	-	24	2916				CEP112_ENST00000535342.2_Intron|CEP112_ENST00000537949.1_Intron|CEP112_ENST00000317442.8_Intron|CEP112_ENST00000541355.1_Intron|CEP112_ENST00000580482.1_5'UTR	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa						receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						gtgtgagccactgcacctggc	0.498													C|||	1631	0.325679	0.2776	0.3501	5008	,	,		17339	0.2946		0.3539	False		,,,				2504	0.3763					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.2697+72G>A	17.37:g.63685174C>T			Q6PIB5|Q8NCR4|Q8NFR4	RNA	SNP	-	NULL	ENST00000392769.2	37	NULL	CCDS32710.1	17																																																																																			CEP112	-	-	ENSG00000154240		0.498	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP112	HGNC	protein_coding	OTTHUMT00000446582.1	37	0.00	0	C	NM_145036		63685174	63685174	-1	no_errors	ENST00000580482	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	0.001	T
COL6A4P1	344875	genome.wustl.edu	37	3	15216727	15216727	+	RNA	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr3:15216727G>A	ENST00000446690.2	-	0	983					NR_027927.1				collagen, type VI, alpha 4 pseudogene 1																		ACTCGGACACGGTCACTGCTG	0.493																																						dbGAP											0																																										-	-	-			0			AB299979		3p25.1	2013-01-16	2010-05-24	2010-05-24	ENSG00000230524	ENSG00000230524		"""Collagens"""	33484	pseudogene	pseudogene	"""von Willebrand factor A domain containing 6"", ""collagen, type VI, alpha 4"", ""collagen, type VI, alpha 4, pseudogene"""	612397	"""dual von Willebrand factor A domains"""	DVWA		19507504, 19486942	Standard	NR_027927		Approved	VWA6, DIVA, COL6A4, COL6A4P	uc011avo.1		OTTHUMG00000154983		3.37:g.15216727G>A				RNA	SNP	-	NULL	ENST00000446690.2	37	NULL		3																																																																																			COL6A4P1	-	-	ENSG00000230524		0.493	COL6A4P1-002	KNOWN	basic	processed_transcript	COL6A4P1	HGNC	pseudogene	OTTHUMT00000337912.1	61	0.00	0	G	NR_027927		15216727	15216727	-1	no_errors	ENST00000446690	ensembl	human	known	69_37n	rna	70	38.05	43	SNP	0.999	A
COL6A4P1	344875	genome.wustl.edu	37	3	15216727	15216727	+	RNA	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr3:15216727G>A	ENST00000446690.2	-	0	983					NR_027927.1				collagen, type VI, alpha 4 pseudogene 1																		ACTCGGACACGGTCACTGCTG	0.493																																						dbGAP											0																																										-	-	-			0			AB299979		3p25.1	2013-01-16	2010-05-24	2010-05-24	ENSG00000230524	ENSG00000230524		"""Collagens"""	33484	pseudogene	pseudogene	"""von Willebrand factor A domain containing 6"", ""collagen, type VI, alpha 4"", ""collagen, type VI, alpha 4, pseudogene"""	612397	"""dual von Willebrand factor A domains"""	DVWA		19507504, 19486942	Standard	NR_027927		Approved	VWA6, DIVA, COL6A4, COL6A4P	uc011avo.1		OTTHUMG00000154983		3.37:g.15216727G>A				RNA	SNP	-	NULL	ENST00000446690.2	37	NULL		3																																																																																			COL6A4P1	-	-	ENSG00000230524		0.493	COL6A4P1-002	KNOWN	basic	processed_transcript	COL6A4P1	HGNC	pseudogene	OTTHUMT00000337912.1	59	0.00	0	G	NR_027927		15216727	15216727	-1	no_errors	ENST00000446690	ensembl	human	known	69_37n	rna	70	38.05	43	SNP	0.999	A
CPNE8	144402	genome.wustl.edu	37	12	39047620	39047620	+	3'UTR	SNP	C	C	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr12:39047620C>A	ENST00000331366.5	-	0	1855				CPNE8_ENST00000546603.1_5'UTR|CPNE8_ENST00000538596.2_3'UTR	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII							extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				TTACAGAGCACCAGGCACAAA	0.383																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.*64G>T	12.37:g.39047620C>A			Q2TB41|Q86VY2	RNA	SNP	-	NULL	ENST00000331366.5	37	NULL	CCDS8733.1	12																																																																																			CPNE8	-	-	ENSG00000139117		0.383	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	61	0.00	0	C	NM_153634		39047620	39047620	-1	no_errors	ENST00000546603	ensembl	human	known	69_37n	rna	135	15.09	24	SNP	1.000	A
CPNE8	144402	genome.wustl.edu	37	12	39047620	39047620	+	3'UTR	SNP	C	C	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr12:39047620C>A	ENST00000331366.5	-	0	1855				CPNE8_ENST00000546603.1_5'UTR|CPNE8_ENST00000538596.2_3'UTR	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII							extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				TTACAGAGCACCAGGCACAAA	0.383																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.*64G>T	12.37:g.39047620C>A			Q2TB41|Q86VY2	RNA	SNP	-	NULL	ENST00000331366.5	37	NULL	CCDS8733.1	12																																																																																			CPNE8	-	-	ENSG00000139117		0.383	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	72	0.00	0	C	NM_153634		39047620	39047620	-1	no_errors	ENST00000546603	ensembl	human	known	69_37n	rna	135	15.09	24	SNP	1.000	A
BRINP1	1620	genome.wustl.edu	37	9	121929581	121929581	+	Silent	SNP	A	A	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr9:121929581A>C	ENST00000265922.3	-	8	2528	c.2067T>G	c.(2065-2067)tcT>tcG	p.S689S	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	689					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											TCACTGACGAAGAGGAATAGA	0.572																																						dbGAP											0													136.0	131.0	132.0					9																	121929581		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.2067T>G	9.37:g.121929581A>C			Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	pfam_MACPF,smart_MACPF	p.S689	ENST00000265922.3	37	c.2067	CCDS6822.1	9																																																																																			DBC1	-	NULL	ENSG00000078725		0.572	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBC1	HGNC	protein_coding	OTTHUMT00000055440.2	26	0.00	0	A	NM_014618		121929581	121929581	-1	no_errors	ENST00000265922	ensembl	human	known	69_37n	silent	27	25.00	9	SNP	0.058	C
BRINP1	1620	genome.wustl.edu	37	9	121929581	121929581	+	Silent	SNP	A	A	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr9:121929581A>C	ENST00000265922.3	-	8	2528	c.2067T>G	c.(2065-2067)tcT>tcG	p.S689S	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	689					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											TCACTGACGAAGAGGAATAGA	0.572																																						dbGAP											0													136.0	131.0	132.0					9																	121929581		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.2067T>G	9.37:g.121929581A>C			Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	pfam_MACPF,smart_MACPF	p.S689	ENST00000265922.3	37	c.2067	CCDS6822.1	9																																																																																			DBC1	-	NULL	ENSG00000078725		0.572	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBC1	HGNC	protein_coding	OTTHUMT00000055440.2	16	0.00	0	A	NM_014618		121929581	121929581	-1	no_errors	ENST00000265922	ensembl	human	known	69_37n	silent	27	25.00	9	SNP	0.058	C
DDO	8528	genome.wustl.edu	37	6	110729556	110729556	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr6:110729556C>T	ENST00000368924.3	-	3	361	c.346G>A	c.(346-348)Ggt>Agt	p.G116S	DDO_ENST00000368923.3_Missense_Mutation_p.G116S	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	88					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		AAATGAACACCAGCATCTCCA	0.378																																						dbGAP											0													121.0	117.0	118.0					6																	110729556		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.346G>A	6.37:g.110729556C>T	ENSP00000357920:p.Gly116Ser		A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase	p.G116S	ENST00000368924.3	37	c.346	CCDS5082.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.242025	0.95272	.	.	ENSG00000203797	ENST00000368924;ENST00000368923;ENST00000368925	T;D;T	0.95518	0.97;-3.73;0.97	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.98451	0.9484	H	0.97465	4.01	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71656	0.974;0.974	D	0.98574	1.0647	10	0.22109	T	0.4	-19.7131	19.4442	0.94840	0.0:1.0:0.0:0.0	.	116;116	Q99489-4;Q99489-3	.;.	S	116;116;88	ENSP00000357920:G116S;ENSP00000357919:G116S;ENSP00000357921:G88S	ENSP00000357919:G116S	G	-	1	0	DDO	110836249	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	7.019000	0.76412	2.692000	0.91855	0.591000	0.81541	GGT	DDO	-	pfam_FAD-dep_OxRdtase	ENSG00000203797		0.378	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDO	HGNC	protein_coding	OTTHUMT00000041796.1	61	0.00	0	C			110729556	110729556	-1	no_errors	ENST00000368924	ensembl	human	known	69_37n	missense	76	38.71	48	SNP	1.000	T
DDO	8528	genome.wustl.edu	37	6	110729556	110729556	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr6:110729556C>T	ENST00000368924.3	-	3	361	c.346G>A	c.(346-348)Ggt>Agt	p.G116S	DDO_ENST00000368923.3_Missense_Mutation_p.G116S	NM_003649.2	NP_003640.2	Q99489	OXDD_HUMAN	D-aspartate oxidase	88					aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|D-amino acid catabolic process (GO:0019478)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insemination (GO:0007320)|oxidation-reduction process (GO:0055114)	peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-aspartate oxidase activity (GO:0008445)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|pancreas(1)|skin(3)	24		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		AAATGAACACCAGCATCTCCA	0.378																																						dbGAP											0													121.0	117.0	118.0					6																	110729556		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89858	CCDS5082.1, CCDS5083.1	6q22.1	2008-02-05			ENSG00000203797	ENSG00000203797	1.4.3.1		2727	protein-coding gene	gene with protein product		124450				9163533	Standard	NM_003649		Approved		uc003puc.3	Q99489	OTTHUMG00000015360	ENST00000368924.3:c.346G>A	6.37:g.110729556C>T	ENSP00000357920:p.Gly116Ser		A8KAG4|Q5JXM4|Q5JXM5|Q5JXM6|Q8N552	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase	p.G116S	ENST00000368924.3	37	c.346	CCDS5082.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.242025	0.95272	.	.	ENSG00000203797	ENST00000368924;ENST00000368923;ENST00000368925	T;D;T	0.95518	0.97;-3.73;0.97	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.98451	0.9484	H	0.97465	4.01	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71656	0.974;0.974	D	0.98574	1.0647	10	0.22109	T	0.4	-19.7131	19.4442	0.94840	0.0:1.0:0.0:0.0	.	116;116	Q99489-4;Q99489-3	.;.	S	116;116;88	ENSP00000357920:G116S;ENSP00000357919:G116S;ENSP00000357921:G88S	ENSP00000357919:G116S	G	-	1	0	DDO	110836249	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	7.019000	0.76412	2.692000	0.91855	0.591000	0.81541	GGT	DDO	-	pfam_FAD-dep_OxRdtase	ENSG00000203797		0.378	DDO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDO	HGNC	protein_coding	OTTHUMT00000041796.1	63	0.00	0	C			110729556	110729556	-1	no_errors	ENST00000368924	ensembl	human	known	69_37n	missense	76	38.71	48	SNP	1.000	T
DOCK6	57572	genome.wustl.edu	37	19	11325067	11325067	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr19:11325067C>A	ENST00000294618.7	-	34	4233	c.4222G>T	c.(4222-4224)Gcc>Tcc	p.A1408S	DOCK6_ENST00000319867.7_Missense_Mutation_p.A747S|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1408					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CTCTCCCGGGCTTCTGAAAGC	0.587																																						dbGAP											0													66.0	68.0	68.0					19																	11325067		1967	4134	6101	-	-	-	SO:0001583	missense	0				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.4222G>T	19.37:g.11325067C>A	ENSP00000294618:p.Ala1408Ser		A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398	p.A1408S	ENST00000294618.7	37	c.4222	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	C	0.039	-1.294712	0.01375	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.54866	0.55;0.55	5.59	4.53	0.55603	.	0.262541	0.35235	N	0.003356	T	0.30135	0.0755	N	0.04746	-0.17	0.29843	N	0.829092	B;B	0.11235	0.0;0.004	B;B	0.06405	0.001;0.002	T	0.12400	-1.0549	10	0.15952	T	0.53	-16.1148	13.8155	0.63290	0.0:0.7073:0.2927:0.0	.	747;1408	C9IZV6;Q96HP0	.;DOCK6_HUMAN	S	1408;747	ENSP00000294618:A1408S;ENSP00000321556:A747S	ENSP00000294618:A1408S	A	-	1	0	DOCK6	11186067	0.704000	0.27836	0.994000	0.49952	0.148000	0.21650	0.675000	0.25232	1.311000	0.45024	0.655000	0.94253	GCC	DOCK6	-	NULL	ENSG00000130158		0.587	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	38	0.00	0	C	NM_020812		11325067	11325067	-1	no_errors	ENST00000294618	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	A
DOCK6	57572	genome.wustl.edu	37	19	11325067	11325067	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr19:11325067C>A	ENST00000294618.7	-	34	4233	c.4222G>T	c.(4222-4224)Gcc>Tcc	p.A1408S	DOCK6_ENST00000319867.7_Missense_Mutation_p.A747S|CTC-510F12.2_ENST00000588634.1_RNA	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	1408					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CTCTCCCGGGCTTCTGAAAGC	0.587																																						dbGAP											0													66.0	68.0	68.0					19																	11325067		1967	4134	6101	-	-	-	SO:0001583	missense	0				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.4222G>T	19.37:g.11325067C>A	ENSP00000294618:p.Ala1408Ser		A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398	p.A1408S	ENST00000294618.7	37	c.4222	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	C	0.039	-1.294712	0.01375	.	.	ENSG00000130158	ENST00000294618;ENST00000319867	T;T	0.54866	0.55;0.55	5.59	4.53	0.55603	.	0.262541	0.35235	N	0.003356	T	0.30135	0.0755	N	0.04746	-0.17	0.29843	N	0.829092	B;B	0.11235	0.0;0.004	B;B	0.06405	0.001;0.002	T	0.12400	-1.0549	10	0.15952	T	0.53	-16.1148	13.8155	0.63290	0.0:0.7073:0.2927:0.0	.	747;1408	C9IZV6;Q96HP0	.;DOCK6_HUMAN	S	1408;747	ENSP00000294618:A1408S;ENSP00000321556:A747S	ENSP00000294618:A1408S	A	-	1	0	DOCK6	11186067	0.704000	0.27836	0.994000	0.49952	0.148000	0.21650	0.675000	0.25232	1.311000	0.45024	0.655000	0.94253	GCC	DOCK6	-	NULL	ENSG00000130158		0.587	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	42	0.00	0	C	NM_020812		11325067	11325067	-1	no_errors	ENST00000294618	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	A
ENGASE	64772	genome.wustl.edu	37	17	77081765	77081765	+	Silent	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr17:77081765G>A	ENST00000579016.1	+	13	1764	c.1764G>A	c.(1762-1764)ccG>ccA	p.P588P		NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	588						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						TCTCACGGCCGCCGGGTAGTC	0.647																																						dbGAP											0													35.0	40.0	38.0					17																	77081765		2047	4203	6250	-	-	-	SO:0001819	synonymous_variant	0			AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.1764G>A	17.37:g.77081765G>A			Q659F0|Q8TB86|Q9H6U4	Silent	SNP	pfam_Glyco_hydro_85,pfscan_BRCT_dom	p.P588	ENST00000579016.1	37	c.1764	CCDS42394.1	17																																																																																			ENGASE	-	NULL	ENSG00000167280		0.647	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENGASE	HGNC	protein_coding	OTTHUMT00000395807.1	50	0.00	0	G	NM_022759		77081765	77081765	+1	no_errors	ENST00000579016	ensembl	human	known	69_37n	silent	75	17.58	16	SNP	0.002	A
ENGASE	64772	genome.wustl.edu	37	17	77081765	77081765	+	Silent	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr17:77081765G>A	ENST00000579016.1	+	13	1764	c.1764G>A	c.(1762-1764)ccG>ccA	p.P588P		NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	588						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						TCTCACGGCCGCCGGGTAGTC	0.647																																						dbGAP											0													35.0	40.0	38.0					17																	77081765		2047	4203	6250	-	-	-	SO:0001819	synonymous_variant	0			AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.1764G>A	17.37:g.77081765G>A			Q659F0|Q8TB86|Q9H6U4	Silent	SNP	pfam_Glyco_hydro_85,pfscan_BRCT_dom	p.P588	ENST00000579016.1	37	c.1764	CCDS42394.1	17																																																																																			ENGASE	-	NULL	ENSG00000167280		0.647	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENGASE	HGNC	protein_coding	OTTHUMT00000395807.1	79	0.00	0	G	NM_022759		77081765	77081765	+1	no_errors	ENST00000579016	ensembl	human	known	69_37n	silent	75	17.58	16	SNP	0.002	A
FLNA	2316	genome.wustl.edu	37	X	153594795	153594795	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chrX:153594795A>T	ENST00000369850.3	-	8	1345	c.1109T>A	c.(1108-1110)tTc>tAc	p.F370Y	FLNA_ENST00000344736.4_Missense_Mutation_p.F370Y|FLNA_ENST00000360319.4_Missense_Mutation_p.F370Y|FLNA_ENST00000422373.1_Missense_Mutation_p.F370Y	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	370			F -> L (in dbSNP:rs1064817).		actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTACACCTCGAAGGGGCTCTT	0.627																																						dbGAP											0													62.0	61.0	62.0					X																	153594795		2050	4185	6235	-	-	-	SO:0001583	missense	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1109T>A	X.37:g.153594795A>T	ENSP00000358866:p.Phe370Tyr		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.F370Y	ENST00000369850.3	37	c.1109	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	A	7.721	0.697282	0.15106	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	4.87	4.87	0.63330	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87317	0.6147	L	0.43554	1.36	0.80722	D	1	P;B	0.43607	0.812;0.092	P;B	0.50617	0.646;0.168	D	0.86768	0.1971	10	0.42905	T	0.14	.	13.6928	0.62556	1.0:0.0:0.0:0.0	.	370;370	P21333-2;P21333	.;FLNA_HUMAN	Y	370;343;370;370;370	ENSP00000353467:F370Y;ENSP00000416926:F370Y;ENSP00000358866:F370Y;ENSP00000358863:F370Y	ENSP00000358863:F370Y	F	-	2	0	FLNA	153247989	1.000000	0.71417	0.995000	0.50966	0.073000	0.16967	7.410000	0.80065	1.607000	0.50170	0.427000	0.28365	TTC	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.627	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	104	0.00	0	A			153594795	153594795	-1	no_errors	ENST00000369850	ensembl	human	known	69_37n	missense	160	27.27	60	SNP	1.000	T
FLNA	2316	genome.wustl.edu	37	X	153594795	153594795	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chrX:153594795A>T	ENST00000369850.3	-	8	1345	c.1109T>A	c.(1108-1110)tTc>tAc	p.F370Y	FLNA_ENST00000344736.4_Missense_Mutation_p.F370Y|FLNA_ENST00000360319.4_Missense_Mutation_p.F370Y|FLNA_ENST00000422373.1_Missense_Mutation_p.F370Y	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	370			F -> L (in dbSNP:rs1064817).		actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTACACCTCGAAGGGGCTCTT	0.627																																						dbGAP											0													62.0	61.0	62.0					X																	153594795		2050	4185	6235	-	-	-	SO:0001583	missense	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1109T>A	X.37:g.153594795A>T	ENSP00000358866:p.Phe370Tyr		E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.F370Y	ENST00000369850.3	37	c.1109	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	A	7.721	0.697282	0.15106	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.86432	-2.12;-2.12;-2.12;-2.12	4.87	4.87	0.63330	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87317	0.6147	L	0.43554	1.36	0.80722	D	1	P;B	0.43607	0.812;0.092	P;B	0.50617	0.646;0.168	D	0.86768	0.1971	10	0.42905	T	0.14	.	13.6928	0.62556	1.0:0.0:0.0:0.0	.	370;370	P21333-2;P21333	.;FLNA_HUMAN	Y	370;343;370;370;370	ENSP00000353467:F370Y;ENSP00000416926:F370Y;ENSP00000358866:F370Y;ENSP00000358863:F370Y	ENSP00000358863:F370Y	F	-	2	0	FLNA	153247989	1.000000	0.71417	0.995000	0.50966	0.073000	0.16967	7.410000	0.80065	1.607000	0.50170	0.427000	0.28365	TTC	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.627	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	112	0.00	0	A			153594795	153594795	-1	no_errors	ENST00000369850	ensembl	human	known	69_37n	missense	160	27.27	60	SNP	1.000	T
FSIP2	401024	genome.wustl.edu	37	2	186673617	186673617	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr2:186673617A>C	ENST00000424728.1	+	17	19584	c.19584A>C	c.(19582-19584)aaA>aaC	p.K6528N	FSIP2_ENST00000343098.5_Missense_Mutation_p.K6617N			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6528										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TTGGAAAAAAACCAGTCAAAA	0.299																																						dbGAP											0													44.0	43.0	43.0					2																	186673617		1789	4059	5848	-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.19584A>C	2.37:g.186673617A>C	ENSP00000401306:p.Lys6528Asn		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.K6617N	ENST00000424728.1	37	c.19851		2	.	.	.	.	.	.	.	.	.	.	A	13.31	2.198176	0.38806	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.56941	0.43;0.43	5.35	1.69	0.24217	.	0.206031	0.34156	N	0.004203	T	0.46112	0.1376	L	0.43923	1.385	0.21220	N	0.999759	.	.	.	.	.	.	T	0.40021	-0.9585	8	0.72032	D	0.01	.	6.1023	0.20053	0.6857:0.0:0.3143:0.0	.	.	.	.	N	6617;6528	ENSP00000344403:K6617N;ENSP00000401306:K6528N	ENSP00000344403:K6617N	K	+	3	2	FSIP2	186381862	0.035000	0.19736	0.093000	0.20910	0.302000	0.27658	0.104000	0.15313	0.482000	0.27582	0.482000	0.46254	AAA	FSIP2	-	NULL	ENSG00000188738		0.299	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	44	0.00	0	A	NM_173651		186673617	186673617	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	59	10.45	7	SNP	0.460	C
FSIP2	401024	genome.wustl.edu	37	2	186673617	186673617	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr2:186673617A>C	ENST00000424728.1	+	17	19584	c.19584A>C	c.(19582-19584)aaA>aaC	p.K6528N	FSIP2_ENST00000343098.5_Missense_Mutation_p.K6617N			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6528										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TTGGAAAAAAACCAGTCAAAA	0.299																																						dbGAP											0													44.0	43.0	43.0					2																	186673617		1789	4059	5848	-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.19584A>C	2.37:g.186673617A>C	ENSP00000401306:p.Lys6528Asn		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.K6617N	ENST00000424728.1	37	c.19851		2	.	.	.	.	.	.	.	.	.	.	A	13.31	2.198176	0.38806	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.56941	0.43;0.43	5.35	1.69	0.24217	.	0.206031	0.34156	N	0.004203	T	0.46112	0.1376	L	0.43923	1.385	0.21220	N	0.999759	.	.	.	.	.	.	T	0.40021	-0.9585	8	0.72032	D	0.01	.	6.1023	0.20053	0.6857:0.0:0.3143:0.0	.	.	.	.	N	6617;6528	ENSP00000344403:K6617N;ENSP00000401306:K6528N	ENSP00000344403:K6617N	K	+	3	2	FSIP2	186381862	0.035000	0.19736	0.093000	0.20910	0.302000	0.27658	0.104000	0.15313	0.482000	0.27582	0.482000	0.46254	AAA	FSIP2	-	NULL	ENSG00000188738		0.299	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	39	0.00	0	A	NM_173651		186673617	186673617	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	59	10.45	7	SNP	0.460	C
FTH1P3	2498	genome.wustl.edu	37	5	17354528	17354528	+	lincRNA	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr5:17354528G>A	ENST00000511821.1	+	0	387				FTH1P10_ENST00000401830.3_RNA																							GGACGCGGTCGTCATGGCGGC	0.677																																						dbGAP											0																																										-	-	-			0																															5.37:g.17354528G>A				RNA	SNP	-	NULL	ENST00000511821.1	37	NULL		5																																																																																			FTH1P10	-	-	ENSG00000223361		0.677	CTD-2139B15.2-001	KNOWN	basic	lincRNA	FTH1P10	HGNC	lincRNA	OTTHUMT00000366261.1	58	0.00	0	G			17354528	17354528	-1	no_errors	ENST00000401830	ensembl	human	known	69_37n	rna	69	39.47	45	SNP	0.003	A
FTH1P3	2498	genome.wustl.edu	37	5	17354528	17354528	+	lincRNA	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr5:17354528G>A	ENST00000511821.1	+	0	387				FTH1P10_ENST00000401830.3_RNA																							GGACGCGGTCGTCATGGCGGC	0.677																																						dbGAP											0																																										-	-	-			0																															5.37:g.17354528G>A				RNA	SNP	-	NULL	ENST00000511821.1	37	NULL		5																																																																																			FTH1P10	-	-	ENSG00000223361		0.677	CTD-2139B15.2-001	KNOWN	basic	lincRNA	FTH1P10	HGNC	lincRNA	OTTHUMT00000366261.1	65	0.00	0	G			17354528	17354528	-1	no_errors	ENST00000401830	ensembl	human	known	69_37n	rna	69	39.47	45	SNP	0.003	A
TTC41P	253724	genome.wustl.edu	37	12	104287077	104287077	+	IGR	SNP	G	G	A	rs10778301	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr12:104287077G>A								RP11-650K20.3 (48635 upstream) : RP11-642P15.1 (20727 downstream)																							ATCCGGGCGGGCACACAACGA	0.473													G|||	2250	0.449281	0.4017	0.3732	5008	,	,		19291	0.5327		0.4712	False		,,,				2504	0.4591					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.104287077G>A				RNA	SNP	-	NULL		37	NULL		12																																																																																			RP11-642P15.1	-	-	ENSG00000214198	0	0.473					GNN	Clone_based_vega_gene			39	0.00	0	G			104287077	104287077	-1	no_errors	ENST00000552065	ensembl	human	known	69_37n	rna	41	10.87	5	SNP	0.908	A
TTC41P	253724	genome.wustl.edu	37	12	104287077	104287077	+	IGR	SNP	G	G	A	rs10778301	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr12:104287077G>A								RP11-650K20.3 (48635 upstream) : RP11-642P15.1 (20727 downstream)																							ATCCGGGCGGGCACACAACGA	0.473													G|||	2250	0.449281	0.4017	0.3732	5008	,	,		19291	0.5327		0.4712	False		,,,				2504	0.4591					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.104287077G>A				RNA	SNP	-	NULL		37	NULL		12																																																																																			RP11-642P15.1	-	-	ENSG00000214198	0	0.473					GNN	Clone_based_vega_gene			49	0.00	0	G			104287077	104287077	-1	no_errors	ENST00000552065	ensembl	human	known	69_37n	rna	41	10.87	5	SNP	0.908	A
GPAT2	150763	genome.wustl.edu	37	2	96688929	96688929	+	Missense_Mutation	SNP	G	G	A	rs201647131	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr2:96688929G>A	ENST00000434632.1	-	20	2533	c.2074C>T	c.(2074-2076)Cgc>Tgc	p.R692C	FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000377137.3_Intron|GPAT2_ENST00000359548.4_Missense_Mutation_p.R692C|GPAT2_ENST00000453542.1_Missense_Mutation_p.R621C			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	692					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.R692C(3)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTGAGCAGGCGGCAGAGGAAA	0.652																																						dbGAP											3	Substitution - Missense(3)	large_intestine(1)|NS(1)|skin(1)											14.0	17.0	16.0					2																	96688929		1816	4045	5861	-	-	-	SO:0001583	missense	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2074C>T	2.37:g.96688929G>A	ENSP00000389395:p.Arg692Cys		Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	smart_Acyltransferase	p.R692C	ENST00000434632.1	37	c.2074	CCDS42714.1	2	152	0.0695970695970696	8	0.016260162601626018	16	0.04419889502762431	27	0.0472027972027972	101	0.13324538258575197	g	16.45	3.127649	0.56721	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.80480	-1.38;-1.38;-0.41	5.44	5.44	0.79542	.	0.381151	0.27411	N	0.019488	T	0.02727	0.0082	L	0.50333	1.59	0.80722	D	1	P;D;P;B	0.54207	0.584;0.965;0.953;0.354	B;B;B;B	0.42062	0.093;0.374;0.267;0.065	T	0.41840	-0.9486	10	0.66056	D	0.02	-11.9956	16.7485	0.85479	0.0:0.0:1.0:0.0	.	621;698;692;621	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	C	692;692;621	ENSP00000352547:R692C;ENSP00000389395:R692C;ENSP00000393770:R621C	ENSP00000352547:R692C	R	-	1	0	GPAT2	96052656	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.041000	0.49807	2.569000	0.86673	0.637000	0.83480	CGC	GPAT2	-	NULL	ENSG00000186281		0.652	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	31	0.00	0	G	NM_207328		96688929	96688929	-1	no_errors	ENST00000359548	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	1.000	A
GPBP1L1	60313	genome.wustl.edu	37	1	46121010	46121010	+	Intron	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr1:46121010G>A	ENST00000290795.3	-	4	1282				GPBP1L1_ENST00000355105.3_Intron			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1						positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					ATGAAGTATGGAGAGGCAAAT	0.408																																						dbGAP											0													123.0	118.0	120.0					1																	46121010		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.61-19C>T	1.37:g.46121010G>A			D3DQ10|Q9H751	RNA	SNP	-	NULL	ENST00000290795.3	37	NULL	CCDS528.1	1																																																																																			GPBP1L1	-	-	ENSG00000159592		0.408	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBP1L1	HGNC	protein_coding	OTTHUMT00000098375.1	69	0.00	0	G	NM_021639		46121010	46121010	-1	no_errors	ENST00000496278	ensembl	human	known	69_37n	rna	72	20.88	19	SNP	0.000	A
GPBP1L1	60313	genome.wustl.edu	37	1	46121010	46121010	+	Intron	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:46121010G>A	ENST00000290795.3	-	4	1282				GPBP1L1_ENST00000355105.3_Intron			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1						positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					ATGAAGTATGGAGAGGCAAAT	0.408																																						dbGAP											0													123.0	118.0	120.0					1																	46121010		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.61-19C>T	1.37:g.46121010G>A			D3DQ10|Q9H751	RNA	SNP	-	NULL	ENST00000290795.3	37	NULL	CCDS528.1	1																																																																																			GPBP1L1	-	-	ENSG00000159592		0.408	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBP1L1	HGNC	protein_coding	OTTHUMT00000098375.1	66	0.00	0	G	NM_021639		46121010	46121010	-1	no_errors	ENST00000496278	ensembl	human	known	69_37n	rna	72	20.88	19	SNP	0.000	A
GRIN2D	2906	genome.wustl.edu	37	19	48922957	48922957	+	Silent	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr19:48922957G>A	ENST00000263269.3	+	9	2065	c.1977G>A	c.(1975-1977)gtG>gtA	p.V659V		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	659					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AAATCATGGTGCTGGTGTGGG	0.582																																						dbGAP											0													121.0	111.0	114.0					19																	48922957		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1977G>A	19.37:g.48922957G>A				Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V659	ENST00000263269.3	37	c.1977	CCDS12719.1	19																																																																																			GRIN2D	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000105464		0.582	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2D	HGNC	protein_coding	OTTHUMT00000466121.1	49	0.00	0	G			48922957	48922957	+1	no_errors	ENST00000263269	ensembl	human	known	69_37n	silent	114	13.64	18	SNP	0.983	A
GRIN2D	2906	genome.wustl.edu	37	19	48922957	48922957	+	Silent	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr19:48922957G>A	ENST00000263269.3	+	9	2065	c.1977G>A	c.(1975-1977)gtG>gtA	p.V659V		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	659					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AAATCATGGTGCTGGTGTGGG	0.582																																						dbGAP											0													121.0	111.0	114.0					19																	48922957		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1977G>A	19.37:g.48922957G>A				Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V659	ENST00000263269.3	37	c.1977	CCDS12719.1	19																																																																																			GRIN2D	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000105464		0.582	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2D	HGNC	protein_coding	OTTHUMT00000466121.1	61	0.00	0	G			48922957	48922957	+1	no_errors	ENST00000263269	ensembl	human	known	69_37n	silent	114	13.64	18	SNP	0.983	A
HEG1	57493	genome.wustl.edu	37	3	124732410	124732410	+	Silent	SNP	A	A	G			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr3:124732410A>G	ENST00000311127.4	-	6	2080	c.2013T>C	c.(2011-2013)tcT>tcC	p.S671S	HEG1_ENST00000477536.1_5'UTR	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	671	Ser-rich.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GAGGCCCTgaagaagaagaag	0.473																																						dbGAP											0													46.0	52.0	50.0					3																	124732410		2119	4239	6358	-	-	-	SO:0001819	synonymous_variant	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2013T>C	3.37:g.124732410A>G			Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	p.S671	ENST00000311127.4	37	c.2013	CCDS46898.1	3																																																																																			HEG1	-	NULL	ENSG00000173706		0.473	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	26	0.00	0	A	XM_087386		124732410	124732410	-1	no_errors	ENST00000311127	ensembl	human	known	69_37n	silent	28	20.00	7	SNP	0.018	G
HIST4H4	121504	genome.wustl.edu	37	12	14923963	14923963	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr12:14923963T>A	ENST00000539745.1	-	1	102	c.56A>T	c.(55-57)cAc>cTc	p.H19L	HIST4H4_ENST00000541592.1_5'Flank	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	19					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						CACCTTCCGGTGGCGCTTGGC	0.597											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													49.0	55.0	53.0					12																	14923963		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.56A>T	12.37:g.14923963T>A	ENSP00000443017:p.His19Leu	698	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.H19L	ENST00000539745.1	37	c.56	CCDS8665.1	12	.	.	.	.	.	.	.	.	.	.	T	13.35	2.210987	0.39102	.	.	ENSG00000197837	ENST00000539745	.	.	.	4.18	3.0	0.34707	.	0.000000	0.56097	U	0.000028	T	0.63931	0.2553	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.64728	-0.6339	6	0.87932	D	0	.	8.4165	0.32674	0.1748:0.0:0.0:0.8252	.	.	.	.	L	19	.	ENSP00000350767:H19L	H	-	2	0	HIST4H4	14815230	1.000000	0.71417	0.900000	0.35374	0.296000	0.27459	3.690000	0.54713	0.744000	0.32741	0.528000	0.53228	CAC	HIST4H4	-	superfamily_Histone-fold,smart_Histone_H4	ENSG00000197837		0.597	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST4H4	HGNC	protein_coding	OTTHUMT00000400844.1	47	0.00	0	T	NM_175054		14923963	14923963	-1	no_errors	ENST00000358064	ensembl	human	known	69_37n	missense	71	16.47	14	SNP	1.000	A
HIST4H4	121504	genome.wustl.edu	37	12	14923963	14923963	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr12:14923963T>A	ENST00000539745.1	-	1	102	c.56A>T	c.(55-57)cAc>cTc	p.H19L	HIST4H4_ENST00000541592.1_5'Flank	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	19					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						CACCTTCCGGTGGCGCTTGGC	0.597											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													49.0	55.0	53.0					12																	14923963		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.56A>T	12.37:g.14923963T>A	ENSP00000443017:p.His19Leu	698	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.H19L	ENST00000539745.1	37	c.56	CCDS8665.1	12	.	.	.	.	.	.	.	.	.	.	T	13.35	2.210987	0.39102	.	.	ENSG00000197837	ENST00000539745	.	.	.	4.18	3.0	0.34707	.	0.000000	0.56097	U	0.000028	T	0.63931	0.2553	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.64728	-0.6339	6	0.87932	D	0	.	8.4165	0.32674	0.1748:0.0:0.0:0.8252	.	.	.	.	L	19	.	ENSP00000350767:H19L	H	-	2	0	HIST4H4	14815230	1.000000	0.71417	0.900000	0.35374	0.296000	0.27459	3.690000	0.54713	0.744000	0.32741	0.528000	0.53228	CAC	HIST4H4	-	superfamily_Histone-fold,smart_Histone_H4	ENSG00000197837		0.597	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST4H4	HGNC	protein_coding	OTTHUMT00000400844.1	45	0.00	0	T	NM_175054		14923963	14923963	-1	no_errors	ENST00000358064	ensembl	human	known	69_37n	missense	71	16.47	14	SNP	1.000	A
HYDIN	54768	genome.wustl.edu	37	16	70928402	70928402	+	Silent	SNP	C	C	T	rs12102717	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr16:70928402C>T	ENST00000393567.2	-	55	9348	c.9198G>A	c.(9196-9198)gcG>gcA	p.A3066A		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3066					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GGGGCTGCTTCGCCTCCTCTG	0.572																																						dbGAP											0													47.0	43.0	45.0					16																	70928402		1822	4046	5868	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.9198G>A	16.37:g.70928402C>T			A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like	p.A3065	ENST00000393567.2	37	c.9195	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.572	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	38	0.00	0	C			70928402	70928402	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	silent	41	10.87	5	SNP	0.896	T
LRRC8D	55144	genome.wustl.edu	37	1	90400208	90400208	+	Silent	SNP	T	T	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr1:90400208T>C	ENST00000337338.5	+	3	1988	c.1581T>C	c.(1579-1581)gtT>gtC	p.V527V	LRRC8D_ENST00000394593.3_Silent_p.V527V	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	527					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		CTGCAAAAGTTGAACAGACTG	0.438																																						dbGAP											0													85.0	90.0	88.0					1																	90400208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1581T>C	1.37:g.90400208T>C			D3DT29|Q6UWB2|Q9NVW3	Silent	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.V527	ENST00000337338.5	37	c.1581	CCDS726.1	1																																																																																			LRRC8D	-	NULL	ENSG00000171492		0.438	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8D	HGNC	protein_coding	OTTHUMT00000029203.2	36	0.00	0	T	NM_018103		90400208	90400208	+1	no_errors	ENST00000337338	ensembl	human	known	69_37n	silent	69	20.69	18	SNP	0.002	C
LRRC8D	55144	genome.wustl.edu	37	1	90400208	90400208	+	Silent	SNP	T	T	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:90400208T>C	ENST00000337338.5	+	3	1988	c.1581T>C	c.(1579-1581)gtT>gtC	p.V527V	LRRC8D_ENST00000394593.3_Silent_p.V527V	NM_001134479.1	NP_001127951.1	Q7L1W4	LRC8D_HUMAN	leucine rich repeat containing 8 family, member D	527					ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(2)|skin(1)	29		all_lung(203;0.0894)|Lung NSC(277;0.227)		all cancers(265;0.0109)|Epithelial(280;0.0427)		CTGCAAAAGTTGAACAGACTG	0.438																																						dbGAP											0													85.0	90.0	88.0					1																	90400208		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001332	CCDS726.1	1p22.2	2008-02-05	2005-06-29	2005-06-29	ENSG00000171492	ENSG00000171492			16992	protein-coding gene	gene with protein product		612890	"""leucine rich repeat containing 5"""	LRRC5			Standard	NM_018103		Approved	FLJ10470	uc001dnn.3	Q7L1W4	OTTHUMG00000010583	ENST00000337338.5:c.1581T>C	1.37:g.90400208T>C			D3DT29|Q6UWB2|Q9NVW3	Silent	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.V527	ENST00000337338.5	37	c.1581	CCDS726.1	1																																																																																			LRRC8D	-	NULL	ENSG00000171492		0.438	LRRC8D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8D	HGNC	protein_coding	OTTHUMT00000029203.2	53	0.00	0	T	NM_018103		90400208	90400208	+1	no_errors	ENST00000337338	ensembl	human	known	69_37n	silent	69	20.69	18	SNP	0.002	C
KPRP	448834	genome.wustl.edu	37	1	152732300	152732300	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr1:152732300A>G	ENST00000606109.1	+	1	264	c.236A>G	c.(235-237)aAg>aGg	p.K79R	KPRP_ENST00000368773.1_Missense_Mutation_p.K79R			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	79	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTAAGACCAAGCAGGTGAAG	0.557																																						dbGAP											0													190.0	163.0	172.0					1																	152732300		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.236A>G	1.37:g.152732300A>G	ENSP00000475216:p.Lys79Arg			Missense_Mutation	SNP	NULL	p.K79R	ENST00000606109.1	37	c.236	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	A	3.399	-0.122643	0.06795	.	.	ENSG00000203786	ENST00000368773	T	0.12361	2.69	4.79	0.647	0.17796	.	1.324350	0.05107	N	0.488125	T	0.02267	0.0070	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.43909	-0.9362	10	0.19147	T	0.46	0.3991	3.5323	0.07781	0.4149:0.3784:0.0:0.2067	.	79	Q5T749	KPRP_HUMAN	R	79	ENSP00000357762:K79R	ENSP00000357762:K79R	K	+	2	0	KPRP	150998924	0.000000	0.05858	0.089000	0.20774	0.497000	0.33675	0.012000	0.13287	0.253000	0.21552	0.533000	0.62120	AAG	KPRP	-	NULL	ENSG00000203786		0.557	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	HGNC	protein_coding	OTTHUMT00000034522.2	46	0.00	0	A	NM_001025231		152732300	152732300	+1	no_errors	ENST00000368773	ensembl	human	known	69_37n	missense	79	15.96	15	SNP	0.031	G
KPRP	448834	genome.wustl.edu	37	1	152732300	152732300	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:152732300A>G	ENST00000606109.1	+	1	264	c.236A>G	c.(235-237)aAg>aGg	p.K79R	KPRP_ENST00000368773.1_Missense_Mutation_p.K79R			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	79	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTAAGACCAAGCAGGTGAAG	0.557																																						dbGAP											0													190.0	163.0	172.0					1																	152732300		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.236A>G	1.37:g.152732300A>G	ENSP00000475216:p.Lys79Arg			Missense_Mutation	SNP	NULL	p.K79R	ENST00000606109.1	37	c.236	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	A	3.399	-0.122643	0.06795	.	.	ENSG00000203786	ENST00000368773	T	0.12361	2.69	4.79	0.647	0.17796	.	1.324350	0.05107	N	0.488125	T	0.02267	0.0070	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.43909	-0.9362	10	0.19147	T	0.46	0.3991	3.5323	0.07781	0.4149:0.3784:0.0:0.2067	.	79	Q5T749	KPRP_HUMAN	R	79	ENSP00000357762:K79R	ENSP00000357762:K79R	K	+	2	0	KPRP	150998924	0.000000	0.05858	0.089000	0.20774	0.497000	0.33675	0.012000	0.13287	0.253000	0.21552	0.533000	0.62120	AAG	KPRP	-	NULL	ENSG00000203786		0.557	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	HGNC	protein_coding	OTTHUMT00000034522.2	65	0.00	0	A	NM_001025231		152732300	152732300	+1	no_errors	ENST00000368773	ensembl	human	known	69_37n	missense	79	15.96	15	SNP	0.031	G
LCE1D	353134	genome.wustl.edu	37	1	152770503	152770503	+	Missense_Mutation	SNP	G	G	A	rs41268490	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:152770503G>A	ENST00000326233.6	+	2	276	c.233G>A	c.(232-234)cGc>cAc	p.R78H		NM_178352.2	NP_848129.1	Q5T752	LCE1D_HUMAN	late cornified envelope 1D	78	Cys-rich.		R -> H (in dbSNP:rs41268490).		cellular response to calcium ion (GO:0071277)|cognition (GO:0050890)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(1)	1	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CACCACAGGCGCCACAGGTCC	0.711													G|||	350	0.0698882	0.1286	0.0562	5008	,	,		10300	0.0595		0.0398	False		,,,				2504	0.0419					dbGAP											0													19.0	22.0	21.0					1																	152770503		2016	3750	5766	-	-	-	SO:0001583	missense	0				CCDS1025.1	1q21.3	2008-02-05			ENSG00000172155	ENSG00000172155		"""Late cornified envelopes"""	29465	protein-coding gene	gene with protein product		612606				11698679	Standard	NM_178352		Approved	LEP4	uc009wnp.3	Q5T752	OTTHUMG00000012444	ENST00000326233.6:c.233G>A	1.37:g.152770503G>A	ENSP00000316737:p.Arg78His			Missense_Mutation	SNP	NULL	p.R78H	ENST00000326233.6	37	c.233	CCDS1025.1	1	191	0.08745421245421245	54	0.10975609756097561	47	0.1298342541436464	12	0.02097902097902098	78	0.10290237467018469	G	9.439	1.087448	0.20390	.	.	ENSG00000172155	ENST00000326233	T	0.03772	3.81	4.19	-0.192	0.13248	.	1.035500	0.07789	N	0.954589	T	0.01222	0.0040	L	0.28344	0.845	0.21802	N	0.999534	B	0.06786	0.001	B	0.04013	0.001	T	0.48581	-0.9023	10	0.87932	D	0	.	5.7684	0.18239	0.2311:0.2277:0.5411:0.0	rs41268490	78	Q5T752	LCE1D_HUMAN	H	78	ENSP00000316737:R78H	ENSP00000316737:R78H	R	+	2	0	LCE1D	151037127	0.987000	0.35691	0.972000	0.41901	0.680000	0.39746	0.805000	0.27112	-0.024000	0.13941	-0.263000	0.10527	CGC	LCE1D	-	NULL	ENSG00000172155		0.711	LCE1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1D	HGNC	protein_coding	OTTHUMT00000034657.2	51	0.00	0	G	NM_178352		152770503	152770503	+1	no_errors	ENST00000326233	ensembl	human	known	69_37n	missense	81	13.83	13	SNP	0.956	A
IGFN1	91156	genome.wustl.edu	37	1	201176353	201176353	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:201176353C>T	ENST00000335211.4	+	12	2462	c.2332C>T	c.(2332-2334)Cca>Tca	p.P778S	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCCTGGAGGCCCAGGAGACCC	0.582																																						dbGAP											0													25.0	32.0	30.0					1																	201176353		692	1591	2283	-	-	-	SO:0001583	missense	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.2332C>T	1.37:g.201176353C>T	ENSP00000334714:p.Pro778Ser		F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P778S	ENST00000335211.4	37	c.2332	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175046	0.38413	.	.	ENSG00000163395	ENST00000335211	T	0.54071	0.59	3.83	-0.39	0.12450	.	.	.	.	.	T	0.24699	0.0599	N	0.08118	0	0.09310	N	0.999998	.	.	.	.	.	.	T	0.16719	-1.0393	6	.	.	.	.	3.6163	0.08078	0.0:0.4691:0.1905:0.3404	.	.	.	.	S	778	ENSP00000334714:P778S	.	P	+	1	0	IGFN1	199442976	0.000000	0.05858	0.005000	0.12908	0.424000	0.31475	-0.674000	0.05233	-0.275000	0.09219	-0.140000	0.14226	CCA	IGFN1	-	NULL	ENSG00000163395		0.582	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		28	0.00	0	C	NM_178275		201176353	201176353	+1	no_errors	ENST00000335211	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	0.009	T
MAB21L1	4081	genome.wustl.edu	37	13	36049883	36049883	+	Silent	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr13:36049883C>T	ENST00000379919.4	-	1	949	c.393G>A	c.(391-393)agG>agA	p.R131R	NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000400445.3_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	131					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GCGTCTGAAACCTGGACCGGA	0.562																																						dbGAP											0													48.0	49.0	49.0					13																	36049883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.393G>A	13.37:g.36049883C>T			Q6I9T5	Silent	SNP	pfam_Mab-21_dom	p.R131	ENST00000379919.4	37	c.393	CCDS9353.1	13																																																																																			MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.562	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	31	0.00	0	C	NM_005584		36049883	36049883	-1	no_errors	ENST00000379919	ensembl	human	known	69_37n	silent	27	38.64	17	SNP	0.992	T
MAB21L1	4081	genome.wustl.edu	37	13	36049883	36049883	+	Silent	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr13:36049883C>T	ENST00000379919.4	-	1	949	c.393G>A	c.(391-393)agG>agA	p.R131R	NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000400445.3_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	131					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GCGTCTGAAACCTGGACCGGA	0.562																																						dbGAP											0													48.0	49.0	49.0					13																	36049883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.393G>A	13.37:g.36049883C>T			Q6I9T5	Silent	SNP	pfam_Mab-21_dom	p.R131	ENST00000379919.4	37	c.393	CCDS9353.1	13																																																																																			MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.562	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	44	0.00	0	C	NM_005584		36049883	36049883	-1	no_errors	ENST00000379919	ensembl	human	known	69_37n	silent	27	38.64	17	SNP	0.992	T
KMT2C	58508	genome.wustl.edu	37	7	151945694	151945694	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr7:151945694delG	ENST00000262189.6	-	14	2043	c.1825delC	c.(1825-1827)catfs	p.H609fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.H609fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	609					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTCACTGTATGTTGGGATGAT	0.303																																						dbGAP											0													24.0	24.0	24.0					7																	151945694		2192	4253	6445	-	-	-	SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1825delC	7.37:g.151945694delG	ENSP00000262189:p.His609fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.H609fs	ENST00000262189.6	37	c.1825	CCDS5931.1	7																																																																																			MLL3	-	NULL	ENSG00000055609		0.303	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	29	0.00	0	G			151945694	151945694	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	frame_shift_del	14	53.12	17	DEL	0.000	-
KMT2C	58508	genome.wustl.edu	37	7	151945694	151945694	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr7:151945694delG	ENST00000262189.6	-	14	2043	c.1825delC	c.(1825-1827)catfs	p.H609fs	KMT2C_ENST00000355193.2_Frame_Shift_Del_p.H609fs	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	609					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTCACTGTATGTTGGGATGAT	0.303																																						dbGAP											0													24.0	24.0	24.0					7																	151945694		2192	4253	6445	-	-	-	SO:0001589	frameshift_variant	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.1825delC	7.37:g.151945694delG	ENSP00000262189:p.His609fs		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.H609fs	ENST00000262189.6	37	c.1825	CCDS5931.1	7																																																																																			MLL3	-	NULL	ENSG00000055609		0.303	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	26	0.00	0	G			151945694	151945694	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	frame_shift_del	14	53.12	17	DEL	0.000	-
MOB3C	148932	genome.wustl.edu	37	1	47078684	47078684	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr1:47078684G>A	ENST00000319928.3	-	2	540	c.310C>T	c.(310-312)Cgc>Tgc	p.R104C	MOB3C_ENST00000371940.1_Missense_Mutation_p.R127C|MOB3C_ENST00000271139.8_Missense_Mutation_p.R156C|MKNK1_ENST00000545730.1_Intron|MOB3C_ENST00000477318.1_5'UTR	NM_201403.2	NP_958805.1	Q70IA8	MOB3C_HUMAN	MOB kinase activator 3C	104							metal ion binding (GO:0046872)	p.R156C(1)									CGGTACTGGCGCTCGTCCTGC	0.642																																						dbGAP											1	Substitution - Missense(1)	pancreas(1)											33.0	34.0	34.0					1																	47078684		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK091808	CCDS539.1, CCDS540.1	1p34.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000142961	ENSG00000142961		"""MOB kinase activators"""	29800	protein-coding gene	gene with protein product			"""MOB1, Mps One Binder kinase activator-like 2C (yeast)"""	MOBKL2C		12477932	Standard	NM_145279		Approved	MOB1E	uc001cqe.4	Q70IA8	OTTHUMG00000007989	ENST00000319928.3:c.310C>T	1.37:g.47078684G>A	ENSP00000315113:p.Arg104Cys		D3DQ22|Q0VA98|Q5TC10|Q5TC11|Q8NAZ2|Q8NF28	Missense_Mutation	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.R156C	ENST00000319928.3	37	c.466	CCDS540.1	1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444959	0.63178	.	.	ENSG00000142961	ENST00000319928;ENST00000271139;ENST00000371940	.	.	.	5.26	5.26	0.73747	.	0.393144	0.30850	N	0.008751	T	0.41581	0.1165	L	0.46157	1.445	0.43007	D	0.994538	P	0.36874	0.572	B	0.26614	0.071	T	0.48139	-0.9061	9	0.59425	D	0.04	-26.3282	11.6839	0.51474	0.0:0.0:0.7177:0.2823	.	104	Q70IA8	MOB3C_HUMAN	C	104;156;127	.	ENSP00000271139:R156C	R	-	1	0	MOBKL2C	46851271	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	2.625000	0.46452	2.462000	0.83206	0.557000	0.71058	CGC	MOB3C	-	pfam_Mob1_phocein,superfamily_Mob1_phocein	ENSG00000142961		0.642	MOB3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB3C	HGNC	protein_coding		56	0.00	0	G	NM_145279		47078684	47078684	-1	no_errors	ENST00000271139	ensembl	human	known	69_37n	missense	55	35.29	30	SNP	1.000	A
MOB3C	148932	genome.wustl.edu	37	1	47078684	47078684	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:47078684G>A	ENST00000319928.3	-	2	540	c.310C>T	c.(310-312)Cgc>Tgc	p.R104C	MOB3C_ENST00000371940.1_Missense_Mutation_p.R127C|MOB3C_ENST00000271139.8_Missense_Mutation_p.R156C|MKNK1_ENST00000545730.1_Intron|MOB3C_ENST00000477318.1_5'UTR	NM_201403.2	NP_958805.1	Q70IA8	MOB3C_HUMAN	MOB kinase activator 3C	104							metal ion binding (GO:0046872)	p.R156C(1)									CGGTACTGGCGCTCGTCCTGC	0.642																																						dbGAP											1	Substitution - Missense(1)	pancreas(1)											33.0	34.0	34.0					1																	47078684		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK091808	CCDS539.1, CCDS540.1	1p34.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000142961	ENSG00000142961		"""MOB kinase activators"""	29800	protein-coding gene	gene with protein product			"""MOB1, Mps One Binder kinase activator-like 2C (yeast)"""	MOBKL2C		12477932	Standard	NM_145279		Approved	MOB1E	uc001cqe.4	Q70IA8	OTTHUMG00000007989	ENST00000319928.3:c.310C>T	1.37:g.47078684G>A	ENSP00000315113:p.Arg104Cys		D3DQ22|Q0VA98|Q5TC10|Q5TC11|Q8NAZ2|Q8NF28	Missense_Mutation	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.R156C	ENST00000319928.3	37	c.466	CCDS540.1	1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444959	0.63178	.	.	ENSG00000142961	ENST00000319928;ENST00000271139;ENST00000371940	.	.	.	5.26	5.26	0.73747	.	0.393144	0.30850	N	0.008751	T	0.41581	0.1165	L	0.46157	1.445	0.43007	D	0.994538	P	0.36874	0.572	B	0.26614	0.071	T	0.48139	-0.9061	9	0.59425	D	0.04	-26.3282	11.6839	0.51474	0.0:0.0:0.7177:0.2823	.	104	Q70IA8	MOB3C_HUMAN	C	104;156;127	.	ENSP00000271139:R156C	R	-	1	0	MOBKL2C	46851271	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	2.625000	0.46452	2.462000	0.83206	0.557000	0.71058	CGC	MOB3C	-	pfam_Mob1_phocein,superfamily_Mob1_phocein	ENSG00000142961		0.642	MOB3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB3C	HGNC	protein_coding		66	0.00	0	G	NM_145279		47078684	47078684	-1	no_errors	ENST00000271139	ensembl	human	known	69_37n	missense	55	35.29	30	SNP	1.000	A
MRPS2	51116	genome.wustl.edu	37	9	138395623	138395623	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr9:138395623G>A	ENST00000371785.1	+	5	744	c.535G>A	c.(535-537)Gcg>Acg	p.A179T	MRPS2_ENST00000241600.5_Missense_Mutation_p.A179T|C9orf116_ENST00000371791.1_5'Flank|RP11-426A6.5_ENST00000415062.1_RNA|MRPS2_ENST00000488610.1_3'UTR			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	179					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		GCTGACCAACGCGCGCCTCCT	0.617																																						dbGAP											0													56.0	53.0	54.0					9																	138395623		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910	ENST00000371785.1:c.535G>A	9.37:g.138395623G>A	ENSP00000360850:p.Ala179Thr		Q5T899|Q9BSQ4	Missense_Mutation	SNP	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2	p.A179T	ENST00000371785.1	37	c.535	CCDS6990.1	9	.	.	.	.	.	.	.	.	.	.	G	5.555	0.287207	0.10513	.	.	ENSG00000122140	ENST00000371785;ENST00000241600;ENST00000453385	T;T;T	0.22134	1.97;1.97;1.97	4.56	3.66	0.41972	Ribosomal protein S2, flavodoxin-like domain (1);	0.311321	0.33419	N	0.004940	T	0.35219	0.0924	L	0.56769	1.78	0.49687	D	0.999817	D;D	0.63880	0.993;0.993	P;P	0.58520	0.84;0.84	T	0.09164	-1.0687	10	0.56958	D	0.05	-17.8138	11.5719	0.50839	0.0885:0.0:0.9115:0.0	.	193;179	Q5T8A0;Q9Y399	.;RT02_HUMAN	T	179;179;193	ENSP00000360850:A179T;ENSP00000241600:A179T;ENSP00000400082:A193T	ENSP00000241600:A179T	A	+	1	0	MRPS2	137535444	0.997000	0.39634	0.197000	0.23402	0.268000	0.26511	3.010000	0.49559	1.134000	0.42165	0.585000	0.79938	GCG	MRPS2	-	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2	ENSG00000122140		0.617	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS2	HGNC	protein_coding	OTTHUMT00000054998.1	22	0.00	0	G			138395623	138395623	+1	no_errors	ENST00000241600	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.998	A
MRPS2	51116	genome.wustl.edu	37	9	138395623	138395623	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr9:138395623G>A	ENST00000371785.1	+	5	744	c.535G>A	c.(535-537)Gcg>Acg	p.A179T	MRPS2_ENST00000241600.5_Missense_Mutation_p.A179T|C9orf116_ENST00000371791.1_5'Flank|RP11-426A6.5_ENST00000415062.1_RNA|MRPS2_ENST00000488610.1_3'UTR			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	179					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		GCTGACCAACGCGCGCCTCCT	0.617																																						dbGAP											0													56.0	53.0	54.0					9																	138395623		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910	ENST00000371785.1:c.535G>A	9.37:g.138395623G>A	ENSP00000360850:p.Ala179Thr		Q5T899|Q9BSQ4	Missense_Mutation	SNP	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2	p.A179T	ENST00000371785.1	37	c.535	CCDS6990.1	9	.	.	.	.	.	.	.	.	.	.	G	5.555	0.287207	0.10513	.	.	ENSG00000122140	ENST00000371785;ENST00000241600;ENST00000453385	T;T;T	0.22134	1.97;1.97;1.97	4.56	3.66	0.41972	Ribosomal protein S2, flavodoxin-like domain (1);	0.311321	0.33419	N	0.004940	T	0.35219	0.0924	L	0.56769	1.78	0.49687	D	0.999817	D;D	0.63880	0.993;0.993	P;P	0.58520	0.84;0.84	T	0.09164	-1.0687	10	0.56958	D	0.05	-17.8138	11.5719	0.50839	0.0885:0.0:0.9115:0.0	.	193;179	Q5T8A0;Q9Y399	.;RT02_HUMAN	T	179;179;193	ENSP00000360850:A179T;ENSP00000241600:A179T;ENSP00000400082:A193T	ENSP00000241600:A179T	A	+	1	0	MRPS2	137535444	0.997000	0.39634	0.197000	0.23402	0.268000	0.26511	3.010000	0.49559	1.134000	0.42165	0.585000	0.79938	GCG	MRPS2	-	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2	ENSG00000122140		0.617	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS2	HGNC	protein_coding	OTTHUMT00000054998.1	39	0.00	0	G			138395623	138395623	+1	no_errors	ENST00000241600	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.998	A
MYO18B	84700	genome.wustl.edu	37	22	26291146	26291146	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr22:26291146G>A	ENST00000407587.2	+	28	4739	c.4570G>A	c.(4570-4572)Gac>Aac	p.D1524N	CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000594856.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000597614.2_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.D1523N|CTA-125H2.2_ENST00000609275.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.D1523N|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000600903.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000608507.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1523	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GATGCGCTTCGACTGTGCTCA	0.547																																						dbGAP											0													37.0	41.0	39.0					22																	26291146		2190	4283	6473	-	-	-	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4570G>A	22.37:g.26291146G>A	ENSP00000386096:p.Asp1524Asn		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd_dom,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1523N	ENST00000407587.2	37	c.4567		22	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623551	0.66901	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;T	0.86627	-2.15;-2.15;-1.16	5.26	5.26	0.73747	.	0.251447	0.33309	N	0.005057	D	0.91744	0.7389	L	0.53249	1.67	0.37554	D	0.9188	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.982;0.983;0.998;0.992	D	0.93184	0.6577	10	0.56958	D	0.05	.	16.3609	0.83267	0.0:0.0:1.0:0.0	.	1036;1523;1524;1523	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	N	1523;1523;1524	ENSP00000441229:D1523N;ENSP00000334563:D1523N;ENSP00000386096:D1524N	ENSP00000334563:D1523N	D	+	1	0	MYO18B	24621146	1.000000	0.71417	0.945000	0.38365	0.315000	0.28087	5.788000	0.69020	2.471000	0.83476	0.563000	0.77884	GAC	MYO18B	-	NULL	ENSG00000133454		0.547	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	62	0.00	0	G	NM_032608		26291146	26291146	+1	no_errors	ENST00000335473	ensembl	human	known	69_37n	missense	50	36.71	29	SNP	0.987	A
MYO18B	84700	genome.wustl.edu	37	22	26291146	26291146	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr22:26291146G>A	ENST00000407587.2	+	28	4739	c.4570G>A	c.(4570-4572)Gac>Aac	p.D1524N	CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000594856.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000597614.2_RNA|MYO18B_ENST00000536101.1_Missense_Mutation_p.D1523N|CTA-125H2.2_ENST00000609275.1_RNA|MYO18B_ENST00000335473.7_Missense_Mutation_p.D1523N|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000600903.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000608507.1_RNA|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000600269.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000599792.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1523	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GATGCGCTTCGACTGTGCTCA	0.547																																						dbGAP											0													37.0	41.0	39.0					22																	26291146		2190	4283	6473	-	-	-	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4570G>A	22.37:g.26291146G>A	ENSP00000386096:p.Asp1524Asn		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd_dom,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1523N	ENST00000407587.2	37	c.4567		22	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623551	0.66901	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;T	0.86627	-2.15;-2.15;-1.16	5.26	5.26	0.73747	.	0.251447	0.33309	N	0.005057	D	0.91744	0.7389	L	0.53249	1.67	0.37554	D	0.9188	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.982;0.983;0.998;0.992	D	0.93184	0.6577	10	0.56958	D	0.05	.	16.3609	0.83267	0.0:0.0:1.0:0.0	.	1036;1523;1524;1523	Q8IUG5-2;Q8IUG5;F5GXR6;F5GYU7	.;MY18B_HUMAN;.;.	N	1523;1523;1524	ENSP00000441229:D1523N;ENSP00000334563:D1523N;ENSP00000386096:D1524N	ENSP00000334563:D1523N	D	+	1	0	MYO18B	24621146	1.000000	0.71417	0.945000	0.38365	0.315000	0.28087	5.788000	0.69020	2.471000	0.83476	0.563000	0.77884	GAC	MYO18B	-	NULL	ENSG00000133454		0.547	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	71	0.00	0	G	NM_032608		26291146	26291146	+1	no_errors	ENST00000335473	ensembl	human	known	69_37n	missense	50	36.71	29	SNP	0.987	A
MYO5B	4645	genome.wustl.edu	37	18	47511089	47511089	+	Splice_Site	SNP	G	G	A	rs535504125		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr18:47511089G>A	ENST00000285039.7	-	8	1244	c.945C>T	c.(943-945)ctC>ctT	p.L315L		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	315	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GCTCCTTACCGAGGAGTGTGA	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20699	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													97.0	99.0	99.0					18																	47511089		1987	4178	6165	-	-	-	SO:0001630	splice_region_variant	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.946+1C>T	18.37:g.47511089G>A			B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L315	ENST00000285039.7	37	c.945	CCDS42436.1	18																																																																																			MYO5B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000167306		0.552	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	51	0.00	0	G		Silent	47511089	47511089	-1	no_errors	ENST00000285039	ensembl	human	known	69_37n	silent	77	37.90	47	SNP	0.069	A
MYO5B	4645	genome.wustl.edu	37	18	47511089	47511089	+	Splice_Site	SNP	G	G	A	rs535504125		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr18:47511089G>A	ENST00000285039.7	-	8	1244	c.945C>T	c.(943-945)ctC>ctT	p.L315L		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	315	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GCTCCTTACCGAGGAGTGTGA	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20699	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													97.0	99.0	99.0					18																	47511089		1987	4178	6165	-	-	-	SO:0001630	splice_region_variant	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.946+1C>T	18.37:g.47511089G>A			B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L315	ENST00000285039.7	37	c.945	CCDS42436.1	18																																																																																			MYO5B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000167306		0.552	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	65	0.00	0	G		Silent	47511089	47511089	-1	no_errors	ENST00000285039	ensembl	human	known	69_37n	silent	77	37.90	47	SNP	0.069	A
NBPF1	55672	genome.wustl.edu	37	1	16889890	16889891	+	3'UTR	DEL	TG	TG	-	rs58780635|rs545158456	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr1:16889890_16889891delTG	ENST00000430580.2	-	0	4854_4855					NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		GCTGAAGGACTGTGGCTTCTCT	0.49														1471	0.29373	0.4054	0.2752	5008	,	,		55089	0.3006		0.1958	False		,,,				2504	0.2495					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.*548CA>-	1.37:g.16889892_16889893delTG			Q8N4E8|Q9C0H0	RNA	DEL	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.490	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	9	0.00	0	TG	NM_017940		16889890	16889891	-1	no_errors	ENST00000392963	ensembl	human	known	69_37n	rna	7	36.36	4	DEL	0.001:0.000	-
PCDHA13	56136	genome.wustl.edu	37	5	140263298	140263298	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr5:140263298C>T	ENST00000289272.2	+	1	1445	c.1445C>T	c.(1444-1446)gCg>gTg	p.A482V	PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.A482V|PCDHA10_ENST00000307360.5_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	482	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCAGGACGCGGACGCACAG	0.667																																					Melanoma(147;1739 1852 5500 27947 37288)	dbGAP											0													72.0	73.0	72.0					5																	140263298		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1445C>T	5.37:g.140263298C>T	ENSP00000289272:p.Ala482Val		O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A482V	ENST00000289272.2	37	c.1445	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359244	0.24598	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.61627	0.09;0.09	4.62	3.75	0.43078	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.43700	0.1259	N	0.20328	0.56	0.27737	N	0.944619	B;B;B	0.33494	0.331;0.331;0.414	B;B;B	0.32762	0.151;0.152;0.094	T	0.42565	-0.9444	9	0.66056	D	0.02	.	12.52	0.56054	0.0:0.9178:0.0:0.0822	.	482;482;482	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	V	482	ENSP00000386821:A482V;ENSP00000289272:A482V	ENSP00000289272:A482V	A	+	2	0	PCDHA13	140243482	0.000000	0.05858	0.999000	0.59377	0.097000	0.18754	-0.105000	0.10907	1.160000	0.42584	-0.265000	0.10407	GCG	PCDHA13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000239389		0.667	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	172	0.00	0	C	NM_018904		140263298	140263298	+1	no_errors	ENST00000289272	ensembl	human	known	69_37n	missense	152	24.00	48	SNP	0.993	T
PCDHA13	56136	genome.wustl.edu	37	5	140263298	140263298	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr5:140263298C>T	ENST00000289272.2	+	1	1445	c.1445C>T	c.(1444-1446)gCg>gTg	p.A482V	PCDHA10_ENST00000506939.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.A482V|PCDHA10_ENST00000307360.5_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	482	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCAGGACGCGGACGCACAG	0.667																																					Melanoma(147;1739 1852 5500 27947 37288)	dbGAP											0													72.0	73.0	72.0					5																	140263298		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1445C>T	5.37:g.140263298C>T	ENSP00000289272:p.Ala482Val		O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A482V	ENST00000289272.2	37	c.1445	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359244	0.24598	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.61627	0.09;0.09	4.62	3.75	0.43078	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.43700	0.1259	N	0.20328	0.56	0.27737	N	0.944619	B;B;B	0.33494	0.331;0.331;0.414	B;B;B	0.32762	0.151;0.152;0.094	T	0.42565	-0.9444	9	0.66056	D	0.02	.	12.52	0.56054	0.0:0.9178:0.0:0.0822	.	482;482;482	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	V	482	ENSP00000386821:A482V;ENSP00000289272:A482V	ENSP00000289272:A482V	A	+	2	0	PCDHA13	140243482	0.000000	0.05858	0.999000	0.59377	0.097000	0.18754	-0.105000	0.10907	1.160000	0.42584	-0.265000	0.10407	GCG	PCDHA13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000239389		0.667	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	193	0.00	0	C	NM_018904		140263298	140263298	+1	no_errors	ENST00000289272	ensembl	human	known	69_37n	missense	152	24.00	48	SNP	0.993	T
PCDHGB7	56099	genome.wustl.edu	37	5	140798221	140798221	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr5:140798221G>T	ENST00000398594.2	+	1	795	c.795G>T	c.(793-795)aaG>aaT	p.K265N	PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	265	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGAGTGAAGGCCACTGACC	0.527																																						dbGAP											0													61.0	63.0	62.0					5																	140798221		2053	4195	6248	-	-	-	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.795G>T	5.37:g.140798221G>T	ENSP00000381594:p.Lys265Asn		Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.K265N	ENST00000398594.2	37	c.795	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	0.053	-1.243891	0.01481	.	.	ENSG00000254122	ENST00000398594	T	0.51071	0.72	5.7	-4.01	0.04045	Cadherin (5);Cadherin-like (1);	172.624000	0.01226	U	0.008237	T	0.22244	0.0536	N	0.12853	0.265	0.18873	N	0.999987	B;B	0.30179	0.271;0.077	B;B	0.33121	0.158;0.098	T	0.18840	-1.0324	10	0.02654	T	1	.	1.2733	0.02025	0.1673:0.2609:0.2112:0.3606	.	265;265	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	N	265	ENSP00000381594:K265N	ENSP00000381594:K265N	K	+	3	2	PCDHGB7	140778405	0.000000	0.05858	0.629000	0.29254	0.864000	0.49448	-7.420000	0.00036	-0.214000	0.10078	-0.291000	0.09656	AAG	PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000254122		0.527	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	56	0.00	0	G	NM_018927		140798221	140798221	+1	no_errors	ENST00000398594	ensembl	human	known	69_37n	missense	40	23.08	12	SNP	0.000	T
PCDHGB7	56099	genome.wustl.edu	37	5	140798221	140798221	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr5:140798221G>T	ENST00000398594.2	+	1	795	c.795G>T	c.(793-795)aaG>aaT	p.K265N	PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB6_ENST00000520790.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	265	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGAGTGAAGGCCACTGACC	0.527																																						dbGAP											0													61.0	63.0	62.0					5																	140798221		2053	4195	6248	-	-	-	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.795G>T	5.37:g.140798221G>T	ENSP00000381594:p.Lys265Asn		Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.K265N	ENST00000398594.2	37	c.795	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	0.053	-1.243891	0.01481	.	.	ENSG00000254122	ENST00000398594	T	0.51071	0.72	5.7	-4.01	0.04045	Cadherin (5);Cadherin-like (1);	172.624000	0.01226	U	0.008237	T	0.22244	0.0536	N	0.12853	0.265	0.18873	N	0.999987	B;B	0.30179	0.271;0.077	B;B	0.33121	0.158;0.098	T	0.18840	-1.0324	10	0.02654	T	1	.	1.2733	0.02025	0.1673:0.2609:0.2112:0.3606	.	265;265	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	N	265	ENSP00000381594:K265N	ENSP00000381594:K265N	K	+	3	2	PCDHGB7	140778405	0.000000	0.05858	0.629000	0.29254	0.864000	0.49448	-7.420000	0.00036	-0.214000	0.10078	-0.291000	0.09656	AAG	PCDHGB7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000254122		0.527	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	64	0.00	0	G	NM_018927		140798221	140798221	+1	no_errors	ENST00000398594	ensembl	human	known	69_37n	missense	40	23.08	12	SNP	0.000	T
PCGF6	84108	genome.wustl.edu	37	10	105110525	105110527	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr10:105110525_105110527delTCC	ENST00000369847.3	-	1	364_366	c.297_299delGGA	c.(295-300)gaggac>gac	p.E99del	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_In_Frame_Del_p.E99del	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	99	Glu-rich.				negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		GTGACTCATGtcctcctcctcct	0.65																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.297_299delGGA	10.37:g.105110534_105110536delTCC	ENSP00000358862:p.Glu99del		A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	In_Frame_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.E99in_frame_del	ENST00000369847.3	37	c.299_297	CCDS31275.1	10																																																																																			PCGF6	-	NULL	ENSG00000156374		0.650	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF6	HGNC	protein_coding	OTTHUMT00000050132.1	133	0.00	0	TCC	NM_032154		105110525	105110527	-1	no_errors	ENST00000369847	ensembl	human	known	69_37n	in_frame_del	88	45.78	76	DEL	0.531:0.557:0.476	-
PCGF6	84108	genome.wustl.edu	37	10	105110525	105110527	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr10:105110525_105110527delTCC	ENST00000369847.3	-	1	364_366	c.297_299delGGA	c.(295-300)gaggac>gac	p.E99del	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_In_Frame_Del_p.E99del	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	99	Glu-rich.				negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		GTGACTCATGtcctcctcctcct	0.65																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.297_299delGGA	10.37:g.105110534_105110536delTCC	ENSP00000358862:p.Glu99del		A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	In_Frame_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.E99in_frame_del	ENST00000369847.3	37	c.299_297	CCDS31275.1	10																																																																																			PCGF6	-	NULL	ENSG00000156374		0.650	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF6	HGNC	protein_coding	OTTHUMT00000050132.1	75	0.00	0	TCC	NM_032154		105110525	105110527	-1	no_errors	ENST00000369847	ensembl	human	known	69_37n	in_frame_del	88	45.78	76	DEL	0.531:0.557:0.476	-
PCSK7	9159	genome.wustl.edu	37	11	117076708	117076708	+	3'UTR	SNP	T	T	C	rs35186251	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr11:117076708T>C	ENST00000320934.3	-	0	2993				PCSK7_ENST00000529458.1_5'UTR|PCSK7_ENST00000540028.1_3'UTR	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7						peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		TGTCAGGCCCTGAGGTCAGCA	0.557			T	IGH@	MLCLS								T|||	2552	0.509585	0.6195	0.3617	5008	,	,		22113	0.6349		0.2634	False		,,,				2504	0.59					dbGAP		Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0													4.0	5.0	5.0					11																	117076708		1891	3885	5776	-	-	-	SO:0001624	3_prime_UTR_variant	0			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.*5A>G	11.37:g.117076708T>C			B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	RNA	SNP	-	NULL	ENST00000320934.3	37	NULL	CCDS8382.1	11																																																																																			PCSK7	-	-	ENSG00000160613		0.557	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	9	0.00	0	T	NM_004716		117076708	117076708	-1	no_errors	ENST00000529458	ensembl	human	known	69_37n	rna	12	40.00	8	SNP	0.001	C
PDE1B	5153	genome.wustl.edu	37	12	54955324	54955324	+	Intron	SNP	T	T	C	rs10747699	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr12:54955324T>C	ENST00000243052.3	+	3	549				PDE1B_ENST00000550620.1_5'UTR|PDE1B_ENST00000394277.3_3'UTR|PDE1B_ENST00000538346.1_Intron	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTGGGGCTCCTGGGGTCAGGA	0.557													C|||	3035	0.60603	0.4539	0.6326	5008	,	,		16202	0.6121		0.6928	False		,,,				2504	0.6973					dbGAP											0													22.0	21.0	21.0					12																	54955324		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.114-5434T>C	12.37:g.54955324T>C			Q92825|Q96KP3	RNA	SNP	-	NULL	ENST00000243052.3	37	NULL	CCDS8882.1	12																																																																																			PDE1B	-	-	ENSG00000123360		0.557	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	HGNC	protein_coding	OTTHUMT00000406203.1	42	0.00	0	T			54955324	54955324	+1	no_errors	ENST00000394277	ensembl	human	known	69_37n	rna	71	10.13	8	SNP	0.000	C
NPY4R	5540	genome.wustl.edu	37	10	47087803	47087803	+	Frame_Shift_Del	DEL	C	C	-	rs551101246		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr10:47087803delC	ENST00000395716.1	+	2	1105	c.1020delC	c.(1018-1020)tgcfs	p.C340fs	NPY4R_ENST00000374312.1_Frame_Shift_Del_p.C340fs			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	340					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										TGCTGACTTGCCAGCAGAGCG	0.572																																						dbGAP											0													139.0	139.0	139.0					10																	47087803		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.1020delC	10.37:g.47087803delC	ENSP00000379066:p.Cys340fs		Q13456|Q5ISU3|Q5T2X9|Q6FH06	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_NPY4_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.Q341fs	ENST00000395716.1	37	c.1020	CCDS31193.1	10																																																																																			PPYR1	-	NULL	ENSG00000204174		0.572	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPYR1	HGNC	protein_coding	OTTHUMT00000047837.1	188	0.00	0	C			47087803	47087803	+1	no_errors	ENST00000374312	ensembl	human	known	69_37n	frame_shift_del	275	18.90	65	DEL	1.000	-
NPY4R	5540	genome.wustl.edu	37	10	47087803	47087803	+	Frame_Shift_Del	DEL	C	C	-	rs551101246		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr10:47087803delC	ENST00000395716.1	+	2	1105	c.1020delC	c.(1018-1020)tgcfs	p.C340fs	NPY4R_ENST00000374312.1_Frame_Shift_Del_p.C340fs			P50391	NPY4R_HUMAN	neuropeptide Y receptor Y4	340					blood circulation (GO:0008015)|digestion (GO:0007586)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|pancreatic polypeptide receptor activity (GO:0001602)|peptide binding (GO:0042277)|peptide YY receptor activity (GO:0001601)										TGCTGACTTGCCAGCAGAGCG	0.572																																						dbGAP											0													139.0	139.0	139.0					10																	47087803		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS73100.1	10q11.2	2013-03-26	2013-03-26	2013-03-26	ENSG00000204174	ENSG00000204174		"""GPCR / Class A : Neuropeptide receptors : Y"""	9329	protein-coding gene	gene with protein product		601790	"""pancreatic polypeptide receptor 1"""	PPYR1		9417917	Standard	NM_005972		Approved	Y4, PP1	uc001jee.3	P50391	OTTHUMG00000018108	ENST00000395716.1:c.1020delC	10.37:g.47087803delC	ENSP00000379066:p.Cys340fs		Q13456|Q5ISU3|Q5T2X9|Q6FH06	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_NPY4_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.Q341fs	ENST00000395716.1	37	c.1020	CCDS31193.1	10																																																																																			PPYR1	-	NULL	ENSG00000204174		0.572	NPY4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPYR1	HGNC	protein_coding	OTTHUMT00000047837.1	153	0.00	0	C			47087803	47087803	+1	no_errors	ENST00000374312	ensembl	human	known	69_37n	frame_shift_del	275	18.90	65	DEL	1.000	-
PROC	5624	genome.wustl.edu	37	2	128178906	128178906	+	Missense_Mutation	SNP	C	C	T	rs199514227		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr2:128178906C>T	ENST00000234071.3	+	3	205	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	MIR4783_ENST00000580343.1_RNA|PROC_ENST00000422777.3_Missense_Mutation_p.R40C|PROC_ENST00000453608.2_Missense_Mutation_p.R61C|PROC_ENST00000409048.1_Missense_Mutation_p.R40C	NM_000312.3	NP_000303.1	P04070	PROC_HUMAN	protein C (inactivator of coagulation factors Va and VIIIa)	40					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood coagulation (GO:0030195)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0673)	Antihemophilic Factor(DB00025)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	GCTGCGGATCCGCAAACGTGC	0.602																																						dbGAP											0			GRCh37	CD962129|CM941178	PROC	D|M							84.0	75.0	78.0					2																	128178906		2203	4300	6503	-	-	-	SO:0001583	missense	0			X02750	CCDS2145.1	2q13-q14	2014-01-30			ENSG00000115718	ENSG00000115718		"""Endogenous ligands"""	9451	protein-coding gene	gene with protein product	"""prepro-protein C"""	612283				2991887, 2437584	Standard	NM_000312		Approved		uc002tok.3	P04070	OTTHUMG00000131528	ENST00000234071.3:c.118C>T	2.37:g.128178906C>T	ENSP00000234071:p.Arg40Cys		B4DPQ7|Q15189|Q15190|Q16001|Q53S74|Q9UC55	Missense_Mutation	SNP	pirsf_Pept_S1A_FX,pfam_Peptidase_S1_S6,pfam_GLA_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,prints_GLA_domain,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1_S6	p.R61C	ENST00000234071.3	37	c.181	CCDS2145.1	2	.	.	.	.	.	.	.	.	.	.	C	15.26	2.779543	0.49891	.	.	ENSG00000115718	ENST00000234071;ENST00000429925;ENST00000442644;ENST00000453608;ENST00000427769;ENST00000409048;ENST00000422777	D;D;D;D;D;D;D	0.99706	-3.08;-5.96;-6.47;-3.15;-5.66;-3.14;-3.08	4.73	4.73	0.59995	Gamma-carboxyglutamic acid-rich (GLA) domain (1);	1.038910	0.07697	N	0.939616	D	0.99625	0.9863	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;0.995;0.998;0.999	P;P;P;P	0.61592	0.891;0.513;0.724;0.789	D	0.98134	1.0432	10	0.56958	D	0.05	.	17.7067	0.88310	0.0:1.0:0.0:0.0	.	61;61;40;40	B4DPQ7;B4DPQ3;E7END6;P04070	.;.;.;PROC_HUMAN	C	40;40;40;61;40;40;40	ENSP00000234071:R40C;ENSP00000412697:R40C;ENSP00000411241:R40C;ENSP00000404030:R61C;ENSP00000406295:R40C;ENSP00000386679:R40C;ENSP00000409543:R40C	ENSP00000234071:R40C	R	+	1	0	PROC	127895376	0.009000	0.17119	0.107000	0.21349	0.318000	0.28184	1.388000	0.34442	2.162000	0.67917	0.491000	0.48974	CGC	PROC	-	pirsf_Pept_S1A_FX,smart_GLA_domain	ENSG00000115718		0.602	PROC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROC	HGNC	protein_coding	OTTHUMT00000254385.2	24	0.00	0	C	NM_000312		128178906	128178906	+1	no_errors	ENST00000453608	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.881	T
R3HDM1	23518	genome.wustl.edu	37	2	136379141	136379141	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr2:136379141delG	ENST00000264160.4	+	6	751	c.381delG	c.(379-381)aagfs	p.K127fs	R3HDM1_ENST00000409478.1_Frame_Shift_Del_p.K83fs|R3HDM1_ENST00000410054.1_Frame_Shift_Del_p.K71fs|R3HDM1_ENST00000329971.3_Frame_Shift_Del_p.K83fs|R3HDM1_ENST00000409606.1_Frame_Shift_Del_p.K127fs	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	127							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		AAAAAGAAAAGGCCAGTGATA	0.333																																						dbGAP											0													78.0	86.0	83.0					2																	136379141		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.381delG	2.37:g.136379141delG	ENSP00000264160:p.Lys127fs		A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Frame_Shift_Del	DEL	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.A128fs	ENST00000264160.4	37	c.381	CCDS2177.1	2																																																																																			R3HDM1	-	NULL	ENSG00000048991		0.333	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM1	HGNC	protein_coding	OTTHUMT00000254659.1	73	0.00	0	G	NM_015361		136379141	136379141	+1	no_errors	ENST00000264160	ensembl	human	known	69_37n	frame_shift_del	83	10.53	10	DEL	1.000	-
R3HDM1	23518	genome.wustl.edu	37	2	136379141	136379141	+	Frame_Shift_Del	DEL	G	G	-			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr2:136379141delG	ENST00000264160.4	+	6	751	c.381delG	c.(379-381)aagfs	p.K127fs	R3HDM1_ENST00000409478.1_Frame_Shift_Del_p.K83fs|R3HDM1_ENST00000410054.1_Frame_Shift_Del_p.K71fs|R3HDM1_ENST00000329971.3_Frame_Shift_Del_p.K83fs|R3HDM1_ENST00000409606.1_Frame_Shift_Del_p.K127fs	NM_001282798.1|NM_015361.2	NP_001269727.1|NP_056176.2	Q15032	R3HD1_HUMAN	R3H domain containing 1	127							poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(6)|kidney(5)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	38				BRCA - Breast invasive adenocarcinoma(221;0.127)		AAAAAGAAAAGGCCAGTGATA	0.333																																						dbGAP											0													78.0	86.0	83.0					2																	136379141		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			D21852	CCDS2177.1, CCDS63024.1, CCDS63025.1, CCDS63026.1	2q21.3	2012-09-20	2005-09-02	2005-09-02	ENSG00000048991	ENSG00000048991			9757	protein-coding gene	gene with protein product			"""R3H domain (binds single-stranded nucleic acids) containing"""	R3HDM		7584026	Standard	NM_001282798		Approved	KIAA0029	uc002tuo.3	Q15032	OTTHUMG00000131740	ENST00000264160.4:c.381delG	2.37:g.136379141delG	ENSP00000264160:p.Lys127fs		A8K1V0|B3KXQ9|E9PBB4|E9PG42|G5E9G8|Q8IW32	Frame_Shift_Del	DEL	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.A128fs	ENST00000264160.4	37	c.381	CCDS2177.1	2																																																																																			R3HDM1	-	NULL	ENSG00000048991		0.333	R3HDM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM1	HGNC	protein_coding	OTTHUMT00000254659.1	71	0.00	0	G	NM_015361		136379141	136379141	+1	no_errors	ENST00000264160	ensembl	human	known	69_37n	frame_shift_del	83	10.53	10	DEL	1.000	-
RAD21L1	642636	genome.wustl.edu	37	20	1218796	1218796	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr20:1218796G>A	ENST00000409241.1	+	6	677	c.584G>A	c.(583-585)cGa>cAa	p.R195Q	RAD21L1_ENST00000381882.2_Missense_Mutation_p.R195Q|RAD21L1_ENST00000402452.1_Missense_Mutation_p.R195Q	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	195					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						ACTGGAGAACGATCTCTATTC	0.378																																						dbGAP											0													126.0	110.0	115.0					20																	1218796		692	1591	2283	-	-	-	SO:0001583	missense	0			AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.584G>A	20.37:g.1218796G>A	ENSP00000386414:p.Arg195Gln		B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.R195Q	ENST00000409241.1	37	c.584	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899145	0.33535	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	T;T;T	0.41758	0.99;0.99;0.99	5.24	1.79	0.24919	.	.	.	.	.	T	0.16385	0.0394	N	0.03608	-0.345	0.23204	N	0.998128	B	0.14438	0.01	B	0.10450	0.005	T	0.27905	-1.0060	9	0.16896	T	0.51	.	4.2042	0.10481	0.687:0.0:0.1649:0.1481	.	195	Q9H4I0	RD21L_HUMAN	Q	195	ENSP00000385925:R195Q;ENSP00000386414:R195Q;ENSP00000371306:R195Q	ENSP00000371306:R195Q	R	+	2	0	RAD21L1	1166796	0.854000	0.29725	0.560000	0.28344	0.503000	0.33858	1.542000	0.36137	0.121000	0.18284	-0.302000	0.09304	CGA	RAD21L1	-	NULL	ENSG00000244588		0.378	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	HGNC	protein_coding	OTTHUMT00000334022.1	61	0.00	0	G			1218796	1218796	+1	no_errors	ENST00000409241	ensembl	human	known	69_37n	missense	112	11.81	15	SNP	0.793	A
RAD21L1	642636	genome.wustl.edu	37	20	1218796	1218796	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr20:1218796G>A	ENST00000409241.1	+	6	677	c.584G>A	c.(583-585)cGa>cAa	p.R195Q	RAD21L1_ENST00000381882.2_Missense_Mutation_p.R195Q|RAD21L1_ENST00000402452.1_Missense_Mutation_p.R195Q	NM_001136566.2	NP_001130038.2	Q9H4I0	RD21L_HUMAN	RAD21-like 1 (S. pombe)	195					attachment of telomeric heterochromatin to nuclear envelope (GO:0070197)|chromosome segregation (GO:0007059)|double-strand break repair via homologous recombination (GO:0000724)|fertilization (GO:0009566)|linear element assembly (GO:0030999)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleus (GO:0005634)				NS(1)|breast(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	7						ACTGGAGAACGATCTCTATTC	0.378																																						dbGAP											0													126.0	110.0	115.0					20																	1218796		692	1591	2283	-	-	-	SO:0001583	missense	0			AL031665	CCDS46568.1	20p13	2011-08-12			ENSG00000244588	ENSG00000244588			16271	protein-coding gene	gene with protein product							Standard	NM_001136566		Approved	dJ545L17.2, RAD21L	uc010gab.1	Q9H4I0	OTTHUMG00000031664	ENST00000409241.1:c.584G>A	20.37:g.1218796G>A	ENSP00000386414:p.Arg195Gln		B2RXL0|B7ZBB1|B7ZW76|Q5W0X5	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu	p.R195Q	ENST00000409241.1	37	c.584	CCDS46568.1	20	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899145	0.33535	.	.	ENSG00000244588	ENST00000402452;ENST00000409241;ENST00000381882	T;T;T	0.41758	0.99;0.99;0.99	5.24	1.79	0.24919	.	.	.	.	.	T	0.16385	0.0394	N	0.03608	-0.345	0.23204	N	0.998128	B	0.14438	0.01	B	0.10450	0.005	T	0.27905	-1.0060	9	0.16896	T	0.51	.	4.2042	0.10481	0.687:0.0:0.1649:0.1481	.	195	Q9H4I0	RD21L_HUMAN	Q	195	ENSP00000385925:R195Q;ENSP00000386414:R195Q;ENSP00000371306:R195Q	ENSP00000371306:R195Q	R	+	2	0	RAD21L1	1166796	0.854000	0.29725	0.560000	0.28344	0.503000	0.33858	1.542000	0.36137	0.121000	0.18284	-0.302000	0.09304	CGA	RAD21L1	-	NULL	ENSG00000244588		0.378	RAD21L1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21L1	HGNC	protein_coding	OTTHUMT00000334022.1	54	0.00	0	G			1218796	1218796	+1	no_errors	ENST00000409241	ensembl	human	known	69_37n	missense	112	11.81	15	SNP	0.793	A
RGR	5995	genome.wustl.edu	37	10	86017648	86017648	+	Splice_Site	SNP	G	G	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr10:86017648G>T	ENST00000359452.4	+	6	680		c.e6-1		RGR_ENST00000479725.1_Splice_Site|RGR_ENST00000358110.5_Intron	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor						chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						TTTCTCCCCAGGTAAACACCA	0.587																																					NSCLC(15;204 545 5889 6385 32445)	dbGAP											0													70.0	64.0	66.0					10																	86017648		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.643-1G>T	10.37:g.86017648G>T			A6NKK7|Q96FC5	Splice_Site	SNP	-	e6-1	ENST00000359452.4	37	c.643-1	CCDS7374.1	10	.	.	.	.	.	.	.	.	.	.	G	11.30	1.596696	0.28445	.	.	ENSG00000148604	ENST00000359452	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8047	0.85623	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RGR	86007628	1.000000	0.71417	0.999000	0.59377	0.081000	0.17604	8.081000	0.89511	2.423000	0.82170	0.655000	0.94253	.	RGR	-	-	ENSG00000148604		0.587	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	HGNC	protein_coding	OTTHUMT00000049116.1	29	0.00	0	G	NM_002921	Intron	86017648	86017648	+1	no_errors	ENST00000359452	ensembl	human	known	69_37n	splice_site	35	10.26	4	SNP	1.000	T
RGR	5995	genome.wustl.edu	37	10	86017648	86017648	+	Splice_Site	SNP	G	G	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr10:86017648G>T	ENST00000359452.4	+	6	680		c.e6-1		RGR_ENST00000479725.1_Splice_Site|RGR_ENST00000358110.5_Intron	NM_001012720.1|NM_002921.3	NP_001012738.1|NP_002912.2	P47804	RGR_HUMAN	retinal G protein coupled receptor						chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	17						TTTCTCCCCAGGTAAACACCA	0.587																																					NSCLC(15;204 545 5889 6385 32445)	dbGAP											0													70.0	64.0	66.0					10																	86017648		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC011349	CCDS7374.1, CCDS41543.1	10q23	2013-02-14			ENSG00000148604	ENSG00000148604		"""GPCR / Class A : Opsin receptors"""	9990	protein-coding gene	gene with protein product	"""RGR-opsin"""	600342				8641686	Standard	NM_002921		Approved	RP44	uc001kdd.1	P47804	OTTHUMG00000018636	ENST00000359452.4:c.643-1G>T	10.37:g.86017648G>T			A6NKK7|Q96FC5	Splice_Site	SNP	-	e6-1	ENST00000359452.4	37	c.643-1	CCDS7374.1	10	.	.	.	.	.	.	.	.	.	.	G	11.30	1.596696	0.28445	.	.	ENSG00000148604	ENST00000359452	.	.	.	4.48	4.48	0.54585	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8047	0.85623	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RGR	86007628	1.000000	0.71417	0.999000	0.59377	0.081000	0.17604	8.081000	0.89511	2.423000	0.82170	0.655000	0.94253	.	RGR	-	-	ENSG00000148604		0.587	RGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGR	HGNC	protein_coding	OTTHUMT00000049116.1	33	0.00	0	G	NM_002921	Intron	86017648	86017648	+1	no_errors	ENST00000359452	ensembl	human	known	69_37n	splice_site	35	10.26	4	SNP	1.000	T
RHPN1	114822	genome.wustl.edu	37	8	144462047	144462047	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr8:144462047G>A	ENST00000289013.6	+	9	1095	c.994G>A	c.(994-996)Gtc>Atc	p.V332I		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	332	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CCAGCCACCCGTCCACGACTA	0.667																																						dbGAP											0													41.0	51.0	47.0					8																	144462047		2127	4231	6358	-	-	-	SO:0001583	missense	0			AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.994G>A	8.37:g.144462047G>A	ENSP00000289013:p.Val332Ile		Q8TAV1|Q96PV9	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,pfam_PDZ,superfamily_PDZ,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom,pfscan_PDZ	p.V332I	ENST00000289013.6	37	c.994	CCDS47927.1	8	.	.	.	.	.	.	.	.	.	.	G	9.585	1.124726	0.20959	.	.	ENSG00000158106	ENST00000289013	T	0.17528	2.27	4.53	2.65	0.31530	.	0.326292	0.29198	N	0.012860	T	0.14141	0.0342	L	0.45581	1.43	0.28958	N	0.890019	B	0.26147	0.143	B	0.23018	0.043	T	0.11299	-1.0593	10	0.37606	T	0.19	-22.5668	8.6557	0.34062	0.0864:0.1527:0.7608:0.0	.	332	Q8TCX5-2	.	I	332	ENSP00000289013:V332I	ENSP00000289013:V332I	V	+	1	0	RHPN1	144533190	0.998000	0.40836	0.001000	0.08648	0.157000	0.22087	2.829000	0.48128	0.308000	0.22923	0.511000	0.50034	GTC	RHPN1	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000158106		0.667	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN1	HGNC	protein_coding	OTTHUMT00000381417.1	94	0.00	0	G			144462047	144462047	+1	no_errors	ENST00000289013	ensembl	human	known	69_37n	missense	180	18.55	41	SNP	0.694	A
RHPN1	114822	genome.wustl.edu	37	8	144462047	144462047	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr8:144462047G>A	ENST00000289013.6	+	9	1095	c.994G>A	c.(994-996)Gtc>Atc	p.V332I		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	332	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CCAGCCACCCGTCCACGACTA	0.667																																						dbGAP											0													41.0	51.0	47.0					8																	144462047		2127	4231	6358	-	-	-	SO:0001583	missense	0			AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.994G>A	8.37:g.144462047G>A	ENSP00000289013:p.Val332Ile		Q8TAV1|Q96PV9	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,pfam_PDZ,superfamily_PDZ,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom,pfscan_PDZ	p.V332I	ENST00000289013.6	37	c.994	CCDS47927.1	8	.	.	.	.	.	.	.	.	.	.	G	9.585	1.124726	0.20959	.	.	ENSG00000158106	ENST00000289013	T	0.17528	2.27	4.53	2.65	0.31530	.	0.326292	0.29198	N	0.012860	T	0.14141	0.0342	L	0.45581	1.43	0.28958	N	0.890019	B	0.26147	0.143	B	0.23018	0.043	T	0.11299	-1.0593	10	0.37606	T	0.19	-22.5668	8.6557	0.34062	0.0864:0.1527:0.7608:0.0	.	332	Q8TCX5-2	.	I	332	ENSP00000289013:V332I	ENSP00000289013:V332I	V	+	1	0	RHPN1	144533190	0.998000	0.40836	0.001000	0.08648	0.157000	0.22087	2.829000	0.48128	0.308000	0.22923	0.511000	0.50034	GTC	RHPN1	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000158106		0.667	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN1	HGNC	protein_coding	OTTHUMT00000381417.1	160	0.00	0	G			144462047	144462047	+1	no_errors	ENST00000289013	ensembl	human	known	69_37n	missense	180	18.55	41	SNP	0.694	A
RPL23AP7	118433	genome.wustl.edu	37	2	114369629	114369629	+	RNA	SNP	G	G	T	rs112337169	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr2:114369629G>T	ENST00000416673.2	-	0	527					NR_000029.3				ribosomal protein L23a pseudogene 7																		GTTTCTCCTGGGGGTGCTCTT	0.532																																						dbGAP											0																																										-	-	-			0			BC000596		2q14	2009-03-11				ENSG00000240356		"""L ribosomal proteins"""	17336	pseudogene	pseudogene						19123937	Standard	NR_000029		Approved	RPL23AL1, bA395L14.9	uc010yxy.1				2.37:g.114369629G>T				RNA	SNP	-	NULL	ENST00000416673.2	37	NULL		2																																																																																			AL078621.11	-	-	ENSG00000240356		0.532	RPL23AP7-003	KNOWN	basic	processed_transcript	RPL23AP7	Clone_based_vega_gene	pseudogene	OTTHUMT00000397215.1	18	0.00	0	G			114369629	114369629	-1	no_errors	ENST00000391616	ensembl	human	known	69_37n	rna	12	29.41	5	SNP	1.000	T
SFRP1	6422	genome.wustl.edu	37	8	41122697	41122697	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr8:41122697C>T	ENST00000220772.3	-	3	1271	c.934G>A	c.(934-936)Gtg>Atg	p.V312M	SFRP1_ENST00000379845.3_Missense_Mutation_p.V176M	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	312					bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			CACTTAAACACGGACTGAAAG	0.572																																						dbGAP											0													32.0	26.0	28.0					8																	41122697		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.934G>A	8.37:g.41122697C>T	ENSP00000220772:p.Val312Met		O00546|O14779	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.V312M	ENST00000220772.3	37	c.934	CCDS34886.1	8	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485431	0.44147	.	.	ENSG00000104332	ENST00000220772;ENST00000379845;ENST00000535263	T	0.68765	-0.35	4.89	4.89	0.63831	.	0.146689	0.45606	D	0.000359	T	0.67230	0.2871	L	0.43923	1.385	0.49582	D	0.999802	D	0.63880	0.993	P	0.53224	0.721	T	0.69453	-0.5141	10	0.62326	D	0.03	.	10.8504	0.46767	0.0:0.9104:0.0:0.0896	.	312	Q8N474	SFRP1_HUMAN	M	312;176;312	ENSP00000220772:V312M	ENSP00000220772:V312M	V	-	1	0	SFRP1	41241854	0.992000	0.36948	0.963000	0.40424	0.025000	0.11179	2.995000	0.49441	2.546000	0.85860	0.563000	0.77884	GTG	SFRP1	-	NULL	ENSG00000104332		0.572	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP1	HGNC	protein_coding	OTTHUMT00000377132.1	37	0.00	0	C	NM_003012		41122697	41122697	-1	no_errors	ENST00000220772	ensembl	human	known	69_37n	missense	68	20.93	18	SNP	0.951	T
SFRP1	6422	genome.wustl.edu	37	8	41122697	41122697	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr8:41122697C>T	ENST00000220772.3	-	3	1271	c.934G>A	c.(934-936)Gtg>Atg	p.V312M	SFRP1_ENST00000379845.3_Missense_Mutation_p.V176M	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	312					bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			CACTTAAACACGGACTGAAAG	0.572																																						dbGAP											0													32.0	26.0	28.0					8																	41122697		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.934G>A	8.37:g.41122697C>T	ENSP00000220772:p.Val312Met		O00546|O14779	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.V312M	ENST00000220772.3	37	c.934	CCDS34886.1	8	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485431	0.44147	.	.	ENSG00000104332	ENST00000220772;ENST00000379845;ENST00000535263	T	0.68765	-0.35	4.89	4.89	0.63831	.	0.146689	0.45606	D	0.000359	T	0.67230	0.2871	L	0.43923	1.385	0.49582	D	0.999802	D	0.63880	0.993	P	0.53224	0.721	T	0.69453	-0.5141	10	0.62326	D	0.03	.	10.8504	0.46767	0.0:0.9104:0.0:0.0896	.	312	Q8N474	SFRP1_HUMAN	M	312;176;312	ENSP00000220772:V312M	ENSP00000220772:V312M	V	-	1	0	SFRP1	41241854	0.992000	0.36948	0.963000	0.40424	0.025000	0.11179	2.995000	0.49441	2.546000	0.85860	0.563000	0.77884	GTG	SFRP1	-	NULL	ENSG00000104332		0.572	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP1	HGNC	protein_coding	OTTHUMT00000377132.1	42	0.00	0	C	NM_003012		41122697	41122697	-1	no_errors	ENST00000220772	ensembl	human	known	69_37n	missense	68	20.93	18	SNP	0.951	T
SHISA9	729993	genome.wustl.edu	37	16	13297377	13297377	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr16:13297377T>C	ENST00000424107.3	+	3	1263	c.818T>C	c.(817-819)cTc>cCc	p.L273P	AC009134.1_ENST00000571939.1_RNA|SHISA9_ENST00000558583.1_Missense_Mutation_p.L314P			B4DS77	SHSA9_HUMAN	shisa family member 9	273					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						GGAAAAGAGCTCAACAAGTAC	0.527																																						dbGAP											0													180.0	166.0	170.0					16																	13297377		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.818T>C	16.37:g.13297377T>C	ENSP00000407958:p.Leu273Pro		C9J314|C9JCE9	Missense_Mutation	SNP	NULL	p.L314P	ENST00000424107.3	37	c.941	CCDS45417.2	16	.	.	.	.	.	.	.	.	.	.	T	17.87	3.493954	0.64186	.	.	ENSG00000237515	ENST00000424107	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	T	0.41789	0.1174	L	0.41710	1.295	0.80722	D	1	P	0.42409	0.779	B	0.32149	0.141	T	0.49273	-0.8957	8	0.72032	D	0.01	.	14.7375	0.69427	0.0:0.0:0.0:1.0	.	273	B4DS77	SHSA9_HUMAN	P	314	.	ENSP00000407958:L314P	L	+	2	0	SHISA9	13204878	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.502000	0.66956	2.155000	0.67459	0.450000	0.29827	CTC	SHISA9	-	NULL	ENSG00000237515		0.527	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	54	0.00	0	T	NM_001145204		13297377	13297377	+1	no_errors	ENST00000558583	ensembl	human	known	69_37n	missense	24	53.85	28	SNP	1.000	C
SHISA9	729993	genome.wustl.edu	37	16	13297377	13297377	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr16:13297377T>C	ENST00000424107.3	+	3	1263	c.818T>C	c.(817-819)cTc>cCc	p.L273P	AC009134.1_ENST00000571939.1_RNA|SHISA9_ENST00000558583.1_Missense_Mutation_p.L314P			B4DS77	SHSA9_HUMAN	shisa family member 9	273					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						GGAAAAGAGCTCAACAAGTAC	0.527																																						dbGAP											0													180.0	166.0	170.0					16																	13297377		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.818T>C	16.37:g.13297377T>C	ENSP00000407958:p.Leu273Pro		C9J314|C9JCE9	Missense_Mutation	SNP	NULL	p.L314P	ENST00000424107.3	37	c.941	CCDS45417.2	16	.	.	.	.	.	.	.	.	.	.	T	17.87	3.493954	0.64186	.	.	ENSG00000237515	ENST00000424107	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	T	0.41789	0.1174	L	0.41710	1.295	0.80722	D	1	P	0.42409	0.779	B	0.32149	0.141	T	0.49273	-0.8957	8	0.72032	D	0.01	.	14.7375	0.69427	0.0:0.0:0.0:1.0	.	273	B4DS77	SHSA9_HUMAN	P	314	.	ENSP00000407958:L314P	L	+	2	0	SHISA9	13204878	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.502000	0.66956	2.155000	0.67459	0.450000	0.29827	CTC	SHISA9	-	NULL	ENSG00000237515		0.527	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	42	0.00	0	T	NM_001145204		13297377	13297377	+1	no_errors	ENST00000558583	ensembl	human	known	69_37n	missense	24	53.85	28	SNP	1.000	C
SIX3	6496	genome.wustl.edu	37	2	45169910	45169910	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr2:45169910G>T	ENST00000260653.3	+	1	1009	c.667G>T	c.(667-669)Gag>Tag	p.E223*	SIX3-AS1_ENST00000419364.1_RNA|SIX3-AS1_ENST00000456467.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	223					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)	p.E223Q(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCTGTTGCGGGAGTGGTACCT	0.607																																						dbGAP											1	Substitution - Missense(1)	lung(1)											31.0	34.0	33.0					2																	45169910		2180	4246	6426	-	-	-	SO:0001587	stop_gained	0			AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.667G>T	2.37:g.45169910G>T	ENSP00000260653:p.Glu223*		D6W5A5|Q53T42	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.E223*	ENST00000260653.3	37	c.667	CCDS1821.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.567291	0.98361	.	.	ENSG00000138083	ENST00000260653	.	.	.	3.41	3.41	0.39046	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	14.5902	0.68359	0.0:0.0:1.0:0.0	.	.	.	.	X	223	.	ENSP00000260653:E223X	E	+	1	0	SIX3	45023414	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	9.274000	0.95731	1.729000	0.51567	0.484000	0.47621	GAG	SIX3	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000138083		0.607	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX3	HGNC	protein_coding	OTTHUMT00000326192.1	52	0.00	0	G	NM_005413		45169910	45169910	+1	no_errors	ENST00000260653	ensembl	human	known	69_37n	nonsense	68	20.00	17	SNP	1.000	T
SIX3	6496	genome.wustl.edu	37	2	45169910	45169910	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr2:45169910G>T	ENST00000260653.3	+	1	1009	c.667G>T	c.(667-669)Gag>Tag	p.E223*	SIX3-AS1_ENST00000419364.1_RNA|SIX3-AS1_ENST00000456467.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	223					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)	p.E223Q(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCTGTTGCGGGAGTGGTACCT	0.607																																						dbGAP											1	Substitution - Missense(1)	lung(1)											31.0	34.0	33.0					2																	45169910		2180	4246	6426	-	-	-	SO:0001587	stop_gained	0			AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.667G>T	2.37:g.45169910G>T	ENSP00000260653:p.Glu223*		D6W5A5|Q53T42	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.E223*	ENST00000260653.3	37	c.667	CCDS1821.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.567291	0.98361	.	.	ENSG00000138083	ENST00000260653	.	.	.	3.41	3.41	0.39046	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	14.5902	0.68359	0.0:0.0:1.0:0.0	.	.	.	.	X	223	.	ENSP00000260653:E223X	E	+	1	0	SIX3	45023414	1.000000	0.71417	1.000000	0.80357	0.849000	0.48306	9.274000	0.95731	1.729000	0.51567	0.484000	0.47621	GAG	SIX3	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000138083		0.607	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX3	HGNC	protein_coding	OTTHUMT00000326192.1	80	0.00	0	G	NM_005413		45169910	45169910	+1	no_errors	ENST00000260653	ensembl	human	known	69_37n	nonsense	68	20.00	17	SNP	1.000	T
SLAMF9	89886	genome.wustl.edu	37	1	159923336	159923336	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr1:159923336T>A	ENST00000368093.3	-	2	270	c.154A>T	c.(154-156)Aac>Tac	p.N52Y	SLAMF9_ENST00000466773.1_5'Flank|SLAMF9_ENST00000368092.3_Missense_Mutation_p.N52Y	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	52	Ig-like V-type.					integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGATGATGTTCTCAACCTCT	0.537																																						dbGAP											0													161.0	145.0	151.0					1																	159923336		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.154A>T	1.37:g.159923336T>A	ENSP00000357072:p.Asn52Tyr		Q5JRQ9|Q5JRR0|Q6UWG1	Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.N52Y	ENST00000368093.3	37	c.154	CCDS1191.1	1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.277861	0.40294	.	.	ENSG00000162723	ENST00000368093;ENST00000368092	T;T	0.64438	-0.1;-0.1	5.61	-7.28	0.01456	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.260500	0.05063	N	0.480203	T	0.38241	0.1033	L	0.52905	1.665	0.09310	N	1	P;P	0.45634	0.662;0.863	B;P	0.47162	0.315;0.54	T	0.50591	-0.8810	9	.	.	.	-16.0363	6.8129	0.23814	0.0:0.3629:0.2194:0.4177	.	52;52	Q96A28-2;Q96A28	.;SLAF9_HUMAN	Y	52	ENSP00000357072:N52Y;ENSP00000357071:N52Y	.	N	-	1	0	SLAMF9	158189960	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.476000	0.06591	-1.744000	0.01338	-0.408000	0.06270	AAC	SLAMF9	-	pfam_Ig_V-set	ENSG00000162723		0.537	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF9	HGNC	protein_coding	OTTHUMT00000060630.1	52	0.00	0	T	NM_033438		159923336	159923336	-1	no_errors	ENST00000368093	ensembl	human	known	69_37n	missense	93	13.08	14	SNP	0.000	A
SLAMF9	89886	genome.wustl.edu	37	1	159923336	159923336	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr1:159923336T>A	ENST00000368093.3	-	2	270	c.154A>T	c.(154-156)Aac>Tac	p.N52Y	SLAMF9_ENST00000466773.1_5'Flank|SLAMF9_ENST00000368092.3_Missense_Mutation_p.N52Y	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	52	Ig-like V-type.					integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGATGATGTTCTCAACCTCT	0.537																																						dbGAP											0													161.0	145.0	151.0					1																	159923336		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.154A>T	1.37:g.159923336T>A	ENSP00000357072:p.Asn52Tyr		Q5JRQ9|Q5JRR0|Q6UWG1	Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.N52Y	ENST00000368093.3	37	c.154	CCDS1191.1	1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.277861	0.40294	.	.	ENSG00000162723	ENST00000368093;ENST00000368092	T;T	0.64438	-0.1;-0.1	5.61	-7.28	0.01456	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	1.260500	0.05063	N	0.480203	T	0.38241	0.1033	L	0.52905	1.665	0.09310	N	1	P;P	0.45634	0.662;0.863	B;P	0.47162	0.315;0.54	T	0.50591	-0.8810	9	.	.	.	-16.0363	6.8129	0.23814	0.0:0.3629:0.2194:0.4177	.	52;52	Q96A28-2;Q96A28	.;SLAF9_HUMAN	Y	52	ENSP00000357072:N52Y;ENSP00000357071:N52Y	.	N	-	1	0	SLAMF9	158189960	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.476000	0.06591	-1.744000	0.01338	-0.408000	0.06270	AAC	SLAMF9	-	pfam_Ig_V-set	ENSG00000162723		0.537	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF9	HGNC	protein_coding	OTTHUMT00000060630.1	45	0.00	0	T	NM_033438		159923336	159923336	-1	no_errors	ENST00000368093	ensembl	human	known	69_37n	missense	93	13.08	14	SNP	0.000	A
SLC25A48	153328	genome.wustl.edu	37	5	135223721	135223721	+	Splice_Site	SNP	G	G	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr5:135223721G>T	ENST00000412661.2	+	5	543	c.422G>T	c.(421-423)gGa>gTa	p.G141V		NM_145282.4	NP_660325.4	Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	0					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						CTGTTTCCAGGAGGTGAACAC	0.507											OREG0016806	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													121.0	110.0	113.0					5																	135223721		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0				CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000412661.2:c.422-1G>T	5.37:g.135223721G>T		1616	Q8TAV9	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.G141V	ENST00000412661.2	37	c.422	CCDS43366.2	5	.	.	.	.	.	.	.	.	.	.	G	6.318	0.426730	0.11987	.	.	ENSG00000145832	ENST00000412661	T	0.80738	-1.41	2.94	2.07	0.26955	.	.	.	.	.	T	0.64549	0.2608	.	.	.	0.09310	N	0.999999	B	0.06786	0.001	B	0.12156	0.007	T	0.48917	-0.8992	7	.	.	.	.	5.9704	0.19349	0.1444:0.0:0.8556:0.0	.	141	Q6ZT89-3	.	V	141	ENSP00000413049:G141V	.	G	+	2	0	SLC25A48	135251620	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.341000	0.07811	0.801000	0.34066	-0.140000	0.14226	GGA	SLC25A48	-	superfamily_Mt_carrier_dom	ENSG00000145832		0.507	SLC25A48-003	KNOWN	basic|CCDS	protein_coding	SLC25A48	HGNC	protein_coding	OTTHUMT00000347066.1	89	0.00	0	G	NM_145282	Missense_Mutation	135223721	135223721	+1	no_errors	ENST00000412661	ensembl	human	known	69_37n	missense	125	25.60	43	SNP	0.001	T
SLC25A48	153328	genome.wustl.edu	37	5	135223721	135223721	+	Splice_Site	SNP	G	G	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr5:135223721G>T	ENST00000412661.2	+	5	543	c.422G>T	c.(421-423)gGa>gTa	p.G141V		NM_145282.4	NP_660325.4	Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	0					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						CTGTTTCCAGGAGGTGAACAC	0.507											OREG0016806	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													121.0	110.0	113.0					5																	135223721		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0				CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000412661.2:c.422-1G>T	5.37:g.135223721G>T		1616	Q8TAV9	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.G141V	ENST00000412661.2	37	c.422	CCDS43366.2	5	.	.	.	.	.	.	.	.	.	.	G	6.318	0.426730	0.11987	.	.	ENSG00000145832	ENST00000412661	T	0.80738	-1.41	2.94	2.07	0.26955	.	.	.	.	.	T	0.64549	0.2608	.	.	.	0.09310	N	0.999999	B	0.06786	0.001	B	0.12156	0.007	T	0.48917	-0.8992	7	.	.	.	.	5.9704	0.19349	0.1444:0.0:0.8556:0.0	.	141	Q6ZT89-3	.	V	141	ENSP00000413049:G141V	.	G	+	2	0	SLC25A48	135251620	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.341000	0.07811	0.801000	0.34066	-0.140000	0.14226	GGA	SLC25A48	-	superfamily_Mt_carrier_dom	ENSG00000145832		0.507	SLC25A48-003	KNOWN	basic|CCDS	protein_coding	SLC25A48	HGNC	protein_coding	OTTHUMT00000347066.1	160	0.00	0	G	NM_145282	Missense_Mutation	135223721	135223721	+1	no_errors	ENST00000412661	ensembl	human	known	69_37n	missense	125	25.60	43	SNP	0.001	T
SLC37A1	54020	genome.wustl.edu	37	21	43988519	43988519	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr21:43988519C>T	ENST00000352133.2	+	17	2376	c.1394C>T	c.(1393-1395)aCg>aTg	p.T465M	SLC37A1_ENST00000398341.3_Missense_Mutation_p.T465M			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	465					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						TCCACCGTGACGGCCATCATT	0.522																																						dbGAP											0													93.0	82.0	86.0					21																	43988519		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.1394C>T	21.37:g.43988519C>T	ENSP00000344648:p.Thr465Met		D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.T465M	ENST00000352133.2	37	c.1394	CCDS13689.1	21	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283816	0.80803	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.58506	0.33;0.33	4.72	4.72	0.59763	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.80449	0.4625	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.85317	0.1082	10	0.87932	D	0	-11.4678	16.8483	0.85987	0.0:1.0:0.0:0.0	.	465	P57057	GLPT_HUMAN	M	465	ENSP00000381383:T465M;ENSP00000344648:T465M	ENSP00000344648:T465M	T	+	2	0	SLC37A1	42861588	1.000000	0.71417	0.989000	0.46669	0.723000	0.41478	6.814000	0.75236	2.337000	0.79520	0.655000	0.94253	ACG	SLC37A1	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000160190		0.522	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC37A1	HGNC	protein_coding	OTTHUMT00000195377.1	73	0.00	0	C			43988519	43988519	+1	no_errors	ENST00000352133	ensembl	human	known	69_37n	missense	48	29.41	20	SNP	1.000	T
SMURF1	57154	genome.wustl.edu	37	7	98645333	98645333	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr7:98645333C>T	ENST00000361125.1	-	11	1523	c.1204G>A	c.(1204-1206)Gaa>Aaa	p.E402K	SMURF1_ENST00000361368.2_Missense_Mutation_p.E376K|AC004893.11_ENST00000482799.2_RNA|AC004893.11_ENST00000468960.2_RNA	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	402					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CTGGACACTTCGATGCGGCAA	0.488																																						dbGAP											0													98.0	96.0	97.0					7																	98645333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.1204G>A	7.37:g.98645333C>T	ENSP00000354621:p.Glu402Lys		A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.E402K	ENST00000361125.1	37	c.1204	CCDS34690.1	7	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941544	0.53079	.	.	ENSG00000198742	ENST00000361368;ENST00000361125	T;T	0.75477	-0.94;-0.94	5.57	5.57	0.84162	HECT (1);	0.000000	0.85682	D	0.000000	T	0.75170	0.3813	N	0.20845	0.615	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.984;0.946	T	0.67193	-0.5732	10	0.02654	T	1	.	19.5545	0.95338	0.0:1.0:0.0:0.0	.	376;402;376	Q9HCE7-2;Q9HCE7;B9EGV3	.;SMUF1_HUMAN;.	K	376;402	ENSP00000355326:E376K;ENSP00000354621:E402K	ENSP00000354621:E402K	E	-	1	0	SMURF1	98483269	1.000000	0.71417	0.984000	0.44739	0.906000	0.53458	7.814000	0.86154	2.596000	0.87737	0.655000	0.94253	GAA	SMURF1	-	superfamily_HECT	ENSG00000198742		0.488	SMURF1-001	KNOWN	basic|CCDS	protein_coding	SMURF1	HGNC	protein_coding	OTTHUMT00000335001.2	53	0.00	0	C	NM_020429		98645333	98645333	-1	no_errors	ENST00000361125	ensembl	human	known	69_37n	missense	61	32.22	29	SNP	1.000	T
SMURF1	57154	genome.wustl.edu	37	7	98645333	98645333	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr7:98645333C>T	ENST00000361125.1	-	11	1523	c.1204G>A	c.(1204-1206)Gaa>Aaa	p.E402K	SMURF1_ENST00000361368.2_Missense_Mutation_p.E376K|AC004893.11_ENST00000482799.2_RNA|AC004893.11_ENST00000468960.2_RNA	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	402					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CTGGACACTTCGATGCGGCAA	0.488																																						dbGAP											0													98.0	96.0	97.0					7																	98645333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.1204G>A	7.37:g.98645333C>T	ENSP00000354621:p.Glu402Lys		A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.E402K	ENST00000361125.1	37	c.1204	CCDS34690.1	7	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941544	0.53079	.	.	ENSG00000198742	ENST00000361368;ENST00000361125	T;T	0.75477	-0.94;-0.94	5.57	5.57	0.84162	HECT (1);	0.000000	0.85682	D	0.000000	T	0.75170	0.3813	N	0.20845	0.615	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.984;0.946	T	0.67193	-0.5732	10	0.02654	T	1	.	19.5545	0.95338	0.0:1.0:0.0:0.0	.	376;402;376	Q9HCE7-2;Q9HCE7;B9EGV3	.;SMUF1_HUMAN;.	K	376;402	ENSP00000355326:E376K;ENSP00000354621:E402K	ENSP00000354621:E402K	E	-	1	0	SMURF1	98483269	1.000000	0.71417	0.984000	0.44739	0.906000	0.53458	7.814000	0.86154	2.596000	0.87737	0.655000	0.94253	GAA	SMURF1	-	superfamily_HECT	ENSG00000198742		0.488	SMURF1-001	KNOWN	basic|CCDS	protein_coding	SMURF1	HGNC	protein_coding	OTTHUMT00000335001.2	54	0.00	0	C	NM_020429		98645333	98645333	-1	no_errors	ENST00000361125	ensembl	human	known	69_37n	missense	61	32.22	29	SNP	1.000	T
TOX3	27324	genome.wustl.edu	37	16	52473349	52473349	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr16:52473349G>A	ENST00000219746.9	-	7	1803	c.1519C>T	c.(1519-1521)Cag>Tag	p.Q507*	TOX3_ENST00000407228.3_Nonsense_Mutation_p.Q502*	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	507	Gln-rich.				apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						agctgctgctgcagctgctgt	0.597																																						dbGAP											0													10.0	11.0	10.0					16																	52473349		2069	4164	6233	-	-	-	SO:0001587	stop_gained	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1519C>T	16.37:g.52473349G>A	ENSP00000219746:p.Gln507*		B4DRD0|B5MCW4	Nonsense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.Q507*	ENST00000219746.9	37	c.1519	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.505283	0.97620	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	.	.	.	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	19.5892	0.95501	0.0:0.0:1.0:0.0	.	.	.	.	X	507;502	.	ENSP00000219746:Q507X	Q	-	1	0	TOX3	51030850	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.076000	0.94009	2.720000	0.93068	0.655000	0.94253	CAG	TOX3	-	NULL	ENSG00000103460		0.597	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1	53	0.00	0	G	XM_049037		52473349	52473349	-1	no_errors	ENST00000219746	ensembl	human	known	69_37n	nonsense	58	15.94	11	SNP	1.000	A
TOX3	27324	genome.wustl.edu	37	16	52473349	52473349	+	Nonsense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr16:52473349G>A	ENST00000219746.9	-	7	1803	c.1519C>T	c.(1519-1521)Cag>Tag	p.Q507*	TOX3_ENST00000407228.3_Nonsense_Mutation_p.Q502*	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	507	Gln-rich.				apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						agctgctgctgcagctgctgt	0.597																																						dbGAP											0													10.0	11.0	10.0					16																	52473349		2069	4164	6233	-	-	-	SO:0001587	stop_gained	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1519C>T	16.37:g.52473349G>A	ENSP00000219746:p.Gln507*		B4DRD0|B5MCW4	Nonsense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.Q507*	ENST00000219746.9	37	c.1519	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.505283	0.97620	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	.	.	.	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	19.5892	0.95501	0.0:0.0:1.0:0.0	.	.	.	.	X	507;502	.	ENSP00000219746:Q507X	Q	-	1	0	TOX3	51030850	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.076000	0.94009	2.720000	0.93068	0.655000	0.94253	CAG	TOX3	-	NULL	ENSG00000103460		0.597	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1	51	0.00	0	G	XM_049037		52473349	52473349	-1	no_errors	ENST00000219746	ensembl	human	known	69_37n	nonsense	58	15.94	11	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	C	T	rs587782664		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr17:7577570C>T	ENST00000269305.4	-	7	900	c.711G>A	c.(709-711)atG>atA	p.M237I	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.M237I|TP53_ENST00000413465.2_Missense_Mutation_p.M237I|TP53_ENST00000359597.4_Missense_Mutation_p.M237I|TP53_ENST00000445888.2_Missense_Mutation_p.M237I|TP53_ENST00000420246.2_Missense_Mutation_p.M237I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	237	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M237I(109)|p.0?(8)|p.?(5)|p.M144I(4)|p.M237_N239delMCN(4)|p.Y236_M237delYM(1)|p.H233fs*6(1)|p.M144_N146delMCN(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233_C242del10(1)|p.M237fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGTTACACATGTAGTTGT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	139	Substitution - Missense(113)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)|Insertion - In frame(1)	upper_aerodigestive_tract(23)|ovary(22)|lung(18)|breast(18)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(9)|large_intestine(9)|stomach(6)|biliary_tract(5)|bone(5)|oesophagus(4)|urinary_tract(3)|pancreas(2)|thyroid(1)|testis(1)|soft_tissue(1)|liver(1)	GRCh37	CM011014	TP53	M							130.0	102.0	112.0					17																	7577570		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.711G>A	17.37:g.7577570C>T	ENSP00000269305:p.Met237Ile		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.M237I	ENST00000269305.4	37	c.711	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343240	0.82022	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.09	3.12	0.35913	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.86953	2.85	0.54753	D	0.999983	D;D;D;D;D;D	0.89917	1.0;0.975;0.999;1.0;0.998;1.0	D;P;D;D;D;D	0.91635	0.999;0.864;0.999;0.999;0.999;0.998	D	0.97922	1.0315	10	0.72032	D	0.01	-32.6033	10.0519	0.42221	0.0:0.8993:0.0:0.1007	.	237;237;144;237;237;237	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	I	237;237;237;237;237;237;226;144;105;144	ENSP00000410739:M237I;ENSP00000352610:M237I;ENSP00000269305:M237I;ENSP00000398846:M237I;ENSP00000391127:M237I;ENSP00000391478:M237I;ENSP00000425104:M105I;ENSP00000423862:M144I	ENSP00000269305:M237I	M	-	3	0	TP53	7518295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	1.305000	0.44909	0.462000	0.41574	ATG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	65	0.00	0	C	NM_000546		7577570	7577570	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	51	48.00	48	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577570	7577570	+	Missense_Mutation	SNP	C	C	T	rs587782664		TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr17:7577570C>T	ENST00000269305.4	-	7	900	c.711G>A	c.(709-711)atG>atA	p.M237I	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.M237I|TP53_ENST00000413465.2_Missense_Mutation_p.M237I|TP53_ENST00000359597.4_Missense_Mutation_p.M237I|TP53_ENST00000445888.2_Missense_Mutation_p.M237I|TP53_ENST00000420246.2_Missense_Mutation_p.M237I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	237	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		M -> I (in LFS; germline mutation and in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M237I(109)|p.0?(8)|p.?(5)|p.M144I(4)|p.M237_N239delMCN(4)|p.Y236_M237delYM(1)|p.H233fs*6(1)|p.M144_N146delMCN(1)|p.Y236_M243delYMCNSSCM(1)|p.C238fs*2(1)|p.V225fs*23(1)|p.M237_C238insX(1)|p.H233_C242del10(1)|p.M237fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGTTACACATGTAGTTGT	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	139	Substitution - Missense(113)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)|Insertion - In frame(1)	upper_aerodigestive_tract(23)|ovary(22)|lung(18)|breast(18)|central_nervous_system(11)|haematopoietic_and_lymphoid_tissue(9)|large_intestine(9)|stomach(6)|biliary_tract(5)|bone(5)|oesophagus(4)|urinary_tract(3)|pancreas(2)|thyroid(1)|testis(1)|soft_tissue(1)|liver(1)	GRCh37	CM011014	TP53	M							130.0	102.0	112.0					17																	7577570		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.711G>A	17.37:g.7577570C>T	ENSP00000269305:p.Met237Ile		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.M237I	ENST00000269305.4	37	c.711	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343240	0.82022	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99793	-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77;-6.77	4.09	3.12	0.35913	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99697	0.9885	M	0.86953	2.85	0.54753	D	0.999983	D;D;D;D;D;D	0.89917	1.0;0.975;0.999;1.0;0.998;1.0	D;P;D;D;D;D	0.91635	0.999;0.864;0.999;0.999;0.999;0.998	D	0.97922	1.0315	10	0.72032	D	0.01	-32.6033	10.0519	0.42221	0.0:0.8993:0.0:0.1007	.	237;237;144;237;237;237	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	I	237;237;237;237;237;237;226;144;105;144	ENSP00000410739:M237I;ENSP00000352610:M237I;ENSP00000269305:M237I;ENSP00000398846:M237I;ENSP00000391127:M237I;ENSP00000391478:M237I;ENSP00000425104:M105I;ENSP00000423862:M144I	ENSP00000269305:M237I	M	-	3	0	TP53	7518295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	1.305000	0.44909	0.462000	0.41574	ATG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	83	0.00	0	C	NM_000546		7577570	7577570	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	51	48.00	48	SNP	1.000	T
TTC38	55020	genome.wustl.edu	37	22	46684349	46684349	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr22:46684349G>A	ENST00000381031.3	+	11	1022	c.946G>A	c.(946-948)Gtc>Atc	p.V316I	TTC38_ENST00000445282.2_Missense_Mutation_p.V258I	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	316						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						GTGGCAGGATGTCCTGCCTGT	0.647																																						dbGAP											0													81.0	86.0	84.0					22																	46684349		2087	4213	6300	-	-	-	SO:0001583	missense	0				CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.946G>A	22.37:g.46684349G>A	ENSP00000370419:p.Val316Ile		Q8WV27|Q9NWP8	Missense_Mutation	SNP	NULL	p.V258I	ENST00000381031.3	37	c.772	CCDS43030.1	22	.	.	.	.	.	.	.	.	.	.	G	6.857	0.527492	0.13066	.	.	ENSG00000075234	ENST00000381031;ENST00000445282	T;T	0.47177	0.85;0.86	5.15	-2.24	0.06909	.	0.718048	0.13800	N	0.361868	T	0.25158	0.0611	N	0.22421	0.69	0.23056	N	0.998369	B;B	0.09022	0.002;0.001	B;B	0.12837	0.005;0.008	T	0.18241	-1.0343	10	0.18710	T	0.47	-8.9399	5.227	0.15399	0.3952:0.2541:0.3507:0.0	.	258;316	E7ES35;Q5R3I4	.;TTC38_HUMAN	I	316;258	ENSP00000370419:V316I;ENSP00000393960:V258I	ENSP00000370419:V316I	V	+	1	0	TTC38	45063013	0.033000	0.19621	0.001000	0.08648	0.412000	0.31113	0.281000	0.18810	-0.277000	0.09193	-0.145000	0.13849	GTC	TTC38	-	NULL	ENSG00000075234		0.647	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TTC38	HGNC	protein_coding	OTTHUMT00000318469.1	41	0.00	0	G	NM_017931		46684349	46684349	+1	no_errors	ENST00000445282	ensembl	human	known	69_37n	missense	127	18.06	28	SNP	0.046	A
TTC38	55020	genome.wustl.edu	37	22	46684349	46684349	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr22:46684349G>A	ENST00000381031.3	+	11	1022	c.946G>A	c.(946-948)Gtc>Atc	p.V316I	TTC38_ENST00000445282.2_Missense_Mutation_p.V258I	NM_017931.2	NP_060401	Q5R3I4	TTC38_HUMAN	tetratricopeptide repeat domain 38	316						extracellular vesicular exosome (GO:0070062)				endometrium(4)|large_intestine(3)|lung(4)|ovary(1)	12						GTGGCAGGATGTCCTGCCTGT	0.647																																						dbGAP											0													81.0	86.0	84.0					22																	46684349		2087	4213	6300	-	-	-	SO:0001583	missense	0				CCDS43030.1	22q13	2013-01-11			ENSG00000075234	ENSG00000075234		"""Tetratricopeptide (TTC) repeat domain containing"""	26082	protein-coding gene	gene with protein product							Standard	NM_017931		Approved	FLJ20699	uc003bhi.3	Q5R3I4	OTTHUMG00000150494	ENST00000381031.3:c.946G>A	22.37:g.46684349G>A	ENSP00000370419:p.Val316Ile		Q8WV27|Q9NWP8	Missense_Mutation	SNP	NULL	p.V258I	ENST00000381031.3	37	c.772	CCDS43030.1	22	.	.	.	.	.	.	.	.	.	.	G	6.857	0.527492	0.13066	.	.	ENSG00000075234	ENST00000381031;ENST00000445282	T;T	0.47177	0.85;0.86	5.15	-2.24	0.06909	.	0.718048	0.13800	N	0.361868	T	0.25158	0.0611	N	0.22421	0.69	0.23056	N	0.998369	B;B	0.09022	0.002;0.001	B;B	0.12837	0.005;0.008	T	0.18241	-1.0343	10	0.18710	T	0.47	-8.9399	5.227	0.15399	0.3952:0.2541:0.3507:0.0	.	258;316	E7ES35;Q5R3I4	.;TTC38_HUMAN	I	316;258	ENSP00000370419:V316I;ENSP00000393960:V258I	ENSP00000370419:V316I	V	+	1	0	TTC38	45063013	0.033000	0.19621	0.001000	0.08648	0.412000	0.31113	0.281000	0.18810	-0.277000	0.09193	-0.145000	0.13849	GTC	TTC38	-	NULL	ENSG00000075234		0.647	TTC38-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TTC38	HGNC	protein_coding	OTTHUMT00000318469.1	74	0.00	0	G	NM_017931		46684349	46684349	+1	no_errors	ENST00000445282	ensembl	human	known	69_37n	missense	127	18.06	28	SNP	0.046	A
WDR87	83889	genome.wustl.edu	37	19	38384389	38384389	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr19:38384389C>A	ENST00000303868.5	-	4	2061	c.1837G>T	c.(1837-1839)Gtc>Ttc	p.V613F	WDR87_ENST00000447313.2_Missense_Mutation_p.V652F	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	613										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GCAAAACAGACTGGGCCAAAG	0.502																																						dbGAP											0													51.0	48.0	49.0					19																	38384389		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.1837G>T	19.37:g.38384389C>A	ENSP00000368025:p.Val613Phe		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V652F	ENST00000303868.5	37	c.1954	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	C	8.352	0.831206	0.16820	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.12984	2.63;2.63	5.62	-1.04	0.10068	WD40/YVTN repeat-like-containing domain (1);	0.505572	0.18326	N	0.144630	T	0.07324	0.0185	N	0.14661	0.345	0.21499	N	0.999669	B;B	0.16802	0.019;0.019	B;B	0.18263	0.021;0.021	T	0.30416	-0.9979	10	0.51188	T	0.08	-6.3179	9.1923	0.37207	0.0:0.3915:0.3424:0.2661	.	613;652	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	F	652;613	ENSP00000405012:V652F;ENSP00000368025:V613F	ENSP00000368025:V613F	V	-	1	0	WDR87	43076229	0.014000	0.17966	0.589000	0.28718	0.981000	0.71138	-0.224000	0.09164	0.000000	0.14550	-0.148000	0.13756	GTC	WDR87	-	NULL	ENSG00000171804		0.502	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	19	0.00	0	C	XM_940478		38384389	38384389	-1	no_errors	ENST00000447313	ensembl	human	known	69_37n	missense	59	16.90	12	SNP	0.531	A
WDR87	83889	genome.wustl.edu	37	19	38384389	38384389	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr19:38384389C>A	ENST00000303868.5	-	4	2061	c.1837G>T	c.(1837-1839)Gtc>Ttc	p.V613F	WDR87_ENST00000447313.2_Missense_Mutation_p.V652F	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	613										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GCAAAACAGACTGGGCCAAAG	0.502																																						dbGAP											0													51.0	48.0	49.0					19																	38384389		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.1837G>T	19.37:g.38384389C>A	ENSP00000368025:p.Val613Phe		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V652F	ENST00000303868.5	37	c.1954	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	C	8.352	0.831206	0.16820	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.12984	2.63;2.63	5.62	-1.04	0.10068	WD40/YVTN repeat-like-containing domain (1);	0.505572	0.18326	N	0.144630	T	0.07324	0.0185	N	0.14661	0.345	0.21499	N	0.999669	B;B	0.16802	0.019;0.019	B;B	0.18263	0.021;0.021	T	0.30416	-0.9979	10	0.51188	T	0.08	-6.3179	9.1923	0.37207	0.0:0.3915:0.3424:0.2661	.	613;652	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	F	652;613	ENSP00000405012:V652F;ENSP00000368025:V613F	ENSP00000368025:V613F	V	-	1	0	WDR87	43076229	0.014000	0.17966	0.589000	0.28718	0.981000	0.71138	-0.224000	0.09164	0.000000	0.14550	-0.148000	0.13756	GTC	WDR87	-	NULL	ENSG00000171804		0.502	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	53	0.00	0	C	XM_940478		38384389	38384389	-1	no_errors	ENST00000447313	ensembl	human	known	69_37n	missense	59	16.90	12	SNP	0.531	A
ZNF704	619279	genome.wustl.edu	37	8	81553683	81553683	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-11A-43D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	727808a9-5f85-47b1-ad15-2f6bb5a231dd	g.chr8:81553683C>T	ENST00000327835.3	-	9	1388	c.1157G>A	c.(1156-1158)cGg>cAg	p.R386Q		NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	386							metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			GTACACCTTCCGACACTTTTT	0.547																																						dbGAP											0													87.0	67.0	74.0					8																	81553683		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.1157G>A	8.37:g.81553683C>T	ENSP00000331462:p.Arg386Gln		B2RNE6|B9EGW6	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.R386Q	ENST00000327835.3	37	c.1157	CCDS34913.1	8	.	.	.	.	.	.	.	.	.	.	C	37	6.073287	0.97256	.	.	ENSG00000164684	ENST00000327835	T	0.35789	1.29	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.66674	0.2813	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69371	-0.5163	10	0.87932	D	0	-18.9186	20.2789	0.98501	0.0:1.0:0.0:0.0	.	386	Q6ZNC4	ZN704_HUMAN	Q	386	ENSP00000331462:R386Q	ENSP00000331462:R386Q	R	-	2	0	ZNF704	81716238	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.818000	0.86416	2.788000	0.95919	0.650000	0.86243	CGG	ZNF704	-	NULL	ENSG00000164684		0.547	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF704	HGNC	protein_coding	OTTHUMT00000379964.2	137	0.00	0	C	NM_001033723		81553683	81553683	-1	no_errors	ENST00000327835	ensembl	human	known	69_37n	missense	205	14.58	35	SNP	1.000	T
ZNF704	619279	genome.wustl.edu	37	8	81553683	81553683	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr8:81553683C>T	ENST00000327835.3	-	9	1388	c.1157G>A	c.(1156-1158)cGg>cAg	p.R386Q		NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	386							metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			GTACACCTTCCGACACTTTTT	0.547																																						dbGAP											0													87.0	67.0	74.0					8																	81553683		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.1157G>A	8.37:g.81553683C>T	ENSP00000331462:p.Arg386Gln		B2RNE6|B9EGW6	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.R386Q	ENST00000327835.3	37	c.1157	CCDS34913.1	8	.	.	.	.	.	.	.	.	.	.	C	37	6.073287	0.97256	.	.	ENSG00000164684	ENST00000327835	T	0.35789	1.29	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.66674	0.2813	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.69371	-0.5163	10	0.87932	D	0	-18.9186	20.2789	0.98501	0.0:1.0:0.0:0.0	.	386	Q6ZNC4	ZN704_HUMAN	Q	386	ENSP00000331462:R386Q	ENSP00000331462:R386Q	R	-	2	0	ZNF704	81716238	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.818000	0.86416	2.788000	0.95919	0.650000	0.86243	CGG	ZNF704	-	NULL	ENSG00000164684		0.547	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF704	HGNC	protein_coding	OTTHUMT00000379964.2	148	0.00	0	C	NM_001033723		81553683	81553683	-1	no_errors	ENST00000327835	ensembl	human	known	69_37n	missense	205	14.58	35	SNP	1.000	T
ZNF783	100289678	genome.wustl.edu	37	7	148990933	148990933	+	IGR	SNP	G	G	A	rs6977581	byFrequency	TCGA-A7-A4SD-01A-11D-A25Q-09	TCGA-A7-A4SD-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	2afa9f1e-e155-41ea-9284-baca6943f237	183446dc-6ca8-4d0d-ad38-73b34d833ba4	g.chr7:148990933G>A	ENST00000489518.1	+	0	763				RP4-800G7.2_ENST00000416232.1_RNA			Q6ZMS7	ZN783_HUMAN	zinc finger family member 783						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)	22	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.0014)			CACAGTACACGGTGGGAAGGG	0.507													A|||	483	0.0964457	0.2141	0.0576	5008	,	,		19942	0.003		0.1054	False		,,,				2504	0.0521					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK131504	CCDS56519.1	7q36.1	2013-01-08	2008-05-28		ENSG00000204946	ENSG00000204946		"""Zinc fingers, C2H2-type"", ""-"""	27222	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001195220		Approved	DKFZp667J212	uc011kuo.2	Q6ZMS7	OTTHUMG00000158969		7.37:g.148990933G>A			C9J9J2	Missense_Mutation	SNP	NULL	p.G212S	ENST00000489518.1	37	c.634		7																																																																																			ZNF783	-	NULL	ENSG00000204946		0.507	ZNF783-005	KNOWN	basic	processed_transcript	ZNF783	HGNC	protein_coding	OTTHUMT00000352719.2	22	0.00	0	G	NM_001195220		148990933	148990933	+1	no_errors	ENST00000481519	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.010	A
