#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2ML1	144568	genome.wustl.edu	37	12	9006836	9006836	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:9006836T>C	ENST00000299698.7	+	21	2883	c.2703T>C	c.(2701-2703)gtT>gtC	p.V901V	A2ML1_ENST00000539547.1_Silent_p.V410V	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TCAAGCCAGTTCTCGTCAAAG	0.488																																						dbGAP											0													102.0	99.0	100.0					12																	9006836		1989	4163	6152	-	-	-	SO:0001819	synonymous_variant	0			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.2703T>C	12.37:g.9006836T>C				Silent	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.V901	ENST00000299698.7	37	c.2703	CCDS8596.2	12																																																																																			A2ML1	-	NULL	ENSG00000166535		0.488	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	HGNC	protein_coding	OTTHUMT00000250304.3	41	0.00	0	T	NM_144670		9006836	9006836	+1	no_errors	ENST00000299698	ensembl	human	known	69_37n	silent	42	20.75	11	SNP	1.000	C
ABCA13	154664	genome.wustl.edu	37	7	48318271	48318271	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:48318271C>A	ENST00000435803.1	+	18	7504	c.7480C>A	c.(7480-7482)Ccc>Acc	p.P2494T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2494					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CGTCCTGAAACCCCTCTTAGA	0.398																																						dbGAP											0													182.0	181.0	181.0					7																	48318271		1845	4089	5934	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7480C>A	7.37:g.48318271C>A	ENSP00000411096:p.Pro2494Thr		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P2494T	ENST00000435803.1	37	c.7480	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	11.75	1.731070	0.30684	.	.	ENSG00000179869	ENST00000435803	T	0.56776	0.44	5.02	-0.341	0.12639	.	0.867169	0.09729	N	0.763443	T	0.31670	0.0804	L	0.27053	0.805	0.09310	N	1	B	0.34103	0.437	B	0.30401	0.115	T	0.28038	-1.0056	10	0.66056	D	0.02	.	1.6037	0.02679	0.1441:0.4299:0.1418:0.2843	.	2494	Q86UQ4	ABCAD_HUMAN	T	2494	ENSP00000411096:P2494T	ENSP00000411096:P2494T	P	+	1	0	ABCA13	48288817	0.000000	0.05858	0.001000	0.08648	0.054000	0.15201	-0.154000	0.10130	0.168000	0.19655	0.655000	0.94253	CCC	ABCA13	-	NULL	ENSG00000179869		0.398	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	27	0.00	0	C	NM_152701		48318271	48318271	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	0.000	A
ACBD5	91452	genome.wustl.edu	37	10	27529276	27529276	+	Silent	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr10:27529276C>T	ENST00000375888.1	-	1	211	c.147G>A	c.(145-147)gtG>gtA	p.V49V	ACBD5_ENST00000375905.4_Silent_p.V16V|RP11-85G18.6_ENST00000574842.1_lincRNA|ACBD5_ENST00000375901.1_5'UTR|ACBD5_ENST00000375897.3_5'UTR|ACBD5_ENST00000396271.3_Silent_p.V51V|ACBD5_ENST00000476758.1_5'UTR			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	49	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.				peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						GGATCACCTTCACGGCCGCCT	0.622																																						dbGAP											0													100.0	91.0	94.0					10																	27529276		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.147G>A	10.37:g.27529276C>T			B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Silent	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	p.V49	ENST00000375888.1	37	c.147		10																																																																																			ACBD5	-	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	ENSG00000107897		0.622	ACBD5-005	KNOWN	basic	protein_coding	ACBD5	HGNC	protein_coding	OTTHUMT00000047314.1	43	0.00	0	C	NM_145698		27529276	27529276	-1	no_errors	ENST00000375888	ensembl	human	known	69_37n	silent	41	14.58	7	SNP	1.000	T
ACTB	60	genome.wustl.edu	37	7	5568044	5568044	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:5568044C>G	ENST00000331789.5	-	4	861	c.670G>C	c.(670-672)Gag>Cag	p.E224Q	AC006483.1_ENST00000579427.1_RNA|ACTB_ENST00000464611.1_5'Flank	NM_001101.3	NP_001092.1	P63261	ACTG_HUMAN	actin, beta	224					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(2)|prostate(2)	8		Ovarian(82;0.0606)		UCEC - Uterine corpus endometrioid carcinoma (126;0.175)|OV - Ovarian serous cystadenocarcinoma(56;4.24e-37)		ATCTCTTGCTCGAAGTCCAGG	0.607																																						dbGAP											0													65.0	66.0	66.0					7																	5568044		2203	4299	6502	-	-	-	SO:0001583	missense	0			M28424	CCDS5341.1	7p22	2014-09-17			ENSG00000075624	ENSG00000075624			132	protein-coding gene	gene with protein product		102630				1505215	Standard	NM_001101		Approved		uc003sot.4	P60709	OTTHUMG00000023268	ENST00000331789.5:c.670G>C	7.37:g.5568044C>G	ENSP00000349960:p.Glu224Gln		A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.E224Q	ENST00000331789.5	37	c.670	CCDS5341.1	7	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783262	0.49891	.	.	ENSG00000075624	ENST00000331789;ENST00000445914;ENST00000400179;ENST00000320713	D	0.94457	-3.43	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000016	D	0.93543	0.7939	L	0.58302	1.8	0.50813	D	0.999894	B	0.06786	0.001	B	0.21917	0.037	D	0.90478	0.4458	10	0.87932	D	0	.	18.1418	0.89642	0.0:1.0:0.0:0.0	.	224	P60709	ACTB_HUMAN	Q	224;200;196;143	ENSP00000349960:E224Q	ENSP00000440549:E143Q	E	-	1	0	ACTB	5534570	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.533000	0.81994	2.617000	0.88574	0.650000	0.86243	GAG	ACTB	-	pfam_Actin-like,smart_Actin-like	ENSG00000075624		0.607	ACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTB	HGNC	protein_coding	OTTHUMT00000059589.4	140	0.00	0	C	NM_001101		5568044	5568044	-1	no_errors	ENST00000331789	ensembl	human	known	69_37n	missense	58	34.83	31	SNP	1.000	G
AZIN2	113451	genome.wustl.edu	37	1	33586077	33586077	+	3'UTR	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:33586077C>A	ENST00000373443.3	+	0	1995				ADC_ENST00000484656.1_3'UTR|ADC_ENST00000398167.1_3'UTR			Q96A70	AZIN2_HUMAN							agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of protein catabolic process (GO:0042177)|ornithine metabolic process (GO:0006591)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of catalytic activity (GO:0043085)|positive regulation of polyamine transmembrane transport (GO:1902269)|putrescine transport (GO:0015847)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|trans-Golgi network membrane organization (GO:0098629)	axon (GO:0030424)|cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|granular vesicle (GO:1990005)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	catalytic activity (GO:0003824)|ornithine decarboxylase activator activity (GO:0042978)|putrescine transmembrane transporter activity (GO:0015489)			NS(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)	TGGTCTCCTTCCCACCTTTGT	0.473																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0																														ENST00000373443.3:c.*294C>A	1.37:g.33586077C>A			B2RDU5|D3DPQ9|Q5TIF4|Q5TIF5|Q5TIF6|Q8TF56|Q96L54|Q96L55|Q96L56|Q96L57|Q96MD9	RNA	SNP	-	NULL	ENST00000373443.3	37	NULL	CCDS375.1	1																																																																																			ADC	-	-	ENSG00000142920		0.473	ADC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADC	HGNC	protein_coding	OTTHUMT00000011866.1	50	0.00	0	C			33586077	33586077	+1	no_errors	ENST00000471119	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	0.000	A
ADCY7	113	genome.wustl.edu	37	16	50341022	50341022	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:50341022T>G	ENST00000394697.2	+	15	2154	c.1814T>G	c.(1813-1815)gTc>gGc	p.V605G	ADCY7_ENST00000538642.1_Missense_Mutation_p.V605G|ADCY7_ENST00000254235.3_Missense_Mutation_p.V605G|ADCY7_ENST00000537579.1_3'UTR|ADCY7_ENST00000566433.2_Missense_Mutation_p.V605G			P51828	ADCY7_HUMAN	adenylate cyclase 7	605					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		CTGATCTTCGTCTGCATCCTG	0.667																																						dbGAP											0													58.0	51.0	53.0					16																	50341022		2198	4300	6498	-	-	-	SO:0001583	missense	0			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.1814T>G	16.37:g.50341022T>G	ENSP00000378187:p.Val605Gly		A0AVA6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.V605G	ENST00000394697.2	37	c.1814	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	T	10.56	1.384671	0.25031	.	.	ENSG00000121281	ENST00000538642;ENST00000394697;ENST00000254235	T;D;D	0.82433	0.86;-1.61;-1.61	4.76	3.67	0.42095	.	1.005240	0.08023	U	0.992238	T	0.81489	0.4833	L	0.54323	1.7	0.80722	D	1	B;B	0.26845	0.161;0.035	B;B	0.30782	0.066;0.12	T	0.72697	-0.4215	10	0.87932	D	0	.	10.0571	0.42252	0.0:0.0801:0.0:0.9199	.	605;605	P51828;F5H4D1	ADCY7_HUMAN;.	G	605	ENSP00000445046:V605G;ENSP00000378187:V605G;ENSP00000254235:V605G	ENSP00000254235:V605G	V	+	2	0	ADCY7	48898523	0.966000	0.33281	0.673000	0.29887	0.011000	0.07611	1.742000	0.38248	0.780000	0.33566	0.482000	0.46254	GTC	ADCY7	-	NULL	ENSG00000121281		0.667	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	HGNC	protein_coding	OTTHUMT00000256877.3	74	0.00	0	T			50341022	50341022	+1	no_errors	ENST00000254235	ensembl	human	known	69_37n	missense	49	26.87	18	SNP	0.959	G
ADCY8	114	genome.wustl.edu	37	8	131862032	131862032	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:131862032A>C	ENST00000286355.5	-	10	4320	c.2228T>G	c.(2227-2229)aTc>aGc	p.I743S	ADCY8_ENST00000377928.3_Intron	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	743					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GGAGAACTGGATGGTCATTGG	0.468										HNSCC(32;0.087)																												dbGAP											0													119.0	85.0	96.0					8																	131862032		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2228T>G	8.37:g.131862032A>C	ENSP00000286355:p.Ile743Ser			Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.I743S	ENST00000286355.5	37	c.2228	CCDS6363.1	8	.	.	.	.	.	.	.	.	.	.	A	18.49	3.636368	0.67130	.	.	ENSG00000155897	ENST00000286355	T	0.50548	0.74	5.31	5.31	0.75309	.	0.208574	0.49305	D	0.000149	T	0.49064	0.1535	L	0.55481	1.735	0.80722	D	1	P	0.48764	0.915	P	0.45232	0.474	T	0.53947	-0.8366	10	0.59425	D	0.04	.	14.4368	0.67287	1.0:0.0:0.0:0.0	.	743	P40145	ADCY8_HUMAN	S	743	ENSP00000286355:I743S	ENSP00000286355:I743S	I	-	2	0	ADCY8	131931214	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.824000	0.92023	1.995000	0.58328	0.533000	0.62120	ATC	ADCY8	-	NULL	ENSG00000155897		0.468	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	24	0.00	0	A			131862032	131862032	-1	no_errors	ENST00000286355	ensembl	human	known	69_37n	missense	39	30.36	17	SNP	1.000	C
AGBL1	123624	genome.wustl.edu	37	15	86810230	86810230	+	Silent	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr15:86810230A>G	ENST00000441037.2	+	12	1718	c.1623A>G	c.(1621-1623)caA>caG	p.Q541Q	AGBL1_ENST00000389298.3_Silent_p.Q272Q|AGBL1_ENST00000421325.2_Silent_p.Q541Q	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	541					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						GGCCTTTGCAAGACAATGCTT	0.358																																						dbGAP											0													86.0	78.0	80.0					15																	86810230		1883	4108	5991	-	-	-	SO:0001819	synonymous_variant	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1623A>G	15.37:g.86810230A>G			A1A4X5|A6NJH6|C9JHL5	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.Q541	ENST00000441037.2	37	c.1623	CCDS58398.1	15																																																																																			AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.358	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	23	0.00	0	A	NM_152336		86810230	86810230	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	silent	26	36.59	15	SNP	0.127	G
AKAP17A	8227	genome.wustl.edu	37	X	1718374	1718374	+	Intron	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:1718374C>T	ENST00000313871.3	+	4	1348				AKAP17A_ENST00000381261.3_Nonsense_Mutation_p.Q401*	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A						B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GGGCTGCCCTCAGTGCCCTCC	0.687																																						dbGAP											0													12.0	16.0	15.0					X																	1718374		2090	4096	6186	-	-	-	SO:0001627	intron_variant	0			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1152+49C>T	X.37:g.1718374C>T			Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Nonsense_Mutation	SNP	NULL	p.Q401*	ENST00000313871.3	37	c.1201	CCDS14116.1	X	.	.	.	.	.	.	.	.	.	.	c	14.85	2.659516	0.47467	.	.	ENSG00000197976	ENST00000381261	.	.	.	0.998	-2.0	0.07433	.	.	.	.	.	.	.	.	.	.	.	0.49051	D	0.999741	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.2542	0.15539	0.0:0.6395:0.3605:0.0	.	.	.	.	X	401	.	.	Q	+	1	0	AKAP17A	1678374	0.018000	0.18449	0.001000	0.08648	0.001000	0.01503	0.856000	0.27818	-0.876000	0.04017	-0.915000	0.02750	CAG	AKAP17A	-	NULL	ENSG00000197976		0.687	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP17A	HGNC	protein_coding	OTTHUMT00000055609.2	74	0.00	0	C	NM_005088		1718374	1718374	+1	no_errors	ENST00000381261	ensembl	human	known	69_37n	nonsense	26	23.53	8	SNP	0.008	T
ALMS1	7840	genome.wustl.edu	37	2	73679158	73679158	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:73679158G>C	ENST00000264448.6	+	8	5612	c.5501G>C	c.(5500-5502)gGa>gCa	p.G1834A	ALMS1_ENST00000377715.1_Missense_Mutation_p.G1834A|ALMS1_ENST00000409009.1_Missense_Mutation_p.G1792A	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1834	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGAGTTCCTGGACCAGCTGAC	0.458																																						dbGAP											0													85.0	81.0	82.0					2																	73679158		1841	4095	5936	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.5501G>C	2.37:g.73679158G>C	ENSP00000264448:p.Gly1834Ala		Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.G1834A	ENST00000264448.6	37	c.5501	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	G	0.093	-1.163482	0.01673	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.19105	3.01;3.02;2.17	4.23	-3.86	0.04230	.	0.384018	0.22713	N	0.056553	T	0.09291	0.0229	N	0.25485	0.75	0.09310	N	0.999999	B;B;B	0.32245	0.121;0.197;0.361	B;B;B	0.28784	0.032;0.094;0.072	T	0.35001	-0.9806	10	0.16896	T	0.51	.	7.2537	0.26164	0.6471:0.1444:0.2085:0.0	.	1834;1792;1834	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	A	1792;1834;1834	ENSP00000386627:G1792A;ENSP00000264448:G1834A;ENSP00000366944:G1834A	ENSP00000264448:G1834A	G	+	2	0	ALMS1	73532666	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.785000	0.04628	-0.923000	0.03785	-0.143000	0.13931	GGA	ALMS1	-	NULL	ENSG00000116127		0.458	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	25	0.00	0	G	NM_015120		73679158	73679158	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	37	34.48	20	SNP	0.001	C
AMY2A	279	genome.wustl.edu	37	1	104160229	104160229	+	Splice_Site	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:104160229A>C	ENST00000414303.2	+	1	231	c.167A>C	c.(166-168)cAg>cCg	p.Q56P		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	56					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	GGAGGGGTTCAGGTGGGTATG	0.413																																						dbGAP											0													291.0	241.0	258.0					1																	104160229		2201	4278	6479	-	-	-	SO:0001630	splice_region_variant	0			BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.168+1A>C	1.37:g.104160229A>C			B9EJG1|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.Q56P	ENST00000414303.2	37	c.167	CCDS783.1	1	.	.	.	.	.	.	.	.	.	.	a	10.51	1.371019	0.24771	.	.	ENSG00000243480	ENST00000414303;ENST00000393932	D	0.98362	-4.89	3.22	3.22	0.36961	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98811	0.9599	H	0.98612	4.28	0.80722	D	1	B;B	0.29270	0.089;0.24	B;B	0.43916	0.244;0.436	D	0.99970	1.1972	10	0.87932	D	0	.	11.6147	0.51083	1.0:0.0:0.0:0.0	.	56;56	B9EJG1;P04746	.;AMYP_HUMAN	P	56	ENSP00000397582:Q56P	ENSP00000377509:Q56P	Q	+	2	0	AMY2A	103961752	1.000000	0.71417	1.000000	0.80357	0.083000	0.17756	8.453000	0.90349	1.455000	0.47813	0.374000	0.22700	CAG	AMY2A	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000243480		0.413	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2A	HGNC	protein_coding	OTTHUMT00000030315.1	127	0.00	0	A	NM_000699	Missense_Mutation	104160229	104160229	+1	no_errors	ENST00000414303	ensembl	human	known	69_37n	missense	79	50.93	82	SNP	1.000	C
AP3M2	10947	genome.wustl.edu	37	8	42012400	42012400	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:42012400T>C	ENST00000518421.1	+	3	486	c.195T>C	c.(193-195)ttT>ttC	p.F65F	AP3M2_ENST00000174653.3_Silent_p.F65F|AP3M2_ENST00000517922.1_Silent_p.F65F|AP3M2_ENST00000396926.3_Silent_p.F65F|AP3M2_ENST00000520685.1_Intron|RP11-589C21.5_ENST00000564481.1_RNA	NM_001134296.1	NP_001127768.1	P53677	AP3M2_HUMAN	adaptor-related protein complex 3, mu 2 subunit	65					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)				endometrium(3)|kidney(1)|large_intestine(1)|lung(10)|prostate(1)|stomach(1)	17	all_cancers(6;8.14e-25)|all_epithelial(6;2.41e-27)|all_lung(13;5.09e-13)|Lung NSC(13;8.38e-12)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|Colorectal(10;0.00165)|OV - Ovarian serous cystadenocarcinoma(14;0.00346)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)			ACAAGATCTTTTTTGTGGCCG	0.493																																						dbGAP											0													88.0	89.0	88.0					8																	42012400		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38293	CCDS6125.1	8p11.2	2008-07-07			ENSG00000070718	ENSG00000070718			570	protein-coding gene	gene with protein product		610469				7601449	Standard	NM_006803		Approved	CLA20, AP47B	uc003xoo.3	P53677	OTTHUMG00000164060	ENST00000518421.1:c.195T>C	8.37:g.42012400T>C			B2RCR0|D3DSY2|Q7Z472	Silent	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.F65	ENST00000518421.1	37	c.195	CCDS6125.1	8																																																																																			AP3M2	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_Clathrin_mu	ENSG00000070718		0.493	AP3M2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP3M2	HGNC	protein_coding	OTTHUMT00000376996.1	67	0.00	0	T			42012400	42012400	+1	no_errors	ENST00000174653	ensembl	human	known	69_37n	silent	81	14.74	14	SNP	1.000	C
APMAP	57136	genome.wustl.edu	37	20	24954350	24954350	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr20:24954350C>T	ENST00000217456.2	-	4	642	c.352G>A	c.(352-354)Gat>Aat	p.D118N	APMAP_ENST00000447138.1_Missense_Mutation_p.D118N|RNU6-1257P_ENST00000384625.1_RNA	NM_020531.2	NP_065392.1	Q9HDC9	APMAP_HUMAN	adipocyte plasma membrane associated protein	118					biosynthetic process (GO:0009058)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	arylesterase activity (GO:0004064)|strictosidine synthase activity (GO:0016844)										ACCCGGCCATCTGCTGTCCCA	0.458																																						dbGAP											0													77.0	70.0	72.0					20																	24954350		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033767	CCDS13166.1	20p11.2	2012-07-20	2012-07-20	2012-07-20	ENSG00000101474	ENSG00000101474			13238	protein-coding gene	gene with protein product		615884	"""chromosome 20 open reading frame 3"""	C20orf3		10945474, 11583587, 20552250	Standard	NM_020531		Approved	BSCv	uc002wty.3	Q9HDC9	OTTHUMG00000032107	ENST00000217456.2:c.352G>A	20.37:g.24954350C>T	ENSP00000217456:p.Asp118Asn		A8K514|B4DXG1|Q6UVZ8|Q9GZS8|Q9NUB2	Missense_Mutation	SNP	pfam_Strictosidine_synth_cons-reg,pfam_SGL	p.D118N	ENST00000217456.2	37	c.352	CCDS13166.1	20	.	.	.	.	.	.	.	.	.	.	C	31	5.062541	0.93898	.	.	ENSG00000101474	ENST00000217456;ENST00000447138	T;T	0.31510	1.49;1.49	5.43	5.43	0.79202	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	T	0.60907	0.2305	M	0.85462	2.755	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.989	D;D;P	0.91635	0.955;0.999;0.904	T	0.64871	-0.6305	10	0.52906	T	0.07	-23.164	16.752	0.85488	0.0:1.0:0.0:0.0	.	118;102;118	Q9HDC9-2;A2A2F9;Q9HDC9	.;.;APMAP_HUMAN	N	118	ENSP00000217456:D118N;ENSP00000415373:D118N	ENSP00000217456:D118N	D	-	1	0	C20orf3	24902350	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	6.156000	0.71840	2.547000	0.85894	0.655000	0.94253	GAT	APMAP	-	NULL	ENSG00000101474		0.458	APMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APMAP	HGNC	protein_coding	OTTHUMT00000078380.2	34	0.00	0	C	NM_020531		24954350	24954350	-1	no_errors	ENST00000217456	ensembl	human	known	69_37n	missense	10	52.38	11	SNP	1.000	T
ARPP21	10777	genome.wustl.edu	37	3	35731625	35731625	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:35731625G>T	ENST00000187397.4	+	8	994	c.538G>T	c.(538-540)Gac>Tac	p.D180Y	ARPP21_ENST00000458225.1_Missense_Mutation_p.D180Y|ARPP21_ENST00000444190.1_Missense_Mutation_p.D180Y|ARPP21_ENST00000417925.1_Missense_Mutation_p.D180Y|ARPP21_ENST00000337271.5_Missense_Mutation_p.D180Y	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	180	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						TTTCATTGCTGACAACAAGTA	0.323																																						dbGAP											0													111.0	108.0	109.0					3																	35731625		2202	4298	6500	-	-	-	SO:0001583	missense	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.538G>T	3.37:g.35731625G>T	ENSP00000187397:p.Asp180Tyr		B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.D180Y	ENST00000187397.4	37	c.538	CCDS2661.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.93|12.93	2.084121|2.084121	0.36758|0.36758	.|.	.|.	ENSG00000172995|ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925|ENST00000425289	T;T;T;T;T|.	0.54866|.	0.55;0.55;0.55;0.55;0.55|.	5.73|5.73	4.85|4.85	0.62838|0.62838	Single-stranded nucleic acid binding R3H (3);|.	0.094382|.	0.64402|.	D|.	0.000001|.	T|.	0.71584|.	0.3357|.	M|M	0.73598|0.73598	2.24|2.24	0.58432|0.58432	D|D	0.999995|0.999995	D;D;D|.	0.76494|.	0.998;0.999;0.998|.	D;D;D|.	0.91635|.	0.991;0.999;0.991|.	T|.	0.72187|.	-0.4366|.	10|.	0.87932|.	D|.	0|.	-25.7531|-25.7531	11.2929|11.2929	0.49261|0.49261	0.1398:0.0:0.8602:0.0|0.1398:0.0:0.8602:0.0	.|.	180;180;180|.	Q9UBL0-3;Q9UBL0;Q9UBL0-4|.	.;ARP21_HUMAN;.|.	Y|L	180|21	ENSP00000414351:D180Y;ENSP00000337792:D180Y;ENSP00000405276:D180Y;ENSP00000187397:D180Y;ENSP00000412326:D180Y|.	ENSP00000187397:D180Y|.	D|X	+|+	1|2	0|2	ARPP21|ARPP21	35706629|35706629	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.197000|0.197000	0.23852|0.23852	3.890000|3.890000	0.56220|0.56220	1.560000|1.560000	0.49568|0.49568	-0.150000|-0.150000	0.13652|0.13652	GAC|TGA	ARPP21	-	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	ENSG00000172995		0.323	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	55	0.00	0	G	NM_198399		35731625	35731625	+1	no_errors	ENST00000417925	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	T
ASIC4	55515	genome.wustl.edu	37	2	220379706	220379706	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:220379706G>T	ENST00000347842.3	+	1	655	c.641G>T	c.(640-642)gGc>gTc	p.G214V	AC053503.11_ENST00000429882.1_RNA|ASIC4_ENST00000358078.4_Missense_Mutation_p.G214V	NM_182847.2	NP_878267.2	Q96FT7	ASIC4_HUMAN	acid-sensing (proton-gated) ion channel family member 4	214					ion transmembrane transport (GO:0034220)|sodium ion transmembrane transport (GO:0035725)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)	ion channel activity (GO:0005216)|sodium channel activity (GO:0005272)|sodium ion transmembrane transporter activity (GO:0015081)										CAGGCGGCTGGCCTGGCCCGG	0.716																																						dbGAP											0													20.0	23.0	22.0					2																	220379706		2200	4296	6496	-	-	-	SO:0001583	missense	0			AJ271643	CCDS2442.1	2q36.1	2012-02-22	2012-02-22	2012-02-22	ENSG00000072182	ENSG00000072182		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	21263	protein-coding gene	gene with protein product		606715	"""amiloride-sensitive cation channel 4, pituitary"", ""amiloride-sensitive cation channel family member 4, pituitary"""	ACCN4		10852210	Standard	NM_182847		Approved	BNAC4	uc002vma.3	Q96FT7	OTTHUMG00000058928	ENST00000347842.3:c.641G>T	2.37:g.220379706G>T	ENSP00000326627:p.Gly214Val		Q53SB7|Q6GMS1|Q6PIN9|Q9NQA4	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC	p.G214V	ENST00000347842.3	37	c.641	CCDS2442.1	2	.	.	.	.	.	.	.	.	.	.	G	9.069	0.996527	0.19043	.	.	ENSG00000072182	ENST00000347842;ENST00000358078	T;T	0.62639	0.01;0.01	4.48	4.48	0.54585	.	0.599221	0.17172	N	0.184227	T	0.38799	0.1054	N	0.11560	0.145	0.47065	D	0.999302	P;B;B	0.43287	0.802;0.391;0.358	B;B;B	0.37601	0.254;0.236;0.106	T	0.22347	-1.0219	10	0.28530	T	0.3	-8.8345	10.076	0.42360	0.0955:0.0:0.9045:0.0	.	214;214;214	Q96FT7;Q96FT7-4;Q96FT7-2	ACCN4_HUMAN;.;.	V	214	ENSP00000326627:G214V;ENSP00000350786:G214V	ENSP00000326627:G214V	G	+	2	0	ACCN4	220087950	0.878000	0.30173	0.899000	0.35326	0.483000	0.33249	2.303000	0.43646	2.319000	0.78375	0.655000	0.94253	GGC	ASIC4	-	pfam_Na+channel_ASC	ENSG00000072182		0.716	ASIC4-001	KNOWN	basic|CCDS	protein_coding	ASIC4	HGNC	protein_coding	OTTHUMT00000130263.1	20	0.00	0	G	NM_018674		220379706	220379706	+1	no_errors	ENST00000347842	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	0.874	T
ASXL3	80816	genome.wustl.edu	37	18	31323268	31323268	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr18:31323268G>T	ENST00000269197.5	+	12	3456	c.3456G>T	c.(3454-3456)atG>atT	p.M1152I		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1152					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AAACAAAAATGGAAGGTTCGA	0.498																																						dbGAP											0													41.0	41.0	41.0					18																	31323268		1877	4109	5986	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3456G>T	18.37:g.31323268G>T	ENSP00000269197:p.Met1152Ile		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.M1152I	ENST00000269197.5	37	c.3456	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	7.643	0.681281	0.14907	.	.	ENSG00000141431	ENST00000269197	T	0.37235	1.21	5.91	-3.83	0.04269	.	1.067180	0.07167	N	0.851663	T	0.15262	0.0368	N	0.08118	0	0.29762	N	0.835449	B	0.02656	0.0	B	0.01281	0.0	T	0.44467	-0.9326	10	0.05833	T	0.94	.	10.8713	0.46885	0.0:0.2608:0.1843:0.5548	.	1152	Q9C0F0	ASXL3_HUMAN	I	1152	ENSP00000269197:M1152I	ENSP00000269197:M1152I	M	+	3	0	ASXL3	29577266	0.321000	0.24625	0.942000	0.38095	0.992000	0.81027	-0.437000	0.06914	-0.613000	0.05694	0.655000	0.94253	ATG	ASXL3	-	NULL	ENSG00000141431		0.498	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	24	0.00	0	G			31323268	31323268	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	6	45.45	5	SNP	0.899	T
ATP2A1	487	genome.wustl.edu	37	16	28913614	28913614	+	Missense_Mutation	SNP	C	C	T	rs200376448		TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:28913614C>T	ENST00000357084.3	+	17	2698	c.2431C>T	c.(2431-2433)Cca>Tca	p.P811S	ATP2A1_ENST00000536376.1_Missense_Mutation_p.P686S|ATP2A1_ENST00000395503.4_Missense_Mutation_p.P811S	NM_173201.3	NP_775293.1	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, cardiac muscle, fast twitch 1	811					apoptotic mitochondrial changes (GO:0008637)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|ion transmembrane transport (GO:0034220)|maintenance of mitochondrion location (GO:0051659)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|negative regulation of striated muscle contraction (GO:0045988)|positive regulation of endoplasmic reticulum calcium ion concentration (GO:0032470)|positive regulation of fast-twitch skeletal muscle fiber contraction (GO:0031448)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|regulation of striated muscle contraction (GO:0006942)|relaxation of skeletal muscle (GO:0090076)|response to endoplasmic reticulum stress (GO:0034976)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|H zone (GO:0031673)|I band (GO:0031674)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	38						GGGCTTCAACCCACCAGACCT	0.667																																						dbGAP											0													67.0	77.0	74.0					16																	28913614		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10643.1, CCDS42139.1, CCDS66997.1	16p12.1	2012-10-22			ENSG00000196296	ENSG00000196296	3.6.3.8	"""ATPases / P-type"""	811	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 1"", ""calcium pump 1"""	108730		ATP2A			Standard	NM_004320		Approved	SERCA1	uc002dro.1	O14983	OTTHUMG00000131760	ENST00000357084.3:c.2431C>T	16.37:g.28913614C>T	ENSP00000349595:p.Pro811Ser		A8K5J9|B3KY17|O14984	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,tigrfam_ATPase_P-typ_Ca-transp,tigrfam_ATPase_P-typ_ion-transptr	p.P811S	ENST00000357084.3	37	c.2431	CCDS10643.1	16	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817865	0.90790	.	.	ENSG00000196296	ENST00000357084;ENST00000395503;ENST00000536376	D;D;D	0.96522	-2.66;-2.66;-4.04	4.95	4.95	0.65309	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98713	0.9568	H	0.96269	3.795	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.994	D;D;D	0.71870	0.975;0.959;0.93	D	0.99624	1.0984	10	0.87932	D	0	.	17.0954	0.86633	0.0:1.0:0.0:0.0	.	686;811;811	B3KY17;O14983;O14983-2	.;AT2A1_HUMAN;.	S	811;811;686	ENSP00000349595:P811S;ENSP00000378879:P811S;ENSP00000443101:P686S	ENSP00000349595:P811S	P	+	1	0	ATP2A1	28821115	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.627000	0.83176	2.566000	0.86566	0.561000	0.74099	CCA	ATP2A1	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Ca-transp	ENSG00000196296		0.667	ATP2A1-001	KNOWN	basic|CCDS	protein_coding	ATP2A1	HGNC	protein_coding	OTTHUMT00000254686.2	162	0.00	0	C	NM_004320		28913614	28913614	+1	no_errors	ENST00000357084	ensembl	human	known	69_37n	missense	112	25.83	39	SNP	1.000	T
AXIN2	8313	genome.wustl.edu	37	17	63533717	63533717	+	Silent	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr17:63533717G>A	ENST00000375702.5	-	5	1545	c.1437C>T	c.(1435-1437)tcC>tcT	p.S479S	AXIN2_ENST00000307078.5_Silent_p.S479S			Q9Y2T1	AXIN2_HUMAN	axin 2	479					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						GCGGGAGCAGGGAGTGGTACT	0.706									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																													dbGAP											0													24.0	24.0	24.0					17																	63533717		2196	4276	6472	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1437C>T	17.37:g.63533717G>A			Q3MJ88|Q9H3M6|Q9UH84	Silent	SNP	pfam_DIX,pfam_Regulat_G_prot_signal,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.S479	ENST00000375702.5	37	c.1437		17																																																																																			AXIN2	-	NULL	ENSG00000168646		0.706	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	HGNC	protein_coding	OTTHUMT00000445901.1	46	0.00	0	G	NM_004655		63533717	63533717	-1	no_errors	ENST00000307078	ensembl	human	known	69_37n	silent	35	22.22	10	SNP	0.007	A
BAZ2B	29994	genome.wustl.edu	37	2	160319659	160319659	+	Intron	SNP	G	G	A	rs6708006	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:160319659G>A	ENST00000392783.2	-	4	641				BAZ2B_ENST00000355831.2_Intron|BAZ2B_ENST00000483316.1_5'UTR|BAZ2B_ENST00000392782.1_Intron|BAZ2B_ENST00000343439.5_Intron	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CATAGTAGCCGAATATCACTG	0.428													G|||	357	0.0712859	0.149	0.049	5008	,	,		19720	0.002		0.0507	False		,,,				2504	0.0746					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.146-9347C>T	2.37:g.160319659G>A			D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	RNA	SNP	-	NULL	ENST00000392783.2	37	NULL	CCDS2209.2	2																																																																																			BAZ2B	-	-	ENSG00000123636		0.428	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	9	0.00	0	G			160319659	160319659	-1	no_errors	ENST00000483316	ensembl	human	known	69_37n	rna	3	62.50	5	SNP	0.095	A
BCL7C	9274	genome.wustl.edu	37	16	30904206	30904206	+	Missense_Mutation	SNP	C	C	T	rs35860871		TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:30904206C>T	ENST00000215115.4	-	3	1250	c.235G>A	c.(235-237)Gcc>Acc	p.A79T	MIR4519_ENST00000565573.1_RNA|MIR4519_ENST00000570025.1_RNA|AC106782.20_ENST00000572471.1_RNA|MIR762_ENST00000390236.1_RNA|MIR4519_ENST00000564901.1_RNA|BCL7C_ENST00000380317.4_Missense_Mutation_p.A79T	NM_004765.2	NP_004756.2	Q8WUZ0	BCL7C_HUMAN	B-cell CLL/lymphoma 7C	79					apoptotic process (GO:0006915)					large_intestine(1)|lung(3)|prostate(1)|skin(1)	6			Colorectal(24;0.198)			CGGGGACTGGCGCCCCTGCCC	0.642																																						dbGAP											0													50.0	63.0	59.0					16																	30904206		2197	4299	6496	-	-	-	SO:0001583	missense	0			AJ223980	CCDS10693.1, CCDS67012.1	16p11	2012-11-19			ENSG00000099385	ENSG00000099385			1006	protein-coding gene	gene with protein product		605847				9931421	Standard	NM_004765		Approved		uc002dzv.3	Q8WUZ0	OTTHUMG00000177719	ENST00000215115.4:c.235G>A	16.37:g.30904206C>T	ENSP00000215115:p.Ala79Thr		O43770|Q6PD89	Missense_Mutation	SNP	pfam_BCL7	p.A79T	ENST00000215115.4	37	c.235	CCDS10693.1	16	.	.	.	.	.	.	.	.	.	.	C	6.516	0.463437	0.12402	.	.	ENSG00000099385	ENST00000380317;ENST00000215115	T;T	0.40756	1.02;1.11	5.08	-0.969	0.10310	.	0.591860	0.14595	N	0.309991	T	0.18467	0.0443	L	0.29908	0.895	0.09310	N	0.999999	B;B	0.10296	0.0;0.003	B;B	0.04013	0.0;0.001	T	0.24870	-1.0148	10	0.02654	T	1	-25.9882	0.8255	0.01120	0.1758:0.3882:0.149:0.287	.	79;79	Q8WUZ0;Q8WUZ0-2	BCL7C_HUMAN;.	T	79	ENSP00000369674:A79T;ENSP00000215115:A79T	ENSP00000215115:A79T	A	-	1	0	BCL7C	30811707	0.004000	0.15560	0.229000	0.23960	0.994000	0.84299	-0.285000	0.08410	-0.075000	0.12798	0.561000	0.74099	GCC	BCL7C	-	NULL	ENSG00000099385		0.642	BCL7C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL7C	HGNC	protein_coding	OTTHUMT00000255547.3	36	0.00	0	C	NM_004765		30904206	30904206	-1	no_errors	ENST00000380317	ensembl	human	known	69_37n	missense	17	41.38	12	SNP	0.130	T
BEST4	266675	genome.wustl.edu	37	1	45253311	45253311	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:45253311G>A	ENST00000372207.3	-	1	66	c.67C>T	c.(67-69)Cgc>Tgc	p.R23C		NM_153274.2	NP_695006.1	Q8NFU0	BEST4_HUMAN	bestrophin 4	23						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			large_intestine(1)|lung(4)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)					CCCCTCCAGCGGAGAAGCAGG	0.577																																						dbGAP											0													88.0	99.0	95.0					1																	45253311		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF440757	CCDS514.1	1p33-p32.3	2012-09-26	2006-10-18	2006-10-18	ENSG00000142959	ENSG00000142959		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17106	protein-coding gene	gene with protein product		607336	"""vitelliform macular dystrophy 2-like 2"""	VMD2L2		12032738, 16702355	Standard	NM_153274		Approved		uc001cmm.3	Q8NFU0	OTTHUMG00000008488	ENST00000372207.3:c.67C>T	1.37:g.45253311G>A	ENSP00000361281:p.Arg23Cys		Q5JR93	Missense_Mutation	SNP	pfam_Bestrophin/UPF0187	p.R23C	ENST00000372207.3	37	c.67	CCDS514.1	1	.	.	.	.	.	.	.	.	.	.	G	6.028	0.373487	0.11409	.	.	ENSG00000142959	ENST00000372207	D	0.98901	-5.22	4.68	2.71	0.32032	.	0.194192	0.37809	N	0.001924	D	0.97288	0.9113	M	0.83384	2.64	0.26146	N	0.980209	P	0.37636	0.603	B	0.35899	0.213	D	0.93725	0.7036	10	0.51188	T	0.08	-7.0986	7.2153	0.25957	0.0:0.1691:0.4827:0.3482	.	23	Q8NFU0	BEST4_HUMAN	C	23	ENSP00000361281:R23C	ENSP00000361281:R23C	R	-	1	0	BEST4	45025898	0.516000	0.26218	0.073000	0.20177	0.153000	0.21895	0.768000	0.26590	0.521000	0.28445	0.655000	0.94253	CGC	BEST4	-	pfam_Bestrophin/UPF0187	ENSG00000142959		0.577	BEST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEST4	HGNC	protein_coding	OTTHUMT00000023425.1	40	0.00	0	G	NM_153274		45253311	45253311	-1	no_errors	ENST00000372207	ensembl	human	known	69_37n	missense	82	13.68	13	SNP	0.063	A
BLOC1S3	388552	genome.wustl.edu	37	19	45683173	45683173	+	3'UTR	SNP	T	T	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:45683173T>A	ENST00000433642.2	+	0	715				BLOC1S3_ENST00000587722.1_3'UTR|BLOC1S3_ENST00000588362.1_3'UTR|AC005779.2_ENST00000593083.1_3'UTR|TRAPPC6A_ENST00000592647.1_5'Flank|TRAPPC6A_ENST00000588062.1_5'Flank|TRAPPC6A_ENST00000006275.4_5'Flank|TRAPPC6A_ENST00000585934.1_5'Flank	NM_212550.3	NP_997715.1	Q6QNY0	BL1S3_HUMAN	biogenesis of lysosomal organelles complex-1, subunit 3						anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to melanosome transport (GO:0035646)|eye development (GO:0001654)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of natural killer cell activation (GO:0032816)|post-Golgi vesicle-mediated transport (GO:0006892)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)	BLOC-1 complex (GO:0031083)|cytosol (GO:0005829)|transport vesicle (GO:0030133)				ovary(1)|skin(1)	2		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		GCCATGATTCTACTTCCCAAC	0.642									Hermansky-Pudlak syndrome																													dbGAP											0													27.0	23.0	24.0					19																	45683173		1818	3731	5549	-	-	-	SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	HPS, HPS1-8	AY531266	CCDS12656.1	19q13.32	2012-08-01	2008-08-11			ENSG00000189114		"""Biogenesis of lysosomal organelles complex-1 subunits"""	20914	protein-coding gene	gene with protein product	"""BLOC-1 subunit 3"", ""Biogenesis of Lysosome-related Organelles complex-1 Subunit 3"", ""Hermansky-Pudlak syndrome 8"""	609762				15102850	Standard	NM_212550		Approved	BLOS3, HPS8	uc002pax.4	Q6QNY0		ENST00000433642.2:c.*10T>A	19.37:g.45683173T>A			B2RXB8	RNA	SNP	-	NULL	ENST00000433642.2	37	NULL	CCDS12656.1	19																																																																																			BLOC1S3	-	-	ENSG00000189114		0.642	BLOC1S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLOC1S3	HGNC	protein_coding	OTTHUMT00000457559.1	35	0.00	0	T	NM_212550		45683173	45683173	+1	no_errors	ENST00000588362	ensembl	human	putative	69_37n	rna	7	41.67	5	SNP	0.001	A
CCDC7	79741	genome.wustl.edu	37	10	32983901	32983901	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr10:32983901T>C	ENST00000375030.2	+	9	1002	c.384T>C	c.(382-384)ccT>ccC	p.P128P	C10orf68_ENST00000375028.3_Intron|C10orf68_ENST00000375025.4_Silent_p.P120P			Q9H943	CJ068_HUMAN		120										breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(4)	29						AAAAACTTCCTAGAGAGAAAA	0.284																																						dbGAP											0													32.0	31.0	31.0					10																	32983901		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000375030.2:c.384T>C	10.37:g.32983901T>C			B0QZ71|Q08AN7|Q8N7T7	Silent	SNP	NULL	p.P120	ENST00000375030.2	37	c.360		10																																																																																			C10orf68	-	NULL	ENSG00000150076		0.284	C10orf68-001	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	C10orf68	HGNC	protein_coding	OTTHUMT00000313999.2	14	0.00	0	T			32983901	32983901	+1	no_errors	ENST00000375025	ensembl	human	known	69_37n	silent	13	40.91	9	SNP	0.000	C
C1orf87	127795	genome.wustl.edu	37	1	60521024	60521024	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:60521024G>T	ENST00000371201.3	-	3	301	c.194C>A	c.(193-195)aCc>aAc	p.T65N	C1orf87_ENST00000450089.2_Missense_Mutation_p.T65N	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	65							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GGGAACTGGGGTGTCTCTGCT	0.418																																					NSCLC(75;811 1386 4923 13371 51772)	dbGAP											0													379.0	323.0	342.0					1																	60521024		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.194C>A	1.37:g.60521024G>T	ENSP00000360244:p.Thr65Asn		Q6ZU07|Q8IVS0	Missense_Mutation	SNP	NULL	p.T65N	ENST00000371201.3	37	c.194	CCDS614.1	1	.	.	.	.	.	.	.	.	.	.	G	11.75	1.731450	0.30684	.	.	ENSG00000162598	ENST00000371201;ENST00000450089	T	0.17213	2.29	4.86	2.52	0.30459	.	0.593098	0.15159	N	0.277265	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.30475	-0.9977	10	0.40728	T	0.16	0.7371	6.3632	0.21441	0.2773:0.0:0.7227:0.0	.	65	Q8N0U7	CA087_HUMAN	N	65	ENSP00000360244:T65N	ENSP00000360244:T65N	T	-	2	0	C1orf87	60293612	0.893000	0.30496	0.000000	0.03702	0.394000	0.30568	2.998000	0.49465	0.501000	0.28013	0.591000	0.81541	ACC	C1orf87	-	NULL	ENSG00000162598		0.418	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	HGNC	protein_coding	OTTHUMT00000024943.1	184	0.00	0	G	NM_152377		60521024	60521024	-1	no_errors	ENST00000371201	ensembl	human	known	69_37n	missense	386	14.79	67	SNP	0.000	T
C6	729	genome.wustl.edu	37	5	41158826	41158826	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:41158826C>A	ENST00000263413.3	-	13	2182	c.1918G>T	c.(1918-1920)Gca>Tca	p.A640S	C6_ENST00000475349.1_5'Flank|C6_ENST00000337836.5_Missense_Mutation_p.A640S	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	640	CCP 1.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CCGGAATCTGCTTCTATCTCA	0.393																																						dbGAP											0													107.0	110.0	109.0					5																	41158826		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1918G>T	5.37:g.41158826C>A	ENSP00000263413:p.Ala640Ser			Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal-type_dom,superfamily_Complement_control_module,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.A640S	ENST00000263413.3	37	c.1918	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	7.646	0.681851	0.14907	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.61274	0.12;0.12	6.16	-5.18	0.02840	Complement control module (1);	1.193850	0.05727	N	0.598946	T	0.24699	0.0599	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.08027	-1.0742	10	0.19590	T	0.45	-0.5926	1.6761	0.02822	0.1873:0.3966:0.1306:0.2855	.	640	P13671	CO6_HUMAN	S	640	ENSP00000338861:A640S;ENSP00000263413:A640S	ENSP00000263413:A640S	A	-	1	0	C6	41194583	0.956000	0.32656	0.286000	0.24833	0.868000	0.49771	0.431000	0.21444	-0.860000	0.04099	-0.175000	0.13238	GCA	C6	-	superfamily_Complement_control_module	ENSG00000039537		0.393	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	40	0.00	0	C			41158826	41158826	-1	no_errors	ENST00000263413	ensembl	human	known	69_37n	missense	38	49.33	37	SNP	0.062	A
C7orf72	100130988	genome.wustl.edu	37	7	50135833	50135833	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:50135833A>G	ENST00000297001.6	+	1	202	c.152A>G	c.(151-153)cAt>cGt	p.H51R	ZPBP_ENST00000046087.2_5'Flank	NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	51										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						GAGAACAGACATAACTATGGC	0.368																																						dbGAP											0													88.0	88.0	88.0					7																	50135833		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.152A>G	7.37:g.50135833A>G	ENSP00000297001:p.His51Arg		A6NDX9	Missense_Mutation	SNP	NULL	p.H51R	ENST00000297001.6	37	c.152	CCDS47585.1	7	.	.	.	.	.	.	.	.	.	.	A	18.33	3.601296	0.66445	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	T	0.62865	0.2463	L	0.50333	1.59	0.29944	N	0.820848	D	0.89917	1.0	D	0.91635	0.999	T	0.61412	-0.7068	7	.	.	.	-5.403	13.6617	0.62372	1.0:0.0:0.0:0.0	.	51	A4D263	CG072_HUMAN	R	51	.	.	H	+	2	0	C7orf72	50106379	0.999000	0.42202	0.957000	0.39632	0.938000	0.57974	5.270000	0.65547	2.163000	0.67991	0.402000	0.26972	CAT	C7orf72	-	NULL	ENSG00000164500		0.368	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf72	HGNC	protein_coding	OTTHUMT00000342124.1	74	0.00	0	A	NM_001161834		50135833	50135833	+1	no_errors	ENST00000297001	ensembl	human	known	69_37n	missense	64	31.18	29	SNP	0.980	G
C9orf114	51490	genome.wustl.edu	37	9	131592034	131592034	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:131592034G>C	ENST00000361256.5	-	1	66	c.26C>G	c.(25-27)cCg>cGg	p.P9R		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	9							poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|ovary(1)	7						CGGGCCGCACGGCCGCTTCCT	0.721																																						dbGAP											0													12.0	13.0	13.0					9																	131592034		2185	4282	6467	-	-	-	SO:0001583	missense	0				CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.26C>G	9.37:g.131592034G>C	ENSP00000354812:p.Pro9Arg		Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Missense_Mutation	SNP	pfam_Put_MeTrfase,superfamily_NA-bd_OB-fold-like	p.P9R	ENST00000361256.5	37	c.26	CCDS6913.1	9	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323655	0.60634	.	.	ENSG00000198917	ENST00000361256;ENST00000372618	T	0.24350	1.86	5.26	5.26	0.73747	.	0.624518	0.16772	N	0.200159	T	0.37404	0.1002	L	0.40543	1.245	0.40538	D	0.980996	D;D	0.63880	0.993;0.993	P;P	0.58620	0.842;0.842	T	0.02269	-1.1185	10	0.23302	T	0.38	-8.1637	16.717	0.85399	0.0:0.0:1.0:0.0	.	9;9	E7ESY7;Q5T280	.;CI114_HUMAN	R	9	ENSP00000354812:P9R	ENSP00000354812:P9R	P	-	2	0	C9orf114	130631855	0.997000	0.39634	0.899000	0.35326	0.083000	0.17756	3.349000	0.52217	2.608000	0.88229	0.655000	0.94253	CCG	C9orf114	-	NULL	ENSG00000198917		0.721	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf114	HGNC	protein_coding	OTTHUMT00000054500.1	47	0.00	0	G	NM_016390		131592034	131592034	-1	no_errors	ENST00000361256	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	0.988	C
CAMSAP3	57662	genome.wustl.edu	37	19	7676785	7676785	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:7676785C>T	ENST00000160298.4	+	11	1507	c.1406C>T	c.(1405-1407)gCc>gTc	p.A469V	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.A496V	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	469	Pro-rich.				epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						ATCCACAGTGCCGAGCCCCGG	0.731																																						dbGAP											0													23.0	29.0	27.0					19																	7676785		1921	4112	6033	-	-	-	SO:0001583	missense	0			AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1406C>T	19.37:g.7676785C>T	ENSP00000160298:p.Ala469Val		Q8NDF1	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.A496V	ENST00000160298.4	37	c.1487	CCDS42489.1	19	.	.	.	.	.	.	.	.	.	.	c	11.02	1.515251	0.27123	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.13901	2.55;2.55	4.47	4.47	0.54385	.	0.335360	0.30732	N	0.008989	T	0.10895	0.0266	N	0.25647	0.755	0.24473	N	0.994382	B;B	0.17268	0.007;0.021	B;B	0.15484	0.003;0.013	T	0.16808	-1.0390	10	0.56958	D	0.05	-15.9799	12.4958	0.55927	0.0:0.8301:0.1699:0.0	.	469;496	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	V	496;469	ENSP00000416797:A496V;ENSP00000160298:A469V	ENSP00000160298:A469V	A	+	2	0	KIAA1543	7582785	0.011000	0.17503	0.995000	0.50966	0.685000	0.39939	1.828000	0.39111	2.031000	0.59945	0.544000	0.68410	GCC	CAMSAP3	-	NULL	ENSG00000076826		0.731	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAMSAP3	HGNC	protein_coding	OTTHUMT00000459300.1	33	0.00	0	C	XM_048362		7676785	7676785	+1	no_errors	ENST00000446248	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	0.908	T
CARD6	84674	genome.wustl.edu	37	5	40843354	40843354	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:40843354T>C	ENST00000254691.5	+	2	583	c.384T>C	c.(382-384)ccT>ccC	p.P128P	CARD6_ENST00000381677.3_Silent_p.P128P	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	128					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						CTGAAGCCCCTGAGATCACAG	0.408																																						dbGAP											0													52.0	55.0	54.0					5																	40843354		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.384T>C	5.37:g.40843354T>C			Q52LR2	Silent	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.P128	ENST00000254691.5	37	c.384	CCDS3935.1	5																																																																																			CARD6	-	NULL	ENSG00000132357		0.408	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	HGNC	protein_coding	OTTHUMT00000211584.3	20	0.00	0	T			40843354	40843354	+1	no_errors	ENST00000254691	ensembl	human	known	69_37n	silent	38	24.00	12	SNP	0.086	C
CAT	847	genome.wustl.edu	37	11	34470811	34470811	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:34470811C>G	ENST00000241052.4	+	2	228	c.139C>G	c.(139-141)Cgt>Ggt	p.R47G		NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase	47					aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	AGTAGGGCCCCGTGGGCCCCT	0.478																																						dbGAP											0													90.0	92.0	91.0					11																	34470811		2202	4298	6500	-	-	-	SO:0001583	missense	0			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.139C>G	11.37:g.34470811C>G	ENSP00000241052:p.Arg47Gly		A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	Missense_Mutation	SNP	pfam_Catalase_core,pfam_Catalase_immune_responsive,superfamily_Catalase-like_dom,prints_Catalase	p.R47G	ENST00000241052.4	37	c.139	CCDS7891.1	11	.	.	.	.	.	.	.	.	.	.	C	21.4	4.140109	0.77775	.	.	ENSG00000121691	ENST00000241052	D	0.92397	-3.03	6.02	5.09	0.68999	Catalase domain (1);Catalase, N-terminal (2);	0.178850	0.47852	D	0.000201	D	0.95677	0.8594	M	0.82056	2.57	0.80722	D	1	P	0.49447	0.924	P	0.60541	0.876	D	0.96042	0.9025	10	0.72032	D	0.01	-11.011	16.542	0.84395	0.1316:0.8684:0.0:0.0	.	47	P04040	CATA_HUMAN	G	47	ENSP00000241052:R47G	ENSP00000241052:R47G	R	+	1	0	CAT	34427387	0.978000	0.34361	0.109000	0.21407	0.689000	0.40095	2.680000	0.46918	1.510000	0.48803	0.655000	0.94253	CGT	CAT	-	pfam_Catalase_core,superfamily_Catalase-like_dom,prints_Catalase	ENSG00000121691		0.478	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAT	HGNC	protein_coding	OTTHUMT00000103197.2	53	0.00	0	C	NM_001752		34470811	34470811	+1	no_errors	ENST00000241052	ensembl	human	known	69_37n	missense	65	22.62	19	SNP	0.897	G
CCDC27	148870	genome.wustl.edu	37	1	3677858	3677858	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:3677858C>T	ENST00000294600.2	+	5	809	c.725C>T	c.(724-726)tCt>tTt	p.S242F		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	242										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CACTGCCTGTCTGAGCTGGAG	0.597																																						dbGAP											0													68.0	65.0	66.0					1																	3677858		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.725C>T	1.37:g.3677858C>T	ENSP00000294600:p.Ser242Phe		Q5TBV3|Q96M50	Missense_Mutation	SNP	superfamily_Prefoldin	p.S242F	ENST00000294600.2	37	c.725	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	C	8.655	0.899241	0.17686	.	.	ENSG00000162592	ENST00000294600	T	0.20332	2.08	3.75	2.81	0.32909	.	0.179015	0.27535	N	0.018932	T	0.30665	0.0772	L	0.32530	0.975	0.09310	N	1	D	0.76494	0.999	D	0.71414	0.973	T	0.03212	-1.1060	10	0.72032	D	0.01	-3.9808	9.7152	0.40270	0.0:0.7866:0.2134:0.0	.	242	Q2M243	CCD27_HUMAN	F	242	ENSP00000294600:S242F	ENSP00000294600:S242F	S	+	2	0	CCDC27	3667718	0.966000	0.33281	0.002000	0.10522	0.005000	0.04900	3.425000	0.52771	0.875000	0.35847	-0.300000	0.09419	TCT	CCDC27	-	NULL	ENSG00000162592		0.597	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1	42	0.00	0	C	NM_152492		3677858	3677858	+1	no_errors	ENST00000294600	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.006	T
CCDC91	55297	genome.wustl.edu	37	12	28605484	28605484	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:28605484A>G	ENST00000545336.1	+	14	1417	c.998A>G	c.(997-999)cAt>cGt	p.H333R	CCDC91_ENST00000381259.1_Missense_Mutation_p.H333R|CCDC91_ENST00000306172.5_Missense_Mutation_p.H303R|CCDC91_ENST00000381256.1_Missense_Mutation_p.H297R|CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000539107.1_Missense_Mutation_p.H297R			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	333	Homodimerization.				protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					GAAAAAGCGCATGCTGAAGAA	0.308																																						dbGAP											0													65.0	74.0	71.0					12																	28605484		2202	4291	6493	-	-	-	SO:0001583	missense	0			AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.998A>G	12.37:g.28605484A>G	ENSP00000438040:p.His333Arg		B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Missense_Mutation	SNP	NULL	p.H333R	ENST00000545336.1	37	c.998	CCDS8716.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.94|18.94	3.729844|3.729844	0.69074|0.69074	.|.	.|.	ENSG00000123106|ENSG00000123106	ENST00000536154;ENST00000539107;ENST00000536442;ENST00000545336;ENST00000545737;ENST00000381259;ENST00000381256;ENST00000306172;ENST00000535212|ENST00000542801	T;T;T;T;T;T;T;T;T|.	0.51071|.	1.28;1.05;1.3;1.44;1.3;1.44;1.05;1.42;0.72|.	5.43|5.43	5.43|5.43	0.79202|0.79202	.|.	0.000000|.	0.64402|.	D|.	0.000005|.	T|T	0.45915|0.45915	0.1366|0.1366	N|N	0.24115|0.24115	0.695|0.695	0.33965|0.33965	D|D	0.646119|0.646119	D;D;D|.	0.76494|.	0.989;0.999;0.999|.	D;D;D|.	0.80764|.	0.978;0.994;0.994|.	T|T	0.57015|0.57015	-0.7883|-0.7883	10|5	0.22109|.	T|.	0.4|.	-12.8623|-12.8623	13.5104|13.5104	0.61508|0.61508	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	297;333;303|.	Q7Z6B0-3;Q7Z6B0;Q7Z6B0-2|.	.;CCD91_HUMAN;.|.	R|V	73;297;333;333;333;333;297;303;32|4	ENSP00000444440:H73R;ENSP00000440513:H297R;ENSP00000445660:H333R;ENSP00000438040:H333R;ENSP00000442544:H333R;ENSP00000370658:H333R;ENSP00000370655:H297R;ENSP00000305075:H303R;ENSP00000445999:H32R|.	ENSP00000305075:H303R|.	H|M	+|+	2|1	0|0	CCDC91|CCDC91	28496751|28496751	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.977000|0.977000	0.68977|0.68977	5.352000|5.352000	0.66028|0.66028	2.178000|2.178000	0.69098|0.69098	0.477000|0.477000	0.44152|0.44152	CAT|ATG	CCDC91	-	NULL	ENSG00000123106		0.308	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC91	HGNC	protein_coding	OTTHUMT00000402447.1	16	0.00	0	A	NM_018318		28605484	28605484	+1	no_errors	ENST00000381259	ensembl	human	known	69_37n	missense	17	48.48	16	SNP	1.000	G
CDH9	1007	genome.wustl.edu	37	5	26906194	26906194	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:26906194T>C	ENST00000231021.4	-	5	857	c.685A>G	c.(685-687)Aga>Gga	p.R229G		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	229	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TACTGCTCTCTATTTTCTCTG	0.413																																					Melanoma(8;187 585 15745 40864 52829)	dbGAP											0													236.0	208.0	217.0					5																	26906194		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.685A>G	5.37:g.26906194T>C	ENSP00000231021:p.Arg229Gly		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R229G	ENST00000231021.4	37	c.685	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	T	15.35	2.807526	0.50421	.	.	ENSG00000113100	ENST00000231021	T	0.53640	0.61	5.6	-1.87	0.07737	Cadherin (4);Cadherin-like (1);	0.149645	0.56097	D	0.000032	T	0.48132	0.1483	M	0.63843	1.955	0.26587	N	0.973279	B	0.26708	0.157	B	0.36418	0.224	T	0.50197	-0.8856	9	.	.	.	.	17.837	0.88700	0.0:0.0:0.7237:0.2763	.	229	Q9ULB4	CADH9_HUMAN	G	229	ENSP00000231021:R229G	.	R	-	1	2	CDH9	26941951	0.983000	0.35010	0.020000	0.16555	0.995000	0.86356	1.760000	0.38430	-0.436000	0.07254	0.528000	0.53228	AGA	CDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113100		0.413	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	79	0.00	0	T	NM_016279		26906194	26906194	-1	no_errors	ENST00000231021	ensembl	human	known	69_37n	missense	132	17.50	28	SNP	0.368	C
CEP95	90799	genome.wustl.edu	37	17	62530746	62530746	+	Nonsense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr17:62530746C>G	ENST00000556440.2	+	17	2471	c.1961C>G	c.(1960-1962)tCa>tGa	p.S654*	CEP95_ENST00000553412.1_Nonsense_Mutation_p.S490*	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	654						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						TTGACCCAATCAAAGATAAAA	0.423																																						dbGAP											0													102.0	96.0	98.0					17																	62530746		1887	4115	6002	-	-	-	SO:0001587	stop_gained	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1961C>G	17.37:g.62530746C>G	ENSP00000450461:p.Ser654*		B4DMD2|Q96M81	Nonsense_Mutation	SNP	superfamily_CH-domain	p.S654*	ENST00000556440.2	37	c.1961	CCDS45763.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.864540	0.97897	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	.	.	.	5.75	4.77	0.60923	.	0.388589	0.23906	N	0.043398	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-11.9243	8.5048	0.33181	0.2485:0.6722:0.0:0.0793	.	.	.	.	X	589;654;490	.	ENSP00000438458:S589X	S	+	2	0	CEP95	59961208	1.000000	0.71417	1.000000	0.80357	0.056000	0.15407	1.995000	0.40767	2.866000	0.98385	0.650000	0.86243	TCA	CEP95	-	NULL	ENSG00000258890		0.423	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	55	0.00	0	C	NM_138363		62530746	62530746	+1	no_errors	ENST00000556440	ensembl	human	known	69_37n	nonsense	50	23.08	15	SNP	0.997	G
CEP97	79598	genome.wustl.edu	37	3	101476918	101476918	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:101476918A>G	ENST00000341893.3	+	9	2220	c.1468A>G	c.(1468-1470)Atc>Gtc	p.I490V	CEP97_ENST00000327230.4_Missense_Mutation_p.I490V|CEP97_ENST00000494050.1_Missense_Mutation_p.I431V			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	490	CCP110-binding.				cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						GCCAACAATAATCAGTGCTAT	0.373																																						dbGAP											0													115.0	118.0	117.0					3																	101476918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.1468A>G	3.37:g.101476918A>G	ENSP00000342510:p.Ile490Val		B5MDY8|Q8NA71|Q9H5T9	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.I490V	ENST00000341893.3	37	c.1468	CCDS2944.1	3	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.644155	0.00792	.	.	ENSG00000182504	ENST00000341893;ENST00000327230;ENST00000494050	T;T;T	0.49720	0.85;0.79;0.77	5.37	-0.324	0.12706	.	0.952137	0.08884	N	0.879577	T	0.27559	0.0677	N	0.24115	0.695	0.09310	N	1	B;B;B	0.10296	0.003;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.25606	-1.0127	10	0.02654	T	1	0.0011	9.6313	0.39780	0.5616:0.0:0.4384:0.0	.	431;490;490	E9PG22;Q8IW35-2;Q8IW35	.;.;CEP97_HUMAN	V	490;490;431	ENSP00000342510:I490V;ENSP00000325881:I490V;ENSP00000418185:I431V	ENSP00000325881:I490V	I	+	1	0	CEP97	102959608	0.000000	0.05858	0.001000	0.08648	0.041000	0.13682	0.028000	0.13644	0.033000	0.15463	0.254000	0.18369	ATC	CEP97	-	NULL	ENSG00000182504		0.373	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP97	HGNC	protein_coding	OTTHUMT00000353597.2	44	0.00	0	A	NM_024548		101476918	101476918	+1	no_errors	ENST00000327230	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	0.000	G
COL19A1	1310	genome.wustl.edu	37	6	70881901	70881901	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:70881901G>A	ENST00000322773.4	+	41	2716	c.2614G>A	c.(2614-2616)Ggt>Agt	p.G872S	COL19A1_ENST00000393344.1_Missense_Mutation_p.G494S	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	872	Collagen-like 9.|Triple-helical region 5 (COL5).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						AGGATTTCCAGGTGTAAAGGT	0.368																																						dbGAP											0													106.0	108.0	107.0					6																	70881901		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.2614G>A	6.37:g.70881901G>A	ENSP00000316030:p.Gly872Ser		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.G872S	ENST00000322773.4	37	c.2614	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907977	0.72868	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.99329	-5.75;-5.75	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.99739	0.9897	H	0.97829	4.085	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.97647	1.0152	10	0.62326	D	0.03	.	18.8014	0.92018	0.0:0.0:1.0:0.0	.	872	Q14993	COJA1_HUMAN	S	872;494	ENSP00000316030:G872S;ENSP00000377013:G494S	ENSP00000316030:G872S	G	+	1	0	COL19A1	70938622	1.000000	0.71417	0.999000	0.59377	0.778000	0.44026	7.567000	0.82357	2.882000	0.98803	0.655000	0.94253	GGT	COL19A1	-	pfam_Collagen	ENSG00000082293		0.368	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	53	0.00	0	G			70881901	70881901	+1	no_errors	ENST00000322773	ensembl	human	known	69_37n	missense	61	24.69	20	SNP	1.000	A
COL27A1	85301	genome.wustl.edu	37	9	117068771	117068771	+	Intron	SNP	T	T	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:117068771T>A	ENST00000356083.3	+	58	5329					NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1						extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GACCCTAAGGTCCCAATGACC	0.577											OREG0019417	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													45.0	46.0	46.0					9																	117068771		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4939-29T>A	9.37:g.117068771T>A		1478	Q66K43|Q96JF7	RNA	SNP	-	NULL	ENST00000356083.3	37	NULL	CCDS6802.1	9																																																																																			COL27A1	-	-	ENSG00000196739		0.577	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1	58	0.00	0	T	NM_032888		117068771	117068771	+1	no_errors	ENST00000490831	ensembl	human	putative	69_37n	rna	45	28.12	18	SNP	0.000	A
CORO2B	10391	genome.wustl.edu	37	15	69018290	69018290	+	Missense_Mutation	SNP	C	C	T	rs546189688		TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr15:69018290C>T	ENST00000566799.1	+	12	1449	c.1420C>T	c.(1420-1422)Cgc>Tgc	p.R474C	CORO2B_ENST00000543950.1_Missense_Mutation_p.R469C|CORO2B_ENST00000540068.1_Missense_Mutation_p.R469C|CORO2B_ENST00000261861.5_Missense_Mutation_p.R469C			Q9UQ03	COR2B_HUMAN	coronin, actin binding protein, 2B	474					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|membrane (GO:0016020)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			kidney(3)|large_intestine(13)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GAAAAACTTGCGCAACAGCCC	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17256	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													55.0	55.0	55.0					15																	69018290		2200	4298	6498	-	-	-	SO:0001583	missense	0			AB010098	CCDS53952.1, CCDS10229.2	15q22.31	2013-01-10	2001-11-28		ENSG00000103647	ENSG00000103647		"""Coronins"", ""WD repeat domain containing"""	2256	protein-coding gene	gene with protein product	"""clipin C"", ""coronin, actin-binding, 2B"""	605002	"""coronin, actin-binding protein, 2B"""			10224093, 10231032	Standard	NM_001190456		Approved	ClipinC, KIAA0925	uc021spj.1	Q9UQ03	OTTHUMG00000133288	ENST00000566799.1:c.1420C>T	15.37:g.69018290C>T	ENSP00000454783:p.Arg474Cys		A8K0W3|O94767|Q8TAN1	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R474C	ENST00000566799.1	37	c.1420	CCDS10229.2	15	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619263	0.66787	.	.	ENSG00000103647	ENST00000261861;ENST00000540068;ENST00000543950	T;T	0.61274	0.12;0.12	3.62	2.69	0.31865	.	0.121256	0.52532	D	0.000061	T	0.59528	0.2200	L	0.61218	1.895	0.58432	D	0.999997	D	0.64830	0.994	P	0.52758	0.708	T	0.59490	-0.7445	10	0.72032	D	0.01	-6.0309	5.4172	0.16380	0.1973:0.6932:0.0:0.1094	.	474	Q9UQ03	COR2B_HUMAN	C	474;469;469	ENSP00000446250:R469C;ENSP00000443819:R469C	ENSP00000261861:R474C	R	+	1	0	CORO2B	66805344	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.701000	0.61810	0.632000	0.30432	0.442000	0.29010	CGC	CORO2B	-	NULL	ENSG00000103647		0.527	CORO2B-203	KNOWN	basic|CCDS	protein_coding	CORO2B	HGNC	protein_coding		23	0.00	0	C	NM_006091		69018290	69018290	+1	no_errors	ENST00000566799	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	1.000	T
CRB1	23418	genome.wustl.edu	37	1	197390621	197390621	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:197390621C>A	ENST00000367400.3	+	6	1798	c.1663C>A	c.(1663-1665)Ctt>Att	p.L555I	CRB1_ENST00000538660.1_Missense_Mutation_p.L555I|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000543483.1_Missense_Mutation_p.L254I|CRB1_ENST00000367399.2_Missense_Mutation_p.L443I|CRB1_ENST00000535699.1_Missense_Mutation_p.L486I|CRB1_ENST00000544212.1_Missense_Mutation_p.L36I	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	555	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						GTCAAAGGTGCTTCTGTTCAT	0.448																																						dbGAP											0													127.0	127.0	127.0					1																	197390621		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1663C>A	1.37:g.197390621C>A	ENSP00000356370:p.Leu555Ile		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.L555I	ENST00000367400.3	37	c.1663	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	C	7.224	0.597905	0.13939	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483;ENST00000544212;ENST00000367401	T;T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-1.25;-1.25;-1.25	5.69	2.26	0.28386	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.78585	0.4306	M	0.64997	1.995	0.09310	N	1	P;B;D;B;B	0.54964	0.752;0.105;0.969;0.023;0.363	B;B;P;B;B	0.55260	0.255;0.038;0.772;0.007;0.168	T	0.64601	-0.6369	9	0.20046	T	0.44	.	6.2584	0.20887	0.2235:0.5829:0.12:0.0735	.	555;486;443;204;555	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	I	486;555;555;443;254;36;204	ENSP00000438786:L486I;ENSP00000438091:L555I;ENSP00000356370:L555I;ENSP00000356369:L443I;ENSP00000439579:L254I;ENSP00000444556:L36I	ENSP00000356369:L443I	L	+	1	0	CRB1	195657244	0.861000	0.29849	0.009000	0.14445	0.037000	0.13140	0.931000	0.28871	0.704000	0.31869	0.557000	0.71058	CTT	CRB1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000134376		0.448	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	42	0.00	0	C	NM_201253		197390621	197390621	+1	no_errors	ENST00000367400	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	0.001	A
CSNK1G1	53944	genome.wustl.edu	37	15	64495365	64495365	+	Silent	SNP	G	G	A	rs528335045		TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr15:64495365G>A	ENST00000303052.7	-	10	1446	c.1023C>T	c.(1021-1023)caC>caT	p.H341H	CTD-2116N17.1_ENST00000606793.1_Silent_p.H323H|CSNK1G1_ENST00000607537.1_Silent_p.H341H|CSNK1G1_ENST00000303032.6_Silent_p.H341H	NM_022048.3	NP_071331.2	Q9HCP0	KC1G1_HUMAN	casein kinase 1, gamma 1	341					Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|urinary_tract(1)	13						CAGAATCTACGTGAACTGACC	0.443													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19791	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													168.0	134.0	146.0					15																	64495365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB042562	CCDS10192.2	15q22.1-q22.31	2013-01-17			ENSG00000169118	ENSG00000169118			2454	protein-coding gene	gene with protein product		606274				11124537	Standard	NM_022048		Approved	CK1gamma1	uc002anf.3	Q9HCP0	OTTHUMG00000133019	ENST00000303052.7:c.1023C>T	15.37:g.64495365G>A			Q5JPH1|Q96AE9|Q9HCP1	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Casein_kinase-1_gamma_C,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.H341	ENST00000303052.7	37	c.1023	CCDS10192.2	15																																																																																			CSNK1G1	-	pfam_Casein_kinase-1_gamma_C	ENSG00000169118		0.443	CSNK1G1-001	KNOWN	basic|CCDS	protein_coding	CSNK1G1	HGNC	protein_coding	OTTHUMT00000256605.1	70	0.00	0	G	NM_022048		64495365	64495365	-1	no_errors	ENST00000303052	ensembl	human	known	69_37n	silent	30	36.17	17	SNP	1.000	A
CUEDC2	79004	genome.wustl.edu	37	10	104184498	104184498	+	Silent	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr10:104184498C>A	ENST00000369937.4	-	3	271	c.126G>T	c.(124-126)ctG>ctT	p.L42L	CUEDC2_ENST00000465409.1_5'Flank	NM_024040.2	NP_076945.2	Q9H467	CUED2_HUMAN	CUE domain containing 2	42						cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCGAGGGGCCCAGGTCCTCCA	0.587																																						dbGAP											0													52.0	56.0	55.0					10																	104184498		1923	4123	6046	-	-	-	SO:0001819	synonymous_variant	0			BC000262	CCDS41566.1	10q24.32	2008-10-23	2004-03-04	2004-03-05	ENSG00000107874	ENSG00000107874			28352	protein-coding gene	gene with protein product		614142	"""chromosome 10 open reading frame 66"""	C10orf66		12477932	Standard	NM_024040		Approved	MGC2491	uc001kvn.2	Q9H467	OTTHUMG00000018958	ENST00000369937.4:c.126G>T	10.37:g.104184498C>A			D3DR88|Q9BWG8	Silent	SNP	pfam_CUE,superfamily_UBA-like,pfscan_CUE	p.L42	ENST00000369937.4	37	c.126	CCDS41566.1	10																																																																																			CUEDC2	-	NULL	ENSG00000107874		0.587	CUEDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUEDC2	HGNC	protein_coding	OTTHUMT00000050060.1	23	0.00	0	C	NM_024040		104184498	104184498	-1	no_errors	ENST00000369937	ensembl	human	known	69_37n	silent	5	66.67	10	SNP	1.000	A
DCP1A	55802	genome.wustl.edu	37	3	53381533	53381533	+	Silent	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:53381533C>G	ENST00000607628.1	-	1	121	c.12G>C	c.(10-12)ctG>ctC	p.L4L	DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000606822.1_Silent_p.L4L|DCP1A_ENST00000294241.6_Silent_p.L4L	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	4					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		CAGCTCGACTCAGCGCCTCCA	0.612																																						dbGAP											0													70.0	83.0	79.0					3																	53381533		2140	4265	6405	-	-	-	SO:0001819	synonymous_variant	0			AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.12G>C	3.37:g.53381533C>G			B4DHN9|U3KQM8	RNA	SNP	-	NULL	ENST00000607628.1	37	NULL		3																																																																																			DCP1A	-	-	ENSG00000162290		0.612	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	DCP1A	HGNC	protein_coding		37	0.00	0	C	NM_018403		53381533	53381533	-1	no_errors	ENST00000294241	ensembl	human	known	69_37n	rna	7	53.33	8	SNP	0.987	G
DENND2D	79961	genome.wustl.edu	37	1	111740503	111740503	+	Intron	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:111740503G>C	ENST00000357640.4	-	4	656				DENND2D_ENST00000369752.5_Intron|CHI3L2_ENST00000445067.2_5'Flank|DENND2D_ENST00000473682.1_5'UTR	NM_024901.3	NP_079177.2	Q9H6A0	DEN2D_HUMAN	DENN/MADD domain containing 2D						positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(1)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	25		all_cancers(81;0.00198)|all_epithelial(167;0.000686)|all_lung(203;0.00318)|Lung NSC(277;0.00499)		Lung(183;0.0162)|Colorectal(144;0.069)|all cancers(265;0.0757)|LUSC - Lung squamous cell carcinoma(189;0.0845)|Epithelial(280;0.114)|COAD - Colon adenocarcinoma(174;0.14)		GAGCTGAGCAGACTGCAGAAA	0.557																																						dbGAP											0													56.0	51.0	53.0					1																	111740503		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS831.1, CCDS60219.1	1p13.3	2014-02-12	2005-08-17		ENSG00000162777	ENSG00000162777		"""DENN/MADD domain containing"""	26192	protein-coding gene	gene with protein product		615111				12477932	Standard	NM_024901		Approved	FLJ22457, RP5-1180E21.2	uc001eal.2	Q9H6A0	OTTHUMG00000012356	ENST00000357640.4:c.426+38C>G	1.37:g.111740503G>C			Q5T5V6|Q9BSU0	RNA	SNP	-	NULL	ENST00000357640.4	37	NULL	CCDS831.1	1																																																																																			DENND2D	-	-	ENSG00000162777		0.557	DENND2D-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND2D	HGNC	protein_coding	OTTHUMT00000034456.1	31	0.00	0	G	NM_024901		111740503	111740503	-1	no_errors	ENST00000473682	ensembl	human	known	69_37n	rna	28	28.21	11	SNP	0.000	C
DMXL2	23312	genome.wustl.edu	37	15	51756941	51756941	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr15:51756941A>T	ENST00000251076.5	-	32	8023	c.7736T>A	c.(7735-7737)cTt>cAt	p.L2579H	DMXL2_ENST00000543779.2_Missense_Mutation_p.L2580H|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000449909.3_Missense_Mutation_p.L1943H	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2579						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		TCCCACTGAAAGGTCAGTTGG	0.398																																						dbGAP											0													119.0	110.0	114.0					15																	51756941		2196	4293	6489	-	-	-	SO:0001583	missense	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7736T>A	15.37:g.51756941A>T	ENSP00000251076:p.Leu2579His		B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L2580H	ENST00000251076.5	37	c.7739	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	A	16.60	3.169786	0.57584	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.23950	2.02;2.02;1.88	5.25	4.05	0.47172	.	0.190957	0.46442	D	0.000295	T	0.28001	0.0690	L	0.54323	1.7	0.38689	D	0.952717	D;D;P;P	0.63880	0.971;0.993;0.951;0.65	P;P;B;B	0.49999	0.599;0.628;0.395;0.403	T	0.04128	-1.0975	10	0.27082	T	0.32	.	6.9873	0.24735	0.7448:0.1426:0.1126:0.0	.	2580;1943;2579;2580	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	H	2579;2580;1943;124	ENSP00000251076:L2579H;ENSP00000441858:L2580H;ENSP00000400855:L1943H	ENSP00000251076:L2579H	L	-	2	0	DMXL2	49544233	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.648000	0.46647	2.330000	0.79161	0.477000	0.44152	CTT	DMXL2	-	NULL	ENSG00000104093		0.398	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	34	0.00	0	A	NM_015263		51756941	51756941	-1	no_errors	ENST00000543779	ensembl	human	known	69_37n	missense	20	59.18	29	SNP	1.000	T
DNAH14	127602	genome.wustl.edu	37	1	225341452	225341452	+	Splice_Site	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:225341452G>C	ENST00000445597.2	+	21	3916	c.3916G>C	c.(3916-3918)Gat>Cat	p.D1306H	DNAH14_ENST00000430092.1_Splice_Site_p.D1716H|DNAH14_ENST00000439375.2_Splice_Site_p.D1716H			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1306					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TGTTTGATAGGATCATTATAA	0.279																																						dbGAP											0													72.0	62.0	65.0					1																	225341452		692	1589	2281	-	-	-	SO:0001630	splice_region_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.3916-1G>C	1.37:g.225341452G>C			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.D1716H	ENST00000445597.2	37	c.5146		1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425582	0.62733	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.15603	2.41;2.41;2.41;2.41	4.99	4.99	0.66335	.	0.290330	0.23281	U	0.049907	T	0.28034	0.0691	L	0.50333	1.59	0.80722	D	1	D	0.65815	0.995	P	0.57620	0.824	T	0.00465	-1.1723	9	.	.	.	.	11.0059	0.47633	0.0883:0.0:0.9117:0.0	.	1716	Q0VDD8-4	.	H	1306;1716;1716;813	ENSP00000409472:D1306H;ENSP00000414402:D1716H;ENSP00000392061:D1716H;ENSP00000332424:D813H	.	D	+	1	0	DNAH14	223408075	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.939000	0.70179	2.478000	0.83669	0.430000	0.28490	GAT	DNAH14	-	NULL	ENSG00000185842		0.279	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	49	0.00	0	G	XM_059166	Missense_Mutation	225341452	225341452	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	missense	45	32.84	22	SNP	1.000	C
DNAH8	1769	genome.wustl.edu	37	6	38813487	38813487	+	Silent	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:38813487G>A	ENST00000359357.3	+	34	4586	c.4332G>A	c.(4330-4332)tcG>tcA	p.S1444S	DNAH8_ENST00000449981.2_Silent_p.S1661S|DNAH8_ENST00000441566.1_Silent_p.S1444S			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1444					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GAACCGAATCGGGAGAAATTA	0.393																																						dbGAP											0													107.0	109.0	109.0					6																	38813487		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4332G>A	6.37:g.38813487G>A			O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.S1444	ENST00000359357.3	37	c.4332		6																																																																																			DNAH8	-	pfam_Dynein_heavy_dom-2	ENSG00000124721		0.393	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1	47	0.00	0	G	NM_001206927		38813487	38813487	+1	no_errors	ENST00000359357	ensembl	human	known	69_37n	silent	42	51.16	44	SNP	0.350	A
DNAJB12	54788	genome.wustl.edu	37	10	74097985	74097985	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr10:74097985G>T	ENST00000444643.2	-	6	1140	c.808C>A	c.(808-810)Cca>Aca	p.P270T	DNAJB12_ENST00000394903.2_Missense_Mutation_p.P304T|DNAJB12_ENST00000338820.3_Missense_Mutation_p.P304T|DNAJB12_ENST00000461919.1_Missense_Mutation_p.P65T			Q9NXW2	DJB12_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 12	270						integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|skin(1)	4						CTGTAGGGTGGACTGGAGACC	0.577																																						dbGAP											0													108.0	93.0	98.0					10																	74097985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000034	CCDS7316.2	10q22	2011-09-02			ENSG00000148719	ENSG00000148719		"""Heat shock proteins / DNAJ (HSP40)"""	14891	protein-coding gene	gene with protein product		608376				11147971	Standard	NM_001002762		Approved	DJ10, FLJ20027	uc001jta.2	Q9NXW2	OTTHUMG00000018436	ENST00000444643.2:c.808C>A	10.37:g.74097985G>T	ENSP00000403313:p.Pro270Thr		B7Z7I3|Q9H6H0	Missense_Mutation	SNP	pfam_DUF1977_DnaJ-like,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.P304T	ENST00000444643.2	37	c.910		10	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780021	0.90195	.	.	ENSG00000148719	ENST00000338820;ENST00000394903;ENST00000444643	T;T;T	0.69926	-0.44;-0.44;-0.44	5.85	4.93	0.64822	Domain of unknown function DUF1977, DnaJ-like (1);	0.000000	0.85682	D	0.000000	D	0.85274	0.5659	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.988;0.99	D	0.88661	0.3189	10	0.62326	D	0.03	-22.3115	16.1903	0.81986	0.0:0.0:0.8658:0.1342	.	270;270	Q9NXW2-2;Q9NXW2	.;DJB12_HUMAN	T	304;304;270	ENSP00000345575:P304T;ENSP00000378363:P304T;ENSP00000403313:P270T	ENSP00000345575:P304T	P	-	1	0	DNAJB12	73767991	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.761000	0.98940	1.434000	0.47414	0.655000	0.94253	CCA	DNAJB12	-	pfam_DUF1977_DnaJ-like	ENSG00000148719		0.577	DNAJB12-001	KNOWN	basic|appris_principal	protein_coding	DNAJB12	HGNC	protein_coding	OTTHUMT00000048581.2	44	0.00	0	G			74097985	74097985	-1	no_errors	ENST00000338820	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	T
DPP7	29952	genome.wustl.edu	37	9	140007473	140007473	+	Missense_Mutation	SNP	C	C	T	rs111226653	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:140007473C>T	ENST00000371579.2	-	7	806	c.802G>A	c.(802-804)Gtg>Atg	p.V268M		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	268						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		ATGGCCAGCACGGTGAAGGCA	0.657																																						dbGAP											0													52.0	55.0	54.0					9																	140007473		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.802G>A	9.37:g.140007473C>T	ENSP00000360635:p.Val268Met		A8K7U7|Q5VSF1|Q969X4	Missense_Mutation	SNP	pfam_Peptidase_S28,pfam_AB_hydrolase_1	p.V268M	ENST00000371579.2	37	c.802	CCDS7030.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.710|5.710	0.315517|0.315517	0.10789|0.10789	.|.	.|.	ENSG00000176978|ENSG00000176978	ENST00000443858|ENST00000371579	.|T	.|0.14893	.|2.47	5.01|5.01	-1.21|-1.21	0.09524|0.09524	.|.	.|0.347270	.|0.26975	.|N	.|0.021560	T|T	0.05410|0.05410	0.0143|0.0143	N|N	0.11927|0.11927	0.2|0.2	0.09310|0.09310	N|N	1|1	.|P	.|0.40660	.|0.726	.|B	.|0.27380	.|0.079	T|T	0.40308|0.40308	-0.9570|-0.9570	6|10	0.87932|0.34782	D|T	0|0.22	-33.509|-33.509	6.1447|6.1447	0.20278|0.20278	0.0:0.3571:0.4237:0.2192|0.0:0.3571:0.4237:0.2192	.|.	.|268	.|Q9UHL4	.|DPP2_HUMAN	H|M	265|268	.|ENSP00000360635:V268M	ENSP00000413492:R265H|ENSP00000360635:V268M	R|V	-|-	2|1	0|0	DPP7|DPP7	139127294|139127294	0.000000|0.000000	0.05858|0.05858	0.315000|0.315000	0.25238|0.25238	0.299000|0.299000	0.27559|0.27559	-0.364000|-0.364000	0.07583|0.07583	-0.094000|-0.094000	0.12374|0.12374	0.555000|0.555000	0.69702|0.69702	CGT|GTG	DPP7	-	pfam_Peptidase_S28	ENSG00000176978		0.657	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP7	HGNC	protein_coding	OTTHUMT00000055279.1	84	0.00	0	C	NM_013379		140007473	140007473	-1	no_errors	ENST00000371579	ensembl	human	known	69_37n	missense	14	75.00	42	SNP	0.056	T
DQX1	165545	genome.wustl.edu	37	2	74745704	74745704	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:74745704A>C	ENST00000404568.3	-	12	2242	c.2023T>G	c.(2023-2025)Ttc>Gtc	p.F675V	DQX1_ENST00000393951.2_Missense_Mutation_p.F675V	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	675						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TTACTCAGGAAGTATGGAGGG	0.483																																						dbGAP											0													102.0	93.0	97.0					2																	74745704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.2023T>G	2.37:g.74745704A>C	ENSP00000384621:p.Phe675Val		Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,smart_Helicase_ATP-bd,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.F675V	ENST00000404568.3	37	c.2023	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	A	16.26	3.073196	0.55646	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.03801	3.8;3.8	5.0	3.82	0.43975	.	0.091863	0.46145	D	0.000309	T	0.06234	0.0161	M	0.66939	2.045	0.34306	D	0.684851	P	0.43826	0.818	B	0.36186	0.219	T	0.22173	-1.0224	10	0.87932	D	0	.	7.9718	0.30132	0.8176:0.0:0.0:0.1824	.	675	Q8TE96	DQX1_HUMAN	V	675	ENSP00000377523:F675V;ENSP00000384621:F675V	ENSP00000377523:F675V	F	-	1	0	DQX1	74599212	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.297000	0.89942	0.722000	0.32252	-0.490000	0.04691	TTC	DQX1	-	NULL	ENSG00000144045		0.483	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	HGNC	protein_coding	OTTHUMT00000252230.3	60	0.00	0	A	NM_133637		74745704	74745704	-1	no_errors	ENST00000393951	ensembl	human	known	69_37n	missense	79	18.56	18	SNP	1.000	C
EIF3G	8666	genome.wustl.edu	37	19	10230338	10230338	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:10230338C>G	ENST00000253108.4	-	2	101	c.59G>C	c.(58-60)gGg>gCg	p.G20A	EIF3G_ENST00000587168.1_5'UTR	NM_003755.3	NP_003746.2			eukaryotic translation initiation factor 3, subunit G											central_nervous_system(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			ACCGTCCTCCCCCTCCTCCTC	0.642											OREG0025231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Colon(124;1100 1638 3822 4510 4876)	dbGAP											0													64.0	62.0	63.0					19																	10230338		2203	4300	6503	-	-	-	SO:0001583	missense	0			U96074	CCDS12227.1	19p13.2	2013-02-12	2007-07-27	2007-07-27		ENSG00000130811		"""RNA binding motif (RRM) containing"""	3274	protein-coding gene	gene with protein product		603913	"""eukaryotic translation initiation factor 3, subunit 4 delta, 44kDa"""	EIF3S4		9822659	Standard	NM_003755		Approved	eIF3-delta, eIF3-p44, eIF3g	uc002mnd.3	O75821		ENST00000253108.4:c.59G>C	19.37:g.10230338C>G	ENSP00000253108:p.Gly20Ala	663		Missense_Mutation	SNP	pfam_eIF3g_N,pfam_RRM_dom,smart_RRM_dom,pirsf_Transl_init_eIF-3_G,pfscan_RRM_dom	p.G20A	ENST00000253108.4	37	c.59	CCDS12227.1	19	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972787	0.34848	.	.	ENSG00000130811	ENST00000253108	T	0.11277	2.79	4.84	3.79	0.43588	.	0.130529	0.49916	D	0.000123	T	0.13157	0.0319	N	0.08118	0	0.45899	D	0.998747	D;B;B	0.89917	1.0;0.427;0.037	D;B;B	0.74348	0.983;0.098;0.021	T	0.30268	-0.9984	10	0.23891	T	0.37	-11.9283	12.1763	0.54188	0.1722:0.8278:0.0:0.0	.	20;20;20	B4DK39;B0AZV5;O75821	.;.;EIF3G_HUMAN	A	20	ENSP00000253108:G20A	ENSP00000253108:G20A	G	-	2	0	EIF3G	10091338	1.000000	0.71417	1.000000	0.80357	0.400000	0.30750	2.465000	0.45075	1.242000	0.43836	0.491000	0.48974	GGG	EIF3G	-	pirsf_Transl_init_eIF-3_G	ENSG00000130811		0.642	EIF3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3G	HGNC	protein_coding	OTTHUMT00000451144.1	137	0.00	0	C			10230338	10230338	-1	no_errors	ENST00000253108	ensembl	human	known	69_37n	missense	84	27.59	32	SNP	1.000	G
EYS	346007	genome.wustl.edu	37	6	65596590	65596590	+	Splice_Site	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:65596590C>A	ENST00000370621.3	-	19	3518	c.2992G>T	c.(2992-2994)Ggc>Tgc	p.G998C	EYS_ENST00000370616.2_Splice_Site_p.G998C|EYS_ENST00000503581.1_Splice_Site_p.G998C			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	998	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						ATGGATTTACCTGTATAACCA	0.378																																						dbGAP											0													130.0	112.0	118.0					6																	65596590		692	1590	2282	-	-	-	SO:0001630	splice_region_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2992+1G>T	6.37:g.65596590C>A			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G998C	ENST00000370621.3	37	c.2992		6	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434999	0.62955	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.96651	-4.08;-4.08;-4.08	4.08	4.08	0.47627	.	.	.	.	.	D	0.98551	0.9516	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99490	1.0950	8	.	.	.	.	13.5363	0.61648	0.0:1.0:0.0:0.0	.	998	Q5T1H1-1	.	C	998	ENSP00000424243:G998C;ENSP00000359655:G998C;ENSP00000359650:G998C	.	G	-	1	0	EYS	65653311	1.000000	0.71417	0.805000	0.32314	0.800000	0.45204	5.495000	0.66912	1.965000	0.57142	0.462000	0.41574	GGC	EYS	-	smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000188107		0.378	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	50	0.00	0	C	XM_294050	Missense_Mutation	65596590	65596590	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	missense	53	32.91	26	SNP	1.000	A
FAM127B	26071	genome.wustl.edu	37	X	134186146	134186146	+	5'UTR	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:134186146C>T	ENST00000370775.2	-	0	59				FAM127B_ENST00000520964.1_5'UTR	NM_001078172.1	NP_001071640.1	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B											breast(3)|endometrium(2)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;0.000127)					CATCGTGCCGCGCGCGCTCCG	0.741																																						dbGAP											0													24.0	26.0	26.0					X																	134186146		1915	4105	6020	-	-	-	SO:0001623	5_prime_UTR_variant	0			AL117556	CCDS43998.1	Xq26.3	2014-05-16			ENSG00000203950	ENSG00000203950			24514	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078172		Approved	DKFZP564B147, MAR8A, CXX1b	uc004eyf.3	Q9BWD3	OTTHUMG00000022466	ENST00000370775.2:c.-8G>A	X.37:g.134186146C>T			A2A2V9|Q8TBU2	RNA	SNP	-	NULL	ENST00000370775.2	37	NULL	CCDS43998.1	X																																																																																			FAM127B	-	-	ENSG00000203950		0.741	FAM127B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127B	HGNC	protein_coding	OTTHUMT00000058393.2	24	0.00	0	C	NM_001078172		134186146	134186146	-1	no_errors	ENST00000520964	ensembl	human	known	69_37n	rna	33	28.26	13	SNP	0.000	T
FAM26D	221301	genome.wustl.edu	37	6	116875396	116875396	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:116875396A>C	ENST00000368596.3	+	1	484	c.440A>C	c.(439-441)aAt>aCt	p.N147T	FAM26D_ENST00000416171.2_Intron|FAM26D_ENST00000405399.1_Missense_Mutation_p.N4T|FAM26D_ENST00000368597.2_Intron			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	147					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		ATGTTTGATAATGTCAGTGCC	0.473																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.440A>C	6.37:g.116875396A>C	ENSP00000357585:p.Asn147Thr		B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Missense_Mutation	SNP	NULL	p.N147T	ENST00000368596.3	37	c.440		6	.	.	.	.	.	.	.	.	.	.	A	14.57	2.574802	0.45902	.	.	ENSG00000164451	ENST00000405399;ENST00000368596	T;T	0.17691	2.26;2.26	6.11	6.11	0.99139	.	0.000000	0.64402	D	0.000002	T	0.19765	0.0475	.	.	.	0.37087	D	0.89924	D	0.59767	0.986	P	0.58660	0.843	T	0.03829	-1.1000	9	0.22706	T	0.39	-6.946	14.4431	0.67330	1.0:0.0:0.0:0.0	.	147	Q5JW98	FA26D_HUMAN	T	4;147	ENSP00000385836:N4T;ENSP00000357585:N147T	ENSP00000357585:N147T	N	+	2	0	FAM26D	116982089	0.954000	0.32549	0.028000	0.17463	0.486000	0.33341	3.643000	0.54374	2.343000	0.79666	0.533000	0.62120	AAT	FAM26D	-	NULL	ENSG00000164451		0.473	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	HGNC	protein_coding	OTTHUMT00000041958.1	48	0.00	0	A	NM_153036		116875396	116875396	+1	no_errors	ENST00000368596	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	0.039	C
FAM41C	284593	genome.wustl.edu	37	1	809581	809581	+	lincRNA	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:809581A>G	ENST00000446136.1	-	0	1112					NR_027055.1				family with sequence similarity 41, member C																		GCCTTCCTCCATTGGTACACG	0.512																																						dbGAP											0																																										-	-	-			0			BC047940		1p36.33	2013-01-16	2011-08-31	2011-08-31	ENSG00000230368	ENSG00000230368		"""Long non-coding RNAs"""	27635	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_027055		Approved		uc001abt.4		OTTHUMG00000002469		1.37:g.809581A>G				RNA	SNP	-	NULL	ENST00000446136.1	37	NULL		1																																																																																			FAM41C	-	-	ENSG00000230368		0.512	FAM41C-001	KNOWN	basic	lincRNA	FAM41C	HGNC	lincRNA	OTTHUMT00000007021.1	152	0.00	0	A	NR_027055		809581	809581	-1	no_errors	ENST00000446136	ensembl	human	known	69_37n	rna	63	36.36	36	SNP	1.000	G
FANCA	2175	genome.wustl.edu	37	16	89816214	89816214	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:89816214G>C	ENST00000389301.3	-	32	3193	c.3163C>G	c.(3163-3165)Cgg>Ggg	p.R1055G	FANCA_ENST00000568369.1_Missense_Mutation_p.R1055G	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1055			R -> L (in FA). {ECO:0000269|PubMed:9371798}.|R -> W (in FA). {ECO:0000269|PubMed:9929978}.		DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GCCTGGAGCCGTCTGCGGAAA	0.577			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0			GRCh37	CM990585	FANCA	M							66.0	61.0	62.0					16																	89816214		2198	4300	6498	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3163C>G	16.37:g.89816214G>C	ENSP00000373952:p.Arg1055Gly		A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.R1055G	ENST00000389301.3	37	c.3163	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	G	13.83	2.353486	0.41700	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.89050	-2.46	4.2	0.712	0.18167	.	0.103898	0.40818	N	0.001008	D	0.92599	0.7649	M	0.74881	2.28	0.28682	N	0.905036	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.995;0.998;0.998	D	0.86904	0.2056	10	0.87932	D	0	-36.6799	10.5414	0.45035	0.0:0.0:0.3455:0.6545	.	32;1055;1055	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	G	1055;32	ENSP00000373952:R1055G	ENSP00000306281:R32G	R	-	1	2	FANCA	88343715	0.905000	0.30787	0.082000	0.20525	0.001000	0.01503	1.302000	0.33459	0.465000	0.27167	-0.320000	0.08662	CGG	FANCA	-	NULL	ENSG00000187741		0.577	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1	118	0.00	0	G			89816214	89816214	-1	no_errors	ENST00000389301	ensembl	human	known	69_37n	missense	82	29.31	34	SNP	0.115	C
FBXL14	144699	genome.wustl.edu	37	12	1702198	1702198	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:1702198G>C	ENST00000339235.3	-	1	1133	c.1035C>G	c.(1033-1035)gaC>gaG	p.D345E	FBXL14_ENST00000543278.1_5'UTR|WNT5B_ENST00000537031.1_Intron	NM_152441.2	NP_689654.1	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14	345					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	8	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			CCAGGCCCTTGTCCGTGATGC	0.617																																						dbGAP											0													130.0	110.0	116.0					12																	1702198		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028132	CCDS8509.1	12p13.33	2011-06-09			ENSG00000171823	ENSG00000171823		"""F-boxes / Leucine-rich repeats"""	28624	protein-coding gene	gene with protein product		609081				12477932	Standard	NM_152441		Approved	MGC40195, Fbl14	uc001qjh.3	Q8N1E6	OTTHUMG00000090369	ENST00000339235.3:c.1035C>G	12.37:g.1702198G>C	ENSP00000344855:p.Asp345Glu			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom_cyclin-like,pfam_Leu-rich_rpt_2,superfamily_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp	p.D345E	ENST00000339235.3	37	c.1035	CCDS8509.1	12	.	.	.	.	.	.	.	.	.	.	G	24.6	4.545935	0.86022	.	.	ENSG00000171823	ENST00000339235	T	0.13089	2.62	4.85	4.85	0.62838	.	0.110357	0.64402	D	0.000011	T	0.37376	0.1001	M	0.68728	2.09	0.80722	D	1	D	0.64830	0.994	D	0.72625	0.978	T	0.15521	-1.0434	10	0.87932	D	0	.	18.1632	0.89716	0.0:0.0:1.0:0.0	.	345	Q8N1E6	FXL14_HUMAN	E	345	ENSP00000344855:D345E	ENSP00000344855:D345E	D	-	3	2	FBXL14	1572459	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.571000	0.98176	2.495000	0.84180	0.650000	0.86243	GAC	FBXL14	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000171823		0.617	FBXL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL14	HGNC	protein_coding	OTTHUMT00000206741.1	91	0.00	0	G	NM_152441		1702198	1702198	-1	no_errors	ENST00000339235	ensembl	human	known	69_37n	missense	81	24.30	26	SNP	1.000	C
FBXO41	150726	genome.wustl.edu	37	2	73490823	73490823	+	Silent	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:73490823C>T	ENST00000521871.1	-	8	2473	c.2058G>A	c.(2056-2058)ctG>ctA	p.L686L	FBXO41_ENST00000520530.2_Silent_p.L686L|FBXO41_ENST00000295133.5_Silent_p.L747L			Q8TF61	FBX41_HUMAN	F-box protein 41	686										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						TGACAGCCTGCAGGGCACGGC	0.632																																						dbGAP											0													58.0	72.0	67.0					2																	73490823		2138	4248	6386	-	-	-	SO:0001819	synonymous_variant	0			AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.2058G>A	2.37:g.73490823C>T			G3V0Z7|Q2M1V8	Silent	SNP	superfamily_F-box_dom_cyclin-like	p.L747	ENST00000521871.1	37	c.2241	CCDS46337.2	2																																																																																			FBXO41	-	NULL	ENSG00000163013		0.632	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	HGNC	protein_coding	OTTHUMT00000377381.1	125	0.00	0	C			73490823	73490823	-1	no_errors	ENST00000295133	ensembl	human	known	69_37n	silent	107	30.97	48	SNP	1.000	T
FGFR3	2261	genome.wustl.edu	37	4	1805440	1805440	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr4:1805440G>A	ENST00000260795.2	+	7	1054	c.952G>A	c.(952-954)Gac>Aac	p.D318N	FGFR3_ENST00000481110.2_Missense_Mutation_p.D318N|FGFR3_ENST00000352904.1_Intron|FGFR3_ENST00000412135.2_Intron|FGFR3_ENST00000440486.2_Missense_Mutation_p.D318N|FGFR3_ENST00000340107.4_Intron			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	318	Ig-like C2-type 3.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	TAACACCACCGACAAGGAGCT	0.607		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																													dbGAP		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	0													80.0	75.0	77.0					4																	1805440		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.952G>A	4.37:g.1805440G>A	ENSP00000260795:p.Asp318Asn		D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Missense_Mutation	SNP	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D318N	ENST00000260795.2	37	c.952	CCDS3353.1	4	.	.	.	.	.	.	.	.	.	.	g	17.61	3.433429	0.62844	.	.	ENSG00000068078	ENST00000481110;ENST00000440486;ENST00000260795;ENST00000507588	D;D;D;T	0.96041	-3.89;-3.89;-3.89;-1.33	4.29	3.44	0.39384	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.212673	0.48286	D	0.000196	D	0.92149	0.7511	L	0.33792	1.035	0.80722	D	1	P;P;B;P	0.47762	0.9;0.824;0.142;0.558	P;B;B;B	0.46026	0.501;0.336;0.081;0.076	D	0.89021	0.3435	10	0.25106	T	0.35	.	12.1103	0.53836	0.085:0.0:0.915:0.0	.	281;318;318;318	Q8NI15;P22607-4;P22607;F8W9L4	.;.;FGFR3_HUMAN;.	N	318;318;318;104	ENSP00000420533:D318N;ENSP00000414914:D318N;ENSP00000260795:D318N;ENSP00000427289:D104N	ENSP00000260795:D318N	D	+	1	0	FGFR3	1775238	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.623000	0.83113	0.908000	0.36671	0.561000	0.74099	GAC	FGFR3	-	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000068078		0.607	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FGFR3	HGNC	protein_coding	OTTHUMT00000241632.2	164	0.00	0	G	NM_000142		1805440	1805440	+1	no_errors	ENST00000260795	ensembl	human	known	69_37n	missense	26	58.73	37	SNP	1.000	A
FLNC	2318	genome.wustl.edu	37	7	128488116	128488116	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:128488116C>A	ENST00000325888.8	+	26	4835	c.4574C>A	c.(4573-4575)cCa>cAa	p.P1525Q	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Missense_Mutation_p.P1525Q	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1525					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CAGGAGGTGCCACGCAGGTGA	0.652																																						dbGAP											0													29.0	33.0	32.0					7																	128488116		2138	4242	6380	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4574C>A	7.37:g.128488116C>A	ENSP00000327145:p.Pro1525Gln		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.P1525Q	ENST00000325888.8	37	c.4574	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	C	29.6	5.022712	0.93462	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.84589	-1.87;-1.87	5.12	5.12	0.69794	Immunoglobulin E-set (2);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93077	0.7796	M	0.83603	2.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93889	0.7178	10	0.87932	D	0	.	18.9115	0.92487	0.0:1.0:0.0:0.0	.	1525;1525	Q14315-2;Q14315	.;FLNC_HUMAN	Q	1525	ENSP00000327145:P1525Q;ENSP00000344002:P1525Q	ENSP00000327145:P1525Q	P	+	2	0	FLNC	128275352	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.093000	0.71422	2.543000	0.85770	0.561000	0.74099	CCA	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.652	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	83	0.00	0	C			128488116	128488116	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	60	18.92	14	SNP	1.000	A
FMO5	2330	genome.wustl.edu	37	1	146656161	146656161	+	IGR	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:146656161T>C	ENST00000254090.4	-	0	2632				RP11-337C18.10_ENST00000606856.1_RNA|RP11-337C18.8_ENST00000606757.1_RNA|FMO5_ENST00000441068.2_Silent_p.L435L|RP11-337C18.8_ENST00000607149.1_RNA	NM_001461.2	NP_001452.2	P49326	FMO5_HUMAN	flavin containing monooxygenase 5							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	25	all_hematologic(923;0.0487)					caggtatttgtagaatattct	0.383																																						dbGAP											0													149.0	127.0	134.0					1																	146656161		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0			Z47553	CCDS926.1, CCDS44209.1, CCDS44210.1	1q21.1	2011-08-04			ENSG00000131781	ENSG00000131781			3773	protein-coding gene	gene with protein product		603957				8786146, 9119381	Standard	NM_001461		Approved		uc001epi.2	P49326	OTTHUMG00000014607		1.37:g.146656161T>C			B2RBG1|C9JJD1|Q8IV22	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Flavin_mOase,prints_Flavin_mOase_5,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.L435	ENST00000254090.4	37	c.1305	CCDS926.1	1																																																																																			FMO5	-	NULL	ENSG00000131781		0.383	FMO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO5	HGNC	protein_coding	OTTHUMT00000040373.2	33	0.00	0	T	NM_001461		146656161	146656161	-1	no_errors	ENST00000441068	ensembl	human	known	69_37n	silent	30	21.05	8	SNP	0.104	C
CMTR2	55783	genome.wustl.edu	37	16	71318220	71318220	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:71318220G>C	ENST00000338099.5	-	3	1940	c.1604C>G	c.(1603-1605)tCc>tGc	p.S535C	CMTR2_ENST00000434935.2_Missense_Mutation_p.S535C			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	535					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)	p.S535F(1)									CCTAAACTTGGAATCCAAATT	0.353																																						dbGAP											1	Substitution - Missense(1)	lung(1)											43.0	45.0	44.0					16																	71318220		2198	4298	6496	-	-	-	SO:0001583	missense	0			BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.1604C>G	16.37:g.71318220G>C	ENSP00000337512:p.Ser535Cys		B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	pfam_rRNA_MeTrfase_FtsJ_dom	p.S535C	ENST00000338099.5	37	c.1604	CCDS10898.1	16	.	.	.	.	.	.	.	.	.	.	G	7.562	0.664985	0.14710	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.15372	2.43;2.43	5.75	3.81	0.43845	.	0.755257	0.12409	N	0.471442	T	0.11707	0.0285	N	0.24115	0.695	0.23602	N	0.99732	P	0.40619	0.724	B	0.37091	0.241	T	0.14008	-1.0488	10	0.52906	T	0.07	-11.1614	8.6005	0.33742	0.1743:0.0:0.8257:0.0	.	535	Q8IYT2	FTSJ1_HUMAN	C	535	ENSP00000337512:S535C;ENSP00000411148:S535C	ENSP00000337512:S535C	S	-	2	0	FTSJD1	69875721	1.000000	0.71417	0.992000	0.48379	0.799000	0.45148	1.546000	0.36179	0.796000	0.33947	0.561000	0.74099	TCC	FTSJD1	-	NULL	ENSG00000180917		0.353	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJD1	HGNC	protein_coding	OTTHUMT00000268984.2	15	0.00	0	G	NM_018348		71318220	71318220	-1	no_errors	ENST00000338099	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.993	C
GCNT2	2651	genome.wustl.edu	37	6	10529665	10529665	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:10529665T>A	ENST00000379597.3	+	1	1077	c.521T>A	c.(520-522)cTg>cAg	p.L174Q	GCNT2_ENST00000397423.2_Intron|GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000495262.1_Missense_Mutation_p.L174Q			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	174					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		CTGAACTGCCTGGAAGACCTT	0.507																																						dbGAP											0													41.0	42.0	42.0					6																	10529665		2203	4300	6503	-	-	-	SO:0001583	missense	0			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.521T>A	6.37:g.10529665T>A	ENSP00000368917:p.Leu174Gln			Missense_Mutation	SNP	pfam_Glyco_trans_14	p.L174Q	ENST00000379597.3	37	c.521	CCDS34338.1	6	.	.	.	.	.	.	.	.	.	.	T	12.79	2.042288	0.35989	.	.	ENSG00000111846	ENST00000495262;ENST00000379597	T;T	0.18338	2.22;2.22	5.47	5.47	0.80525	.	0.677027	0.15011	N	0.285537	T	0.15003	0.0362	M	0.66939	2.045	0.80722	D	1	B;B	0.22983	0.078;0.078	B;B	0.32393	0.145;0.145	T	0.01961	-1.1239	10	0.54805	T	0.06	-22.4408	15.2222	0.73320	0.0:0.0:0.0:1.0	.	174;173	Q8N0V5;Q08M29	GNT2A_HUMAN;.	Q	174	ENSP00000419411:L174Q;ENSP00000368917:L174Q	ENSP00000368917:L174Q	L	+	2	0	GCNT2	10637651	1.000000	0.71417	0.006000	0.13384	0.009000	0.06853	7.836000	0.86788	2.076000	0.62316	0.459000	0.35465	CTG	GCNT2	-	pfam_Glyco_trans_14	ENSG00000111846		0.507	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GCNT2	HGNC	protein_coding	OTTHUMT00000327912.3	14	0.00	0	T	NM_145649		10529665	10529665	+1	no_errors	ENST00000379597	ensembl	human	known	69_37n	missense	0	100.00	4	SNP	0.928	A
GIGYF1	64599	genome.wustl.edu	37	7	100284299	100284299	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:100284299C>A	ENST00000275732.5	-	7	1876	c.667G>T	c.(667-669)Ggc>Tgc	p.G223C	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	223					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CAGCGGTCGCCGTCTCGCCGG	0.692																																						dbGAP											0													27.0	32.0	31.0					7																	100284299		2198	4288	6486	-	-	-	SO:0001583	missense	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.667G>T	7.37:g.100284299C>A	ENSP00000275732:p.Gly223Cys		Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.G223C	ENST00000275732.5	37	c.667	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	17.32	3.360501	0.61403	.	.	ENSG00000146830	ENST00000275732	D	0.84516	-1.86	4.96	4.06	0.47325	.	0.062571	0.64402	D	0.000006	D	0.87446	0.6179	L	0.46157	1.445	0.48135	D	0.999593	D	0.69078	0.997	P	0.58970	0.849	D	0.88418	0.3026	10	0.87932	D	0	-15.9972	13.0018	0.58681	0.0:0.8364:0.1636:0.0	.	223	O75420	PERQ1_HUMAN	C	223	ENSP00000275732:G223C	ENSP00000275732:G223C	G	-	1	0	GIGYF1	100122235	0.005000	0.15991	0.771000	0.31576	0.470000	0.32858	1.028000	0.30128	1.287000	0.44583	0.563000	0.77884	GGC	GIGYF1	-	NULL	ENSG00000146830		0.692	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2	56	0.00	0	C	NM_022574		100284299	100284299	-1	no_errors	ENST00000275732	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.994	A
GIMAP8	155038	genome.wustl.edu	37	7	150174567	150174567	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:150174567G>A	ENST00000307271.3	+	5	2271	c.1697G>A	c.(1696-1698)cGg>cAg	p.R566Q		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	566	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CTGTTCACCCGGAAGGAAGAC	0.493																																						dbGAP											0													86.0	91.0	90.0					7																	150174567		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1697G>A	7.37:g.150174567G>A	ENSP00000305107:p.Arg566Gln			Missense_Mutation	SNP	pfam_AIG1	p.R566Q	ENST00000307271.3	37	c.1697	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124641	0.56613	.	.	ENSG00000171115	ENST00000307271	T	0.34275	1.37	4.44	4.44	0.53790	AIG1 (1);	0.000000	0.38548	N	0.001654	T	0.60843	0.2300	M	0.83692	2.655	0.18873	N	0.999982	D	0.89917	1.0	D	0.80764	0.994	T	0.55573	-0.8120	10	0.62326	D	0.03	.	12.4348	0.55593	0.0:0.0:1.0:0.0	.	566	Q8ND71	GIMA8_HUMAN	Q	566	ENSP00000305107:R566Q	ENSP00000305107:R566Q	R	+	2	0	GIMAP8	149805500	0.014000	0.17966	0.988000	0.46212	0.151000	0.21798	1.848000	0.39309	2.321000	0.78463	0.655000	0.94253	CGG	GIMAP8	-	pfam_AIG1	ENSG00000171115		0.493	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	25	0.00	0	G	NM_175571		150174567	150174567	+1	no_errors	ENST00000307271	ensembl	human	known	69_37n	missense	21	54.35	25	SNP	0.346	A
GOLGA4	2803	genome.wustl.edu	37	3	37388771	37388771	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:37388771T>G	ENST00000361924.2	+	21	6934	c.6560T>G	c.(6559-6561)aTg>aGg	p.M2187R	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.M2202R	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	2187	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GAGTATATGATGGGTCGTGAG	0.363																																						dbGAP											0													114.0	108.0	110.0					3																	37388771		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.6560T>G	3.37:g.37388771T>G	ENSP00000354486:p.Met2187Arg		F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,superfamily_t-SNARE,superfamily_Prefoldin,smart_GRIP,pfscan_GRIP	p.M2187R	ENST00000361924.2	37	c.6560	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	T	21.6	4.172715	0.78452	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.35973	1.35;1.35;1.28	5.48	5.48	0.80851	GRIP (5);	0.000000	0.39834	N	0.001259	T	0.54382	0.1855	M	0.63843	1.955	0.49798	D	0.99982	D;D;D	0.63880	0.99;0.983;0.993	P;P;P	0.61201	0.885;0.804;0.876	T	0.58289	-0.7662	10	0.87932	D	0	.	14.5407	0.67990	0.0:0.0:0.0:1.0	.	2187;2202;2187	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	R	2187;2202;2058	ENSP00000354486:M2187R;ENSP00000349305:M2202R;ENSP00000405842:M2058R	ENSP00000349305:M2202R	M	+	2	0	GOLGA4	37363775	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.341000	0.72977	2.081000	0.62600	0.374000	0.22700	ATG	GOLGA4	-	pfam_GRIP,superfamily_GRIP,smart_GRIP,pfscan_GRIP	ENSG00000144674		0.363	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	44	0.00	0	T	NM_002078		37388771	37388771	+1	no_errors	ENST00000361924	ensembl	human	known	69_37n	missense	23	51.06	24	SNP	1.000	G
GOLT1B	51026	genome.wustl.edu	37	12	21654806	21654806	+	5'UTR	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:21654806C>T	ENST00000229314.5	+	0	58				RECQL_ENST00000421138.2_5'Flank|GOLT1B_ENST00000535593.1_3'UTR|GOLT1B_ENST00000542038.1_5'UTR|GOLT1B_ENST00000540141.1_5'UTR|RECQL_ENST00000444129.2_5'Flank	NM_016072.4	NP_057156.1	Q9Y3E0	GOT1B_HUMAN	golgi transport 1B						positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|signal transduction (GO:0007165)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	signal transducer activity (GO:0004871)			large_intestine(2)|lung(3)	5						GACTCAGCTTCCCACCCTGGG	0.637																																						dbGAP											0													17.0	19.0	18.0					12																	21654806		1568	3582	5150	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB097020	CCDS8689.1	12p13.1	2010-06-24	2010-06-24		ENSG00000111711	ENSG00000111711			20175	protein-coding gene	gene with protein product		615078	"""golgi transport 1 homolog B (S. cerevisiae)"""			12414650, 10810093	Standard	NM_016072		Approved	CGI-141, YMR292W, GOT1	uc001rez.2	Q9Y3E0	OTTHUMG00000169133	ENST00000229314.5:c.-52C>T	12.37:g.21654806C>T			B2R4R4|Q54A40|Q6I9W6|Q9P1R9	RNA	SNP	-	NULL	ENST00000229314.5	37	NULL	CCDS8689.1	12																																																																																			GOLT1B	-	-	ENSG00000111711		0.637	GOLT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLT1B	HGNC	protein_coding	OTTHUMT00000402384.2	131	0.00	0	C	NM_016072		21654806	21654806	+1	no_errors	ENST00000535593	ensembl	human	known	69_37n	rna	69	34.29	36	SNP	0.000	T
GPR133	283383	genome.wustl.edu	37	12	131623712	131623712	+	Splice_Site	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:131623712G>A	ENST00000261654.5	+	25	3088		c.e25-1		GPR133_ENST00000540207.1_Splice_Site|GPR133_ENST00000535015.1_Splice_Site|GPR133_ENST00000376682.4_Splice_Site|GPR133_ENST00000543617.1_Splice_Site	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		ATGCTTTGCAGATGAATGGGA	0.637																																						dbGAP											0													37.0	33.0	34.0					12																	131623712		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.2530-1G>A	12.37:g.131623712G>A			B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Splice_Site	SNP	-	e25-1	ENST00000261654.5	37	c.2530-1	CCDS9272.1	12	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362782	0.61403	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000376682;ENST00000335486;ENST00000543617	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7662	0.85524	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPR133	130189665	1.000000	0.71417	0.747000	0.31113	0.512000	0.34134	7.767000	0.85331	2.565000	0.86533	0.591000	0.81541	.	GPR133	-	-	ENSG00000111452		0.637	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	HGNC	protein_coding	OTTHUMT00000399356.1	55	0.00	0	G	NM_198827	Intron	131623712	131623712	+1	no_errors	ENST00000261654	ensembl	human	known	69_37n	splice_site	31	31.11	14	SNP	1.000	A
GPR158	57512	genome.wustl.edu	37	10	25888838	25888838	+	3'UTR	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr10:25888838G>C	ENST00000376351.3	+	0	4642				GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158						protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AATTGTTATTGCACCTTACAG	0.328																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.*635G>C	10.37:g.25888838G>C			Q6QR81|Q9ULT3	RNA	SNP	-	NULL	ENST00000376351.3	37	NULL	CCDS31166.1	10																																																																																			GPR158	-	-	ENSG00000151025		0.328	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	49	0.00	0	G	XM_166110		25888838	25888838	+1	no_errors	ENST00000490549	ensembl	human	known	69_37n	rna	21	37.14	13	SNP	1.000	C
GRIA1	2890	genome.wustl.edu	37	5	153190763	153190763	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:153190763C>A	ENST00000285900.5	+	16	3042	c.2699C>A	c.(2698-2700)cCc>cAc	p.P900H	GRIA1_ENST00000518142.1_Missense_Mutation_p.P820H|GRIA1_ENST00000518783.1_Missense_Mutation_p.P910H|GRIA1_ENST00000340592.5_Missense_Mutation_p.P900H|GRIA1_ENST00000448073.4_Missense_Mutation_p.P910H|GRIA1_ENST00000521843.2_Missense_Mutation_p.P831H	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	900					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TCAGGGATGCCCTTGGGAGCC	0.597																																						dbGAP											0													47.0	43.0	44.0					5																	153190763		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2699C>A	5.37:g.153190763C>A	ENSP00000285900:p.Pro900His		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.P910H	ENST00000285900.5	37	c.2729	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	C	15.54	2.863725	0.51482	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04;-0.04;-0.04;-0.04	5.03	5.03	0.67393	.	0.245878	0.39909	N	0.001227	T	0.44414	0.1292	N	0.08118	0	0.32146	N	0.584925	B;B;P;B;B	0.36837	0.291;0.291;0.571;0.164;0.153	B;B;B;B;B	0.34242	0.125;0.125;0.178;0.163;0.139	T	0.60910	-0.7169	10	0.72032	D	0.01	.	17.3487	0.87316	0.0:1.0:0.0:0.0	.	910;910;820;900;900	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	H	900;900;820;900;833;831;910;910	ENSP00000285900:P900H;ENSP00000427920:P820H;ENSP00000339343:P900H;ENSP00000427864:P833H;ENSP00000442108:P831H;ENSP00000428994:P910H;ENSP00000415569:P910H	ENSP00000285900:P900H	P	+	2	0	GRIA1	153170956	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.739000	0.68622	2.330000	0.79161	0.561000	0.74099	CCC	GRIA1	-	NULL	ENSG00000155511		0.597	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	56	0.00	0	C			153190763	153190763	+1	no_errors	ENST00000448073	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	1.000	A
H2AFJ	55766	genome.wustl.edu	37	12	14927767	14927767	+	Silent	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:14927767G>A	ENST00000544848.1	+	1	498	c.363G>A	c.(361-363)acG>acA	p.T121T		NM_177925.2	NP_808760.1	Q9BTM1	H2AJ_HUMAN	H2A histone family, member J	121						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|kidney(1)|ovary(1)|skin(1)	5						CCAAGAAGACGGAGAGTCAGA	0.597																																						dbGAP											0													53.0	53.0	53.0					12																	14927767		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001765	CCDS31752.1	12p12.3	2012-09-11			ENSG00000246705	ENSG00000246705		"""Histones / Replication-independent"""	14456	protein-coding gene	gene with protein product							Standard	NM_177925		Approved	FLJ10903, MGC921	uc009zia.3	Q9BTM1	OTTHUMG00000168736	ENST00000544848.1:c.363G>A	12.37:g.14927767G>A			Q9NV63	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.T121	ENST00000544848.1	37	c.363	CCDS31752.1	12																																																																																			H2AFJ	-	superfamily_Histone-fold,smart_Histone_H2A	ENSG00000246705		0.597	H2AFJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H2AFJ	HGNC	protein_coding	OTTHUMT00000400845.1	86	0.00	0	G	NM_177925		14927767	14927767	+1	no_errors	ENST00000389078	ensembl	human	known	69_37n	silent	82	23.36	25	SNP	0.838	A
HEMGN	55363	genome.wustl.edu	37	9	100693415	100693415	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:100693415G>A	ENST00000259456.3	-	4	405	c.262C>T	c.(262-264)Cct>Tct	p.P88S		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	88					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				TGTGGCTGAGGCTCCACCTTC	0.428																																						dbGAP											0													173.0	165.0	168.0					9																	100693415		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.262C>T	9.37:g.100693415G>A	ENSP00000259456:p.Pro88Ser		Q6XAR3|Q86XY5|Q9NPC0	Missense_Mutation	SNP	NULL	p.P88S	ENST00000259456.3	37	c.262	CCDS6731.1	9	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289255	0.23478	.	.	ENSG00000136929	ENST00000375112;ENST00000259456	.	.	.	4.84	3.93	0.45458	.	0.264002	0.37669	N	0.001991	T	0.31670	0.0804	L	0.47716	1.5	0.09310	N	1	P	0.46912	0.886	P	0.44673	0.457	T	0.10382	-1.0632	9	0.19590	T	0.45	-5.1378	9.553	0.39321	0.0972:0.0:0.9028:0.0	.	88	Q9BXL5	HEMGN_HUMAN	S	88	.	ENSP00000259456:P88S	P	-	1	0	HEMGN	99733236	0.118000	0.22208	0.006000	0.13384	0.190000	0.23558	0.838000	0.27572	1.394000	0.46624	0.591000	0.81541	CCT	HEMGN	-	NULL	ENSG00000136929		0.428	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEMGN	HGNC	protein_coding	OTTHUMT00000053344.2	33	0.00	0	G	NM_197978		100693415	100693415	-1	no_errors	ENST00000259456	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	0.012	A
HMCN1	83872	genome.wustl.edu	37	1	186114962	186114962	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:186114962C>T	ENST00000271588.4	+	93	14744	c.14515C>T	c.(14515-14517)Cgg>Tgg	p.R4839W	HMCN1_ENST00000367492.2_Missense_Mutation_p.R4839W	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4839	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GACTCGGAAGCGGCTGTGCGA	0.552																																						dbGAP											0													78.0	72.0	74.0					1																	186114962		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14515C>T	1.37:g.186114962C>T	ENSP00000271588:p.Arg4839Trp		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.R4839W	ENST00000271588.4	37	c.14515	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106362	0.77096	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.65732	-0.17;-0.17	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.89280	0.6670	H	0.99404	4.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93769	0.7073	10	0.87932	D	0	.	19.5993	0.95554	0.0:1.0:0.0:0.0	.	4839	Q96RW7	HMCN1_HUMAN	W	4839	ENSP00000271588:R4839W;ENSP00000356462:R4839W	ENSP00000271588:R4839W	R	+	1	2	HMCN1	184381585	0.997000	0.39634	0.274000	0.24659	0.695000	0.40330	3.579000	0.53900	2.628000	0.89032	0.655000	0.94253	CGG	HMCN1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.552	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	62	0.00	0	C	NM_031935		186114962	186114962	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	49	31.94	23	SNP	0.991	T
HMMR	3161	genome.wustl.edu	37	5	162909722	162909722	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:162909722A>T	ENST00000358715.3	+	13	1493	c.1457A>T	c.(1456-1458)aAg>aTg	p.K486M	RP11-80G7.1_ENST00000514724.2_RNA|HMMR_ENST00000353866.3_Missense_Mutation_p.K471M|HMMR_ENST00000393915.4_Missense_Mutation_p.K487M|HMMR_ENST00000432118.2_Missense_Mutation_p.K400M|RP11-80G7.1_ENST00000521666.1_RNA			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	486					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	AAAGCGGCCAAGGCTGGGAAA	0.368																																						dbGAP											0													76.0	77.0	77.0					5																	162909722		2203	4300	6503	-	-	-	SO:0001583	missense	0			U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.1457A>T	5.37:g.162909722A>T	ENSP00000351554:p.Lys486Met		A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	NULL	p.K487M	ENST00000358715.3	37	c.1460	CCDS4362.1	5	.	.	.	.	.	.	.	.	.	.	A	4.367	0.067594	0.08436	.	.	ENSG00000072571	ENST00000416990;ENST00000353866;ENST00000393915;ENST00000426586;ENST00000432118;ENST00000358715	T;T;T;T;T	0.07800	3.16;3.16;3.16;3.16;3.16	5.43	1.57	0.23409	.	0.743917	0.13939	N	0.352354	T	0.03915	0.0110	N	0.12746	0.255	0.09310	N	1	B;B;B;B	0.20671	0.047;0.017;0.047;0.047	B;B;B;B	0.20577	0.03;0.005;0.019;0.019	T	0.42464	-0.9450	10	0.32370	T	0.25	-3.3115	2.3902	0.04376	0.5788:0.1932:0.0822:0.1458	.	400;487;471;486	O75330-4;O75330-3;O75330-2;O75330	.;.;.;HMMR_HUMAN	M	372;471;487;463;400;486	ENSP00000400527:K372M;ENSP00000185942:K471M;ENSP00000377492:K487M;ENSP00000402673:K400M;ENSP00000351554:K486M	ENSP00000185942:K471M	K	+	2	0	HMMR	162842300	0.000000	0.05858	0.158000	0.22627	0.019000	0.09904	0.139000	0.16036	0.087000	0.17167	0.528000	0.53228	AAG	HMMR	-	NULL	ENSG00000072571		0.368	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HMMR	HGNC	protein_coding	OTTHUMT00000252752.1	44	0.00	0	A	NM_012484		162909722	162909722	+1	no_errors	ENST00000393915	ensembl	human	known	69_37n	missense	11	62.07	18	SNP	0.140	T
HOXA9	3205	genome.wustl.edu	37	7	27202442	27202442	+	3'UTR	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:27202442A>C	ENST00000343483.6	-	0	1671				HOXA9_ENST00000497089.1_5'UTR|RP1-170O19.20_ENST00000465941.1_5'Flank	NM_152739.3	NP_689952.1	P31269	HXA9_HUMAN	homeobox A9						endothelial cell activation (GO:0042118)|multicellular organismal development (GO:0007275)|negative regulation of myeloid cell differentiation (GO:0045638)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|endometrium(1)|lung(5)|prostate(1)	8						ACAATAGACAAGACAGGACTA	0.323			T	"""NUP98, MSI2"""	AML*																																	dbGAP		Dom	yes		7	7p15-p14.2	3205	homeo box A9		L	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS5409.1	7p15.2	2011-06-20	2005-12-22		ENSG00000078399	ENSG00000078399		"""Homeoboxes / ANTP class : HOXL subclass"""	5109	protein-coding gene	gene with protein product		142956	"""homeo box A9"""	HOX1G, HOX1		1973146, 1358459	Standard	NM_152739		Approved		uc003syt.3	P31269	OTTHUMG00000023220	ENST00000343483.6:c.*780T>G	7.37:g.27202442A>C			O43369|O43429|Q99820	RNA	SNP	-	NULL	ENST00000343483.6	37	NULL	CCDS5409.1	7																																																																																			HOXA9	-	-	ENSG00000078399		0.323	HOXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA9	HGNC	protein_coding	OTTHUMT00000358706.2	27	0.00	0	A			27202442	27202442	-1	no_errors	ENST00000497089	ensembl	human	known	69_37n	rna	15	37.50	9	SNP	0.987	C
HPS5	11234	genome.wustl.edu	37	11	18309142	18309142	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:18309142T>C	ENST00000349215.3	-	18	2934	c.2657A>G	c.(2656-2658)cAt>cGt	p.H886R	HPS5_ENST00000352460.3_5'UTR|HPS5_ENST00000537258.1_5'Flank|HPS5_ENST00000396253.3_Missense_Mutation_p.H772R|HPS5_ENST00000438420.2_Missense_Mutation_p.H772R	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	886					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CTCAGCAGGATGATGATGACA	0.423									Hermansky-Pudlak syndrome																													dbGAP											0													95.0	92.0	93.0					11																	18309142		2199	4293	6492	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.2657A>G	11.37:g.18309142T>C	ENSP00000265967:p.His886Arg		A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_BLOC-2_complex_Hps5_subunit	p.H886R	ENST00000349215.3	37	c.2657	CCDS7836.1	11	.	.	.	.	.	.	.	.	.	.	T	14.40	2.523187	0.44866	.	.	ENSG00000110756	ENST00000396253;ENST00000438420;ENST00000349215;ENST00000544218	T;T;T	0.54479	0.57;0.57;0.58	5.13	5.13	0.70059	.	0.355791	0.34245	N	0.004133	T	0.46600	0.1401	L	0.56769	1.78	0.80722	D	1	B	0.30973	0.302	B	0.27380	0.079	T	0.44190	-0.9344	10	0.34782	T	0.22	.	11.1622	0.48522	0.0:0.0:0.1539:0.8461	.	886	Q9UPZ3	HPS5_HUMAN	R	772;772;886;72	ENSP00000379552:H772R;ENSP00000399590:H772R;ENSP00000265967:H886R	ENSP00000265967:H886R	H	-	2	0	HPS5	18265718	0.163000	0.22920	0.713000	0.30519	0.914000	0.54420	2.156000	0.42310	2.161000	0.67846	0.455000	0.32223	CAT	HPS5	-	pirsf_BLOC-2_complex_Hps5_subunit	ENSG00000110756		0.423	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS5	HGNC	protein_coding	OTTHUMT00000390808.1	22	0.00	0	T	NM_181507		18309142	18309142	-1	no_errors	ENST00000349215	ensembl	human	known	69_37n	missense	9	52.38	11	SNP	0.889	C
IER5L	389792	genome.wustl.edu	37	9	131939194	131939194	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:131939194G>T	ENST00000372491.2	-	1	1346	c.1138C>A	c.(1138-1140)Ccg>Acg	p.P380T	RP11-247A12.8_ENST00000599172.2_RNA|RP11-247A12.2_ENST00000372490.3_RNA	NM_203434.2	NP_982258.2	Q5T953	IER5L_HUMAN	immediate early response 5-like	380													Ovarian(14;0.0448)|Medulloblastoma(224;0.235)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)		CCGTTGAGCGGCGGCGGCTGC	0.682																																						dbGAP											0													6.0	9.0	8.0					9																	131939194		1631	3788	5419	-	-	-	SO:0001583	missense	0			BC013070	CCDS43888.1	9q34.11	2013-09-20			ENSG00000188483	ENSG00000188483			23679	protein-coding gene	gene with protein product							Standard	NM_203434		Approved	bA247A12.2	uc010myt.1	Q5T953	OTTHUMG00000020773	ENST00000372491.2:c.1138C>A	9.37:g.131939194G>T	ENSP00000361569:p.Pro380Thr		Q6P3E2	Missense_Mutation	SNP	pfam_IER	p.P380T	ENST00000372491.2	37	c.1138	CCDS43888.1	9	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620803	0.46736	.	.	ENSG00000188483	ENST00000372491	T	0.11277	2.79	2.47	2.47	0.30058	.	0.916328	0.08734	U	0.901682	T	0.16385	0.0394	N	0.14661	0.345	0.26743	N	0.970355	D	0.69078	0.997	D	0.81914	0.995	T	0.33523	-0.9865	10	0.56958	D	0.05	.	8.5674	0.33547	0.0:0.0:1.0:0.0	.	380	Q5T953	IER5L_HUMAN	T	380	ENSP00000361569:P380T	ENSP00000361569:P380T	P	-	1	0	IER5L	130979015	.	.	1.000000	0.80357	0.997000	0.91878	.	.	1.702000	0.51228	0.549000	0.68633	CCG	IER5L	-	pfam_IER	ENSG00000188483		0.682	IER5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IER5L	HGNC	protein_coding	OTTHUMT00000054556.2	9	0.00	0	G			131939194	131939194	-1	no_errors	ENST00000372491	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	1.000	T
IGKV3D-20	28874	genome.wustl.edu	37	2	90078037	90078037	+	RNA	SNP	C	C	G	rs189772344	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:90078037C>G	ENST00000390270.2	+	0	171									immunoglobulin kappa variable 3D-20																		ATTGTGTTGACGCAGTCTCCA	0.498																																						dbGAP											0													91.0	91.0	91.0					2																	90078037		1875	4108	5983	-	-	-			0			X12687		2p11.2	2012-02-08			ENSG00000211625	ENSG00000211625		"""Immunoglobulins / IGK locus"""	5825	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151615		2.37:g.90078037C>G				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.T25R	ENST00000390270.2	37	c.74		2																																																																																			IGKV3D-20	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211625		0.498	IGKV3D-20-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV3D-20	HGNC	IG_V_gene	OTTHUMT00000323287.1	156	0.00	0	C	NG_000833		90078037	90078037	+1	no_stop_codon	ENST00000390270	ensembl	human	known	69_37n	missense	138	24.18	44	SNP	0.986	G
IGKV1D-43	28891	genome.wustl.edu	37	2	90249196	90249196	+	RNA	SNP	T	T	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:90249196T>A	ENST00000468879.1	+	0	333									immunoglobulin kappa variable 1D-43																		AGTCAGGGCATTAGCAGTTAT	0.502																																						dbGAP											0													141.0	143.0	142.0					2																	90249196		1889	4121	6010	-	-	-			0			X72817		2p11.2	2012-10-03			ENSG00000242580	ENSG00000242580		"""Immunoglobulins / IGK locus"""	5758	other	immunoglobulin gene							Standard	NG_000833		Approved				OTTHUMG00000151572		2.37:g.90249196T>A				Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.I51N	ENST00000468879.1	37	c.152		2																																																																																			IGKV1D-43	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000242580		0.502	IGKV1D-43-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV1D-43	HGNC	IG_V_gene	OTTHUMT00000323147.2	119	0.00	0	T	NG_000833		90249196	90249196	+1	no_stop_codon	ENST00000468879	ensembl	human	known	69_37n	missense	154	17.65	33	SNP	0.018	A
IL17D	53342	genome.wustl.edu	37	13	21277444	21277444	+	5'Flank	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr13:21277444G>T	ENST00000304920.3	+	0	0				IL17D_ENST00000498088.1_3'UTR|AL161772.1_ENST00000581760.1_RNA	NM_138284.1	NP_612141.1	Q8TAD2	IL17D_HUMAN	interleukin 17D						inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|skin(1)	2		all_cancers(29;9.63e-24)|all_epithelial(30;1.09e-19)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000301)|Epithelial(112;0.000633)|OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Lung(94;0.0154)|LUSC - Lung squamous cell carcinoma(192;0.0414)		CGGGGGAGAAGATGTTGGGGG	0.607																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AY078238	CCDS9292.1	13q11	2008-07-18			ENSG00000172458	ENSG00000172458		"""Interleukins and interleukin receptors"""	5984	protein-coding gene	gene with protein product	"""interleukin 27"""	607587				12097364	Standard	NM_138284		Approved	IL-22, IL-27, IL-17D, IL27, FLJ30846	uc001unm.3	Q8TAD2	OTTHUMG00000016521		13.37:g.21277444G>T	Exception_encountered		B1AM69	RNA	SNP	-	NULL	ENST00000304920.3	37	NULL	CCDS9292.1	13																																																																																			IL17D	-	-	ENSG00000172458		0.607	IL17D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17D	HGNC	protein_coding	OTTHUMT00000044087.1	37	0.00	0	G	NM_138284		21277444	21277444	+1	no_errors	ENST00000498088	ensembl	human	known	69_37n	rna	15	16.67	3	SNP	0.003	T
IL17RD	54756	genome.wustl.edu	37	3	57136608	57136608	+	Missense_Mutation	SNP	G	G	T	rs150457965	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:57136608G>T	ENST00000296318.7	-	10	966	c.878C>A	c.(877-879)cCg>cAg	p.P293Q	IL17RD_ENST00000320057.5_Missense_Mutation_p.P149Q|IL17RD_ENST00000463523.1_Missense_Mutation_p.P149Q|IL17RD_ENST00000427856.2_Missense_Mutation_p.P269Q	NM_017563.3	NP_060033.3	Q8NFM7	I17RD_HUMAN	interleukin 17 receptor D	293					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(1)|ovary(1)|pancreas(1)	16				KIRC - Kidney renal clear cell carcinoma(284;0.0173)|Kidney(284;0.0204)		CCCGGCCCACGGGGAGTGCAC	0.468																																						dbGAP											0													42.0	46.0	44.0					3																	57136608		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF494208	CCDS2880.2	3p21.1	2008-02-05			ENSG00000144730	ENSG00000144730		"""Interleukins and interleukin receptors"""	17616	protein-coding gene	gene with protein product		606807				11802164, 12604616	Standard	NM_017563		Approved	SEF, IL17RLM, FLJ35755, IL-17RD	uc003dil.3	Q8NFM7	OTTHUMG00000150171	ENST00000296318.7:c.878C>A	3.37:g.57136608G>T	ENSP00000296318:p.Pro293Gln		Q2NKP7|Q58EZ7|Q6RVF4|Q6UWI5|Q8N113|Q8NFS0|Q9UFA0	Missense_Mutation	SNP	pfam_SEFIR,superfamily_TIR_dom	p.P293Q	ENST00000296318.7	37	c.878	CCDS2880.2	3	.	.	.	.	.	.	.	.	.	.	G	25.2	4.608671	0.87258	.	.	ENSG00000144730	ENST00000296318;ENST00000320057;ENST00000427856;ENST00000463523	T;T;T;T	0.10288	2.89;2.9;2.9;2.9	5.48	5.48	0.80851	.	0.050900	0.85682	D	0.000000	T	0.25754	0.0627	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.80764	0.994;0.98;0.986	T	0.00527	-1.1688	10	0.87932	D	0	-8.1787	19.5489	0.95310	0.0:0.0:1.0:0.0	.	149;293;269	B4DXM5;Q8NFM7;Q8NFM7-3	.;I17RD_HUMAN;.	Q	293;149;269;149	ENSP00000296318:P293Q;ENSP00000322250:P149Q;ENSP00000399209:P269Q;ENSP00000417516:P149Q	ENSP00000296318:P293Q	P	-	2	0	IL17RD	57111648	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	7.380000	0.79704	2.850000	0.98022	0.655000	0.94253	CCG	IL17RD	-	NULL	ENSG00000144730		0.468	IL17RD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RD	HGNC	protein_coding	OTTHUMT00000316680.1	41	0.00	0	G	NM_017563		57136608	57136608	-1	no_errors	ENST00000296318	ensembl	human	known	69_37n	missense	18	43.75	14	SNP	1.000	T
IQCA1L	392843	genome.wustl.edu	37	7	150900584	150900584	+	IGR	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:150900584G>C								IQCA1P1 (7894 upstream) : ABCF2 (4338 downstream)																							TTTGGGGATTGGAACCTCCAG	0.567																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															7.37:g.150900584G>C				RNA	SNP	-	NULL		37	NULL		7																																																																																			IQCA1P1	-	-	ENSG00000183016	0	0.567					IQCA1P1	HGNC			26	0.00	0	G			150900584	150900584	-1	no_errors	ENST00000453127	ensembl	human	known	69_37n	rna	31	11.43	4	SNP	0.998	C
IRF2BP2	359948	genome.wustl.edu	37	1	234744216	234744216	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:234744216T>C	ENST00000366609.3	-	1	1055	c.1025A>G	c.(1024-1026)aAc>aGc	p.N342S	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000491430.1_5'Flank|IRF2BP2_ENST00000366610.3_Intron	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	342					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GTTGGCCCCGTTGGCCTCGAA	0.617																																						dbGAP											0													20.0	20.0	20.0					1																	234744216		2202	4298	6500	-	-	-	SO:0001583	missense	0			AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1025A>G	1.37:g.234744216T>C	ENSP00000355568:p.Asn342Ser		B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Missense_Mutation	SNP	pfam_Interferon_reg_fac2-bd1_2_Znf	p.N342S	ENST00000366609.3	37	c.1025	CCDS1602.1	1	.	.	.	.	.	.	.	.	.	.	T	5.369	0.253382	0.10185	.	.	ENSG00000168264	ENST00000366609	T	0.27890	1.64	4.94	3.82	0.43975	.	0.467844	0.24158	N	0.041010	T	0.13500	0.0327	N	0.08118	0	0.33691	D	0.613293	B	0.14438	0.01	B	0.10450	0.005	T	0.20806	-1.0264	10	0.07482	T	0.82	-6.9281	10.1232	0.42634	0.0:0.0796:0.0:0.9204	.	342	Q7Z5L9	I2BP2_HUMAN	S	342	ENSP00000355568:N342S	ENSP00000355568:N342S	N	-	2	0	IRF2BP2	232810839	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.064000	0.30579	0.904000	0.36572	0.533000	0.62120	AAC	IRF2BP2	-	pfam_Interferon_reg_fac2-bd1_2_Znf	ENSG00000168264		0.617	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	IRF2BP2	HGNC	protein_coding	OTTHUMT00000092705.1	70	0.00	0	T	NM_182972		234744216	234744216	-1	no_errors	ENST00000366609	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	1.000	C
IRF8	3394	genome.wustl.edu	37	16	85952175	85952175	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:85952175T>C	ENST00000268638.5	+	7	1176	c.754T>C	c.(754-756)Ttc>Ctc	p.F252L	IRF8_ENST00000562492.1_Missense_Mutation_p.F48L	NM_002163.2	NP_002154.1	Q02556	IRF8_HUMAN	interferon regulatory factor 8	252					cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	24		Prostate(104;0.0771)				GCTGGTGCGCTTCCCGCCGGC	0.736																																						dbGAP											0													15.0	20.0	18.0					16																	85952175		2170	4258	6428	-	-	-	SO:0001583	missense	0			M91196	CCDS10956.1	16q24.1	2014-09-17	2004-11-12	2004-11-12	ENSG00000140968	ENSG00000140968			5358	protein-coding gene	gene with protein product		601565	"""interferon consensus sequence binding protein 1"""	ICSBP1		1460054, 11997525	Standard	NM_002163		Approved	IRF-8, ICSBP	uc002fjh.3	Q02556	OTTHUMG00000137648	ENST00000268638.5:c.754T>C	16.37:g.85952175T>C	ENSP00000268638:p.Phe252Leu		A0AV82	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.F252L	ENST00000268638.5	37	c.754	CCDS10956.1	16	.	.	.	.	.	.	.	.	.	.	T	28.2	4.895523	0.91962	.	.	ENSG00000140968	ENST00000268638	D	0.92249	-3.0	4.95	4.95	0.65309	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.141019	0.64402	N	0.000003	D	0.92688	0.7676	L	0.59912	1.85	0.80722	D	1	P	0.41546	0.754	P	0.51415	0.669	D	0.90504	0.4476	10	0.17832	T	0.49	-25.7503	14.9142	0.70781	0.0:0.0:0.0:1.0	.	252	Q02556	IRF8_HUMAN	L	252	ENSP00000268638:F252L	ENSP00000268638:F252L	F	+	1	0	IRF8	84509676	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	5.719000	0.68462	1.986000	0.57962	0.528000	0.53228	TTC	IRF8	-	pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain	ENSG00000140968		0.736	IRF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF8	HGNC	protein_coding	OTTHUMT00000269100.2	50	0.00	0	T	NM_002163		85952175	85952175	+1	no_errors	ENST00000268638	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	1.000	C
IRX4	50805	genome.wustl.edu	37	5	1878506	1878506	+	Silent	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:1878506G>A	ENST00000505790.1	-	6	1593	c.1137C>T	c.(1135-1137)gcC>gcT	p.A379A	IRX4_ENST00000231357.2_Silent_p.A379A|IRX4_ENST00000505938.1_5'Flank|IRX4_ENST00000513692.1_Silent_p.A379A	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	379	Poly-Ala.				establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		tggcggcggcggcggcggcgg	0.731																																						dbGAP											0													2.0	4.0	3.0					5																	1878506		1488	3131	4619	-	-	-	SO:0001819	synonymous_variant	0			AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.1137C>T	5.37:g.1878506G>A			B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,smart_Iroquois_homeo,pfscan_Homeodomain	p.A379	ENST00000505790.1	37	c.1137	CCDS3867.1	5																																																																																			IRX4	-	NULL	ENSG00000113430		0.731	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	IRX4	HGNC	protein_coding	OTTHUMT00000365500.1	22	0.00	0	G	NM_016358		1878506	1878506	-1	no_errors	ENST00000231357	ensembl	human	known	69_37n	silent	17	30.77	8	SNP	0.932	A
ITGA4	3676	genome.wustl.edu	37	2	182323032	182323032	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:182323032C>A	ENST00000397033.2	+	2	737	c.307C>A	c.(307-309)Cag>Aag	p.Q103K	ITGA4_ENST00000339307.4_Missense_Mutation_p.Q103K|ITGA4_ENST00000478440.1_3'UTR	NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	103					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GACGTGCGAACAGCTCCAGCT	0.592																																						dbGAP											0													31.0	36.0	35.0					2																	182323032		2003	4158	6161	-	-	-	SO:0001583	missense	0				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.307C>A	2.37:g.182323032C>A	ENSP00000380227:p.Gln103Lys		D3DPG4|Q7Z4L6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.Q103K	ENST00000397033.2	37	c.307	CCDS42788.1	2	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564790	0.65651	.	.	ENSG00000115232	ENST00000425522;ENST00000339307;ENST00000397033;ENST00000233573	T;T;T	0.55760	0.5;0.5;0.5	4.71	3.82	0.43975	.	0.487672	0.22132	N	0.064177	T	0.34366	0.0895	L	0.33245	0.995	0.39829	D	0.972947	B;P;P	0.41475	0.354;0.751;0.61	B;B;B	0.33121	0.138;0.158;0.09	T	0.18935	-1.0321	10	0.36615	T	0.2	.	8.1246	0.30990	0.1803:0.6455:0.1742:0.0	.	103;103;103	E7EP60;P13612;E7ESG7	.;ITA4_HUMAN;.	K	103	ENSP00000340149:Q103K;ENSP00000380227:Q103K;ENSP00000233573:Q103K	ENSP00000233573:Q103K	Q	+	1	0	ITGA4	182031277	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.855000	0.48333	1.309000	0.44985	0.462000	0.41574	CAG	ITGA4	-	smart_Int_alpha_beta-p	ENSG00000115232		0.592	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	HGNC	protein_coding	OTTHUMT00000334427.1	20	0.00	0	C			182323032	182323032	+1	no_errors	ENST00000397033	ensembl	human	known	69_37n	missense	11	45.00	9	SNP	1.000	A
ITPR2	3709	genome.wustl.edu	37	12	26592110	26592110	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:26592110T>A	ENST00000381340.3	-	47	7009	c.6593A>T	c.(6592-6594)cAg>cTg	p.Q2198L		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2198					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TTCTGTTTGCTGGAAAAAGTC	0.378																																						dbGAP											0													193.0	186.0	188.0					12																	26592110		1881	4112	5993	-	-	-	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.6593A>T	12.37:g.26592110T>A	ENSP00000370744:p.Gln2198Leu		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.Q2198L	ENST00000381340.3	37	c.6593	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	T	13.62	2.292601	0.40594	.	.	ENSG00000123104	ENST00000381340	D	0.91686	-2.89	5.52	4.32	0.51571	.	0.000000	0.85682	D	0.000000	D	0.82678	0.5089	N	0.05124	-0.11	0.80722	D	1	B	0.33512	0.415	B	0.37451	0.25	T	0.80728	-0.1253	10	0.23891	T	0.37	.	12.0507	0.53505	0.1286:0.0:0.0:0.8714	.	2198	Q14571	ITPR2_HUMAN	L	2198	ENSP00000370744:Q2198L	ENSP00000370744:Q2198L	Q	-	2	0	ITPR2	26483377	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.864000	0.62990	2.317000	0.78254	0.460000	0.39030	CAG	ITPR2	-	NULL	ENSG00000123104		0.378	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	79	0.00	0	T	NM_002223		26592110	26592110	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	missense	60	61.54	96	SNP	1.000	A
ITPR2	3709	genome.wustl.edu	37	12	26834906	26834906	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:26834906G>C	ENST00000381340.3	-	13	1726	c.1310C>G	c.(1309-1311)tCt>tGt	p.S437C		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	437					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	TCGAACTTCAGACAGTGGAAC	0.388																																						dbGAP											0													184.0	167.0	172.0					12																	26834906		1849	4099	5948	-	-	-	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.1310C>G	12.37:g.26834906G>C	ENSP00000370744:p.Ser437Cys		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.S437C	ENST00000381340.3	37	c.1310	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427436	0.83667	.	.	ENSG00000123104	ENST00000381340	D	0.89681	-2.55	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.92163	0.7515	L	0.52573	1.65	0.80722	D	1	D	0.69078	0.997	P	0.61800	0.894	D	0.92667	0.6146	10	0.66056	D	0.02	.	18.692	0.91586	0.0:0.0:1.0:0.0	.	437	Q14571	ITPR2_HUMAN	C	437	ENSP00000370744:S437C	ENSP00000370744:S437C	S	-	2	0	ITPR2	26726173	1.000000	0.71417	0.952000	0.39060	0.984000	0.73092	6.417000	0.73337	2.630000	0.89119	0.650000	0.86243	TCT	ITPR2	-	prints_InsP3_rcpt-bd	ENSG00000123104		0.388	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	38	0.00	0	G	NM_002223		26834906	26834906	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	missense	110	16.67	22	SNP	1.000	C
ITPR2	3709	genome.wustl.edu	37	12	26834918	26834918	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:26834918G>C	ENST00000381340.3	-	13	1714	c.1298C>G	c.(1297-1299)tCt>tGt	p.S433C		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	433	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	CAGTGGAACAGACACGATTGC	0.373																																						dbGAP											0													173.0	158.0	163.0					12																	26834918		1849	4103	5952	-	-	-	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.1298C>G	12.37:g.26834918G>C	ENSP00000370744:p.Ser433Cys		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.S433C	ENST00000381340.3	37	c.1298	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	G	15.56	2.870281	0.51588	.	.	ENSG00000123104	ENST00000381340	D	0.92099	-2.97	5.09	4.18	0.49190	MIR motif (1);MIR (1);	0.056269	0.64402	N	0.000001	D	0.87095	0.6092	N	0.25647	0.755	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.83245	-0.0056	10	0.56958	D	0.05	.	15.3191	0.74105	0.0:0.1452:0.8548:0.0	.	433	Q14571	ITPR2_HUMAN	C	433	ENSP00000370744:S433C	ENSP00000370744:S433C	S	-	2	0	ITPR2	26726185	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	7.465000	0.80898	1.320000	0.45209	0.650000	0.86243	TCT	ITPR2	-	superfamily_MIR,prints_InsP3_rcpt-bd	ENSG00000123104		0.373	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	42	0.00	0	G	NM_002223		26834918	26834918	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	missense	119	15.00	21	SNP	0.999	C
KCTD3	51133	genome.wustl.edu	37	1	215793688	215793688	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:215793688T>C	ENST00000259154.4	+	18	2470	c.2176T>C	c.(2176-2178)Ttg>Ctg	p.L726L	KCTD3_ENST00000495537.1_3'UTR	NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	726					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		GGATAGTGGATTGGAAGTGCA	0.348																																						dbGAP											0													65.0	73.0	71.0					1																	215793688		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.2176T>C	1.37:g.215793688T>C			A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.L726	ENST00000259154.4	37	c.2176	CCDS1515.1	1																																																																																			KCTD3	-	NULL	ENSG00000136636		0.348	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	18	0.00	0	T	NM_016121		215793688	215793688	+1	no_errors	ENST00000259154	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.000	C
KERA	11081	genome.wustl.edu	37	12	91449978	91449978	+	Silent	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:91449978A>G	ENST00000266719.3	-	2	328	c.81T>C	c.(79-81)taT>taC	p.Y27Y		NM_007035.3	NP_008966.1	O60938	KERA_HUMAN	keratocan	27					carbohydrate metabolic process (GO:0005975)|cornea development in camera-type eye (GO:0061303)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|response to stimulus (GO:0050896)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|large_intestine(8)|lung(5)|prostate(2)|skin(2)	19						CATGTACTTCATAGACCTGCC	0.408																																						dbGAP											0													95.0	76.0	82.0					12																	91449978		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF063301	CCDS9037.1	12q21.3-q22	2014-09-17				ENSG00000139330		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6309	protein-coding gene	gene with protein product	"""keratocan proteoglycan"""	603288		CNA2		10565548, 10802664	Standard	NM_007035		Approved	SLRR2B	uc001tbl.3	O60938		ENST00000266719.3:c.81T>C	12.37:g.91449978A>G				Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.Y27	ENST00000266719.3	37	c.81	CCDS9037.1	12																																																																																			KERA	-	NULL	ENSG00000139330		0.408	KERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KERA	HGNC	protein_coding	OTTHUMT00000407149.2	26	0.00	0	A	NM_007035		91449978	91449978	-1	no_errors	ENST00000266719	ensembl	human	known	69_37n	silent	12	55.56	15	SNP	0.916	G
KIF20A	10112	genome.wustl.edu	37	5	137518631	137518631	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:137518631G>C	ENST00000394894.3	+	7	1010	c.784G>C	c.(784-786)Gct>Cct	p.A262P	KIF20A_ENST00000508792.1_Missense_Mutation_p.A244P	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A	262	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CAGTGGCATTGCTGGGCTCTC	0.532																																						dbGAP											0													79.0	74.0	76.0					5																	137518631		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.784G>C	5.37:g.137518631G>C	ENSP00000378356:p.Ala262Pro		B4DL79|D3DQB6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A262P	ENST00000394894.3	37	c.784	CCDS4199.1	5	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014753	0.75161	.	.	ENSG00000112984	ENST00000394894;ENST00000508792	T;T	0.70986	-0.49;-0.53	4.88	4.88	0.63580	Kinesin, motor domain (3);	0.000000	0.44902	D	0.000414	T	0.71492	0.3346	N	0.11201	0.11	0.52099	D	0.999945	D;D	0.76494	0.967;0.999	P;D	0.71184	0.745;0.972	T	0.77091	-0.2716	10	0.52906	T	0.07	-10.1391	18.2245	0.89913	0.0:0.0:1.0:0.0	.	244;262	B4DL79;O95235	.;KI20A_HUMAN	P	262;244	ENSP00000378356:A262P;ENSP00000420880:A244P	ENSP00000378356:A262P	A	+	1	0	KIF20A	137546530	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.146000	0.77373	2.548000	0.85928	0.655000	0.94253	GCT	KIF20A	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000112984		0.532	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF20A	HGNC	protein_coding	OTTHUMT00000251272.1	34	0.00	0	G	NM_005733		137518631	137518631	+1	no_errors	ENST00000394894	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	1.000	C
KIF4A	24137	genome.wustl.edu	37	X	69639953	69639953	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:69639953G>C	ENST00000374403.3	+	31	3619	c.3537G>C	c.(3535-3537)aaG>aaC	p.K1179N	GDPD2_ENST00000536730.1_5'Flank|GDPD2_ENST00000538649.1_5'Flank|GDPD2_ENST00000453994.2_5'Flank	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	1179	Globular.|Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TGCTGTCAAAGAAGACTCCCC	0.498																																						dbGAP											0													67.0	66.0	66.0					X																	69639953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.3537G>C	X.37:g.69639953G>C	ENSP00000363524:p.Lys1179Asn		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K1179N	ENST00000374403.3	37	c.3537	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	g	7.867	0.727341	0.15439	.	.	ENSG00000090889	ENST00000374403;ENST00000544650	T	0.53206	0.63	4.37	1.51	0.23008	.	0.596033	0.15221	N	0.273939	T	0.33177	0.0854	L	0.40543	1.245	0.09310	N	1	B	0.23735	0.09	B	0.16289	0.015	T	0.16988	-1.0384	9	.	.	.	.	7.4315	0.27131	0.1005:0.492:0.4075:0.0	.	1179	O95239	KIF4A_HUMAN	N	1179;481	ENSP00000363524:K1179N	.	K	+	3	2	KIF4A	69556678	0.398000	0.25279	0.000000	0.03702	0.095000	0.18619	0.931000	0.28871	0.073000	0.16731	0.597000	0.82753	AAG	KIF4A	-	NULL	ENSG00000090889		0.498	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	78	0.00	0	G	NM_012310		69639953	69639953	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	70	35.78	39	SNP	0.001	C
KIR2DL3	3804	genome.wustl.edu	37	19	55250970	55250970	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:55250970G>T	ENST00000342376.3	+	2	83	c.52G>T	c.(52-54)Ggg>Tgg	p.G18W	KIR3DL1_ENST00000538269.1_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL3_ENST00000434419.2_Missense_Mutation_p.G18W	NM_015868.2	NP_056952.2	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3	18					immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CTTGCTGCAGGGGGCCTGGCC	0.562																																						dbGAP											0													24.0	20.0	22.0					19																	55250970		1379	2463	3842	-	-	-	SO:0001583	missense	0			L41268	CCDS33107.1	19q13.4	2013-01-29				ENSG00000243772		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6331	protein-coding gene	gene with protein product		604938				7749980, 8662091	Standard	XM_006725426		Approved	cl-6, nkat2, nkat2a, nkat2b, p58, CD158B2		P43628	OTTHUMG00000065887	ENST00000342376.3:c.52G>T	19.37:g.55250970G>T	ENSP00000342215:p.Gly18Trp		O43472|P78402|Q14944|Q14945|Q9UM51|Q9UQ70	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.G18W	ENST00000342376.3	37	c.52	CCDS33107.1	19	.	.	.	.	.	.	.	.	.	.	G	6.330	0.428958	0.11987	.	.	ENSG00000243772	ENST00000342376;ENST00000434419	T;T	0.00476	7.15;7.15	0.418	-0.836	0.10770	.	.	.	.	.	T	0.00875	0.0029	M	0.63428	1.95	0.09310	N	1	D;D;D;D	0.76494	0.993;0.999;0.994;0.994	D;D;D;D	0.77557	0.966;0.99;0.938;0.938	T	0.49899	-0.8890	9	0.87932	D	0	.	4.549	0.12103	0.3991:0.0:0.6009:0.0	.	18;18;18;18	E3NZD7;P43628-2;P43628;E3NZD8	.;.;KI2L3_HUMAN;.	W	18	ENSP00000342215:G18W;ENSP00000415758:G18W	ENSP00000342215:G18W	G	+	1	0	KIR2DL3	59942782	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.527000	0.06200	-0.704000	0.05042	-1.109000	0.02080	GGG	KIR2DL3	-	NULL	ENSG00000243772		0.562	KIR2DL3-001	KNOWN	basic|CCDS	protein_coding	KIR2DL3	HGNC	protein_coding	OTTHUMT00000141150.1	123	0.00	0	G			55250970	55250970	+1	no_errors	ENST00000434419	ensembl	human	known	69_37n	missense	96	16.52	19	SNP	0.003	T
KLHL1	57626	genome.wustl.edu	37	13	70281842	70281842	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr13:70281842C>G	ENST00000377844.4	-	10	2861	c.2102G>C	c.(2101-2103)aGa>aCa	p.R701T	KLHL1_ENST00000545028.1_Missense_Mutation_p.R508T	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	701					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		AGCATATAATCTGTCACCAAG	0.438																																						dbGAP											0													165.0	134.0	144.0					13																	70281842		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.2102G>C	13.37:g.70281842C>G	ENSP00000367075:p.Arg701Thr		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.R701T	ENST00000377844.4	37	c.2102	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613063	0.46631	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.78126	-1.15;-1.15	5.19	4.33	0.51752	Galactose oxidase, beta-propeller (1);	0.000000	0.64402	D	0.000003	T	0.80308	0.4599	L	0.58969	1.84	0.36149	D	0.847353	P;B	0.46277	0.875;0.07	P;B	0.54174	0.744;0.297	T	0.82468	-0.0442	10	0.39692	T	0.17	.	10.5324	0.44983	0.0:0.8237:0.0:0.1763	.	701;701	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	T	701;508	ENSP00000367075:R701T;ENSP00000439602:R508T	ENSP00000367075:R701T	R	-	2	0	KLHL1	69179843	0.975000	0.34042	1.000000	0.80357	0.983000	0.72400	1.498000	0.35660	2.595000	0.87683	0.650000	0.86243	AGA	KLHL1	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1	ENSG00000150361		0.438	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	49	0.00	0	C	NM_020866		70281842	70281842	-1	no_errors	ENST00000377844	ensembl	human	known	69_37n	missense	12	80.00	48	SNP	1.000	G
KRIT1	889	genome.wustl.edu	37	7	91844033	91844033	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:91844033T>G	ENST00000340022.2	-	15	2640	c.1622A>C	c.(1621-1623)aAg>aCg	p.K541T	KRIT1_ENST00000412043.2_Missense_Mutation_p.K541T|KRIT1_ENST00000394507.1_Missense_Mutation_p.K541T|KRIT1_ENST00000394503.2_Missense_Mutation_p.K493T|KRIT1_ENST00000394505.2_Missense_Mutation_p.K541T	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	541	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATAAAAGCCCTTCAATAAATT	0.333																																						dbGAP											0													66.0	68.0	67.0					7																	91844033		2203	4297	6500	-	-	-	SO:0001583	missense	0			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1622A>C	7.37:g.91844033T>G	ENSP00000344668:p.Lys541Thr		A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Missense_Mutation	SNP	pfam_FERM_central,superfamily_Ankyrin_rpt-contain_dom,superfamily_FERM_central,smart_Ankyrin_rpt,smart_Band_41_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_FERM_domain	p.K541T	ENST00000340022.2	37	c.1622	CCDS5624.1	7	.	.	.	.	.	.	.	.	.	.	T	16.59	3.165206	0.57476	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503;ENST00000415227	T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14	5.3	4.15	0.48705	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	T	0.79667	0.4485	L	0.29908	0.895	0.80722	D	1	D;D;D	0.69078	0.997;0.997;0.997	D;P;D	0.79108	0.992;0.908;0.992	T	0.77208	-0.2672	10	0.36615	T	0.2	-4.9145	11.1475	0.48438	0.0:0.0726:0.0:0.9274	.	541;493;541	A4D1F7;A6NNU0;O00522	.;.;KRIT1_HUMAN	T	541;541;541;541;493;541	ENSP00000378015:K541T;ENSP00000344668:K541T;ENSP00000410909:K541T;ENSP00000378013:K541T;ENSP00000378011:K493T	ENSP00000344668:K541T	K	-	2	0	KRIT1	91681969	1.000000	0.71417	1.000000	0.80357	0.372000	0.29890	7.775000	0.85489	0.969000	0.38237	-0.326000	0.08463	AAG	KRIT1	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000001631		0.333	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRIT1	HGNC	protein_coding	OTTHUMT00000253910.1	42	0.00	0	T			91844033	91844033	-1	no_errors	ENST00000340022	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	1.000	G
KRT2	3849	genome.wustl.edu	37	12	53045616	53045618	+	In_Frame_Del	DEL	CCT	CCT	-	rs150409603		TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:53045616_53045618delCCT	ENST00000309680.3	-	1	330_332	c.309_311delAGG	c.(307-312)ggaggt>ggt	p.103_104GG>G		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	103	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		gccgctgccacctccaaagctgc	0.616																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.309_311delAGG	12.37:g.53045616_53045618delCCT	ENSP00000310861:p.Gly105del		Q4VAQ2	In_Frame_Del	DEL	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G105in_frame_del	ENST00000309680.3	37	c.311_309	CCDS8835.1	12																																																																																			KRT2	-	NULL	ENSG00000172867		0.616	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT2	HGNC	protein_coding	OTTHUMT00000405704.1	133	0.00	0	CCT	NM_000423		53045616	53045618	-1	no_errors	ENST00000309680	ensembl	human	known	69_37n	in_frame_del	59	25.00	20	DEL	0.910:0.878:0.850	-
KRTAP15-1	254950	genome.wustl.edu	37	21	31812765	31812765	+	Silent	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr21:31812765C>T	ENST00000334067.3	+	1	169	c.120C>T	c.(118-120)acC>acT	p.T40T		NM_181623.1	NP_853654.1	Q3LI76	KR151_HUMAN	keratin associated protein 15-1	40						intermediate filament (GO:0005882)				kidney(1)|large_intestine(3)|lung(6)|skin(1)	11						CTCCAAATACCTGCCAACTGG	0.488																																						dbGAP											0													84.0	85.0	85.0					21																	31812765		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AP001708	CCDS13593.1	21q22.1	2008-05-21			ENSG00000186970	ENSG00000186970		"""Keratin associated proteins"""	18927	protein-coding gene	gene with protein product						12359730	Standard	NM_181623		Approved	KAP15.1	uc002yod.3	Q3LI76	OTTHUMG00000057784	ENST00000334067.3:c.120C>T	21.37:g.31812765C>T			Q2M3F4	Silent	SNP	pfam_PMG	p.T40	ENST00000334067.3	37	c.120	CCDS13593.1	21																																																																																			KRTAP15-1	-	pfam_PMG	ENSG00000186970		0.488	KRTAP15-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP15-1	HGNC	protein_coding	OTTHUMT00000128236.1	32	0.00	0	C			31812765	31812765	+1	no_errors	ENST00000334067	ensembl	human	known	69_37n	silent	19	32.14	9	SNP	0.002	T
LAMA1	284217	genome.wustl.edu	37	18	7034688	7034688	+	Splice_Site	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr18:7034688C>A	ENST00000389658.3	-	14	1934	c.1841G>T	c.(1840-1842)gGa>gTa	p.G614V		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	614	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GAGTCCGTTTCCCTAACATTT	0.333																																						dbGAP											0													79.0	73.0	75.0					18																	7034688		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1840-1G>T	18.37:g.7034688C>A				Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G614V	ENST00000389658.3	37	c.1841	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	23.3	4.398376	0.83120	.	.	ENSG00000101680	ENST00000389658	T	0.73897	-0.79	5.9	5.9	0.94986	Laminin B type IV (2);Laminin B, subgroup (1);	0.125558	0.56097	D	0.000040	D	0.89543	0.6745	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90213	0.4266	10	0.62326	D	0.03	.	20.2768	0.98488	0.0:1.0:0.0:0.0	.	614	P25391	LAMA1_HUMAN	V	614	ENSP00000374309:G614V	ENSP00000374309:G614V	G	-	2	0	LAMA1	7024688	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	6.761000	0.74945	2.797000	0.96272	0.655000	0.94253	GGA	LAMA1	-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV	ENSG00000101680		0.333	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	22	0.00	0	C	NM_005559	Missense_Mutation	7034688	7034688	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	1.000	A
LARP1B	55132	genome.wustl.edu	37	4	129043104	129043104	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr4:129043104A>T	ENST00000326639.6	+	11	1496	c.1285A>T	c.(1285-1287)Act>Tct	p.T429S	LARP1B_ENST00000427266.1_Missense_Mutation_p.T429S|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000441387.1_Missense_Mutation_p.T429S|LARP1B_ENST00000512292.1_Missense_Mutation_p.T429S|LARP1B_ENST00000264584.5_Missense_Mutation_p.T382S	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	429						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						AAACACATTTACTGATTGGTC	0.318																																						dbGAP											0													70.0	69.0	69.0					4																	129043104		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.1285A>T	4.37:g.129043104A>T	ENSP00000321997:p.Thr429Ser		Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.T429S	ENST00000326639.6	37	c.1285	CCDS3738.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.96|12.96	2.093344|2.093344	0.36952|0.36952	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000508819;ENST00000264584;ENST00000441387;ENST00000427266|ENST00000507377	T;T;T;T;T;T|.	0.33654|.	1.88;1.41;1.52;1.94;1.86;1.4|.	4.71|4.71	2.23|2.23	0.28157|0.28157	.|.	0.175392|.	0.49305|.	D|.	0.000145|.	T|T	0.53481|0.53481	0.1799|0.1799	L|L	0.46885|0.46885	1.475|1.475	0.80722|0.80722	D|D	1|1	P;P;P|.	0.44090|.	0.506;0.826;0.51|.	B;B;B|.	0.43018|.	0.217;0.405;0.13|.	T|T	0.40887|0.40887	-0.9539|-0.9539	10|5	0.15499|.	T|.	0.54|.	.|.	7.1663|7.1663	0.25693|0.25693	0.7756:0.1476:0.0767:0.0|0.7756:0.1476:0.0767:0.0	.|.	382;429;429|.	D6RJB0;Q659C4;G3XAJ5|.	.;LAR1B_HUMAN;.|.	S|F	429;429;382;382;429;429|397	ENSP00000321997:T429S;ENSP00000422850:T429S;ENSP00000427281:T382S;ENSP00000264584:T382S;ENSP00000396521:T429S;ENSP00000403586:T429S|.	ENSP00000264584:T382S|.	T|Y	+|+	1|2	0|0	LARP1B|LARP1B	129262554|129262554	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.989000|0.989000	0.77384|0.77384	4.076000|4.076000	0.57591|0.57591	0.301000|0.301000	0.22738|0.22738	0.477000|0.477000	0.44152|0.44152	ACT|TAC	LARP1B	-	NULL	ENSG00000138709		0.318	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LARP1B	HGNC	protein_coding	OTTHUMT00000257173.2	34	0.00	0	A	NM_018078		129043104	129043104	+1	no_errors	ENST00000326639	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	T
LILRB1	10859	genome.wustl.edu	37	19	55144502	55144502	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:55144502C>A	ENST00000396331.1	+	8	1351	c.994C>A	c.(994-996)Ccg>Acg	p.P332T	LILRB1_ENST00000418536.2_Missense_Mutation_p.P332T|LILRB1_ENST00000396327.3_Missense_Mutation_p.P332T|LILRB1_ENST00000396317.1_Missense_Mutation_p.P332T|LILRB1_ENST00000396315.1_Missense_Mutation_p.P332T|LILRB1_ENST00000448689.1_Missense_Mutation_p.P332T|LILRB1_ENST00000427581.2_Missense_Mutation_p.P368T|LILRB1_ENST00000396332.4_Missense_Mutation_p.P332T|LILRB1_ENST00000396321.2_Missense_Mutation_p.P332T|LILRB1_ENST00000324602.7_Missense_Mutation_p.P332T|LILRB1_ENST00000434867.2_Missense_Mutation_p.P332T	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	332	Ig-like C2-type 4.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		CTCGGTGCAGCCGGGCCCCAC	0.607										HNSCC(37;0.09)																												dbGAP											0													59.0	64.0	62.0					19																	55144502		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.994C>A	19.37:g.55144502C>A	ENSP00000379622:p.Pro332Thr		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P332T	ENST00000396331.1	37	c.994	CCDS42617.1	19	.	.	.	.	.	.	.	.	.	.	C	12.53	1.965630	0.34659	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.01221	5.15;5.15;5.15;5.15;5.15;5.15;5.15;5.15;5.15;5.15;5.15	2.25	2.25	0.28309	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.496226	0.15396	N	0.264561	T	0.11067	0.0270	H	0.95504	3.68	0.09310	N	1	D;D;D;P;D	0.89917	0.998;0.995;1.0;0.949;0.996	D;D;D;P;D	0.77557	0.973;0.944;0.99;0.848;0.967	T	0.03384	-1.1042	10	0.87932	D	0	.	7.936	0.29931	0.0:1.0:0.0:0.0	.	332;332;332;332;332	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	T	332;332;332;332;332;332;332;332;368;332;332	ENSP00000379614:P332T;ENSP00000391514:P332T;ENSP00000409968:P332T;ENSP00000379622:P332T;ENSP00000379618:P332T;ENSP00000315997:P332T;ENSP00000405243:P332T;ENSP00000379623:P332T;ENSP00000395004:P368T;ENSP00000379610:P332T;ENSP00000379608:P332T	ENSP00000315997:P332T	P	+	1	0	LILRB1	59836314	0.003000	0.15002	0.003000	0.11579	0.006000	0.05464	1.193000	0.32162	1.265000	0.44215	0.205000	0.17691	CCG	LILRB1	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000104972		0.607	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	77	0.00	0	C			55144502	55144502	+1	no_errors	ENST00000324602	ensembl	human	known	69_37n	missense	45	40.79	31	SNP	0.005	A
LIPN	643418	genome.wustl.edu	37	10	90537925	90537925	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr10:90537925G>C	ENST00000404459.1	+	9	1123	c.1123G>C	c.(1123-1125)Gat>Cat	p.D375H		NM_001102469.1	NP_001095939.1	Q5VXI9	LIPN_HUMAN	lipase, family member N	375					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	9		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		GAACCACTTTGATTTTGTCTG	0.418																																						dbGAP											0													88.0	83.0	85.0					10																	90537925		1900	4102	6002	-	-	-	SO:0001583	missense	0				CCDS44456.1	10q23.31	2013-09-20	2007-02-27	2007-02-27	ENSG00000204020	ENSG00000204020			23452	protein-coding gene	gene with protein product		613924	"""lipase-like, ab-hydrolase domain containing 4"""	LIPL4			Standard	NM_001102469		Approved	bA186O14.3	uc010qmw.2	Q5VXI9	OTTHUMG00000018694	ENST00000404459.1:c.1123G>C	10.37:g.90537925G>C	ENSP00000383923:p.Asp375His		A7KIH9	Missense_Mutation	SNP	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.D375H	ENST00000404459.1	37	c.1123	CCDS44456.1	10	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345938	0.82022	.	.	ENSG00000204020	ENST00000404459	T	0.72942	-0.7	5.21	5.21	0.72293	Alpha/beta hydrolase fold-1 (1);	.	.	.	.	D	0.87629	0.6225	M	0.91140	3.18	0.53005	D	0.999962	D	0.89917	1.0	D	0.97110	1.0	D	0.89337	0.3651	8	.	.	.	-22.7157	18.038	0.89311	0.0:0.0:1.0:0.0	.	375	Q5VXI9	LIPN_HUMAN	H	375	ENSP00000383923:D375H	.	D	+	1	0	LIPN	90527905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.965000	0.63708	2.871000	0.98454	0.643000	0.83706	GAT	LIPN	-	pfam_AB_hydrolase_1	ENSG00000204020		0.418	LIPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPN	HGNC	protein_coding	OTTHUMT00000049254.2	66	0.00	0	G	XM_926751		90537925	90537925	+1	no_errors	ENST00000404459	ensembl	human	known	69_37n	missense	29	40.82	20	SNP	1.000	C
LLGL1	3996	genome.wustl.edu	37	17	18138574	18138574	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr17:18138574G>A	ENST00000316843.4	+	10	1328	c.1232G>A	c.(1231-1233)cGc>cAc	p.R411H		NM_004140.3	NP_004131	Q15334	L2GL1_HUMAN	lethal giant larvae homolog 1 (Drosophila)	411					axonogenesis (GO:0007409)|cortical actin cytoskeleton organization (GO:0030866)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|maintenance of apical/basal cell polarity (GO:0035090)|positive regulation of Rab GTPase activity (GO:0032851)|protein complex assembly (GO:0006461)	cell projection (GO:0042995)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome membrane (GO:0031901)|Golgi cis cisterna (GO:0000137)|myelin sheath abaxonal region (GO:0035748)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)|structural molecule activity (GO:0005198)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_neural(463;0.228)					CTGTGGGCCCGCATTGTGAGC	0.672																																						dbGAP											0													17.0	19.0	19.0					17																	18138574		2196	4290	6486	-	-	-	SO:0001583	missense	0				CCDS32586.1	17p11.2	2013-01-10	2001-11-28		ENSG00000131899	ENSG00000131899		"""WD repeat domain containing"""	6628	protein-coding gene	gene with protein product		600966	"""lethal giant larvae (Drosophila) homolog 1"""	DLG4, LLGL, HUGL, HUGL-1		7542763, 8565641	Standard	XM_005256643		Approved		uc002gsp.3	Q15334	OTTHUMG00000059396	ENST00000316843.4:c.1232G>A	17.37:g.18138574G>A	ENSP00000321537:p.Arg411His		A7MBM7|O00188|Q58F11|Q86UK6	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Lethal2_giant,pfscan_WD40_repeat	p.R411H	ENST00000316843.4	37	c.1232	CCDS32586.1	17	.	.	.	.	.	.	.	.	.	.	G	30	5.054142	0.93793	.	.	ENSG00000131899	ENST00000316843	T	0.05786	3.39	6.02	5.04	0.67666	WD40 repeat-like-containing domain (1);	0.046212	0.85682	D	0.000000	T	0.28896	0.0717	M	0.86502	2.82	0.53688	D	0.999978	D	0.89917	1.0	D	0.69142	0.962	T	0.12142	-1.0559	10	0.52906	T	0.07	-34.8773	15.5201	0.75859	0.0:0.0:0.8603:0.1397	.	411	Q15334	L2GL1_HUMAN	H	411	ENSP00000321537:R411H	ENSP00000321537:R411H	R	+	2	0	LLGL1	18079299	1.000000	0.71417	0.931000	0.37212	0.834000	0.47266	6.713000	0.74686	1.535000	0.49220	0.650000	0.86243	CGC	LLGL1	-	superfamily_WD40_repeat_dom	ENSG00000131899		0.672	LLGL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LLGL1	HGNC	protein_coding	OTTHUMT00000132067.3	68	0.00	0	G			18138574	18138574	+1	no_errors	ENST00000316843	ensembl	human	known	69_37n	missense	7	83.72	36	SNP	1.000	A
LMO7	4008	genome.wustl.edu	37	13	76381850	76381850	+	Silent	SNP	T	T	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr13:76381850T>A	ENST00000321797.8	+	8	1453	c.732T>A	c.(730-732)gtT>gtA	p.V244V	LMO7_ENST00000377534.3_Silent_p.V529V|LMO7_ENST00000357063.3_Silent_p.V529V|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000465261.2_Silent_p.V244V|RP11-29G8.3_ENST00000563635.1_RNA			Q8WWI1	LMO7_HUMAN	LIM domain 7	529					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ATCCATATGTTCTCCGAGCTT	0.418																																						dbGAP											0													84.0	80.0	81.0					13																	76381850		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.732T>A	13.37:g.76381850T>A			E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S153T	ENST00000321797.8	37	c.457		13	.	.	.	.	.	.	.	.	.	.	T	8.806	0.934055	0.18206	.	.	ENSG00000136153	ENST00000447038	.	.	.	5.83	-3.59	0.04583	.	.	.	.	.	T	0.38852	0.1056	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	T	0.32322	-0.9911	4	.	.	.	-16.3044	2.1418	0.03777	0.1084:0.1908:0.3358:0.3651	.	.	.	.	T	153	.	.	S	+	1	0	LMO7	75279851	0.411000	0.25384	0.922000	0.36590	0.975000	0.68041	0.045000	0.14013	-0.819000	0.04323	-0.333000	0.08304	TCT	LMO7	-	NULL	ENSG00000136153		0.418	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	HGNC	protein_coding	OTTHUMT00000045301.3	28	0.00	0	T	NM_005358		76381850	76381850	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000447038	ensembl	human	novel	69_37n	missense	11	52.17	12	SNP	0.788	A
LRCH3	84859	genome.wustl.edu	37	3	197574884	197574885	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:197574884_197574885delTT	ENST00000425562.2	+	12	1522_1523	c.1522_1523delTT	c.(1522-1524)tttfs	p.F508fs	LRCH3_ENST00000536618.1_Frame_Shift_Del_p.F103fs|LRCH3_ENST00000441090.2_Frame_Shift_Del_p.F354fs|LRCH3_ENST00000414675.2_Frame_Shift_Del_p.F480fs|LRCH3_ENST00000438796.2_Frame_Shift_Del_p.F508fs|LRCH3_ENST00000334859.4_Frame_Shift_Del_p.F508fs			Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 3	508						cytoplasm (GO:0005737)|extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		TGTCCTGGACTTTGTCAAAGTG	0.47																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL137527	CCDS3330.1	3q29	2006-04-12			ENSG00000186001	ENSG00000186001			28637	protein-coding gene	gene with protein product						12477932	Standard	NM_032773		Approved	MGC4126	uc003fyj.1	Q96II8	OTTHUMG00000155378	ENST00000425562.2:c.1522_1523delTT	3.37:g.197574884_197574885delTT	ENSP00000393579:p.Phe508fs		B4E0T7|Q96FP9|Q9NT52	Frame_Shift_Del	DEL	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.F508fs	ENST00000425562.2	37	c.1522_1523		3																																																																																			LRCH3	-	NULL	ENSG00000186001		0.470	LRCH3-006	KNOWN	basic	protein_coding	LRCH3	HGNC	protein_coding	OTTHUMT00000339965.1	76	0.00	0	TT	NM_032773		197574884	197574885	+1	no_errors	ENST00000438796	ensembl	human	known	69_37n	frame_shift_del	58	46.79	51	DEL	1.000:1.000	-
LRP1B	53353	genome.wustl.edu	37	2	141660640	141660640	+	Silent	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:141660640G>A	ENST00000389484.3	-	23	4586	c.3615C>T	c.(3613-3615)ctC>ctT	p.L1205L		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1205	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGTCTTTGTTGAGTTGAAGTC	0.423										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													151.0	131.0	138.0					2																	141660640		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3615C>T	2.37:g.141660640G>A			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.L1205	ENST00000389484.3	37	c.3615	CCDS2182.1	2																																																																																			LRP1B	-	smart_EGF-like	ENSG00000168702		0.423	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	51	0.00	0	G	NM_018557		141660640	141660640	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	silent	45	29.69	19	SNP	0.609	A
MAGEB10	139422	genome.wustl.edu	37	X	27839450	27839450	+	Silent	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:27839450C>G	ENST00000356790.2	+	3	272	c.27C>G	c.(25-27)ctC>ctG	p.L9L		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	9										NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						AGAGTAAACTCCGTGCCAGGG	0.532																																						dbGAP											0													52.0	52.0	52.0					X																	27839450		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.27C>G	X.37:g.27839450C>G			Q494Y6|Q494Y7|Q9BZ78	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.L9	ENST00000356790.2	37	c.27	CCDS35221.1	X																																																																																			MAGEB10	-	pfam_Melanoma_ass_antigen_N	ENSG00000177689		0.532	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB10	HGNC	protein_coding	OTTHUMT00000106216.1	36	0.00	0	C	NM_182506		27839450	27839450	+1	no_errors	ENST00000356790	ensembl	human	known	69_37n	silent	26	43.48	20	SNP	0.001	G
MAP1B	4131	genome.wustl.edu	37	5	71495434	71495434	+	Silent	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:71495434C>T	ENST00000296755.7	+	5	6550	c.6252C>T	c.(6250-6252)ctC>ctT	p.L2084L		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2084					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATTTATGCCTCGTGTCCTCTT	0.493																																					Melanoma(17;367 822 11631 31730 47712)	dbGAP											0													134.0	141.0	139.0					5																	71495434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6252C>T	5.37:g.71495434C>T			A2BDK5	Silent	SNP	pfam_MAP1B_neuraxin	p.L2084	ENST00000296755.7	37	c.6252	CCDS4012.1	5																																																																																			MAP1B	-	NULL	ENSG00000131711		0.493	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	29	0.00	0	C	NM_005909		71495434	71495434	+1	no_errors	ENST00000296755	ensembl	human	known	69_37n	silent	8	46.67	7	SNP	0.005	T
MOSPD1	56180	genome.wustl.edu	37	X	134023050	134023050	+	3'UTR	SNP	A	A	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:134023050A>T	ENST00000370783.3	-	0	969				MOSPD1_ENST00000491609.1_5'UTR|MOSPD1_ENST00000370779.4_3'UTR	NM_019556.1	NP_062456.1	Q9UJG1	MSPD1_HUMAN	motile sperm domain containing 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	9	Acute lymphoblastic leukemia(192;0.000127)					attataatttaaaatatatat	0.269																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			Z83826	CCDS14645.1	Xq26.3	2008-02-05			ENSG00000101928	ENSG00000101928			25235	protein-coding gene	gene with protein product		300674				15533722	Standard	XM_005262446		Approved	dJ473B4	uc004eyb.3	Q9UJG1	OTTHUMG00000035315	ENST00000370783.3:c.*141T>A	X.37:g.134023050A>T			B2RE62|D3DTG5|Q5H9C5|Q5H9C7	RNA	SNP	-	NULL	ENST00000370783.3	37	NULL	CCDS14645.1	X																																																																																			MOSPD1	-	-	ENSG00000101928		0.269	MOSPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MOSPD1	HGNC	protein_coding	OTTHUMT00000085439.1	29	0.00	0	A	NM_019556		134023050	134023050	-1	no_errors	ENST00000480721	ensembl	human	known	69_37n	rna	28	22.22	8	SNP	1.000	T
MIR892A	100126342	genome.wustl.edu	37	X	145078724	145078724	+	RNA	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:145078724G>T	ENST00000401124.1	-	0	0				MIR892B_ENST00000401279.1_RNA|MIR890_ENST00000401256.1_RNA|MIR888_ENST00000401186.1_RNA	NR_030584.1				microRNA 892a																		GGTGAGCCTTGCTCTACCCAG	0.498																																						dbGAP											0													37.0	31.0	33.0					X																	145078724		1564	3571	5135	-	-	-			0					Xq27.3	2011-09-12		2008-12-18	ENSG00000215943	ENSG00000215943		"""ncRNAs / Micro RNAs"""	33639	non-coding RNA	RNA, micro				MIRN892A			Standard	NR_030584		Approved	hsa-mir-892a	uc022cfq.1				X.37:g.145078724G>T				RNA	SNP	-	NULL	ENST00000401124.1	37	NULL		X																																																																																			MIR892B	-	-	ENSG00000216098		0.498	MIR892A-201	KNOWN	basic	miRNA	MIR892B	HGNC	miRNA		31	0.00	0	G	NR_030584		145078724	145078724	-1	no_errors	ENST00000401279	ensembl	human	known	69_37n	rna	12	55.56	15	SNP	0.000	T
MRPS30	10884	genome.wustl.edu	37	5	44815128	44815128	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:44815128C>A	ENST00000507110.1	+	5	1182	c.1144C>A	c.(1144-1146)Caa>Aaa	p.Q382K		NM_016640.3	NP_057724.2	Q9NP92	RT30_HUMAN	mitochondrial ribosomal protein S30	382					apoptotic process (GO:0006915)|translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(11)|prostate(1)	20	Lung NSC(6;8.08e-07)					ACTGACTACACAAGCTGATCA	0.373																																						dbGAP											0													107.0	110.0	109.0					5																	44815128		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF146192	CCDS3951.1	5q11	2012-09-13		2001-11-09	ENSG00000112996	ENSG00000112996		"""Mitochondrial ribosomal proteins / small subunits"""	8769	protein-coding gene	gene with protein product		611991		PDCD9		10640817, 11279123	Standard	NM_016640		Approved	PAP	uc003joh.3	Q9NP92	OTTHUMG00000096967	ENST00000507110.1:c.1144C>A	5.37:g.44815128C>A	ENSP00000424328:p.Gln382Lys		Q96I91|Q96Q19|Q9H0P8|Q9NSF9|Q9NZ76	Missense_Mutation	SNP	pfam_Ribosomal_L37/S30	p.Q382K	ENST00000507110.1	37	c.1144	CCDS3951.1	5	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983441	0.53827	.	.	ENSG00000112996	ENST00000507110	T	0.16324	2.35	5.86	4.94	0.65067	.	0.157793	0.53938	D	0.000046	T	0.17280	0.0415	M	0.65975	2.015	0.36075	D	0.842415	P	0.44090	0.826	B	0.39217	0.294	T	0.08953	-1.0697	10	0.07175	T	0.84	-28.0852	13.8323	0.63389	0.0:0.6797:0.3203:0.0	.	382	Q9NP92	RT30_HUMAN	K	382	ENSP00000424328:Q382K	ENSP00000424328:Q382K	Q	+	1	0	MRPS30	44850885	0.760000	0.28428	0.992000	0.48379	0.948000	0.59901	1.034000	0.30204	2.771000	0.95319	0.650000	0.86243	CAA	MRPS30	-	pfam_Ribosomal_L37/S30	ENSG00000112996		0.373	MRPS30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS30	HGNC	protein_coding	OTTHUMT00000214033.2	34	0.00	0	C	NM_016640		44815128	44815128	+1	no_errors	ENST00000507110	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	0.997	A
MTOR	2475	genome.wustl.edu	37	1	11174441	11174441	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:11174441C>G	ENST00000361445.4	-	53	7310	c.7234G>C	c.(7234-7236)Gac>Cac	p.D2412H	MTOR_ENST00000376838.1_Missense_Mutation_p.D617H	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2412	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ATGACACTGTCCTTGTGCTCT	0.542																																						dbGAP											0													163.0	133.0	143.0					1																	11174441		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7234G>C	1.37:g.11174441C>G	ENSP00000354558:p.Asp2412His		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.D2412H	ENST00000361445.4	37	c.7234	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.225752	0.95173	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	T;T;T	0.78003	-1.14;-1.14;-1.14	5.89	5.89	0.94794	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.86740	0.6005	M	0.68593	2.085	0.80722	D	1	D	0.60575	0.988	D	0.63381	0.914	D	0.87158	0.2213	10	0.87932	D	0	-8.96	19.2499	0.93919	0.0:1.0:0.0:0.0	.	2412	P42345	MTOR_HUMAN	H	2412;617;68	ENSP00000354558:D2412H;ENSP00000366034:D617H;ENSP00000398745:D68H	ENSP00000354558:D2412H	D	-	1	0	MTOR	11097028	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.456000	0.80751	2.793000	0.96121	0.655000	0.94253	GAC	MTOR	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000198793		0.542	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	39	0.00	0	C	NM_004958		11174441	11174441	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	1.000	G
MUC20P1	651714	genome.wustl.edu	37	3	195345599	195345599	+	IGR	SNP	G	G	A	rs565796471	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:195345599G>A								APOD (34523 upstream) : RP11-141C7.4 (21261 downstream)																							AAACTCAAACGCTGAGCGCTG	0.612													.|||	222	0.0443291	0.09	0.0288	5008	,	,		29536	0.006		0.0457	False		,,,				2504	0.0317					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															3.37:g.195345599G>A				Silent	SNP	NULL	p.T24		37	c.72		3																																																																																			MUC20	-	NULL	ENSG00000176945	0	0.612					MUC20	HGNC			9	0.00	0	G			195345599	195345599	+1	no_errors	ENST00000381954	ensembl	human	known	69_37n	silent	10	37.50	6	SNP	0.014	A
MUC5B	727897	genome.wustl.edu	37	11	1262924	1262924	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:1262924G>T	ENST00000529681.1	+	31	4872	c.4814G>T	c.(4813-4815)gGa>gTa	p.G1605V	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.G1608V	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1605	7 X Cys-rich subdomain repeats.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACTGCAGGGGACGTGCCACA	0.647																																						dbGAP											0													20.0	27.0	25.0					11																	1262924		2114	4215	6329	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.4814G>T	11.37:g.1262924G>T	ENSP00000436812:p.Gly1605Val		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G1608V	ENST00000529681.1	37	c.4823	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	g	7.720	0.696945	0.15106	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21734	1.99;2.13	3.25	-0.618	0.11576	.	.	.	.	.	T	0.14141	0.0342	N	0.19112	0.55	0.09310	N	1	P;P	0.41232	0.743;0.588	B;B	0.41412	0.356;0.206	T	0.21552	-1.0242	9	0.87932	D	0	.	8.3642	0.32376	0.1104:0.6159:0.2737:0.0	.	2298;1608	A7Y9J9;E9PBJ0	.;.	V	1605;1608;1606;1675	ENSP00000436812:G1605V;ENSP00000415793:G1608V	ENSP00000343037:G1606V	G	+	2	0	MUC5B	1219500	0.138000	0.22547	0.000000	0.03702	0.150000	0.21749	1.475000	0.35409	-0.003000	0.14444	0.306000	0.20318	GGA	MUC5B	-	NULL	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	27	0.00	0	G	XM_001126093		1262924	1262924	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.000	T
MYO18B	84700	genome.wustl.edu	37	22	26224779	26224779	+	Silent	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr22:26224779C>A	ENST00000407587.2	+	15	2992	c.2823C>A	c.(2821-2823)atC>atA	p.I941I	MYO18B_ENST00000335473.7_Silent_p.I941I|MYO18B_ENST00000536101.1_Silent_p.I941I			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	941	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TGGCCTCCATCATGGTGGTGG	0.587																																						dbGAP											0													109.0	112.0	111.0					22																	26224779		2000	4174	6174	-	-	-	SO:0001819	synonymous_variant	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.2823C>A	22.37:g.26224779C>A			B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	pfam_Myosin_head_motor_dom,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd_dom,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I941	ENST00000407587.2	37	c.2823		22																																																																																			MYO18B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133454		0.587	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	112	0.00	0	C	NM_032608		26224779	26224779	+1	no_errors	ENST00000335473	ensembl	human	known	69_37n	silent	50	20.63	13	SNP	1.000	A
MYO1A	4640	genome.wustl.edu	37	12	57424899	57424899	+	Frame_Shift_Del	DEL	C	C	-			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:57424899delC	ENST00000442789.2	-	24	2696	c.2409delG	c.(2407-2409)aagfs	p.K803fs	MYO1A_ENST00000544473.1_Frame_Shift_Del_p.K641fs|TAC3_ENST00000415231.1_5'Flank|MYO1A_ENST00000300119.3_Frame_Shift_Del_p.K803fs	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	803					microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						CTGGCCATGTCTTGTCTAAGA	0.542																																						dbGAP											0													104.0	97.0	99.0					12																	57424899		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.2409delG	12.37:g.57424899delC	ENSP00000393392:p.Lys803fs		Q9UQD7	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T804fs	ENST00000442789.2	37	c.2409	CCDS8929.1	12																																																																																			MYO1A	-	NULL	ENSG00000166866		0.542	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1A	HGNC	protein_coding	OTTHUMT00000313833.2	60	0.00	0	C	NM_005379		57424899	57424899	-1	no_errors	ENST00000300119	ensembl	human	known	69_37n	frame_shift_del	27	32.50	13	DEL	0.058	-
NCF2	4688	genome.wustl.edu	37	1	183534865	183534865	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:183534865G>T	ENST00000367535.3	-	10	1225	c.974C>A	c.(973-975)gCc>gAc	p.A325D	NCF2_ENST00000413720.1_Missense_Mutation_p.A280D|NCF2_ENST00000469280.1_5'Flank|NCF2_ENST00000418089.1_Missense_Mutation_p.A244D|NCF2_ENST00000367536.1_Missense_Mutation_p.A325D	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	325					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	TCTTCCAGGGGCTTTGGAACT	0.597																																						dbGAP											0													82.0	83.0	83.0					1																	183534865		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.974C>A	1.37:g.183534865G>T	ENSP00000356505:p.Ala325Asp		B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_TPR-1,pfam_OPR_PB1,superfamily_SH3_domain,smart_TPR_repeat,smart_SH3_domain,smart_OPR_PB1,pfscan_SH3_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_p67phox,prints_SH3_domain	p.A325D	ENST00000367535.3	37	c.974	CCDS1356.1	1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772327	0.49680	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535;ENST00000419402	T;T;T;T;T	0.70869	-0.52;-0.16;-0.04;-0.52;2.68	5.43	5.43	0.79202	Src homology-3 domain (1);	0.209083	0.49916	D	0.000131	T	0.79233	0.4411	M	0.72118	2.19	0.36839	D	0.887295	P;D;P	0.54047	0.89;0.964;0.865	B;P;P	0.55577	0.425;0.603;0.779	T	0.81017	-0.1123	10	0.33141	T	0.24	-34.7642	15.9761	0.80066	0.0:0.0:1.0:0.0	.	244;280;325	E9PHJ2;E9PHX3;P19878	.;.;NCF2_HUMAN	D	325;397;280;244;325;64	ENSP00000356506:A325D;ENSP00000399294:A280D;ENSP00000407217:A244D;ENSP00000356505:A325D;ENSP00000406198:A64D	ENSP00000356505:A325D	A	-	2	0	NCF2	181801488	1.000000	0.71417	0.954000	0.39281	0.349000	0.29174	4.095000	0.57728	2.561000	0.86390	0.561000	0.74099	GCC	NCF2	-	superfamily_SH3_domain	ENSG00000116701		0.597	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	HGNC	protein_coding	OTTHUMT00000085483.1	32	0.00	0	G	NM_000433		183534865	183534865	-1	no_errors	ENST00000367535	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	0.998	T
NEK11	79858	genome.wustl.edu	37	3	130851600	130851600	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:130851600A>C	ENST00000510769.1	+	5	720	c.467A>C	c.(466-468)cAt>cCt	p.H156P	NEK11_ENST00000356918.4_Missense_Mutation_p.H156P|NEK11_ENST00000429253.2_Missense_Mutation_p.H156P|NEK11_ENST00000508196.1_Missense_Mutation_p.H156P|NEK11_ENST00000383366.4_Missense_Mutation_p.H156P|NEK11_ENST00000412440.2_Missense_Mutation_p.H8P|NEK11_ENST00000510688.1_Missense_Mutation_p.H156P|NEK11_ENST00000511262.1_Missense_Mutation_p.H156P|NEK11_ENST00000507910.1_Missense_Mutation_p.H156P|NEK11_ENST00000426022.2_3'UTR					NIMA-related kinase 11											breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|stomach(1)|urinary_tract(2)	33						AGGATACTTCATCGAGACTTA	0.274																																						dbGAP											0													40.0	40.0	40.0					3																	130851600		2187	4259	6446	-	-	-	SO:0001583	missense	0			AK027148	CCDS3069.1, CCDS46915.1, CCDS54639.1	3q22.1	2012-11-15	2012-11-15		ENSG00000114670	ENSG00000114670			18593	protein-coding gene	gene with protein product		609779	"""NIMA (never in mitosis gene a)- related kinase 11"""				Standard	NM_024800		Approved	FLJ23495	uc003eny.3	Q8NG66	OTTHUMG00000159654	ENST00000510769.1:c.467A>C	3.37:g.130851600A>C	ENSP00000421549:p.His156Pro			Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H156P	ENST00000510769.1	37	c.467		3	.	.	.	.	.	.	.	.	.	.	A	19.98	3.927659	0.73327	.	.	ENSG00000114670	ENST00000510769;ENST00000429253;ENST00000356918;ENST00000510688;ENST00000511262;ENST00000383366;ENST00000412440;ENST00000507910;ENST00000508196	T;T;T;T;T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33;-1.33;0.56;-1.33;-1.33	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000091	D	0.94248	0.8153	H	0.99582	4.64	0.58432	D	0.999995	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.997;1.0;0.998;1.0;1.0;1.0	D	0.96312	0.9229	10	0.87932	D	0	.	13.7638	0.62981	1.0:0.0:0.0:0.0	.	156;156;8;156;156;156;156	Q8NG66-3;E9PHI8;B4DDN2;B4DM56;Q8NG66-4;Q8NG66;Q8NG66-2	.;.;.;.;.;NEK11_HUMAN;.	P	156;156;156;156;156;156;8;156;156	ENSP00000421549:H156P;ENSP00000397180:H156P;ENSP00000349389:H156P;ENSP00000423458:H156P;ENSP00000425114:H156P;ENSP00000372857:H156P;ENSP00000411888:H8P;ENSP00000426662:H156P;ENSP00000421851:H156P	ENSP00000349389:H156P	H	+	2	0	NEK11	132334290	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.826000	0.75298	2.202000	0.70862	0.528000	0.53228	CAT	NEK11	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000114670		0.274	NEK11-005	NOVEL	basic|exp_conf	protein_coding	NEK11	HGNC	protein_coding	OTTHUMT00000356757.1	48	0.00	0	A	NM_024800		130851600	130851600	+1	no_errors	ENST00000383366	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	1.000	C
NFX1	4799	genome.wustl.edu	37	9	33344082	33344082	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:33344082C>T	ENST00000379540.3	+	14	2302	c.2240C>T	c.(2239-2241)aCc>aTc	p.T747I	NFX1_ENST00000379521.4_Missense_Mutation_p.T747I|NFX1_ENST00000318524.6_Missense_Mutation_p.T747I	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	747					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GATGAATTAACCTGCCATTGT	0.458																																						dbGAP											0													169.0	139.0	149.0					9																	33344082		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.2240C>T	9.37:g.33344082C>T	ENSP00000368856:p.Thr747Ile		A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	pfam_Znf_NFX1,pfam_R3H_ss-bd,smart_Znf_RING,smart_Znf_NFX1,smart_R3H_ss-bd,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_R3H_ss-bd	p.T747I	ENST00000379540.3	37	c.2240	CCDS6538.1	9	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393641	0.42410	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000536210;ENST00000318524	T;T;T	0.27890	1.64;1.64;1.64	5.49	5.49	0.81192	.	0.152680	0.64402	D	0.000015	T	0.41604	0.1166	M	0.66939	2.045	0.48040	D	0.999571	P;P;B;P;B	0.42757	0.677;0.549;0.003;0.789;0.059	P;B;B;B;B	0.45232	0.474;0.282;0.019;0.394;0.09	T	0.34030	-0.9845	10	0.56958	D	0.05	-4.6735	16.8552	0.86004	0.0:1.0:0.0:0.0	.	747;631;747;747;747	F5GXD0;A0JLR2;Q12986;Q12986-2;Q12986-3	.;.;NFX1_HUMAN;.;.	I	747	ENSP00000368856:T747I;ENSP00000368836:T747I;ENSP00000317695:T747I	ENSP00000317695:T747I	T	+	2	0	NFX1	33334082	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.886000	0.63149	2.581000	0.87130	0.561000	0.74099	ACC	NFX1	-	NULL	ENSG00000086102		0.458	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFX1	HGNC	protein_coding	OTTHUMT00000052069.1	65	0.00	0	C			33344082	33344082	+1	no_errors	ENST00000379540	ensembl	human	known	69_37n	missense	41	38.81	26	SNP	1.000	T
NIPBL	25836	genome.wustl.edu	37	5	36996575	36996575	+	Intron	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:36996575G>T	ENST00000282516.8	+	11	3803				NIPBL_ENST00000448238.2_Intron|NIPBL_ENST00000504430.1_3'UTR	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)						brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GTTTTCCAGAGCTGGCTTCTT	0.483																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.3304+669G>T	5.37:g.36996575G>T			Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	RNA	SNP	-	NULL	ENST00000282516.8	37	NULL	CCDS3920.1	5																																																																																			NIPBL	-	-	ENSG00000164190		0.483	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	83	0.00	0	G	NM_015384		36996575	36996575	+1	no_errors	ENST00000504430	ensembl	human	known	69_37n	rna	113	20.83	30	SNP	1.000	T
NLRC5	84166	genome.wustl.edu	37	16	57068128	57068128	+	Silent	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:57068128C>T	ENST00000262510.6	+	13	2817	c.2592C>T	c.(2590-2592)gcC>gcT	p.A864A	NLRC5_ENST00000539144.1_Silent_p.A864A|NLRC5_ENST00000436936.1_Silent_p.A864A|NLRC5_ENST00000308149.7_Silent_p.A864A	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	864					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CCCTCATAGCCCTGCTCCAGG	0.632																																						dbGAP											0													56.0	46.0	50.0					16																	57068128		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.2592C>T	16.37:g.57068128C>T			B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.P592S	ENST00000262510.6	37	c.1774	CCDS10773.1	16	.	.	.	.	.	.	.	.	.	.	C	6.606	0.480112	0.12581	.	.	ENSG00000140853	ENST00000538805	.	.	.	4.82	2.63	0.31362	.	.	.	.	.	T	0.39200	0.1069	.	.	.	0.19300	N	0.999979	.	.	.	.	.	.	T	0.24012	-1.0172	4	.	.	.	.	11.1697	0.48565	0.0:0.4729:0.5271:0.0	.	.	.	.	S	617	.	.	P	+	1	0	NLRC5	55625629	0.234000	0.23783	0.372000	0.25991	0.051000	0.14879	0.332000	0.19751	1.145000	0.42336	0.462000	0.41574	CCT	NLRC5	-	NULL	ENSG00000140853		0.632	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	105	0.00	0	C	NM_032206		57068128	57068128	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000545081	ensembl	human	known	69_37n	missense	67	34.31	35	SNP	0.207	T
NOL10	79954	genome.wustl.edu	37	2	10743249	10743250	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:10743249_10743250CC>AA	ENST00000381685.5	-	15	1292_1293	c.1187_1188GG>TT	c.(1186-1188)cGG>cTT	p.R396L	NOL10_ENST00000345985.3_Missense_Mutation_p.R346L|AC092687.5_ENST00000414538.1_RNA|NOL10_ENST00000542668.1_Missense_Mutation_p.R346L|NOL10_ENST00000538384.1_Missense_Mutation_p.R370L	NM_024894.3	NP_079170.2	Q9BSC4	NOL10_HUMAN	nucleolar protein 10	396						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)					Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		GCATATATGCCCGGAGGAAAGG	0.416																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK024137	CCDS1673.2, CCDS58697.1, CCDS58698.1	2p25.1	2008-05-23			ENSG00000115761	ENSG00000115761			25862	protein-coding gene	gene with protein product			"""polyglutamine binding protein 5"""	PQBP5		12477932	Standard	NM_024894		Approved	FLJ14075	uc002raq.3	Q9BSC4	OTTHUMG00000119023	ENST00000381685.5:c.1187_1188delinsAA	2.37:g.10743249_10743250delinsAA	ENSP00000371101:p.Arg396Leu		A8K3R5|B4DLV0|Q53RC9|Q96TA5|Q9H7Y7|Q9H855	Silent|Missense_Mutation	SNP	pfam_NUC153,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.R396|p.R396L	ENST00000381685.5	37	c.1188|c.1187	CCDS1673.2	2																																																																																			NOL10	-	NULL	ENSG00000115761		0.416	NOL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL10	HGNC	protein_coding	OTTHUMT00000239227.1	41	0.00	0	C	NM_024894		10743249|10743250	10743249|10743250	-1	no_errors	ENST00000381685	ensembl	human	known	69_37n	silent|missense	17	56.41	22	SNP	1.000	A
NPR2	4882	genome.wustl.edu	37	9	35806119	35806119	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:35806119G>A	ENST00000342694.2	+	15	2516	c.2261G>A	c.(2260-2262)cGg>cAg	p.R754Q		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	754	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	AGCATTGACCGGACCCAACTG	0.517																																						dbGAP											0													71.0	72.0	72.0					9																	35806119		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2261G>A	9.37:g.35806119G>A	ENSP00000341083:p.Arg754Gln		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.R754Q	ENST00000342694.2	37	c.2261	CCDS6590.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.502|8.502	0.864562|0.864562	0.17250|0.17250	.|.	.|.	ENSG00000159899|ENSG00000159899	ENST00000421267|ENST00000342694;ENST00000447210	.|D;T	.|0.82433	.|-1.61;0.03	5.82|5.82	5.82|5.82	0.92795|0.92795	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.187716	.|0.26041	.|N	.|0.026690	T|T	0.72581|0.72581	0.3478|0.3478	N|N	0.25890|0.25890	0.77|0.77	0.09310|0.09310	N|N	0.999994|0.999994	.|P;B	.|0.37398	.|0.593;0.067	.|B;B	.|0.37387	.|0.248;0.011	T|T	0.62006|0.62006	-0.6945|-0.6945	5|10	.|0.13470	.|T	.|0.59	.|.	13.6315|13.6315	0.62198|0.62198	0.0:0.0:0.8451:0.1549|0.0:0.0:0.8451:0.1549	.|.	.|754;754	.|P20594-2;P20594	.|.;ANPRB_HUMAN	R|Q	101|754;13	.|ENSP00000341083:R754Q;ENSP00000393029:R13Q	.|ENSP00000341083:R754Q	G|R	+|+	1|2	0|0	NPR2|NPR2	35796119|35796119	0.028000|0.028000	0.19301|0.19301	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	0.858000|0.858000	0.27845|0.27845	2.756000|2.756000	0.94617|0.94617	0.563000|0.563000	0.77884|0.77884	GGA|CGG	NPR2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000159899		0.517	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	HGNC	protein_coding	OTTHUMT00000052345.1	51	0.00	0	G			35806119	35806119	+1	no_errors	ENST00000342694	ensembl	human	known	69_37n	missense	30	33.33	15	SNP	0.258	A
NT5C2	22978	genome.wustl.edu	37	10	104860650	104860650	+	Intron	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr10:104860650G>C	ENST00000404739.3	-	6	563				NT5C2_ENST00000343289.5_Intron|NT5C2_ENST00000423468.2_Intron|NT5C2_ENST00000369857.4_5'UTR			P49902	5NTC_HUMAN	5'-nucleotidase, cytosolic II						cell death (GO:0008219)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|nucleobase-containing small molecule metabolic process (GO:0055086)|phosphorylation (GO:0016310)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleoside phosphotransferase activity (GO:0050146)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|urinary_tract(1)	16		all_hematologic(284;0.176)|Colorectal(252;0.178)		Epithelial(162;1.33e-08)|all cancers(201;1.04e-07)|BRCA - Breast invasive adenocarcinoma(275;0.159)	Adenosine triphosphate(DB00171)|Ribavirin(DB00811)	tgctggtgctgtcccatctct	0.517																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D38524	CCDS7544.1	10q24.32	2014-03-03	2002-04-18	2002-04-19	ENSG00000076685	ENSG00000076685			8022	protein-coding gene	gene with protein product	"""purine 5' nucleotidase"""	600417	"""5'-nucleotidase (purine), cytosolic type B"""	NT5B		7999131, 24482476	Standard	NM_012229		Approved	PNT5, GMP, cN-II, SPG65	uc001kwq.3	P49902	OTTHUMG00000018981	ENST00000404739.3:c.539+151C>G	10.37:g.104860650G>C			B7Z382|D3DR91|Q5JUV5	Missense_Mutation	SNP	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom	p.D131E	ENST00000404739.3	37	c.393	CCDS7544.1	10																																																																																			NT5C2	-	NULL	ENSG00000076685		0.517	NT5C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5C2	HGNC	protein_coding	OTTHUMT00000050121.1	10	0.00	0	G	NM_012229		104860650	104860650	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000552185	ensembl	human	known	69_37n	missense	4	60.00	6	SNP	1.000	C
NUCB2	4925	genome.wustl.edu	37	11	17332417	17332417	+	Missense_Mutation	SNP	T	T	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:17332417T>G	ENST00000529010.1	+	7	748	c.529T>G	c.(529-531)Ttt>Gtt	p.F177V	NUCB2_ENST00000323688.6_Missense_Mutation_p.F177V|NUCB2_ENST00000458064.2_Missense_Mutation_p.F177V	NM_005013.2	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2	177						cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						TCATGAAGAATTTAAAAAATA	0.274																																						dbGAP											0													68.0	67.0	67.0					11																	17332417		1802	4038	5840	-	-	-	SO:0001583	missense	0			AF052642	CCDS41623.1	11p15.1	2013-01-10						"""EF-hand domain containing"""	8044	protein-coding gene	gene with protein product		608020				7811391	Standard	NM_005013		Approved	NEFA	uc001mmw.3	P80303		ENST00000529010.1:c.529T>G	11.37:g.17332417T>G	ENSP00000436455:p.Phe177Val		A8K642|D3DQX5|Q8NFT5	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.F177V	ENST00000529010.1	37	c.529	CCDS41623.1	11	.	.	.	.	.	.	.	.	.	.	T	29.7	5.032557	0.93575	.	.	ENSG00000070081	ENST00000530527;ENST00000323688;ENST00000529010;ENST00000529313;ENST00000458064	T;T;T	0.49720	0.77;0.78;0.86	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.72748	0.3499	M	0.84585	2.705	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.997	T	0.77795	-0.2454	10	0.87932	D	0	-12.459	16.1905	0.81986	0.0:0.0:0.0:1.0	.	177;177;177	E7EV42;P80303;D3DQX5	.;NUCB2_HUMAN;.	V	177	ENSP00000320168:F177V;ENSP00000436455:F177V;ENSP00000408702:F177V	ENSP00000320168:F177V	F	+	1	0	NUCB2	17288993	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.027000	0.88791	2.212000	0.71576	0.533000	0.62120	TTT	NUCB2	-	NULL	ENSG00000070081		0.274	NUCB2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUCB2	HGNC	protein_coding	OTTHUMT00000387614.2	15	0.00	0	T	NM_005013		17332417	17332417	+1	no_errors	ENST00000323688	ensembl	human	known	69_37n	missense	10	44.44	8	SNP	1.000	G
NUP107	57122	genome.wustl.edu	37	12	69107580	69107580	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:69107580A>C	ENST00000229179.4	+	11	1293	c.961A>C	c.(961-963)Act>Cct	p.T321P	NUP107_ENST00000378905.2_Missense_Mutation_p.T170P|NUP107_ENST00000539906.1_Missense_Mutation_p.T292P	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	321					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			TCCGCTTGTCACTGAATTGGT	0.348																																						dbGAP											0													81.0	82.0	82.0					12																	69107580		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.961A>C	12.37:g.69107580A>C	ENSP00000229179:p.Thr321Pro		B4DZ67|Q6PJE1	Missense_Mutation	SNP	pfam_Nup84_Nup100	p.T321P	ENST00000229179.4	37	c.961	CCDS8985.1	12	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237615	0.58886	.	.	ENSG00000111581	ENST00000229179;ENST00000378905;ENST00000539906	.	.	.	4.9	4.9	0.64082	.	0.047430	0.85682	D	0.000000	T	0.71298	0.3323	M	0.72894	2.215	0.58432	D	0.999992	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.72982	0.979;0.968;0.966	T	0.72456	-0.4288	8	.	.	.	-16.661	9.8443	0.41017	0.847:0.0:0.0:0.153	.	292;170;321	B4DZ67;Q6PJE1;P57740	.;.;NU107_HUMAN	P	321;170;292	.	.	T	+	1	0	NUP107	67393847	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	4.155000	0.58131	1.970000	0.57323	0.374000	0.22700	ACT	NUP107	-	pfam_Nup84_Nup100	ENSG00000111581		0.348	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1	20	0.00	0	A	NM_020401		69107580	69107580	+1	no_errors	ENST00000229179	ensembl	human	known	69_37n	missense	10	47.37	9	SNP	1.000	C
OPN5	221391	genome.wustl.edu	37	6	47791825	47791825	+	3'UTR	SNP	G	G	A	rs377684481	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:47791825G>A	ENST00000371211.2	+	0	1191				RNU1-105P_ENST00000363470.1_RNA|OPN5_ENST00000244799.4_3'UTR|OPN5_ENST00000489301.2_Intron	NM_181744.3	NP_859528.1	Q6U736	OPN5_HUMAN	opsin 5						phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|large_intestine(3)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	29						CTGACTTCTCGCCTCCACTCC	0.393													G|||	2	0.000399361	0.0015	0.0	5008	,	,		21230	0.0		0.0	False		,,,				2504	0.0				Melanoma(28;740 973 10870 42660 45347)	dbGAP											0													75.0	64.0	67.0					6																	47791825		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AY288419	CCDS4923.1	6p12.3	2012-08-08	2004-01-23		ENSG00000124818	ENSG00000124818		"""GPCR / Class A : Opsin receptors"""	19992	protein-coding gene	gene with protein product	"""neuropsin"""	609042	"""transmembrane protein 13"""	TMEM13		14623103, 14623098	Standard	NR_033806		Approved	neuropsin, dJ402H5.1	uc003ozc.3	Q6U736	OTTHUMG00000014803	ENST00000371211.2:c.*98G>A	6.37:g.47791825G>A			A0AV33|Q5T5B9|Q5T886|Q7Z603|Q86SL5	RNA	SNP	-	NULL	ENST00000371211.2	37	NULL	CCDS4923.1	6																																																																																			OPN5	-	-	ENSG00000124818		0.393	OPN5-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPN5	HGNC	protein_coding	OTTHUMT00000359451.1	25	0.00	0	G	NM_181744		47791825	47791825	+1	no_errors	ENST00000244799	ensembl	human	known	69_37n	rna	63	21.25	17	SNP	0.000	A
NUP43	348995	genome.wustl.edu	37	6	150059887	150059887	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:150059887G>C	ENST00000340413.2	-	5	606	c.530C>G	c.(529-531)gCt>gGt	p.A177G	NUP43_ENST00000367403.3_Intron|NUP43_ENST00000367404.4_Intron|NUP43_ENST00000460354.2_Missense_Mutation_p.A177G	NM_198887.1	NP_942590.1	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	177					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				breast(1)|large_intestine(2)|lung(8)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)		AAAGGTTACAGCATGGAGTGT	0.343																																						dbGAP											0													109.0	107.0	108.0					6																	150059887		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF514997	CCDS5218.1	6q25.1	2013-01-10			ENSG00000120253	ENSG00000120253		"""WD repeat domain containing"""	21182	protein-coding gene	gene with protein product		608141				12196509	Standard	XM_005266961		Approved	bA350J20.1, FLJ13287	uc003qmz.3	Q8NFH3	OTTHUMG00000015795	ENST00000340413.2:c.530C>G	6.37:g.150059887G>C	ENSP00000342262:p.Ala177Gly		B4E2F0|Q9H8S0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A177G	ENST00000340413.2	37	c.530	CCDS5218.1	6	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165024	0.57476	.	.	ENSG00000120253	ENST00000340413;ENST00000460354	T;T	0.63913	-0.07;-0.07	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.050228	0.85682	D	0.000000	T	0.42200	0.1192	L	0.49350	1.555	0.80722	D	1	B	0.15719	0.014	B	0.15052	0.012	T	0.31668	-0.9935	10	0.23302	T	0.38	-22.6646	15.0434	0.71807	0.0:0.1418:0.8582:0.0	.	177	Q8NFH3	NUP43_HUMAN	G	177	ENSP00000342262:A177G;ENSP00000432401:A177G	ENSP00000342262:A177G	A	-	2	0	NUP43	150101580	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.204000	0.77872	2.626000	0.88956	0.454000	0.30748	GCT	NUP43	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000120253		0.343	NUP43-004	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP43	HGNC	protein_coding	OTTHUMT00000396947.1	37	0.00	0	G	NM_198887		150059887	150059887	-1	no_errors	ENST00000340413	ensembl	human	known	69_37n	missense	25	45.65	21	SNP	1.000	C
OR52L1	338751	genome.wustl.edu	37	11	6007653	6007653	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:6007653C>T	ENST00000332249.4	-	1	562	c.508G>A	c.(508-510)Gga>Aga	p.G170R		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGTAGTAATCCCCTCACCAGC	0.498																																					Melanoma(121;653 1666 10547 22796 51255)	dbGAP											0													95.0	90.0	92.0					11																	6007653		2032	4184	6216	-	-	-	SO:0001583	missense	0			AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.508G>A	11.37:g.6007653C>T	ENSP00000330338:p.Gly170Arg		B2RPA6|Q6IFK9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G170R	ENST00000332249.4	37	c.508	CCDS44529.1	11	.	.	.	.	.	.	.	.	.	.	C	9.770	1.172533	0.21704	.	.	ENSG00000183313	ENST00000332249	T	0.40476	1.03	3.85	1.89	0.25635	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43260	D	0.000592	T	0.67135	0.2861	M	0.92317	3.295	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.57831	-0.7743	10	0.72032	D	0.01	.	8.3105	0.32068	0.0:0.7935:0.0:0.2065	.	170	Q8NGH7	O52L1_HUMAN	R	170	ENSP00000330338:G170R	ENSP00000330338:G170R	G	-	1	0	OR52L1	5964229	0.000000	0.05858	0.353000	0.25747	0.109000	0.19521	-0.367000	0.07553	0.720000	0.32209	0.313000	0.20887	GGA	OR52L1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183313		0.498	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52L1	HGNC	protein_coding	OTTHUMT00000383754.1	48	0.00	0	C	NM_001005173		6007653	6007653	-1	no_errors	ENST00000332249	ensembl	human	known	69_37n	missense	9	85.00	51	SNP	0.025	T
OR5H6	79295	genome.wustl.edu	37	3	97983248	97983248	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:97983248A>T	ENST00000383696.2	+	1	161	c.120A>T	c.(118-120)aaA>aaT	p.K40N	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CTGACTGTAAAATACCGCTCT	0.413																																						dbGAP											0													192.0	198.0	196.0					3																	97983248		2203	4299	6502	-	-	-	SO:0001583	missense	0			BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.120A>T	3.37:g.97983248A>T	ENSP00000373196:p.Lys40Asn		Q6IF88	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K40N	ENST00000383696.2	37	c.120	CCDS33800.1	3	.	.	.	.	.	.	.	.	.	.	-	8.386	0.838628	0.16891	.	.	ENSG00000230301	ENST00000383696	T	0.00446	7.39	1.97	-2.98	0.05513	.	0.945942	0.08648	N	0.914425	T	0.00241	0.0007	N	0.17674	0.51	0.09310	N	1	B	0.17268	0.021	B	0.17722	0.019	T	0.34527	-0.9825	10	0.72032	D	0.01	.	3.5624	0.07887	0.4954:0.2048:0.2998:0.0	.	40	Q8NGV6	OR5H6_HUMAN	N	40	ENSP00000373196:K40N	ENSP00000373196:K40N	K	+	3	2	OR5H6	99465938	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-2.039000	0.01418	-0.474000	0.06862	0.163000	0.16589	AAA	OR5H6	-	NULL	ENSG00000230301		0.413	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H6	HGNC	protein_coding	OTTHUMT00000359111.2	71	0.00	0	A			97983248	97983248	+1	no_errors	ENST00000383696	ensembl	human	known	69_37n	missense	78	30.97	35	SNP	0.000	T
OR8K1	390157	genome.wustl.edu	37	11	56114431	56114431	+	Missense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:56114431C>A	ENST00000279783.2	+	1	1011	c.917C>A	c.(916-918)gCt>gAt	p.A306D		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					GTAAAAGATGCTCTAAAGAGA	0.343										HNSCC(65;0.19)																												dbGAP											0													64.0	67.0	66.0					11																	56114431		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.917C>A	11.37:g.56114431C>A	ENSP00000279783:p.Ala306Asp		B9EJB1|Q6IFC3|Q96RC1	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A306D	ENST00000279783.2	37	c.917	CCDS31528.1	11	.	.	.	.	.	.	.	.	.	.	C	9.882	1.201745	0.22121	.	.	ENSG00000150261	ENST00000279783	T	0.46063	0.88	5.0	5.0	0.66597	.	0.277119	0.25469	N	0.030444	T	0.69305	0.3096	H	0.99573	4.635	0.09310	N	1	P	0.42296	0.775	B	0.41894	0.369	T	0.75241	-0.3387	10	0.87932	D	0	-5.4212	18.2972	0.90150	0.0:1.0:0.0:0.0	.	306	Q8NGG5	OR8K1_HUMAN	D	306	ENSP00000279783:A306D	ENSP00000279783:A306D	A	+	2	0	OR8K1	55871007	0.022000	0.18835	0.013000	0.15412	0.210000	0.24377	2.164000	0.42387	2.297000	0.77311	0.549000	0.68633	GCT	OR8K1	-	NULL	ENSG00000150261		0.343	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K1	HGNC	protein_coding	OTTHUMT00000391605.1	24	0.00	0	C	NM_001002907		56114431	56114431	+1	no_errors	ENST00000279783	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.006	A
P2RY10	27334	genome.wustl.edu	37	X	78216940	78216940	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:78216940T>C	ENST00000171757.2	+	4	1203	c.923T>C	c.(922-924)aTg>aCg	p.M308T	P2RY10_ENST00000544091.1_Missense_Mutation_p.M308T	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	308						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						TATTACTTTATGGCTTCAGAG	0.483																																						dbGAP											0													157.0	144.0	148.0					X																	78216940		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.923T>C	X.37:g.78216940T>C	ENSP00000171757:p.Met308Thr		D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.M308T	ENST00000171757.2	37	c.923	CCDS14442.1	X	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.448915	0.01080	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.38401	1.14;1.14	4.99	1.3	0.21679	.	0.204155	0.43110	D	0.000603	T	0.14917	0.0360	N	0.08118	0	0.30498	N	0.770657	B	0.02656	0.0	B	0.04013	0.001	T	0.22695	-1.0209	10	0.14656	T	0.56	.	7.5159	0.27600	0.0:0.4491:0.0:0.5509	.	308	O00398	P2Y10_HUMAN	T	308	ENSP00000443138:M308T;ENSP00000171757:M308T	ENSP00000171757:M308T	M	+	2	0	P2RY10	78103596	0.996000	0.38824	1.000000	0.80357	0.992000	0.81027	1.095000	0.30964	0.247000	0.21414	0.483000	0.47432	ATG	P2RY10	-	prints_7TM_GPCR_Rhodpsn	ENSG00000078589		0.483	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY10	HGNC	protein_coding	OTTHUMT00000057323.1	45	0.00	0	T			78216940	78216940	+1	no_errors	ENST00000171757	ensembl	human	known	69_37n	missense	33	36.54	19	SNP	0.988	C
PARK2	5071	genome.wustl.edu	37	6	162622175	162622175	+	Silent	SNP	G	G	C	rs147121590	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:162622175G>C	ENST00000366898.1	-	4	624	c.522C>G	c.(520-522)ctC>ctG	p.L174L	PARK2_ENST00000366894.1_5'UTR|PARK2_ENST00000366892.1_Silent_p.L174L|PARK2_ENST00000366896.1_Intron|PARK2_ENST00000338468.3_Intron|PARK2_ENST00000366897.1_Silent_p.L174L	NM_004562.2	NP_004553.2	O60260	PRKN2_HUMAN	parkin RBR E3 ubiquitin protein ligase	174					adult locomotory behavior (GO:0008344)|aggresome assembly (GO:0070842)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to toxic substance (GO:0097237)|cellular response to unfolded protein (GO:0034620)|central nervous system development (GO:0007417)|dopamine metabolic process (GO:0042417)|dopamine uptake involved in synaptic transmission (GO:0051583)|learning (GO:0007612)|mitochondrion degradation (GO:0000422)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell death (GO:0060548)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of insulin secretion (GO:0046676)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|norepinephrine metabolic process (GO:0042415)|positive regulation of DNA binding (GO:0043388)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fusion (GO:0010636)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor-mediated signaling pathway (GO:1903265)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of autophagy (GO:0010506)|regulation of dopamine secretion (GO:0014059)|regulation of glucose metabolic process (GO:0010906)|regulation of lipid transport (GO:0032368)|regulation of mitochondrion degradation (GO:1903146)|regulation of mitochondrion organization (GO:0010821)|regulation of neurotransmitter secretion (GO:0046928)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to endoplasmic reticulum stress (GO:0034976)|startle response (GO:0001964)|synaptic transmission, glutamatergic (GO:0035249)|transcription, DNA-templated (GO:0006351)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Lewy body (GO:0097413)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|perinuclear region of cytoplasm (GO:0048471)|ubiquitin ligase complex (GO:0000151)	chaperone binding (GO:0051087)|cullin family protein binding (GO:0097602)|F-box domain binding (GO:1990444)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|ligase activity (GO:0016874)|PDZ domain binding (GO:0030165)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|ubiquitin binding (GO:0043130)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease binding (GO:1990381)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		GGGTCAAGGTGAGCGTTGCCT	0.468																																						dbGAP											0													114.0	102.0	106.0					6																	162622175		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5281.1, CCDS5282.1, CCDS5283.1	6q25.2-q27	2013-10-03	2013-10-03		ENSG00000185345	ENSG00000185345		"""Parkinson disease"""	8607	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase"""	602544	"""Parkinson disease (autosomal recessive, juvenile) 2, parkin"", ""parkinson protein 2, E3 ubiquitin protein ligase (parkin)"""			9560156, 9570960	Standard	NM_004562		Approved	PDJ, AR-JP, parkin	uc003qtx.4	O60260	OTTHUMG00000015970	ENST00000366898.1:c.522C>G	6.37:g.162622175G>C			A3FG77|A8K975|D3JZW7|D3K2X0|Q5TFV8|Q5VVX4|Q6Q2I6|Q8NI41|Q8NI43|Q8NI44|Q8WW07	Silent	SNP	pfam_Ubiquitin,pfam_Znf_C6HC,pfam_SUMO,smart_Ubiquitin,smart_Znf_C6HC,pirsf_Parkin,prints_Parkin,prints_Ubiquitin_subgr,pfscan_Ubiquitin_supergroup	p.L174	ENST00000366898.1	37	c.522	CCDS5281.1	6																																																																																			PARK2	-	pirsf_Parkin	ENSG00000185345		0.468	PARK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PARK2	HGNC	protein_coding	OTTHUMT00000042995.1	43	0.00	0	G			162622175	162622175	-1	no_errors	ENST00000366898	ensembl	human	known	69_37n	silent	22	35.29	12	SNP	1.000	C
PCDHB2	56133	genome.wustl.edu	37	5	140475557	140475557	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:140475557T>C	ENST00000194155.4	+	1	1331	c.1183T>C	c.(1183-1185)Ttg>Ctg	p.L395L		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	395	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCTTTTTTCTTGAAACCTTC	0.493																																						dbGAP											0													108.0	100.0	103.0					5																	140475557		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1183T>C	5.37:g.140475557T>C			Q4KMU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L395	ENST00000194155.4	37	c.1183	CCDS4244.1	5																																																																																			PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000112852		0.493	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	43	0.00	0	T	NM_018936		140475557	140475557	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	silent	28	36.36	16	SNP	0.048	C
PCDHGB3	56102	genome.wustl.edu	37	5	140806491	140806491	+	Intron	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:140806491G>C	ENST00000576222.1	+	1	2546				PCDHGB7_ENST00000398594.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB8P_ENST00000502926.1_RNA|PCDHGA4_ENST00000571252.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAGCAATGGACATGGGTGA	0.507																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.2415+54115G>C	5.37:g.140806491G>C			A7E229|Q9Y5C7	RNA	SNP	-	NULL	ENST00000576222.1	37	NULL	CCDS58980.1	5																																																																																			PCDHGB8P	-	-	ENSG00000248449		0.507	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB8P	HGNC	protein_coding	OTTHUMT00000437094.1	54	0.00	0	G	NM_018924		140806491	140806491	+1	no_errors	ENST00000502926	ensembl	human	known	69_37n	rna	24	33.33	12	SNP	1.000	C
PCLO	27445	genome.wustl.edu	37	7	82791775	82791775	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:82791775A>C	ENST00000333891.9	-	1	471	c.134T>G	c.(133-135)tTg>tGg	p.L45W	PCLO_ENST00000423517.2_Missense_Mutation_p.L45W	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CAGCTGGCTCAAATCCGCCTC	0.721																																						dbGAP											0													22.0	26.0	25.0					7																	82791775		2028	4174	6202	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.134T>G	7.37:g.82791775A>C	ENSP00000334319:p.Leu45Trp			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.L45W	ENST00000333891.9	37	c.134	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	A	14.99	2.699615	0.48307	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.30714	1.52;1.53	4.33	4.33	0.51752	.	.	.	.	.	T	0.22666	0.0547	N	0.24115	0.695	0.80722	D	1	B;B	0.32800	0.385;0.385	B;B	0.35688	0.208;0.208	T	0.09618	-1.0666	9	0.87932	D	0	.	9.9367	0.41556	0.8292:0.1708:0.0:0.0	.	45;45	Q9Y6V0-5;Q9Y6V0-6	.;.	W	45	ENSP00000334319:L45W;ENSP00000388393:L45W	ENSP00000334319:L45W	L	-	2	0	PCLO	82629711	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.463000	0.66712	1.808000	0.52836	0.454000	0.30748	TTG	PCLO	-	NULL	ENSG00000186472		0.721	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	135	0.00	0	A	NM_014510		82791775	82791775	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	91	22.22	26	SNP	1.000	C
PDK4	5166	genome.wustl.edu	37	7	95223049	95223049	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:95223049G>T	ENST00000005178.5	-	3	503	c.306C>A	c.(304-306)ttC>ttA	p.F102L	AC002451.3_ENST00000416502.1_RNA|AC002451.3_ENST00000432265.1_RNA	NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	102					cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			TTTTCTCATGGAATTCCACCA	0.338																																						dbGAP											0													108.0	111.0	110.0					7																	95223049		2203	4300	6503	-	-	-	SO:0001583	missense	0			U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.306C>A	7.37:g.95223049G>T	ENSP00000005178:p.Phe102Leu			Missense_Mutation	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.F102L	ENST00000005178.5	37	c.306	CCDS5643.1	7	.	.	.	.	.	.	.	.	.	.	G	18.62	3.664027	0.67700	.	.	ENSG00000004799	ENST00000005178;ENST00000542888	T	0.32272	1.46	5.48	1.35	0.21983	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.47764	0.1463	M	0.68728	2.09	0.53688	D	0.999977	D	0.69078	0.997	D	0.76071	0.987	T	0.36311	-0.9753	10	0.66056	D	0.02	.	8.6253	0.33886	0.397:0.0:0.603:0.0	.	102	Q16654	PDK4_HUMAN	L	102;66	ENSP00000005178:F102L	ENSP00000005178:F102L	F	-	3	2	PDK4	95060985	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	1.573000	0.36472	0.027000	0.15297	-0.345000	0.07892	TTC	PDK4	-	pfam_BCDHK/PDK_N,superfamily_BCDHK/PDK_N	ENSG00000004799		0.338	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK4	HGNC	protein_coding	OTTHUMT00000333298.1	26	0.00	0	G	NM_002612		95223049	95223049	-1	no_errors	ENST00000005178	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	1.000	T
PGLYRP4	57115	genome.wustl.edu	37	1	153317677	153317677	+	Silent	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:153317677G>C	ENST00000359650.5	-	4	385	c.321C>G	c.(319-321)gtC>gtG	p.V107V	PGLYRP4_ENST00000368739.3_Silent_p.V103V|PGLYRP4_ENST00000490266.1_5'UTR	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	107					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGTTGTTGTGGACATGATGGG	0.567																																						dbGAP											0													101.0	99.0	99.0					1																	153317677		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.321C>G	1.37:g.153317677G>C			A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Silent	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.V107	ENST00000359650.5	37	c.321	CCDS30871.1	1																																																																																			PGLYRP4	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	ENSG00000163218		0.567	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGLYRP4	HGNC	protein_coding	OTTHUMT00000089978.1	97	0.00	0	G	NM_020393		153317677	153317677	-1	no_errors	ENST00000359650	ensembl	human	known	69_37n	silent	84	18.45	19	SNP	0.052	C
PHTF2	57157	genome.wustl.edu	37	7	77578993	77578993	+	Splice_Site	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:77578993A>C	ENST00000248550.7	+	16	2035		c.e16-1		PHTF2_ENST00000275575.7_Intron|PHTF2_ENST00000307305.8_Splice_Site|PHTF2_ENST00000422959.2_Splice_Site|PHTF2_ENST00000416283.2_Splice_Site			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						TCATACTTTTAGCTACTTCAT	0.303																																						dbGAP											0													112.0	102.0	105.0					7																	77578993		1849	4080	5929	-	-	-	SO:0001630	splice_region_variant	0			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.1960-1A>C	7.37:g.77578993A>C			A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Splice_Site	SNP	-	e16-2	ENST00000248550.7	37	c.1960-2		7	.	.	.	.	.	.	.	.	.	.	A	14.47	2.543602	0.45280	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000416283;ENST00000248550	.	.	.	5.32	5.32	0.75619	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5763	0.76392	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PHTF2	77416929	1.000000	0.71417	0.899000	0.35326	0.308000	0.27856	9.287000	0.95975	2.139000	0.66308	0.533000	0.62120	.	PHTF2	-	-	ENSG00000006576		0.303	PHTF2-006	KNOWN	basic	protein_coding	PHTF2	HGNC	protein_coding	OTTHUMT00000340638.2	49	0	0	A	NM_020432	Intron	77578993	77578993	+1	no_errors	ENST00000248550	ensembl	human	known	69_37n	splice_site	55	25.68	19	SNP	1.000	C
PKP2	5318	genome.wustl.edu	37	12	32977060	32977060	+	Silent	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:32977060C>G	ENST00000070846.6	-	8	1749	c.1725G>C	c.(1723-1725)gcG>gcC	p.A575A	PKP2_ENST00000340811.4_Silent_p.A531A	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	575					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					ATCTTCTCATCGCTTTTCTCC	0.398																																						dbGAP											0													152.0	128.0	136.0					12																	32977060		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1725G>C	12.37:g.32977060C>G			A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A575	ENST00000070846.6	37	c.1725	CCDS8731.1	12																																																																																			PKP2	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000057294		0.398	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	HGNC	protein_coding	OTTHUMT00000404449.1	37	0.00	0	C	NM_004572		32977060	32977060	-1	no_errors	ENST00000070846	ensembl	human	known	69_37n	silent	47	27.69	18	SNP	0.980	G
PLCG2	5336	genome.wustl.edu	37	16	81939110	81939110	+	Nonsense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:81939110C>T	ENST00000359376.3	+	15	1679	c.1465C>T	c.(1465-1467)Cag>Tag	p.Q489*		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	489					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						TTCCATTGACCAGGTGGGCCT	0.587																																						dbGAP											0													60.0	63.0	62.0					16																	81939110		2041	4178	6219	-	-	-	SO:0001587	stop_gained	0				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.1465C>T	16.37:g.81939110C>T	ENSP00000352336:p.Gln489*		D3DUL3|Q3ZTS2|Q59H45|Q969T5	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_Ca-dep,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pirsf_PLC-gamma,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.Q489*	ENST00000359376.3	37	c.1465	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.163273	0.97338	.	.	ENSG00000197943	ENST00000359376	.	.	.	5.18	5.18	0.71444	.	0.321794	0.35013	N	0.003520	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8926	0.86091	0.0:1.0:0.0:0.0	.	.	.	.	X	489	.	ENSP00000352336:Q489X	Q	+	1	0	PLCG2	80496611	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	4.910000	0.63321	2.425000	0.82216	0.544000	0.68410	CAG	PLCG2	-	superfamily_PLC-like_Pdiesterase_TIM-brl,pirsf_PLC-gamma	ENSG00000197943		0.587	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	HGNC	protein_coding	OTTHUMT00000432429.1	68	0.00	0	C			81939110	81939110	+1	no_errors	ENST00000359376	ensembl	human	known	69_37n	nonsense	57	14.93	10	SNP	1.000	T
POLA1	5422	genome.wustl.edu	37	X	24830922	24830922	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:24830922C>T	ENST00000379059.3	+	29	3235	c.3220C>T	c.(3220-3222)Ctc>Ttc	p.L1074F	POLA1_ENST00000379068.3_Missense_Mutation_p.L1080F	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	1074					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	CAAACAGGAGCTCAAAGGATT	0.403																																						dbGAP											0													99.0	92.0	94.0					X																	24830922		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.3220C>T	X.37:g.24830922C>T	ENSP00000368349:p.Leu1074Phe		Q86UQ7	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.L1080F	ENST00000379059.3	37	c.3238	CCDS14214.1	X	.	.	.	.	.	.	.	.	.	.	C	17.87	3.495313	0.64186	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.17691	2.26;2.26	4.81	3.95	0.45737	DNA polymerase, palm domain (1);DNA-directed DNA polymerase, family B, multifunctional domain (1);	0.067501	0.64402	D	0.000009	T	0.24392	0.0591	L	0.35487	1.065	0.80722	D	1	P	0.48350	0.909	P	0.59703	0.862	T	0.01930	-1.1245	10	0.12766	T	0.61	-1.7122	14.0801	0.64914	0.0:0.8437:0.1563:0.0	.	1074	P09884	DPOLA_HUMAN	F	1080;1074	ENSP00000368358:L1080F;ENSP00000368349:L1074F	ENSP00000368349:L1074F	L	+	1	0	POLA1	24740843	1.000000	0.71417	0.999000	0.59377	0.801000	0.45260	2.336000	0.43938	1.034000	0.39945	0.513000	0.50165	CTC	POLA1	-	pfam_DNA-dir_DNA_pol_B_multi_dom,tigrfam_DNA-dir_DNA_pol_B_pol2	ENSG00000101868		0.403	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	HGNC	protein_coding	OTTHUMT00000056111.1	47	0.00	0	C	NM_016937		24830922	24830922	+1	no_errors	ENST00000379068	ensembl	human	known	69_37n	missense	41	35.94	23	SNP	1.000	T
POU3F4	5456	genome.wustl.edu	37	X	82763378	82763378	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:82763378T>A	ENST00000373200.2	+	1	110	c.46T>A	c.(46-48)Tcc>Acc	p.S16T	RP3-326L13.2_ENST00000607095.1_RNA|RP3-326L13.3_ENST00000607789.1_lincRNA	NM_000307.3	NP_000298	P49335	PO3F4_HUMAN	POU class 3 homeobox 4	16					cochlea morphogenesis (GO:0090103)|forebrain neuron differentiation (GO:0021879)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|sensory perception of sound (GO:0007605)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	AT DNA binding (GO:0003680)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	37						CAGTTCCACCTCCCTAGTCCA	0.547																																						dbGAP											0													64.0	47.0	53.0					X																	82763378		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82324	CCDS14450.1	Xq21.1	2011-06-20	2007-07-13		ENSG00000196767	ENSG00000196767		"""Homeoboxes / POU class"""	9217	protein-coding gene	gene with protein product	"""brain-4"""	300039	"""POU domain class 3, transcription factor 4"""	DFN3		7911044, 7581392	Standard	NM_000307		Approved	BRN4, OTF9, DFNX2	uc004eeg.2	P49335	OTTHUMG00000021919	ENST00000373200.2:c.46T>A	X.37:g.82763378T>A	ENSP00000362296:p.Ser16Thr		B2RC71|Q5H9G9|Q99410	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pirsf_Transcription_factor_POU,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.S16T	ENST00000373200.2	37	c.46	CCDS14450.1	X	.	.	.	.	.	.	.	.	.	.	T	10.52	1.372755	0.24857	.	.	ENSG00000196767	ENST00000373200	D	0.87103	-2.21	4.61	3.39	0.38822	.	0.194900	0.45867	D	0.000336	T	0.79275	0.4418	L	0.42744	1.35	0.34753	D	0.731944	B	0.23316	0.083	B	0.15052	0.012	T	0.74109	-0.3771	10	0.21540	T	0.41	.	8.545	0.33415	0.0:0.0:0.1932:0.8068	.	16	P49335	PO3F4_HUMAN	T	16	ENSP00000362296:S16T	ENSP00000362296:S16T	S	+	1	0	POU3F4	82650034	1.000000	0.71417	0.996000	0.52242	0.953000	0.61014	1.947000	0.40293	0.658000	0.30925	0.483000	0.47432	TCC	POU3F4	-	pirsf_Transcription_factor_POU	ENSG00000196767		0.547	POU3F4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F4	HGNC	protein_coding	OTTHUMT00000057368.2	102	0.00	0	T	NM_000307		82763378	82763378	+1	no_errors	ENST00000373200	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	1.000	A
POU4F1	5457	genome.wustl.edu	37	13	79175956	79175956	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr13:79175956G>A	ENST00000377208.5	-	2	1065	c.854C>T	c.(853-855)aCg>aTg	p.T285M	RNF219-AS1_ENST00000560209.2_RNA|RP11-52L5.6_ENST00000607269.1_RNA|RNF219-AS1_ENST00000430549.2_RNA|RNF219-AS1_ENST00000607205.1_RNA|RNF219-AS1_ENST00000607220.1_RNA|RNF219-AS1_ENST00000607860.1_RNA|RNF219-AS1_ENST00000606376.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000444769.3_RNA|RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000606124.1_RNA	NM_006237.3	NP_006228.3	Q01851	PO4F1_HUMAN	POU class 4 homeobox 1	285	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				axonogenesis (GO:0007409)|cell migration in hindbrain (GO:0021535)|central nervous system neuron differentiation (GO:0021953)|habenula development (GO:0021986)|innervation (GO:0060384)|mesoderm development (GO:0007498)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|peripheral nervous system neuron development (GO:0048935)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proprioception involved in equilibrioception (GO:0051355)|regulation of neurogenesis (GO:0050767)|sensory system development (GO:0048880)|suckling behavior (GO:0001967)|synapse assembly (GO:0007416)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)|ventricular compact myocardium morphogenesis (GO:0003223)	neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)	16		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.129)		GTCGGCCTGCGTCACGCCCAG	0.697																																					Melanoma(109;347 2166 14574 42843)|Ovarian(81;1394 1854 22417 48351)	dbGAP											0													29.0	27.0	27.0					13																	79175956		2201	4298	6499	-	-	-	SO:0001583	missense	0			X64624	CCDS31996.1	13q31.1	2011-06-20	2007-07-13		ENSG00000152192	ENSG00000152192		"""Homeoboxes / POU class"""	9218	protein-coding gene	gene with protein product		601632	"""POU domain class 4, transcription factor 1"""	BRN3A		1357630	Standard	NM_006237		Approved	RDC-1	uc001vkv.3	Q01851	OTTHUMG00000017119	ENST00000377208.5:c.854C>T	13.37:g.79175956G>A	ENSP00000366413:p.Thr285Met		Q14986|Q15318|Q5T227	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.T285M	ENST00000377208.5	37	c.854	CCDS31996.1	13	.	.	.	.	.	.	.	.	.	.	G	15.28	2.786858	0.49997	.	.	ENSG00000152192	ENST00000377208	D	0.88277	-2.36	3.21	3.21	0.36854	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.117068	0.56097	D	0.000023	D	0.92958	0.7759	M	0.91140	3.18	0.58432	D	0.999999	D	0.59357	0.985	P	0.55055	0.767	D	0.93210	0.6599	10	0.87932	D	0	.	8.4674	0.32964	0.1205:0.0:0.8795:0.0	.	285	Q01851	PO4F1_HUMAN	M	285	ENSP00000366413:T285M	ENSP00000366413:T285M	T	-	2	0	POU4F1	78073957	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.460000	0.80816	1.806000	0.52798	0.393000	0.25936	ACG	POU4F1	-	pfam_POU_specific,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,pfscan_POU_specific,prints_POU	ENSG00000152192		0.697	POU4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F1	HGNC	protein_coding	OTTHUMT00000045360.3	89	0.00	0	G			79175956	79175956	-1	no_errors	ENST00000377208	ensembl	human	known	69_37n	missense	36	36.84	21	SNP	1.000	A
PRG3	10394	genome.wustl.edu	37	11	57147150	57147150	+	Silent	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:57147150G>A	ENST00000287143.2	-	3	301	c.192C>T	c.(190-192)gtC>gtT	p.V64V		NM_006093.3	NP_006084.2	Q8TBJ4	LPPR1_HUMAN	proteoglycan 3	0					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			large_intestine(3)|lung(5)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	13						CAGAAGCCTTGACCTCCTCTC	0.552																																					Melanoma(154;1456 2519 19358 45229)	dbGAP											0													111.0	94.0	100.0					11																	57147150		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF132209	CCDS7954.1	11q12.1	2008-02-05			ENSG00000156575	ENSG00000156575			9363	protein-coding gene	gene with protein product		606814				10318872, 11170744	Standard	NM_006093		Approved	MBPH	uc001njv.2	Q9Y2Y8	OTTHUMG00000167026	ENST00000287143.2:c.192C>T	11.37:g.57147150G>A			Q5VX23|Q9NXE2	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Eosinophil_major_basic	p.V64	ENST00000287143.2	37	c.192	CCDS7954.1	11																																																																																			PRG3	-	NULL	ENSG00000156575		0.552	PRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRG3	HGNC	protein_coding	OTTHUMT00000392467.1	54	0.00	0	G	NM_006093		57147150	57147150	-1	no_errors	ENST00000287143	ensembl	human	known	69_37n	silent	33	29.79	14	SNP	0.000	A
PRKCA	5578	genome.wustl.edu	37	17	64731677	64731677	+	Missense_Mutation	SNP	T	T	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr17:64731677T>A	ENST00000413366.3	+	10	1153	c.1127T>A	c.(1126-1128)aTt>aAt	p.I376N		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	376	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	GATGTGGTGATTCAGGATGAT	0.507																																						dbGAP											0													228.0	187.0	201.0					17																	64731677		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1127T>A	17.37:g.64731677T>A	ENSP00000408695:p.Ile376Asn		B5BU22|Q15137|Q32M72|Q96RE4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_C2_dom	p.I376N	ENST00000413366.3	37	c.1127	CCDS11664.1	17	.	.	.	.	.	.	.	.	.	.	T	24.3	4.521355	0.85600	.	.	ENSG00000154229	ENST00000413366;ENST00000284384	T	0.63744	-0.06	5.4	5.4	0.78164	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.63988	0.2558	N	0.11313	0.125	0.80722	D	1	P;D	0.89917	0.935;1.0	P;D	0.77004	0.601;0.989	T	0.72401	-0.4305	10	0.87932	D	0	.	15.4468	0.75238	0.0:0.0:0.0:1.0	.	376;287	P17252;Q59FI5	KPCA_HUMAN;.	N	376;283	ENSP00000408695:I376N	ENSP00000284384:I283N	I	+	2	0	PRKCA	62162139	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	8.040000	0.89188	2.051000	0.60960	0.528000	0.53228	ATT	PRKCA	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000154229		0.507	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCA	HGNC	protein_coding	OTTHUMT00000446976.1	114	0.00	0	T			64731677	64731677	+1	no_errors	ENST00000413366	ensembl	human	known	69_37n	missense	64	44.83	52	SNP	1.000	A
PROKR1	10887	genome.wustl.edu	37	2	68872962	68872962	+	Silent	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:68872962C>A	ENST00000303786.3	+	2	429	c.9C>A	c.(7-9)acC>acA	p.T3T	PROKR1_ENST00000394342.2_Silent_p.T3T			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	3					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						AGATGGAGACCACCATGGGGT	0.547																																						dbGAP											0													145.0	138.0	140.0					2																	68872962		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.9C>A	2.37:g.68872962C>A			A5JUU2|Q53QT9|Q8NFJ7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.T3	ENST00000303786.3	37	c.9	CCDS1889.1	2																																																																																			PROKR1	-	NULL	ENSG00000169618		0.547	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR1	HGNC	protein_coding	OTTHUMT00000251760.2	47	0.00	0	C			68872962	68872962	+1	no_errors	ENST00000303786	ensembl	human	known	69_37n	silent	34	58.02	47	SNP	0.056	A
PRPF4B	8899	genome.wustl.edu	37	6	4041044	4041044	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:4041044G>A	ENST00000337659.6	+	4	1551	c.1451G>A	c.(1450-1452)cGg>cAg	p.R484Q	PRPF4B_ENST00000538861.1_Missense_Mutation_p.R470Q	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	484	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				TTGCGAAGGCGGTCTCGATCA	0.433																																						dbGAP											0													62.0	67.0	65.0					6																	4041044		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1451G>A	6.37:g.4041044G>A	ENSP00000337194:p.Arg484Gln		A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R484Q	ENST00000337659.6	37	c.1451	CCDS4488.1	6	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749232	0.89753	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.69306	-0.39;-0.39	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000003	T	0.71702	0.3371	L	0.48642	1.525	0.48901	D	0.999721	D	0.69078	0.997	D	0.67725	0.953	T	0.66650	-0.5870	10	0.33141	T	0.24	.	19.7383	0.96217	0.0:0.0:1.0:0.0	.	484	Q13523	PRP4B_HUMAN	Q	484;470	ENSP00000337194:R484Q;ENSP00000439331:R470Q	ENSP00000337194:R484Q	R	+	2	0	PRPF4B	3986043	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	6.720000	0.74723	2.735000	0.93741	0.591000	0.81541	CGG	PRPF4B	-	NULL	ENSG00000112739		0.433	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	HGNC	protein_coding	OTTHUMT00000314018.2	43	0.00	0	G			4041044	4041044	+1	no_errors	ENST00000337659	ensembl	human	known	69_37n	missense	10	65.52	19	SNP	1.000	A
PTCD1	26024	genome.wustl.edu	37	7	99023239	99023239	+	Splice_Site	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:99023239C>G	ENST00000292478.4	-	6	1166	c.916G>C	c.(916-918)Gtg>Ctg	p.V306L	ATP5J2-PTCD1_ENST00000413834.1_Splice_Site_p.V355L|PTCD1_ENST00000555673.1_Splice_Site_p.V355L	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	306					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			AGCCGCCACACCTGCCACGGA	0.627																																						dbGAP											0													9.0	9.0	9.0					7																	99023239		1979	3936	5915	-	-	-	SO:0001630	splice_region_variant	0			AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.916-1G>C	7.37:g.99023239C>G			Q3ZB78|Q66K60|Q9UDV2	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,pfam_F1F0-ATPsyn_F_prd,tigrfam_Pentatricopeptide_repeat	p.V355L	ENST00000292478.4	37	c.1063	CCDS34691.1	7	.	.	.	.	.	.	.	.	.	.	C	23.4	4.417210	0.83449	.	.	ENSG00000106246;ENSG00000106246;ENSG00000106246;ENSG00000248919	ENST00000292478;ENST00000438524;ENST00000555673;ENST00000413834	T;T;T	0.63255	-0.03;-0.02;-0.02	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.79040	0.4379	M	0.71296	2.17	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.957	T	0.73820	-0.3862	10	0.27785	T	0.31	-36.9187	20.1278	0.97990	0.0:1.0:0.0:0.0	.	355;306	G3V325;O75127	.;PTCD1_HUMAN	L	306;88;355;355	ENSP00000292478:V306L;ENSP00000450995:V355L;ENSP00000400168:V355L	ENSP00000400168:V355L	V	-	1	0	ATP5J2-PTCD1;PTCD1	98861175	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	4.867000	0.63013	2.768000	0.95171	0.561000	0.74099	GTG	PTCD1	-	NULL	ENSG00000106246		0.627	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCD1	HGNC	protein_coding	OTTHUMT00000336391.1	15	0.00	0	C	NM_015545	Missense_Mutation	99023239	99023239	-1	no_errors	ENST00000555673	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	1.000	G
PTPN5	84867	genome.wustl.edu	37	11	18763852	18763852	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:18763852C>T	ENST00000358540.2	-	7	1112	c.682G>A	c.(682-684)Gac>Aac	p.D228N	PTPN5_ENST00000396170.1_Missense_Mutation_p.D196N|PTPN5_ENST00000477854.1_Missense_Mutation_p.D32N|PTPN5_ENST00000396168.1_Missense_Mutation_p.D204N|PTPN5_ENST00000396171.4_Missense_Mutation_p.D228N|PTPN5_ENST00000396167.2_Missense_Mutation_p.D196N|PTPN5_ENST00000496201.2_5'UTR|RP11-1081L13.4_ENST00000527285.1_RNA	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	228					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GAGGTGGGGTCAGCCTCAGGC	0.597																																						dbGAP											0													78.0	82.0	81.0					11																	18763852		2199	4293	6492	-	-	-	SO:0001583	missense	0			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.682G>A	11.37:g.18763852C>T	ENSP00000351342:p.Asp228Asn		B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.D228N	ENST00000358540.2	37	c.682	CCDS7845.1	11	.	.	.	.	.	.	.	.	.	.	C	25.4	4.630304	0.87660	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T;T	0.03860	3.78;3.78;3.86;3.78;3.86;3.79	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.15435	0.0372	L	0.44542	1.39	0.80722	D	1	P;D	0.69078	0.938;0.997	P;D	0.77004	0.532;0.989	T	0.00870	-1.1533	10	0.46703	T	0.11	-11.8851	16.613	0.84899	0.0:1.0:0.0:0.0	.	228;196	P54829;B3KXG7	PTN5_HUMAN;.	N	32;228;196;228;196;204	ENSP00000435056:D32N;ENSP00000351342:D228N;ENSP00000379473:D196N;ENSP00000379474:D228N;ENSP00000379470:D196N;ENSP00000379471:D204N	ENSP00000351342:D228N	D	-	1	0	PTPN5	18720428	1.000000	0.71417	0.920000	0.36463	0.619000	0.37552	7.162000	0.77515	2.362000	0.80069	0.561000	0.74099	GAC	PTPN5	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5	ENSG00000110786		0.597	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	HGNC	protein_coding	OTTHUMT00000259196.2	55	0.00	0	C	NM_001039970		18763852	18763852	-1	no_errors	ENST00000358540	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	0.999	T
QSOX1	5768	genome.wustl.edu	37	1	180144454	180144454	+	Splice_Site	SNP	A	A	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:180144454A>T	ENST00000367602.3	+	3	440		c.e3-1		QSOX1_ENST00000367600.5_Splice_Site			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1						cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GTTTGCTTCCAGTTCTTCAAG	0.537																																						dbGAP											0													154.0	136.0	142.0					1																	180144454		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.367-1A>T	1.37:g.180144454A>T			Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Splice_Site	SNP	-	e3-2	ENST00000367602.3	37	c.367-2	CCDS1337.1	1	.	.	.	.	.	.	.	.	.	.	A	16.18	3.050132	0.55218	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	.	.	.	3.87	3.87	0.44632	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9474	0.47308	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	QSOX1	178411077	1.000000	0.71417	0.997000	0.53966	0.723000	0.41478	4.692000	0.61746	1.991000	0.58162	0.533000	0.62120	.	QSOX1	-	-	ENSG00000116260		0.537	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	HGNC	protein_coding	OTTHUMT00000085289.1	70	0	0	A	NM_002826	Intron	180144454	180144454	+1	no_errors	ENST00000367602	ensembl	human	known	69_37n	splice_site	53	31.17	24	SNP	1.000	T
RABGAP1	23637	genome.wustl.edu	37	9	125772723	125772723	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:125772723A>G	ENST00000373647.4	+	11	1599	c.1465A>G	c.(1465-1467)Aca>Gca	p.T489A		NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1	489					cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						GAGGAAAACTACAGCCAGTCC	0.418																																						dbGAP											0													104.0	95.0	98.0					9																	125772723		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.1465A>G	9.37:g.125772723A>G	ENSP00000362751:p.Thr489Ala		B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Kinesin-like,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.T489A	ENST00000373647.4	37	c.1465	CCDS6848.2	9	.	.	.	.	.	.	.	.	.	.	A	15.31	2.797126	0.50208	.	.	ENSG00000011454	ENST00000373647	T	0.05382	3.45	5.71	5.71	0.89125	.	0.058932	0.64402	D	0.000002	T	0.03348	0.0097	N	0.04508	-0.205	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.35549	-0.9784	10	0.06494	T	0.89	-12.5826	15.977	0.80076	1.0:0.0:0.0:0.0	.	489	Q9Y3P9	RBGP1_HUMAN	A	489	ENSP00000362751:T489A	ENSP00000362751:T489A	T	+	1	0	RABGAP1	124812544	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	8.365000	0.90108	2.178000	0.69098	0.460000	0.39030	ACA	RABGAP1	-	NULL	ENSG00000011454		0.418	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1	HGNC	protein_coding	OTTHUMT00000053976.3	27	0.00	0	A	NM_012197		125772723	125772723	+1	no_errors	ENST00000373647	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	1.000	G
RBBP4	5928	genome.wustl.edu	37	1	33116821	33116821	+	5'UTR	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:33116821G>A	ENST00000373493.5	+	0	73				RBBP4_ENST00000458695.2_5'Flank|RBBP4_ENST00000414241.3_5'UTR|ZBTB8OS_ENST00000373501.2_5'Flank|RBBP4_ENST00000373485.1_5'Flank|ZBTB8OS_ENST00000492007.1_5'Flank|ZBTB8OS_ENST00000341885.5_5'Flank|RBBP4_ENST00000544435.1_5'UTR|ZBTB8OS_ENST00000468695.1_5'Flank|RBBP4_ENST00000524393.1_3'UTR	NM_001135255.1|NM_005610.2	NP_001128727.1|NP_005601.1	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4						ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin assembly (GO:0031497)|chromatin remodeling (GO:0006338)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|nucleosome assembly (GO:0006334)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|NURF complex (GO:0016589)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				AAACAATAGAGGCCGCGCGCA	0.697																																						dbGAP											0													3.0	5.0	5.0					1																	33116821		577	1431	2008	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC053904	CCDS366.1, CCDS44105.1, CCDS44106.1	1p35.1	2014-07-17	2001-11-28		ENSG00000162521	ENSG00000162521		"""WD repeat domain containing"""	9887	protein-coding gene	gene with protein product		602923	"""retinoblastoma-binding protein 4"""			8350924, 14609955, 17531812	Standard	NM_005610		Approved	RbAp48, NURF55, lin-53	uc001bvr.3	Q09028	OTTHUMG00000007998	ENST00000373493.5:c.-87G>A	1.37:g.33116821G>A			B2R6G9|B4DRH0|D3DPQ3|P31149|Q53H02|Q96BV9	RNA	SNP	-	NULL	ENST00000373493.5	37	NULL	CCDS366.1	1																																																																																			RBBP4	-	-	ENSG00000162521		0.697	RBBP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBBP4	HGNC	protein_coding	OTTHUMT00000021957.3	20	0.00	0	G	NM_005610		33116821	33116821	+1	no_errors	ENST00000524393	ensembl	human	known	69_37n	rna	1	87.50	7	SNP	1.000	A
EIF2D	1939	genome.wustl.edu	37	1	206762065	206762065	+	IGR	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:206762065C>G	ENST00000271764.2	-	0	2094				RASSF5_ENST00000491368.1_3'UTR|EIF2D_ENST00000472709.2_Intron|RASSF5_ENST00000304534.8_3'UTR	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D						formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)			autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						TTTTTTAAACCACAAAAACCC	0.463																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619		1.37:g.206762065C>G			Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	RNA	SNP	-	NULL	ENST00000271764.2	37	NULL	CCDS1465.1	1																																																																																			RASSF5	-	-	ENSG00000136653		0.463	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF5	HGNC	protein_coding	OTTHUMT00000088475.1	22	0.00	0	C	NM_006893		206762065	206762065	+1	no_errors	ENST00000481486	ensembl	human	putative	69_37n	rna	15	28.57	6	SNP	0.063	G
RBM12B	389677	genome.wustl.edu	37	8	94746523	94746523	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:94746523C>T	ENST00000399300.2	-	3	2329	c.2116G>A	c.(2116-2118)Gat>Aat	p.D706N	RBM12B_ENST00000517700.1_Intron|RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	706							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TGCCTGAAATCCTCCTCTGGG	0.627																																						dbGAP											0													101.0	107.0	105.0					8																	94746523		1870	4081	5951	-	-	-	SO:0001583	missense	0				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.2116G>A	8.37:g.94746523C>T	ENSP00000382239:p.Asp706Asn		A8MYB5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D706N	ENST00000399300.2	37	c.2116	CCDS43755.1	8	.	.	.	.	.	.	.	.	.	.	C	26.0	4.697431	0.88830	.	.	ENSG00000183808	ENST00000399300	T	0.07908	3.15	4.79	3.9	0.45041	.	.	.	.	.	T	0.10465	0.0256	N	0.14661	0.345	0.80722	D	1	D	0.67145	0.996	P	0.54544	0.755	T	0.18272	-1.0342	9	0.72032	D	0.01	-9.9142	13.0251	0.58810	0.1616:0.8384:0.0:0.0	.	706	Q8IXT5	RB12B_HUMAN	N	706	ENSP00000382239:D706N	ENSP00000382239:D706N	D	-	1	0	RBM12B	94815699	0.000000	0.05858	0.931000	0.37212	0.295000	0.27426	0.017000	0.13399	1.600000	0.50102	0.655000	0.94253	GAT	RBM12B	-	NULL	ENSG00000183808		0.627	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12B	HGNC	protein_coding	OTTHUMT00000383603.1	38	0.00	0	C	NM_203390		94746523	94746523	-1	no_errors	ENST00000399300	ensembl	human	known	69_37n	missense	62	25.30	21	SNP	0.986	T
RBM12B	389677	genome.wustl.edu	37	8	94746790	94746790	+	Nonsense_Mutation	SNP	C	C	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:94746790C>A	ENST00000399300.2	-	3	2062	c.1849G>T	c.(1849-1851)Gag>Tag	p.E617*	RBM12B_ENST00000517700.1_Nonsense_Mutation_p.E617*|RP11-10N23.4_ENST00000517998.1_RNA|RBM12B_ENST00000520961.1_Intron	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	617							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			CTCCAGTCCTCCTCCCTAGGG	0.642																																						dbGAP											0													50.0	51.0	51.0					8																	94746790		1866	4110	5976	-	-	-	SO:0001587	stop_gained	0				CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.1849G>T	8.37:g.94746790C>A	ENSP00000382239:p.Glu617*		A8MYB5	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E617*	ENST00000399300.2	37	c.1849	CCDS43755.1	8	.	.	.	.	.	.	.	.	.	.	C	40	8.028567	0.98619	.	.	ENSG00000183808	ENST00000399300;ENST00000517700	.	.	.	2.68	2.68	0.31781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-11.1518	5.5791	0.17241	0.0:0.8479:0.0:0.152	.	.	.	.	X	617	.	ENSP00000382239:E617X	E	-	1	0	RBM12B	94815966	0.016000	0.18221	0.129000	0.21949	0.972000	0.66771	0.282000	0.18829	1.786000	0.52430	0.650000	0.86243	GAG	RBM12B	-	NULL	ENSG00000183808		0.642	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12B	HGNC	protein_coding	OTTHUMT00000383603.1	63	0.00	0	C	NM_203390		94746790	94746790	-1	no_errors	ENST00000399300	ensembl	human	known	69_37n	nonsense	86	15.53	16	SNP	0.349	A
RCAN1	1827	genome.wustl.edu	37	21	35889098	35889098	+	3'UTR	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr21:35889098G>C	ENST00000313806.4	-	0	2173				RCAN1_ENST00000381135.3_3'UTR|RCAN1_ENST00000381132.2_3'UTR|RCAN1_ENST00000487990.1_3'UTR|RCAN1_ENST00000489903.1_5'UTR|RCAN1_ENST00000399272.1_3'UTR|RCAN1_ENST00000481448.1_3'UTR|RCAN1_ENST00000443408.2_3'UTR|RCAN1_ENST00000482533.1_3'UTR	NM_004414.5	NP_004405.3	P53805	RCAN1_HUMAN	regulator of calcineurin 1						blood circulation (GO:0008015)|calcineurin-NFAT signaling cascade (GO:0033173)|central nervous system development (GO:0007417)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of smooth muscle cell differentiation (GO:0051151)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|response to ischemia (GO:0002931)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)|signal transduction (GO:0007165)|skeletal muscle fiber development (GO:0048741)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(1)|lung(2)	5						ACATTGTTACGGTATTGTAAG	0.294																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS13637.1, CCDS33551.1, CCDS42921.1, CCDS74788.1, CCDS74790.1	21q22.1-q22.2	2010-08-11	2007-06-26	2007-06-26	ENSG00000159200	ENSG00000159200			3040	protein-coding gene	gene with protein product		602917	"""Down syndrome critical region gene 1"""	DSCR1		8595418	Standard	XM_005260929		Approved		uc002yue.3	P53805	OTTHUMG00000086235	ENST00000313806.4:c.*1284C>G	21.37:g.35889098G>C			D3DSF9|O00582|O00583|Q53XT0|Q6IBC6|Q7Z555|Q96R03|Q9BU69|Q9UF15|Q9UME4	RNA	SNP	-	NULL	ENST00000313806.4	37	NULL	CCDS13637.1	21																																																																																			RCAN1	-	-	ENSG00000159200		0.294	RCAN1-001	KNOWN	basic|CCDS	protein_coding	RCAN1	HGNC	protein_coding	OTTHUMT00000194142.1	18	0.00	0	G			35889098	35889098	-1	no_errors	ENST00000489903	ensembl	human	known	69_37n	rna	1	87.50	7	SNP	0.642	C
RFWD2	64326	genome.wustl.edu	37	1	175958531	175958531	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr1:175958531G>T	ENST00000367669.3	-	16	2328	c.1814C>A	c.(1813-1815)gCa>gAa	p.A605E	RFWD2_ENST00000308769.8_Missense_Mutation_p.A581E	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	605					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CACAAACTTTGCATAAGAGAC	0.398																																					Ovarian(134;1413 1765 5706 35534 51541)	dbGAP											0													156.0	134.0	142.0					1																	175958531		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.1814C>A	1.37:g.175958531G>T	ENSP00000356641:p.Ala605Glu		E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A605E	ENST00000367669.3	37	c.1814	CCDS30944.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.277229	0.95459	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	T;T;T	0.60797	0.16;0.16;0.16	5.79	5.79	0.91817	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.78220	0.4249	M	0.79475	2.455	0.80722	D	1	P;D;D;D;D	0.69078	0.941;0.985;0.974;0.997;0.997	P;D;P;D;D	0.81914	0.738;0.966;0.719;0.995;0.992	T	0.79725	-0.1683	10	0.87932	D	0	-10.2529	19.6032	0.95572	0.0:0.0:1.0:0.0	.	380;365;581;605;605	Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.;.;.;RFWD2_HUMAN;.	E	380;605;440;581	ENSP00000356641:A605E;ENSP00000356638:A440E;ENSP00000310943:A581E	ENSP00000310943:A581E	A	-	2	0	RFWD2	174225154	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.627000	0.98412	2.738000	0.93877	0.655000	0.94253	GCA	RFWD2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000143207		0.398	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFWD2	HGNC	protein_coding	OTTHUMT00000084672.2	18	0.00	0	G	NM_022457		175958531	175958531	-1	no_errors	ENST00000367669	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	T
RIC8A	60626	genome.wustl.edu	37	11	209307	209307	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:209307G>T	ENST00000526104.1	+	2	1465	c.121G>T	c.(121-123)Gag>Tag	p.E41*	RIC8A_ENST00000325207.5_Nonsense_Mutation_p.E41*|BET1L_ENST00000332865.6_5'Flank|BET1L_ENST00000410108.1_5'Flank|BET1L_ENST00000486280.1_5'Flank|BET1L_ENST00000325147.9_5'Flank|BET1L_ENST00000382762.3_5'Flank|BET1L_ENST00000529614.2_5'Flank|RIC8A_ENST00000527696.1_Missense_Mutation_p.R5S			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	41					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGCCCAACAGGAGGACCGGAA	0.617																																						dbGAP											0													127.0	138.0	134.0					11																	209307		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.121G>T	11.37:g.209307G>T	ENSP00000432008:p.Glu41*		Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Nonsense_Mutation	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn	p.E41*	ENST00000526104.1	37	c.121		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.150852|4.150852	0.78001|0.78001	.|.	.|.	ENSG00000177963|ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000531209;ENST00000528357;ENST00000530889|ENST00000527696	.|.	.|.	.|.	3.36|3.36	3.36|3.36	0.38483|0.38483	.|.	0.127741|.	0.50627|.	D|.	0.000108|.	.|T	.|0.32526	.|0.0832	.|.	.|.	.|.	0.25108|0.25108	N|N	0.99074|0.99074	.|B	.|0.33238	.|0.403	.|B	.|0.25405	.|0.06	.|T	.|0.31138	.|-0.9954	.|7	0.56958|0.87932	D|D	0.05|0	-29.6975|-29.6975	13.0314|13.0314	0.58845|0.58845	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|5	.|Q9NPQ8-2	.|.	X|S	41;41;41;41;45|5	.|.	ENSP00000325941:E41X|ENSP00000434833:R5S	E|R	+|+	1|3	0|2	RIC8A|RIC8A	199307|199307	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.567000|0.567000	0.35839|0.35839	3.398000|3.398000	0.52579|0.52579	2.180000|2.180000	0.69256|0.69256	0.462000|0.462000	0.41574|0.41574	GAG|AGG	RIC8A	-	NULL	ENSG00000177963		0.617	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	RIC8A	HGNC	protein_coding	OTTHUMT00000384761.1	123	0.00	0	G	NM_021932		209307	209307	+1	no_errors	ENST00000325207	ensembl	human	known	69_37n	nonsense	48	37.66	29	SNP	0.998	T
RIC8A	60626	genome.wustl.edu	37	11	209710	209710	+	Nonsense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:209710G>T	ENST00000526104.1	+	3	1780	c.436G>T	c.(436-438)Gag>Tag	p.E146*	RIC8A_ENST00000325207.5_Nonsense_Mutation_p.E146*|BET1L_ENST00000332865.6_5'Flank|BET1L_ENST00000410108.1_5'Flank|BET1L_ENST00000486280.1_5'Flank|BET1L_ENST00000325147.9_5'Flank|BET1L_ENST00000382762.3_5'Flank|BET1L_ENST00000529614.2_5'Flank|RIC8A_ENST00000527696.1_Nonsense_Mutation_p.E140*			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A	146					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		GAAGCTCACAGAGCGTGTGGG	0.607																																						dbGAP											0													53.0	48.0	49.0					11																	209710		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.436G>T	11.37:g.209710G>T	ENSP00000432008:p.Glu146*		Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Nonsense_Mutation	SNP	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold,prints_Synembryn	p.E146*	ENST00000526104.1	37	c.436		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.61|17.61	3.431166|3.431166	0.62844|0.62844	.|.	.|.	ENSG00000177963|ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000528357;ENST00000530889;ENST00000527696;ENST00000527468|ENST00000527728	.|.	.|.	.|.	4.45|4.45	3.51|3.51	0.40186|0.40186	.|.	0.502057|.	0.21298|.	N|.	0.076851|.	.|T	.|0.50069	.|0.1594	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.59010	.|-0.7534	.|3	0.20519|.	T|.	0.43|.	-20.3137|-20.3137	8.5213|8.5213	0.33277|0.33277	0.0869:0.433:0.4801:0.0|0.0869:0.433:0.4801:0.0	.|.	.|.	.|.	.|.	X|H	146;146;122;150;140;36|27	.|.	ENSP00000325941:E146X|.	E|Q	+|+	1|3	0|2	RIC8A|RIC8A	199710|199710	0.832000|0.832000	0.29368|0.29368	0.646000|0.646000	0.29493|0.29493	0.576000|0.576000	0.36127|0.36127	1.078000|1.078000	0.30754|0.30754	1.128000|1.128000	0.42052|0.42052	0.561000|0.561000	0.74099|0.74099	GAG|CAG	RIC8A	-	pfam_Gua_nucleotide_exch_fac_Ric8,superfamily_ARM-type_fold	ENSG00000177963		0.607	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	RIC8A	HGNC	protein_coding	OTTHUMT00000384761.1	113	0.00	0	G	NM_021932		209710	209710	+1	no_errors	ENST00000325207	ensembl	human	known	69_37n	nonsense	28	45.10	23	SNP	0.276	T
RIC8A	60626	genome.wustl.edu	37	11	210570	210570	+	Splice_Site	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:210570G>C	ENST00000526104.1	+	4	2070		c.e4-1		RIC8A_ENST00000325207.5_Splice_Site|RIC8A_ENST00000527696.1_Splice_Site			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		TCTTTGGTCAGGAAGACGCTG	0.577																																						dbGAP											0													126.0	122.0	124.0					11																	210570		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069	ENST00000526104.1:c.727-1G>C	11.37:g.210570G>C			Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Splice_Site	SNP	-	e4-1	ENST00000526104.1	37	c.727-1		11	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272479	0.40194	.	.	ENSG00000177963	ENST00000526104;ENST00000325207;ENST00000527696;ENST00000527728	.	.	.	4.41	3.47	0.39725	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9895	0.64357	0.0:0.1535:0.8465:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIC8A	200570	1.000000	0.71417	1.000000	0.80357	0.502000	0.33828	8.925000	0.92832	1.105000	0.41606	0.644000	0.83932	.	RIC8A	-	-	ENSG00000177963		0.577	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	RIC8A	HGNC	protein_coding	OTTHUMT00000384761.1	60	0.00	0	G	NM_021932	Intron	210570	210570	+1	no_errors	ENST00000325207	ensembl	human	known	69_37n	splice_site	25	37.50	15	SNP	1.000	C
RMI1	80010	genome.wustl.edu	37	9	86617537	86617537	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:86617537G>C	ENST00000325875.3	+	3	1968	c.1636G>C	c.(1636-1638)Gtg>Ctg	p.V546L		NM_024945.2	NP_079221.2	Q9H9A7	RMI1_HUMAN	RecQ mediated genome instability 1	546					DNA replication (GO:0006260)|glucose homeostasis (GO:0042593)|multicellular organism growth (GO:0035264)|reduction of food intake in response to dietary excess (GO:0002023)|response to glucose (GO:0009749)	nucleus (GO:0005634)				biliary_tract(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						TGTAGACTTTGTGGATGAAAT	0.378																																						dbGAP											0													184.0	181.0	182.0					9																	86617537		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022950	CCDS6669.1	9q22.1	2013-06-10	2013-06-10	2006-06-12	ENSG00000178966	ENSG00000178966			25764	protein-coding gene	gene with protein product	"""BLM-Associated Polypeptide, 75 kDa"""	610404	"""chromosome 9 open reading frame 76"", ""RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae)"""	C9orf76		15775963, 20826341	Standard	NM_024945		Approved	FLJ12888, BLAP75	uc004anq.4	Q9H9A7	OTTHUMG00000020113	ENST00000325875.3:c.1636G>C	9.37:g.86617537G>C	ENSP00000317039:p.Val546Leu		Q05BX1|Q05CW3|Q5SQG8|Q5SQG9|Q6P1Q4|Q6PI89|Q7Z6L6	Missense_Mutation	SNP	pfam_DUF1767	p.V546L	ENST00000325875.3	37	c.1636	CCDS6669.1	9	.	.	.	.	.	.	.	.	.	.	G	5.863	0.343376	0.11069	.	.	ENSG00000178966	ENST00000325875	T	0.30182	1.54	5.62	1.6	0.23607	.	0.479063	0.23076	N	0.052211	T	0.12008	0.0292	N	0.08118	0	0.20926	N	0.999826	B	0.02656	0.0	B	0.01281	0.0	T	0.26573	-1.0099	9	.	.	.	-13.3182	4.6974	0.12811	0.2951:0.0:0.5649:0.14	.	546	Q9H9A7	RMI1_HUMAN	L	546	ENSP00000317039:V546L	.	V	+	1	0	RMI1	85807357	1.000000	0.71417	0.749000	0.31150	0.396000	0.30629	1.720000	0.38022	0.017000	0.15025	0.563000	0.77884	GTG	RMI1	-	NULL	ENSG00000178966		0.378	RMI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RMI1	HGNC	protein_coding	OTTHUMT00000052870.1	44	0.00	0	G	NM_024945		86617537	86617537	+1	no_errors	ENST00000325875	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	0.975	C
RNF185	91445	genome.wustl.edu	37	22	31600503	31600503	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr22:31600503C>G	ENST00000326132.6	+	7	669	c.510C>G	c.(508-510)gaC>gaG	p.D170E	RNF185_ENST00000426256.2_Missense_Mutation_p.D108E|RNF185_ENST00000266252.7_Missense_Mutation_p.D114E|RNF185-AS1_ENST00000526089.1_RNA	NM_152267.3	NP_689480.2	Q96GF1	RN185_HUMAN	ring finger protein 185	170					autophagy (GO:0006914)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(3)|skin(1)	6						AGTATGTGGACGAGCAGTTCC	0.552																																						dbGAP											0													142.0	121.0	128.0					22																	31600503		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13890.1, CCDS46689.1	22q12.2	2013-01-09			ENSG00000138942	ENSG00000138942		"""RING-type (C3HC4) zinc fingers"""	26783	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38628"""					12477932	Standard	NM_152267		Approved	FLJ38628	uc003akb.3	Q96GF1	OTTHUMG00000151253	ENST00000326132.6:c.510C>G	22.37:g.31600503C>G	ENSP00000320508:p.Asp170Glu		A8K5C1|A9X3T8|Q8N900	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D170E	ENST00000326132.6	37	c.510	CCDS13890.1	22	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318398	0.23994	.	.	ENSG00000138942	ENST00000426256;ENST00000326132;ENST00000266252	D	0.94576	-3.46	5.4	-5.4	0.02656	.	0.000000	0.85682	D	0.000000	D	0.83161	0.5194	N	0.03224	-0.385	0.46609	D	0.99912	B;P;B	0.46706	0.28;0.883;0.311	B;P;B	0.44921	0.349;0.464;0.398	T	0.79045	-0.1964	10	0.08381	T	0.77	.	14.8652	0.70409	0.0:0.601:0.0:0.399	.	114;108;170	Q96GF1-2;B4DMD6;Q96GF1	.;.;RN185_HUMAN	E	108;170;114	ENSP00000320508:D170E	ENSP00000266252:D114E	D	+	3	2	RNF185	29930503	0.987000	0.35691	0.904000	0.35570	0.974000	0.67602	0.155000	0.16362	-1.032000	0.03304	-0.966000	0.02617	GAC	RNF185	-	NULL	ENSG00000138942		0.552	RNF185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF185	HGNC	protein_coding	OTTHUMT00000321927.2	81	0.00	0	C	NM_152267		31600503	31600503	+1	no_errors	ENST00000326132	ensembl	human	known	69_37n	missense	47	38.16	29	SNP	0.899	G
RPL10A	4736	genome.wustl.edu	37	6	35437091	35437091	+	Intron	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:35437091G>C	ENST00000322203.6	+	4	188				RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a						anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						TGCGGTCCCAGACCCTTCACC	0.657																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.162-67G>C	6.37:g.35437091G>C			B2R801|P52859|P53025|Q5TZT6|Q8J013	RNA	SNP	-	NULL	ENST00000322203.6	37	NULL	CCDS4806.1	6																																																																																			RPL10A	-	-	ENSG00000198755		0.657	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10A	HGNC	protein_coding	OTTHUMT00000040283.1	61	0.00	0	G	NM_007104		35437091	35437091	+1	no_errors	ENST00000467020	ensembl	human	known	69_37n	rna	21	34.38	11	SNP	0.001	C
RRN3P2	653390	genome.wustl.edu	37	16	29105702	29105702	+	RNA	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:29105702G>C	ENST00000564580.1	+	0	843							A6NIE6	RN3P2_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 2																		TAATCAAAGGGTGGAAACAGC	0.343																																						dbGAP											0																																										-	-	-			0					16p11.2	2011-12-02			ENSG00000103472	ENSG00000103472			37619	pseudogene	pseudogene							Standard	NR_003369		Approved		uc002dsf.4	A6NIE6			16.37:g.29105702G>C				RNA	SNP	-	NULL	ENST00000564580.1	37	NULL		16																																																																																			RRN3P2	-	-	ENSG00000103472		0.343	RRN3P2-001	KNOWN	basic	processed_transcript	RRN3P2	HGNC	pseudogene	OTTHUMT00000433243.1	76	0.00	0	G	NR_003369		29105702	29105702	+1	no_errors	ENST00000427965	ensembl	human	known	69_37n	rna	64	33.33	32	SNP	0.002	C
RXRA	6256	genome.wustl.edu	37	9	137330373	137330373	+	IGR	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:137330373C>G	ENST00000481739.1	+	0	1846				RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha						camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	CCCGATCCACCGTCCTGAGGC	0.672																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887		9.37:g.137330373C>G			B3KY83|Q2NL52|Q2V504	RNA	SNP	-	NULL	ENST00000481739.1	37	NULL	CCDS35172.1	9																																																																																			RXRA	-	-	ENSG00000186350		0.672	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRA	HGNC	protein_coding	OTTHUMT00000054949.1	54	0.00	0	C	NM_002957		137330373	137330373	+1	no_errors	ENST00000356384	ensembl	human	known	69_37n	rna	15	37.50	9	SNP	0.000	G
SCML4	256380	genome.wustl.edu	37	6	108042094	108042094	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:108042094G>T	ENST00000369020.3	-	6	1031	c.786C>A	c.(784-786)caC>caA	p.H262Q	SCML4_ENST00000369025.2_Missense_Mutation_p.H20Q|SCML4_ENST00000369022.2_Missense_Mutation_p.H204Q|SCML4_ENST00000479803.1_5'UTR|SCML4_ENST00000369021.3_Missense_Mutation_p.H233Q	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		AGGAGGAGGGGTGCAAGGAGC	0.622																																						dbGAP											0													62.0	65.0	64.0					6																	108042094		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.786C>A	6.37:g.108042094G>T	ENSP00000358016:p.His262Gln		B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	pfam_DUF3588	p.H233Q	ENST00000369020.3	37	c.699	CCDS5060.2	6	.	.	.	.	.	.	.	.	.	.	G	5.196	0.221739	0.09863	.	.	ENSG00000146285	ENST00000369022;ENST00000369025;ENST00000369020;ENST00000369021	T;T;T	0.41758	1.0;0.99;1.0	5.19	1.32	0.21799	.	1.169140	0.06331	N	0.706221	T	0.06371	0.0164	N	0.08118	0	0.09310	N	1	B;B;B	0.18310	0.022;0.027;0.011	B;B;B	0.17433	0.013;0.004;0.018	T	0.33420	-0.9869	10	0.10636	T	0.68	.	5.3297	0.15926	0.3186:0.1516:0.5298:0.0	.	262;262;233	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	Q	204;20;262;233	ENSP00000358018:H204Q;ENSP00000358016:H262Q;ENSP00000358017:H233Q	ENSP00000358016:H262Q	H	-	3	2	SCML4	108148787	0.214000	0.23563	0.183000	0.23137	0.446000	0.32137	0.365000	0.20348	0.331000	0.23511	0.650000	0.86243	CAC	SCML4	-	NULL	ENSG00000146285		0.622	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SCML4	HGNC	protein_coding	OTTHUMT00000041700.3	39	0.00	0	G	XM_171128		108042094	108042094	-1	no_errors	ENST00000369021	ensembl	human	known	69_37n	missense	16	44.83	13	SNP	0.012	T
SEPT7P9	285961	genome.wustl.edu	37	10	38691528	38691528	+	RNA	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr10:38691528G>T	ENST00000489259.1	-	0	316									septin 7 pseudogene 9																		GGGCGGCCGGGGCTGCAGCTG	0.701																																						dbGAP											0																																										-	-	-			0					10p11.21	2013-04-02	2013-04-02	2013-04-02	ENSG00000120555	ENSG00000120555			30810	pseudogene	pseudogene			"""CDC10 cell division cycle 10 homolog (S. cerevisiae) like"", ""CDC10 cell division cycle 10 homolog (S. cerevisiae)-like"", ""septin 7-like"""	CDC10L, SEPT7L			Standard	NR_027269		Approved	bA291L22.2	uc009xmd.2		OTTHUMG00000017994		10.37:g.38691528G>T				RNA	SNP	-	NULL	ENST00000489259.1	37	NULL		10																																																																																			SEPT7L	-	-	ENSG00000120555		0.701	SEPT7P9-006	KNOWN	basic	processed_transcript	SEPT7L	HGNC	pseudogene	OTTHUMT00000047644.1	8	0.00	0	G	NR_027269		38691528	38691528	-1	no_errors	ENST00000476473	ensembl	human	known	69_37n	rna	7	50.00	7	SNP	0.602	T
SHROOM2	357	genome.wustl.edu	37	X	9864049	9864049	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:9864049G>A	ENST00000380913.3	+	4	2191	c.2101G>A	c.(2101-2103)Gac>Aac	p.D701N		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	701	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				CAAGCGCCGCGACTTGGACCC	0.647																																						dbGAP											0													13.0	12.0	12.0					X																	9864049		2191	4277	6468	-	-	-	SO:0001583	missense	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2101G>A	X.37:g.9864049G>A	ENSP00000370299:p.Asp701Asn		B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D701N	ENST00000380913.3	37	c.2101	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505421	0.64410	.	.	ENSG00000146950	ENST00000380913	T	0.71698	-0.59	5.04	5.04	0.67666	Apx/shroom, ASD1 (2);	0.000000	0.85682	D	0.000000	D	0.86264	0.5891	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88735	0.3239	10	0.62326	D	0.03	-41.6844	17.2592	0.87065	0.0:0.0:1.0:0.0	.	701	Q13796	SHRM2_HUMAN	N	701	ENSP00000370299:D701N	ENSP00000370299:D701N	D	+	1	0	SHROOM2	9824049	1.000000	0.71417	0.024000	0.17045	0.044000	0.14063	9.244000	0.95423	2.098000	0.63641	0.600000	0.82982	GAC	SHROOM2	-	pfam_ASD1	ENSG00000146950		0.647	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	94	0.00	0	G	NM_001649		9864049	9864049	+1	no_errors	ENST00000380913	ensembl	human	known	69_37n	missense	40	36.51	23	SNP	1.000	A
SLC22A7	10864	genome.wustl.edu	37	6	43269337	43269337	+	Missense_Mutation	SNP	C	C	A	rs368239122		TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:43269337C>A	ENST00000372585.5	+	7	1063	c.968C>A	c.(967-969)gCc>gAc	p.A323D	SLC22A7_ENST00000372574.3_Missense_Mutation_p.A321D|SLC22A7_ENST00000372589.3_Missense_Mutation_p.A321D|SLC22A7_ENST00000487175.1_3'UTR	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	323					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	AGCAAAGTGGCCGCCGGGGAA	0.582																																						dbGAP											0													67.0	53.0	58.0					6																	43269337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.968C>A	6.37:g.43269337C>A	ENSP00000361666:p.Ala323Asp		B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.A323D	ENST00000372585.5	37	c.968	CCDS4893.2	6	.	.	.	.	.	.	.	.	.	.	C	11.97	1.798975	0.31777	.	.	ENSG00000137204	ENST00000372589;ENST00000372585;ENST00000372574;ENST00000436107	T;T;T;T	0.58060	0.41;0.41;0.41;0.36	5.56	3.76	0.43208	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.436230	0.04851	N	0.442401	T	0.34978	0.0916	L	0.27053	0.805	0.20764	N	0.999851	P;P;P	0.37688	0.605;0.551;0.551	P;P;P	0.48770	0.589;0.454;0.454	T	0.48758	-0.9007	10	0.44086	T	0.13	.	9.0902	0.36605	0.0:0.8239:0.0:0.1761	.	323;321;321	Q9Y694;Q9Y694-2;Q9Y694-3	S22A7_HUMAN;.;.	D	321;323;321;16	ENSP00000361670:A321D;ENSP00000361666:A323D;ENSP00000361655:A321D;ENSP00000393836:A16D	ENSP00000361655:A321D	A	+	2	0	SLC22A7	43377315	0.085000	0.21516	0.055000	0.19348	0.095000	0.18619	1.890000	0.39728	0.693000	0.31634	0.462000	0.41574	GCC	SLC22A7	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000137204		0.582	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	SLC22A7	HGNC	protein_coding	OTTHUMT00000040588.1	41	0.00	0	C			43269337	43269337	+1	no_errors	ENST00000372585	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	0.035	A
SLC25A32	81034	genome.wustl.edu	37	8	104414317	104414317	+	Intron	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:104414317A>G	ENST00000297578.4	-	5	719				SLC25A32_ENST00000523701.1_5'UTR|SLC25A32_ENST00000543107.1_Intron	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32						folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	GCAAAACAACATACGTTTGAA	0.328																																						dbGAP											0													30.0	29.0	29.0					8																	104414317		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.553-35T>C	8.37:g.104414317A>G			Q96JZ6|Q96SU7	RNA	SNP	-	NULL	ENST00000297578.4	37	NULL	CCDS6300.1	8																																																																																			SLC25A32	-	-	ENSG00000164933		0.328	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A32	HGNC	protein_coding	OTTHUMT00000380290.2	15	0.00	0	A	NM_030780		104414317	104414317	-1	no_errors	ENST00000523701	ensembl	human	putative	69_37n	rna	33	24.44	11	SNP	0.000	G
SLC29A4	222962	genome.wustl.edu	37	7	5336823	5336823	+	Silent	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:5336823C>G	ENST00000396872.3	+	7	1037	c.876C>G	c.(874-876)gtC>gtG	p.V292V	SLC29A4_ENST00000406453.3_Silent_p.V278V|SLC29A4_ENST00000297195.4_Silent_p.V292V			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	292					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	CCGGGGACGTCCACTTCGTAA	0.662																																						dbGAP											0													29.0	28.0	28.0					7																	5336823		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.876C>G	7.37:g.5336823C>G			Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Silent	SNP	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	p.V292	ENST00000396872.3	37	c.876	CCDS5340.1	7																																																																																			SLC29A4	-	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt	ENSG00000164638		0.662	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A4	HGNC	protein_coding	OTTHUMT00000060118.6	120	0.00	0	C	NM_153247		5336823	5336823	+1	no_errors	ENST00000297195	ensembl	human	known	69_37n	silent	50	26.47	18	SNP	0.716	G
SLC38A2	54407	genome.wustl.edu	37	12	46765205	46765205	+	Intron	SNP	C	C	A	rs556133074	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:46765205C>A	ENST00000256689.5	-	2	359				SLC38A2_ENST00000547252.1_5'UTR|RP11-474P2.2_ENST00000550319.1_RNA	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2						amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		AGCGCCAGCCCGCCGCGGTCA	0.731																																					Ovarian(9;448 492 8335 28722 40361)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.86-43G>T	12.37:g.46765205C>A			Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	RNA	SNP	-	NULL	ENST00000256689.5	37	NULL	CCDS8749.1	12																																																																																			SLC38A2	-	-	ENSG00000134294		0.731	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A2	HGNC	protein_coding	OTTHUMT00000404226.1	22	0.00	0	C			46765205	46765205	-1	no_errors	ENST00000547252	ensembl	human	known	69_37n	rna	4	63.64	7	SNP	0.006	A
SLC46A1	113235	genome.wustl.edu	37	17	26724205	26724205	+	3'UTR	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr17:26724205G>C	ENST00000440501.1	-	0	3942				SLC46A1_ENST00000321666.5_3'UTR|SARM1_ENST00000379061.4_Intron|SARM1_ENST00000457710.3_3'UTR|SLC46A1_ENST00000584729.1_5'UTR	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1						cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	AGCCTAGACAGAACCTGCAGC	0.562																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.*2467C>G	17.37:g.26724205G>C			Q1HE20|Q86T92|Q8TEG3|Q96FL0	RNA	SNP	-	NULL	ENST00000440501.1	37	NULL		17																																																																																			SLC46A1	-	-	ENSG00000076351		0.562	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	SLC46A1	HGNC	protein_coding		22	0.00	0	G	NM_080669		26724205	26724205	-1	no_errors	ENST00000583295	ensembl	human	known	69_37n	rna	6	45.45	5	SNP	0.026	C
SLC6A13	6540	genome.wustl.edu	37	12	352957	352957	+	Silent	SNP	G	G	A	rs557961684		TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr12:352957G>A	ENST00000343164.4	-	3	277	c.225C>T	c.(223-225)ctC>ctT	p.L75L	SLC6A13_ENST00000445055.2_Intron	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	75					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			AGAGGAAGACGAGGTAGGGGA	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		22734	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													94.0	87.0	89.0					12																	352957		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.225C>T	12.37:g.352957G>A			B4DJL1|Q8TCC2|Q8WW56	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT2	p.L75	ENST00000343164.4	37	c.225	CCDS8502.1	12																																																																																			SLC6A13	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000010379		0.527	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A13	HGNC	protein_coding	OTTHUMT00000397801.1	67	0.00	0	G	NM_016615		352957	352957	-1	no_errors	ENST00000343164	ensembl	human	known	69_37n	silent	67	33.66	34	SNP	1.000	A
SNHG23	100507242	genome.wustl.edu	37	14	101429453	101429453	+	lincRNA	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr14:101429453G>T	ENST00000556637.1	+	0	1848				SNORD114-7_ENST00000362520.1_RNA|SNORD114-9_ENST00000364370.1_RNA|AL132709.8_ENST00000423708.3_lincRNA																							ACATGCCTGAGACTCTGAGGT	0.373																																						dbGAP											0													85.0	70.0	75.0					14																	101429453		876	1991	2867	-	-	-			0																															14.37:g.101429453G>T				RNA	SNP	-	NULL	ENST00000556637.1	37	NULL		14																																																																																			SNORD114-7	-	-	ENSG00000199390		0.373	AL132709.5-004	KNOWN	basic	lincRNA	SNORD114-7	HGNC	lincRNA	OTTHUMT00000414510.1	29	0.00	0	G			101429453	101429453	+1	no_errors	ENST00000362520	ensembl	human	known	69_37n	rna	19	24.00	6	SNP	0.000	T
SNX1	6642	genome.wustl.edu	37	15	64415706	64415706	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr15:64415706T>C	ENST00000559844.1	+	5	485	c.471T>C	c.(469-471)gaT>gaC	p.D157D	SNX1_ENST00000561026.1_Silent_p.D92D|SNX1_ENST00000261889.5_Silent_p.D157D|SNX1_ENST00000353874.4_Silent_p.D157D|SNX1_ENST00000560829.1_5'UTR			Q13596	SNX1_HUMAN	sorting nexin 1	157	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						TCACAGGGGATGGTATGAATG	0.433																																						dbGAP											0													221.0	180.0	194.0					15																	64415706		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.471T>C	15.37:g.64415706T>C			A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Silent	SNP	pfam_Vps5_C,pfam_Sorting_nexin_N,pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.D157	ENST00000559844.1	37	c.471	CCDS32266.1	15																																																																																			SNX1	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000028528		0.433	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX1	HGNC	protein_coding	OTTHUMT00000418559.1	80	0.00	0	T	NM_003099		64415706	64415706	+1	no_errors	ENST00000559844	ensembl	human	known	69_37n	silent	42	44.00	33	SNP	0.993	C
SNX31	169166	genome.wustl.edu	37	8	101642561	101642561	+	Silent	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:101642561C>T	ENST00000311812.2	-	4	465	c.315G>A	c.(313-315)gcG>gcA	p.A105A		NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31	105	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			TTACCAGCTGCGCCAGTTTTA	0.493																																						dbGAP											0													93.0	75.0	81.0					8																	101642561		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.315G>A	8.37:g.101642561C>T			C9J6L9|Q8N0U9	Silent	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.A105	ENST00000311812.2	37	c.315	CCDS6288.1	8																																																																																			SNX31	-	superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000174226		0.493	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX31	HGNC	protein_coding	OTTHUMT00000379910.1	29	0.00	0	C	NM_152628		101642561	101642561	-1	no_errors	ENST00000311812	ensembl	human	known	69_37n	silent	35	43.55	27	SNP	0.008	T
SOHLH2	54937	genome.wustl.edu	37	13	36744912	36744912	+	Missense_Mutation	SNP	G	G	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr13:36744912G>A	ENST00000379881.3	-	10	1101	c.1013C>T	c.(1012-1014)tCc>tTc	p.S338F	CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.S415F|SOHLH2_ENST00000554962.1_Missense_Mutation_p.S415F	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	338					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		CTCTGAGGCGGAGCTTGATGG	0.388																																						dbGAP											0													98.0	97.0	97.0					13																	36744912		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.1013C>T	13.37:g.36744912G>A	ENSP00000369210:p.Ser338Phe		B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S415F	ENST00000379881.3	37	c.1244	CCDS9355.1	13	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625276	0.28889	.	.	ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000511166	T;T;T	0.38077	1.16;1.16;1.16	5.14	4.27	0.50696	.	0.257996	0.27841	N	0.017626	T	0.40979	0.1139	L	0.55481	1.735	0.31111	N	0.709946	P;P	0.50066	0.931;0.931	P;P	0.48425	0.577;0.577	T	0.52170	-0.8611	10	0.87932	D	0	4.2119	10.8382	0.46700	0.0:0.0:0.8113:0.1887	.	415;338	B4DX90;Q9NX45	.;SOLH2_HUMAN	F	338;415;415	ENSP00000369210:S338F;ENSP00000451542:S415F;ENSP00000421868:S415F	ENSP00000421868:S415F	S	-	2	0	CCDC169-SOHLH2;SOHLH2	35642912	0.987000	0.35691	0.322000	0.25334	0.022000	0.10575	2.800000	0.47900	1.117000	0.41842	0.655000	0.94253	TCC	SOHLH2	-	NULL	ENSG00000120669		0.388	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOHLH2	HGNC	protein_coding	OTTHUMT00000044477.2	32	0.00	0	G	NM_017826		36744912	36744912	-1	no_errors	ENST00000554962	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.804	A
STXBP5L	9515	genome.wustl.edu	37	3	120977986	120977986	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:120977986T>C	ENST00000273666.6	+	18	2200	c.1929T>C	c.(1927-1929)acT>acC	p.T643T	STXBP5L_ENST00000497029.1_Silent_p.T643T|STXBP5L_ENST00000471454.1_Silent_p.T643T|STXBP5L_ENST00000472879.1_Silent_p.T643T|STXBP5L_ENST00000492541.1_Silent_p.T643T	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	643					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		AACAGATTACTAGTCTTGCTG	0.363																																						dbGAP											0													112.0	107.0	109.0					3																	120977986		1866	4102	5968	-	-	-	SO:0001819	synonymous_variant	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1929T>C	3.37:g.120977986T>C			Q4G1B4|Q6PIC3	Silent	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Lethal2_giant,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin	p.T643	ENST00000273666.6	37	c.1929	CCDS43137.1	3																																																																																			STXBP5L	-	superfamily_WD40_repeat_dom	ENSG00000145087		0.363	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	64	0.00	0	T			120977986	120977986	+1	no_errors	ENST00000273666	ensembl	human	known	69_37n	silent	59	18.06	13	SNP	1.000	C
SUPT6H	6830	genome.wustl.edu	37	17	27000551	27000551	+	Intron	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr17:27000551C>G	ENST00000314616.6	+	2	392				SUPT6H_ENST00000347486.4_Intron|AC010761.13_ENST00000578819.1_RNA	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CAGCCTCAAGCTTCTCCCCAC	0.483																																						dbGAP											0													47.0	46.0	46.0					17																	27000551		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.109+23C>G	17.37:g.27000551C>G			A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	NULL	p.S44R	ENST00000314616.6	37	c.132	CCDS32596.1	17																																																																																			SUPT6H	-	NULL	ENSG00000109111		0.483	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	20	0.00	0	C	NM_003170		27000551	27000551	+1	no_errors	ENST00000584312	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152631867	152631867	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:152631867G>T	ENST00000367255.5	-	88	17453	c.16852C>A	c.(16852-16854)Cag>Aag	p.Q5618K	SYNE1_ENST00000423061.1_Missense_Mutation_p.Q5547K|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q5547K|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q5230K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q5618K|SYNE1_ENST00000356820.4_Missense_Mutation_p.Q142K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5618					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTGATCATCTGTCGCAACTCC	0.383										HNSCC(10;0.0054)																												dbGAP											0													99.0	87.0	91.0					6																	152631867		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.16852C>A	6.37:g.152631867G>T	ENSP00000356224:p.Gln5618Lys		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q5618K	ENST00000367255.5	37	c.16852	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	19.42	3.825065	0.71143	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.53206	1.37;1.37;1.37;1.37;0.63;1.37	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000017	T	0.51058	0.1652	M	0.74881	2.28	0.58432	D	0.999999	P;P;P	0.44521	0.748;0.748;0.837	B;B;P	0.47134	0.233;0.233;0.539	T	0.47420	-0.9119	10	0.37606	T	0.19	.	20.4756	0.99175	0.0:0.0:1.0:0.0	.	5618;5618;5547	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	K	5618;5547;5618;5547;5230;142	ENSP00000356224:Q5618K;ENSP00000396024:Q5547K;ENSP00000265368:Q5618K;ENSP00000390975:Q5547K;ENSP00000341887:Q5230K;ENSP00000349276:Q142K	ENSP00000265368:Q5618K	Q	-	1	0	SYNE1	152673560	1.000000	0.71417	0.363000	0.25875	0.918000	0.54935	7.628000	0.83189	2.847000	0.97988	0.655000	0.94253	CAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.383	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	44	0.00	0	G	NM_182961		152631867	152631867	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152680558	152680558	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:152680558C>G	ENST00000367255.5	-	65	10936	c.10335G>C	c.(10333-10335)ttG>ttC	p.L3445F	SYNE1_ENST00000423061.1_Missense_Mutation_p.L3452F|SYNE1_ENST00000448038.1_Missense_Mutation_p.L3452F|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.L3445F	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3445					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGGTCTCCAGCAAGCTGCTGT	0.443										HNSCC(10;0.0054)																												dbGAP											0													127.0	112.0	117.0					6																	152680558		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10335G>C	6.37:g.152680558C>G	ENSP00000356224:p.Leu3445Phe		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L3445F	ENST00000367255.5	37	c.10335	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	13.23	2.174855	0.38413	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.06	0.863	0.19062	.	0.000000	0.43110	D	0.000609	T	0.36303	0.0962	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.69078	0.995;0.995;0.995;0.997	D;D;D;D	0.68621	0.918;0.918;0.918;0.959	T	0.24012	-1.0172	10	0.56958	D	0.05	.	5.1736	0.15124	0.2416:0.5317:0.0:0.2267	.	3445;3445;3445;3452	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	F	3445;3452;3445;3452	ENSP00000356224:L3445F;ENSP00000396024:L3452F;ENSP00000265368:L3445F;ENSP00000390975:L3452F	ENSP00000265368:L3445F	L	-	3	2	SYNE1	152722251	0.042000	0.20092	0.998000	0.56505	0.989000	0.77384	-0.817000	0.04472	0.166000	0.19597	-0.355000	0.07637	TTG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	89	0.00	0	C	NM_182961		152680558	152680558	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	0.972	G
TCERG1	10915	genome.wustl.edu	37	5	145859620	145859620	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr5:145859620A>C	ENST00000296702.5	+	12	1887	c.1849A>C	c.(1849-1851)Att>Ctt	p.I617L	TCERG1_ENST00000394421.2_Missense_Mutation_p.I596L	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	617					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATGGAAGAAATTAATGAAGA	0.279																																						dbGAP											0													39.0	44.0	42.0					5																	145859620		2193	4287	6480	-	-	-	SO:0001583	missense	0			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.1849A>C	5.37:g.145859620A>C	ENSP00000296702:p.Ile617Leu		Q2NKN2|Q59EA1	Missense_Mutation	SNP	pfam_FF_domain,pfam_WW_Rsp5_WWP,superfamily_FF_domain,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_FF_domain,pfscan_WW_Rsp5_WWP	p.I617L	ENST00000296702.5	37	c.1849	CCDS4282.1	5	.	.	.	.	.	.	.	.	.	.	A	11.51	1.660217	0.29515	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.60797	0.16;2.01	5.14	1.18	0.20946	.	0.877669	0.10488	N	0.668757	T	0.30293	0.0760	N	0.08118	0	0.21020	N	0.999809	B;B;B	0.16802	0.007;0.019;0.007	B;B;B	0.08055	0.001;0.003;0.001	T	0.21415	-1.0246	10	0.10636	T	0.68	1.1114	6.4227	0.21752	0.4401:0.422:0.1379:0.0	.	596;596;617	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	L	617;596	ENSP00000296702:I617L;ENSP00000377943:I596L	ENSP00000296702:I617L	I	+	1	0	TCERG1	145839813	0.770000	0.28543	0.973000	0.42090	0.903000	0.53119	0.536000	0.23129	0.019000	0.15079	0.383000	0.25322	ATT	TCERG1	-	NULL	ENSG00000113649		0.279	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	HGNC	protein_coding	OTTHUMT00000251886.1	26	0.00	0	A	NM_001040006		145859620	145859620	+1	no_errors	ENST00000296702	ensembl	human	known	69_37n	missense	11	47.62	10	SNP	0.886	C
THSD7A	221981	genome.wustl.edu	37	7	11486928	11486928	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:11486928G>C	ENST00000423059.4	-	12	2980	c.2729C>G	c.(2728-2730)aCc>aGc	p.T910S	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	910	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GGACCAGCTGGTCAATTGACA	0.532										HNSCC(18;0.044)																												dbGAP											0													71.0	67.0	68.0					7																	11486928		1926	4138	6064	-	-	-	SO:0001583	missense	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2729C>G	7.37:g.11486928G>C	ENSP00000406482:p.Thr910Ser			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.T910S	ENST00000423059.4	37	c.2729	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	G	15.92	2.973925	0.53720	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.58797	0.31	5.73	5.73	0.89815	.	0.042432	0.85682	D	0.000000	T	0.55689	0.1936	L	0.43923	1.385	0.54753	D	0.999983	B	0.27117	0.168	B	0.34138	0.176	T	0.48445	-0.9035	10	0.18710	T	0.47	.	19.9054	0.97006	0.0:0.0:1.0:0.0	.	910	Q9UPZ6	THS7A_HUMAN	S	910	ENSP00000406482:T910S	ENSP00000262042:T910S	T	-	2	0	THSD7A	11453453	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.606000	0.61126	2.698000	0.92095	0.655000	0.94253	ACC	THSD7A	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000005108		0.532	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	43	0.00	0	G	XM_928187.2		11486928	11486928	-1	no_errors	ENST00000423059	ensembl	human	known	69_37n	missense	74	26.73	27	SNP	1.000	C
TFR2	7036	genome.wustl.edu	37	7	100224404	100224404	+	Nonsense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:100224404G>C	ENST00000462107.1	-	18	2405	c.2118C>G	c.(2116-2118)taC>taG	p.Y706*	TFR2_ENST00000431692.1_3'UTR|TFR2_ENST00000223051.3_Nonsense_Mutation_p.Y706*|TFR2_ENST00000544242.1_Nonsense_Mutation_p.Y247*			Q9UP52	TFR2_HUMAN	transferrin receptor 2	706					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	TGCGCACGTTGTACATGCGTG	0.697																																						dbGAP											0													39.0	28.0	32.0					7																	100224404		1929	3754	5683	-	-	-	SO:0001587	stop_gained	0			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.2118C>G	7.37:g.100224404G>C	ENSP00000420525:p.Tyr706*		A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Nonsense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.Y706*	ENST00000462107.1	37	c.2118	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	g	44	10.751589	0.99461	.	.	ENSG00000106327	ENST00000223051;ENST00000462107;ENST00000544242	.	.	.	5.51	4.63	0.57726	.	0.070550	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-23.2325	12.4211	0.55520	0.0826:0.0:0.9174:0.0	.	.	.	.	X	706;706;247	.	ENSP00000223051:Y706X	Y	-	3	2	TFR2	100062340	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.474000	0.73578	1.316000	0.45131	0.558000	0.71614	TAC	TFR2	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom	ENSG00000106327		0.697	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	HGNC	protein_coding	OTTHUMT00000356392.3	71	0.00	0	G	NM_003227		100224404	100224404	-1	no_errors	ENST00000223051	ensembl	human	known	69_37n	nonsense	57	24.68	19	SNP	1.000	C
TMC2	117532	genome.wustl.edu	37	20	2517931	2517931	+	Missense_Mutation	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr20:2517931A>C	ENST00000358864.1	+	2	66	c.51A>C	c.(49-51)aaA>aaC	p.K17N		NM_080751.2	NP_542789.2	Q8TDI7	TMC2_HUMAN	transmembrane channel-like 2	17	Arg/Asp/Glu/Lys-rich (highly charged).				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						GCGGAGTGAAAGGGCGGGTGA	0.637																																						dbGAP											0													56.0	48.0	51.0					20																	2517931		2200	4299	6499	-	-	-	SO:0001583	missense	0			AF417580	CCDS13029.2	20p13	2010-08-05	2003-02-23		ENSG00000149488	ENSG00000149488			16527	protein-coding gene	gene with protein product		606707	"""transmembrane, cochlear expressed, 2"""	C20orf145		11850618, 12906855	Standard	XM_005260660		Approved	dJ686C3.3	uc002wgf.1	Q8TDI7	OTTHUMG00000031698	ENST00000358864.1:c.51A>C	20.37:g.2517931A>C	ENSP00000351732:p.Lys17Asn		Q5JXT0|Q5JXT1|Q6UWW4|Q6ZS41|Q8N9F3|Q9BYN2|Q9BYN3|Q9BYN4|Q9BYN5	Missense_Mutation	SNP	pfam_TMC	p.K17N	ENST00000358864.1	37	c.51	CCDS13029.2	20	.	.	.	.	.	.	.	.	.	.	A	11.40	1.626928	0.28978	.	.	ENSG00000149488	ENST00000358864	T	0.65732	-0.17	3.98	2.87	0.33458	.	0.895495	0.09196	U	0.835288	T	0.37320	0.0999	N	0.08118	0	0.19300	N	0.999976	B	0.16166	0.016	B	0.14023	0.01	T	0.25047	-1.0143	10	0.17832	T	0.49	-0.5825	5.6566	0.17647	0.8716:0.0:0.1284:0.0	.	17	Q8TDI7	TMC2_HUMAN	N	17	ENSP00000351732:K17N	ENSP00000351732:K17N	K	+	3	2	TMC2	2465931	0.592000	0.26832	0.647000	0.29507	0.016000	0.09150	1.341000	0.33907	0.867000	0.35654	0.379000	0.24179	AAA	TMC2	-	NULL	ENSG00000149488		0.637	TMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC2	HGNC	protein_coding	OTTHUMT00000077601.2	32	0.00	0	A			2517931	2517931	+1	no_errors	ENST00000358864	ensembl	human	known	69_37n	missense	6	68.42	13	SNP	0.695	C
TMEM181	57583	genome.wustl.edu	37	6	159049452	159049453	+	Frame_Shift_Ins	INS	-	-	A			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:159049452_159049453insA	ENST00000367090.3	+	14	1544_1545	c.1533_1534insA	c.(1534-1536)tatfs	p.Y512fs		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	512					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		TCGCCATCCTTTATTTGAGATT	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	Exception_encountered	6.37:g.159049452_159049453insA	ENSP00000356057:p.Tyr512fs		Q5VTU1	Frame_Shift_Ins	INS	NULL	p.Y511fs	ENST00000367090.3	37	c.1533_1534	CCDS43520.1	6																																																																																			TMEM181	-	NULL	ENSG00000146433		0.446	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM181	HGNC	protein_coding	OTTHUMT00000042873.1	99	0.00	0	-	NM_020823		159049452	159049453	+1	no_errors	ENST00000367090	ensembl	human	known	69_37n	frame_shift_ins	66	19.51	16	INS	1.000:0.997	A
TMEM190	147744	genome.wustl.edu	37	19	55889519	55889519	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:55889519G>C	ENST00000291934.3	+	5	500	c.482G>C	c.(481-483)gGg>gCg	p.G161A	CTD-2105E13.15_ENST00000595064.1_RNA	NM_139172.1	NP_631911.1	Q8WZ59	TM190_HUMAN	transmembrane protein 190	161					hematopoietic progenitor cell differentiation (GO:0002244)	inner acrosomal membrane (GO:0002079)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	5	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		ggcaccgagggggaagggacg	0.642																																						dbGAP											0													41.0	44.0	43.0					19																	55889519		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF442729	CCDS33113.1	19q13.42	2011-09-28				ENSG00000160472			29632	protein-coding gene	gene with protein product						21273369	Standard	NM_139172		Approved	MDAC1	uc002qkt.1	Q8WZ59		ENST00000291934.3:c.482G>C	19.37:g.55889519G>C	ENSP00000291934:p.Gly161Ala		A6NJL5	Missense_Mutation	SNP	superfamily_P_trefoil	p.G161A	ENST00000291934.3	37	c.482	CCDS33113.1	19	.	.	.	.	.	.	.	.	.	.	G	0.109	-1.141200	0.01728	.	.	ENSG00000160472	ENST00000291934	.	.	.	2.75	-2.98	0.05513	.	0.745739	0.10632	U	0.652036	T	0.14442	0.0349	N	0.24115	0.695	0.09310	N	1	B	0.32101	0.356	B	0.30401	0.115	T	0.27739	-1.0065	9	0.02654	T	1	-4.1512	2.5927	0.04847	0.2698:0.0:0.3203:0.4098	.	161	Q8WZ59	TM190_HUMAN	A	161	.	ENSP00000291934:G161A	G	+	2	0	TMEM190	60581331	0.969000	0.33509	0.001000	0.08648	0.062000	0.15995	0.141000	0.16076	-0.487000	0.06735	0.313000	0.20887	GGG	TMEM190	-	NULL	ENSG00000160472		0.642	TMEM190-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM190	HGNC	protein_coding	OTTHUMT00000453042.1	84	0.00	0	G	NM_139172		55889519	55889519	+1	no_errors	ENST00000291934	ensembl	human	known	69_37n	missense	36	56.63	47	SNP	0.001	C
TMEM30C	644444	genome.wustl.edu	37	3	99904570	99904570	+	Missense_Mutation	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:99904570G>T	ENST00000429523.2	+	1	40	c.40G>T	c.(40-42)Gac>Tac	p.D14Y				A0ZSE6	CC50C_HUMAN	transmembrane protein 30C	14						integral component of membrane (GO:0016021)											CAGATTACTAGACAACTCTGC	0.473																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					3q12.1	2013-01-16			ENSG00000235156	ENSG00000235156			30443	other	unknown		611030				15375526	Standard	NR_028357		Approved	CDC50C	uc003dtr.2	A0ZSE6	OTTHUMG00000159056	ENST00000429523.2:c.40G>T	3.37:g.99904570G>T	ENSP00000402698:p.Asp14Tyr			Missense_Mutation	SNP	NULL	p.D14Y	ENST00000429523.2	37	c.40		3	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338992	0.81911	.	.	ENSG00000235156	ENST00000429523	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	T	0.69824	0.3154	.	.	.	0.35323	D	0.784933	.	.	.	.	.	.	T	0.74070	-0.3783	4	.	.	.	.	18.4828	0.90818	0.0:0.0:1.0:0.0	.	.	.	.	Y	14	.	.	D	+	1	0	TMEM30C	101387260	1.000000	0.71417	0.998000	0.56505	0.876000	0.50452	6.668000	0.74457	2.712000	0.92718	0.561000	0.74099	GAC	TMEM30C	-	NULL	ENSG00000235156		0.473	TMEM30C-201	KNOWN	basic|appris_principal	protein_coding	TMEM30C	HGNC	protein_coding		52	0.00	0	G	NR_028357		99904570	99904570	+1	no_errors	ENST00000429523	ensembl	human	known	69_37n	missense	76	17.39	16	SNP	1.000	T
TNIP3	79931	genome.wustl.edu	37	4	122103898	122103898	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr4:122103898G>C	ENST00000509841.1	-	3	221	c.143C>G	c.(142-144)gCg>gGg	p.A48G	TNIP3_ENST00000454328.1_5'UTR|TNIP3_ENST00000507879.1_Missense_Mutation_p.A41G	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						ATGAGGAGACGCATTTCTCTC	0.408																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.143C>G	4.37:g.122103898G>C	ENSP00000426613:p.Ala48Gly			Missense_Mutation	SNP	NULL	p.A48G	ENST00000509841.1	37	c.143	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268594	0.59540	.	.	ENSG00000050730	ENST00000507879;ENST00000509841	T;T	0.54866	0.56;0.55	4.94	0.826	0.18829	.	.	.	.	.	T	0.35856	0.0946	.	.	.	0.09310	N	0.999997	P	0.38020	0.615	B	0.38194	0.267	T	0.17930	-1.0353	8	0.36615	T	0.2	.	2.744	0.05262	0.0915:0.1597:0.4208:0.328	.	41	B4DVF5	.	G	41;48	ENSP00000427106:A41G;ENSP00000426613:A48G	ENSP00000427106:A41G	A	-	2	0	TNIP3	122323348	0.000000	0.05858	0.000000	0.03702	0.761000	0.43186	-0.352000	0.07701	0.307000	0.22880	0.655000	0.94253	GCG	TNIP3	-	NULL	ENSG00000050730		0.408	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000364000.4	47	0.00	0	G	NM_024873		122103898	122103898	-1	no_errors	ENST00000509841	ensembl	human	putative	69_37n	missense	27	28.95	11	SNP	0.000	C
TP53	7157	genome.wustl.edu	37	17	7578217	7578218	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr17:7578217_7578218delGT	ENST00000269305.4	-	6	820_821	c.631_632delAC	c.(631-633)actfs	p.T211fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.T211fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Frame_Shift_Del_p.T211fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.T211fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.T211fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.T211fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	211	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> N (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.T211I(7)|p.?(5)|p.T211N(4)|p.T211fs*4(3)|p.T211fs*36(2)|p.R209fs*35(2)|p.T211A(2)|p.T211fs*5(2)|p.D208fs*1(1)|p.R209_R213delRNTFR(1)|p.T211fs*28(1)|p.D207_R213delDDRNTFR(1)|p.D207_V216del10(1)|p.T211_S215delTFRHS(1)|p.R209fs*36(1)|p.T211P(1)|p.T211S(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGTCGAAAAGTGTTTCTGTCA	0.535		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Substitution - Missense(15)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Insertion - Frameshift(2)	large_intestine(6)|biliary_tract(5)|central_nervous_system(5)|bone(5)|stomach(4)|haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|breast(4)|upper_aerodigestive_tract(1)|soft_tissue(1)|thymus(1)|urinary_tract(1)|liver(1)|skin(1)|lung(1)|ovary(1)|pancreas(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.631_632delAC	17.37:g.7578219_7578220delGT	ENSP00000269305:p.Thr211fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.T211fs	ENST00000269305.4	37	c.632_631	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.535	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	58	0.00	0	GT	NM_000546		7578217	7578218	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	7	77.50	31	DEL	0.994:0.993	-
TRERF1	55809	genome.wustl.edu	37	6	42236954	42236954	+	Silent	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:42236954G>T	ENST00000372922.4	-	5	937	c.375C>A	c.(373-375)tcC>tcA	p.S125S	TRERF1_ENST00000340840.2_Silent_p.S125S|TRERF1_ENST00000372917.4_Silent_p.S125S|TRERF1_ENST00000354325.2_Silent_p.S125S|TRERF1_ENST00000541110.1_Silent_p.S125S	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	125					cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CGCTGGCCTGGGAGTAGGTGT	0.557																																						dbGAP											0													168.0	171.0	170.0					6																	42236954		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.375C>A	6.37:g.42236954G>T			Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.S125	ENST00000372922.4	37	c.375	CCDS4867.1	6																																																																																			TRERF1	-	NULL	ENSG00000124496		0.557	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	36	0.00	0	G	NM_033502		42236954	42236954	-1	no_errors	ENST00000541110	ensembl	human	known	69_37n	silent	50	10.71	6	SNP	0.980	T
TRH	7200	genome.wustl.edu	37	3	129695551	129695551	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr3:129695551T>C	ENST00000302649.3	+	3	748	c.221T>C	c.(220-222)aTc>aCc	p.I74T	TRH_ENST00000507066.1_Missense_Mutation_p.I70T	NM_007117.3	NP_009048.1	P20396	TRH_HUMAN	thyrotropin-releasing hormone	74					adult walking behavior (GO:0007628)|cell-cell signaling (GO:0007267)|eating behavior (GO:0042755)|histamine metabolic process (GO:0001692)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of feeding behavior (GO:2000252)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of insulin secretion (GO:0032024)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	thyrotropin-releasing hormone activity (GO:0008437)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)	14						GCGTCCCAGATCTTTCAATCT	0.572																																					Esophageal Squamous(60;321 1330 17401 41911)	dbGAP											0													71.0	69.0	70.0					3																	129695551		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3066.1	3q13.3-q21	2013-02-28				ENSG00000170893		"""Endogenous ligands"""	12298	protein-coding gene	gene with protein product	"""prothyroliberin"""	613879				2126343, 1900134	Standard	NM_007117		Approved		uc003enc.4	P20396		ENST00000302649.3:c.221T>C	3.37:g.129695551T>C	ENSP00000303452:p.Ile74Thr		B2R8R1|Q2TB83	Missense_Mutation	SNP	pfam_TRH,pirsf_TRH	p.I74T	ENST00000302649.3	37	c.221	CCDS3066.1	3	.	.	.	.	.	.	.	.	.	.	T	0.422	-0.907866	0.02434	.	.	ENSG00000170893	ENST00000302649;ENST00000507066	T;T	0.43294	0.95;0.95	4.61	-0.481	0.12082	.	1.162270	0.06041	N	0.654852	T	0.20373	0.0490	N	0.12746	0.255	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.21245	-1.0251	10	0.02654	T	1	0.4711	7.4043	0.26981	0.0:0.4625:0.0:0.5375	.	74	P20396	TRH_HUMAN	T	74;70	ENSP00000303452:I74T;ENSP00000426522:I70T	ENSP00000303452:I74T	I	+	2	0	TRH	131178241	0.000000	0.05858	0.014000	0.15608	0.017000	0.09413	-0.136000	0.10405	-0.057000	0.13199	-0.353000	0.07706	ATC	TRH	-	pfam_TRH,pirsf_TRH	ENSG00000170893		0.572	TRH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRH	HGNC	protein_coding	OTTHUMT00000356592.1	29	0.00	0	T	NM_007117		129695551	129695551	+1	no_errors	ENST00000302649	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	0.000	C
TRPM6	140803	genome.wustl.edu	37	9	77354692	77354692	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr9:77354692G>C	ENST00000360774.1	-	34	5671	c.5434C>G	c.(5434-5436)Cgg>Ggg	p.R1812G	TRPM6_ENST00000361255.3_Missense_Mutation_p.R1807G|TRPM6_ENST00000449912.2_Missense_Mutation_p.R1807G|TRPM6_ENST00000376864.4_Missense_Mutation_p.R1816G|TRPM6_ENST00000376872.3_Missense_Mutation_p.R767G|TRPM6_ENST00000451710.3_Missense_Mutation_p.R1816G|TRPM6_ENST00000376871.3_Missense_Mutation_p.R649G	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1812	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TGCCATGTCCGCACAACCTCA	0.488																																						dbGAP											0													147.0	146.0	146.0					9																	77354692		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.5434C>G	9.37:g.77354692G>C	ENSP00000354006:p.Arg1812Gly		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.R1816G	ENST00000360774.1	37	c.5446	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	9.827	1.187269	0.21870	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000449912;ENST00000361255;ENST00000376870;ENST00000376864	T;T;T;T;T;T;T	0.05925	3.37;3.37;3.37;3.37;3.37;3.37;3.37	5.96	4.12	0.48240	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.422510	0.29410	N	0.012235	T	0.05868	0.0153	N	0.11255	0.115	0.26015	N	0.981945	B;B;B;B;B;B	0.32283	0.355;0.355;0.355;0.362;0.312;0.312	B;B;B;B;B;B	0.38616	0.184;0.184;0.277;0.095;0.057;0.057	T	0.31530	-0.9940	10	0.42905	T	0.14	.	15.6115	0.76721	0.0:0.0:0.7486:0.2514	.	359;645;763;1812;1807;1807	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;.;.;TRPM6_HUMAN;.;.	G	1812;1816;767;649;1807;1807;358;1816	ENSP00000354006:R1812G;ENSP00000407341:R1816G;ENSP00000366068:R767G;ENSP00000366067:R649G;ENSP00000396672:R1807G;ENSP00000354962:R1807G;ENSP00000366060:R1816G	ENSP00000354006:R1812G	R	-	1	2	TRPM6	76544512	0.749000	0.28305	0.927000	0.36925	0.165000	0.22458	2.006000	0.40874	0.845000	0.35118	-0.953000	0.02652	CGG	TRPM6	-	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	ENSG00000119121		0.488	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	46	0.00	0	G	NM_017662		77354692	77354692	-1	no_errors	ENST00000451710	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	0.767	C
TSSK4	283629	genome.wustl.edu	37	14	24677147	24677147	+	Intron	SNP	G	G	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr14:24677147G>T	ENST00000287913.6	+	4	972				TSSK4_ENST00000556621.1_Intron|TSSK4_ENST00000428351.2_Intron|TM9SF1_ENST00000530611.1_Intron|TM9SF1_ENST00000556387.1_Intron|CHMP4A_ENST00000542700.2_5'Flank|TSSK4_ENST00000339917.5_Intron|AL136419.6_ENST00000565988.1_RNA			Q6SA08	TSSK4_HUMAN	testis-specific serine kinase 4						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|positive regulation of CREB transcription factor activity (GO:0032793)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	8				GBM - Glioblastoma multiforme(265;0.018)		ACTCAGGCAAGACCTCTCTCT	0.517																																						dbGAP											0													92.0	69.0	77.0					14																	24677147		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF542390	CCDS9618.1, CCDS53890.1	14q11.2	2006-03-31	2005-03-10	2005-03-12	ENSG00000139908	ENSG00000139908			19825	protein-coding gene	gene with protein product	"""chromosome 14 open reading frame 20"""	610711	"""serine/threonine kinase 22E"""	C14orf20, STK22E			Standard	NM_174944		Approved		uc001wnh.3	Q6SA08	OTTHUMG00000029323	ENST00000287913.6:c.805-23G>T	14.37:g.24677147G>T			Q2TA60|Q6ZNM2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_cat_dom	p.D102Y	ENST00000287913.6	37	c.304	CCDS9618.1	14	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200291	0.58126	.	.	ENSG00000139908	ENST00000553766	.	.	.	5.1	4.21	0.49690	.	.	.	.	.	T	0.59487	0.2197	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57087	-0.7871	4	.	.	.	.	9.2492	0.37545	0.0973:0.0:0.9027:0.0	.	.	.	.	Y	102	.	.	D	+	1	0	TSSK4	23746987	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	2.946000	0.49050	1.378000	0.46305	0.655000	0.94253	GAC	TSSK4	-	pfscan_Prot_kinase_cat_dom	ENSG00000139908		0.517	TSSK4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TSSK4	HGNC	protein_coding	OTTHUMT00000073139.3	51	0.00	0	G	NM_174944		24677147	24677147	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000553766	ensembl	human	putative	69_37n	missense	18	37.93	11	SNP	0.997	T
TTC23	64927	genome.wustl.edu	37	15	99740201	99740201	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr15:99740201C>T	ENST00000394132.2	-	9	1499	c.682G>A	c.(682-684)Gta>Ata	p.V228I	TTC23_ENST00000394130.1_Missense_Mutation_p.V228I|TTC23_ENST00000394136.1_Missense_Mutation_p.V228I|TTC23_ENST00000394129.2_Missense_Mutation_p.V228I|TTC23_ENST00000262074.4_Missense_Mutation_p.V228I|TTC23_ENST00000558663.1_Missense_Mutation_p.V228I|TTC23_ENST00000558613.1_Missense_Mutation_p.V228I|TTC23_ENST00000394135.3_Missense_Mutation_p.V228I			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	228										endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			AATATGGGTACACACTCACGA	0.458																																						dbGAP											0													255.0	224.0	235.0					15																	99740201		2197	4297	6494	-	-	-	SO:0001583	missense	0				CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.682G>A	15.37:g.99740201C>T	ENSP00000377690:p.Val228Ile		A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Missense_Mutation	SNP	smart_TPR_repeat	p.V228I	ENST00000394132.2	37	c.682	CCDS10379.2	15	.	.	.	.	.	.	.	.	.	.	C	8.394	0.840345	0.16891	.	.	ENSG00000103852	ENST00000394132;ENST00000394136;ENST00000262074;ENST00000394135;ENST00000394130;ENST00000394129	T;T;T;T;T;T	0.76448	2.8;2.8;2.8;2.8;-0.01;-1.02	5.87	4.75	0.60458	Tetratricopeptide-like helical (1);	0.510960	0.20732	N	0.086696	T	0.64692	0.2621	L	0.33137	0.985	0.25921	N	0.983116	B;B	0.21753	0.06;0.003	B;B	0.20184	0.028;0.002	T	0.50524	-0.8818	10	0.34782	T	0.22	-17.2928	7.6802	0.28509	0.0:0.8651:0.0:0.1349	.	228;228	Q5W5X9-2;Q5W5X9	.;TTC23_HUMAN	I	228	ENSP00000377690:V228I;ENSP00000377693:V228I;ENSP00000262074:V228I;ENSP00000377692:V228I;ENSP00000377688:V228I;ENSP00000457901:V228I	ENSP00000262074:V228I	V	-	1	0	TTC23	97557724	0.925000	0.31364	0.968000	0.41197	0.800000	0.45204	1.582000	0.36568	2.941000	0.99782	0.655000	0.94253	GTA	TTC23	-	NULL	ENSG00000103852		0.458	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23	HGNC	protein_coding	OTTHUMT00000303953.2	42	0.00	0	C	NM_022905		99740201	99740201	-1	no_errors	ENST00000262074	ensembl	human	known	69_37n	missense	6	70.00	14	SNP	0.982	T
UBE2J1	51465	genome.wustl.edu	37	6	90039466	90039466	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:90039466C>T	ENST00000435041.2	-	8	1167	c.889G>A	c.(889-891)Gca>Aca	p.A297T		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	297					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		GCTGCCAATGCCAAAGTCAGG	0.423																																						dbGAP											0													121.0	98.0	106.0					6																	90039466		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.889G>A	6.37:g.90039466C>T	ENSP00000451261:p.Ala297Thr		A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.A297T	ENST00000435041.2	37	c.889	CCDS5021.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.112541	0.94339	.	.	ENSG00000198833	ENST00000435041;ENST00000536477	T	0.67865	-0.29	5.76	5.76	0.90799	.	0.193643	0.53938	D	0.000052	T	0.70789	0.3264	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.72350	-0.4320	10	0.62326	D	0.03	-21.5335	20.3242	0.98691	0.0:1.0:0.0:0.0	.	297	Q9Y385	UB2J1_HUMAN	T	297;282	ENSP00000451261:A297T	ENSP00000354684:A297T	A	-	1	0	UBE2J1	90096185	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.506000	0.73712	2.882000	0.98803	0.655000	0.94253	GCA	UBE2J1	-	NULL	ENSG00000198833		0.423	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2J1	HGNC	protein_coding	OTTHUMT00000043742.2	49	0.00	0	C	NM_016021		90039466	90039466	-1	no_errors	ENST00000435041	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	1.000	T
UBE2V2	7336	genome.wustl.edu	37	8	48921029	48921029	+	Splice_Site	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:48921029A>C	ENST00000523111.2	+	1	70	c.15A>C	c.(13-15)acA>acC	p.T5T	UBE2V2_ENST00000521346.1_5'UTR|UBE2V2_ENST00000517630.1_5'UTR	NM_003350.2	NP_003341.1	Q15819	UB2V2_HUMAN	ubiquitin-conjugating enzyme E2 variant 2	5					cell proliferation (GO:0008283)|DNA double-strand break processing (GO:0000729)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of DNA repair (GO:0045739)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of synapse assembly (GO:0051965)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of DNA repair (GO:0006282)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|UBC13-MMS2 complex (GO:0031372)	acid-amino acid ligase activity (GO:0016881)			large_intestine(1)|lung(2)	3		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00171)|all_lung(136;0.00196)				CGGTCTCCACAGGTCGGTTCC	0.736								Rad6 pathway																														dbGAP											0													19.0	30.0	26.0					8																	48921029		2021	4183	6204	-	-	-	SO:0001630	splice_region_variant	0			X98091	CCDS43738.1	8q11.21	2008-02-05			ENSG00000169139	ENSG00000169139		"""Ubiquitin-conjugating enzymes E2"""	12495	protein-coding gene	gene with protein product		603001				9418904, 9199207	Standard	NM_003350		Approved	UEV-2, DDVit-1, EDPF-1, MMS2	uc003xqm.3	Q15819	OTTHUMG00000164206	ENST00000523111.2:c.16+1A>C	8.37:g.48921029A>C				Silent	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.T5	ENST00000523111.2	37	c.15	CCDS43738.1	8																																																																																			UBE2V2	-	NULL	ENSG00000169139		0.736	UBE2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2V2	HGNC	protein_coding	OTTHUMT00000377808.3	127	0.00	0	A	NM_003350	Silent	48921029	48921029	+1	no_errors	ENST00000523111	ensembl	human	known	69_37n	silent	108	20.00	27	SNP	1.000	C
UBE3C	9690	genome.wustl.edu	37	7	157000483	157000483	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:157000483G>C	ENST00000348165.5	+	13	2023	c.1663G>C	c.(1663-1665)Ggg>Cgg	p.G555R		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	555					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		TGCATGCCTGGGGATCATCAA	0.388																																						dbGAP											0													135.0	129.0	131.0					7																	157000483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.1663G>C	7.37:g.157000483G>C	ENSP00000309198:p.Gly555Arg		A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.G555R	ENST00000348165.5	37	c.1663	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846768	0.91277	.	.	ENSG00000009335	ENST00000348165	T	0.59083	0.29	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.75034	0.3795	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.70026	-0.4985	10	0.22109	T	0.4	.	19.2903	0.94096	0.0:0.0:1.0:0.0	.	555;555	Q15386;Q15386-2	UBE3C_HUMAN;.	R	555	ENSP00000309198:G555R	ENSP00000309198:G555R	G	+	1	0	UBE3C	156693244	1.000000	0.71417	0.976000	0.42696	0.833000	0.47200	8.834000	0.92094	2.556000	0.86216	0.655000	0.94253	GGG	UBE3C	-	NULL	ENSG00000009335		0.388	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	HGNC	protein_coding	OTTHUMT00000348108.1	60	0.00	0	G	NM_014671		157000483	157000483	+1	no_errors	ENST00000348165	ensembl	human	known	69_37n	missense	111	15.91	21	SNP	1.000	C
UNC80	285175	genome.wustl.edu	37	2	210690764	210690764	+	Missense_Mutation	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:210690764T>C	ENST00000439458.1	+	14	2545	c.2465T>C	c.(2464-2466)gTa>gCa	p.V822A	UNC80_ENST00000272845.6_Splice_Site	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	822					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGACACCAGGTATTCCGAGAG	0.448																																						dbGAP											0													132.0	123.0	126.0					2																	210690764		692	1591	2283	-	-	-	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.2465T>C	2.37:g.210690764T>C	ENSP00000391088:p.Val822Ala		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Splice_Site	SNP	-	e14+2	ENST00000439458.1	37	c.2463+2	CCDS46504.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.8|26.8	4.774245|4.774245	0.90108|0.90108	.|.	.|.	ENSG00000144406|ENSG00000144406	ENST00000272845|ENST00000439458	.|T	.|0.35048	.|1.33	5.96|5.96	5.96|5.96	0.96718|0.96718	.|.	.|.	.|.	.|.	.|.	.|T	.|0.39253	.|0.1071	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|P	.|0.52577	.|0.954	.|D	.|0.67900	.|0.954	.|T	.|0.39921	.|-0.9590	.|8	.|.	.|.	.|.	.|-4.3044	16.4484|16.4484	0.83959|0.83959	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|822	.|Q8N2C7	.|UNC80_HUMAN	.|A	-1|822	.|ENSP00000391088:V822A	.|.	.|V	+|+	.|2	.|0	UNC80|UNC80	210399009|210399009	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.620000|7.620000	0.83070|0.83070	2.285000|2.285000	0.76669|0.76669	0.533000|0.533000	0.62120|0.62120	.|GTA	UNC80	-	-	ENSG00000144406		0.448	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		31	0.00	0	T	NM_182587		210690764	210690764	+1	no_errors	ENST00000272845	ensembl	human	known	69_37n	splice_site	24	31.43	11	SNP	1.000	C
URI1	8725	genome.wustl.edu	37	19	30500217	30500217	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:30500217C>T	ENST00000542441.2	+	8	1289	c.992C>T	c.(991-993)tCt>tTt	p.S331F	URI1_ENST00000392271.1_Missense_Mutation_p.S255F|URI1_ENST00000360605.4_Missense_Mutation_p.S313F|URI1_ENST00000312051.6_Missense_Mutation_p.S291F			O94763	RMP_HUMAN	URI1, prefoldin-like chaperone	331					cellular response to growth factor stimulus (GO:0071363)|cellular response to steroid hormone stimulus (GO:0071383)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|regulation of cell growth (GO:0001558)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to virus (GO:0009615)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, core complex (GO:0005665)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	chromatin binding (GO:0003682)|protein phosphatase inhibitor activity (GO:0004864)|RNA polymerase II transcription corepressor activity (GO:0001106)										GGAGATAATTCTATACCAACA	0.353																																						dbGAP											0													90.0	79.0	83.0					19																	30500217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091095	CCDS12420.1, CCDS58658.1	19q12	2012-04-17	2011-11-21	2011-11-21	ENSG00000105176	ENSG00000105176		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	13236	protein-coding gene	gene with protein product	"""unconventional prefoldin RPB5 interactor"", ""RPB5-mediating protein"", ""protein phosphatase 1, regulatory subunit 19"""	603494	"""chromosome 19 open reading frame 2"""	C19orf2		9878255, 9819440	Standard	NM_003796		Approved	RMP, NNX3, FLJ10575, URI, PPP1R19	uc002nsr.3	O94763		ENST00000542441.2:c.992C>T	19.37:g.30500217C>T	ENSP00000442436:p.Ser331Phe		A8K805|H7BY42|Q8TC23|Q9UNU3	Missense_Mutation	SNP	pfam_Prefoldin_subunit,superfamily_Prefoldin	p.S331F	ENST00000542441.2	37	c.992	CCDS12420.1	19	.	.	.	.	.	.	.	.	.	.	C	17.07	3.296003	0.60086	.	.	ENSG00000105176	ENST00000360605;ENST00000392271;ENST00000542441;ENST00000312051	T	0.50813	0.73	5.88	4.81	0.61882	.	0.149243	0.64402	D	0.000007	T	0.57080	0.2029	M	0.64404	1.975	0.37861	D	0.929717	D;P;D	0.56035	0.97;0.949;0.974	P;B;P	0.50617	0.646;0.443;0.521	T	0.65800	-0.6080	10	0.72032	D	0.01	-7.6262	17.1339	0.86734	0.0:0.8741:0.1259:0.0	.	291;331;328	F8W9T0;O94763;Q8TC23	.;RMP_HUMAN;.	F	329;255;331;291	ENSP00000442436:S331F	ENSP00000312530:S291F	S	+	2	0	C19orf2	35192057	0.999000	0.42202	0.106000	0.21319	0.890000	0.51754	1.694000	0.37752	2.791000	0.96007	0.491000	0.48974	TCT	URI1	-	NULL	ENSG00000105176		0.353	URI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URI1	HGNC	protein_coding	OTTHUMT00000439756.1	43	0.00	0	C	NM_134447		30500217	30500217	+1	no_errors	ENST00000542441	ensembl	human	known	69_37n	missense	30	38.78	19	SNP	0.903	T
VPS13B	157680	genome.wustl.edu	37	8	100523446	100523446	+	Silent	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:100523446A>C	ENST00000358544.2	+	29	4525	c.4414A>C	c.(4414-4416)Aga>Cga	p.R1472R	VPS13B_ENST00000357162.2_Silent_p.R1447R|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1472					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAATGAGCGAAGAAGTTTTCA	0.368																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													139.0	140.0	140.0					8																	100523446		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.4414A>C	8.37:g.100523446A>C			C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	pfam_Autophagy-rel_C	p.R1472	ENST00000358544.2	37	c.4414	CCDS6280.1	8																																																																																			VPS13B	-	NULL	ENSG00000132549		0.368	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	23	0.00	0	A	NM_184042		100523446	100523446	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	1.000	C
WT1	7490	genome.wustl.edu	37	11	32439157	32439157	+	Missense_Mutation	SNP	A	A	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr11:32439157A>T	ENST00000379079.2	-	4	553	c.280T>A	c.(280-282)Tgg>Agg	p.W94R	WT1_ENST00000448076.3_Missense_Mutation_p.W306R|WT1_ENST00000332351.3_Missense_Mutation_p.W306R|WT1_ENST00000530998.1_Missense_Mutation_p.W94R	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	238					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			ATCTGATTCCAGGTCATGCAT	0.368			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																													dbGAP	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	0													126.0	115.0	118.0					11																	32439157		2202	4299	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.280T>A	11.37:g.32439157A>T	ENSP00000368370:p.Trp94Arg		A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	pfam_Wilms_tumour_N,pfam_Znf_C2H2,smart_Znf_C2H2-like,prints_Wilms_tumour,pfscan_Znf_C2H2	p.W306R	ENST00000379079.2	37	c.916	CCDS55751.1	11	.	.	.	.	.	.	.	.	.	.	A	20.3	3.974103	0.74246	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076;ENST00000527775	D;D;D;D;D;D	0.90563	-2.69;-2.69;-2.69;-2.69;-2.69;-2.69	6.07	6.07	0.98685	Wilm&apos (1);s tumour protein, N-terminal (1);	0.000000	0.64402	U	0.000003	D	0.91209	0.7230	L	0.54323	1.7	0.58432	D	0.999999	P;P;P;P;P	0.42296	0.737;0.501;0.775;0.459;0.775	B;P;B;B;B	0.48063	0.347;0.565;0.429;0.23;0.429	D	0.90157	0.4225	10	0.36615	T	0.2	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	311;238;311;94;94	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	R	94;306;94;306;306;57	ENSP00000368370:W94R;ENSP00000331327:W306R;ENSP00000435307:W94R;ENSP00000415516:W306R;ENSP00000413452:W306R;ENSP00000435351:W57R	ENSP00000331327:W306R	W	-	1	0	WT1	32395733	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.697000	0.84279	2.326000	0.78906	0.533000	0.62120	TGG	WT1	-	pfam_Wilms_tumour_N	ENSG00000184937		0.368	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WT1	HGNC	protein_coding	OTTHUMT00000095434.1	46	0.00	0	A	NM_000378		32439157	32439157	-1	no_errors	ENST00000332351	ensembl	human	known	69_37n	missense	22	46.34	19	SNP	1.000	T
XPNPEP3	63929	genome.wustl.edu	37	22	41318426	41318426	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr22:41318426A>G	ENST00000357137.4	+	8	1229	c.1145A>G	c.(1144-1146)gAg>gGg	p.E382G	XPNPEP3_ENST00000544094.1_Missense_Mutation_p.E359G	NM_022098.3	NP_071381.1	Q9NQH7	XPP3_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 3, putative	382					glomerular filtration (GO:0003094)|protein processing (GO:0016485)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metallopeptidase activity (GO:0008237)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	17						ACAAGCTTGGAGAACATCTAC	0.483																																					Ovarian(145;306 1841 7037 21878 30110)	dbGAP											0													230.0	221.0	224.0					22																	41318426		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14007.1, CCDS74869.1	22q13.2	2010-07-20			ENSG00000196236	ENSG00000196236			28052	protein-coding gene	gene with protein product		613553				15708373, 20179356	Standard	NM_022098		Approved	APP3, NPHPL1	uc003azh.3	Q9NQH7	OTTHUMG00000151312	ENST00000357137.4:c.1145A>G	22.37:g.41318426A>G	ENSP00000349658:p.Glu382Gly		B2R9G1|B7Z790|B7Z7B2|Q6I9V9|Q8NDA6|Q9BV27|Q9BVH0	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.E382G	ENST00000357137.4	37	c.1145	CCDS14007.1	22	.	.	.	.	.	.	.	.	.	.	A	27.8	4.867371	0.91511	.	.	ENSG00000196236	ENST00000357137;ENST00000544094	T;T	0.75154	-0.91;-0.91	5.85	5.85	0.93711	Peptidase M24, structural domain (3);	0.144238	0.64402	D	0.000008	T	0.73923	0.3649	N	0.25957	0.775	0.80722	D	1	D	0.53619	0.961	P	0.53224	0.721	T	0.76945	-0.2771	10	0.59425	D	0.04	-14.8656	16.2355	0.82371	1.0:0.0:0.0:0.0	.	382	Q9NQH7	XPP3_HUMAN	G	382;359	ENSP00000349658:E382G;ENSP00000441942:E359G	ENSP00000349658:E382G	E	+	2	0	XPNPEP3	39648372	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.608000	0.90895	2.238000	0.73509	0.533000	0.62120	GAG	XPNPEP3	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain	ENSG00000196236		0.483	XPNPEP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP3	HGNC	protein_coding	OTTHUMT00000322201.2	65	0.00	0	A	NM_022098		41318426	41318426	+1	no_errors	ENST00000357137	ensembl	human	known	69_37n	missense	43	29.51	18	SNP	1.000	G
ZC3H12B	340554	genome.wustl.edu	37	X	64717089	64717089	+	Missense_Mutation	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chrX:64717089A>G	ENST00000338957.4	+	2	753	c.686A>G	c.(685-687)gAt>gGt	p.D229G	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.D218G	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	229							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGCCATAAAGATATTACTGTA	0.403																																						dbGAP											0													71.0	63.0	65.0					X																	64717089		1843	4095	5938	-	-	-	SO:0001583	missense	0			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.686A>G	X.37:g.64717089A>G	ENSP00000340839:p.Asp229Gly		B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.D229G	ENST00000338957.4	37	c.686	CCDS48131.2	X	.	.	.	.	.	.	.	.	.	.	A	16.99	3.273306	0.59649	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.44881	0.91;0.91	5.38	5.38	0.77491	Ribonuclease Zc3h12a-like (1);	0.096854	0.64402	D	0.000001	T	0.46367	0.1389	M	0.78285	2.405	0.58432	D	0.999993	B	0.02656	0.0	B	0.09377	0.004	T	0.46176	-0.9210	10	0.59425	D	0.04	-9.4343	13.1531	0.59500	1.0:0.0:0.0:0.0	.	218	Q5HYM0	ZC12B_HUMAN	G	229;218;165	ENSP00000340839:D229G;ENSP00000408077:D218G	ENSP00000218172:D165G	D	+	2	0	ZC3H12B	64633814	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.966000	0.76073	1.788000	0.52465	0.486000	0.48141	GAT	ZC3H12B	-	pfam_RNase_Zc3h12	ENSG00000102053		0.403	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	HGNC	protein_coding	OTTHUMT00000378734.2	49	0.00	0	A	XM_293334		64717089	64717089	+1	no_errors	ENST00000338957	ensembl	human	known	69_37n	missense	60	29.41	25	SNP	1.000	G
ZEB2	9839	genome.wustl.edu	37	2	145255319	145255319	+	Intron	SNP	A	A	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr2:145255319A>C	ENST00000558170.2	-	2	1258				ZEB2_ENST00000409487.3_Intron|ZEB2_ENST00000539609.3_Intron|ZEB2_ENST00000303660.4_Intron	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2						cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CTTTTCTGACAATCTTGATGA	0.378																																					Melanoma(33;1235 1264 5755 16332)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.73+19525T>G	2.37:g.145255319A>C			A0JP09|B7Z2P2|F5H814|Q9UED1	RNA	SNP	-	NULL	ENST00000558170.2	37	NULL	CCDS2186.1	2																																																																																			ZEB2	-	-	ENSG00000169554		0.378	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	40	0.00	0	A	NM_014795		145255319	145255319	-1	no_errors	ENST00000434448	ensembl	human	known	69_37n	rna	19	45.71	16	SNP	0.001	C
ZFP64	55734	genome.wustl.edu	37	20	50803573	50803573	+	Silent	SNP	G	G	T	rs34351592	byFrequency	TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr20:50803573G>T	ENST00000216923.4	-	2	433	c.84C>A	c.(82-84)ccC>ccA	p.P28P	ZFP64_ENST00000371515.4_Silent_p.P26P|ZFP64_ENST00000371518.2_Silent_p.P28P|ZFP64_ENST00000361387.2_Silent_p.P28P|ZFP64_ENST00000346617.4_Silent_p.P28P	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	28					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						TATGGATGTCGGGAGTCAGCT	0.512																																						dbGAP											0													66.0	59.0	62.0					20																	50803573		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.84C>A	20.37:g.50803573G>T			Q9NTS7|Q9NVH4	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P28	ENST00000216923.4	37	c.84	CCDS13440.1	20																																																																																			ZFP64	-	NULL	ENSG00000020256		0.512	ZFP64-003	KNOWN	basic|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079744.1	42	0.00	0	G	NM_018197		50803573	50803573	-1	no_errors	ENST00000216923	ensembl	human	known	69_37n	silent	60	26.09	24	SNP	0.005	T
ZNF207	7756	genome.wustl.edu	37	17	30696729	30696729	+	Missense_Mutation	SNP	C	C	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr17:30696729C>G	ENST00000321233.6	+	11	1542	c.1388C>G	c.(1387-1389)cCt>cGt	p.P463R	ZNF207_ENST00000394673.2_Missense_Mutation_p.P448R|ZNF207_ENST00000342555.6_Missense_Mutation_p.P482R|ZNF207_ENST00000341711.6_Missense_Mutation_p.P380R|ZNF207_ENST00000577908.1_Missense_Mutation_p.P479R|ZNF207_ENST00000394670.4_Missense_Mutation_p.P479R	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207	463					attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			CCTCCTCGACCTCCGATGGGA	0.532																																						dbGAP											0													80.0	70.0	73.0					17																	30696729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.1388C>G	17.37:g.30696729C>G	ENSP00000322777:p.Pro463Arg		A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.P479R	ENST00000321233.6	37	c.1436	CCDS11271.1	17	.	.	.	.	.	.	.	.	.	.	C	16.55	3.153934	0.57259	.	.	ENSG00000010244	ENST00000394670;ENST00000394673;ENST00000394679;ENST00000321233;ENST00000341711;ENST00000342555	T;T;T	0.54071	0.76;0.7;0.59	5.85	5.85	0.93711	.	0.048863	0.85682	D	0.000000	T	0.59390	0.2190	N	0.24115	0.695	0.80722	D	1	D;D;D;D;D	0.61697	0.99;0.99;0.99;0.99;0.971	P;P;P;P;P	0.59487	0.858;0.858;0.858;0.858;0.714	T	0.62407	-0.6861	10	0.72032	D	0.01	.	20.1518	0.98089	0.0:1.0:0.0:0.0	.	432;482;479;448;463	A8MTG3;Q59G94;E1P660;O43670-2;O43670	.;.;.;.;ZN207_HUMAN	R	479;432;482;448;380;463	ENSP00000378165:P479R;ENSP00000344913:P380R;ENSP00000340029:P463R	ENSP00000322777:P448R	P	+	2	0	ZNF207	27720842	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.351000	0.73022	2.769000	0.95229	0.491000	0.48974	CCT	ZNF207	-	NULL	ENSG00000010244		0.532	ZNF207-003	KNOWN	basic|CCDS	protein_coding	ZNF207	HGNC	protein_coding	OTTHUMT00000256251.2	48	0.00	0	C			30696729	30696729	+1	no_errors	ENST00000394670	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	1.000	G
ZNF208	7757	genome.wustl.edu	37	19	22156954	22156954	+	Silent	SNP	A	A	G			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:22156954A>G	ENST00000397126.4	-	4	1030	c.882T>C	c.(880-882)ttT>ttC	p.F294F	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	294					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGACCTTACTAAAGGCTTTGC	0.403																																						dbGAP											0													53.0	57.0	56.0					19																	22156954		2129	4262	6391	-	-	-	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.882T>C	19.37:g.22156954A>G				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F294	ENST00000397126.4	37	c.882	CCDS54240.1	19																																																																																			ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.403	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	33	0.00	0	A	NM_007153		22156954	22156954	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	silent	37	30.19	16	SNP	0.007	G
ZNF23	7571	genome.wustl.edu	37	16	71482925	71482925	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr16:71482925G>C	ENST00000393539.2	-	6	1816	c.1003C>G	c.(1003-1005)Cct>Gct	p.P335A	AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000357254.4_Missense_Mutation_p.P335A|ZNF23_ENST00000539742.1_5'UTR|ZNF23_ENST00000428724.2_Missense_Mutation_p.P277A|ZNF23_ENST00000417828.1_Missense_Mutation_p.P335A|ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000564528.1_Missense_Mutation_p.P277A|ZNF23_ENST00000358700.2_3'UTR	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		CATTCATAAGGTTTCTCTCCA	0.428																																						dbGAP											0													58.0	55.0	56.0					16																	71482925		2198	4300	6498	-	-	-	SO:0001583	missense	0			X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.1003C>G	16.37:g.71482925G>C	ENSP00000377171:p.Pro335Ala		Q8NDP5|Q96IT3|Q9UG42	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P335A	ENST00000393539.2	37	c.1003	CCDS10900.1	16	.	.	.	.	.	.	.	.	.	.	G	19.96	3.923322	0.73213	.	.	ENSG00000167377	ENST00000393539;ENST00000357254;ENST00000417828;ENST00000428724;ENST00000539742;ENST00000358700	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	4.15	4.15	0.48705	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43919	D	0.000514	T	0.44767	0.1309	L	0.52364	1.645	0.50632	D	0.999881	D;D	0.89917	1.0;0.995	D;P	0.83275	0.996;0.848	T	0.40308	-0.9570	10	0.87932	D	0	-14.4696	14.7472	0.69496	0.0:0.0:1.0:0.0	.	335;335	B3KR55;P17027	.;ZNF23_HUMAN	A	335;335;335;277;277;135	ENSP00000377171:P335A;ENSP00000349796:P335A;ENSP00000395712:P335A;ENSP00000387673:P277A	ENSP00000349796:P335A	P	-	1	0	ZNF23	70040426	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.608000	0.82898	2.599000	0.87857	0.561000	0.74099	CCT	ZNF23	-	pfscan_Znf_C2H2	ENSG00000167377		0.428	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF23	HGNC	protein_coding	OTTHUMT00000268985.23	33	0.00	0	G	NM_145911		71482925	71482925	-1	no_errors	ENST00000357254	ensembl	human	known	69_37n	missense	47	25.40	16	SNP	1.000	C
ZNF230	7773	genome.wustl.edu	37	19	44515324	44515324	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:44515324G>C	ENST00000429154.2	+	5	1361	c.1133G>C	c.(1132-1134)gGt>gCt	p.G378A		NM_006300.3	NP_006291.2	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	378					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)|stomach(3)|urinary_tract(2)	22		Prostate(69;0.0352)				AGTAAGTCAGGTCTTAACTTG	0.433																																					GBM(175;914 2069 22996 47111 52600)	dbGAP											0													113.0	108.0	110.0					19																	44515324		2203	4300	6503	-	-	-	SO:0001583	missense	0			U95044	CCDS33044.1	19q13.31	2013-01-08				ENSG00000159882		"""Zinc fingers, C2H2-type"", ""-"""	13024	protein-coding gene	gene with protein product							Standard	NM_006300		Approved	FDZF2	uc002oyb.1	Q9UIE0		ENST00000429154.2:c.1133G>C	19.37:g.44515324G>C	ENSP00000409318:p.Gly378Ala		O15322|Q504X7|Q86W84|Q9P1U6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G378A	ENST00000429154.2	37	c.1133	CCDS33044.1	19	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248686	0.59103	.	.	ENSG00000159882	ENST00000429154	T	0.07114	3.22	2.55	-1.34	0.09143	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06371	0.0164	N	0.17594	0.5	0.09310	N	1	P	0.37276	0.589	P	0.45913	0.497	T	0.34551	-0.9824	9	0.07644	T	0.81	.	8.9829	0.35977	0.3739:0.0:0.6261:0.0	.	378	Q9UIE0	ZN230_HUMAN	A	378	ENSP00000409318:G378A	ENSP00000409318:G378A	G	+	2	0	ZNF230	49207164	0.000000	0.05858	0.000000	0.03702	0.885000	0.51271	-1.123000	0.03263	-0.565000	0.06061	0.205000	0.17691	GGT	ZNF230	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000159882		0.433	ZNF230-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF230	HGNC	protein_coding	OTTHUMT00000460456.1	41	0.00	0	G			44515324	44515324	+1	no_errors	ENST00000429154	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.000	C
ZNF292	23036	genome.wustl.edu	37	6	87969944	87969944	+	Missense_Mutation	SNP	G	G	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr6:87969944G>C	ENST00000369577.3	+	8	6640	c.6597G>C	c.(6595-6597)atG>atC	p.M2199I	ZNF292_ENST00000339907.4_Missense_Mutation_p.M2194I	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2199						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.M2199I(1)|p.M2054I(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TTCATGAAATGACTCCTGAAG	0.353																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											190.0	189.0	190.0					6																	87969944		1862	4099	5961	-	-	-	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.6597G>C	6.37:g.87969944G>C	ENSP00000358590:p.Met2199Ile		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M2199I	ENST00000369577.3	37	c.6597	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201712	0.58234	.	.	ENSG00000188994	ENST00000369577;ENST00000339907;ENST00000496806	T;T;T	0.40225	1.04;1.04;1.04	5.42	5.42	0.78866	Zinc finger, C2H2 (1);	0.086755	0.85682	D	0.000000	T	0.48150	0.1484	L	0.51422	1.61	0.34156	D	0.668073	D	0.54964	0.969	D	0.63381	0.914	T	0.37103	-0.9720	10	0.31617	T	0.26	.	19.21	0.93749	0.0:0.0:1.0:0.0	.	2199	O60281	ZN292_HUMAN	I	2199;2194;117	ENSP00000358590:M2199I;ENSP00000342847:M2194I;ENSP00000428857:M117I	ENSP00000342847:M2194I	M	+	3	0	ZNF292	88026663	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.745000	0.47459	2.541000	0.85698	0.591000	0.81541	ATG	ZNF292	-	pfscan_Znf_C2H2	ENSG00000188994		0.353	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	22	0.00	0	G	NM_015021		87969944	87969944	+1	no_errors	ENST00000369577	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	1.000	C
ZNF497	162968	genome.wustl.edu	37	19	58868858	58868858	+	Silent	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr19:58868858C>T	ENST00000311044.3	-	3	332	c.144G>A	c.(142-144)ccG>ccA	p.P48P	ZNF497_ENST00000425453.3_Silent_p.P48P|A1BG-AS1_ENST00000595302.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|CTD-2619J13.9_ENST00000599952.1_RNA|A1BG-AS1_ENST00000600379.1_RNA	NM_198458.2	NP_940860.2	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	48					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|lung(3)|skin(2)	7		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)		CTGCCTCCCTCGGAACCTCCG	0.711																																						dbGAP											0													11.0	13.0	12.0					19																	58868858		1928	3826	5754	-	-	-	SO:0001819	synonymous_variant	0			AK126727	CCDS12977.1	19q13.43	2013-01-08			ENSG00000174586	ENSG00000174586		"""Zinc fingers, C2H2-type"""	23714	protein-coding gene	gene with protein product							Standard	NM_198458		Approved	FLJ44773	uc002qsi.2	Q6ZNH5		ENST00000311044.3:c.144G>A	19.37:g.58868858C>T			Q05AG8|Q0VF48|Q6ZTD2|Q9UIA8	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P48	ENST00000311044.3	37	c.144	CCDS12977.1	19																																																																																			ZNF497	-	NULL	ENSG00000174586		0.711	ZNF497-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF497	HGNC	protein_coding	OTTHUMT00000466942.2	23	0.00	0	C	NM_198458		58868858	58868858	-1	no_errors	ENST00000311044	ensembl	human	known	69_37n	silent	12	29.41	5	SNP	0.000	T
ZNF572	137209	genome.wustl.edu	37	8	125989335	125989335	+	Silent	SNP	T	T	C			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr8:125989335T>C	ENST00000319286.5	+	3	979	c.825T>C	c.(823-825)ccT>ccC	p.P275P		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	275					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			ATAAGTGCCCTGATTGTGGGA	0.453										HNSCC(60;0.17)																												dbGAP											0													59.0	63.0	62.0					8																	125989335		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.825T>C	8.37:g.125989335T>C			A1L4F1|Q8N1Q0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P275	ENST00000319286.5	37	c.825	CCDS6354.1	8																																																																																			ZNF572	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180938		0.453	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF572	HGNC	protein_coding	OTTHUMT00000381359.1	32	0.00	0	T	NM_152412		125989335	125989335	+1	no_errors	ENST00000319286	ensembl	human	known	69_37n	silent	45	11.76	6	SNP	0.065	C
ZNF746	155061	genome.wustl.edu	37	7	149171723	149171723	+	Missense_Mutation	SNP	C	C	T			TCGA-A7-A5ZV-01A-11D-A28B-09	TCGA-A7-A5ZV-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none	1		Illumina GAIIx	d8665fda-509b-496c-a9bf-eee1c60dbb78	f1d70ca5-8f78-49a4-b3b3-4112be4c14fa	g.chr7:149171723C>T	ENST00000340622.3	-	7	1967	c.1687G>A	c.(1687-1689)Gtg>Atg	p.V563M	ZNF746_ENST00000458143.2_Missense_Mutation_p.V564M			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	563					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			AAGGGCCGCACGCCCGTGTGC	0.662																																						dbGAP											0													51.0	37.0	42.0					7																	149171723		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.1687G>A	7.37:g.149171723C>T	ENSP00000345140:p.Val563Met		A8K6Z9|Q6ZRF9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_DUF3669_Znf,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V564M	ENST00000340622.3	37	c.1690	CCDS5897.1	7	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546858	0.86022	.	.	ENSG00000181220	ENST00000340622;ENST00000458143	T;T	0.07688	3.17;3.17	5.58	5.58	0.84498	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45126	D	0.000398	T	0.20981	0.0505	L	0.39020	1.185	0.44685	D	0.997675	D;D	0.76494	0.999;0.999	P;D	0.70935	0.897;0.971	T	0.00203	-1.1924	10	0.87932	D	0	-19.7282	17.0667	0.86561	0.0:1.0:0.0:0.0	.	564;563	Q6NUN9-2;Q6NUN9	.;ZN746_HUMAN	M	563;564	ENSP00000345140:V563M;ENSP00000395007:V564M	ENSP00000345140:V563M	V	-	1	0	ZNF746	148802656	0.977000	0.34250	1.000000	0.80357	0.995000	0.86356	4.662000	0.61525	2.630000	0.89119	0.462000	0.41574	GTG	ZNF746	-	pfscan_Znf_C2H2	ENSG00000181220		0.662	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF746	HGNC	protein_coding	OTTHUMT00000352730.1	67	0.00	0	C	NM_152557		149171723	149171723	-1	no_errors	ENST00000458143	ensembl	human	known	69_37n	missense	66	28.26	26	SNP	1.000	T
